INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI films the text diredly from the original or copy submitted. Thus, sorne thesis and dissertation copies are in typewriter face, while others may be trom any type of computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleeclthrough. substandard margins, and improper alignment can adversely affect reproduction. ln the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, thase will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original. beginning at the upper left-hand corner and continuing from left to right in equal sections with small overlaps.

Photographs ineluded in the original manuscript have been reproduced xerographically in this copy. Higher quality. 6" x 9" black and white photographie prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.

Bell & Howell Information and Leaming 300 North Zeeb Road. Ann Arbor, MI 48106-1346 USA 800-521-0600

•

PHYSIOLOGIC AND MOLECULAR STUDIES ON ORAL ANAEROBIC SPIROCHETES AND PROCARYOTES FOUND IN BLOOD

by

Richard McLaughlin Faculty ofDentistry McGill University, Montreal March, 1999

A Thesis Submitted to the Faculty ofGraduate Studies and Research in Partial Fulfillment ofthe Requirements ofthe Degree ofDoctor ofPhilosophy

© Richard McLaughIin, 1999 • National Library Bibliothèque nationale 1+1 of Canada du Canada Acquisitions and Acquisitions et Bibliographie Services services bibliographiques 395 Wellington Street 395. rue Wellington Ottawa ON K1 A ON4 Ottawa ON K1A ON4 Canada canada Your file Votre ré'ërenee

Ourfile Notre référenee

The author bas granted a non­ L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library ofCanada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies ofthis thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/film, de reproduction sur papier ou sur format électronique.

The author retains ownership ofthe L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts from it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permISSIon. autorisation.

Q-612-55421-X

Canada • TABLE OF CONTENTS Page Abstract ix

Resumé xi

Acknowledgments xiii

Claim ofcontribution to knowledge xiv

List offigures xvi

List of tables xi~

List ofAbbreviations xxi

CHAPTER 1. Introduction and Literature Review 1

I. Morphology ofSpirochetes 2

1. Mucoid Layers 5

ii. Outer Membrane Sheath 5

iii. Axial Fibrils 7

IV. Protoplasmic Cylinder Il

v. Peptidoglycan 12

vi. Spirochete Genomes 13

vii. Spherical Bodies 15

II. Taxonomy ofSpirochetes 17 • ii • III. Ecology ofSpirochetes 19 IV. Periodontal Disease 23

l. AnOverview 23

11. Spirochetes as Etiological Agents 24

iii. Classification ofNovel Isolates 24

IV. Spirochete Culturability 25

v. Treatment ofPeriodontal Disease 27

vi. Adherence 30

vu. Cytotoxic Effects 32

viii. Iron Sequestration 35

v. Role ofthe Immune System in Gingivitis and Periodontitis 35

1. Introduction 35

11. Interleukin-l 36

lU. Tumor-Necrosis Factor-a. and Lymphotoxin 36

vi. Arachidonic acid 37

v. Metalloproteinases 37

Vi. Stimulation ofthe Immune System by Treponema denticola 38

vii. Summary 39 • VI. Spirochetes as the Etiological Agent ofAizheimer's Disease 40 Hi i. Introduction 40 • Il. Alzheimer's disease 41 Ill. Pathology 41

iv. Biochemical Abnormalities 42

VII. Examination ofBlood from Healthy Rumans 43

i. Introduction 43

ii. Phylogenetic Identification ofMicrobial Cells with Cultivation 43

111. Nonculture Methods for Identification ofMicroorganisms 45

iv. Norma flora ofthe Human Body 48

v. Blood Culture 48

VIII. L-Forms 49

IX. Mycoplasma 50

x. Procaryotes or Eucaryotes 51

XI. Outline ofthe Thesis 52

Guidelines Regarding Doctoral Theses Containing Quotations • From Published or Submitted Manuscripts 55 IV • Chapter 2. An inexpensive soUd medium for obtainiog colony-forming uoits oforal spirochetes 60

Abstract 61

Paper 62

Acknowledgements 73

Chapter 3. Rapid identification oforal aoaerobic spirochetes using

restriction fragment length polymorphism ofthe 168 ribosomal

gene 74

Introduction to Chapter 3 75

Abstract 76

Introduction 77

Materials and methods 79

Bacterial strains 79

Genomic DNA isolation and PCR amplification 79

Restriction fragment length polymorphisms 79

DNA cloning 80

Results and Discussion 82 • Acknowledgements 85 v Chapter 4. Factors affecting the formation ofspherical bodies in the • spirochete Treponema denticola 86 Introduction to Chapter 4 87

Abstract 88

Paper 89

Acknowledgements 98

Chapter 5. Alzheimer's disease May not be a spirochetosis 99

Introduction to Chapter 5 100

Abstract 101

Introduction 102

Materials and Methods 104

Subjects 104

Blood work-up 104

Results 107

Discussion 109

Acknowledgements 109 • vi Chapter 6. Naturally-occurring pleomorphic microorganisms in • human blood 110 Introduction to Chapter 6 111

Abstract 112

Introduction 113

Materials and Methods 114

Blood 114

Electron rnicroscopy 114

Average microscopic field 115

DNA extraction 116

PCR amplification and cloning 116

Sequencing 117

Indirect immunofiuorescence 117

Fluorescence in situ hybridization 118

Cell culture 118

Results and discussion 119

Acknowledgements 131 • vii • Chapter 7. Summary and Conclusions 132 References 138

• viii • ABSTRACT Spirochetes are helical bacteria consisting of an outer sheath, a protoplasmic

cylinder and periplasmic flagella. AlI oral anaerobic spirochetes (OAS) are species

within the genus Treponema. They are important causative agents ofperiodontitis. This

thesis examines sorne aspects of the physiology of OAS. As weil, a novel symbiotic

bacteriurn found in the blood of healthy hurnans was studied as a consequence of my

work with OAS.

Our lab has been instrumental in rendering routine and reliable growth of OAS in

vitro. An inexpensive medium which remains molten at 37°C and solidifies at 25°C was

found for the enumeration ofcolony-forming units ofOAS. New Oral Spirochete (NOS)

medium with the addition of0.5% gelatin-0.5% Noble agar met the above criteria.

Clinical isolates of spirochetes from the periodontal pocket need to be readily

identified. Restriction fragment length polymorphism (RFLP) analysis was used on

reference strains ofTreponema denticola, T. vincentii, T. phagedenis, and T. socransldi as

weil as a number of clinical isolates in our laboratory collection. The banding patterns

observed allowed discrimination between the different spirochete species.

Morphological variations such as spherical-shaped cells of T. denticola, termed

"spherical bodies" are occasionally observed. The omission of the severa! individual

components from NOS medium (brain heart infusion, yeast extract, rabbit serum, volatile

fatty acids, or thiamine pyrophosphate), the age of the culture and the addition of lactic • acid, enhanced the formation ofthese bodies. ix J. MikIossy (NeuroRepo~ 1993) reported that spirochetes were found in blood, • cerebral cortex and cerebral spinal fluid in autopsied A1zheimer's Disease (AD) subjects. ft was suggested by her that spirochetes could be a causative factor in AD. Our laboratory

attempted to duplicate these results and found spirochetes in the blood ofonly one late stage

AD patient suggesting that spirochetes are not one ofthe causes ofAD.

During the examination of blood by darkfield microscopy, we observed

pleomorphic microorganisms. Blood of a healthy human is a sterile environment.

Evidence for the existence of bacteria in blood includes light and electron micrographs of

their morphology, and molecular analysis oftheir 16S ribosomal RNA and their gyrB gene.

• x RESUMÉ • Les spirochètes sont des bactéries hélicoidales formèes d~une membrane exteme~ d'un cylindre protoplasmique et d'un flagelle périplasmique. Tous les spirochètes

anaérobes oraux (OAS) sont des espèces du "'genus" Treponema. Ils sont une cause

importante de la périodontite. Cette thèse explore certains aspects de la physiologie des

OAS. De plus, cet analyse des OAS a conduit à l'identification et 1étude d'une nouvelle

bactérie symbiotique retrouvée dans le sang de sujets sains.

Les membres de notre laboratoire se sont révélés capables de promouvoir la

croissance des OAS de façon routinière et hautement reproductible. Un milieu de culture

non-dispendieux~ qui se maintient sous fonne liquide à 37°C mais se solidifie à 25°C,

servant à l'énumération d'unités formatrices de colonies, a été élaboré par nous. Le

milieu NOS (New Oral Spirochete) additionné de 0.5% gélatine-O.5% agar Noble

recontre les caractéristiques énumérées ci-dessus.

Des isolats cliniques de spirochètes provenant de la poche périodontale doivent

être identifiés. L'analyse par RFLP (Restriction fragment length polymorphism) de

souches de référence de Treponema denticola, T. vincentii, T. phagedenis et de T.

socranskii ainsi que de nombreux isolats cliniques provenant de notre propre collection a

été faite. Les différents patrons de bandes ont permis de discriminer parmi les différentes

espèces de spirochètes.

Des différences morphologiques, telles la formation de cellules sphériques de T.

denticola, appeleés "spherical bodies" peuvent parfois être observées. L'omission de • différents composants du milieu NOS ("'brain heart infusion", extrait de levure, serum de xi lapin, acides gras volatils, ou de la pyrophosphate de thiamine), l'âge de la culture ainsi • que l'addition d'acide lactique, favorisent cette morphologie. J. Miklossy (NeuroReport, 1993) a rapporté que des spirochètes out été retrouvés

dans le sang, le cortex cérébral ainsi que dans le fluide cérébro spinal lors d'authopsie de

patients atteints de la maladie d'Alzeimer. Elle a aussi suggéré qu'il pourrait y avoir une

relation causale des spriochètes pour la maladie. Nous avons tenté de répéter ses

resultats, mais n'avons trouvé de spirochètes que dans un cas très avancé de la maladie,

suggérant ainsi que l'organisme n'est pas une cause de la maladie.

Lors de l'observation d'échantillons de sang à l'aide de la microscopie à champs

obscur nous avons relevé la présence de microorganismes pléomorphiques malgré le fait

que. Le sang provenant d'humains sains est un environnement stérile. L'evidence de la

présence de bactéries dans le sang humain est présenté l'aide de micrographies

lumineuses et électroniques de leur morphologie ainsi que par l'analyses moléculaire de

l'ARN 165 ribosomal et de leur gène gyrB.

• xii ACKNOWLEDGMENTS • l would like to acknowledge my mother, Eleanor McLaughlin, for her love and support and dedicate this thesis to her. l also acknowledge the late H.R. McLaughlin and

Elizabeth Ralph. They are both sorely missed.

l acknowledge my friends in the Department of Microbiology and Immunology,

Angela De Ciccio, Antonia Klitorinos, Charlie DiFlumeri, Ann Karen Brassinga, Rania

Siam, Marie-Claude üuimet and Alfredo Staffa. They have made my stay here most

enjoyable.

To my committee ofDr. G. Marczynski, Dr. Vali, Dr. G. Jensen and Dr. Shields, l

thank them for their helpful suggestions and guidance.

l especially thank Dr. E.C.S. Chan for allowing me into his laboratory to study

spirochetes. He is a wonderful microbiologist. l am also thankful he did not retire

before l fmished my thesis.

l wish to thank the Max Stem Recruitment Fellowship and the Hydro Quebec

McGill Majors Fellowship for supporting me financially during my Ph.D. studies.

• xiii • CLAIM OF CONTRIBUTION TO KNOWLEDGE 1: NOS medium containing 0.5% gelatin-0.5% Noble Agar (NOS GN) is an

inexpensive medium which remains liquid at 37°C and solidifies at 25°C. ft is an

exceUent medium for the recovery and enumeration oforal anaerobic spirochetes.

l contributed to its development.

2: Restriction fragment length polymorphism ofthe 16S ribosomal gene is a rdiabLe

and useful method for distinguishing different species of oral anaerobic

spirochetes, such as T. denticola, T. vincentii, T. phagedenis, and T. socranskii. 1

applied the technique to the differentiation ofOAS and proved its usefulness.

3: The 16S ribosomal gene from T. denticola stains a and d were sequenced and the

DNA sequences submitted to the GenBank.

4: l determined that spherical body formation is enhanced by the age of the culture,

the omission of the NOS medium component yeast extract and the supplement

components rabbit serum, volatile fatty acids and thiamine pyrophosphate as weU

as the addition ofthe metabolic end product lactic acid.

5: l have demonstrated that spirochetes are not universalLy found in the blood of

early stage and late stage Alzheimer's disease (AD) patients nor are they found in

the cerebral cortex of autopsied AD brain samples. Therefore, spirochetes may

not be one ofthe etiological agents ofAD.

6: l have provided evidence that the bloodstream of a healthy human is not sterile • but that it harbours a pLeomorphic cell wall-deficient bacterium as a symbiont in xiv erythrocytes. The 168 ribosomal gene has been sequenced from this bacterium. • The sequence has high homology with Stenotrophomonas maltophilia LMG958T.

• xv LIST OF FIGURES Page • Chapter 1. Figure 1.1 Schematic diagram ofthe morphology ofa spirochete 3

Figure 1.2 Treponema denticola ATCC 35405 as seen by transmission

electron microscopy 4

Figure 1.3 Schematic diagram ofthe formation ofa spherical body 16

Figure 1.4 Dendrogram ofseveral spirochete species constructed from a

1410 base comparison ofthe 16S rRNA gene 18

Figure 1.5 Identification ofnonculturable bacteria from an environmental

sample 47

Chapter 2.

Figure 2.1 Recovery ofcolony-forrning units of Treponema dentêcola

in NOS-A, NOS-GB and NOS-GN media 67

Figure 2.2 Recovery ofspirochete colony-forming units from

subgingival plaque samples 70

Figure 2.3 Two gelatin-hydrolyzing species ofbacteria, StaphylococcliS

aureus and Bacillus subtilis, seeded and grown to

confluency in NOS-GN medium 71 • xvi Chapter 3. • Figure 3.1 Restriction fragment length polymorphism analysis ofthe 168 rRNA genes from species ofOAS 83

Figure 3.2 Hpaii restriction sites located in the 16S rRNA gene of

Treponema denticola ATCC 35405 84

Chapter 4.

Figure 4.1 Morphology ofspherical bodies 91

Figure 4.2 Effects ofthe deletion ofNOS medium components on the

formation ofspherical bodies 93

Figure 4.3 Effects ofthe addition ofmetabolic end products on the

formation ofspherical bodies 94

Figure 4.4 Effects ofthe deletion ofNOS medium components on

the formation ofspherical bodies 95

Chapter 5.

Figure 5.1 Spirochete from the serum ofa patient with dementia 108

Chapter 6.

Figure 6.1 TEM image ofa PlatinumlCarbon replica showing the

morphology ofa blood bacterium 120 • xvii Figure 6.2 Morphologenesis ofa blood bacterium as captured by time • lapse video cassette recorder 121 Figure 6.3 TEM image ofa negative stain specimen showing a group

ofblood bacteria exhibiting pleomorphic morphology 122

Figure 6.4 TEM image ofultrathin section ofblood bacteria 126

• xviii LIST OF TABLES Page • Chapter 1. Table 1.1 Effect oforal hygiene and root preparation procedures on

subgingivaL microflora in gingival crevices with probing depths

:5;4.5 mm 28

Table 1.2 Effect oforal hygiene and root preparation procedures on

subgingival microflora in gingival crevices with probing depths

~4.5 mm 29

Table 1.3 Culturability determined as a percentage ofculturable

bacteria in comparison with total cell courrts 44

Chapter 2.

Table 2.1 Varying proportions ofgelling agents tested for ability to remain

molten at 37°C and to become solid at room temperature 63

Table 2.2 Colony-forming unit recovery ofT. denticola ATCC 35405

in NOS-A, NOS-GB and NOS-GN media 65

Table 2.3 Colony-forming unit recovery of T. vincentii ATCC 35580

in NOS-A, NOS-GB and NOS-GN media 66

Table 2.4 Viable courrts oforal anaerobic spirochetes from subgingivaI

plaque samples inoculated into NOS-A and NOS-GN media 69 • xix Chapter 4. • Table 4.1 Deletion ofspecifie components from NOS medium 96 Table 4.2 Addition ofmetabolic end products to NOS medium 97

Chapter 5.

Table 5.1 Baseline characteristics ofpatients whose temporal

cortices were examined 106

Chapter6.

Table 6.1 "Blooming" in blood samples resulting in increased

bacilli counts 123

Table 6.2 Selective effect ofantibiotics on the growth of

blood bacteria 125

• xx LIST OF ABBREVIATIONS • ex alpha E epsilon

y gamma

I-l. micro

J.lg microgram

J.ll microlitre

J.lm micrometer

IJ,mol micromole

cr sigma

ATCC American Type Culture Collection

BSA bovine serum albumin

bp base pair

g gram

g time the force ofgravity

kb kilobase

kDa kilodalton

mPas milliPascaIs

N normal

nm nanometer

ns nanosecond • Mb megabase xxi PAGE polyacrylamide gel electrophoresis • peR polymerase chain reaction RNA ribonucleic acid

rRNA ribosomal RNA

s.c. subcutaneous

SDS sodium dodecylsulfate

• xxii • CHAPTERI

Introduction and Literature Review

While examining a specimen obtained from a person's teeth, Anton van

Leeuwenhoek (1632-1 723) in his communication with the Royal Society (England)

stated, "1 found an unbelievably great company of living animalculus aswimming

more nimbly than any 1 had seen up to this time. The biggest sort (whereof there

were a great plenty) bent their body into curves going forward..." This probably

describes the first microscopie observation of a spirochete (HoIt 1978).

Like Anton van Leeuwenhoek l was aiso interested and fascinated by these

peculiar bacteria called spirochetes. My interest was to study the biology of such

microorganisms. Consequently, my research on these organisms began with

mapping the genome of Spirochaeta aurantia. Upon completion of this work at

Queen's University, 1 had the opportunity to pursue further work on spirochetes,

specifically the oral anaerobic spirochetes that are recognized as etiological agents

of periodontitis. This thesis is an exposition of this work including an extension

into the study of pleomorphic microbes in the blood of heaIthy humans, a study

initiated because of the implications of spirochetal involvement in Alzheimer's

disease. • I. Morphology of Spirochetes • Spirochetes are helical-shaped bacteria, but differ ultrastructurally from

other helical bacteria, such as Spirulina and Spirillum species, by exhibiting an

unusual morphology. The typical ultrastructure consists of an outer sheath (outer

membrane, outer membrane sheath), protoplasmic cylinder and axial fibrils (axial

filaments, periplasmic fibrils or endoflagella) inserted at subterminallocations, and

located between the outer sheath and the protoplasmic cylinder. The axial fibrils

are involved in the motility of spirochetes (HaIt 1978). Recently, an extracellular

polysaccharide layer has been visualized in the oral spirochete Treponema

denticola (Scott, Klittorinos et al. 1997). Figures 1 and 2 illustrate the morphology

of a spirochete.

• 2 • Figure 1. Schematic diagram ofthe morphology ofa spirochete. A. Longitudinal-section ofa spirochete cell.

B. Cross-section ofa spirochete celi.

ML mucoid layer

OMS outer membrane sheath

AFaxial fibril

PG peptidoglycan

CM cytoplasmic membrane

(Holt, 1978)

• 3 •

A ML OMS PG

B \-t----OMS

ML-__~ ~""-CM PG

• Figure 2. Treponema denticola ATCC 35405 as seen by transmission electron • microscopy.

• 4 • 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 • 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1. Mucoid Layers • External to the outer membrane in many bacteria~ especially medically relevant bacteria, is found polysaccharides arranged to form a capsule or loosely

organized structure termed a slime layer. Scott et al. (1997) has shown that

Treponema denticola ATCC 35405 possesses an extracellular mucoid layer. This

layer can be visualized using darkfield optics by staining cells with Alcian Blue, a

dye which is specifie for polysaccharides. Perhaps the spirochetes are protected by

the layer against phagocytosis, bacteriocins and immunoglobins (Scott, Klitorinos

et al. 1997).

lI. Outer Membrane Sheath

Early evidence for the presence of an outer membrane sheath was provided

by antibody agglutination studies. Polyclonal antibodies specific to Treponema

pallidum did not agglutinate viable cells suggesting that the bacteria are surrounded

by a non-reactïve external barrier (Hardy and Neil 1957); (Turner and Hollander

1950); (Turner and Hollander 1954). This layer appears smooth, a characteristic

shared with certain other spirochetes including Spirochaeta plicatilis, S.

stenostrepta, Treponema phagedenis and aIl Borrelèa species (Holt 1978).

An intact outer membrane sheath is critieal for the viability of the

spiroehete. Hypotonie solutions which result in damage to this structure resulted in

non-viable treponemes. There are several structural components which have

been isolated. The type of lipopolysaccharide (LPS) in spirochetes is variable. An

LPS-like substance or incomplete endotoxin is found in the outer membrane sheath

of Treponema denticola (Yotis, Sharma et al. 1991). Classical endotoxin was not • 5 present in the outer membrane sheath of Leptospira interrogans and T. phagedenis • since the rabbits fed the endotoxin preparations exhibited an extremely low mean febrile response as compared with the response of the animaIs fed Salmonella

minnesota extract (Johnson 1976). However, T. phagedenis does contain smooth

LPS (Stru;;nall, Cockayne et al. 1990).

The only known porin found in the outer membrane sheath of Treponema

denticola ATCC 35405 is a 53-kDa major surface protein (Msp). This protein has

pore-forming activity as well as adhesin activity (Mathers~ Leung et al. 1996).

Section IV of the thesis will discuss virulence factors of Treponema denticola of

which the role of the 53-kDa protein win be discussed. The pore size of the

channel produced is 3.4 nm which is the largest diameter of any kno\vn porin to

date. Previously, the largest porin described was a 36.5-kDa protein of Spirocheta

aurantia which formed a channel diameter of 2.3 nm. In comparison, the OmpF

porin of Escherichia coli has a channel diameter of 1.1 7 nm. The large channel

diameters suggests that sorne spirochetes are primitive filter feeders and the outer

membrane sheath serves as a crude filtration device allowing nutrients ta pass into

the periplasm as the bacteria move through the environment (Egi, Leung et al.

1993).

The outer membrane sheath of T. pallidum subsp. pallidum and T. vincentii

have been isolated using sucrase gradients. Freeze fracture electron microscopy

indicated an extremely low density of outer membrane proteins. The outer

membrane sheath of T. pallidum has 6-fold less proteins than that of T vincentii.

The soluble fraction of T. pallidum outer membrane sheath was subjected to black

lipid bilayer analysis. The conductance measurements suggested that there were • 6 two different channel sizes corresponding to a channel diameter of 0.35 and 0.68 • nID implying two different porin proteins (Blanco, Reimann et al. 1994). In pathogenic Leptospira a rare 31-kDa surface protein OmpL l has been isolated. It

has a channel conductance of 1.1 ns which is in the range of known porins. As was

so with T. pallidum, pathogenic Leptospira has an extremely low density of OMP

in their outer sheath. The scarcity of porin proteins would result in increased

diffusion time of nutrients and could explain the slow metabolism and doubling

times of these bacteria (Shang, Exner et al. 1995).

Recently, a 42-kDa major outer membrane protein (MompA) was isolated

from T. pectinovorum ATCC 33768. Functional studies to determine if the protein

has pore-forming abiLities or is a possible virulence factor is the subject of future

investigation (Walker, Ebersole et al. 1997).

111. Axial Fibrils

The axial fibril is morphologically similar to the procaryotic flagellum in

that it is composed of the flagellum shaft, an insertion proximal hook and insertion

disks. The filament structure has a helical conformation which is retained when

separated from the cel!. Spirochete endoflagella differ from other procaryotic

flagella in that they lie between the outer membrane sheath and the protoplasmic

cylinder, therefore they are not exposed ta the external environment. In

Spirachaeta plicatilis the core is 10 nID in diameter and is covered by a sheath 15

to 20 nm in diameter (Blakemore and E. 1973). The flagella of Treponema,

Spirochaeta and Borrelia have basal bodies with a single pair of rings similar ta

the arrangement seen in Gram-positive bacteria. The flagella of Leptospira have a • 7 basal body with a series of disks which are similar to the two pairs of rings seen in • Gram-negative bacteria (Johnson 1977). In certain spirochetes, for example, S. thermophilia, S. sentostrepta, S. aurantia, S. plicatilis and Treponema zuelzerae,

the axial fibrils are present in a n-2n-n arrangement with one end of each flagellum

inserted near one pole and the free end overlapping the midsection of the cell with

the flagellum filament from the other pole. In certain spirochetes, such as

Leptospira serotype Hline, serotype Pomona and serotype Patoc 1 the flagella

filaments do not overlap (n-n arrangement) (Hovind-Hougen 1976).

T. pallidum possesses three endoflagella (inserted into each end of the cell)

which are approximately 17 nm in diameter and 12 ~m in length (Norris and group.

1993). There are 36 genes encoding proteins involved in flagellar structure and

function. This bacterium has three core proteins, FlaB1, FlaB2 and FlaB3, a sheath

protein, FlaA and two uncharacterized proteins (Fraser, Norris et al. 1998). The

jlaA gene encodes a polypeptide which possesses a hydrophobie leader segment

containing a cleavage site for signal peptidase 1. The promoter region for this gene

contains a -35 and a -10 region which would be recognized by RNA polymerase

substituted with cr 70 of Escherichia coli. The fiaB l, fiaB2 and fiaB3 genes encode

polypeptides of 286, 286 and 285 amino acids, respectively. The fiaB 1 and fiaB2

are preceded by a putative promoter which should be recognized by cr 28 of E. coli,

which is flagella specifie. The fiaB3 is downstream from the fiaB l, but lacks a

promoter region. It is therefore possible that these three genes are expressed on a

polycistronic mRNA. FlaB proteins do not have a signal peptide and appear to be

transported through the core of the flagella and added to the end of the growing

flagellum. It is unclear as to the spatial orientation of FlaB l, FlaB2 and FlaB3. In • 8 addition, it has not been determined whether aIl three component are on the same • flagella. The calculated molecular masses from DNA sequencing of FlaB1 is 31,179 daltons and for FlaB2 is 31,353 daltons which differ from the deduced

molecular masses, based upon SDS-PAGE, of 35-kDa and 34-kDa, suggesting

glycosylation. The function of the two uncharacterized proteins TpN29 and

TpN27.5 is still uncertain (Nords and group. 1993).

S. aurantia has two periplasmic flagella, one inserted at each end ofthe celi.

The bacterium moves due ta the rotation of the periplasmic flagella against the

outer membrane sheath. The organism can move in three manners: runs, reversaIs

and flexing. To generate a run, one flagellum rotates clockwise and the other

counterclockwise. A reversaI occurs when each flagellum rotates in the opposite

manner from that of the run. When both flagella rotate clockwise or

counterclockwise, a flex occurs in which the bacterium bends in the middle in order

to change direction (Fosnaugh and Greenburg 1988). ATP hydrolysis does not

appear to be the driving force for motility, while a proton motive force, in the form

of a transmembrane electricai potential or a transmembrane pH gradient, does

(Goulbourne and Greenburg 1980).

The S. aurantia flagellum is composed of three abundant polypeptides with

molecular masses of 37.5-kDa, 34-kDa and 31.5-kDa and three minor polypeptides

with molecular masses of 36-kDa, 33-kna and 32-kDa (Brahamsha and Greenburg

1988). The 34-kDa and 31.5-kDa polypeptides are major filament core

polypeptides and the 33-kDa and 32-kDa polypeptides are minor core polypeptides.

The 37.5-kDa polypeptide is the FlaA protein (Parales and Greenburg 1991). The

jlaA gene has been cloned and the gene is transcribed into a monocistronic mRNA

from a cr7°-1ike promoter. The open reading frame is 1011 bp (Parales and • 9 Greenburg 1993). • B. burgdorferi contains 10 endoflagella. The major tlagellar protein, p41, is composed of 336 amino acids with a predicted molecular mass of 35.7-kDa, but it

migrates on SDS-PAGE as a 41-kDa protein. This protein shows considerable

homology to the 33-kDa protein of T. pallidum. A hybrid protein, the p97, was

expressed in E. coli by means of DNA fragments ligated with À. gtl1 bacteriophage

DNA. This protein has a molecular mass of 97-kDa. Through the use of

irnmunoelectron microscopy of purified flagella, it appears this protein is

associated with the flagella. It is believed that the protein plays a role in the

preservation of flagellar structure (Eiffert, Hoppert et al. 1992).

S. hyodysenteriae is motile by means of two bundles of seven to nine

periplasmic flagella which are wound around the protoplasmic cylinder and

inserted into each end of the cell (Smibert 1984). The flagella are inserted

subterminally at each pole and the ends overlap in the center. Flagella preparations

contained five major proteins with molecular masses of 44, 37,35,34 and 32-kDa.

The 37, 34 and 32-kDa flagellin proteins are located in the core, while the 44 and

35-kDa flagellin proteins are located exclusively on the outer coat (Li, Dumas et al.

1993). The gene encoding the 44-kDa protein has been cloned and sequenced. It

encodes for a protein of 320 amine acids. This gene has been designated the flaA

gene in accordance with nomenclature used for other spirochetal sheath flagellins.

The protein has a 19 amino acid signal peptide which is cleaved before assembly

into the flagella (Koopman, De Leeuw et al. 1992).

In Leptospira spp., one flagellum is inserted at each end of the protoplasmic

cylinder and it extends along the helical axis without overlapping. The periplasmic

• 10 flagella of Leptospira interrogans serovar Pomona type kennewichi contains a Il.3 • nm core and two sheath layers with diameters of 21.5 and 42 nm, respectively. Two-dimensional gel electrophoresis of the flagella reveals seven different proteins

ranging in molecular mass from 31.5 to 36-kDa. A 34 and a 35.5-kDa protein is

located in the core and a 36-kDa protein is associated with the outer coat (21.5 nm

diameter filament). The amino-termini of the 34 and 35.5-kDa proteins were

sequenced. Both proteins were similar and they had homology to other spirochete

class B proteins (Trueba, Bolin et al. 1992). A flagellin gene, flaB, from L.

borgpetersenii serovar hardjo has been cloned. The nucleotide sequence data

shows an open reading frame encoding 283 residues which "vould correspond to a

molecular mass of 31.3-kDa. The protein sequence shows homologies of 56-59%

with T. pallidum FlaB 1, B2 and B3 (Mitchison, Rood et al. 1991).

Since the axial fibrils are located internally as opposed to E. coli in which

the flagella is external to the cell, it allows the spirochete to locomote in highly

viscous environments. T. denticola can locomote through viscosities of up to 700

mPas whereas optimum motility for E. coli is between 2-5 mPas (Klitorinos, Noble

et al. 1993); (Schneider and Doetsch 1974).

iv. Protoplasmic Cylinder

Beneath the outer membrane sheath is the protoplasmic cylinder. This

structure consists of the cell wall (peptidoglycan), the cytoplasmic membrane and

the contents of the cytoplasm. In sorne spirochetes, for example, Leptospira

interogans, L. biflexa, Treponema pallidum and Borrelia recurrentis, bundles of

fine fibrils are associated with the protoplasmic cylinder. Morphologically, these • Il fibrils can he divided into three categories, perimural fibrils, cytoplasmic fibrils • and helical fibrils. Perimural fibrils (3-5 nm in diameter) are seen in L. biflexa when cells are exposed to 0.5 N NaOH or hyaluronidase. Cytoplasmic fibrils (6-9

nm) are located along the inner layer ofthe cytoplasmic membrane. Using negative

staining techniques, it was determined that the fibrils are tubular in nature. They

are composed of a complex network of strands and occur in clusters of six to eight

at the cell poles. One possible role of the fibrils is to maintain the spiral shape of

the celI. Helical fibrils are found on the surface of the protoplasmic cylinder of

Spirochaeta stenostrepta. They appear as a layer of longitudinal helices which are

0.25 nm in diameter and have an amplitude of 0.5 nm. The function of this

structure is unknown (Holt 1978).

v. Peptidoglycan

Using electron microscopy it was determined that members of the genus

Spirochaeta, Leptospira, Treponema and Borrelia have a triple-Iayered cytoplasmic

membrane surrounded by a thin peptidoglycan layer. This is the structure seen in

Escherichia coli. The peptidoglycan layer is responsible for maintaining the

helical shape of the spirochete. Muramic acid, glucosamine, alanine and glutamic

acid are the major amino acid and amino sugar components in the peptidoglycan of

Leptospira, Spirochaeta and Treponema species. However, peptidoglycan

molecules in Spirochaeta and Treponema species possess the diamino acid

ornithine whereas, Leptospira species contain y,E-diaminopimelic acid (Johnson

1976).

• 12 vi. Spirochete Genomes • Physical/genetic maps have been constructed for five spirochete species: Borrelia burgdorferi, Leptospira interrogans, Serpulina hyodysenteriae,

Treponema denticola and T. pallidum. While it was once thought that aH

procaryotes had circular genomes, this myth was shattered in 1989 when the first

procaryotic linear chromosome was discovered in B. burgdorferi, the causative

agent of Lyme disease. The chromosome of B. burgdorferi was determined to be

linear by pulsed field gel electrophoresis (PFGE) analysis. The chromosomal DNA

was prepared in situ in agarose blocks. The B. burgdorferi chromosomal DNA did

migrate into the gel and exhibited a size of about 1 Mb (Ferdcws and Barbour

1989). Restriction digests were carried out with several different enzymes. By

summing the mass of each of the fragments, the chromosome size was determined

to be 946 kb, in agreement with the previous findings. One possibility which

should be considered is that the chromosome is circular, but is extremely fragile

and that during the preparation of the DNA for analysis by PFGE, or during the

running of a gel, the DNA is sheared (Saint Girons, Old et al. 1994).

The S. hyodysenteriae B78T genome consists of one circular chromosome,

3.2 Mb in size with no extrachromosomal DNA present. There is only one copy of

each of the rRNA genes rrs (16S), rrl (238) and rrf (SS). Most bacteria studied

have multiple copies of each of the rRNA genes. The organization of these genes

is unusual. Instead of a rrn operon (rrs-rrl-rrfJ, the rrf and rrl genes are 860 kb

from the rrs gene (Zuerner and Stanton 1994).

L. interrogans serovars icterohaemorrhagiae and pomona contain two

replicons, one of 4.4-4.6 Mb and the other of 0.35 Mb. The majority of the • 13 essential genes are found on the larger replicon in both serovars. However, the • smaller replicon contains the asd gene (present in one copy within the L. interogans genome) which encodes a-semialdehyde dehydrogenase. This enzyme

is essential in the biosynthesis of threonine, methionine, lysine and diaminopimelic

acid. DNA homology suggests that the two serovars are similar, but their genomic

organization is different (Zuerner, Herrmann et al. 1993).

Treponema denticola has a single circular chromosome which IS

approximately 3 Mb in size and one circular plasmid (pTD1) which is 2.6 kb in

size. The enzyme I-CeuI cut the DNA twice, confirming the presence of two rrl

genes on the chromosome. Onlya few genes have been cloned and characterized

making it difficult to comment on the genomic organization (MacDougall and Saint

Girons 1995).

A physical map has also been created for T. pallidum. Previous findings

indicate the chromosome is circular and 900 kb in size. The chromosomal DNA

was treated with 4 krad of gamma irradiation. PFGE of the DNA resulted in a

single band between 800 ta 1 000 kb. If the DNA was not irradiated, it did not

migrate into the gel suggesting that the DNA possesses a circular conformation.

The chromosomal DNA was then digested with the restriction endonucleases NotI

and Spel, which resulted in 12 and 26 fragments respectively, in arder for more

accurate sizing and for creating a future physical map (Walker, Arnett et al. 1991).

The entire genome has recently been sequenced. The exact genomic size reported

was 1,138,006 bp containing 1041 predicted open reading frames with an average

size of 1023 bp (Fraser, Norris et al. 1998).

• 14 vu. Spherical Bodies • Treponema denticola cells are usuaUy helical in morphology. However, Hampp in 1948 described morphological variations which he termed "granules." Later these

structures were called "spherical bodies." The morphogenesis of spherical bodies

was described by Wolf et al. (1993) by means of analysis of the various forms

using electron microscopy. Scanning electron microscopy revealed four different

morphological forms classified in the following groups: (i) single spirochete in a

normal helical state; (ii) twisted plait-like spirochetes; (iii) twisted spirochetes with

enlarged end, forrning clubs; and (iv) spherical bodies of different size. A

schernatic drawing of the morphogenesis of a spherical body is shown in Fig 3.

During the formation of a spherical body the treponemes lose their outer sheaths

and axial fibrils and produce a cornmon outer envelope. It is unknown what is the

physiological significance of these structures. It is speculated that the surface area

of a spherical body may be reduced by up to 75% when compared ta the helical

forrn of a celi. This could be a survival strategy because the reaction surface for

antibodies or other hast immune system factors will be reduced (Wolf, Lange et al.

1993); (Wolf and J. 1994).

• 15 • Figure 3. Schematic diagram ofthe formation ofa spherical body. a. A helical spirochete.

b. The spirochete undergoes cell division but the outer membrane sheath

remains intact.

c. Spirochetes move in opposite directions.

d. Spirochetes become interwoven forming a plait.

e. A club is formed by compression ofthe spirochetes.

f. A rounded structure termed a spherical body which contains many

spirochetes.

g. Cross section ofa spherical body.

PC protoplasmic cylinder

S outer membrane sheath

(Wolf, Lange et al. 1993)

• 16 • a. Typical heIicaI forme

b. Separation of protoplasmic cylinders.

c. Initiation ofplait formation.

d. Plait.

e. Club.

f. Spherical body.

g. Cross section of a spherical body. • o II. Taxonomy of Spirochetes • Spirochetes are classified into the order Spirochaetales and are divided into the Spirochaetaceae and Leptospiraceae families. The Spirochaetaceae family

consists of the genera Borrelia, Brevinema, Treponema, Serpulina, Brachyspira

and Spirochaeta. The Leptospiraceae family consists of the genera Leptospira and

Leptonema (Paster, Pelletier et al. 1996). Because members of the genus

Cristispira are unable to be grown in culture they were unable to be categorized in

either ofthe two spirochete families. However, recently rRNA genes were peR

amplified from Cristispira DNA isolated from the oyster Crassastrea virginica.

The DNA sequence of a single clone, CP1, revealed that this organism branched

deeply within the Spirochaetaceae family (Paster, Pelletier et al. 1996). This

procedure is commonly done to classify uncultivable organisms and is explained in

detail in section VII, iii. ofthe thesis.

• 17 Figure 4. Dendrogram of several spirochete species constructed from a 1410 base • comparison ofthe 16S rRNA gene. Scale bar represents a 10% difference in the nucleotide sequence.

(paster, Pelletier et al. 1996)

• 18 •

(% Difference) 11111111111 ...----- Treponema pallidum ,...--- Treponema phagedenis '---- Treponema denticola r--- Treponema bryant,ï

IL-..------Treponema succinifaciens

r---- Treponema pectinovorum ""------Treponema saccharophJ1um r---- Spirochaeta aurantia r---- Spirochaeta litoralis r--- Spirochaeta halophila "'---- Spirochaeta bajacaliforniensis r------Cristispira clone CP 1 Borre/ïa anserina Borrelia hermsii Borrelia burydorferi Rabbit Borre/ia sp.

0....- Brevinema andersonii Serpulina hyodysenteriae L..------l Serpulina innocens ,.----- Leptonem.a J1lini ,..---- Leptospira biflexa L..---l '----- Leptospira interrogans

• Bacteria have simple morphologies that are generally not useful in defining • phylogeny. In the case of spirochetes they are one of the few groups of bacteria correctly identified by morphological criteria, namely, their spiral shape and the

presence of axial fibrils (Woese 1987). The best tool for determining phylogenetic

relationship between distantly related organisms is 16S rRNA sequence

similarities. These ribosomal sequences differ by an average of 10% between

species of treponemes (Paster, Dewhirst et al. 1991). Figure 4 is a dendrogram

showing the % difference between several genera of spirochetes.

III. Ecology of Spirochetes

The genus Leptospira contains species which are free-living in soil and

\vater, as well as species which are associated \Vith animaIs. Sorne strains of L.

interrogans cause leptospirosis, a disease characterized by fever and hemorrhaging.

Leptospirosis is important because of the effect on livestock; for example, loss of

milk production. This disease also affects humans, callsing illness and sometimes

death. The disease manifests itself either as a chronic infection with little clinical

symptoms or as an acute infection. Nonpathogenic saprophytic leptospires, such as

L. biflexa, exhibit a minimal growth temperatllre of 11-13oC and an optimal growth

temperature of 25-28°C. Pathogenic species, on the other hand, will not grow at

these low temperatures (Il-13°C) showing optimal growth at temperatures between

28-30°C. The temperatures at which the bacteria are able to grow is one method to

distingllish between pathogenic and nonpathogenic Leptospira (Herrmann,

Bellenger et al. 1992). The pathogenic Leptospira spp. consist of six species L.

borgpetersenii, L. inadai, L. interrogans, L. noguchii, L. santaosai and L. weili

• 19 (Holt, K.rieg et al. 1994). • Leptonema is ouly represented by the species Leptonema illini. Very littie is known about the ecology of the bacterium. ft is nonpathogenic (Schwan,

Schrumpfet al. 1992); (Hait, Krieg et al. 1994).

Borrelia species are extracellular parasites which do not produce any known

toxins and cause zoonoses. They are Gram-negative microaerophiles and grow

optimally at temperatures between 30-35°C with generation times of 12-24 hours

(Johnson and Hughes 1992). The bacteria can be transmitted by body lice or

various species of hard and soft ticks to humans, causing reLapsing fever or Lyme

disease. There are several different etiological agents for Lyme disease. In North

America, this disease is caused by B. burgdorferi (Saint Girons, Old et al. 1994)

which is spread by an Ixodes tick. Members of this genus are able to shuttle

between hematophagous arthropods and vertebrates (Bergstrom, Barbour et al.

1991). The disease is characterized by a lesion at the primary site of the tick bite.

Progression of the disease is characterized by neurological abnormalities such as

facial paIsy and peripheral neuropathy. The third stage of the disease is marked by

arthritis, usuaLly infecting large joints, particularly the knee. It is rarely fatal but is

the source of chronic iLl health if untreated (Plorde 1994). Borrelia hermsii is the

causative agent of reLapsing fever. This is characterized by bouts of fever and

bacteremia along with intermittent periods of good health. The bacteria avoid the

immune system of the host through antigenic variation; the bacteria change outer

membrane lipoproteins, called Vmp. This occurs via a new vmp gene transLocating

to the expression site of the plasmid. The old vmp is lost during the recombination

process (Restrepo, Kitten et al. 1992).

• 20 Brevinema andersonii cells have been isolated from blood and other tissues • of the short-tailed shrew (B/arina breicauda) and the white-footed mouse (Peromysclls leucopus). The spirochete is able to infect laboratory mice and Syrian

hamsters. They are flexible helical cells with a diameter of 0.2-0.3 Jlm and a

length of 4-5 Jlm. The bacteria possess the typical spirochete ultrastructure with a

1-2-1 arrangement of periplasmic flagella. In vitro cultivation is possible in

modified BSK medium. The bacterium is microaerophilic with a growth

temperature 30-34°C at a pH of 7.4 (Defasse, Johnson et al. 1995).

Serpulina hyodysenteriae is the causative agent of swine dysentery. It is

characterized by mucohaemorrhagic diarrhea and lesions in the large intestine.

Damage to the epithelial cells is thought to be caused by two toxins: a LPS

endotoxin and a haemolysin. The LPS direetly affects the colonie enterocytes,

while the haemolysin produces severe damage to the ileal epithelium (Lyons, Kent

et al. 1991). Because the epithelial layer is damaged, nutrients, electrolytes and

water cannot be absorbed which results in diarrhea (Sueyoshi and Adachi 1990).

Interestingly, this organism has been isolated from homosexual men \vith AIDS

(Miller, Smibert et al. 1992). S. pilosicoli is the etiologic agent of colonic disease

which affects humans, dogs, pigs and birds. The spirochetes colonize the surface

and crypt mucin and attach to the apical membrane of cecal and colonic

enterocytes. Swine challenged with the spirochete developed diarrhea and reduced

growth with attachment of the apical surfaces of colonie enterocytes (Duhamel,

Trott et al. 1998). S. innocens has been isolated from swine and dog intestinal

tissue and fecal matter. This bacterium is not disease-producing. It is weakly

hemolytic and is not enteropathogenic for swine (Smibert 1984). • 21 Brachyspira aalborgi have been seen in humans and rhesus macaques with • intestinal spirochetosis (Duhamel, Trott et al. 1998). CeLIs are 0.2 f.lm in diameter and 1.7-6 Ilm in length. The bacterium is anaerobic and can be cultivated on

tryptose soy agar supplemented with 5% calf blood (Holt, KIieg et al. 1994).

The genus Spirochaeta includes anaerobic and facultative anaerobic

spirochetes. They are indigenous to aquatic environments including hypersaline

environments, hydrothermal vent communities, as well as fresh water marshes,

ponds and mud. AIl species ofSpirochaeta are saccharolytic (Canale-Parola 1992).

S. stenotrepta is an obligate anaerobe, orginally isolated from H2S-containing mud

of a freshwater pond. S. aurantia is a facultative anaerobe which has been isolated

from water and mud of freshwater ponds and swamps. S. halophilia is a salt-Ioving

bacteria, originally isolated from H2 S-containing mud of a high salinity pond Located on the Sinae shore of the Gulf of Elat, an environment with high amounts

2 2 of Na"', CI-, Ca + and Mg +. Several thermophilic spirochetes have been isolated.

One example is S. thermophilia RI 19.B1, which was isolated from the Kermadec

Islands. It is able to grow at temperatures as high as 73°C (Janssen and Morgan

1992).

Treponemes are part of the normal oral, intestinal and genital flora in

humans and animaIs as weIl as causative agents of disease. Four morphologically

identical pathogens in humans are T. pallidum subsp. pallidum (syphilis), T.

pallidum subsp. patens (yaws), T. pallidum subsp. endemicum (non verereal

endemic syphilis) and T. carateum (pinta). Only one treponema is an animal

pathogen, T. paraluiscuniculi (venereal rabbit spirochetosis) (Miller, Smibert et al.

1992). • 22 Even though effective therapies, such as penicillin, are available, syphilis • and related treponematoses are still a world-wide health concern. T. pallidum subsp. pallidum, the causative agent of syphilis, is extremely invasive, being able

to attach to mammalian cell surfaces and penetrate endothelial junctions and tissue

layers (Miller, Smibert et al. 1992); (Norris and group. 1993). Primary syphilis is

characterized by a chancre formation at the site of the primary infection, while the

secondary form of the disease is characterized by lesions at multiple sites in the

skin and internai organs. Tertiary syphilis is divided into three types:

neurosyphilis, cardiovascular syphilis and gummatous syphilis. These bacteria,

presumably due to the lack of LPS and perhaps antigenic outer sheath proteins, are

able to evade the immune response which allows them to propagate for extremely

long periods oftime (Norris and group. 1993).

Oral anaerobic spirochetes (OAS), aIl of which are members of the genus

Treponema are one of the etiological agents involved in periodontitis. The

association of spirochetes, the virulence factors and the effect of the host immune

system will be discussed in sections IV and V of the introduction.

IV. Periodontal Disease

i) An Overview

Chronic marginal periodontitis is comprised of two diseases: gingivitis and

periodontitis. Gingivitis is the condition in which inflammation is limited to the

marginal gingiva without bone resorption around the neck of the tooth.

Periodontitis is the stage of chronic marginal periodontal disease in which the

periodontium has become acutely or chronically inflamed resulting in progressive

loss of tooth support. Periodontitis is responsible for most tooth loss of people • 23 over 40 years of age. This disease, unlike gingivitis, is irreversible since lost • alveolar bone and periodontalligament do not regenerate. Within the oral cavity over 300 bacterial species are present (Darveau,

Tanner et al. 1997). In the case of chronic marginal periodontitis there are only a

few bacterial species thought ta be pathogenic which include Porphyromonas

gingivalis, Prevotella intermedia, Baeteroides forsythus, Campylobacter recrus,

Fusobacterium nueleatum, Peptostreptoeoeeus micros, Eikenella eorrodens, and

Treponema denticola (Robinovitch 1994). It is likely that several different

periodontal pathogens are the causative agents of chronic marginal periodontitis,

not just one species (Darveau, Tanner et al. 1997).

ii) Spirochetes as Etiological Agents

Chronic periodontal lesions are comprised of a complex microfIora in which

the majority population are proteolytic Gram-negative anaerobes. Spirochetes

serve as both etiological agents and as indicator organisms for monitoring status of

the disease. In the healthy gingiva treponemes are present in the gingival crevice

and supra- and subgingival plaque in low numbers. In cases of disease the

percentage increases. In gingivitis, treponemes constitute 2-10% of the fIora in

subgingival plaque. In bleeding periodontal sites the percentage is higher than in

non-bleeding sites. Thirty percent of the microflora involved in acute necrotizing

gingivitis are GAS. The highest percentage of spirochetes, 40-56%, is found in

adult chronic periodontitis species (Darveau, Tanner et al. 1997).

Ill• Classification ofNovel Isolates

• 24 The periodontal pocket can provide a niche for over 500 species of bacteria.

CUITent methods for the classification of microbes isolated from periodontal

• methods~ probes~ pockets include culture whole chromosomal DNA cloned DNA

probes and immunodiagnostic methods. Culture methods are extremely valuable in

order for a holistic study of the spirochete. Unfortunately~ there are a number of

üAS which are still yet unculturable. Whole chromosomal DNA probes are

problematic in that they have low specificity. Randomly cloned DNA fragments

often have low sensitivity and such a method can be time-consuming in attempting

to clone DNA fragments which will not cross-react with other spirochete species.

Immunodiagnostic methods require antibody reagents which may not be readily

available and may cross-react with non-targeted organisms. Restriction fragment

length polymorphis (RFLP) is a promising method for the rapid identification of

novel cultivable isolates especially those microorganism which are not easily

distinguishable. PCR is a highly sensitive method which offers a number of

potential amplification sites. The 16S rRNA genes are most often used because

they are present in every bacterium and these genes are highly conserved

(Ashimoto~ Chen et al. 1996). The 16S rRNA genes contain signature sequences

unique to each bacterium, thus allowing it to be distinguishable among other

bacteria (Amann, Ludwig et al. 1995). RFLP analysis of the üAS Treponema

denticola, T. vincentii~ T. phagedenis, and T. socranskii as weIl as a nurnber of

clinical isolates in our laboratory collection is described in Chapter 2 of this thesis.

IV. Spirochete Culturablity

There is a great diversity of GAS in the gingival crevice. Ultrastructural

evidence indicates that there are over a dozen morphotypes of oral spirochetes. In • 25 one study subgingival plaque was coIIected from a patient with severe destructive • periodontitis. Partial 16S rRNA genes were PCR amplified using universal primers. The approximately 500 bp fragments were cloned into E. coli and the

resultant clone library was screened by colony hybridization with a radiolabeled,

treponema-specific oligonucleotide probe. Clones which represented nearly 20

new species were found. This suggested that previous methods of isolation,

cultivation and identification have grossly underestimated the diversity of

spirochetes (Choi, Paster et al. 1994). Only a smaII number of oral treponemes are

cultivable on conventional isolation media. Cultivation is difficult because of the

unique and complex nutrient requirements of spirochetes and the strict anaerobic

conditions needed for growth (Koseki, Ishikawa et al. 1995). Only limited studies

can be conducted on microorganisms which cannot be pure cultured (Amano,

Ludwig et al. 1995). In order to detennine the role of each species of spirochete in

periodontal disease, one must be able to pure culture the organisme

Qiu et al. (1994) developed a method for quantifying OAS in pure culture

by a viable count technique. NOS medium with the addition of 0.7% SeaPlaque

Agarose and 20 ~g/ml rifampin was used for the assay. Molten NOS-agarose­

rifampin (NAR) medium was pipetted into 40-ml polystyrene tissue-culture flasks,

inoculated with subgingival plaque samples, allowed to gel at 4°C and then

incubated anaerobicaIly. The percentage of viable spirochete cell recovered was

variable, between 4.1 to 100% with a mean of 39.3 and standard error ±7.4. Using

this method it is possible to obtain viable counts of OAS from subgingival plaque

samples (Qiu, Klitorinos et al. 1994).

In order to augment this previous study, our laboratory undertook a search

• 26 for an inexpensive gelling agent that remains molten at 37°C and gels at 25°C. • Chapter 3 of this thesis outlines these experiments and details how this medium enhances the recovery ofcolony-forming units.

v. Treatment of Periodontal Disease

A successful treatment of adult marginal periodontitis is a substantial

reduction of periodontopathic microorganisms such as Treponema and Bacteroides

spp. which are present in high proportions during the disease state. With this

reduction, the subgingival region can be recolonîzed with bacteria most often found

within the gingival crevice. Methods involved in the treatlnent of periodontitis

include mechanical debridement, scaling and root planing and antibiotic therapy

(Gusberti, Syed et al. 1988).

A study by Hinrichs et al. (1985) investigated the effects of scaling and root

planing on subgingival microbiota. In order ta provide an estimate of the naturaUy

occurring distribution of microorganisms a large group (284 subjects/568 sites/ages

20-40) was examined. A second group (19 subjects with moderate ta advanced

periodontitis/76 sites) was examined ta determine microorganisms present at

disease sites and to determine the changes in the microorganisms which occurred

after treatment (rooting planing and oral hygiene procedures). Darkfield

microscopy was used to count the number and the type of microorganisms present

in the plaque samples collected. Tables 1 and 2 show the mean percentage of

subgingival microflora with probing depths of <4.5 mm and >4.5 mm, respectively,

of the subjects that underwent root planing and oral hygiene treatments. The most

dramatic drop is in the percentage of spirochetes (Hinrichs, Wolff et al. 1985).

• 27 Table 1. Effect oforal hygiene and root preparation procedures on subgingival • microf1ora in gingival crevices with probing depths <4.5 mm*

Subgingival rnicroflora Evaluation Mean % oftotal subgingival P-value+

period microflora

Coccoid Pre-treatment 34.54 ~O.OOI

Post-treatment 56.93

Spirochetes Pre-treatment 10.11 ~O.OOI

Post-treatment 2.88 1

Total motiles Pre-treatment 13.67 ~O.OOI

Post-treatrnent 4.25

Fusobacterium spp. Pre-treatment 7.23 ~O.05 Post-treatment 2.86

Dark-pigrnented Pre-treatment 5.05 0.079 NS

Bacteroides spp. Post-treatment 2.02

* Mean of four probing depth measurements, one on rnesio-buccal and one on mesio­ lingual by two separate examiners. + Based on paired student t test with separate variance estirnates and two-tailed probabilities. NS Not statistically significant, P> 0.05. (Hinrichs, Wolff et al. 1985). • 28 Table 2. Effect oforal hygiene and root preparation procedures on subgingival • microflora in gingival crevices with probing depths ~4.5 mm*

Subgingival microflara Evaluation Mean % oftotal subgingival P-value'"

period microflora

Coccoid Pre-treatment 18.30 ~O.OOl

Post-treatment 46.95

Spirochetes Pre-treatment 20.95 ~O.OOl

Post-treatment 3.14

Totai motiles Pre-treatment 28.49 ~0.001

Post-treatment 5.92

Fusobacterium spp. Pre-treatment 10.15 ~O.OOS Post-treatment 2.18

Dark-pigmented Pre-treatment 14.04 NS

Bacteroides spp. Post-treatment 9.72

* Mean offour probing depth measurements, one on mesio-buccal and one mesio­ lingual by two separate examiners.

+ Based on paired student t test with separate variance estimates and two-tailed probabilities. NS Not statistically significant, P> 0.05. (Hinrichs, Wolff et al. 1985). • 29 vi. Adherence • The primary niche for OAS is in the gingival crevice. In order to cause disease the spirochete must be able to attach to a substrate, multiply and express

virulence factors. If the bacteria are not able to attach to a substrate then they will

be washed away by the gingival crevice fluid. Treponema denticola has been

shown to attach to human gingival fibroblasts (HGF) under both aerobic and

anaerobic conditions. It was suggested that the mechanism for binding to the

fibroblasts was lectin-mediated with affinity for galactose and mannose on the HGF

surface (Weinberg and HoIt 1990).

It has been shown that most T. denticola strains adhere weIl ta extracellular

proteins like fibronectin which are synthesized by HGF and bind to the plasma

membrane of the fibroblaste In the presence of anti-human fibronectin antibodies,

adherence to HGF was reduced but not fully inhibited (Ellen, Song et al. 1994).

T. denticola has also be shown to adhere to basement membrane proteins

laminin, fibronectin and type IV coIlagen as weIl as type l collagen, gelatin and

fibrinogen. ELISA tests showed increased attachments to aIl proteins compared ta

BSA. The binding to laminin was most prominent. Information about the nature of

attachment was gathered by preincubating the spirochetes or the substrate proteins

with potential inhibitors of attachment. The sulfhydryl reagent p­

chloromercuribenzoic acid (pCMBA) showed the strongest effect reducing the

attachment of T. denticola cells by 80-90% for each protein. If T. denlicola was

heat treated at 70°C for 10 min, the attachment ta laminin was reduced by aver

70% and the attachrnent to fibrinogen reduced 40-50%. The attachment to

fibrinogen was reduced by 50%. Only a 20% reduction in the attachment ta gelatin

• 30 occurred in the presence of mixed glycosidase. It appears that T. denticola binds to • different kinds of proteins by using specifie attachment mechanisms in which the binding involved protein-SH groups and/or carbohydrate residues (Haapasalo,

Singh et aL 1991).

The major surface protein of T. denticola is a 53-kDa proteine Most likely

outer surface proteins are involved in adhesion. Outer envelope preparation of T.

denticola were separated by SnS-PAGE and transferred to nitrocellulose. After

exposure to many mammalian proteins it was determined that laminin, fibrinogen

and fibronectin bound to the 53-kDa proteine Other T. denticola proteins ranging

from 75 ta 95-kDa bound some of the mammalian proteins. However, since

proteins are not found surface-exposed in the outer sheath of T. denticola, they

were not considered important in adherence (Haapasalo, Muller et al. 1992).

In sorne strains of T. denticola the outer membrane-associated

chymotrypsin-like protease complex (CTLP) is highly expressed. This complex is

localized ta the OMS. On SnS-PAGE the CTLP complex when not heated,

migrates as a proteolytic active doublet with a molecular mass of 95-kDa. If the

complex is heated, the complex separates into three fragments. The largest

fragment is 72-kDa and the two smaller fragments sizes have been reported as 27

and 23, 39 and 32 or 43 and 38-kDa (Fenno and McBride 1998). The CTLP is

believed to be involved in T. denticola adherence to epithelial cells by becoming

associated with 53-kDa major outer membrane proteine The 53-kDa protein is

thought to integrate with the plasma membrane of the host cell and function in the

transport of T. denticola surface components into the cells. The cytotoxicity of the

CTLP will be discussed below (Vitto, Pan et al. 1995). • 31 T. denticola has been shown to bind to hyaluronan. Hyaluronan is a high • molecular-weight polysaccharide which is composed of repeating units of glucuronic acid and N-acetyl-D-glucosamine. This polysaccharide is very abundant

in epithelium and soft tissue. The stratified epithelium of the oral mucosa contains

hyaluronan which forms a highly hydrated gel maintaining the intercellular space

to allow the diffusion of nutrients. The ability of T. denticola to bind to this

molecule may give the bacteria an ecological advantage since hyaluronidases

probably acts to break down the polysaccharide. The bacteria is thought to bind to

hyaluronan via the CTLP. Since phenylmethysulfonyl fluoride, periodate

oxidation, heat and p-chloromercurybenzoic acid inhibited binding and also

inhibited protease activity, it is believed that the protease is involved in binding.

As well, in binding assays, purified CTLP bound to hyaluronan (Haapasalo,

Hannam et al. 1996).

vii. Cvtotoxic Effects

Adherence of oral spirochetes in the gingival crevice is not itself a

pathogenic process. It is only when the cytopathic effects of the adherence and

colonization of the bacteria result, can initial colonization be considered a

virulence factor. Therefore, if the bacteria benevolently adhere to a site resulting

in no damage to host cells, colonization is not a virulence factor. Ellen et al.

(1994) has reported the cytopathic response of HGF upon incubation with T.

denticola. The effects seen on the HGF are the following: the pLasma membrane

blebs, folds and is grossly rounded, F-actin rearrangement iuto a perinuclear array,

ceLl detachment from the substratum and reduced cell proliferation and cell death • 32 (Ellen, Song et al. 1994). • Grenier (1991) has shown that T. denticola is able to agglutinate and lyse red blood cells. This process involves two steps. The first step is bacterial binding

to the erythrocyte using a D-glucosamine-like-containing component and the

second step results in damage to the erythrocyte membrane (Grenier 1991). A 46­

kDa hemolysin produced by T. denticola has been studied. The gene responsible

for encoding this protein is the hly gene. The entire hly gene was cLoned and

transformed into E. coli. Both hemolysis and hemoxidation was seen when the E.

coli cells containing the cloned hemolysin was grown on sheep blood agar plates.

Interestingly, the deduced amino acid sequence from the hly gene was not

homologous to the sequence of other hemolysins in the protein databases (Chu,

Burgum et al. 1995).

A second enzyme isolated from T. denticola which \vas able to cause

hemoLysis of sheep erythrocytes is a chymotrypsin-like protease. The molecular

mass of this protein which is encoded by the prlB gene is 30.4-kDa. Because this

enzyme is affected by the protease inhibitors phenylmethylsulfonyL fluoride,

diisopropyLfluorophosphate, and N-tosyL-L-phenyalanine chLoromethyl ketone, it

was concluded that it acted as a chymotrypsin-like protease. This protein does not

hydrolyze the proteins fibronectin, type IV collagen, Laminin, etc., which wouLd be

found in the periodontal pocket. Therefore the physiological raIe for the protein is

still under investigation (Arakawa and Kuramitsu 1994).

The CTLP, aise called dentilisin, has been shown ta have potent cytotoxic

effects on epithelial cells. Membrane blebbing of epithelial cells was seen after

cells were treated with T. denticola for two hours. Similar blebbing was seen when • 33 cells were treated for 2 h with 20 J.lg/ ml of CTLP. The purified protein was also • able to degrade endogenous pericellular fibronectin in epithelial cells and fibroblasts. This may inhibit cell adhesion and locomotion of migrating cells.

Arresting adhesion to fibronectin has been shown to cause apoptosis of epithelial

cells (Uitto~ Pan et al. 1995). Purified CTLP can hydrolyse fibrinogen, transferrin~

cxt-antitrypsin, IgA, IgG, gelatin, serum albumin, and laminin. It can also

inactivate substance P by attacking the Phe-8-Gly-9 bond~ convert angiotensin l

into angiotensin II and then breakdown angiotensin II into tetrapeptides (Makinen,

Makinen et al. 1995).

To ascertain the physiological role of dentilisin, the prtP gene of T.

denticola was mutated. The virulence ofprtP gene mutants were tested in a mouse

model. Wild-type and mutant strains were injected s.e. into the posterior

dorsolateral surface of two groups of mice. The animaIs inoculated with the prtP

gene mutant developed smaUer lesions compared to the animaIs inoculated with

wild-type strains over a 3 to 14 day period after infection. Therefore the

pathogenicity of T. denticola is affected by the 10ss of dentilisin activity (Ishihara,

Kuramitsu et al. 1998).

The 53-kDa Msp along with functioning as a porin and an adhesin also

exhibits cytotoxic effects. The mechanism in which cytotoxicity is induced is not

certain but pore-forming activity is involved. Translocation of bacterial porin-like

structures to eukaryotic cell membranes have been documented for several bacteria

including Salmonella typhimurium, Neisseria gonorrhoeae and Porphyromonas

gingivalis (Fenno, Hannam et al. 1998). tvfsp was found cytotoxic to epithelial

cells and erythrocytes (Fermo and McBride 1998) (Fenno, Hannam et al. 1998). • 34 • VUl. Iron Sequestration An important step ln the colonization of the periodontal pocket is the

acquisition of irone Scott et al. (1993) was able to show that T. denticola bound

Congo red and hemin via a 47-kDa outer membrane protein (Scott, Siboo et al.

1993). Further study revealed that T. denticola had no siderophore activity and did

not transport [3H]-hemin into the cytoplasm. The model for iron appropriation is as

follows: phospholipase C and other cell-associated and extracellular factors cause

hemolysis of erythrocytes, hemin then becomes liberated and is trapped by a 47­

kDa outer membrane sheath receptor proteine In addition, T. denticola can utilize

lactoferrin, an iron binding protein found in saliva, through the expression of 17

and 43-kDa outer membrane sheath receptors (Scott, Chan et al. 1996).

v. Role of the Immune System in Gingivitis and Periodontitis

i. Introduction

Inflammation of only the gingiva causes gingivitis. A more serious

condition, periodontitis results if both the gingiva and the periodontal ligament

and the alveolar bone sUITounding and supporting the teeth become inflamed.

Periodontitis can result from the direct cytotoxic and proteolytic effects of bacteria

as weIL as the indirect host immune response (polymorphonuclear-induced damage,

neutrophil complement-mediated damage and cell-mediated damage). A number of

mediators are produced and released by leukocytes, plasma cells, fibroblasts and

other connective tissue which also play a role in the inflammatory process and

tissue destruction (Greenspan 1994). • 35 • Il. Interleukin-1 There are two forros of interleukin-l (IL-I), designated IL-la. and IL-1f3.

The gene products are cleaved by plasmin or elastase to biologically active

molecules of Mr 17 500. IL-I is produced by macrophages activated by microbial

substances, cytokines or immune complexes. This cytokine can also be released

from platelets, fibroblasts, keratinocytes and endothelial ceLls. LPS found in the

outer membrane of Gram-negative bacteria will induce IL-1 release from

macrophages. The release of this molecule increases the attachment of neutrophils

and monocytes to endothelial cells, aiding in the recruitment of cells to the site of

inflammation and inducing the production of prostaglandin E2 (PGE2) from

macrophages and gingival fibroblasts. PGE2 increases vascular permeability at the site of inflammation and is a mediator of bone demineralization. IL-l acts to

induce formation of osteoclasts from bone marrow precursors. Finally, IL-I

induces the proteinases (prostomelysin, procollagnease, serine proteinase and

urokinase-type plasminogen activator). The urokinase type plasminogen activator

converts plasminogen into plasmin which activates neutral metalloproteinase

proenzymes. Proteoglycans and collagens are degraded by the activated enzymes

(Page 1991).

111. Tumor-Necrosis Factor-a and Lymphotoxin

Tumor-necrosis factor-a. (TNF-a) and lymphotoxin (LT) are mediators of

inflammation. TNF-a is produced by macrophages which have been activated by

Gram-negative bacteria (LPS). LT is produced by TH I subset of CD4+ T

• 36 lymphocytes which have been activated by a mitogen or antigen. Both TNF-a and • LT are involved in bone resorption by stimulating the proliferation of osteoclast precursors and by acting on mature osteoclasts. TNF-a increases chemotactic

responsiveness, degranulation and adherence to the surfaces of endothelial cells by

leukocytes. It also enhances vascular permeability and stimulates endothelial cells

to produce IL-1 (Page 1991).

iv. Arachidonic acid

Arachidonic acid is a 2ü-carbon polyunsaturated fatty acid. It is a portion of

the plasma membrane of many different cells which is released by the action of

phospholipases. Arachidonic acid can be converted to several different compounds

such as prostaglandins and leukotrienes. Many of these metabolites are associated

with inflammation. PGE-2 suppresses the production and release of IL-1 and TNF-

a. Prostaglandin-E is a mediator of bone resorption. Leukotrienes are responsible

for inducing vascular pernleability, chemotaxis of leukocytes, vasoconstriction and

bronchoconstriction (Page 1991).

There is much evidence demonstrating the importance of prostaglandins in

tissue destruction within the periodontium. Levels of this compound are

approximately 4-fold higher in active disease sites in contrast to non-active disease

sites with levels decreasing after treatment. In animaIs the amount of alveolar bone

resorption is greatly reduced if nonsteroidai anti-inflammatory drugs which inhibit

the production of prostoglandins is administered (Page 1991).

v. Metalloproteinases

Members of the metalloproteinase famiIy in sum degrade the extracellular • 37 matrix in inflammatory diseases such as periodontitis. AlI enzymes are secreted in • a precursor form which requires activation. Fibroblasts, macrophages and keratinocytes produce such enzymes which degrade periodontal connective tissue.

An activated macrophage secretes large quantities of collagenase, elastase and acid

proteases which degrade the connective tissue matrix. Bacterial structures, for

instance LPS, cause cells such as monocytes to produce IL-l and TNF-Cl. These

cytokines are autostimulatory for macrophage and they activate fibroblasts which

results in perpetuating the degradation process (Page 1991).

VI. Stimulation ofthe Immune System by Treponema denticola

Human polymorphonuclear leukocytes (PMN) were isolated from healthy

donors. The PMNs were incubated with test substances (53-kDa OMS protein, LPS

and peptidoglycan) isolated from T. denticola. The 53-kDa protein (Section V

parts v and vi) strongly stimulated the reLease of collagenase while the LPS and

peptidoglycan caused only a small release of enzyme. The strongest stimulators of

gelatinase release was caused by the 53-kDa protein and LPS. Both the gelatinase

and the collagenase secreted from the PMN were predominantly in the active forro.

Only the 53-kDa protein induced the reLease of serine proteinases, specifically

cathepsin Gand elastase. To insure that the enzymes released from the PMNs were

not caused by toxic effects of the test substances, lactate dehydrogenase was

assayed for. This enzyme was not liberated by the PMNs indicating that the

granular contents released were not due to cellular disintegration (Ding, Ditto et al.

1996).

T. denticola has also been shown to have a proinflammatory role ln

periodontitis. IL-l is an extremely important cytokine in the development of • 38 inflammation. Monocytes~ macrophages and keratinocytes produce the inactive • precursor pro-IL-lp which is enyrnatically cleaved into a 17.5-kDa fragment which was biologically active. Sorne cells such as keratinacytes do not have the enzymes

required to cleave pro-IL-lpinta an active forme To test whether T. denticola

produces the enzymes necessary~ recombinant pro-IL-l p was incubated in the

presence of the spirochete. The degradation products were analyzed using SDS­

PAGE and Western immunoblotting. It was found that pro-IL-lp was

enzymatically digested into a 21-kDa polypeptide within 30s~ then further degraded

to a 19-kDa fragment and finally degraded into an 18-kDa fragment. To determine

if the 18-kDa fragments have biological activity, the supernatant containing this

polypeptide was added to a thymocyte suspension in the presence of ConA.

Thymocyte proliferation occurs in the presence of IL-l p in a dose dependent

manner with a suboptimal concentration of ConA. The thymocyte cells~ when

incubated with the 18-kDa polypeptide produced from enzyrnatic digestion of

recombinant pro-IL-l p by T. denticola, proliferated in a dose dependent rnanner.

The resultant 18-kDa fragments were biologicaUy active. Which T. denticola

enzyme(s) cleaved the pro-IL-l p is not known (Beausejour~ Deslauriers et al.

1997).

vii. Summary

The normal immunological response in periodontitis is that of a protective

role. In immunocompromised subjects such as individuals suffering from AlOS or

imrnunocompromised animals~ severe periodontitis can occur. The reduction in

total T cell number resulted in the rapid onset of periodontitis. However, the • 39 immunological factors which are present do contribute to tissue destruction within • the periodontium. There is a battle between infecting bacteria and the immunological defense of the host (Ranney 1991). Thus T. denticola does evoke

an immune response. This response is directed primarily to remove the bacteria

however; in this process, tissue destruction can result.

VI. Spirochetes as the Etiological Agent of Alzheimer's Disease

i. Introduction

The etiology of Alzheimer's disease (AD) is to date unknown. Judit

Miklossy (1993) hypothesized that spirochetes could play a role in the pathogenesis

of AD. Late stages of two spirochetal diseases: Lyme disease caused by Borrelia

burgdorferi and neurosyphilis caused by Treponema pallidum result in cortical

atrophy and dementia. To prove this hypothesis, that spirochetes were associated

with AD, 27 random autopsy cases were chosen. Of these cases, 14 were

diagnosed with AD and the remainder diagnosed with other neuropsychiatrie

diseases. In aIl cases blood and cerebral spinal fluid (CSf) were examined using

darkfield microscopy. Ten J.lI of blood were diluted with 20 J.lI of sterile distilled

water and put on a slide and examined. Thirty IJ.I of CSf (undiluted) were placed

on a slide and examined.

Cerebral cortex samples were also examined for the presence of spirochetes.

3 Small fragments with a volume of 1 cm , were taken from sterile post mortem

brain biopsy material, finely sliced and inoculated into 3 ml of PBS or saline. The

material was shaken for 30 minutes. A 30 J.lI aliquot of supernatant was removed

and examined under darkfield microscopy. Attempts were also made to culture the • 40 spirochetes in Noguchi medium.

In all 14 AD cases spirochetes were found in the blood, CSF and brain with

• estimates of 100-400 per cc, 50-200 per cc and 1000-2000 per cc, respectively. In

the 13 cases of patients with other neuropsychiatrie (non-AD) diseases, no

spiroehetes were found (Mikiossy 1993). To insure that what was being visualized

under darkfield mieroseopy were spirochetes 4 of the 14 AD brain samples were

selected for examination using scanning electron microscopy. Mieroorganisms

isolated from the cortex of AD brains showed helically shaped bacteria with axial

fibriis winding around the microorganisms. The hallmark of a spiroehete is axial

fibrils. The observations made using eleetron microseopy were in agreement with

previous observations made using darkfieid microscopy, that the microorganisms

seen were spiroehetes. These extraordinary findings suggested that spiroehetes are

associated with AD (Mikiossy, Kasas et al. 1994).

Il. Alzheimer's Disease

A definitive diagnosis of AD requires a histological examination of brain

tissue. In clinical practiee the above eriterion is rarely met so a diagnosis of

"probable" AD is accepted for clinical purposes. The disease usually runs a

progressive and relentless course that can be divided into three progressive stages

based on the severity of intellectual deterioration (Kaufman 1995).

iii. Pathology

The brains of AD patients are more atrophie than brains of age-matehed

controIs, especially in the cerebral cortex association areas. A feature of the

disease is "plaques and tangles." These entities are aiso found on the brains of • 41 elderly non-AD patients. The critical factor is that the plaques and tangles are at • higher densities and are distributed in the cortex association areas and the limbic system, notably the hippocampus.

Neurofibrillary tangles are comprised of paired, helical filaments of

abnormal protein within neurons. Such tangles are numerous and concentrated on

the hippocampus in AD. Senile plaques are extracellular aggregates composed of

amyloid core surrounded by abnormal axons and dendrites. The amyloid is p­

amyloid, cleaved from amyloid precursor protein which is encoded for on

chromosome 21. Plaques "vere once believed to correlate with presence and

severity of disease. More recent evidence suggested that this was untrue. Instead

neurofibrillary tangles correlated more closely than plaques with dementia

(Kaufman 1995).

iv. Biochemical Abnormalities

In AD patients cerebral cortical acetylcholine (ACh) concentrations are less

than that of age-matched controls. Substantia innominata neurons are lost which

results in a reduction of ACh and choline acetyltransferase in the cerebral cortex.

There is also a pronounced reduction in somatostatin, a peptide neurotransmitter.

A decrease in this peptide does not closely relate to dementia. Since it is believed

that a reduction in ACh correlates with dementia, the "cholinergie hypothesis" has

been formulated which attributes dementia in AD to a reduction in cholinergie

activity (Kaufman 1995).

• 42 VII. Examination of Blood from Healthy Humans

• L Introduction Recent molecular-phylogenetic advances with the 168 rRNA genes have

allowed analysis on microorganisms that are viable but otherwise non-cultivable in

conventional microbiological media. This fact provides support to the argument

that there is a great diversity of microorganisms in nature that are viable but not as

yet cultivable by current methods (Ward, Weller et al. 1990). During the

examination of blood from both AD patients and healthy subjects by darkfield

microscopy in our laboratory, we observed pleomorphic microorganisms. This is

contrary to medical dogma which states that the blood of a healthy human is a

sterile environment (Ryan 1994). Therefore, bacteria residing as symbionts in the

blood ofa healthy human is entirely possible.

Il. Phylogenetic Identification of Microbial Cells without Cultivation

In terms of characterizing microorganisms, morphology alone is tao simple

to serve as a reliable basis for classification in contrast to plants and animaIs.

Classical microbiology involves the isolation and pure culture of an organism for

identification by physiological and biochemical traits. For the quantification of

active cells in environmental samples viable plate counts or most probable number

techniques are used. Because these methods selected for certain organisms a strong

bias was introduced. When samples were examined microscopically, the

microscopie counts exceeded the viable-cell counts by orders of magnitude. This

was known as the "great plate count anomaly." Table 3 describes the percentage of

cultivable microbes from different environments compared to the total microscopie

• 43 Table 3. Culturability determined as a percentage ofculturable bacteria in • comparison with total microscopie cell counts

Habitat Percent culturability·

Seawater 0.001-0.1

Freshwater 0.25

Mesotrophic lake 0.1-1

Unpolluted esturarine waters 0.1-3

Activated sludge 1-15

Soil 0.3

* Culturable bacteria measured as colony-forming units (CFU).

(Amann, Lud'\vig et aL 1995).

• 44 ceH count. The majority ofcells microscopically visualized were viable but did not • form colonies on agar plates. This occurred with known species because either the conditions were not suitable or these cells entered into a non-cultivable state. In

the case of unknown species which had never been cultivated before, unsuitable

methods did not allow cultivation. Known pathogens such as Salmonella

enteritidis, Vibro cholerae and V. vulnificus can quickly enter into a non-cultivable

state upon exposure to salt water, freshwater or lo\v temperatures. This state is

termed viable but non-culturable (VNC) (Amann, Ludwig et aL 1995).

Such bacteria were once believed not to be unculturable. It was simply that

researchers failed to provided appropriate conditions to support their cultivation.

In sorne cases this is trae, but not in aIl cases. Bloomfield hypothesizes that when

cells are arrested in growth during exponential-phase by chemical or physical

agents, that metabolism continues producing free radicals which damage DNA and

perhaps kil1 the cells. Bloomfield proposes that this mechanism explains the

failure of standard media to recover viable cells from sorne environmental sources

or from starved and or cold stored microcosms. If cells are plated on nutrient rich

media at temperatures optimum for enzyme kinetics, an imbalance in metabolism

occurs and superoxide and free radicals are produced. CeHs will die because they

are unable to detoxify the superoxide and free radicals (Dixon 1998).

lIi. Nonculture Methods for Identification of Microorganisms

Since only a small number of bacteria (Bacteria and Archaea) have been

described, approximately 5000 species compared with 500, 000 insect species, new

methods were needed to characterize environmental samples (Amann, Ludwig et al.

1995); (Pace 1997). Using the polymerase chain reaction (peR) the 16S rRNA • 45 gene can be amplified from a mixed population of DNA. These amplified rDNA • fragments can be cloned and sequenced. The sequence data are compared with other 16S ribosomal sequences in an rDNA database which will provide

phylogenetic identification. Phylogenetic groups are characterized by regional

rRNA sequence idiosyncrasies, a signature. An oligonucleotide probe (17 to 34

nucleotides in length) is designed to hybridize to this signature region. Fluorescent

probes are commonly used which hybridize to the 16S rRNA signature sequence of

individual cells. The sequence specifie probes are necessary because the retrieved

sequences could have originated from naked DNA present in the sample or from

contamination. This final step, using sequence-specifie hybridization probes which

upon binding, the 16S rRNA, would identify and enumerate whole fixed cells in the

original sample by in situ hybridization. A schematic diagram of these steps are

presented in Figure 5. Appropriate probes composed of oligonucleotide sequences

can also be used to distinguish between Eucarya, Bacteria and Archaea (DeLong,

Wickham et al. 1989); (Amann, Ludwig et al. 1995).

This procedure is an excellent method for identification of uncultivable

organisms. However, during the procedure several biases can be introduced.

During the extraction of nucleic acids, not aIl microorganisms lyse equally weIl.

Therefore, a higher concentration of nucleic acids will be present from sorne

organisms. PCR amplification can result in sorne sequences being amplified

because of selective priming of structural elements. If the number of rRNA genes

are more abundant in a bacterial chromosome, e.g., mycoplasma 1 and bacilli up to

10, then a greater quantity of one population will be produced. Another bias can

occur during the cloning step. There are different cloning efficiencies for rRNA

fragments from different bacteria (Amann, Ludwig et al. 1995). • 46 • Figure 5. Identification ofnonculurable bacteria from an environmental sample. Bacteria from an environmental sample are collected and the DNA or RNA is

isolated. The 168 ribosomal gene is peR amplified and the resultant

amplicons are cloned. Many of the cloned 168 rDNA inserts are sequenced

and the sequence is compared with other 168 rDNA sequences within the

database. Fluorescently labeled oligonucleotide probes are designed to

hybridize to the signature region ofthe 168 rDNA sequences. The fluorescent

probes are primarily used to identify and enumerate whole fixed cells from the

environmental sample. These probes can alSO be used to perform a colony

blot of the rDNA clones and to hybridize to the extracted nucleic acids for

quantification ofthe amount of the signaL

(Amann, Ludwig et al. 1995)

• 47 •

:~~: :;:: ~:~:::~ ~~.;::: ~:~ ~ ~ ~:::: ~~::: i: ~~:: ~ ~ ~~:: ~:) ~ ~ ~: ~~ ~~ ~~ :~~~~~~m~~~;~i ~~~~. Environmental Sampie ...

Extracted Nucfeic Acids ~ DNA ~ rRNA

••••••• :~tt. Nucleic Acid Probe 1'1@~ ~l....(])_:~~_'~~;' ~ __r_D_N_A_C_lon_e_s• __

~ . rONA Sequences & ..•./~ rDNA Database

<",====p=r=O=b=i=n=g==::c::J:!! Ib ==s=e=Q=u=e=n=C=in=g===:J9>

• iv. Nonna Flora ofthe Human Body • In every healthy human there exists a "normal microbiota" of which bacteria are the major component. Usually the relationship between human and microbes is

a mutualistic (both partners are benefited) with sorne being commensalistic (one

partner is benefited and the other is neither harmed or benefited). If the host

becomes immunocompromised then sorne of the microbes which comprise the

normal microbiota become opportunistic pathogens and infect the host. Several

body sites are colonized by microbes. However, blood is considered sterile unless

the person has a bacteremia or septicemia (McKane and Kandel 1996).

v. Blood Culture

Diagnosis of sepsis (symptoms associated with microbial infection of tissue

in a blood culture) is by blood culture (Ryan 1994). Blood is drawn by aseptic

venipuncture and inoculated into enriched broth or agar plates. One broth tube

which is specifie for anaerobic culture is usually inoculated (Willis 1991). If

growth is detected the organismes) is isolated, identified and tested for

antimicrobial susceptibility. To reduce the risk of contamination the skin over the

vein must be disinfected. Counts can be greatly reduced if a combination of 70%

alcohol and an iodine-based antiseptic is used. Poor phlebotomy can result in a

contaminated sample. In adult patients, samples of at least 10 ml should be

collected because the numbers of organisms present in the sample could be

extremely low (less than 1 organism/ml). With an adequate volume of blood,

collection of two or three blood cultures is not necessary (Ray and Ryan 1994).

Five to ten milliliters of blood is the appropriate inoculum for a 75-ml culture

volume (Willis 1991). Intravascular infections such as infective endocarditis \vill • 48 result in a positi-ve blood culture in 95% of the cases. Blood cultures from • bacteremic patieIL1s without endocarditis yielded positive results in 80-90% of cases on the firs.t culture, 90-95% with two blood cultures and 99% with a

minimum ofone o·fthree cultures (Ryan 1994).

Detection of organisms in the blood is variable. Transient bacterernia is

usually not detec"ted because the organisms are usually eliminated before any

indication of seps:is. A continuous bacteremia, such as infective endocarditis, is

readily detected by incubation of blood in an enriched broth. However, care must

be taken to ensure detection of a broad range of organisms in the least amount of

time. Bacteria sutCh as LeptospÏra, require special growth media and will not be

isolated using rou-tine methods. Contamination occurs in 2-4% of venipuctures,

even after disinfection. Isolation of Streptococcus epidermidis, corynebacteria

(diphtberoids), and propionibacteria should be dismissed as contaminants unless

the quantity is greater than 5 organisms/ml which would suggest infective

endocarditis or catheter bacteremia (Ryan 1994).

VIII. L-Forms

With the ex:ception of mycoplasmas, the vast majority of bacteria have cell

\valls (McKane and Kandel 1996). Since members of this genus are devoid of cell

walls they are pLeomorphic (Holt, Krieg et al. 1994). Unlike mycoplasma,

organisms which noOrmal1y possess a cell wall can become wall-deficient if they are

exposed to chemic:al agents such as penicillin and lysozyme or by a spontaneous

mutation in the DNA (McKane and KandeL 1996); (Frobisher, Hinsdill et al. 1974).

These organism are referred to as L-forms, "L" for the Lister Institute in London

where they were tirst discovered (McKane and Kandel 1996). Sorne tbeorize that • 49 they are normally produced during the vegetative life cycle of bacteria and are not • seen routinely because the growth media do not allow for their propagation (Swatek 1967). These ceH wall-deficient forms must he kept in an osmotically

favourable environment to prevent osmotic lysis. Usually, they will resynthesisize

their cells walls once the antibiotic is removed (McKane and Kandel 1996).

However, sorne are slow ta revert back ta their original form and regarded as stable

L-forms such as strains ofProteus and Salmonella which have failed ta revert back

after 15 years of successive transfer to media containing no penicillin (Frobisher,

Hinsdill et al. 1974).

IX. Mycoplasma

Mycoplasma IS used to denote any species within the class J.'vfollicutes.

Within this class are the following genera, Acholeplasma, Anaeroplasma,

Asterolsplasma, Mycoplasma, Spiroplasma and Ureaplasma. These procaryotes

are devoid of cell walls and bound only with a plasma membrane. Because of the

lack of a cell wall they are very sensitive ta lysis by osmotic shock, detergents and

alcohol. As weLl they also stain poody using common methods. AIL species are

pleomorphic, capable of shape change, form colonies which have a "fried egg"

appearance, and are filterable through a 450-nm pore diameter filter. AIL

Mollicutes are parasites, commensals or saprophytes with some being pathogenic

towards humans, plants and insects (Freundt and Razin 1984); (HoIt, Krieg et al.

1994).

• 50 • x. Procaryotes or Eucaryotes It is usually easy ta distinguish bacteria from eucaryotic microorganisms.

However, there are cases where the differentiation can be difficult. The most

reliable method ta distinguish is the absence of a nuclear membrane in procaryotes

which involves the thin sectioning of cells and examination under electron

microscopy. Since bacteria lack a nucleus they are called procaryotes meaning

"before nucleus" in the Greek and the higher microorganisms are called eucaryotes

meaning "good" or "true nucleus" in the Greek (HaIt, KIieg et al. 1994); (Perry and

Staley 1997).

According to Bergey's Manual of Determinative Bacteriology, bacteria can

be described as follows: single cells or simple association of similar cells (0.2-10.0

J.Lm in smallest dimension) forming a group defined by cellular not organismal

properties. A nuclear membrane never separates the cytoplasm from the

nucleoplasm. Cell division is not accompanied by cyclical changes in the texture

or staining properties of either nucleoplasm or cytoplasm; a microtubular (spindle)

system is not formed. The plasma membrane (cytoplasmic membrane) is

frequently complex in topology and forms vesicular, lamellar, or tubular intrusions

into the cytoplasm; vacuoles and replicating cytoplasmic organelles independent of

the plasma membrane system are relatively rare and are enclosed by nonunit

membranes. Ribosomes are dispersed in the cytoplasm and are of the 70S type,

with the exception of the archaeobacteria which have higher S values. An

endoplasmic reticulum studded with ribosomes is not found. Cytoplasmic

streaming or pseudopodial movements are not found due to the relative immobility

of the cytoplasm. Cells are enclosed by a rigid cell wall with notable exceptions • 51 • (HoIt, Krieg et al. 1994). XI. Outline of the Thesis

In 1995 l began the study of OAS which are species within the genus

Treponema and are important causative agents of periodontitis. Although üAS are

important pathogens in dental health, there was litde literature published about

OAS because it was difficuIt to obtain in vitro growth of culturable spirochetes due

ta their cornplex nutrient requirements. This thesis examines sorne aspects of the

physiology of OAS. As weIl, a novel symbiotic bacterium found in the blood of

healthy humans was studied as an extension of my work with OAS.

As mentioned above our laboratory has been instrumental in rendering

routine and reliable gro\vth of üAS in vitro. Choi et al. (1994) deterrnined that

approximately 20 new species of Treponema were present in a patient with severe

destructive periodontitis. Since only a relatively few number of oral spirochetes

are cultivable much work needs ta be done in this area. Qiu et al. (1994)

developed a method for quantifying OAS in pure culture by a viable count. NOS

medium with the addition of low temperature-gelling agarose was used as the

inoculation medium. Chapter 2 describes an extension of the work done by Qiu et

al. in which the search for an inexpensive solid medium \vhich enhances colony­

forming units of oral spirochetes was undertaken.

Clinical isolates of spirochetes from the periodontal pocket need ta be

readily identified in order ta determine their occurrence, distribution and

pathogenicity. There are a number of methods for this purpose. Sorne of these

methods include DNA-DNA hybridization, 16S rRNA gene sequence alignments (Choi, • 52 Paster et al. 1994); (Paster, Dewhirst et al. 1996), DNA probes (DiRienzo, CorneU et al. • 1991) and the use of monoclonal antibodies (Barron, Riviere et al. 1991); (Fukurnoto, Kato et al. 1989). Chapter 3 contains RFLP analysis of several species ofüAS in order

for rapid analysis ofnovel spirochete isolates.

Another aspect of the physiological characterization of oral spirochetes

which is discussed in Chapter 4 was the examination of morphologically variant

forms of T. denticola. The oral spirochete T. denticola typically is a helically

shaped, motile bacterial cel!. However, morphological variations such as spherical­

shaped cells of T. denticola are occasionally observed (Wolf, Lange et al. 1993);

(Wolf and J. 1994). Thus these variants have been termed "spherical bodies."

However, little is known about the environmental factors which promote their

formation and thus this aspect was examined.

It has been reported by J. Miklossy (1993) that spirochetes were found in

blood, cerebral cortex and cerebral spinal fluid in autopsied Alzheimer's Disease

(AD) patients and were not found in autopsied patients with other neuropsychiatrie

(non-AD) diseases (Miklossy 1993); (Miklossy, Kasas et al. 1994). It was

suggested by her that the presence of spirochetes could be one of the causative

factors in AD. The etiological agent of AD is currently unknown. We

hypothesized that the spirochetes seen by Miklossy were the result of a transient

bacteremia, perhaps with its source being the oral cavity. In this study, described

in Chapter 5, we attempted to duplicate the finding of spirochetes within b100d and

cerebal cortex of AD patients.

During the examination of blood from both AD patients and healthy subjects

by darkfield microscopy, we observed pleomorphic microorganisms. This is

contrary to medical dogma which states that the blood of a healthy human is a • 53 sterile environment (Ryan 1994). Recent molecular-phylogenetic advances with • the 168 rRNA genes have allowed analysis on microorganisms that are viable but otherwise non-cultivable in conventional microbiological media. This fact

provides support to the argument that there is a great diversity of microorganisms

in nature that are viable but not as yet cultivable by CUITent methods (Amann,

Ludwig et al. 1995); (Pace 1997). Chapter 6 provides evidence for the existence of

the bacteria in blood of healthy humans.

• 54 • Guidelines Regarding Doctoral Theses Containing Quotations From Published or Submitted Manuscripts.

Ifthe thesis eonsists ofa collection ofpapers, il should eonform to the following

requirements

Candidates have the option ofineluding, as part ofthe thesis, the text ofone

or more papers submitted or to be submitted for publication, or the elearly­

duplieated text (not the reprints) of one or more published papers. These texts

must eonform to the Thesis Preparation Guidelines with respect to font size, Une

spaeing and margin sizes and must be bound together as an integral part of the

thesis. (Reprints ofpublished papers can be ineluded in the appendices at the end

ofthe thesis.)

The thesis must be more than a collection ofmanuseripts. Ail eomponents

must be integrated into a eohesive unit with a logieal progression from one ehapter

to the next. In order to ensure that the thesis has continuity, connecting texts tllat

provide logical bridges between tIre different papers are mandatory.

The thesis must conform to al! other requirements of the "Guidelines for

Thesis Preparation II in addition to the manuscripts. The thesis must inelude the

following: a table ofcontents; an abstract in English and French; an introduction

whieh elearly states the rational and objectives ofthe researeh, a comprehensive • 55 review of the literature (in addition to that covered in the introduction to each • paper); afinal conclusion and summary; and, rather than individual reference lists after each chapter or paper, one comprehensive hibliography or reftrence list, at

the end ofthe thesis, after the final conclusion and sllmmary.

As manuscripts for publication are frequently very concise documents,

where appropriate additional material must he provided (e.g., in appendices) in

sufficient detail to al!ow clear and precise judgement to be made ofthe importance

and originality ofthe research reported in the thesis.

In general, when co-authored papers are included in a thesis the candidate

must have made a substantial contribution to al! paper included in the (hesis. ln

addition, tlle candidate is required to tnake explicit statement ill tlle tlzesis as to

who contributed to suc" work and to w/lat extent. This statement should appear

in a single section entitled "Contributions ofAuthors" as a preface to the thesis.

The supervisor must allest to the accuracy of this statement at (he doctoral oral

defence. Since the task ofthe examiners is made more difficult in these cases, ft is

in the candidate's best interest to clearly specify the responsibilities of al! tlze

authors ofthe co-authoredpapers.

When previously published copyright material is presented in a thesis, the

candidate must obtain, if necessary, signed waivers from the co-authors and • 56 publisher and submit these to the Thesis Office with the final deposition. • Irrespective of the internai and external examiners reports, if the oral defence committee feels that the thesis has major omissions with regard to the above

guidelines, the candidate may be required to resubmit an amended version ofthe

thesis.

In no case can a co-author ofany component ofsuch a thesis serve as an external

examinerfor that thesis.

** * In accordance with the above guidelines, l hereby state that:

Chapter 2 of this thesis includes the text of a manuscript published in Oral

Microbiology and Immunology: Chan~ E.C.S., A. De Ciccio, R. McLaughlin~ A.

Klitorinos, and R. Siboo. An inexpensive soLid medium for obtaining colony­

forming units or oral spirochetes. Oral Microbiol Immunol. 1998: 12:372-376. Dr.

Chan supervised aIl experiments and wrote the manuscript with the aid of A. De

Ciccio , R. Siboo and myself. A. De Ciccio and myself performed the experiments

involving varying amounts of Noble agar and Bacto agar mixed with varying

amounts of gelatin (Table 1) and aIl work invoived in Tables 2 and 3 and Fig 1. A.

De Ciccio and A. Klitorinos did ail work in Table 4 and Fig 2. l was responsible

for Fig 3. • 57 Chapter 3 of this thesis contains the test of the following manscript:

McLaughlin R., Lau, P.C.K. and E.C.8. Chan. The use of restriction fragment

• length polymorphism as a method of ribo-typing oral spirochetes. Dent. Res. J.

(submitted) aIl experiments were conducted by me. P.C.K. Lau sequenced the 168

ribosomal genes.

Chapter 4 of this thesis included: De Ciccio A., R. McLaughlin, E.C.S.

Chan. Factors affecting the formation of spherical bodies in the spirochete

Treponema denticola. Oral Microbiol. Immunol. (Submitted). Angela De Ciccio

performed experiments dealing with the omission of components of NOS medium

(brain heart infusion, yeast extract, rabbit serum, volatile fatty acids, or thiamine

pyrophosphate). l performed aIl other experiments, and wrote the manuscript under

the supervision of Dr. E.C.S. Chan.

Chapter 5 of this thesis is comprised of the manuscript McLaughlin R., M.

Chen, N.W.K. Ng Ying Kin, N.P. Nair and E.C.S. Chan. Alzheimer's disease is not a

spirochetosis. NeuroReport (submitted). M. Chen supplied autopsied AD brain

samples, N.W.K. Ng Ying Kin provided the blood samples from healthy volunteers

and AD patients and N.P. Nair screened aIl patients used in this study. l performed

aIl experiments and wrote the manuscript with the aid of E.C.S. Chan and N.W.K.

Ng Ying Kin.

Chapter 6 of this thesis is comprised of the manuscript McLaughlin R.,

P.C.K. Lau, H. Vali, N.W.K. Ng Ying Kin, R. Palfree, M. Sirois, and E.C.S. Chan.

NaturaIly-occurring viable pleomorphic bacteria in blood of healthy humans. Proc.

Nat!. Acad. Sci. USA. (submitted). R. Palfree aided me in cloning the 16S ribosomal

genes, P.C.K Lau sequenced the 168 ribosomal genes and gyrB genes, H. Vali

aided in the electron micrographs (carbon replica, thin sectioning), N.M.K.N.Y. • 58 Kin provided the blood samples and M. Sirois repeated in his laboratory the • fluorescence in situ hybridization and the amplification, cloning and sequencing of 16S ribosomal genes experiments. I wrote the manuscript with the aid of E.C.S.

Chan.

• 59 Chapter2 • An inexpensive solid medium for obtaining colony-forming uoits of oral spirochetes

E.C.S. Chan, A. De Ciccio, R. McLaughlin, A. Klitorinos, R. Siboo

Faculty ofDentistry and Faculty ofMedicine, McGill University, Montreal, Quebec,

Canada

This manuscript was published in Oral Microbiology and Immunology

1997: 12: 372-376.

• 60 Abstract • A method for the enumeration of colony-forming units of oral anaerobic spirochetes in New Oral Spirochete agarose (NOS-A) medium has been described recently. However,

the high cost of agarose limits the extent to which large assays can be carried out.

Accordingly, a search for an inexpensive gelling agent that remains molten at 37°C and

gels at 25°C was undertaken. Varying amounts ofNoble agar or Bacto agar (0.5 to 1.5%,

w/v) were mixed with varying amounts of gelatin (0.5 to 1.0%, w/v) in NOS medium.

NOS medium containing 0.5% gelatin-0.5% Noble agar (NOS-GN) or 0.5% gelatïn-0.5°;fa

Bacto agar (NOS-GB) met the above criteria. NOS-GN and NOS-GB media yieided

higher colony-forming units with Treponema denticola than NOS-A medium in that

order. However, aIl three media, NOS-GN, NOS-GB and NOS-A, performed equally

weIl in the recovery of viable counts of T. vincentii. The NOS-GN medium was not

liquefied by subgingival bacteria or two gelatinase-producing species ofbacteria, Bacillus

subtilis and Staphylococcus aureus. Thus NOS-GN medium is the recommended

medium both in cost and performance for obtaining colony counts ofspirochetes.

• 61 We (Chan, Siboo et al. 1993); (Qiu, Klitorinos et al. 1994) recently described a

method for the enumeration of colony-forming units of cultivable species of oral

• spirochetes~ anaerobic bath from pure culture and from subgingival plaque. The success

of the method depended on the use of a low temperature (37°C) gelling agent, 0.7%

SeaPlaque agarose (A), in New Oral Spirochete (NOS) medium (Leschine and Canale­

Parola 1980). The NOS-A medium has been used successfully to compare the growth

rates of different species of cultivable oral anaerobic spirochetes, determine their

susceptibilities to antibiotics, characterize distinctive colonial morphologies, and

demonstrate the secretion ofhemolysins. The extent ta which these and other assays can

be carried out, however, is limited by the high cost of agarose. This report describes a

study undertaken for an inexpensive gelling agent, or combination of agents, that

facilitates solid NOS medium ta remain molten at 37°C and gel quickly at room

temperature.

Varying amounts of gelatin and either Noble or Bacto agar (Difco, Detroit, MI)

were added to NOS medium to provide varying proportions of gelling agents in the

Inedium as shown in Table 1. The mixtures were boiled, autoclaved, and 27 ml of each

mixture "vere dispensed separately into different 25-cm2 polystyrene culture flasks (ICN

Biochemicals, Mississauga, Ontario). The flasks were held for l hour in a 37°C water­

bath and the fluidity of the various mixtures at this temperature was tested by tilting the

flasks. The flasks with mixtures still in the fluid state were removed, held at room

temperature, and 0 bserved for gelation by inversion ofthe flasks.

Of aIl the gelatin-Bacto agar and gelatin-Noble agar mixtures tested, only four

remained molten at 37°C and solidified at room temperature (Table 1). These mixtures

• 62 Table 1. Varying proportions ofgelling agents tested for ability to remain molten at • 37°C and to become solid at room temperature.

% (w/v) agar

% (w/v) gelatin Bacto Noble Molten at 37°C Solid at room temperature

5.0 1.5 no no

4.0 1.5 no no

3.0 1.5 no no

3.0 2.0 no no 3.0 2.5 no no 2.0 3.0 no no 1.0 2.0 no no

1.0 1.0 no no 1.0 0.5 yes yes 0.5 0.5 yes yes 1.0 0.5 yes yes 1.0 0.4 yes semi-solid 1.0 0.3 yes semi-solid 0.5 0.5 yes yes 0.5 0.4 yes no 0.5 0.3 yes no

• 63 were 1% gelatin-O.5% Noble agàr, 0.5% gelatin-0.5% Noble agar, 1% gelatin-O.5% Bacto ·- agar, and 0.5% gelatin-O.5% Bacto agar. The data shows that the gel point ofNoble and Bacto agars was reduced from 50°C to less than 37°C in these mixtures. Ho\vever, the

1% gelatin-O.5% Bacto agar and 1% gelatin-0.5% Noble agar mixtures solidified at room

temperature in approximately 5 to 10 min, which was considered tao short a time for

manipulations involving seriaI dilutions. Therefore, only the 0.5% gelatin-0.5% Noble

agar and 0.5% gelatin-O.5% Bacto agar mixtures were fiuther tested in NOS medium ta

determine whether or not they could support the growth of stock cultures of T. denticola

ATCC 35405 and T. vincentii ATCC 35580.

The recovery of CFUs from a 5-day old fluid culture of Treponema denticola

ATCC 35405 and a two-week old culture of T. vincentii were compared in NOS-A

medium, NOS medium containing 0.5% gelatin-0.5% Noble agar (NOS-GN), and NOS

medium containing 0.5% gelatin-0.5% Bacto agar (NOS-GB). (AlI percentages were

w/v.) Three ml of each culture were inoculated into 27 ml of each type of medium in

separate flasks. The cells in these initial flasks were then serially diluted 10-foid in flasks

containing the same medium as the initial flasks. The media were allowed to gel at room

temperature and 5 ml molten NOS-0.7% Noble agar were used as an overlay onto the

medium of each flask to keep out any oxygene The flasks were then incubated in a Coy

anaerobic chamber (Coy Laboratory Products, Ann Arbor, MI) at 37°C and examined

after two weeks for T. denticola and after four weeks for T. vincentii.

The viable counts ofthe same-size inoculum in each ofthe three media are shown

in Tables 2 and 3 for T. denticola and T. vincentii, respectively. As may be seen, the

NOS-GN medium gave the highest counts, followed by NOS-GB medium, and fmally

• 64 Table 2. Colony-forming unit recovery of T. denticola ATCC 35405 in NOS-A, • NOS-GB and NOS-GN media.

T. denticola dilution NOS-A NOS-GB NOS-GN

10-4 TNTC' TNTC TNTC 10-5 TNTC TNTC TNTC

10--6 TNTC TNTC TNTC

10-7 922 210 TNTC

10-8 12 25 52

10-9 2 5 10

1 TNTC means tao numerous ta counL

2 AlI colony-forming unit nurnbers represent the mean oftwo flasks.

• 65 Table 3. Colony-forming unit recovery of T. viJlcentii ATCC 35580 in NOS-A, NOS­ • GB and NOS-GN media.

T. vincentii dilution NOS-A NOS-GB NOS-GN

10-4 TNTCl TNTC TNTC

10-5 TNTC TNTC TNTC

10-6 TNTC TNTC TNTC

10-7 302 25 32

8 10- 6 5 -''" 10-9 0 0 0

1 TNTC means too numerous to counl.

2 AIl colony-forming unit numbers represent the mean oftwo flasks.

• 66 Figure 1. Recovery of colony-forming units of Treponema denticola in NOS-A, NOS­ • GB and NOS-GN media. With the same-sized inocula, more colony-forming units were recovered in NOS-GN medium than in NOS-GB and NOS-A media as seen from right ta

left.

• 67 •

• by NOS-A medium for T. denticola. These resuLts are illustrated in the CFUs obtained at • the sarne dilution in the culture flasks in Fig. 1. Table 3 shows that all three media~ NOS­ GN, NOS-GB and NOS-A, gave recovery ofapproximately equal numbers ofCFUs with

T. vincentii.

Viable courrts of oral anaerobic spirochetes from periodontal pockets were aIso

made. Subgingival plaque samples were obtained with two sterile paper points from each

periodontal pocket with 6-7 mm probing depth. These samples were transported and

processed as described previously (Qiu~ Klitorinos et al. 1994). Plaque samples were

serially diluted 10-fold in fluid NOS medium. One ml of each dilution was inoculated

into flasks, each of which contained 29 ml NOS-A or NOS-GN medium, with the

incorporation of2 I-lg/ml rifampin/ml or 1 I-lg/ml rifampin with 100 J.lglml phosphomycin

(both from Sigma Chemical Co., St. Louis~ MO).

The recovery ofspirochete CFUs from subgingival plaque of Il patients is shown

in Table 4. Note that antibiotics were used to select for growth of oral anaerobic

spirochetes and to inhibit other (non-spirochete) bacteria. NOS-GN medium (with

antibiotics) generally yielded higher viable courrts than the equivalent NOS-A medium.

AIso, the combination of rifarnpin and phosphomycin was more selective for oral

anaerobic spirochetes than rifampin alone; that is~ isolated CFUs of oral anaerobic

spirochetes were more easily obtained in the presence of the two antibiotics. These

results are illustrated in Fig. 2.

In order to show that NOS-GN medium would remain a solid (gel) even in the

presence of gelatinase-producing microorganisms~!Wo species ofbacteria that produce

• 68 Table 4. Viable counts oforal anaerobic spirochetes from subgingival plaque • samples inoculated into NOS-A and NOS-GN media1. NOS-A + 1 NOS-GN+ 1

NOS-A + 2 Jlg/ml rifampin NOS-GN + 2 Jlg/ml rifampin

Sample number J.lg/ml rifarnpin + 100 Jlg/ml J.lg/ml rifampin + 100 Jlg/ml

phosphomycin phosphomycin

1 1.1xI04 1.3xI04 1.9xl04 2.7xl04

2 6.5xI04 8.0xlO4 1.8xI04 1.4xlO4

~ 4 4 4 4 :J 1.1 xI0 1.0xI0 1.3xI0 1.7xI0

4 5.0xI03 6.0xI03 2.1x104 2.0x104

5 2.5xI03 0 4.0x104 2.0x104

6 2.IxI05 1.8 xiOs 6.5xIOs 1.6x10s

7 1.6x104 2.7xI04 2.3x10s 3.Ix105

8 8.0x104 ND2 2.5x105 ND

9 2.0xI04 ND 7.0xI05 ND

10 2.0x104 ND 2.lxI05 ND

Il 3.0x104 ND 5.0 x104 ND

l Counts (colony-forming unit/ml) represent averages obtained from two flasks.

2 ND means not determined.

• 69 Figure 2. Recovery of spirochete colony-fonning units from subgingival plaque • samples. Left: NOS-GN medium containing 2 ~g/ml rifampin; right: NOS-GN medium containing l f.lg/ml rifampin and 100 f.lg/ml phosphomycin. Two antibiotics were found

to be more selective for spirochetes than one antibiotic alone. As shown in the right

flask, discrete colonies ofspirochetes were obtained in the absence ofmost ather bacteria.

The left flask with rifampin alone was overgrown with other bacteria crowding out any

development ofspirochete colonies.

• 70 •

• Figure 3. Two gelatin-hydrolyzing species of bacteri~ Staphylococcus aureus (left) and • Bacillus subtilis (right), seeded and grown to confluency in NOS-GN medium. Flasks were in horizontal position when the photograph was taken: evidence that the medium

(in the bottom haIfofthe flasks) was still solid.

• 71 •

• copious amounts ofge1atinase were tested. Bacillus subtilis and Staphylococcus aureus, • were grown overnight in Luria-Bertani broth. The cultures were diluted to 10-3 and one ml of each culture was inoculated into NOS-GN medium and incubated

aerobically at 37°C for 5 days .

The growth of B. subtilis and S. aureus NOS-GN medium is shown in Fig. 3.

Their abundant growth did not liquefy the medium.

The higher viable counts oforal anaerobic spirochetes in NOS-GN medium than

in NOS-A medium, as found with T. denticola (Table 2) and with samples from

periodontal pockets (Table 4), may be due to the availability ofsmall gelatin peptides that

are produced when gelatin is prepared from collagen. Oral anaerobic spirochetes produce

a proline-specific endopeptidase (Makinen~ Makinen et al. 1980) which cleaves gelatin

peptides and the products serve as a nutrient source for oral anaerobic spirochetes.

However, large molecules ofgelatin in the medium are not hydrolysed by oral anaerobic

spirochetes or even by gelatin-hydrolysing species such as B. subtilis and S. aureus (Fig.

3). Thus NOS-GN medium remains solid even after the growth ofthese organisms.

ft appears that at liquefaction, large molecules of agar polysaccharides exist in

their primary structure. As the temperature drops to the solidifying point of the agar, the

polysaccharides begin to form double helices (Arnott, Fulmer et al. 1974); CRees 1972)

and trap large molecules of gelatin within the helices. The gelatin within the double

helices probably destabilizes the hydrogen bonding between D-galactose and 3,6­

anhydro-L-galactose and thus reduces the gel point of Noble agar. Moreover, the large

molecules of gelatin within the polysaccharide helices of the agar are protected from the

gelatinase produced by the oral anaerobic spirochetes (Grenier, Uitto et al. 1990); (Uitto,

Grenier et al. 1988).

Our results indicate that NOS-GN medium can serve as an inexpensive medium • 72 for the enumeration of CFUs of oral anaerobic spirochetes. Seing cost-effective, it • eliminates the economic constraints on the use of a solid medium for obtaining viable counts oforal anaerobic spirochetes.

Acknowledgment

This research was supported by a grant (MA-IOS09) from the Medical Research Council

ofCanada.

• 73 • Chapter3 Rapid identification oforal anaerobic spirochetes usiog restriction fragment leogth

polymorphism ofthe 168 ribosomal gene.

Chapter three contains a report on a molecuIar biology method for the rapid identification

and speciation of novel oral anaerobic spirochete isolates from the periodontal pocket.

The NOS-GN medium showed enhanced recovery of colony counts of oral spirochetes.

Perhaps novel species oftreponemes will now be able to be grown in pure culture using

the NOS-GN medium and the bacteria identified using the techniques outlined in this

chapter.

• 74 • Chapter 3 Rapid identification oforal anaerobic spirochetes using restriction fragment length

polymorphism ofthe 168 ribosomal gene.

2 R. McLaughlin', P.C.K. Lau , and E.C.S. Chan'*

'Faculty ofDentistry, 3775 University Street, McGill University, Montreal, Quebec H3A

2B4, Canada; 2Biotechnology Research Institute, National Research Council Canada,

6100 Royalmount Avenue, Montreal, Quebec H3 P 2R2, Canada.

This manuscript has been submitted for publication in the

Journal ofDental Research.

• 75 Abstract • Clinical isolates of spirochetes from the periodontal pocket need to be readily identified in order to determine their occurrence, distribution and species pathogenicity.

Conventional microbiological characterization methods for identification can be tedious

and equivocal. A molecular biological technique was used to obtain rapid reproducibility

and dependability in species identification. Restriction fragment length polymorphism

(RFLP) analysis was tested on reference strains of Treponema denticola, T. vincentii, T.

phagedenis, and T. socransldi as well as a number of clinical treponema isolates. The

procedure involved amplification of the 165 ribosomal gene via polymerase chain

reaction (PCR) using universal primers. The isolated amplicons \-vere digested with the

restriction enzyme HpaII, and when subjected to gel electrophoresis, banding patterns

specific to each spirochete species allowed discrimination between the different

spirochete species. RFLP was able to confirm previously identified and genetically

different 168 ribosomal genes of T. denticola strains a and d reinforcing PCR-RFLP as a

rapid and dependable method for differentiation of cultivable oral spirochetes. The 165

rRNA genes of T. denticola strains a and d were cloned and sequenced. An identity of

99% was shown between the two strains.

• 76 Introduction • Oral anaerobic spirochetes (OAS) have been implicated in both the initiation and the progression of periodontal disease (Loesche 1988). The treponemes proliferate ta

high numbers at diseased sites and secrete a number ofvirulence factors (Chan, Siboo et

al. 1993); (Arakawa and Kuramitu 1994); (Chu, Ebersole et al. 1997). The most

frequently isolated spirochete is Treponema denticola although many other üAS are also

present at the diseased site (Chan, Klitorinos et al. 1996); (Choi, Paster et al. 1994).

Conventional methods for the identification of microbes isolated from periodontal

pockets include standard microbiological culture, light and electron microscopy,

and chemical analyses of fermentation products. But these methods are tedious and

equivocal in providing definitive identification of the spirochetes. More

contemporary approaches employ molecular techniques including whole

chromosomal DNA probes, cloned DNA probes and DNA-DNA hybridization

methods. Restriction fragment length polymorphism (RFLP), used in conjunction

with polymerase chain reaction (PCR), has been reported to be an excellent method

for the rapid identification of novel cultivable bacterial isolates, especially those

which are not easily differentiated (Sato, Matsuyama et al. 1998); (Sato, Sato et al.

1998). PCR is a highly sensitive method which offers a number of potential

amplification sites for RFLP analysis. The 16S rRNA genes are most often used

because they are present in every bacterium and these genes are highly conserved

(Ashimoto, Chen et al. 1996). The 16S rRNA genes contain signature sequences

unique to each bacterium, thus allowing it to be distinguishable among other

bacteria (Amann, Ludwig et al. 1995).

In this study the 16S rRNA genes of reference strains of Treponema denticola, T

vincentii, T phagedenis, and T. socranskii as weIl as a number of clinical isolates in • 77 our laboratory collection (A38, UI, US, U8a, U8b, U9c and U14) were PCR­ • amplified and subjected to RFLP analysis. In addition, the 16S rRNA genes from T. denticola ATCC 35405 (serotype a) and T. denticola ATCC 35404 (serotype d) (Cheng,

Siboo et al. 1985) were sequenced for comparison.

• 78 Materials and methods • Bacterial Strains The reference strains used in this study were T denticola ATCC 35405 (serotype

a)~ T. denticola ATCC 35404 (serotype d), T vincentii ATCC 35580, T. socranskii

subspecies socranskii ATCC 35536 and T. phagedenis biovar Reiter. AIl reference

strains were obtained from the American Type Culture Collection~ Rockville, MD.

Strains A38, Ul, U5, U8a, U8b, U9c and Ul4 were clinical isolates maintained in our

laboratory. Ali bacteria were grown in New Oral Spirochete (NOS) medium. (Leschine

and Canale-Parola 1980) modified by use ofbrain heart infusion instead ofheart infusion.

Genomic DNA Isolation and PCR Amplification

Genomic DNA was isolated using the Genomic DNA Suffer Set (Qiagen Ine.,

Chatsworth, CA) according to the manufacturer's directions. Amplication of the 16S

rRNA gene was done using PCR. The universal primer sequences used were

5'AGAGTTGATCCTGGCTCAG3' (PA) and 5'AAGGAGGTGATCCAGCCGCA3'

(pH·) which correspond to nucleotides 8-28 and 1542-1522 in Escherichia coli 16S rRNA

(Edwards, Rogall et al. 1989). The amplification conditions were as follows: denature,

94°C/l min; anneal, 45°C/1 min; extend 72°C/2 min; 30 cycles performed. Vent DNA

polymerase (New England Siolabs, Mississauga, ON) was used for the RFLP study.

Restriction Fragment Length Polymorphisms

The PCR-amplified 168 RNA gene was analyzed using a 1% agarose gel (Ultra

Pure DNA Grade Agarose, BioRad Laboratories, Richmond, CA) in 100 ml of lx TAE

buffer (50x TAE; 242 g Tris base, 57.1 mL glacial acetic acid and 100ml 0.5 M EDTA • 79 per liter, pH 8.0). The agarose gel was fUll in a Wide Mini-Sub Cell (Bio-Rad • Laboratories) at 50 mA (60 V) for 1.5 h. Gels were stained with 0.5 ~g/ml ethidium bromide for 30 min. Nucleic acids in the gels were visualized and photographed under

ultraviolet light. DNA bands 1.5 kb in size were removed from the agarose and the DNA

purified using the Geneclean II Kit (Bio 101, Inc., La Jolla, CA). The purified DNA was

digested with the restriction endonuclease Hpall (New England Biolabs) for 1_5 h at

37°C. The DNA fragments were resolved as above except with an agarose concentration

of2%. The 100 bp ladder was used as the DNA molecular weight standard (Gibco BRL,

Burlington ON).

DNACloning

The 16S rRNA gene of T. denticola ATCC 35405 and T. denticola ATCC 35404

were PCR-amplified using the universal primers pA and pH·. The amplification

conditions were as follows: denature, 94°CIl min; anneal, 37°C/1 min; extend 72°C/2

min; 30 cycles performed. Taq polymerase (New England Biolabs, Mississauga, ON)

was used due to the 5' adenine overhang. Amplicons were resolved using standard gel

electrophoresis. The DNA was purified using the Geneclean II Kit (Bio 101, Ine.) and

then cloned using the TOPO™ TA Cloning Kit® (Invitrogen, Carlsbad, CA) according to

the manufacturer's instructions. Nucleotide sequence analysis was performed using the

ABI automated DNA sequencer (Mode1373A) and the ABI Prism Cycle Sequencing kits

with Ampl. Taq DNA polymerase, FS (perkin Elmer Corp.). Both top and bottom

strands were sequenced. The 1518-bp 16S rDNA sequence of T. denticola ATCC 35405

(serotype a) and the 1450-bp 168 rDNA sequence of T. denticola ATCC 35404 (serotype

d) has been deposited in GenBank and assigned accession numbers AF139203 and • 80 • AF139204~ respectively.

• 8t ResuUs and Discussion • A clear difference in the Hpall generated RFLP pattern can be seen between the different reference Treponema spp. as shown in Fig 1 (lanes 2-6). Surprisingly, a

different banding pattern can be seen between T. denticola ATTC 35405 (serotype a)

(lane 4) and T. denticola ATCC 35404 (serotype d) (lane 6). The three dissimilar bands

seen in lanes 4 and 10 which are approximately 700, 500 and 400 bp were the results ofa

partial digestion and/or the digestion products of other 16S ribosomal genes located on

the chromosome of T. denticola ATCC 35405 (for exarnple, T. denticola ATCe 33520

has two copies of each ofthe rRNA genes (MacDougall and Saint Girons 1995)). Fig 2

shows the Hpall restriction sites and the possible partial digestion products which could

have resLÙted. The banding patterns visualized in Fig lIanes 4 and 10 are in agreement

with the theoretical position of Hpall sites found in the T. dentïcola ATCC 35405 16S

rRNA sequence (Fig. 2). As shown in this study, aIl of the clinical isolates were strains

of T. denticola. A38, U1, U5, U8b, li9c and U14 were identified as serotype d and U8a

was identified as serotype a.

An alignment ofthe DNA sequence ofthe 16S rRNA genes of T. denticola ATCC

35405 and T. denticola ATCC 35404 showed 99% identity between the two strains. A

sequence aLignment of T. denticola ATCC 33520 (GenBank accession number M71236)

with T. denticola ATCC 35405 showed 97% identity; 28 of38 mismatches corresponded

to the ambiguous base (N) present in the ATCC 33520 sequence. An alignment of T.

denticola ATCC 33520 (GenBank accession number M71236) with T. denticola ATeC

35404 showed 97% identity; again 28 of 33 mismatches corresponded to an (N) in the

ATCC 33520 sequence. • 82 Figure 1. Restriction fragment length polymorphism analysis ofthe 16S rRNA genes • from species ofüAS. Amplified 165 rRNA genes from both reference strains and clinical isolates ofüAS were digested with HpaIL Lanes: 1: 100 bp ladder; 2:

Treponema vincentii ATCC 35580; 3: T. phagedenis biovar Reiter; 4: T. denticola

ATCC 35405; 5: T. socranskii ATCC 35536; 6: T denticola ATCC 35404; 7: A38; 8:

U1; 9: U5; 10: U8a; Il: U8b; 12: U9c; 13: U14; 14 100 bp ladder.

• 83 •

• Figure 2. Hpall restriction sites located in the 16S rRNA gene of Treponema • denticola ATCC 35405. Solid vertical bars indicate HpaII sites, solid horizontallines indicate the theoretical fragment sizes produced upon complete digestion with HpaII and

broken lines indicate possible partial digestion products produced upon incomplete

digestion with HpaII.

• 84 • -1 ~ r - =" ~ 1 1 ~ 0\ 1 1 ~ 1 ~ 10\ 1 oc--...J N 'C 1 ,..... I~ 1 ~ 1 ~ 1 1 ...... J -1- QC 1 1 ~ ~[ 0\ 00 ~ 1 ..J N 0\ 0\ 1 \C ~

~ N ...... J QC ,.....~ ~ ~ ~ \C • N There are several contemporary methods available for the identification of OAS

which include DNA-DNA hybridization (Olsen, Fiehn et al. 1995), 16S rRNA gene • sequence alignments (Choi, Paster et al. 1994); (paster, Dewhirst et al. 1996), DNA probes (DiRienzo, Comell et al. 1991) and the use of monoclonal antibodies (Barron,

Riviere et al. 1991); (Fukumoto, Kato et al. 1989). These methods can be used to

differentiate between different species of oral treponemes but they are more labor­

intensive and time-consuming. As demonstrated, RFLP ofthe 16S rDNA gene is both a

more rapid method (than those mentioned above) and a reliable method for identification

of OAS. It therefore can be used to identify novel OAS isolates from the periodontal

pocket.

Acknowledgements.

We thank Hélène Bergeron for her skillful technical assistance. This work has been

supported in part by the financial contribution ofMr. lan Henderson.

• 85 Chapter4

• Factors affecting the formation ofsphericaI bodies in the spirochete Treponema denticola

Chapter 4 represents observations on a different aspect of the physiology of Treponema

denticola. This chapter discusses factors which promote the formation of spherical

bodies in which T. denticola cells become interwoven and then compressed ioto a

spherical conformation "vith a common outer membrane sheath surrounding the outside

of the structure. The factors examined to determine their effect on the formation of

spherical bodies were oxygen~ growth temperature~ nutrient depletion~ and the addition of

metabolic end-products and the age ofthe culture.

• 86 Chapter 4 • Factors affecting the formation ofspherical bodies in the spirochete Treponema denticola

A. De Ciccio, R. McLaughlin, E.C.S. Chan

Faculty ofDentistry, McGill University, Montreal, Quebec, Canada.

This manuscript has been submitted for publication in the

journal Oral Microbiology and Irnmunology.

• 87 Abstract

• The oral spirochete Treponema denticola typically is a helically shaped, motile bacterial celI. However, morphological variations of T. denticola cells in the form of "spherical

bodies" are sometimes seen. Little is known about the environmental factors which cause

their formation. The effects of oxygen, growth temperature, nutrient depletion, and the

addition of metabolic end-products were tested to determine their role in the

morphogenesis of the spherical bodies. It was found that the age of the culture, the

omission of individual components Cyeast extract, rabbit serum, volatile fatty acids, or

thiamine pyrophosphate) from the medium, and the addition ofthe metabolic end product

lactic acid enhanced the formation ofthese bodies.

• 88 Spirochetes are typically helical-shaped bacteria consisting of an outer sheath, a • protoplasmic cylinder and periplasmic flagella inserted at polar locations (Holt 1978). The periplasmic flagella lie beneath the outer sheath and wind around the protoplasmic

cylinder (Blakemore and E. 1973). Atypical morphological variations of Treponema

denticola, termed "spherical bodies", often appear within a population of cells. These

spherical bodies were fust described by Hampp et al. in 1948 (Hampp, Scott et al. 1948).

Further reports ofspherical bodies in different spirochete species were made sporadically

over the years by various investigators. For instance, Bladen and Hampp (1964)

described a common outer sheath surrounding a spherical body (Bladen and Hampp

1964). Recently, Wolf et al. reconstructed a model for the morphogenetic process of

spherical body (also called multicellular body) formation using different electron

microscope techniques including negative-staining, thin-sectioning, carbon replication,

scanning and freeze-fracturing of specimens (Wolf, Lange et al. 1993); (Wolf and J.

1994). During this process, the treponemes lose their individual outer sheath as weIl as

their individual periplasmic flagella and become enclosed by a common outer sheath with

a unit or biological membrane profile (Wolf, Lange et al. 1993); (Wolf and J. 1994). To

our knowledge, none of these reports specified any specific environmental and/or

nutritional factors responsible for promoting the formation of spherical bodies. We now

report the effect of different factors, such as oxygen, growth temperature, nutrient

components ofNew Oral Spirochete (NOS) growth medium, and metabolic end-products,

on the formation ofspherical bodies.

Treponema denticola ATCC 35405 was used for physiological study. It was

grown in New Oral Spirochete (NOS) medium (Leschine and Canale-Parola 1980)

modified by use of brain heart infusion instead of heart infusion. Typical spherical

bodies of T denticola are shown in Fig. 1. The effect of oxygen and growth temperature • 89 on the formation of spherical bodies was tested by inoculating four glass screw-capped • test-tubes (in duplicate), each containing 10 ml NOS broth, with 250 ~l logarithmic growth phase culture of T. denticola. One culture was grown anaerobically at 35°C, and

the rest grown aerobically at varying temperatures, namely, 25°C, 35°C, and 45°C. A 5­

III aliquot from each tube was examined by darkfield microscopy, and the numbers of

free spirochetes and spherical bodies in four fields enumerated. Counts were repeated in

a similar manner on days 3, 7, and 15.

The effect of omission of fluid NOS basal medium components (brain heart

infusion, trypticase, yeast extract, sodium thioglycollate, asparagine, cysteine

hydrochloride or glucose) on spherical body formation was tested. Complete fluid NOS

medium was used as a controL Duplicate test-tubes each containing 5 ml oftest medium

were inoculated with a logarithmic phase culture. A third tube containing an equal

volume of medium but uninoculated was used as a blank for optical density (00)

measurements. 00620nm measurements were made on days 0, 3, 7, and 14. Similarly the

effect of omitting supplement components (sodium bicarbonate, rabbit serum, volatile

fatty acid mixture, or thiamine pyrophosphate) was determined. The ratio of spherical

bodies ta free spirochetes was determined from the averages of counts of the number of

spherical bodies per 100 free spirochetes in four fields as seen in the cultures on days 0

(day ofinoculation), 3, 7, and 14.

• 90 Figure 1. Morphology ofspherical bodies. • A. Photomicrograph ofspherical bodies as seen by darkfield microscopy. Magnification, XIOOO.

B. Transmission electron microscope image ofa negative stain specimen showing

spherical bodies. Scale bar indicates l Jlm.

• 91 •

i B : ~

•

.. ;-

• .".o.fI; • HespeH and Canale-Parola (Hespell and Canale-Parola 1971) reported on the end • products resulting from T. denticola metabolism. Sorne of these were tested for their effect on spherical body formation. Duplicate test-tubes each containing 5 ml fluid media

were inoculated with log-phase culture of T. denticola and a third was used as a blank for

O.D. measurements. Test-tubes containing either 26,500 f.unoUl acetic acid, 272 /-lmoUl

pyruvie acid, 2,720 /-lmol/l lactie acid, 2,108 I-lmol/l fOmUe acid, or 5,990 I-lmoUl acid

suecinic acid were similarly inoculated. Optical density measurements were made as

previously. The ratio of spherical bodies to free spirochetes was only measured on day

21.

The age of the culture (in a stale medium) affects the formation of spherical

bodies because a sharp drop is seen in the ratio of spherical bodies to free spirochetes

when the bacteria are inoeulated into fresh medium. However, the effects of oxygen and

temperature variation did not promote the formation ofspherical bodies (data not shown).

The deletion of certain components from NOS basal medium inereased the ratio

ofspherical bodies to that of free unicellular spirochetes as shown in Fig. 2 and Table 1.

The deletion of yeast extract resulted in an increased ratio. The omission of the

supplement components rabbit serum, volatile fatty acids, and thiamine pyrophosphate

also resulted in an increased ratio.

With the addition of the metabolic end products pyruvic acid, lactic acid, and

formic acid, only the addition of lactic acid gready affected the formation of spherical

bodies (Fig. 3 and Table 2). The addition of this organie acid resulted in the ratio of 70

spherical bodies/l00 free spirochetes. The effect on growth of the spirochete upon

addition of the metabolie end products is shown in Fig. 4. In general, the ratio of

• 92 Figure 2. Effects ofthe deletion ofthe NOS medium components brain heart infusion • (B.H.!.), trypticase (Try), yeast extract (Y.E.), glucose (Glu), cysteine Hel (Cyst), sodium thioglycollate (Na thio), asparagine (Asp), volatile fatty acids (V.F.A.), thiamine

pyrophosphate (T.P.P.), rabbit serum. (R.S.) and sodium bicarbonate (Na bicar) on

the formation ofspherical bodies.

• 93 • •

fi.) ~ 't ~ A. Control ~ 25 Ti------.1 = B. B.H.I. .=~ ~ 20 1 • C. Try ;a~ O. Y.E. ,.Q= 15 ,1------E. Glu, '; Y F. Cyst ••~ G. Na thio J 10 1 • ~ CIl H.Asp .... 5 5 "'*"11-+--1- 1. V.f.A. Y ~ ~ J. T.P.P. ~

o l' l ,- ,- 1 K. R.S. A Be DE FG HI J K L1L. Na bicar Component deleted from NOS medium Figure 3. Effects ofthe addition ofmetabolic end products on the formation ofspherical • bodies.

• 94 "'C • "'C -­ "a -- (J (J ._- (J « "'C --« "(J « (J -U - (J « (J -- « e .- (J -> .5 (J ... E ;:; ::J (J ;:; c: ... (1) ... CJ (J o 0 (J >.a ::J ca o u. « D.. en -1

1 1 1 1 1 1 1

i- ~ ...... ~

i- ~= 1- Q Q..= ~ i- =~ --~ U .c-= ...... ~ =~ ~

l- =

I 1 1 00000 000 t-- CD II) ~ CV) N ~ • salaq~o.l!ds/sa!poq 18J!.Iaqds :}ua~.Iad • Figure 4. Effects ofmetabolic end products on the growth of Treponema denticola.

• 95 • •

0.6 ---r--""'------• Table 1. Deletion ofspecifie components from NOS medium. Component Removed SB Free Spirochetes % ofSB Chi-Square p-value

Complete NOS 105 1550 6.8

Brain heart infusion 37.5 465 8.1 0.913 0.339

Trypticase 92.5 1782.5 5.2 3.19 0.074

Yeast extract 57.5 492.5 11.7 10.564 0.001 *

Glucose 115 1590 7.2 0.220 0.639

Cysteine HCl 77.5 1297.5 6.0 0.605 0.437

Sodium thioglycollate 120 2117.5 5.6 1.686 0.194

Asparagine 80 1595 5.0 3.902 0.048*

Volatile fatty acids 62.5 325 19.2 40.758 0.001*

Thiamine 155 1225 12.7 22.49 0.001 *

pyrophosphate

Rabbit serum 157.5 720 21.9 83.690 0.001 *

Sodium bicarbonate 75 1720 4.3 8.170 0.001 *

* statistical significance~ P ~ 0.05.

SB spherical bodies

• 96 • Table 2. Addition ofmetabolic end products to NOS medium. End Product SB Free Spirochetes % ofSB p-value*

no addition 23.5 112.2 22.8

Formic Acid 29.7 226 13.1 0.124

Acetic Acid 4.7 18.7 25 0.774

Pyruvic Acid 25.7 129.3 19.9 0.877

Succinic Acid 17 72 23.6 0.860

Lactic Acid 3 4.3 69.8 0.124

* Fisher exact two tailed

SB spherical bodies

• 97 spherical bodies to free spirochetes is inversely proportional to growth (0.0. readings). • In a culture that \vas growing weil, the proportion of spherical bodies to free spirochetes was low; but in a poody growing culture, the ratio was relatively high.

In this study, a number ofenvironmental factors has been demonstrated to induce

the formation of spherical bodies. These factors include age of culture, the omission of

yeast extract, rabbit serum, volatile fatty acids, or thiamine pYr0phosphate from complete

NOS medium, and the addition of lactic acid. It appears that environmental stress is

conducive to the formation ofspherical bodies. However, the omission ofasparagine and

sodium bicarbonate decreased the formation of such bodies. Thus it is reasonable to

suggest that spherical or multicellular bodies represent a means for the spirochetes to

survive environmental insults. As \vell, our laboratory has observed these structures from

samples taken directly from deep periodontal pockets. The reason for their presence

therein is hypothetical. Sïnce periodontitis is termed an episodic disease (Goodson

1992), perhaps the spherical bodies represent resting forms of the organisms and their

presence coincide with periods ofdisease quiescence. But this remains to be proven.

Acknowledgement

The assistance ofDr. E. Shields in the statistical analyses is gratefully acknowledged.

• 98 • Chapter5 AJzheimer's disease May not be a spirochetosis.

Chapter five represents what we originally believed was an extension of our work with

oral anaerobic spirochetes. J. Miklossy reported that spirochetes were found in the blood,

cerebral spinal fluid and cerebral cortex of AD patients. We hypothesized that the

spirochetes seen in the tissues ofthe autopsied AD subjects originated in the oral cavity.

In this study we attempted to duplicate the frndings which were reported by Miklossy.

• 99 • Chapter 5 A1zheimer's disease may Dot be a spirochetosis.

Richard McLaughlin, N.M.K. Ng Ying Kin', Moy Fong Chen,

N.P.V. Naïr!, and Eddie C.S. Chanca

Faculty ofMedicine, 3775 University Street, McGill University, Montreal, Quebec H3A

2B4, Canada; IDepartment ofPsychiatry, Douglas Hospital Research Centre, 6875 bouI.

LaSalle, Verdun, Quebec H4H 1R4, Canada; and Department ofPsychiatry, 1033 Pine

Avenue West, Montreal, Quebec H3A lAI McGill University Canada cUcorresponding author

This manuscript has been submitted for publication

in the journal NeuroReport.

• 100 Abstract • It has been reported previously that spirochetes could be one of the causes of Alzheimer's disease (AD). In this study, we have attempted to reproduce these fmdings

by examining fresh blood samples from twenty two patients diagnosed with early stage

(N=16) and late stage (N=6) AD. The patients were participants in a clinical drug trial.

Fresh necropsy brain cortical specimens from AD patients (N= 7) were also examined.

The presence of spirochetes was microscopically observed in the blood of only one late

stage AD patient. None of the brain tissues showed the presence of spirochetes. Our

results suggest that spirochetes are most probably not associated with AD.

• 101 Introduction • AIzheimer's disease (AD) is a chronic organie disease of the brain affeeting mainly the elderly (Katzman 1986). The diagnosis of the disease is made on clinical

grounds, since there is no definitive laboratory marker for the disease known to-date

(Diagnostic and Statistieal Manual ofMental Disorders (DSM-IV) 4th ed.). Although the

etiology of AD is still not known, the disease is characterized by very specific

neuropathological abnorrnalities, namely, deposits of neuritic plaques in the neuropil and

neurofibriUary tangles in the soma, as well as neuronal loss (Tomlinson, Blessed et al.

1970). Several hypotheses have been proposed regarding the origin of the

neuropathological changes (Hardy 1997). Recently, Judit Miklossy, 1993, hypothesized

that spirochetes could play a role in the pathogenesis of AD sinee late stages of two

spirochetal diseases, Lyme disease caused by Borrelia burgdorftri and neurosyphilis

caused by Treponema pallidum, result in cortical atrophy and dementia (Miklossy 1993).

To prove this hypothesis, that spirochetes were associated with AD, she randomly

seleeted 27 autopsy cases for study. Ofthese cases, 14 were diagnosed with AD and the

remainder with other neuropsychiatric diseases. In aU cases blood and cerebrospinaI. fluid

(CSf) were examined for spirochetes using darkfield microscopy. Cerebral cortex

samples were also examined for the presence ofthese organisms (Miklossy 1993).

In all 14 AD cases spirochetes were found in the blood, CSf and brain with an

estimate of 100-400 per cc, 50-200 per cc and 1000-2000 per cc, respectively. In the 13

cases with other neuropsychiatrie (non-AD), no spirochetes were found. To ensure that

what was being visualized under dark-field microseopy were spirochetes, 4 ofthe 14 AD

brain sarnples were selected for examination using scanning eleetron microscopy.

Mieroorganisms isolated from the cortex ofAD brains showed helieally shaped bacteria

with axial fibrils winding around the mieroorganism (Miklossy 1993). The haUmark ofa • 102 spirochete are axial fibrils (Miklossy, Kasas et al. 1994). The observations made using

electron microscopy are in agreement with previous observations made using darkfield

• microscopy, that the microorganisms seen were spirochetes. These extraordinary fmdings suggested that spirochetes are associated with AD (Miklossy 1993); (Miklossy,

Kasas et al. 1994).

A particular shortcoming of these findings, however, is the possibility of

contamination introduced during the period preceding autopsy. We therefore attempted

to reproduce the findings reported by Miklossy, using fresh blood specimens from living

subjects. Blood samples from healthy volunteers, early stage AD patients and late stage

AD patients were drawn and examined under dark-field and electron microscopy. Frozen

cerebral cortex samples as weU as biopsied cerebral cortex samples from AD patients

were also examined for the presence ofspirochetes.

• 103 Materials and Methods • Subjects: Blood samples were obtained form 16 early stage (age range 64-86,; M lOfF = 6), 6 Late stage AD patients (age range 72-85; M = 4/F = 2 and 6 age-mateched controLs

(age range 62-78; M = 4/F = 2). The patients were participating in a double-blind

controlled clinical drug trial, and therefore had to satisfy strict physical and mental health

criteria prior to enrollment. The age-matched contraIs were part of a group of healthy

subjects participating in a World Health Organization sponsored longitudinal study on

normal aging. Blood samples were col1ected from aU subjects for clinical work-up and

also for this present study at the time of their physicaL examinations. Subjects with

significant abnormal frndings in blood chemistry and hematology were excluded as

stipulated in the clinical drug trial protocol.

Blood work-up: Blood was coLlected aseptically from each subject uSlng a plain

Vacutainer glass tube without anticoagulant. The blood was allowed to clot at room

temperature and the coagulated material allowed to settle for about 2 h. A small sampLe

of the serum was then removed aseptically with a Pasteur pipette and a wet mount was

made for examination under the microscope using dark-field illumination. Negative­

stains of 10 early stage AD and 6 control serum samples were made and examined using

electron microscopy. The blood collection tube was then incubated at 30°C for seven

days and aliquot samples were reexamined under both the darkfield and electron

microscope.

To further the study, blood collected from the 6 late stage AD patients were also

examined under dark-field microscopy and electron microscopy. As weU, 7 cerebral

cortex samples were analyzed, five frozen samples (stored -80°C) of temporal cortices

• 104 from advanced cases and 2 samples [unfrozen] 0 btained from post mortem biopsy • material (Table 1). Frozen material was thawed and then sliced into small fragment. The unfrozen biopsies material was also sliced into fragments. A cortal slice was then placed

in a tube containing 3 ml of PBS and shaken for 30 min at room temperature. A 10 fil

aliquot of supernatant was inspected under dark-field microscopy. An aliquot of

supernatant from each ofthe tubes was examined under electron microscopy.

• 105 Table L Baseline characteristics ofpatients whose temporal cortices were • examined.

Subject Age Gender PMD

1* 72 F 24:00 h

2* 82 F 10:00 h

3* 70 M 28:00 h

4* 67 M 05:15 h

5* 71 M 10:00 h

6 l 75 M 12:00 h

7 l 80 M 10:00 h

* frozen temporal cortices unfrozen temporal cortices

PMD post mortem delay

• 106 Results • Spirochetes were detected in ooly one of the blood samples (from the cohort of late stage AD patients) following seven days' incubation. The spirochetal nature of one

ofthe cells was confirmed by its helical fonn as well as by the presence ofaxial fibrils as

shown in Fig. 1. Morphologically the bacterium appeared to be similar to that visualized

by Miklossy (Miklossy 1993). Spirochetes were not found in the blood of the healthy

control subjects, the early stage AD patients, the remaining 5 late stage AD patients and

the cerebral cortex samples.

• 107 Figure 1. Spirochete from the serum ofa patient with dementia.

• A. TEM image of a negative stain specimen ofa whole cell. Scale bar corresponds to 1 J-lm.

B. TEM image of a negative stain portion of cell showing periplasmic flagella

(arrow) around a protoplasmic cylinder ofa spirochete. Scale bar corresponds to

0.1 J.lm.

• 108 • ••

."'- . ~ ,,~:~

• Discussion • Except for one blood sample from a late stage AD patient, all the other samples examined by darkfield and electron microscopy observations were negative for the

presence ofspirochetes. These other samples inciuded blood from 15 early stage patients

and 5 from late stage patients. Neither did the slices of frozen and biopsied cerebral

cortex samples reveal any spirochetes after sunilar examination. The presence of

spirochetes in the one positive sample could have been an oral spirochete that entered the

bloodstream from periodontal lesions in the oral cavity. We conclude that AD may not

be caused by a spirochetosis since its presence was not detected in all AD cases

examined.

Acknowlegdements

We are grateful for technical support from the Clinical laboratory of the Douglas

Hospital, and to Dr. J. Thavundayil, Dr. C. Pavate, and Ms. J. Mallette, clinical members

associated with the WHO and Clinical trial studies at the Douglas Hospital. We thank

Dr. Y. Robitaille and Danielle CecYre for the temporal cortices form the Douglas

Hospital research centre. The technical assistance of Katherine Hewitt in electron

microscopy is also gratefully acknowledged. This work has been supported in part by the

financial contribution ofMr. ran Henderson.

• 109 Chapter 6 • Naturally-occurring pleomorphic microorganisms in human blood

According ta the medical literature, blood from healthy humans is sterile (Brooks, Butel

et al. 1995); (Ryan 1994). However, while examining blood from bath AD patients and

healthy age-matched contraIs (Chapter 5), we found bacteria in the blood ofall subjects.

Since this fmding is contrary ta established medical beliefs, further study was necessary.

This chapter characterizes the bacteria found in blood using bath traditional

microbiologicai and contemporary molecular biology techniques.

• llO Chapter6 • Naturally-occurring pleomorphic microorganisms in human blood

Richard McLaughlin, Peter C.K. Lau, Hojatollah Vali, N.M.K. Ng Ying Kin, Roger

Palfree, Marc Sirois and Eddie C.S. Chan

R. McLaughlin, H. Vali, R. Palfree and E.C.S. Chan. Faculties ofDentistry and

Medicine, 3775 University Street, McGill University, Montreal, Quebec H3A 2B4,

Canada. P.C.K. Lau. Biotechnology Research Institute, National Research Council of

Canada, 6100 Royalmount Avenue, Montreal, Quebec H4P 2R2, Canada. N.M.K. Ng

Ying Kin. Department ofPsychiatry, 6875 bou!. LaSalle, Douglas Hospital, Verdun,

Quebec H4H, lR4, Canada. M. Sirois. Departement de Chimie-Biologie, Universite du

Quebec a Trois Riveres, Quebec G9A 5H7, Canada.

This manuscript has been submitted for publication in the journal Proceedings of

the National Academy ofSciences ofthe United States ofAmerica.

• 111 Abstract: The bloodstream of a healthy human is considered a sterile environment. • Upon scanning blood samples from healthy individuals by darkfield microscopy, we observed pleomorphic microorganisms ranging in size of0.2 !-Lm diameter for the coccoid

forms and 0.1 J.1m X ca.1 - 5 JlID for the rod forms. Recent molecular-phylogenetic

advances with the 16S rRNA genes revealed that most microorganisms in an ecosystem

have not been cultivated in conventional microbiological media. Evidence is presented in

this report that bacteria residing as symbionts in the healthy human bloodstream

constitute one such group of microbes. For instance, their growth was inhibited by

polymyxin B and their 16S rRNA gene sequence showed 99.6% identity with

Stenotrophomonas maltophilia LMG958T.

• 112 Introduction • Conventional diagnostic medical microbiology requires the isolation ofpure cultures of cultivable microbes on standard media and subsequent testing of their

nutritional and physiological behaviour in order to estabLish the cause of an infection.

This pure-eulture approach has served the practical needs ofmedical microbiology over

the years so weIl that any digression from this protocol is generaLly suspect. Based on

this premise, textbooks present the bloodstream in healthy humans as a sterile

environment (Brooks, Butel et al. 1995); (Ryan 1994) since blood samples yielded no

visible mass of microbial growth when inoculated on rich organic agar medium.

However, when we examined carefully blood samples from apparently healthy human

subjects by darkfield microscopy, we observed microorganisms. In this report, we

present evidence for the presence and viability of such microbes, as weLl as data on their

cellular nature and phylogenetic position.

• 113 • Materials and Methods Blood

Blood was aseptically drawn into a Becton Dickinson Vacutainer from 25 volunteers. A

wet mount of the incubated serum from the clotted blood of each sample was examined

under darkfield rnicroscopy.

Electron microscopy

Bacterial cells in blood sarnples were separated from blood elements by the following

method. Al:10 dilution of blood in phosphate-buffered saline (PBS) was centrifuged in

a microfuge at 14,000.g for 5 sec. The supemate was removed and centrifuged as before

for 10 min. It was decanted and the pellet washed twice in PBS. The pellet containing a

high concentration of blood bacteria was resuspended in a final small volume of PBS.

Alternatively, blood diluted 1: Iain PBS was filtered through a 0.45-~m membrane filter.

The filtrate was centrifuged at 14,000.g for 10 min and the pellet washed twice with

PBS. This pellet also was resuspended in a small volume ofPBS for electron microscopy

investigation. Negative-staining was performed with 2% phosphotungstic acid. For

preparation of ultrathin-sectioning, the cells were fixed in 2.5% glutaraldehyde in O.lM

cacodylate buffer for 2 h. The cells were then centrifuged at 14,000.g for la min and

resuspended in O.lM cacodylate buffer. The cells were recentrifuged as before and the

pellet suspended in 4% (v/w) low-melting point Type IV agarose (Sigma-Aldrich,

üakville, ON). After solidification, 200 ~l of 1% osmium tetroxide in 0.15% (v/w)

KPeCN solution were added to the agarose pellet and let stand for 1 h at 4°C. The cells

were dehydrated using the following ethanol series: 30% alcohol (3 washes, 5 min each),

50% alcohol (1 \vash, 5 min), 70% alcohol Cl wash, 10 min), 90% alcohol Cl wash, 10 • 114 min), 95% alcohol (1 wash, 10 min) and 100% alcohol (2 washes, 15 min each). The • dehydrated cells were infiltrated with Epon using the following solutions: propylene oxide (2 washes, 10 min each), 1:1 Epon to propylene oxide (1 wash, 1 h), 2:1 Epon to

propylene oride Cl wash, 1 h), 3: 1 Epon to propylene oxide Cl wash, ovemight), and pure

Epon (l wash, 24 h). The pellet was placed in a mould, overlayed with Epon and

incubated at 56°C for 2 days. The pellet was then sectioned with a diamond knife. The

sections were stained with uranyl acetate and lead citrate and examined using the Joel

2000 FX transmission electron microscope (TEM). For the preparation of Platinum­

Carbon (Pt-C) replicas, cells were fixed aceording to the procedure used in ultrathin

sectioning. A thin layer of suspension containing the bacteria was placed on the surface

of a freshly cleaved mica plate. The specimen was dropped into liquid propane and

frozen at 77K. The frozen specimen was transferred to a Balzer High-Vacuum Freeze­

Etch Unit (Model 301), freeze dried in a vacuum of 1.3 x 10-4 Pa, shadowed with Pt-C at

an angle of 25 and coated with a carbon film. The replica was cleaned with 3% HF

solution, washed in deionized water and transferred onto a 300-mesh TEM grid with

formvar and carbon-supported film as a substrate.

Average microscopie field

The average microscopie field has a radius ofabout 100 Jlm and 51J.L ofa cell suspension

2 was spread under a coverslip of 484 mm • The microscopie field is defined as the area

containing cells divided by the area of one microscopie field. The microscopie field

would be 484,000,000/3.14 X 10,000 = 15,400; the microscopie factor would be 15,400

X 200 or 3,080,000 for 1 mL of blood. In the case of subject #1, there was 1 celI/50

fields or 0.02/ field. Multiplying 0.02 by the microscopie factor one obtains 61,600 (or

4 approx. 6 X 10 ), which is a very high nurnber ofsymbiotic bacteria per mL ofblood. • 115 • DNA extraction A O.S ml aliquot ofblood containing a bloom ofbacteria was mixed with 0.5 mL

lysis buffer (0.32 M sucrose, 10 mM Tris-HCI {pH 7.S}, 5 mM MgCl2 and 1% Trition X­

100). This mixture was centrifuged at 13,000.g for 20 sec; the supemate was removed,

and the pellet resuspended in 1 ml Lysis buffer. The resuspended pellet was again

centrifuged as before; the supemate was removed, and the pellet resuspended in 1 mL

Lysis buffer. The last procedure was repeated once more. The pellet was fmally resuspended in 0.5 ml PCR buffer w/nonionic detergents (50 mM KCl, la mM Tris-HCl

{pH 8.3}, 2.5 mM MgCL2, 0.1 mg/mL gelatin, 0.45% NP40 and 0.45 Tween 20). Three J.lL Proteinase K (10 mg/mL, boehringer Mannheim) were added and the mixture

incubated at S5°C for 1 h. The proteinase was then inactivated at 95°C for 10 min. The

solution was stored at -20°C.

PCR amplification and cloning

Three J.lL of the mixture was used for DNA amplification as described by (Edwards,

Rogall et al. 1989) using the forward primer pA (S'AGAGTTTGATCCTGGCTCAG3')

and the reverse primer pH- (S'AAGGAGGTGATCCAGCCGC3'). The amplication

conditions were as follows: denature, 94°C/1 min; anneal, 70°C/30 sec; extend, 72°C/90

sec; 30 cycles performed. Vent DNA polymerase (New England Biology, Mississauga,

ON) was used due to its proofreading ability.

Amplicons were resoLved using standard gel elecrophoresis. DNA was purified

using the Geneclean II Kit (Bio 101, Ine., La Jolla, CA) and the DNA cLoned iuto the

SmaI site of the vector pBlueSeript II. Nucleotide sequence analysis of two randomly

picked clones were performed using the ABI automated DNA sequencer (Model 373A) • 116 and the ABI Prism Cycle Sequencing kits with Ampl. Taq polymerase, fS (perkin Elmer • Corp.).

Sequencing

Sequence data were analyzed using the BLASTN program of the National Center for

Biotechnology Infomation (Bethesda, MD) (Altschul, above). The highest score

candidate sequences were retrieved accordingly and aligned with the NALIGN program

ofPC/Gene (Intelligenetics, Inc).

The 1537-bp 16S rDNA sequence ofS. maltophilia T5 has been deposited in GenBank

and assigned accession number Af098637.

Indirect immunot1uorescence

Cells were fixed as for thin-sectioning. A 10 ilL aliquot was placed on a glass slide and

aUowed to air-dry. An equal volume ofcontrol blood (1:15 dilution in PBS pH 7.5) was

spread on a separate glass slide and also allowed to air-dry. The air-dried smears were

fixed further for one min using IGrkpatrick flXative (60 mL isopropanol; 30 mL

cWoroform; 10 mL 37% formaldehyde). A 200 JlL (1 :40 dilution in PBS pH 7.5) aliquot

ofanti-actin antibody (Sigma, St Louis, MO) was placed over the fixed smear for 20 min

at room temperature. Excess antibody was removed by two 5-min rinses with PBS (pH

7.5 at 4°C). Excess buffer was removed and 100 JlL Cl :10 dilution in PBS pH 7.5) of

anti-rabbit IgG FITC conjugate (Sigma, St Louis, MO) was placed on the smear. The

reaction was allowed ta proceed as above. Excess antiserum-conjugate was removed.

Cells were then examined using fluorescence microscopy.

• 117 Fluorescence in situ hybridization • A high concentration ofblood bacteria was fixed by the addition of4% paraformaldehyde fixative in IX PBS for 3 h at 4°C. The hybridization was performing according to

Amann (Amann 1995).

Cell culture

Human chronic myelogenous leukemia cells (ATCC CCL 243 K-562), a human

erythroleukemia line, were grown in RPMI 1640 media supplemented with 10% fetal

bovine serum and 100 f.l.g/mL penicil1in G (all from Sigma). It was been continuously

transferred as a cellline since its establishment in 1975.

• 118 • Results and discussion We observed bacteria in the sera of all subjects. These bacteria have the morphology of

bacilli with knobbed poles as seen by Iight and electron microscopy. Figure 1 shows a

transmission electron microscope (TEM) micrograph of the organism observed in

platinumlcarbon replica. Unlike the commonly known organisms of the eubacterial

kingdom~ sorne members of the bacteria in blood are capable of rapid morphogenesis.

One member~ tracked by a time Iapse video cassette recorder~ was seen to change from a

rod-shaped to a coccoidal-shaped organism one in less thanlO min. Selected prints from

this recording are shown in Fig. 2; the morphological transitions occurred at the times

imprinted. By virtue oftheir capacity to undergo cellular morphogenesis~ an aggregate of

such cells mounted on a TEM grid and treated with uranyi acetate demonstrates their

pleomorphic nature in the TEM (Fig. 3). In addition to their cellular movement~ such as

flexing~ observed under the microscope~ the viable nature of these pleomorphic bacteria

was reinforced by their ability to increase in number in serum upon aerobic incubation of

a clotted blood sample at 30°C for 7 days. Table 1 shows the increase in cell numbers~ or

blooming, of 7 blood sarnples. The counts were made at 1,OOOX magnification using

darkfield illumination. The mode of reproduction in the blood bacteria is most probably

transverse binary fission as well as cell fragmentation as observed by electron

microscopy. The capacity of blood bacteria to grow confirmed that the cells observed

were indeed viable. These organisms were not saprophytic bacterial contaminants since

no bacterial growth was 0 bserved upon streaking serum aliquots on blood agar and

chocolate agar media and incubating them aerobically at either 30°C or 37°C.

• 119 Figure 1. TEM image ofa PlatinumlCarbon replica showing the morphology ofa blood • bacteriurn.

• 120 •

• Figure 2. Morphogenesis of a blood bacterium as captured by time lapse video cassette • recorder under darldield illumination. Changes in morphology were recorded at the times indicated. 10:37:37 = knobbed bacillus (A); 10:37:42 = bacillus with central bulge (B);

10:37:52 = spherical cell with three protrusions CC); 10:41:07 = spherical cell with two

protrusions CD); 10:43:15 = spherical ceLl with one protrusion (E); 10:46:44 = coccoidal

cell (F).

• 121 Figure 3. TEM image ofa negative stain specimen showing a group ofhlood bacteria • exhibiting pleomorphic morphology.

• 122 •

• • Table L "Blooming" in blood samples resulting in increased bacilli counts. Subject Initial counts* Final counts*#

1 1 500

2 3 600 ... ..) 18 1250

4 0 200 ... 5 ..) 800

6 1 2550

7 1 800

* Total counts/50 fields

# Aerobic incubation at 30°C after 7 days

• 123 Unfortunately, attempts to grow the blood bacteria on various other enriched laboratory • media (including those used for the cultivation of spirochetes, mycoplasmas, and tissue cultures) were not successful. We conclude that the pleomorphic bacteria in blood are

viable but not cultivable in vitro using conventional techniques. Furthermore, washings

from the blood collection tubes yielded no pleomorphic bacteria \vhen examined under

the darkfield microscope. The pleomorphic bacteria in blood were selectively inhibited

by the presence of antibiotics. Table 2 shows the effect oftwo antibiotics on the growth

of these bacteria in serum. Polymyxin B was the most inhibitory while bacitracin had

limited effect. The pleomorphic bacilli were not retained by 0.45 J.1rn cellulose acetate

membrane filters, a property that is shared by mycoplasmas. This characteristic of

passing through filters facilitated their concentration in the laboratory to a relatively high

cell density devoid of most blood cell elements. Such concentrated cell preparations, as

weIl as those from differential centrifugation, \vere used for morphological investigation

in the TEM (see Fig. 3). TEM micrographs of ultrathin sections of pleomorphic bacteria

showed bacillary and coccoid round forms ofthe ceIls (Fig. 4). The ceUs were enclosed

by a double membrane with no evidence of a dense layer of peptidoglycan. No discrete

nuclei or membrane-bound intracellular organelles typical of eucaryotes were visible. It

is evident that the pleomorphic bacteria are highly organized entities rather than random

protein fragments resulting from degradation of cellular elements (Fig. 4). This

observation was supported by indirect immunofluorescence using an anti-actin antibody

(Seeley, Vandemark et al. 1991). The pleomorphic bacteria exhibited no fluorescence

indicating the absence of surface actin and therefore are not remnants of red blood cells

which have surface actin (Stryer 1998).

• 124 • Table 2. Selective effect ofantibiotics on the growth of blood bacteria• Days o 5 7 9 Il 13

Control 5 100 120 140 160 200

Bacitracin* 5 60 110 120 130 150 Polymyxin B* 5 2 10 o o o

* 100 ~g/ml

AlI counts were numbers ofbacilli/50 fields after aerobic incubation at 30°C.

• 125 Figure 4. TEM image ofultrathin section ofblood bacteria. Bounding membranes of • the cens are indicated by arrows.

• 126 •

• The presence of bacteria in blood samples suggests that the bacteria live symbiotically • with the blood elements like the erythrocytes. These bacteria appeared ta emerge from and adhere to them. It is possible that the bacilli cannot be separated from the

erythrocytes for the purpose of maintaining them in viable culture. This hypothesis was

substantiated by another of our observations. We have in the laboratory a tissue culture

of erythroblasts (ATCC CCL 243 K-S62). This continuous ceH line was established in

1975. Upon examination of these cells under darkfield optics, we observed similar­

looking bacilli in the tluid of the medium with many of them attached to the human

erythroblast cells. These bacilli do not cause rapid spoilage or fermentation of the rich

tissue culture medium (Sigma RPMI medium 1640 supplemented with fetal bovine

serum). Their viable nature was confirmed by means of Molecular Probes LIVE

BacLight Bacteria Viability Kit (Eugene, OR) and used according ta manufacturer's

directions. The bacilli cells stained fluorescent green indicating their viability and the

presence ofnucleic acid within an intact cell membrane. The presence of latent bacteria

in blood was further supported by use of 16S ribosomal RNA identification (Amann,

Ludwig et al. 1995); (pace 1997). It was shawn that at day O~ no PCR amplification of

16S rDNA was detected. But after 5 days, incubation at 30°C a positive signal was

obtained. On boLh days, upon aliquot inoculation into nutrient broth, no growth of

bacteria resulted. (Thus the signal obtained was not a result of saprophytic bacterial

contamination.) Bacterial DNA was isolated from 0.5 mL whole blood containing

bacteria according ta the procedure of Higuchi (Higuchi 1989). PCR-amplified DNA

fragment sizes 1.2- and 1.S-kb from these bacteria were cloned. Two recombinant

plasmids, B16 and TS, were used for DNA sequencing. The two sequences were

identical except for a truncated 5' end in B16. The near complete 16S rRNA gene ofT5

(1497-bp excluding the primer sequences) showed 99.6% identity with the 1500-bp • 127 sequence of Stenotrophomonas maltophilia LMG958T, a type strain of Laboratorium • voor Microbiologie Gent Culture Collection, Gent, Belgium. The sequence of T5 determined on both strands showed 4 transitions and 2 transversions from that of

LM958T (GenBank accession number X95923). This finding has been confumed with a

second sample from another subject, as weil as a sample from the erythroblast culture.

The phylogenetîc position of S. maltophilia has been under intensive investigation

(Hauben, Vauterin et al. 1997); (Spencer 1995); (Irifime 1994). Originally called

Pseudomonas maltophilia, it was later called Xanthomonas maltophilia, S. maltophilia is

clustered \vithin the gamma-subclass ofthe Proteobacteria representing a distinct taxon.

Although closely related, Xanthomonas maltophilia is not a plant pathogen and occurs

widely in soils and water. The 16S rRNA results described above have been reproduced

independently in the laboratory of Marc Sirois at the University of Quebec at Trois­

Rivieres with three additional subjects. Analysis of the 168 ribosomal gene sequence

showed that the bacterial genus of closest homology was Pseudomonas. This confmned

our fmdings at McGill University since Stenotrophomonas, as indicated above, was

formerly in the genus Pseudomonas. In addition to the 16S rRNA results above, we have

also PCR-amplified the gyrB gene of the blood bacteria. The gyrB gene encodes the

subunit B protein of DNA gyrase; it is a new molecular method for detecting and

identifying bacteria (Yamamoto and Harayarna 1995). The sequence ofthe 475-bp PCR

fragment was found to be different from the partial gyrB gene (l252-bp) of the S.

maltophilia type strain ATCC 13637, the sequence of wrnch we obtained in our

laboratory. Thus our isolates from blood are not exactly S. maltophilia but instead are

variants of the species. Using the sequence of the PCR probe pH- fluorescence in situ

hybridization (FISH) ofthe blood bacteria was carried out (Amann, Ludwig et al. 1995); • 128 (Amann 1995). However, numerous attempts using standard protocols were not • successful since these pleomorphic cell wall-deficient bacteria lysed as a consequence of the harsh experimentaI procedures. S. maltophilia and Pseudomonas spp. are easily

cultivated in common 1aboratory media like nutrient agar and sheep blood agar (Irifime

1994). In spite of many attempts using various types of media~ we were not able to

cultivate the pleomorphic bacteria in vitro even though it is related to Stenotrophomonas

and Pseudomonas. This apparent anomaly may be explained by the observation that

known pathogens, even those like Salmonella enteritidis and Vibrio cholerae enter a

nonculturable state when exposed to salt water, freshwater, or low temperature

environments (Amann, Ludwig et al. 1995). It is conceivable that upon removal from its

habitat, the blood organisms enter into such a nonculturable state even though they may

remain viable. Furthermore, it is generally recognized that most microorganisms in

naturaI habitats have not been isolated and maintained in pure culture in the laboratory.

Nomlan Pace has reiterated that the pure-eulture approach to the study of microbial

forms constrains the view of microbial diversity since most microbes defy cultivation by

standard methods (Amann, Ludwig et al. 1995).

The pleomorphic blood bacteria are likely L-forms (cell wall-deficient forms).

The TEM images of ultrathin-sections (Fig. 4) demonstrated the absence of a rigid

membrane containing peptidoglycan in the cell of the blood bacteria. They could have

evoLved from the walled form by mutation or adaptation to the hypertonie blood

environment. The blood bacteria reported herein need not belong to any one particular

taxon. In Light ofour knowledge ofmicrobial diversity, many species and related strains,

which \ve have not as yet identified, may be present in bLood. The blood bacterium

studied could not have been a contaminant in our blood sarnples since we could not

isolate any saprophytes on enriched organic medium nor was there any evidence of e. 129 contaminating overgrowth or presence of rod-shaped cells typical of pseudomonads, • particularly in the sarnples used for PCR. As mentioned earlier, washings from the blood collection tubes also yielded no pleomorphic bacteria upon darkfield microscopie

examination.

Our report of naturally-occurring viable pleomorphic bacteria in blood ofhealthy

humans is not entirely novel. G. Tedeshi, in1969, at the University of Carnerino in Italy

had reported similar baeteria as intraerythrocytic parasites of clinically healthy human

subjeets in the journal Nature (Tedeschi, Amice et al. 1969). They showed that red blood

cells increased the uptake or incorporation of radioactive thymine, uridine, and glycine

because of the presence ofthese bacteria. Incorporation ofthese compounds are not part

of the normal metabolic activity of erythroeytes. In addition, recently, Kajander and

Çiftçioglu reported in the Proc. Nati. Acad. Sei. (Kajander and Cifteioglu 1998) the

existence of nanobaeteria in human blood. These bacteria possess unusual properties

(poody disruptable, extremely resistant to heat, and production of apatite). Using

contemporary molecular biology techniques, we have aiso demonstrated the presence of

baeteria in serum of healthy human subjects that share morphological sirnilarity to those

reported by Tedeshi (Tedeschi, Amice et al. 1969). Since these bacteria are quiescent

symbionts in the blood ofhealthy individuals, it is tempting to speeulate that they can be

harnessed for gene therapy. Useful genes cao be cloned in the blood bacteria which then

can be reintroduced into the host for the purpose of producing specifie proteins. More

importantly, our findings suggest that we have still so much more to learn about

microorganisms in the human bloodstream and to unravel the roles they might play in

disease and in health ofthe individual hosto

• 130 Acknowledgements

We thank the following colleagues who generously provided their assistance ta the

• project: Héléne Bergeron, Moy Fang Chen, Isabelle Saint Girons, W.C. Friend, and

Evelyn Kokoskin. The cell line of leukemic erythroblasts was a generous gift of Kyle

Vogan. The generous fmancial support ofMr. Ian Henderson for this project is gratefully

acknowiedged.

• 131 e· Chapter 7. Summary and Conclusions Oral anaerobic spirochetes (OAS) have been implicated in both the initiation and

the progression of periodontal disease (Simonson, Goodman et al. 1988); (Chan,

Klitorinos et al. 1996). There are, however, numerous oral spirochetes present in

diseased periodontal pockets which to date are yet uncultivable (Choi, Paster et al. 1994).

At the time this study was initiated we were interested in continuing the work by Chan et

al. (1993) and Qiu et al. (1994) in which a method was developed for quantifying OAS in

pure culture and in diseased sites of the periodontium (Chan, Siboo et al. 1993); (Qiu,

Klitorinos et al. 1994). The use ofNOS medium in combination with a low-temperature

gelling agent, 0.7% SeaPlaque agarose (NOS-A), was successful for the above-stated

purpose (Chan, Siboo et al. 1993); (Qiu, Klitorinos et al. 1994). We wished to develop a

better medium, one which gave enhanced growth of spirochetes. Aiso, due to the high

cost ofagarose, the extent which large assays could be carried out was limited. Therefore

a gelling agent(s) which was less expensive and which remained molten at 37°C and

solidified at 25°C was sought.

Chapter 2 describes the search for this medium. To find a medium that met the

above criteria, varying proportions of gelatin (5.0 to 0.5%) and Bacto agar (1.0 to 0.5%)

were added to NOS medium or varying proportions of gelatin (1.0 to 0.5%) and Noble

agar (0.5 to 0.3%) \vere added to NOS medium. The best two combinations which met

the criteria for remaining liquid at 37°C and solidifying at room temperature were that of

0.5% gelatin-O.5% Bacto agar (NOS-GB) and 0.5% gelatin-O.5% Noble agar (NOS-GN)

(Chapter 2, Table 1).

• 132 These two combinations were tested further to assay for their colony-forming unit

recovery of T. denticola ATCC 35404 (Chapter 2, Table 2) and T. vincentii ATCC 35580

(Chapter 2, Table 3) compared with the recovery obtained by NOS-A. Based on the

viable counts of same size inoculum NOS-GN, gave the highest counts, followed by

NOS-GB, followed by NOS-A for T. denticola (Chapter 2, Table 2). In the case of T.

vincentii all three media performed equally weIl in the recovery of colony-forming units

(Chapter 2, Table 3).

The recovery ofspirochete colony-forming units from subgingival plaque samples

of Il patients is shown in Chapter 2, Table 4. In general NOS-GN with one or both

antibiotics yielded higher counts than the equivalent NOS-A medium. It was also

determined that NOS-GN medium with the addition of l I-Lg/ml rifampin + 100 I-Lg/ml

phosphomycin was more selective for OAS than rifampin alone (Chapter 2, Figure 2).

Many OAS produce a proline-specific endopeptidase (Makinen, Makinen et al.

1980) which cleave gelatin peptides. Other bacteria present in subgingival plaque would

also hydrolyze gelatin. To determine if the NOS-GN medium would remain solid in the

presence of gelatinase-producing bacteria two species of bacteria, Bacillus subtilis and

Staphylococcus aureus were inoculated iuto NOS-GN medium and incubated at 37°C for

5 days. The NOS-GN medium was not liquefied (Chapter 2, Figure 3). We have shown

in chapter 2 that NOS-GN medium remains molten at 37°C and solidifies at 25°C. This

medium is more cost-effective than NOS-A medium and also superior for the

enumeration ofcolony-forming units oforal anaerobic spirochetes.

• 133 Novel isolates wmch are able to be grown in pure culture, perhaps using NOS-GN • medium, need to be readily identified and speciated. A molecular biology method was developed in our laboratory for that purpose. Restriction fragment Length polymorphism

(RFLP) on the 168 ribosomal gene was tested on reference stains of T. denticola

(serotypes a and d), T. vincentii, T. phagedenis and T. socrans/di as weLl as a number of

clinical treponema isoLates. As weIl, the 168 ribosomal gene of T. denticola (serotypes a

and d) were cLoned and sequenced.

A distinct banding pattern was seen between ail the reference Treponema spp.

(Chapter 3, Figure 1). A notable difference was seen between the serotypes a and d of T.

denticola. The three dissimilar bands were probably the result of a partial digestion

(Chapter 3, Figure 1 and 2). The theorical banding pattern (Chapter 3, Figure 2)

produced by digestion with Hpali (based on DNA sequence data) corresponded to the

actual banding pattern for T. denticola 35405 (Chapter 3, Figure 1 Lane 4). Ail of the

clinical isolates \vere strains of T. denticola, with 7 isolates being serotype d and 1 being

serotype a (Chaper 3, Figure 1).

Treponema denticola cells sometimes form atypical morphological variations

termed "spherical bodies" wmch were tirst described by Hampp et al (1948) (Hampp,

Scott et al. 1948) We were interested in examining environmentaVnutrition factors which

promoted the formation ofthese bodies.

Because T. denticola is an anaerobic bacterium which grows poody at 25°C and

45°C (8mibert 1984) the effects ofboth oxygen and growth temperature on the formation • 134 of spherical bodies were tested. We found that growth temperature or oxygen did not • affect the formation ofspherical bodies.

Next the effect of the omission of fluid NOS basal medium components (brain

heart infusion, trypticase, yeast extract, sodium thioglycoUate, asparagine, cysteine

hydrochloride or glucose) and the supplement components (rabbit serum, volatile fatty

acid mixture, sodium bicarbonate or thiamine pyrophosphate) on the formation of

spherical bodies were examined. The deletion of NOS basal medium component yeast

extract and the supplement components rabbit serum, volatile fatty acids and thiamine

pyrophosphate promoted the formation ofspherical bodies (Chapter 4, Figure 2 and Table

1).

The metabolic end products secreted by T. denticola were reported by Hespell and

Canale-Parora (Hespell and Canale-Parola 1971). Concentrations of either 26, 500

~ffiOl/l acetic acid, 272 ~mol/l pyruvic acid, 2,720 J.1ffiollI, 2108 J.1molll formic acid or

5990 ~molll were added to separate test-tubes containing NOS medium. Only the

addition of lactic acid greatly affected the formation of spherical bodies (Chapter 4,

Figure 3 and Table 2).

Judit Miklossy reported that spirochetes could be the causative agent or at least

associated with Alzheîmer's disease (AD). We attempted to duplicate the findings of

Miklossy. Fresh blood from 16 early stage AD patients and 6 late stage patients were

examined under darkfield microscopy for the presence of spirochetes. Brain tissues were

also examined (Chapter 5, Table 1). Spirochetes were microscopically observed in the

blood ofonly one late stage AD patient (Chapter 5, Figure1). This observation suggested • 135 • that spirochetes were probably not associated with AD. As a consequence ofmy work with GAS, while examining blood using darkfield

microscopy from both AD patients and healthy volunteers, we observed pleomorphic

bacilli within the blood serum. This was an extraordinary fmding since the bloodstream

of a healthy human is considered a sterile environment (Brooks, Butel et al. 1995).

Chapter 6 provides a report on the evidence we have collected of bacteria residing as

symbionts in the human bloodstream.

In order to characterize the morphology ofthe these bacteria a number ofelectron

microscopy techniques were employed. A transmission electron microscope (TEM)

micrograph of the organism observed in platinum/carbon replica shows the surface

topology of the bacterium (Chapter 6, Figure 1). This organism is capable of rapid

morphogenesis. One organism was captured by a time lapse video cassette recorder

undergoing a variety ofshape changes (Chapter 6, Figure 2). An aggregate of such cells

examined under TEM demonstrates their capacity to undergo cellular morphogenesis

(Chapter 6, Figure 3). In order to study their internaI structure, TEM micrographs of

ultrathin sections were done (Chapter 6, Figure 4). The bacteria were enveloped by a

double membrane with no dense peptidoglycan layer visualized. Discrete nuclei or

membrane bound organelles typical ofeucaryotes were not visible. To further prove that

these organisms were not red bIood cell (RBC) degradation products, indirect

immunofluorescence using an anti-actin antibody was used. Since the pleomorphic

bacteria did not f1uoresce, indicating the absence of surface actin, the organisms are not

RBC degradation products.

• 136 These bacteria increase in cell number when the blood is incubated at 30°C for • seven days (Chapter 6, Table 1). These bacteria were aIso selectively inhibited by the antibiotic polymyxin B (Chapter 6, Table 2).

The presence ofbacteria in the blood ofhealthy humans was further supported by

168 ribosomal RNA analysis. It was shown that on day 0, no signal was detected upon

PCR amplification. However, if the blood was incubated 5 days at 30°C, a signal was

obtained. Sequence analysis by our laboratory showed the organism to be very similar to

Stenotrophomonas maltophîlia LMG958T. The 16S rRNA results obtained

independently in the laboratory of Marc Sirois showed closest homology to

Pseudomonas. This confmns our fmdings since Stenotrophomonas was fOlTIlerly in the

genus Pseudomonas (Hauben, Vauterin et al. 1997); (Irifune 1994); (Spencer 1995). As

weLI, the blood bacteria may not belong to one particular taxon. S. maltophîlia and

Pseudomonas spp. are cultivable in common laboratory media, but in spite numerous

attempts the blood bacterium could not be cultivated in microbiological media.

Similar bacteria found in blood of healthy humans have been reported by

Tedeschi as intracellular parasites (Tedeschi, Amice et al. 1969). Using both traditional

microbiological and contemporary molecular biology techniques we have demonstrated

the presence of similar bacteria that share morphology resembling those reported by

Tedeschi et al. (Tedeschi, Amice et al. 1969).

• 137 • References Amann, R. 1. (1995). In situ identification of microorganisms bv whole cel! hybridization

with rRNA-targeted nucleic acid probes. New York, N.Y., Academie PubLishers.

Amann, R. L, W. Ludwig, et al. (1995). "PhyLogenetic identification and in situ detection

individuaL microbiaL ceILs without cuLtivation." MicrobioL. Rev. 59: 143-169.

Arakawa, S. and H. Kuramitsu (1994). "Cloning and sequence anaLysis of a

chymotrypsinlike protease from Treponema denticola.'" Infect. Immun. 62: 3424-3433.

Amott., S., A. Fulmer, et al. (1974). "Agarose double helix and its function in agarose gel

structure.'" J. Mol. BioL. 90:: 269-284.

Ashimoto, A., C. Chen, et al. (1996). "Polymerase chain reaction detection of 8 putative

periodontal pathogens in subgingival pLaque of gingivitis and advanced periodontitis

lesions." Oral MicrobioL. Immunol. Il:: 266-273.

Barron., S. L., G. R. Riviere, et al. (1991). ·'Use of moncolonal antibodies ta enumerate

spirochetes and identify Treponema denticola in dental plaque of children, adolescents

and young adults." Oral Microbiol. Immunol. 6:: 97-101.

Beausejour., A., N. Desiauriers, et al. (1997). "Activation ofthe interleukin-l J3 precursor

by Treponema denticola: a potential role in chronic inflammatory periodontal diseases."

Infect. Immun. 65: 3199-3202.

Bergstrom, S., A. G. Barbour, et al. (1991). "Genetics of Borrelai burgdorferi.'" Scand. J.

Infect. Dis. - Suppl. 77: 102-107.

Bladen, H. A. and E. G. Hampp (1964). "UItrastructure of Treponema microdentium and

Borrelia vincentii." J. Bacteriol. 87: 1180-1191. • 138 Blakemore, R. P. and C.-P. E. (1973). "Morphological and ecological characteristics of • Spirochaeta plicatilis." Arch. Mikrobiol. 89: 273-289. Blanco, D. R., K. Reimann, et al. (1994). "Isolation of the outer membranes frOID

Treponema pallidum and Treponema vencentii." J. Bacteriol. 176: 6088-6099.

Brahamsha, B. and E. P. Greenburg (1988). "A biochemical and cytological analysis of

the complex periplasmic flagella form Spirocheata aurantia." J. Bacteriol. 170: 4023­

4032.

Brooks, G. F., J. S. Butel, et al. (1995). Jawetz. Melnick & Adelberg's Medical

Microbiology. Norwalk, CT, Appleton & Lange.

Canale-Parola, E. (1992). Free-living saccharolytic spirochetes: the genus Spirochaeta.

The prokarvotes: a handbook on the biology of bacteria ecophysiology. isolation.

identification. applications. A. Balows, H. G. Truper, M. Dworkin, W. Harder and K.-H.

Schleifer. New York, N.Y., Springer-Verlag: 3524-3536.

Chan, E. C. S., A. Klitorinos, et al. (1996). "Characterization ofa 4.2-kb plasmid isolated

from periodontopathic spirochetes." Oral Microbiol. Immun. 5: 365-368.

Chan, E. C. S., R. Siboo, et al. (1993). "Treponema denticola (ex Brumpt 1925) Spa nov.,

nom. rev., and identification ofnew spirochete isolates from periodontal pockets." Int. J.

Syst. Bacteriol. 43:: 196-203.

Chan, E. C. S., R. Siboo, et al. (1993). "A successful method for quantifying viable oral

anaerobic spirochetes." Oral Microbiol. Immuno!. 8:: 80-83.

Cheng, S.-L., R. Siboo, et al. (1985). "Comparative study of six random oral spirochete

isolates. Serological heterogeneity of Treponema denticola." J. Periodont Res 20: 602­

612.

• 139 Choi, B. K., B. J. Paster, et aL (1994). "Diversity of cultivable and uncultivable oral • spirochetes from a patient \vith severe destructive periodontitis." Infect. Immun. 62:: 1889-1895.

Chu, L., A. Burgum, et al. (1995). "The 46-kilodalton-hemolysin gene from Treponema

denticola encodes a novel hemolysin homologous to aminotransferases." Infect. Immun.

63: 4448-4455.

Chu, L., J. L. Ebersole, et al. (1997). "Cystalysin, a 46-kilodalton cysteine desulthydrase

from Treponema denticola, with hemolytic and hemoxidative activities." Infect. Immun.

65: 3231-3228.

Darveau, R. P., A. Tanner, et al. (1997). "The microbial challenge in periodontitis."

Periodontol. 2000 14: 12-32.

Defosse, D. L., R. C. Johnson, et al. (1995). "Brevinema andersonii gen. nov., sp. nov.,

an infectious spirochete isolated from the short-tailed shrew (Blarina brevicauda) and the

\vhite-footed mouse (Peromyscus leucopus)." Int. J. Syst. Bacterio!. 45: 78-84.

DeLong, E. F., G. S. Wickham, et al. (1989). "Phylogenetic stains: ribosomal RNA­

based probes for the identification ofsingle cells." Science 243: 1360-1363.

Ding, Y., V.-J. Uitto, et al. (1996). "Membrane components of Treponema denticola

trigger proteinase release form human polymorphonuclear leuk.ocytes." J. Dent. Res. 75:

1986-1193.

DiRienzo, J. M., M. Comell, et al. (1991). "Use of randomly cloned DNA fragments for

the identification oforal spriochetes." Oral Microbiol. Immunol. 6:: 88-96.

Dixon, B. (1998). "Viable but nonculurable." ASM News 64: 372-373.

Duhamel, G. E., D. J. Trott, et al. (1998). "Canine intestinal spirochetes consist of

• 140 Serpulina pilosicoli and a newly identified group provisionally designated "Serpulina • canis" Spa nov." J. Clin. MicrobioI. 36: 2264-2270. Edwards, U., T. Rogall, et aL (1989). "Isolation and direct complete nucleotide

determination of entire genes. Characterization of a gene coding for 168 ribosomal

RNA." Nuc!. Acids Res. 17: 7843-7853.

Egi, C., W. K. Leung, et al. (1993). "Pore-forming properties ofthe major 53-kilodalton

surface antigen from the outer sheath of Treponema denticola." Infect. Immun. 63: 1694­

1699.

Eiffert, H., S. M. Hoppert, et al. (1992). "Identification of an endoflagellar associated

protein in Borrelia burgdorferi." J. Med. Microbiol. 32: 209-214.

Ellen, R. P., M. Song, et al. (1994). "Degradation of endogenous plasma membrane

fibronectin concomitant with Treponerna denticola 35405 adhesion to gingival

fibroblasts." Infect. Immun. 62: 3033-3037.

Fermo, J. C., M. H. Hannam, et al. (1998). "'Cytopathic effects of the major surface

protein and the chymotrysinlike protease of Treponema denticola." Infect. Immun. 66:

1869-1877.

Fermo, J. C. and B. C. McBride (1998). "Virulence factors oforal treponemes.~'Anaerobe

4: 1-17.

Ferdows, M. S. and A. G. Barbour (1989). "Megabase-sized linear DNA in the bacterium

Borrelia burgdorftri, the Lyme disease agent." Proc. Nati. Acad. Sci. USA. 86: 5969­

5973.

Fosnaugh, K. and E. P. Greenburg (1988). "Chemotaxis mutants of Spirochaeta

aurantia." J. Bacteriol. 177: 606-611.

Fraser, D. M., S. J. Noms, et al. (1998). "Complete genome sequence of Treponema • l4l pallidum, the syphilis spirochete." Science 281: 375-388. • Freundt, E. A. and S. Razin (1984). Genus L Mycoplasma Norwak 1929, 1349 Nom. cons. Jud. Comm. Opine 22~ 1958, 166AL. Bergey's manuel of systematic bacteriology.

N. R. Krieg and J. G. Holt. Baltimore MD, Williams and Wilkins. 1: pp. 742-743.

Frobisher, M., R. O. Hinsdill~ et al. (1974). Fundamentals of microbiology. Toronto ON,

W.B. Saunders Company.

Fukumoto, Y., T. Kato, et al. (1989). "A common antigen of Treponema denticola and

other Treponema species detected by monoclonal antibody." Oral Microbiol. Immunol.

4:: 112-116.

Goodson, J. M. (1992). "Oiagnosis of periodontitis by physical measurement:

interpretation from episodic disease hypothesis." J. Periodontol. 63: 373-378 (4 Supple).

Goulbourne, E. R. J. and E. P. Greenburg (1980). "Relationship between proton motive

force and motility in Spirochaeta aurnatia." J. Bacterio!. 143: !450-1457.

Greenspan, J. S. (1994). Orodental diseases. Basic & Clinical Immunology. D. P. Stites,

A. 1. a. Terr and T. G. Parslow. Norwalk CT., Appleton & Lange: 470-477.

Grenier, O. (1991). "Characteristics of hemolytic and hemagglutinating activities of

Treponema denticola." Oral Microbiol. Immuno!. 6: 246-249.

Grenier, D., V.-J. Vitto, et al. (1990). "Cellular location of a Treponema denticola

chymotrypinlike protease and importance of protease in migration through the basement

membrane." Infect. Immun. 58:: 347-351.

Gusberti, F. A., S. A. Syed, et al. (1988). "Combined antibotic (metronidazole) and

mechanial treatment effects on the subgingival bacterial fIora of sites with recurrent

periodontal disease." J. Clin. Periodontol. 15: 353-359.

Haapasalo, H., P. Hannam, et al. (1996). "Hyaluronan, a possible ligand mediating • 142 Treponema denticola binding to periodontal tissue." Oral Microbiol. Immunol. Il: 156­ e· 160.

Haapasalo, M., K.-H. Muller, et al. (1992). "Characterization, cloning, and binding

properties of the major 53-kilodalton Treponema denticola surface antigen." Infect.

Immun. 60: 2058-2065.

Haapasalo, M., U. Singh, et al. (1991). "Sulhydryl-dependent attachment of Treponema

denticola to laminin and other proteins." Infect. Immun. 59: 4230-4237.

Hampp, E. G., D. Scott, et al. (1948). "Morphologie characteristics of certain cultured

strains of oral spirochetes and Treponema pallidum as revealed by electron microscopy."

J. Bacteriol. 56: 755-769.

Hardy, J. (1997). "The Alzheimer family of diseases: Many etiologies, one

pathogenesis?" Proc. Natl. Acad. Sei. USA. 94: 2095-2097.

Hardy, P. H. and E. E. Neil (1957). "Study of the antigenic structure of T. pallidum by

specifie agglutination." Am. J. Hyg. 66: 160-172.

Hauben, L., L. Vauterin, et al. (1997). "Comparison of 16S ribosomal DNA sequences of

all Xanthomonas species." Int. J. Svst. Bacteriol. 47: 328-335.

Hemnann, J. K., E. Bellenger, et al. (1992). "Pulsed-field gel electrophoresis of iVotI

digests of Leptospira DNA: a new rapid method of serovar identification." J Clin.

Microbiol. 30: 1696-1702.

Hespell, R. B. and E. Canale-Parola (1971). "Amino acid and glucose fermentation by

Treponema denticola." Archiv. Mikrobiol. 78: 234-251.

Higuchi, R. (1989). "Simple and rapid preparation ofsamples for PCR. PCR Technology.

New York, N.Y., M. Stockton Press. • 143 Hinrichs, J. E., L. f. Wolff: et al. (1985). "Effects of scaling and root planing on • subgingival microbial proportion standardized in terms of the naturally occurring distribution." J. Periodontol. 56: 187-194.

Holt, J. G., N. R. Krieg, et al., Eds. (1994). Bergey's manual of determinative

bacteriology. Baltimore MD, Williams and Wilkins.

Holt, S. C. (1978). "Anatomy and chemistry of spirochetes." Microbiol. Rev. 42: 114­

160.

Hovind-Hougen, K. (1976). "Determination by means of electron microscopy of

morphological criteria of values for classification of sorne spirochetes, in particular

treponmes." Acta Pathol MicrobioL. Scand. Sect. B 255 (Suppl.): 1-44.

lrifune, K. (1994). "Pneumonia caused by Stenotrophomonas maltophilia with a mucoid

phenotype." J. Clin. MicrobioL. 32: 2856-2857.

Ishihara, K., H. K. Kuramitsu, et al. (1998). '~Dentilisin activity affects the organization

ofthe outer sheath of Treponema denticola." J. Bacteriol. 180: 3837-3844.

Janssen, P. H. and H. W. Morgan (1992). "Glucose catabolism by Spirochaeta

thermophilia RI 19.B1." J. Bacteriol. 174: 2449-2453.

Johnson, R. C. (1976). Comparative spirochete physiology and cellular composition. The

biology ofparasitic spirochetes. Johnson R.C. New York, Academie Press: pp. 39-48.

Johnson, R. C. (1977). "The spirochetes." ADn Rev MicrobioI31:: 89-106.

Johnson, R. C. and C. A. N. Hughes (1992). The genus Borrelia. The prokarvotes: a

handbook on the biology ofbacteria ecophysiology. isolation. identification. applications.

A. Balows, H. G. Truper, M. Dworkin, W. Harder and K.-H. Schleifer. New York, N.Y.,

Springer-Verlag: 3506-3567. • 144 Kajander, E. O. and N. Ciftcioglu (1998). "Nanobacteria: an alternative mechanism for • pathogenic intra- and extracellular calcification and stone formation." Proc. Nat Acad. Sei. 95: 8274-8279.

Katzman, R. (1986). "Alzheimer's disease." N. Engl. J. Med. 314: 964-973.

Kaufinan, D. M. (1995). Clinical neurology for psychiatrists. New York, NY., W.B.

Saunders Company.

Klitorinos, A., P. Noble, et al. (1993). "Viscosity-dependent locomotion of oral

spirochetes." Oral Microbiol. Immunol. 8: 242-244.

Koopman, M. B. H., O. S. De Leeuw, et al. (1992). "Clonïng and DNA sequence analysis

of a Serpula (Treponema) hyodysenteréae gene encoding a periplasmic flagellar sheath

protein." Infect. Immun. 60: 2920-2925.

Koseki, T., 1. Ishikawa, et al. (1995). "Characterization oforal treponemes isolated from

human periodontal pockets." Oral MicrobiaL Immunol. 10:: 271-277.

Leschine, S. B. and E. Canale-Parola (1980). "Rifampin as a selective agent for isolation

oforal spirochetes." J. Clin. Microbiol. 12:: 792-795.

Li, Z., F. Dumas, et al. (1993). ·'A species-specific periplasmic flagellar protein of

Serpulina (Treponema) hyodysenteréae." J. Bacteriol. 175: 8000-8007.

Loesche, W. J. (1988). ·'The role ofspirochetes in periodontal disease." Adv. Ent. Res. 2:

275-283.

Lyons, R. J., K. A. Kent, et al. (1991). "'A cytotoxic haemolysin from Treponema

hyodysenteriae-a probable virulence determinant in swine dysentery." J. Med. Microbiol.

34: 97-102.

MacDougall, J. and 1. Saint Girons (1995). "Physical map of the Treponema denticola

• 145 chromosome." J. Bacteriol. 177: 1805-1811. • Makinen~ P.-L., K. Makinen~ et al. (1995). "Role of the chymotrypsin-like membrane­ associated proteinase from Treponema denticola ATee 35405 in inactivation of

bioactive peptides." Infect. Immun. 63: 3567-3575.

Makinen, P.-L., K. K. Makinen, et al. (1980). "An endo-acting proline-specific

oligopeptidase from Treponema dentècola ATee 35404: evidence of hydrolysis of

human bioactive peptides." Infect. Immun. 62:: 4938-4947.

Mathers, D. A., W. K. Leung, et al. (1996). "The major surface protein complex of

Treonema denticola depolarizes and induces ion channels in HeLa cell membranes."

Infect. Immun. 64: 2904-2910.

McKane, L. and J. Kandel (1996). Microbiology essentials and applications. Toronto,

ON, McGraw-Hill, Inc.

Miklossy, J. (1993). "Alzheimer's disease-a spirochetosis?" NeuroReport 4: 841-848.

Miklossy, J., S. Kasas, et al. (1994). "Further ultrastructural evidence that spirochaetes

may play a raIe in the aetiology ofAlzheimer's disease." NeuroReport 5: 1201-1204.

Miller, J. N., R. M. Smibert, et aL. (1992). The genus Treponema. The prokarvotes: a

handbook on the biologv ofhacteria ecophysiology. isolation. identification. applications.

A. Balows, H. G. Truper, M. Dworkin, W. Harder and K.-H. Schleifer. New York, N.Y.,

Springer-Verlag: 3537-3559.

Mitchison, M., J. 1. Rood, et al. (1991). "Molecular analysis of a Leptospira

borgpetersenii gene encoding an endoflagellar suhunit protein." J. Geu. Microbiol. 137:

1529-1536.

Norris~ S. J. and T. T. p. p. r. group. (1993). "Polypeptides of Treponema pallidum:

• 146 Progress toward understanding their structural, functional, and immunologie roles." • Microbiol. Rev. 57: 750-779. Olsen, L, N.-E. Fiehn, et al. (1995). "Identity of 1:2:1 and 2:4:2 subgingival spirochetes

by DNA hybridization." Oral Microbiol. Immunol. 10:: 378-381.

Pace, N. R. (1997). "A molecular view ofmicrobial diversity and the biosphere." Science

276: 734-740.

Page, R. C. (1991). "The role ofinflammatory mediators in the pathogenesis ofperidontal

disease." J. Periodont. Res. 26:: 230-242.

Parales, J. and E. P. Greenburg (1991). "N-terminal amino acid sequences and amino acid

compositions of the Spirochaeta auranita flageLIar filament polypeptides." J. BacterioL

173: 1357-1359.

Parales, J. and E. P. Greenburg (1993). "Analysis of the Spirochaeta aurantia flaA gene

and transcript." FEMS Microbiol. Lett. 106: 245-251.

Paster, B. J., F. E. Dewhirst, et al. (1996). "Phylogeny of not-yet-cultured spirochetes

from termite guts." Appt Environ. Microbiol. 62:: 347-352.

Paster, B. J., F. E. Dewhirst, et al. (1991). "Phylogenetic analysis of the spirochetes." J.

Bacteriol. 173: 6101-6109.

Paster, B. J., O. A. Pelletier, et al. (1996). "Phylogenetic position ofthe spirochetal genus

Cristispiria." Appt. Environ. Microbiol. 62: 942-946.

Perry, J. J. and J. T. Staley (1997). Microbiology: dynamics and diversitv. Toronto ON.,

Saunders College Publishing.

Plorde, J. J. (1994). Spirochetes. Sherris medical microbiology: an introduction to

infectious diseases. K. J. Ryan. Norkwalk, CT., Appleton & Lange: 385-399.

• 147 Qiu, Y.-S., A. Klitorinos, et al. (1994). "Enumeration of viable oral spirochetes from • periodontal pockets." Oral Microbiol. Immunol. 9:: 301-304. Ranney, R. R. (1991). "Immunologie mechanisms ofpathogenesis in periodontal disease:

an assessment." J. Periodontal. Res. 26: 243-254.

Ray, G. C. and K. J. Ryan (1994). Intravascular infections, bacterernia, and endotoxemia.

Sherris medical microbiology. K. J. Ryan. Norwalk, CT, Appleton & Lange: 791-800.

Rees, D. A. (1972). "Shapely polysaccharides." Biochem. J. 126:: 257-273.

Restrepo, B. 1., T. Kitten, et al. (1992). "Subtelemeric expression regions of Borrelia

hermsii linear plasmids are highly polymorphie." 1\101. Microbio1. 6: 3299-3311.

Robinovitch, M. R. (1994). Dental and periodontal infections. Sherris medical

microbiology. An introduction to infectious diseases. K. J. Ryan. NorwaLk, Appleton &

Lange: 747-753.

Ryan, K. J. (1994). Intravascular infections, bacterernia and endotoxemia. Sherris

Medical Microbiology. An introduction to infectious diseases. K. J. Ryan. Norwalk,

Appleton & Lange.

Ryan, K. J. (1994). Sherris Medical Microbiology. An Introduction to Infectious

Diseases. Norwalk, CT, Appleton & Lange.

Saint Girons, 1., 1. G. OId, et al. (1994). "Molecular biology ofthe Borrelia, bacteria with

Linear replicons." Mol. Microbiol. 140: 1803-1816.

Sato, T., J. Matsuyama, et aL. (1998). "Differentiation oforal Actinomyces species by 168

ribosornal DNA polyrnerase chain reaction-restriction fragment length polymorphism."

Arch. Oral Biol. 43: 247-252.

Sato, T., M. Sato, et al. (1998). "Restriction fragment-Iength polyrnorphism analysis of • 148 16S rDNA amplified by polymerase chain reaction from oral asaccharolytic Eubacterium • species." Oral Microbiol. Immunol. 13: 23-29. Schneider, W. R. and R. N. Doetsch (1974). "~Effect ofviscosity on bacterial motility." J.

Bacteriol. 177: 696-701.

Schwan, T. G., M. E. Schrumpf, et al. (1992). ""Analysis of Leptospira spp. Leptonema

fllini, and Ricketta richettsii for the 39-kilodalton antigen (P39) ofBorrelia burgdorfèri."

J. Clin. Microbiol. 30: 735-738.

Scott, D., E. C. S. Chan, et al. (1996). '"Iron acquisition by oral hemolytic spirochetes:

isolation ofa hemin-binding protein and identification ofiron reductase activity." Cano J.

Microbiol. 42: 1072-1079.

Scott, D., A. Klitorinos, et al. (1997). "~Visualization of an extracellular mucoid layer of

Treponema denticola ATCC 35405 and surface sugar lectin analysis ofsorne Treponema

species." Oral Microbiol. Immunol. 12: 121-125.

Scott, D., 1. R. Siboo, et al. (1993). '"Binding ofhemin and Congo Red by oral hemolytic

spirochetes." Oral Microbiol. Immunol. 8: 245-250.

Seeley, H. W. J., P. J. Vandemark, et al. (1991). Microbes in Action. New York, NY,

W.H. Freeman: 343-345.

Shang, E. S., M. M. Exner, et al. (1995). "The rare outer membrane protein OmpL1, of

pathogenic Leptospira Species is a heat-modifiable porïn." Infect. Immun. 63: 3174­

3181.

Simonson, L. G., C. H. Goodman, et al. (1988). '"Quantitative relationship of Treponema

denticola to severity ofperiodontal disease." Infect Immun. 56:: 726-728.

Smibert, R. M. (1984). Genus III Treponema Schaudinn 1905, 1728 AL. Bergey's • 149 Manual of Systematic Baeterio10gy. N. R. Krieg and J. G. Holt. Baltimore MD., The • Williams & Wilkins Co. vol 1: pp. 49-57. Spencer, R. C. (1995). "The emergence of epidemic, multiple-antibiotic-resistant

Stenotrophomonas (Xanthomonas) maltophilia and Burkholderia (Pseudomonas)

cepacia." J. Hosp. Infect. (Supplement) 30: 453-463.

Strugnall, R., A. Cockayne, et al. (1990). "MolecuIar and antigenic analysis of

treponemes." Crit. Rev. MicrobioL 17: 321-249.

Stryer, L. (1998). Biochemistry. New York, NY, W.H. freeman.

Sueyoshi, M. and Y. Adaehi (1990). "Diarrhea induced by Treponema hyodysenteriae: a

young chiek cecal model for swine dysentery." Infect. Immun. 58: 3348-3362.

Swatek, f. E. (1967). Textbook of microbiology. Saint Louis MO, The C.V. Mosby

Company.

Tedeschi, G. G., D. Amice, et al. (1969). "Incorporation of nucleosides and amino-aeids

in human erythrocyte suspensions: possible relation with a diffuse infection of

mycoplasms or bacteria in the L form." Nature 222: 1285-1286.

Tomlinson, S. E., G. Blessed, et al. (1970). "Observations on the brain of demented Oid

people." J. Neural. Sei. Il: 205-242.

Trueba, G. A., C. A. Bolin, et aL (1992). "Characteristic of the periplasmic flagellum

proteins ofLeptospira interrogans." J. BacterioL 174: 4761-4768.

Turner, T. B. and D. H. Hollander (1950). "Cortisone in experimental syphilis." BulL

John Hopkins Hosp. 87: 503-509.

Turner, T. B. and O. H. Hollander (1954). "Studies on the mechanism of action of

cortisone in experimental syphilis." Am. J. Syph. Gonorrhea Vener. Dis. 38: 371-387.

• 150 Uitto, V.-J., D. Grenier, et al. (1988). "Isolation of a chymotrypinlike enzyme from • Treponema denticola." Infect. Immun. 56:: 2717-2722. Uitto, V.-J., Y.-M. Pan, et al. (1995). "Cytopathic effects of Treponema denticola

chymotrypsin-like proteinase on migrating and stratified epithelial cells." Infect. Immun.

63: 3401-3410.

Walker, E. M., J. K. Arnett, et al. (1991). "Treponema pallidum subsp. pallidum has a

single, circular chromosome with a size of -900 kilobase pairs." Infect. Immun. 59:

2476-2479.

WaIker, S. G., J. L. Ebersole, et al. (1997). "Identification, isolation, and characterization

of the 42-kilodaiton major outer membrane protein (MompA) from Treponema

pectinovorum ATCC 33768." J. Bacterio!. 179: 6441-6447.

Ward, D. M., R. WeIler, et al. (1990). "16S rRNA sequences reveal numerous uncultured

microorganisms in a natural community." Naure 345: 63-65.

Weinberg, A. and S. C. HoIt (1990). "Interaction of Treponema denticofa TD-4, GM-l,

and MS25 with human gingival fibroblasts." Infect. Immun. 58: 1720-1729.

Willis, A. T. (1991). Anaerobie culture methods. Anaerobie microbiology. P. N. Levett.

New York, N.Y., Oxford University Press: 1-11.

Woese, C. R. (1987). ~'Bacterial evolution." Microbiol. Rev. 51: 221-271.

Wolt: V. and W. J. (1994). "Formation ofmultiple treponemes." Zbl. Bakt. 280: 297-303.

Wolf, V., R. Lange, et al. (1993). "Development of quasi-multicellular bodies of

Treponema dentieola." Arch. Microbiol. 160: 206-213.

Yamamoto, S. and S. Harayama (1995). "PCR amplification and direct sequencing of

gyrB genes with universal primers and their application to the detection and taxonomie

• 151 analysis ofPseudomonas putida strains." Appt Environ. Microbiol. 61: 1104-1109. • •• Yotis, W. W., V. K. Sharma, et al. (1991). "Biochemical properties of the outer membrane ofTreponema denticola." J. Clin. Microbiol. 29:: 1397-1406.

Zuerner, R. L., J. L. Herrmann, et al. (1993). "Comparison of genetic maps for two

Leptospira interrogans serovars provides evidence for two chromosomes and intaspecies

heterogeneity." J. Bacteriol. 175: 5445-5451.

Zuerner, R. L. and T. B. Stanton (1994). ~~Physical and genetic map of the Serpulina

hyodysenteriae B78T chromosome." J. BacterioL 176: 1087-1092.

• 152