Biosynthesis of Pyrrolysine, the 22Nd Amino Acid Dissertation Presented

Home , Acetohalobium arabaticum, Pyrrolysine, SECIS element, Selenocysteine

Biosynthesis of pyrrolysine, the 22nd amino acid

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Marsha Ann Gaston, M.S.

Graduate Program in Microbiology

The Ohio State University

2011

Dissertation Committee:

Dr. Joseph Krzycki

Dr. Karin Musier-Forsyth

Dr. John Reeve

Dr. F. Robert Tabita

Marsha Ann Gaston

2011

Abstract

Pyrrolysine is the 22nd genetically encoded amino acid, co-translationally inserted into methylamine methyltransferases as directed by in-frame amber

(UAG) codons in methanogenic Archaea. UAG is interpreted as pyrrolysine with a devoted tRNA that is directly aminoacylated with pyrrolysine by a dedicated aminoacyl-tRNA synthetase (encoded by pylS). The pyrrolysine gene cluster, pylTSBCD, encodes three additional proteins bearing homology with biosynthetic enzymes (by pylBCD). The expression of pylB, pylC, and pylD from

Methanosarcina acetivorans is necessary and sufficient for pyrrolysine biosynthesis in Escherichia coli, suggesting that the precursors of pyrrolysine are common between the metabolism of an enterobacterioacaea species and methanogenic archaea. However, the identity of those metabolic precursors of pyrrolysine have remained unknown.

Here we present a thin layer chromatography methodology that separates pyrrolysine from other E. coli metabolites. A series of isotopic labeling experiments using thin layer chromatography and mass spectrometry indicate two molecules of lysine serve as the entire carbon and nitrogen skeleton of pyrrolysine. All carbons between the two molecules of lysine are retained in

ii pyrrolysine, where an epsilon-nitrogen of one lysine molecule is lost during pyrrolysine biosynthesis.

The biosynthesis of a pyrrolysine analog, desmethylpyrrolysine, is also described. This analog is produced in E. coli expressing pylCD when cultured in the presence of D-ornithine. The presence of D-ornithine circumvents PylB, acting as an analog of the pyrrolysine ring precursor. These studies allow us to place PylB as the first enzyme in the pyrrolysine biosynthetic pathway as well as propose the product of the reaction it catalyzes.

Additional studies using D-ornithine have allowed us to order PylC as the first enzyme and PylD as the second enzyme to act in the desmethylpyrrolysine biosynthetic pathway. Furthermore, deuterium labeling studies presented here provide insights into the mechanism of PylB. Finally, an ordered pathway for pyrrolysine biosynthesis is proposed.

iii

Dedication

Dedicated to my husband and parents for their endless support and encouragement

Acknowledgements

Many professional and personal thanks need to be extended to those folks who have made this work possible. First and foremost I would like to thank my advisor, Dr. Joseph Kryzcki. His knowledge, patience, and guidance have contributed significantly to my scientific upbringing. I am grateful that he allowed me to dive into such a fascinating problem. I am also appreciative of my committee members, Dr. Karin Musier-Forsyth, Dr. John Reeve, and Dr. Robert

Tabita for their insights and suggestions. Much of the work presented here would not have been possible without the expertise of Dr. Kari Green-Church and Dr.

Liwen Zhang of The Ohio State University Mass Spectrometry and Proteomics

Facility of the Campus Chemical Instrument Center. Dr. Zhang’s dedication to our project and her willingness to answer my many questions have been very much appreciated. My labmates Sherry Blight, Dave Longstaff, Anirban

Mahapatra, Jitesh Soares, Ross Larue, and Ruisheng Jiang have been a phenomenal source of training, encouragement, scientific discussion, and friendship. I have had a phenomenal amount of support from friends, old and new. I am also thankful to Dr. Juan Alfonzo, Dr. Mary Anne Rubio, and the members of the Alfonzo lab. Their enthusiasm for science and generosity have contributed greatly to the work presented here. I am appreciative for the kindness and generosity of Michael Carter and Stacia Kock, whose hospitality has allowed v me to see my degree to fruition. My parents, Ron and Carol Thalhofer fostered my curiosity early in life and have been an endless source of encouragement for which I am immensely thankful. Finally, I am infinitely grateful for the support, inspiration, and understanding of my husband Kirk.

Vita

2005...... B.S. Biology, Saint Vincent College

2008...... M.S. Microbiology, The Ohio State University 2005 to present...... Graduate Research and Teaching Associate, The Ohio State University

Publications

1. Gaston MA, Zhang L, Green-Church KB, Krzycki JA. The complete biosynthesis of the genetically encoded amino acid pyrrolysine from lysine. Nature. 2011 Mar 31;471(7340):647-50.

2. Gaston MA, Jiang R, Krzycki JA. Functional context, biosynthesis, and encoding of pyrrolysine. Current Opinion in Microbiology. 2011 Jun;14(3):342-9.

Field of Study

Major Field: Microbiology

vii

Table of Contents

Abstract...... ii Dedication...... iv Acknowledgements ...... v Vita...... vii List of Tables ...... xi List of Figures ...... xv

Chapters:

1. Introduction ...... 1 1.1 Archaea...... 1 1.1.1 Archaeal diversity ...... 1 1.1.2 Methanogens...... 3 1.2 Amino acid biosynthesis ...... 5 1.3 Selenocysteine ...... 7 1.4 Pyrrolysine, the 22nd genetically encoded amino acid ...... 9 1.4.1 Discovery of an amber codon read-through event in Methanosarcina spp...... 9 1.4.2 Genetic encoding of pyrrolysine ...... 13 1.4.3 Pyrrolysine biosynthesis ...... 19 1.4.4 Pyrrolysine function ...... 28 1.5 Overview of thesis...... 29

2. Pyrrolysine is biosynthesized entirely from lysine...... 31 2.1 Introduction ...... 31 2.2 Experimental procedures...... 32 2.2.1 Organisms and plasmids ...... 32 2.2.2 Growth conditions for recombinant biosynthesis of pyrrolysine ...... 33 2.2.3 Growth conditions for recombinant radiolabelled biosynthesis of pyrrolysine ...... 34 2.2.4 Extraction of recombinantly expressed pyrrolysine using organic solvents ...... 35 2.2.5 Ninhydrin-based standardization of concentrations of cell extracts...... 35 2.2.6 Thin layer chromatography separation of pyrrolysine...... 36

viii 2.2.7 Pixel density correlation to pyrrolysine concentration in organic solvent extracts using TLC...... 36 2.2.8 Growth conditions for MtmB(His)6 production for labelling of pyrrolysine with stable isotope ...... 37 2.2.9 Enrichment of MtmB(His)6 ...... 38 2.2.10 Anti-MtmB immunoblot ...... 39 2.2.11 Sample preparation and mass spectrometric analysis of MtmB(His)6 ...... 39 2.3 Results...... 40 2.3.1 TLC separation of recombinantly expressed pyrrolysine...... 40 2.3.2 Quantification of pyrrolysine produced by recombinant E. coli using TLC...... 47 2.3.3 Radiolabelled lysine is incorporated into recombinantly biosynthesized pyrrolysine ...... 51 2.3.4 Expression and enrichment of MtmB(His)6 from M9-SAG...... 54 2.3.5 All carbon and all nitrogen in pyrrolysine are derived from two molecules of lysine ...... 55 2.3.6 The epsilon-nitrogen from one lysine molecule is eliminated during pyrrolysine biosynthesis ...... 64 2.4 Discussion...... 70

3. Desmethylpyrrolysine is a pyrrolysine analog produced from D-ornithine and lysine ...... 75 3.1 Introduction ...... 75 3.2 Experimental procedures...... 77 3.2.1 Organisms and plasmids ...... 77 3.2.2 Growth conditions for recombinant pyrrolysine biosynthesis in the presence or absence of D-ornithine...... 77 3.2.3 Growth conditions for MtmB(His)6 production in the presence or absence of D-ornithine ...... 78 3.3 Results...... 79 3.3.1 Supplementing media with D-ornithine does not increase free intercellular pyrrolysine concentration ...... 79 3.3.2 D-ornithine, but not L-ornithine, increases UAG read-through ...... 83 3.3.3 PylB is not required for full-length MtmB production in the presence of D-ornithine ...... 85 3.3.4 Both pyrrolysine and pyrrolysine analog desmethylpyrrolysine are inserted at the UAG position in the presence of D-ornithine and pylBCD...... 87 3.3.5 Only desmethylpyrrolysine is detectable in recombinant E. coli bearing pylCD in the presence of D-ornithine...... 95 3.3.6 D-ornithine acts as the ring precursor only in desmethylpyrrolysine...... 100 3.3.7 Evidence of ring opening in desmethylpyrrolysine ...... 105

ix 3.4 Discussion...... 108

4. In vivo analysis of the activities of pyrrolysine biosynthetic enzymes.....117 4.1 Introduction ...... 117 4.2 Experimental procedures...... 118 4.2.1 Organisms and plasmids ...... 118 4.2.2 Growth conditions for radiolabelling of desmethylpyrrolysine pathway intermediates...... 119 4.2.3 Thin layer chromatography of radiolabelled organic solvent extracts and chemically synthesized standards ...... 120 4.2.4 Growth conditions for mass spectrometry analysis of intercellular metabolite pool...... 120 4.2.5 Hot methanol extraction of intercellular Escherichia coli metabolite pool for mass spectrometry...... 121 4.2.6 Growth conditions for immunoblot analysis ...... 121 4.2.7 Recombinant PylB production and isolation ...... 122 4.2.8 Iron analysis of PylB ...... 124 4.2.9 Growth conditions for MtmB(His)6 production in the presence of deuterated lysine ...... 125 4.3 Results...... 126 4.3.1 Identifying desmethylpyrrolysine intermediates using thin layer chromatography ...... 126 4.3.2 Product of PylC enzymatic activity detected by mass spectrometry...... 130 4.3.3 D-ornithyl-N!-L-lysine can serve as a substrate for PylD in vivo...... 132 4.3.4 Evidence that PylB is an iron-sulfur protein...... 134 4.3.5 Deuterium labelling studies ...... 136 4.4 Discussion...... 152

5. Future directions ...... 164

References...... 169

List of Tables

Table Page

2.1 Rf values of the 20 canonical amino acids, chemically synthesized pyrrolysine, pyrrolysine analog 2-Thf-lys, and cadaverine after chromatographic separation by TLC ...... 43

2.2 Comparison of pyrrolysine-containing MtmB peptide and pyrrolysine residue after expression in the presence of L-lysine comprised of isotopes of naturally occurring 12 14 abundances ( C6, N2) or uniformly labelled L-lysine 13 15 ( C6, N2)...... 58

2.3 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGMGVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 12 14 in the presence of C6 N2-L-lysine...... 59

2.4 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGM(ox)GVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in 12 14 the presence of C6 N2-L-lysine...... 60

2.5 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGMGVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 13 15 in the presence of C6 N2-L-lysine...... 62

2.6 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGM(ox)GVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in 13 15 the presence of C6 N2-L-lysine...... 63

2.7 Comparison of pyrrolysine-containing MtmB peptide and pyrrolysine residue after expression in the presence of L-lysine comprised of isotopes of naturally occurring abundances (12C, 14N) or L-lysine heavy labelled at either the alpha nitrogen or epsilon nitrogen...... 66

xi 2.8 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGM(ox)GVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in the presence of "-15N-L-lysine ...... 67

2.9 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGMGVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in the presence of !-15N-L-lysine...... 68

2.10 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGM(ox)GVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in the presence of !-15N-L-lysine...... 69

3.1 Comparison of pyrrolysyl-containing MtmB peptide and pyrrolysyl residue after synthesis in the absence or presence of D-ornithine. Pyrrolysyl-peptides were identified from cells supplemented with D-ornithine and bearing either pylBCD or pylCD ...... 89

3.2 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGMGVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 and pylBCDTS in the presence of D-ornithine and 12 14 C6 N2-L-lysine ...... 91

3.3 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGM(ox)GVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 and pylBCDTS in the presence of D-ornithine and 12 14 C6 N2-L-lysine ...... 92

3.4 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGMGVO-meGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 and pylBCDTS in the presence of D-ornithine and 12 14 C6 N2-L-lysine ...... 93

3.5 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGM(ox)GVO-meGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 and pylBCDTS in the presence of D-ornithine and 12 14 C6 N2-L-lysine ...... 94

xii

3.6 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGMGVO-meGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 and pylCDTS in the presence of D-ornithine and 12 14 C6 N2-L-lysine ...... 98

3.7 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGM(ox)GVO-meGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 and pylCDTS in the presence of D-ornithine and 12 14 C6 N2-L-lysine ...... 99

3.8 Comparison of pyrrolysine and desmethylpyrrolysine- containing MtmB peptides produced in E. coli bearing pDLBADHis and pK13, cultured in M9-SAG medium 13 15 supplemented with C6 N2-L-lysine in the absence or presence of D-ornithine...... 101

3.9 Some desmethylpyrrolysine-containing MtmB peptides produced in E. coli bearing pDLBADHis and pK13 show evidence of the ring being hydrated to the opened aldehyde form ...... 106

4.1 Comparison of MtmB pyrrolysyl-peptide and pyrrolysine residue after synthesis in the presence of L-lysine comprised of isotopes of naturally occurring abundances or: 2,3,3,4,4,5,5,6,6-d9-L-lysine, 2,6,6-d3-L-lysine, 4,4,5,5-d4-L-lysine ...... 138

4.2 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGMGVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in the presence of 2,3,3,4,4,5,5,6,6-d9-L-lysine. (Pyl + 15 Da) ...... 140

4.3 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGM(ox)GVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in the presence of 2,3,3,4,4,5,5,6,6-d9-L-lysine (Pyl + 15 Da) ...... 141

4.4 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGMGVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in the presence of 2,3,3,4,4,5,5,6,6-d9-L-lysine. (Pyl + 9 Da) ...... 142

xiii

4.5 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGM(ox)GVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in the presence of 2,3,3,4,4,5,5,6,6-d9-L-lysine (Pyl + 9 Da) ...... 143

4.6 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGMGVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in the presence of 2,6,6-d3-L-lysine. (Pyl + 5 Da) ...... 145

4.7 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGM(ox)GVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in the presence of 2,6,6-d3-L-lysine. (Pyl + 5 Da) ...... 146

4.8 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGMGVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in the presence of 4,4,5,5-d4-L-lysine. (Pyl + 6 Da) ...... 149

4.9 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGMGVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in the presence of 4,4,5,5-d4-L-lysine. (Pyl + 5 Da) ...... 150

4.10 The calculated masses and measured m/z of b- and y-series ions of MtmB peptide 194AGRPGMGVOGPETSL208, analyzed from MtmB isolated from E. coli expressing mtmB1 in the presence of 4,4,5,5-d4-L-lysine. (Pyl + 4 Da) ...... 151

xiv

List of Figures

Figure Page

1.1 Pyrrolysine within the MtmB active site, as observed in the MtmB crystal structure ...... 11

1.2 The structure of L-pyrrolysine ...... 12

1.3 Arrangement of pyl genes found in genomes of representative archaeal and bacterial species...... 14

1.4 Pyrrolysine and pyrrolysine analogs that have been demonstrated to act as substrates for pyrrolysyl-tRNA synthetase ...... 17

1.5 Alignment of archaeal and bacterial PylB amino acid sequences with biotin synthase sequences encoded by E. coli and Bacillus subtilis ...... 23

1.6 Consensus tree of archaeal and bacterial PylC sequences, d-alanine-d-alanine ligase and carbamoyl phosphate synthetase; and consensus tree of archaeal and bacterial PylD sequences, 3- hydroxyisobutyrate dehydrogenase, 6-phosphogluconate dehydrogenase, leucine dehydrogenase ...... 26

2.1 Pyrrolysine can be resolved as a separate spot from the twenty canonical amino acids using TLC ...... 42

2.2 Recombinantly biosynthesized pyrrolysine can be resolved as a separate spot in organic solvent extracts of E. coli expressing pylBCD...... 45

2.3 TLC of organic solvent extracts of E. coli bearing pACYCDuet-1 (vector only), pK13 (pylBCD), pK14 (pylBD), pK15 (pylCD), or pK16 (pylBC) ...... 46

2.4 Ninhydrin-stained TLC can be used to determine pyrrolysine concentration from a standard curve...... 48

xv 2.5 TLC of organic solvent extracts from E. coli bearing either pACYCDuet-1 (vector) or pK13 (pylBCD) cultured in LB or M9-SAG medium...... 50

2.6 TLC of extracts of E. coli bearing only the vector (pACYCDuet-1) and E. coli bearing pK13 (pylBCD) after incubation with uniformly labelled 14C-L-lysine...... 53

2.7 Spectra of b- and y-series ions generated from CID of pyrrolysine containing peptide 194AGRPGMGVOGPETSL208, analyzed MtmB isolated from E. coli expressing mtmB1 in 13 15 the presence of C6 N2-L-lysine...... 61

2.8 Pyrrolysine is synthesized from two lysine molecules, catalyzed by PylB, PylC, and PylD...... 74

3.1 Recombinant pyrrolysine production in the absence or presence of D-ornithine...... 81

3.2 Densitometric comparison of organic solvent extracts of recombinant E. coli cultured in the presence or absence of D-ornithine...... 82

3.3 Anti-MtmB immunoblot of whole cell extracts of E. coli bearing pDLBADHis (pylTS and mtmB1-his) and either pACYCDuet-1 or pK13 (pylBCD) cultured in M9-SAG supplemented with D-ornithine or L-ornithine ...... 84

3.4 Anti-MtmB immunoblot of whole cell extracts of E. coli bearing pDLBADHis (pylTS and mtmB1-his) and pACYCDuet-1, pK13 (pylBCD), pK14 (pylBD), pK15 (pylCD), or pK16 (pylBC) cultured in the presence or absence of D-ornithine ...... 86

3.5 The structures of pyrrolysine and desmethylpyrrolysine ...... 96

3.6 CID spectra of desmethylpyrrolysine-containing peptides generated after chymotryptic digestion of recombinant MtmB 12 14 produced in the presence of D-ornithine and C6 N2-L-lysine 13 15 or C6 N2-L-lysine ...... 103

3.7 Mass spectrometry indicates that desmethylpyrrolysine is susceptible to ring opening by the addition of water to the imine, forming an amino aldehyde...... 107

xvi 3.8 Desmethylpyrrolysine is biosynthesized from lysine and D-ornithine in recombinant strains expressing pylCD ...... 112

3.9 The pyrrolysine biosynthesis pathway begins with the radical rearrangement of lysine to catalyzed by PylB, but the order of PylC and PylD in the pathway remains unknown...... 115

4.1 The most likely first step of desmethylpyrrolysine biosynthesis from D-ornithine and L-lysine in the event that either PylC or PylD act as the first enzyme in the pathway...... 127

4.2 TLC of organic solvent extracts of E. coli bearing pK17 (pylD) or pK18 (pylC) after incubation in M9-SAG supplemented with uniformly labelled 14C-L-lysine and D-ornithine...... 129

4.3 Mass spectrum of signals corresponding to D-ornithyl-N!-L-lysine detected in extracts from E. coli transformed with pK18 (pylC) that had been cultured in the presence of D-ornithine...... 131

4.4 Anti-MtmB immunoblot showing that supplementing recombinant E. coli cultured in M9-SAG medium with D-ornithyl-N!-lysine results in the production of full-length MtmB only when pylD is expressed ...... 133

4.5 Coomassie-stained 12.5% SDS-PAGE gel of PylB-enriched fractions of a protein peak from nickel affinity chromatography ...... 135

4.6 Likely positions of deuterium incorporation in pyrrolysine synthesized by recombinant E. coli expressing pylBCDTS and mtmB1 in the presence of 2,6,6-d3-L-lysine ...... 147

4.7 Desmethylpyrrolysine biosynthetic pathway ...... 154

4.8 Possible mechanism of PylB...... 159

4.9 Pyrrolysine biosynthetic pathway from two molecules of lysine...... 163

xvii

Chapter 1

INTRODUCTION

1.1 Archaea

1.1.1 Archaeal diversity

Advances in molecular biology have greatly contributed to a better understanding of the evolutionary relationships between organisms. Perhaps the most noteworthy example has been the re-classification of all life from either the two main groups of Prokaryotes and Eukaryotes or five kingdoms (Monera,

Animalia, Plantae, Fungi, and Protista) into three domains (Archaea, Bacteria, and Eukarya) based on the sequence of small subunit (SSU) ribosomal RNA in

Archaea, Bacteria, and Eukarya (Woese, Kandler, & Wheelis, 1990). This analysis was the first to distinguish Archaea as distinct from Bacteria, and placed

Archaea as diverging from Eukarya after the initial Bacteria-Eukarya divergence from the Last Universal Common Ancestor on a phylogenetic tree.

The physiology of Archaea represents this early divergence, with many genes of metabolism sharing closest similarity to Bacteria but with Eukaryotic-like transcription and translation machinery (Cavicchioli, 2011). However, the

1 Archaea prove to be completely unique in other respects. The lipids within archaeal membranes have a glycerol-1-phosphate backbone joined by ether linkages rather than the lipids of a glycerol-3-phosphate backbone joined by ester linkages seen in Bacteria and Eukarya. Additionally, methanogenesis is a metabolism completely unique to the Archaea.

In addition to proposing the classification of all life into three distinct

Domains, Woese and colleagues also suggested that Archaea be divided into two phyla or kingdoms based on 16S rRNA sequences: Crenarchaeota and

Euryarchaeota (Woese et al., 1990). All organisms clustering in the

Crenarchaeota are hyperthermophilic organisms and are proposed to represent the most ancient archaea. The Euryarchaeota, which includes the methanogens, are more phylogenetically diverse including hyperthermophilic, halophilic, and sulfate-reducing organisms.

As more genomes have become available, three additional Archaeal phyla have been proposed based on compete genome analyses: Nanoarchaeota

(Huber et al., 2002), Korarchaeota (Elkins et al., 2008), and Thaumarchaeota

(Brochier-Armanet, Boussau, Gribaldo, & Forterre, 2008). The phylum

Nanoarchaeota is currently represented only by its founding member

Nanoarchaeum equitans (Cavicchioli, 2011). First observed microscopically as contacting the Crenarchaeota Ignicoccus hospitalis, N. equitans are very small in both cell dimension and genome size (Huber et al., 2002). The genome of N. equitans is lacking many essential genes and is proposed to be an obligate symbiont of Ignicoccus hospitalis. The 16S rRNA of N. equitans was not similar

2 enough to hybridize to any archaeal or bacterial probes, and the sequence was not identified until the genome of the organism was obtained.

The Korarchaeota is defined by its founding member, Candidatus

Korarchaeum cryptofilum (Elkins et al., 2008). Genome analysis of this anaerobic hyperthermophilic organism was performed from culture enrichments, but pure cultures are not yet attainable. The 16S rRNA suggests these organisms diverged early from Crenarchaeota and Euryarcharyota. The genome of

Candidatus Korarchaeum cryptofilum was found to possess a mixture of both crenarchaeal-like and euryarchaeal-like genes, emphasizing its classification as a separate phylum (Brochier-Armanet, Forterre, & Gribaldo, 2011; Elkins et al.,

2008).

The Thaumarchaeota were originally classified as Crenarchaeota, but the mesophilic physiology of its founding member Cenarchaeum symbiosum and analysis of the conserved genomic cores suggested the introduction of a third phylum (Brochier-Armanet et al., 2008). Additional genome sequences have since revealed a wealth of diversity within this phylum, including both mesophiles and thermophiles, and aerobic ammonia oxidizers, which was a metabolism previously thought to only belong to members of the beta-Proteobacteria and gamma-Proteobacteria (Brochier-Armanet et al., 2011).

1.1.2 Methanogens

Methanogenesis is a metabolism specific to Archaea. Members of the phylum Euryarchaeota, these universally anaerobic but widely varied organisms

3 have been isolated from a multitude of habitats including freshwater sediment, marine sediment, sewage sludge, insect guts, and mammalian intestinal tracts

(Liu & Whitman, 2008). Methanogens prefer a range of temperature, pH, and salinity. These organisms contribute greatly to the global carbon cycle, with biological methane representing approximately 74% of methane emitted to the atmosphere each year. In addition to ecological considerations, the study of methanogens has contributed greatly to biology. Initial studies of the 16S rRNA sequences of methanogens in 1977 paved the way for the classification of

Archaea as a distinct domain (Cavicchioli, 2011; Fox, Magrum, Balch, Wolfe, &

Woese, 1977). Unique enzymes and cofactors such as F420, coenzyme M, and coenzyme B have been discovered from studies of methanogen metabolism

(Cavicchioli, 2011; Gaston, Jiang, & Krzycki, 2011). Most recently, the study of methylamine metabolism led to the discovery of pyrrolysine, the 22nd genetically encoded amino acid.

All methanogenic pathways are catalyzed by an unusual set of enzymes that utilize novel cofactors and are initiated from one of three classes of substrate

(Liu & Whitman, 2008). The most commonly used substrate by the five orders of methanogens (Methanobacteriales, Methanococcales, Methanomicrobiales,

Methanosarcinales, and Methanopyrales) is carbon dioxide, which use H2 and/or formate as an electron donor to reduce carbon dioxide to methane (Rother &

Krzycki, 2010). Methanogenesis initiated from acetate results in the production of methane and carbon dioxide after the acetate molecule is split (Ferry, 1997).

Only organisms from two genera, Methanosarcina and Methanosaeta, can utilize

4 acetate for methanogenesis, although it is not the preferred substrate of

Methanosarcina. Despite the few organisms that prefer acetate as a growth substrate, acetate-derived methane accounts for approximately two-thirds of the biological methane produced each year. Finally, methylotrophic methanogens initiate methanogenesis from methylated compounds such as methanol, methylthiols, and methylamines. This metabolism is unique to the order

Methanosarcinales, of which the acetate-utilizing Methanosarcina and

Methanosaeta are members (Liu & Whitman, 2008). The metabolism of these methylated compounds is initiated by a methyltransferase specific to the compound, which catalyzes the transfer of the methyl group from the substrate to a cognate corrinoid protein (Rother & Krzycki, 2010). Despite similarities in substrate and the reaction catalyzed, no sequence similarity exists between monomethylamine methyltransferase (MtmB), dimethylamine methyltransferase

(MtbB) and trimethylamine methyltransferase (MttB).

1.2 Amino acid biosynthesis

While some amino acid biosynthetic pathways have been studied in a number of organisms, the most comprehensive studies of amino acid biosynthetic pathways and their regulation have primarily been focused in

Escherichia coli and, unless specified, are the pathways to be discussed here

(Umbarger, 1978). Biosynthetic pathways of the canonical 20 amino acids are not universal amongst all organisms but are typically divided into six families.

Most amino acids are biosynthesized from a parent amino acid for which the

5 pathway families are named, often in multi-step reactions catalyzed by many enzymes. Histidine is the sole amino acid not part of a bigger family, biosynthesized in ten enzymatic reactions from phosphoribosylpyrophosphate and ATP (Alifano et al., 1996). Cysteine and glycine are each synthesized from serine, which arises from 3-phosphoglycerate (Umbarger, 1978). The aromatic amino acids are biosynthesized in another family, as tyrosine, phenylalanine, and tryptophan claim phosphoenolpyruvate and erythrose-4-phosphate as precursors

(Sprenger, 2007). Pyruvate serves as the precursor to branched chain amino acids valine and leucine, as well as alanine (Umbarger, 1978). Glutamate is biosynthesized from !-ketoglutarate. Glutamine, proline, and arginine are each synthesized from glutamate (Cunin, Glansdorff, Pierard, & Stalon, 1986;

Umbarger, 1978). In fungi, thermophilic bacterium Thermus thermophilus, and thermophilic archaeon Pyrococcus horikoshii, lysine is also biosynthesized from glutamate via the !-aminoadipic acid (AAA) pathway (Nishida et al., 1999;

Umbarger, 1978). Lastly, lysine, asparagine, and isoleucine are members of the aspartate family of amino acids, although isoleucine derives part of its carbon skeleton from pyruvate.

Lysine is a member of the aspartate family of amino acids in E. coli and most other Bacteria, branching off from a common "-aspartic semialdehyde intermediate common also to methionine and threonine (Viola, 2001). The immediate precursor of "-aspartic semialdehyde, "-aspartyl phosphate, is the product of a reaction of aspartate and ATP catalyzed by three separate aspartokinases. Lysine, methionine, and threonine independently act in feedback

6 inhibition for each of these aspartokinases. However, there appears to be no specific channeling of the synthesized "-aspartyl phosphate from any of these enzymes to the biosynthesis of one specific amino acid. Lysine is synthesized in an eleven-step pathway starting from aspartate in E. coli (Umbarger, 1978). A lysine biosynthetic pathway intermediate, diaminopimelic acid (DAP), is critical for peptidoglycan biosynthesis in E. coli. The last step of lysine biosynthesis, the decarboxylation of DAP, is irreversible.

1.3 Selenocysteine

Selenocysteine (Sec) is commonly referred to as the 21st genetically encoded amino acid. Selenocysteine is structurally similar to cysteine, but with a selenium in place of the sulfur found in cysteine (Cone, Del Rio, Davis, &

Stadtman, 1976). Co-translationally inserted at specific UGA (opal) codons

(Chambers et al., 1986; Zinoni, Birkmann, Stadtman, & Bock, 1986), selenocysteine is found in all domains of life, albeit not in every species.

Moreover, differences exist between the biosynthesis and translational insertion of selenocysteine in Bacteria versus Archaea and Eukarya. All domains see selenocysteine biosynthesis occurring on tRNASec after tRNASec is aminoacylated with serine by the seryl-tRNA synthetase (Hatfield & Gladyshev, 2002; Leinfelder,

Zehelein, Mandrand-Berthelot, & Bock, 1988). The presence of tRNASec and its aminoacylation with serine is required for biosynthesis. In bacteria, selenophosphate synthetase (SelD) catalyzes the synthesis of the selenium donor, selenomonophosphate, from selenide and ATP (Leinfelder,

7 Forchhammer, Veprek, Zehelein, & Bock, 1990; Tormay et al., 1998).

Selenocysteine synthase, SelA, then catalyzes the conversion of Ser-tRNASec to

Sec-tRNASec using selenomonophosphate (Forchhammer, Leinfelder, Boesmiller,

Veprek, & Bock, 1991). Biosynthesis of selenocysteine in Archaea (recently reviewed in (Rother & Krzycki, 2010)) and Eukarya first sees the ATP-dependent phosphorylation of Ser-tRNASec by o-phosphoseryl-tRNASec kinase (Carlson et al., 2004; Kaiser et al., 2005). O-phosphoseryl-tRNASec, together with a selenium donor, acts as a substrate for O-phosphoseryl-tRNASec:Sec synthase to catalyze the formation of Sec-tRNASec (Yuan et al., 2006).

Insertion of selenocysteine at UGA codons is dependent upon the presence of a selenocysteine insertion sequence (SECIS) element, a cis-acting hairpin that forms in the mRNA. The SECIS element is required in all three domains, but as with biosynthesis, insertion is different between Bacteria and

Archaea and Eukaryotes. In Bacteria, the SECIS element is found immediately downstream of the UGA codon of the selenoprotein-encoding mRNA (Zinoni,

Heider, & Bock, 1990). SelB functions as both a GTP-dependent tRNASec-specific elongation factor and a SECIS binding protein that delivers Sec-tRNASec to the ribosomal A site (Forchhammer, Leinfelder, & Bock, 1989; Forchhammer,

Rucknagel, & Bock, 1990). Again, as for biosynthesis Archaea and Eukaryotes appear to employ a similar strategy for insertion of selenocysteine into growing proteins. The SECIS element in organisms belonging to these two domains is located in the 3’-untranslated region (Berry et al., 1991; Wilting, Schorling,

Persson, & Bock, 1997). However, other elements of selenocysteine insertion

8 within these two domains is less well-understood than in Bacteria. In eukaryotes, ribosomal protein L30 and SECIS binding protein 2 bind the SECIS element and are necessary for selenocysteine insertion at UGA codons (Chavatte, Brown, &

Driscoll, 2005; Copeland, Fletcher, Carlson, Hatfield, & Driscoll, 2000). However, the equivalent has not been found in Archaea, as the Methanococcus jannaschii

L30 homolog was not shown to bind a SECIS sequence (Chavatte et al., 2005).

1.4 Pyrrolysine, the 22nd genetically encoded amino acid

1.4.1 Discovery of an amber codon read-through event in Methanosarcina spp.

Methanogenesis pathways using methylamines as substrates are initiated by methyltransferases specific to each methylamine: monomethylamine (MMA) metabolism is initiated by monomethylamine methyltransferase (MtmB), dimethylamine (DMA) metabolism initiated by dimethylamine methyltransferase

(MtbB), and trimethylamine (TMA) metabolism initiated by trimethylamine methyltransferase (MttB). Sequencing mtmB1, one of the two copies of the monomethylamine methyltransferase gene found in the M. barkeri genome, led to the surprising observation of an in-frame amber codon with the mtmB1 gene

(Burke, Lo, & Krzycki, 1998). Translation was thought to not terminate at this

UAG codon, based on the size of isolated MtmB and the presence of many stop codons in the other reading frames. This in-frame UAG codon was also found in sequences of M. barkeri mtbB and mttB, despite the lack of sequence homology between the three methylamine methyltransferases (Paul, Ferguson, & Krzycki,

9 2000). Mass spectrometry and Edman degredation of tryptic digests of MtmB suggested that lysine was encoded at the UAG position (James, Ferguson,

Leykam, & Krzycki, 2001). However, peptide separation had been performed under harsh conditions that may have removed any modification on lysine.

Crystal structures of MtmB were instrumental in characterizing the UAG- encoded residue. The enzyme was resolved to 1.55 Å when precipitated in NaCl and 1.7 Å in (NH4)2SO4. In both structures, the UAG-encoded residue was revealed as L-lysine ligated at the epsilon nitrogen to (4R,5R)-pyrroline-5- carboxylate (Figure 1.1), termed L-pyrrolysine (Hao et al., 2002). The crystal structure revealed the pyrroline ring to be substituted at the C4 position, but the identity of this group could not be discerned. The empirical formula of pyrrolysine was later determined to be C12H19N3O2 by mass spectrometry of chymotrypric digests of MtmB, indicating that a methyl group is at the C4 substituted position of the pyrroline ring (Figure 1.2) (Soares et al., 2005). Furthermore, mass spectrometry of MtbB, and MttB revealed pyrrolysine to be the UAG-encoded residue in all three methylamine methyltransferases.

Figure 1.1 (a) Pyrrolysine (shaded blue) is located within an anionic cavity of an MtmB monomer, shown as a surface model. (b) The UAG-encoded residue is depicted as a stick model in the ribbon-modeled cavity. (c) The model was rotated to best demonstrate the structure of pyrrolysine. Nitrogen atoms are shown in blue, oxygen atoms are shown in red, and carbon atoms are shown in green. Coordinates for the (NH4)2SO4 MtmB crystal (PDB ID: 1L2Q) were viewed using MacPyMOL (DeLano Scientific LLC, 2006).

Figure 1.2 The structure of L-pyrrolysine.

12 1.4.2 Genetic encoding of pyrrolysine

Pyrrolysine is co-translationally inserted by a dedicated aminoacyl-tRNA synthetase, PylS, and dedicated tRNA that can decode the UAG codon (Blight et al., 2004; Srinivasan, James, & Krzycki, 2002). Sequence homology and the crystal structure of pyrrolysyl-tRNA synthetase place it in the class II family of aminoacyl-tRNA synthetases (Nozawa et al., 2009; Srinivasan et al., 2002). In addition to Methanosarcina barkeri, genes encoding for PylS (pylS) and tRNAPyl

(pylT) have been discovered in six additional archaeal genomes, all of which belong to the family Methanosarcinaceae: Methanosarcina acetivorans,

Methanosarcina mazei, the cold-adapted Methanococcoides burtonii, and halophiles Methanohalobium evestigatum, Methanohalophilus mahii (Gaston et al., 2011), and most recently Methanosalsum zhilinae (Figure 1.3). Additionally, genes encoding for PylS and tRNAPyl have been discovered in the genomes of some bacterial species. These include organisms in the class Clostridia:

Desulfitobacterium hafniense (Srinivasan et al., 2002), Desulfotomaculum acetoxidans, Acetohalobium arabaticum, Thermincola sp. JR; and the #- proteobacteria Bilophila wadsworthia (Gaston et al., 2011) and metagenome- identified #-proteobacterial symbiont of gutless worm Olavius algarvensis (Zhang

& Gladyshev, 2007). In all bacterial genomes in which the gene encoding the pyrrolysyl-tRNA synthetase was found, the gene is split into a gene encoding the

C-terminal domain of PylS (pylSc) and N-terminal domain PylSn (pylSn). It has been demonstrated that PylSc (Herring, Ambrogelly, Polycarpo, & Soll, 2007)

Figure 1.3 Arrangement of pyl genes found in genomes of representative archaeal and bacterial species. Genes for encoding of pyrrolysine (pylT, pylS) at UAG codon positions are shown in red. Pyrrolysine biosynthetic genes (pylB, pylC, pylD) are depicted in blue. Representative methylamine metabolism genes found in genomes are shown in green. The positions of the in-frame amber codon within the methylamine methyltransferase genes are shown in orange. An incomplete set of pyl genes is found in Desulfobacterium autotrophicum. The methylamine methyltransferase homologs found in this organism lacks an in frame amber codon. Genomic location is indicated by nucleotide number below the illustrated genes from the complete genome. The name of the genome file from NCBI is given beside each organism name.

Figure 1.3

15 and the homologous C-terminal domain of PylS is the catalytic domain of pyrrolysyl-tRNA synthetase (Herring et al., 2007; Nozawa et al., 2009).

Recent analog studies (Li et al., 2009; Polycarpo et al., 2006) and crystal structures of the C-terminus of the archaeal PylS (Kavran et al., 2007;

Yanagisawa et al., 2008) and the bacterial PylSc (Lee et al., 2008; Nozawa et al.,

2009) have revealed important substrate features for recognition by pyrrolysyl- tRNA synthetase. Kinetic analysis performed of M. barkeri pyrrolysyl-tRNA synthetase with chemically synthesized pyrrolysine and a number of pyrrolysine analogs demonstrated that L-pyrrolysine is the preferred substrate (Li et al.,

2009). PylS exhibits the next best catalytic efficiency (kcat/Km) with 2-amino-6-

((R)-tetrahydro-furan-2-carboxamido)hexanoic acid (2-Tfh-lys) as a substrate

(Figure 1.4b), albeit with only 9% the efficiency of pyrrolysine. It was demonstrated that N!-cyclopentyloxycarbonyl-L-lysine (Cyc) (Figure 1.4c) (Li et al., 2009; Polycarpo et al., 2006) and 2-amino-6-

(cyclopentanecarboxamino)hexanoic acid (Cpn-lys) (Li et al., 2009) (Figure 1.4d) could also be used by M. barkeri PylS as substrates with respectively decreasing catalytic efficiencies. However, no catalytic activity could be detected using analogs of 2-Thf-lys where the oxygen is at the 3 or 4 position within the ring, indicating that the presence of an electronegative atom at the 2 position in the ring contributes to recognition by pyrrolysyl-tRNA synthetase.

Figure 1.4 (a) Pyrrolysine and (b-e) pyrrolysine analogs that have been demonstrated to act as substrates for pyrrolysyl-tRNA synthetase. (b) 2-amino-6- ((R)-tetrahydro-furan-2-carboxamido)hexanoic acid (2-Thf-lys) (c) N!- cyclopentyloxycarbonyl-L-lysine (Cyc) and (d) 2-amino-6- (cyclopentanecarboxamino)hexanoic acid (Cpn-lys) have been shown to act as substrates for M. barkeri PylS in in vitro assays with decreasing catalytic efficiencies. (e) N 6-[(3-methyl-2,3-dihydro-1H-pyrrol-2-yl)carbonyl]-lysine (enPyl) was demonstrated as a M. barkeri PylS substrate using in vitro assays and as a substrate for the C-terminal domain of M. mazei PylS in crystal structures.

17 Crystal structures of the C-terminus of the archaeal PylS (Kavran et al.,

2007; Yanagisawa et al., 2008) and the bacterial PylSc (Lee et al., 2008; Nozawa et al., 2009) suggest a potential reason for PylS demonstrating a substrate preference for an electronegative atom at the second position of the pyrroline ring. Pyrrolysine binds within a hydrophobic pocket, but the hydroxyl group of a conserved tyrosine on a mobile loop is found to be within hydrogen binding distance to the nitrogen on the pyrroline ring (Kavran et al., 2007; Nozawa et al.,

2009). However, this nitrogen was modeled to be within this hydrogen bonding distance, as the orientation of the ring of pyrrolysine could not be determined. It was established that the epsilon nitrogen of the lysyl-moiety of pyrrolysine does not participate in hydrogen bonding with this tyrosine residue.

Selenocysteine insertion at UGA codons is dependent upon a SECIS element, a stem loop located downstream of the UGA codon in the 3’- untranslated region in Archaea and Eukarya and located downstream of the UGA codon in the coding region in Bacteria (Rother & Krzycki, 2010). As UAG does act as a stop codon in Methanosarcina spp., a similar essential pyrrolysine insertion sequence (PYLIS) element was proposed act immediately downstream of the in-frame amber codon in Methanosarcina mtmB genes, directing pyrrolysine insertion at specific UAG codons (Namy, Rousset, Napthine, &

Brierley, 2004; Theobald-Dietrich, Giege, & Rudinger-Thirion, 2005). However, a bioinformatics-based study found that the likely secondary structure of the sequence downstream of the in-frame UAG codon in several mtbB and mttB was dissimilar from the putative PYLIS element in mtmB (Zhang, Baranov, Atkins, &

18 Gladyshev, 2005). An in vivo study in M. acetivorans better explored the role of the putative PYLIS element in achieving UAG read-through (Longstaff, Blight,

Zhang, Green-Church, & Krzycki, 2007). UAG translation as pyrrolysine was monitored in both recombinant mtmB and the bacterial gene uidA engineered with an in frame UAG codon. Context immediately downstream of the UAG did increase the amount of full-length protein detected. However, this context was not required as translation of the amber codon as pyrrolysine was still achievable to 20-30% in the absence of the putative PYLIS element.

1.4.3 Pyrrolysine biosynthesis

After the discovery of the genes encoding pyrrolysyl-tRNA synthetase and tRNAPyl, it was noted that the products of the three genes immediately downstream of pylT and pylS in the Methanosarcina species, termed pylB, pylC, and pylD, were most likely involved in pyrrolysine biosynthesis (Srinivasan et al.,

2002). This role was hypothesized based on sequence homologies of the putative protein products of these three genes to enzymes involved in biosynthetic pathways. Understanding of pyrrolysine biosynthesis was greatly informed by recombinant studies in Escherichia coli (Longstaff et al., 2007).

David Longstaff and coworkers in our laboratory demonstrated that pyrrolysine biosynthesis was achievable in E. coli. Pyrrolysine was incorporated at the UAG position in MtmB produced in E. coli expressing the M. acetivorans genes pylB, pylC, pylD, pylT, and pylS. The identity of the UAG-encoded residue was confirmed by mass spectrometry to be pyrrolysine. Furthermore, pyrrolysine

19 could be detected using PylS-based assays in methanol extracts of E. coli expressing only pylB, pylC, and pylD. This latter observation distinguished pyrrolysine biosynthesis from selenocysteine biosynthesis, which is dependent upon tRNASec. UAG read-through could not be detected in the absence of one of the three biosynthetic genes. Additionally, no PylS substrate was present in extracts of E. coli strains that lacked either pylB, pylC, or pylD. Collectively, this study indicates that the expression of pylB, pylC, and pylD are necessary and sufficient for pyrrolysine biosynthesis. These observations also reveal pyrrolysine precursors are common between the metabolism of the Methanosarcinaceae and

Enterobacteriaceae.

A number of pyrrolysine biosynthetic pathways have been proposed, based on the possible precursors available between Methanosarcinaceae and

Enterobacteriaceae and the sequence homologies of PylB, PylC, and PylD to enzymes of known functions (Ambrogelly, Palioura, & Soll, 2007; Krzycki, 2004;

Longstaff et al., 2007). Common among all proposed pyrrolysine biosynthetic pathways is that one intact lysine acts as the precursor of the lysyl-moiety of pyrrolysine. However, considering the biosynthetic pathways of most amino acids, a number of D-amino acids have been proposed as possible precursors of the ring moiety, including D-proline, D-glutamate, D-isoleucine, or D-ornithine.

Recently Olivier Namy and coworkers demonstrated a significant increase in

UAG read-through in a recombinant E. coli strain expressing pylB, pylC, pylD, pylT, and pylS when this strain was cultured in the presence of D-ornithine

(Namy et al., 2007). No such increase was observed this strain was cultured in

20 media supplemented with D-proline, D-glutamate, or D-isoleucine. It was concluded that D-ornithine was likely the ring precursor of pyrrolysine, although a biosynthetic pathway incorporating the steps catalyzed by PylB, PylC, and PylD was not proposed, nor was the UAG read-through event demonstrated to be due to increased incorporation of pyrrolysine.

PylB has been proposed to belong to the radical SAM superfamily of enzymes (Nicolet & Drennan, 2004; Srinivasan et al., 2002). A CXXXCXXC (in which X is any amino acid) motif is found in all enzymes of this family. This motif coordinates a oxygen labile [4Fe-4S] cluster, which is unique in that it is ligated by only these cysteines and one iron remains unligated. The [4Fe-4S] cluster catalyzes the reductive cleavage of S-adenosylmethionine (SAM) to methionine and a 5’deoxyadenosyl radical (Frey & Magnusson, 2003). This radical then initiates the reaction specific to the enzyme. Radical SAM enzymes either catalyze reactions by using SAM as a cofactor, resulting in the regeneration of

SAM after the completion of the reaction mechanism, or as an oxidizing substrate. The formation of a 5’-deoxyadenosine radical necessary for catalysis is common between radical SAM enzymes and the coenzyme B12

(adenosylcobalamin) family of enzymes. SAM synthesis requires a much less complicated biosynthetic pathway and lower energy expenditure when compared to adenosylcobalamin, prompting some to refer to SAM as the “poor man’s adenosylcobalamin” (Frey, 1993; Frey, Ballinger, & Reed, 1998). As of 2008, the radical SAM family of enzymes is predicted to include over 2800 protein sequences (Frey, Hegeman, & Ruzicka, 2008). Members belonging to the radical

21 SAM family catalyze a wide range of reactions, including amino mutase reactions

(lysine 2,3-aminomutase), glycyl radicalization (pyruvate formate lyase activase), and sulfur insertion reactions (biotin synthase). PylB bears closest similarity to biotin synthase (Srinivasan et al., 2002). All PylB sequences closely align to the

CXXXCXXC domain responsible for [4Fe-4S] cluster coordination and glycine- rich regions throughout that likely play a role in SAM binding (Figure 1.5) (Vey &

Drennan, 2011). It has been hypothesized that PylB plays a key role in the synthesis of the ring moiety or in the methylation of the ring of pyrrolysine starting from precursors such as D-proline, D-glutamate, D-isoleucine, or D-ornithine

(Ambrogelly et al., 2007; Longstaff et al., 2007).

Figure 1.5 Alignment of archaeal and bacterial PylB amino acid sequences with biotin synthase sequences encoded by E. coli and Bacillus subtilis. The sequence of PylB found in the CXXXCXXC domain characteristic of radical SAM enzymes is outlined in a red box. Glycine-rich motifs shown in blue boxes may be involved in SAM binding in crystal structures of radical SAM proteins. The alignment was generated with ClustalW using the BLOSUM62 matrix.

23 Figure 1.5

The PylC protein sequence is homologous to the carbamoyl-phosphate synthetase family of enzymes, including D-alanine-D-alanine ligase (Figure 1.5a)

(Longstaff et al., 2007; Srinivasan et al., 2002). The large subunit of carbamoyl phosphate synthetase catalyzes the ligation of bicarbonate to ammonia in an

ATP-dependent reaction (Anderson & Meister, 1965; Raushel, Thoden, &

Holden, 1999). D-alanine-D-alanine ligase, an enzyme critical in the peptidoglycan biosynthetic pathway, catalyses the ATP-dependent ligation of the carboxyl group of one molecule of D-alanine to the amine group of a second molecule of D-alanine (Neuhaus, 1960). PylC has thus been hypothesized to act as an ATP-dependent ligase, catalyzing the bond formation between the epsilon nitrogen of lysine to the carboxyl group of the ring or ring precursor (Ambrogelly et al., 2007; Longstaff et al., 2007).

PylD most closely aligns to dehydrogenases (Figure 1.5b), albeit sequence similarities of this protein are much lower than is seen with PylB and

PylC to enzymes of known function. A motif shown to bind NAD, NADP, or FAD in other dehydrogenases is present in the sequences of PylD (Longstaff et al.,

2007). PylD has been hypothesized to be involved in the formation of the double- bond present in the pyrroline ring of pyrrolysine.

Figure 1.6 (a) Neighbor-joining consensus tree of archaeal and bacterial PylC sequences, the large subunit of E. coli and Methanocaldococcus jannaschii carbamoyl-phosphate synthetase and E. coli and Thermotoga maritima D- alanine-D-alanine ligase. (b) Neighbor-joining consensus tree of archaeal and bacterial PylD sequences, Rhodobacter sphaeroides 3-hydroxyisobutyrate dehydrogenase, Pseudomonas fluorescens 6-phosphogluconate dehydrogenase, and Bacillus cereus leucine dehydrogenase. Sequences were aligned using ClustalW with the BLOSUM62 matrix. Trees were constructed with at least 100 replicates, and bootstrap values are indicated at each node. Scale bars below each tree represent the number of substitutions per site in the alignment.

26 Figure 1.6

1.4.4 Pyrrolysine function

It was noted early after the discovery of pyrrolysine that in-frame amber codons were found in genes encoding methylamine methyltransferases

(Srinivasan et al., 2002). The crystal structure of MtmB indicates that the pyrrolysine residue is in the active site, indicating that it likely plays a key role in catalysis (Hao et al., 2002). Furthermore, the crystallization conditions hinted at possible pyrrolysine function in MtmB. Ammonia was found in the active site of

MtmB crystals grown in (NH4)2SO4, bound to the C2 carbon of the pyrrolysine ring. This was not seen in NaCl-grown crystals. It was suggested that the pyrrolysine binds to the amine moiety of MMA and serves to orient and activate the methyl group for transfer to the cognate corrinoid protein (Hao et al., 2002;

Krzycki, 2004). However, the role of pyrrolysine in catalysis remains hypothetical.

In all genomes in which the pyl genes have since been found, genes encoding for methylamine metabolism are also found (Figure 1.4), further supporting the role of pyrrolysine in methylamine metabolism (Gaston et al.,

2011). Additionally, organisms that have a complete set of pyl genes (pylB, pylC, pylD, pylT, and either pylS (archaea) or the pylSc and pylSn pair (bacteria)) have at least one gene encoding a methylamine methyltransferase (mtmB, mtbB, mttB) with the in-frame amber codon conserved. One bacterial genome, D. autotrophicum, has been found to have an incomplete set of pyl genes (pylT, pylSn, and pylB). All methylamine methyltransferase homologs in D. autotrophicum lacks an in-frame UAG codon.

28 Other genes within Methanosarcina spp. have also been found to contain in-frame UAG codons. These genes include transposases (Gaston et al., 2011) and thg1, a tRNA(His) guanylyltransferase (Heinemann et al., 2009). Isolated from M. acetivorans, Thg1 has been demonstrated to encode for pyrrolysine.

Mutation of the pyrrolysine residue to tryptophan did not adversely affect activity of purified enzyme, indicating that pyrrolysine does not play a critical catalytic role in M. acetivorans Thg1. In-frame amber codons are not found in thg1 genes of the other pyl encoding members of the Methanosarcinaceae. Unlike the methylamine methyltransferases, it is likely that these proteins are the result of a mutation introducing an in-frame amber codon which is tolerable in the presence of active pyl genes.

1.5 Overview of thesis

While lysine has always been assumed to act as the precursor for the acyl-portion of the pyrrolysine molecule, this has never been experimentally verified. In Chapter 2 of this thesis, we demonstrate that lysine is incorporated into pyrrolysine using a newly developed thin layer chromatography system. We conclude that lysine is the sole precursor of the entire carbon and nitrogen skeleton of pyrrolysine using stable isotope labeling and mass spectrometry.

In Chapter 3, we provide evidence that the presence of D-ornithine makes

PylB expendable in achieving UAG read-through in recombinant E. coli expressing pylBCDTS. We suggest that D-ornithine acts as an analog of the product of PylB enzymatic activity but is not a genuine pyrrolysine precursor as it

29 is only incorporated into the demethylated pyrrolysine analog, desmethylpyrrolysine. Furthermore, these studies enable us to place PylB as the first enzyme in the pyrrolysine biosynthetic pathway and suggest a product of

PylB, which acts as the ring precursor.

We present in Chapter 4 a biosynthetic pathway of D-ornithine-derived desmethylpyrrolysine, catalyzed by PylC and PylD. Mass spectrometry studies and immunoblot analysis allow us to propose the desmethylpyrrolysine pathway intermediate, as well as order the enzymes in the pathway. A potential mechanism for PylB is also proposed, based on a series of deuterium labeling studies. Finally, we present a complete pathway for pyrrolysine biosynthesis.

Chapter 2

PYRROLYSINE IS BIOSYNTHESIZED ENTIRELY FROM LYSINE

2.1 Introduction

As mentioned in Chapter 1, critical to the understanding of pyrrolysine biosynthesis was the observation that E. coli expressing M. acetivorans pylTSBCD and M. barkeri mtmB1 can incorporate endogenously-produced pyrrolysine into MtmB at the UAG-encoded position (Longstaff et al., 2007). The residue found at this position was determined by mass spectrometric studies to be pyrrolysine, thus suggesting that the metabolic precursors of pyrrolysine must be common between a methanogenic archaea and an enteric bacteria. It was also determined through PylS-based in vitro assays that E. coli expressing only pylBCD is able to produce pyrrolysine as a free amino acid in the cytoplasm, in the absence of tRNAPyl and PylS. However, in the absence of any one of pylB, pylC, or pylD no pyrrolysine could be detected either with in vitro PylS based assays or incorporated into MtmB, successfully demonstrating that all three biosynthesis genes are needed for pyrrolysine production. This indicated that the

31 biosynthesis of pyrrolysine was indeed unique from that of selenocysteine, the

21st amino acid, which is synthesized from serine after tRNASec is aminoacylated with serine by the seryl-tRNA synthetase.

With the demonstration that pyrrolysine could be biosynthesized in E. coli, and taking into account the structure of pyrrolysine and the homologies of the three biosynthetic proteins to proteins of known function, potential precursors and biosynthetic pathways were proposed. While a number of potential ring precursors were hypothesized, lysine serving as the lysyl-chain portion of the pyrrolysine molecule was common to all proposed pathways. Here we present a thin layer chromatography (TLC) system for separating pyrrolysine from other metabolites extracted from E. coli. This TLC methodology was used to demonstrate radiolabelled lysine incorporation into pyrrolysine. We also present mass spectrometric studies that reveal that lysine serves as the sole precursor of pyrrolysine.

2.2 Experimental procedures

2.2.1 Organisms and plasmids

Escherichia coli BL21 Tuner (DE3) (Novagen, Inc, Madison, WI) transformed with plasmids pK13, bearing pylBCD under the control of an IPTG-inducible T7 promoter, pK14 (pylBD), pK15 (pylCD), pK16 (pylBC) were constructed previously (Longstaff et al., 2007), using pACYCDuet-1 (Novagen, Inc., Madison,

WI) as a parent plasmid. These constructs were used for recombinant pyrrolysine

32 biosynthesis, extraction, and analysis by thin layer chromatography. Primers

MtmBNdeIF (5’-CATATGACATTTAGAAAATCATTTG-3’) and MtmBCHisXhoI (5’-

CTCGAGTTATTATTATTATTAGTGGTGGTGGTGGTGGTG

TCCTCCGAATACAAGTCCCAGGTCTTCGAGCTTCTTCCT-3’) were used to

PCR amplify the M. barkeri mtmB1 gene from pDLBAD (Longstaff et al., 2007) and engineer the addition of a C-terminal GGHHHHHH tag to MtmB. This altered mtmB1 gene was then ligated into pDLBAD using NdeI and XhoI sites, creating pDLBADHis. E. coli BL21 Tuner (DE3) strains bearing the plasmids mentioned above (pK13, pK14, pK15, pK16, or pACYCDuet-1) were each co-transformed with pDLBADHis (bearing pylTS behind an IPTG-inducible promoter and mtmB1 downstream of an arabinose-inducible promoter) for recombinant MtmB expression where MtmB bears a C-terminal hexahistidine tag.

2.2.2 Growth conditions for recombinant biosynthesis of pyrrolysine

An overnight culture of E. coli BL21 Tuner (DE3) bearing pK13 was cultured in 3 ml Luria-Bertani (LB) liquid medium supplemented with 34 µg/ml chloramphenicol at 37oC with shaking. This culture was subsequently used to inoculate 500 ml LB with 34 µg/ml chloramphenicol. At OD600 0.4-0.6, 80 µM isopropyl !-D-1- thiogalactopyranoside (IPTG) was added to induce expression of pylBCD. After three hours further incubation, the cells were pelleted and washed with 50 mM 3-

(N-morpholino)propanesulfonic acid (MOPS), pH 7.2. The cell pellet was stored at -20oC until used for organic solvent extraction. This methodology was also

33 used with E. coli strains pK14, pK15, and pK16 to investigate the possible accumulation of pyrrolysine biosynthetic intermediates.

2.2.3 Growth conditions for recombinant radiolabelled biosynthesis of pyrrolysine

Overnight cultures of E. coli BL21 Tuner (DE3) bearing pK13 or pACYCDuet-1 were grown in M9 minimal medium supplemented with 0.2% glucose, 2 mM

MgSO4, 80 µM CaCl2, 36 µM FeSO4, 1 mM each of the 20 canonical amino acids, and 34 µg/ml chloramphenicol. This media will be referred to as M9-SAG

(salts, amino acids, glucose) from this point on. Three-hundred microliters of each overnight culture was used to inoculate 70 ml of the same medium.

o Cultures were grown with shaking at 37 C to OD600 0.4-0.6. Cells were pelleted, washed twice with 50 mM MOPS, pH 7.2, and resuspended in 12.5 ml of the media described above except that 100 µM L-lysine was radiolabelled with uniformly labelled 14C-L-lysine (220 dpm/pmol) (Moravek Biochemicals and

Radiochemicals, Brea CA). Cell suspensions were induced with 80 µM IPTG for

1 hour in water-jacketed flasks at 37oC with stirring. Cells were then pelleted, washed twice in 50 mM MOPS, pH 7.2, and cell wet-weights were measured.

Cell pellets were stored at -20oC until used for organic solvent extraction.

34 2.2.4 Extraction of recombinantly expressed pyrrolysine using organic solvents

Methanol was added to cell pellets at a concentration of 0.5 mg cell wet weight/ml methanol. Cells were crushed in methanol with a mortar and pestle to extract methanol-soluble components. Insoluble cellular components were removed by centrifugation at 16,100 xg for 10 minutes with the supernatant then being removed to fresh microcentrifuge tubes. Ethyl acetate was added (80% ethyl acetate:20% methanol v/v) and tubes mixed by inversion 4-6 times. Tubes were centrifuged at 16,100 xg for 25 minutes, and the supernatant was again removed to fresh tubes. The cell extracts were then concentrated by vacuum centrifugation to concentrations between 1 mg cells (wet weight) per µl to 5 mg cells/µl. These extracts will be referred to as organic solvent extracts from this point on.

2.2.5 Ninhydrin-based standardization of concentrations of cell extracts

A ninhydrin-based assay was used to ensure equivalent concentrations of organic solvent extracts were analyzed by TLC. A solution comprised of 200 mg ninhydrin dissolved in a mixture of 7.5 ml ethylene glycol and 2.5 ml of 4 N sodium acetate buffer, pH 5.5 and 250 µl of a stannous chloride suspension (50 mg of SnCl2 in 500 µl ddH2O) (Starcher, 2001). Between 1-5 µl of the methanol/ethyl acetate extract was diluted with methanol to a total volume of 100

µl, to which 100 µl of the ninhydrin solution was added. This was then incubated at 100oC for 1-2 hours. Absorbance at 575 nm was measured in a plate reader 35 (Molecular Devices Versa-Max) and organic solvent extracts were adjusted with methanol as necessary.

2.2.6 Thin layer chromatography separation of pyrrolysine

Organic solvent extracts or standard amino acid solutions (Acros Organics, Geel,

Belgium; MP Biomedicals, Solon, OH) were spotted onto a 20 cm x 20 cm plastic-backed cellulose thin layer chromatography (TLC) plate with UV indicator

(Macherey-Nagel CEL400-10 UV254, Macherey-Nagel, Bethlehem, PA).

Chemically synthesized pyrrolysine and 2-amino-6-((R)-tetrahydro-furan-2- carboxamido)hexanoic acid (2-Thf-lys) were gifts from the lab of Michael Chan

(Hao et al., 2004; Li et al., 2009). Plates were developed twice in the same dimension in a resolving system of 35% butanol:38.5% acetone:3.5% glacial acetic acid:23% ddH2O (v/v/v/v). Once dry, plates were either sprayed with

0.25% ninhydrin dissolved in acetone and visualized after incubation at 100oC, or for radiolabel incorporation studies were exposed to a general purpose phosphor screen (GE Healthcare, Piscataway, NJ) for at least 24 hours and then visualized using a STORM Phosphorimager.

2.2.7 Pixel density correlation to pyrrolysine concentration in organic solvent extracts using TLC

Increasing amounts of chemically synthesized pyrrolysine (Hao et al., 2004) was added to aliquots of an organic solvent extract of pACYCDuet-1 and these supplemented extracts were spotted onto the TLC plate alongside an organic

36 solvent extract of pK13. The TLC and ninhydrin staining methodology was carried out as described above. Stained plates were scanned and ImageJ was used to measure the pixel density of the pyrrolysine spot in the resulting images.

After background correction, relative pixel density was plotted versus the amount pyrrolysine added to pACYCDuet-1 extracts. The resulting standard curve was used to determine the amount of pyrrolysine in pK13 organic solvent extracts.

2.2.8 Growth conditions for MtmB(His)6 production for labelling of pyrrolysine with stable isotope

E. coli BL21 Tuner (DE3) co-transformed with pDLBADHis and pK13 was incubated in 3 ml M9 minimal media supplemented with 100 µg/ml ampicillin, 34

µg/ml chloramphenicol, and with salts, glucose, and amino acids as described in section 2.2.3 overnight with shaking at 37oC. The 3 ml overnight culture was used to inoculate 1 L of M9–SAG medium. The culture was incubated at 37oC with shaking until an OD600 0.4-0.6 was reached. The cells were subsequently pelleted, washed with 50 mM MOPS, pH 7.2, and resuspended in 1 L M9 minimal media supplemented as described above with the exception of 1 mM

12 14 13 15 C6 N2-L-lysine being substituted for 1 mM of either C6 N2-L-lysine (99% enrichment), !-15N-L-lysine (95% enrichment), or $-15N-L-lysine (95% enrichment) (Cambridge Isotope Laboratories, Inc., Andover, MA). At this time, the medium was also supplemented with 80 µM IPTG to induce expression of pylBCDTS. After one-hour incubation at 37oC with shaking, L-arabinose was added to the growing culture at a final concentration of 0.02% to induce

37 expression of mtmB1. After an additional 2 hours of incubation, cells were pelleted, washed with 50 mM MOPS, pH 7.2, and stored at -20oC.

2.2.9 Enrichment of MtmB(His)6

MtmB is present in E. coli as inclusion bodies To achieve sufficient separation of

MtmB(His)6 from other cellular proteins which might interfere in mass spectrometric analysis, the cell lysate was subjected to differential centrifugation in increasing concentrations of urea followed by nickel affinity chromatography in urea. Cell pellets were resuspended in 50 mM MOPS, pH 7.2 and were lysed using a French pressure cell operated at 10,000 PSI). This lysate was centrifuged at 1000 xg for 5 minutes. The supernatant was transferred to a fresh tube, and subsequently centrifuged at 25,000 xg for 25 minutes. The resulting pellet was resuspended in 3.5 M urea, 50 mM MOPS pH 7.2 and centrifuged again at 25,000 xg for 25 minutes. The pellet was resuspended in 7 M urea, 50 mM MOPS pH 7.2 and centrifuged once again as before. The supernatant was loaded onto a 1 ml Ni-activated HiTrap Chelating HP column (GE Healthcare

BioSciences, Piscataway, NJ) that was equilibrated with 10 mM imidazole, 500 mM NaCl, 7 M urea in 20 mM sodium phosphate buffer, pH 7.2. A 40 ml linear gradient (1 ml/min) between 10 mM imidazole – 500 mM imidazole in the same buffer was run to elute MtmB, which elutes at approximately 220 mM imidazole.

Fractions (1 ml each) were assayed for MtmB by anti-MtmB immunoblot.

38 2.2.10 Anti-MtmB immunoblot

Fractions suspected of containing MtmB were concentrated 10-fold using centrifugal filter units with a 10,000 Da cutoff (Millipore, Billerica, MA). These concentrated fractions were then screened for MtmB. Samples were loaded onto a 12.5% acrylamide gel containing 1% SDS (SDS-PAGE) and electrophoresed at

70 V (Laemmli, 1970). Proteins were transferred onto a Hybond-P polyvinylidene difluoride membrane (GE Healthcare, Piscataway, NJ) in 80% Laemmli buffer:20% methanol (v/v) at 40 V for 2 hours. After blocking in 5% milk powder and 0.9% NaCl in 10 mM Tris-HCl, pH 7.4 for 2 hours, rabbit polyclonal anti-

MtmB was added as the primary antibody. Horseradish peroxidase conjugated donkey anti-rabbit (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was added as the secondary antibody after washing the blot 3 times in 0.9% NaCl in 10 mM

Tris-HCl, pH 7.4. The blot was washed again and developed in a solution of

0.04% 4-chloro-1-napthol, 17% ethanol, and 50 µL 30% hydrogen peroxide.

2.2.11 Sample preparation and mass spectrometric analysis of MtmB(His)6

Fractions with the strongest full-length MtmB immunoblot response were subjected to SDS-PAGE as above. Gels were prepared for mass spectrometry as described on The Ohio State University Campus Chemical Instrument Center website. Briefly, gels were fixed in a solution of 50% methanol, 10% glacial acetic acid, and 40% ddH2O (v/v/v/v) for 25-30 minutes with shaking. The gel was then washed in ddH2O three times for five minutes each, then proteins were stained for at least one hour with shaking using Bio-Safe Coomassie (Bio-Rad, Hercules,

39 CA). Gels were destained by washing with ddH2O for 2-3 hours with shaking, the water being changed 3-4 times and were then stored at 4oC in a 5% acetic acid solution until band excision and in-gel digestion. The 50 kDa bands were excised, digested in-gel with chymotrypsin, and analyzed by capillary-LC/MS/MS by Liwen Zhang and Kari Green-Church at the CCIC Mass Spectrometry and

Proteomics Facility (Gaston, Zhang, Green-Church, & Krzycki, 2011).

2.3 Results

2.3.1 TLC separation of recombinantly expressed pyrrolysine

Pyrrolysine is biosynthesized in E. coli expressing pylBCD. Pyrrolysine accumulates in the cytoplasm and can be detected in E. coli extracts using PylS based assays. While these synthetase-based assays can detect the presence of pyrrolysine, they could not be used to study the incorporation of label into pyrrolysine using labelled precursors. To begin testing possible pyrrolysine precursors by radiolabel incorporation using the E. coli recombinant system, a

TLC system was developed to separate pyrrolysine from not only the twenty canonical amino acids but also other E. coli metabolites.

The twenty canonical amino acids can be separated from one another after spotting on a cellulose TLC plate and resolving in a system of 37.5% n- butanol, 35% acetone, 23% ddH2O, and 3.5% glacial acetic acid (v/v/v/v). TLC plates were developed a second time in the same dimension in the same resolving system after air drying for 2-3 hours in order to increase the resolution

40 of amino acids. Spots are visualized after staining the plates with ninhydrin

(Figure 2.1). The colors characteristic of each amino acid appear after ninhydrin staining on plates that are treated with the U254 indicator. Pyrrolysine migrates to a position with an Rf of 0.57 in this system (Table 2.1). It can be noted that pyrrolysine also migrates differently than pyrrolysine analog 2-tetrahydrofuran- lysine, in which an oxygen replaces the nitrogen at the 2-position of the pyrroline ring, and the methyl group on the ring is absent (Li et al., 2009).

Figure 2.1 Pyrrolysine can be resolved as a separate spot from the twenty canonical amino acids using TLC. Commercially available standards of the canonical twenty amino acids are spotted (5 µg each) onto a cellulose TLC plate. Chemically synthesized pyrrolysine (Pyl) (1.5 µg) and pyrrolysine analog 2-tetrahydrofuran-lysine (2-Thf-lys) (2.4 µg) (were a gift from Michael Chan. TLC plates were developed twice in 37.5% n-butanol, 35% acetone, 23% ddH2O, and 3.5% glacial acetic acid (v/v/v/v) in the same dimension. Spots are visualized using ninhydrin staining.

Amino acid Measured Rf His 0.29 Arg 0.32 Lys 0.28 Asp 0.22 Glu 0.36 Phe 0.75 Ala 0.46 Leu 0.78 Met 0.68 Ile 0.77 Trp 0.71 Pro 0.55 Val 0.66 Cys 0.67 Gly 0.34 Gln 0.31 Asn 0.24 Ser 0.34 Thr 0.45 Tyr 0.64 Pyl 0.57 2-Thf-lys 0.64 cadaverine 0.40

Table 2.1 Rf values of the 20 canonical amino acids, chemically synthesized pyrrolysine (Pyl), pyrrolysine analog 2-amino-6-((R)-tetrahydro-furan-2- carboxamido)hexanoic acid (2-Thf-lys), and cadaverine after chromatographic separation on cellulose TLC plates developed twice in a solvent system of 35% butanol:38.5% acetone:3.5% glacial acetic acid:23% ddH2O (v/v/v/v). Amino acids were detected by ninhydrin staining. Commercially-available standards were used in all cases except for pyrrolysine and 2-Thf-lys, which were chemically synthesized in the lab of Michael Chan.

Ninhydrin-stainable amino acids and metabolites extracted from E. coli in

20% methanol/80% ethyl acetate can also be separated from pyrrolysine using this TLC system (Figure 2.2). A spot can be resolved in organic solvent extracts of E. coli bearing pK13 that co-migrates with chemically synthesized pyrrolysine.

After spotting organic solvent extracts of E. coli bearing only the pACYCDuet-1 vector, no ninhydrin-stainable spot is visible that co-migrates with chemically synthesized pyrrolysine. If chemically-synthesized pyrrolysine is added to the vector-only extract, a spot is resolved that co-migrates with pyrrolysine chromatographed alone, indicating that the presence of the E. coli extract does not change the migration of pyrrolysine in the TLC system. It should be noted that in this system pyrrolysine always migrates just above a yellow spot in E. coli extracts after staining with ninhydrin, which based on Rf value and characteristic color is most likely proline.

The TLC system was then used to analyze organic solvent extracts of E. coli bearing pK14, pK15, or pK16 for the possible accumulation of intermediates in the pyrrolysine biosynthetic pathway (Figure 2.3). No additional spots were visible in any of these extracts after ninhydrin staining. However, polar compounds do not extract efficiently using the methanol/ethyl acetate extraction methodology and any possible intermediates may potentially have been excluded.

Figure 2.2 TLC of chemically-synthesized pyrrolysine standard and extracts of E. coli bearing only the vector (pACYCDuet-1), E. coli bearing only the vector with chemically-synthesized pyrrolysine added after extraction, and E. coli bearing pK13 (pylBCD). Cellulose TLC plates were developed in the same dimension twice in a solvent system of 35% butanol:38.5% acetone:3.5% glacial acetic acid:23% ddH2O (v/v/v/v). Spots were visualized after staining with ninhydrin. The pyrrolysine spot is indicated by the arrow.

Figure 2.3 TLC of organic solvent extracts of E. coli bearing pACYCDuet-1 (vector only), pK13 (pylBCD), pK14 (pylBD), pK15 (pylCD), or pK16 (pylBC). Cellulose TLC plates were developed twice in 35% butanol:38.5% acetone:3.5% glacial acetic acid:23% ddH2O (v/v/v/v) in the same dimension. Amino acids and metabolites were visualized after staining with ninhydrin. A pyrrolysine spot is only visible in cells bearing pK13. No additional spots could be detected in pK14, pK15, or pK16.

46 2.3.2 Quantification of pyrrolysine produced by recombinant E. coli using

TLC

In addition to using this TLC system as a screen for potential precursors or biosynthetic intermediates, the possibility arose to use measured pixel density of known pyrrolysine concentrations to determine the amount of pyrrolysine being produced by the recombinant E. coli strain. Increasing amounts of chemically synthesized pyrrolysine were added to pACYCDuet-1 organic solvent extracts before spotting on the cellulose TLC plate. On the same plate was spotted a pK13 organic solvent extract (Figure 2.4a). After development and ninhydrin staining, pixel density of pyrrolysine spots was measured using ImageJ software.

A linear correlation between the measured pixel density and the amount of pyrrolysine added to the extracts was demonstrated (Figure 2.4b). The pixel density of the pyrrolysine spot from the pK13 extract was measured and using the standard curve generated from pACYCDuet-1 extracts, it was determined that organic solvent extracts of E. coli bearing pK13 contain approximately 2.3

µmol pyrrolysine per gram of cells (dry weight) when these cells are cultured in

LB medium.

We then tried to measure the amount of pyrrolysine in extracts of E. coli pK13 cultured in M9-SAG using the TLC system. However, pyrrolysine could not be detected in these extracts after ninhydrin staining, even when spotting twice the amount of organic solvent extract as LB-grown cells (Figure 2.5). Pixel density measurements for M9-SAG grown E. coli bearing pK13 were no higher than background.

Figure 2.4 Ninhydrin-stained TLC can be used to determine pyrrolysine concentration from a standard curve. (A) Cellulose TLC plate developed twice in 35% butanol:38.5% acetone:3.5% glacial acetic acid:23% ddH2O (v/v/v/v) and stained with ninhydrin. Organic solvent extracts of pACYCDuet-1 were supplemented with 6, 10, 14, and 18 nmol pyrrolysine before spotting onto TLC plate. Extracts of pK13 and pACYCDuet-1 without any added pyrrolysine were also spotted on the same TLC. (B) Relative pixel density of pyrrolysine spots was measured using ImageJ software and after background correction plotted versus amount of pyrrolysine added to extracts. A linear correlation was seen between the amount of pyrrolysine added to vector-only extracts and the relative measured pixel density.

48 a.

Figure 2.4

Figure 2.5 TLC of organic solvent extracts from E. coli bearing either pACYCDuet-1 (vector) or pK13 (pylBCD) cultured in LB or M9-SAG medium. For LB-grown cells, extracts equivalent to 30 mg cells (wet weight) were spotted. For M9-grown cells, extracts equivalent to 60 mg cells (wet weight) were spotted. The arrow indicates the migration of pyrrolysine, which can be seen only in the pK13 LB grown extract. No pyrrolysine is visible in pK13 M9-SAG grown cells.

Given the ability to separate pyrrolysine from other E. coli metabolites, it was determined that this TLC system, in conjunction with the recombinant E. coli pylBCD expression system, could be used to track the incorporation of radiolabelled precursors into pyrrolysine. However, we would not be able to use the TLC methodology to measure the specific activity of any potential radiolabel incorporation as the amount of pyrrolysine in organic solvent extracts derived from M9-SAG grown cells could not be measured.

2.3.3 Radiolabelled lysine is incorporated into recombinantly biosynthesized pyrrolysine

Considering the structure of pyrrolysine, it has been hypothesized that lysine serves as a precursor of the acyl portion of the pyrrolysine molecule

(Ambrogelly et al., 2007; Longstaff et al., 2007). Thus, lysine was the first potential precursor to be studied using radiolabel tracer experiments. Lysine was particularly attractive to use in radiolabel tracer experiments in view of lysine metabolism in E. coli. Lysine is either incorporated into protein or is decarboxylated to cadaverine and exported out of the cell, and the lysine biosynthetic pathway in E. coli is irreversible. This allowed for in vivo studies using radiolabelled lysine without extensive time courses.

E. coli bearing either pACYCDuet-1 or pK13 were grown in M9 minimal media supplemented with 220 dpm/pmol uniformly-labelled 14C-L-lysine and the remaining 19 canonical amino acids, with the radiolabelled lysine added at the

51 time of pylBCD induction. After methanol and ethyl acetate soluble metabolites are extracted, the radiolabel incorporation was investigated using the aforementioned TLC system. This TLC plate was developed and visualizing using storage-phosphor autoradiography, and compared to one on which chemically synthesized pyrrolysine was resolved and detected by ninhydrin staining. In the vector-only control, only two primary radiolabelled spots were detectable – one that co-migrates with lysine and the second that co-migrates with cadaverine (Figure 2.6). It should be noted that the low intensity seen for the lysine spot is likely due to the exclusion of polar compounds seen with the methanol/ethyl acetate extraction methodology. In E. coli expressing pylBCD, these two spots are detectable in addition to a third spot that co-migrates with pyrrolysine.

The inability to measure the amount of pyrrolysine in these extracts prohibited us from determining the specific activity of the radiolabelled pyrrolysine spot. Thus, to determine the amount of lysine incorporation into pyrrolysine, we turned to mass spectrometry of pyrrolysine containing protein MtmB.

Figure 2.6 TLC of extracts of E. coli bearing only the vector (pACYCDuet-1) and E. coli bearing pK13 (pylBCD) after incubation with uniformly labelled 14C-L- lysine. Cellulose TLC plates were resolved in the same dimension twice in a solvent system of 35% butanol:38.5% acetone:3.5% glacial acetic acid:23% ddH2O (v/v/v/v). Spots were visualized by phosphor autoradiography after exposure to a general purpose phosphor screen for at least 24 hours. The spot closest to the origin migrates with the same Rf as lysine, whereas the spot migrating above migrates to the position observed for cadaverine in the same system. The pyrrolysine spot is indicated by the arrow.

2.3.4 Expression and enrichment of MtmB(His)6 from M9-SAG

Previous work has demonstrated that MtmB is produced as inclusion bodies in E. coli, and can be solubilized between 5-7 M urea (Longstaff et al.,

2007). This property had been exploited to remove some cellular proteins by differential centrifugation in increasing urea concentrations. However, when attempting mass spectrometry of MtmB recombinantly produced in M9-SAG, other cellular proteins interfered too much for the low amount of full-length MtmB we could achieve given the given the lower pyrrolysine production seen with M9-

SAG medium (Figure 2.5). We thus could not use established methodologies for enriching MtmB and turned to a C-terminally His-tagged version of the protein as well as a modified culturing protocol to increase the concentration of full-length

MtmB.

We had observed an increase in doubling time of E. coli bearing pK13 and pDLBADHis from approximately 20 minutes to 60 minutes upon induction of pylBCDTS in both LB and M9-SAG media. When inducing the expression of these genes with IPTG at inoculation followed by mtmB1-his induction at OD600

1.2, as had previously been documented, no full-length MtmB could be detected

(Longstaff, 2007a). However, induction of pylBCDTS at OD600 0.6 followed by the mtmB1-his induction one hour later did result in detectable levels of full-length

MtmB. In addition to the delayed induction, we paired differential centrifugation in increasing urea concentrations with nickel-affinity chromatography in 7 M urea to successfully achieve enrichment of full-length MtmB(His)6 for MS/MS analysis.

2.3.5 All carbon and all nitrogen in pyrrolysine are derived from two molecules of lysine

The incorporation of radiolabel into pyrrolysine as detected by TLC strongly suggested that lysine is a precursor of pyrrolysine. However, this TLC system could not be easily used to gauge the number of labelled carbons being incorporated given the inability to measure total pyrrolysine concentrations in the organic solvent extracts. Stable isotope labelling experiments were undertaken to more precisely determine the degree of lysine incorporation into pyrrolysine that is incorporated into MtmB(His)6.

E. coli transformed with pK13 and pDLBADHis was cultured in M9 minimal

13 15 media supplemented with 1 mM C6 N2-L-lysine and 1 mM each of the 19 other canonical amino acids to allow for the incorporation of stable isotope labelled lysine into biosynthesized pyrrolysine, which is subsequently co-translationally inserted into MtmB at position 202. After partial purification and electrophoresis on an SDS polyacrylamide gel, the 50 kDa band was excised, and was subjected to in-gel chymotryptic digestion. The pyrrolysine-containing peptide in MtmB,

194AGRPGMGVOGPETSL208 had been characterized previously after expression in LB medium (Longstaff et al., 2007). This peptide was now studied after expression in M9 minimal medium supplemented as described using LC/MS on an LTQ Orbitrap, an instrument which permits for high mass accuracy measurements. As there are no lysine residues in this peptide, any increase in the m/z of the peptide can be attributed to labelled lysine incorporation into

55 pyrrolysine. This peptide was subsequently subjected to collision-induced dissociation tandem mass spectrometry (CID MS/MS) to better characterize each amino acid residue in the peptide, especially the pyrrolysine residue itself.

When MtmB expression was induced in media supplemented with

12 14 C6 N2-L-lysine, this peptide was detected in two forms with the amino acid at position 199 either being methionine or methionine sulfoxide, each form further detectable as two different ions (Table 2.2). The observed m/z of all of these ions are within 0.25-1.91 ppm of the theoretical m/z if the amino acid at position 202 is pyrrolysine. The measured mass of the residue at position 202 in both of these peptides also corresponds to pyrrolysine (Table 2.2, 2.3, 2.4).

With the encoding of pyrrolysine in MtmB by the UAG position of mtmB1 transcript confirmed in E. coli grown in minimal medium, the degree of

13 15 incorporation of C6 N2-L-lysine into pyrrolysine was investigated. As with the unlabelled control, both methionine and methionine sulfoxide containing peptides were detected as two different ions. When compared to the unlabelled peptides, the observed m/z of these peptides indicated an increase in the mass of the peptide by 15 Da (Table 2.2). These observed m/z are within 2.53-5.44 ppm of theoretical m/z in which pyrrolysine is entirely comprised of 15N and 13C. CID of these labelled peptides indicate that only the mass of the pyrrolysine residue at position 202 increased, and this increase corresponded to the 15 Da increase seen in the observed peptide masses (Table 2.2, 2.5, 2.6). These data are consistent with the mass expected if pyrrolysine is wholly composed of 15N and

13C when synthesized in the presence of heavy lysine. Pyrrolysine is therefore

56 entirely derived from two molecules of lysine, after the elimination of one of the amine groups from one lysine.

Isotopic Peptide sequence Observed Theoretical m/z Mass O Observed compo- m/z m/z error increase Residue O mass sition of (ppm) relative to Mass increase lysine unlabelled (Da) relative to peptide unlabelled (Da) residue

12 14 2+ 2+ C6, N2 194AGRPGMGVOGPETSL208 783.4080 783.4089 0.77 - 237.05 - 522.60733+ 522.60833+ 1.91 - 2+ 2+ 194AGRPGM(OX)GVOGPETSL208 791.4065 791.4063 0.25 - 236.95 - 527.93963+ 527.94003+ 0.76 - 13 15 2+ 2+ C6, N2 194AGRPGMGVOGPETSL208 790.9225 790.9245 2.53 15.0272 252.05 14.90 527.61633+ 527.61883+ 4.74 15.0238 2+ 2+ 194AGRPGM(OX)GVOGPETSL208 798.9180 798.9220 5.00 15.0314 252.08 14.93 58 532.94753+ 532.95043+ 5.44 15.0226

Table 2.2: Comparison of pyrrolysine-containing MtmB peptide and pyrrolysine residue after expression in the 12 14 presence of L-lysine comprised of isotopes of naturally occurring abundances ( C6, N2) or uniformly labelled L-lysine 13 15 ( C6, N2) at 99% enrichment. Mass increase relative to unlabelled peptide is calculated after comparing the theoretical mass of unlabelled peptide to the observed mass of the labelled peptide. Pyrrolysine residue mass is the calculated average of the observed mass from b- and y-series ions generated by MS/MS. Pyrrolysine mass increase relative to unlabelled pyrrolysine is calculated using the average described above to the theoretical mass of unlabelled pyrrolysine (237.15 Da).

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 57.38 y14 748.15 Gly +2 156.27 y13 719.46 Arg 285.14 b3 97.26 y12 1281.65 Pro 57.04 y11 1184.39 Gly 439.29 b5 154.15 (97+57) 131.04 y10 1127.35 Met 570.15 b6 130.86 56.95 y9 996.31 Gly 627.38 b7 57.23 99.04 y8 939.36 Val 726.24 b8 98.86 237.15 y7 840.32 Pyl 963.39 b9 237.15 56.09 y6 603.17 Gly 1020.37 b10 56.98 225.94 y5 546.08 Pro 1117.23 b11 96.86 (129+97) Glu 1246.54 b12 129.31 y3 320.14 Thr 1347.67 b13 101.13 +2 Ser 717.88 b14 87.09 Leu

Table 2.3 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing mtmB1 in 12 14 2+ the presence of C6 N2-L-lysine. MS/MS data obtained from an m/z 783.4065 ion.

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 57.18 y14 756.01 Gly +2 156.33 y13 727.42 Arg 285.13 b3 97.17 y12 1297.51 Pro 382.33 b4 97.20 57.09 y11 1200.34 Gly 439.33 b5 56.90 146.90 y10 1143.25 Met(ox) 586.18 b6 146.95 57.03 y9 996.35 Gly 643.01 b7 56.83 99.09 y8 939.32 Val 742.11 b8 99.10 237.10 y7 840.23 Pyl 979.38 b9 237.27 57.07 y6 603.13 Gly 1036.41 b10 57.03 225.82 y5 546.06 Pro 1133.53 b11 97.12 (129+97) Glu 1262.57 b12 129.04 y3 320.24 Thr 1363.99 b13 101.42 +2 Ser 725.97 b14 86.95 Leu

Table 2.4 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGM(ox)GVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing 12 14 mtmB1 in the presence of C6 N2-L-lysine. MS/MS data obtained from an m/z 791.40342+ ion.

Figure 2.7 Spectra of (a) b-series and (b) y-series ions generated from CID of pyrrolysine containing peptide 194AGRPGMGVOGPETSL208. The pyrrolysine- containing peptide was analyzed from the chymotryptic digest of MtmB isolated 13 15 from E. coli expressing mtmB1 in the presence of C6 N2-L-lysine. MS/MS data obtained from an m/z 790.92242+ ion.

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 212.74 y14 755.09 Gly (156+57) Arg 285.02 b3 97.22 y12 1296.44 Pro 57.11 y11 1199.20 Gly 439.12 b5 154.10 (97+57) 130.63 y10 1142.09 Met 570.11 b6 130.99 56.96 y9 1011.46 Gly 627.25 b7 57.14 99.41 y8 954.50 Val 726.38 b8 99.13 252.00 y7 855.09 Pyl 978.47 b9 252.09 (237+15) (237+15) 56.91 y6 603.09 Gly 1035.38 b10 56.91 225.98 y5 546.18 Pro 1132.58 b11 97.20 (129+97) Glu 1261.46 b12 128.88 +2 y3 320.20 Thr 681.79 b13 101.12 +2 Ser 725.54 b14 87.50 Leu

Table 2.5 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing mtmB1 in 13 15 2+ the presence of C6 N2-L-lysine. MS/MS data obtained from an m/z 790.9225 ion.

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 57.38 y14 763.53 Gly +2 156.26 734.84 Arg 285.14 b3 154.16 y12 1312.42 Pro (57+97) Gly 439.33 b5 154.19 (97+57) 146.92 y10 1158.26 Met(ox) 586.17 b6 146.84 (131+16) 57.05 y9 1011.34 Gly 643.15 b7 56.98 99.05 y8 954.29 Val 742.37 b8 99.22 252.15 y7 855.24 Pyl 994.39 b9 252.02 (237+15) (237+15) 56.89 y6 603.09 Gly 1051.37 b10 56.98 226.18 y5 546.20 Pro (129+97) Glu 1277.57 b12 226.20 (97+129) y3 320.02 Thr 1378.61 b13 101.04 +2 Ser 733.37 b14 87.13 Leu

Table 2.6 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGM(ox)GVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing 13 15 mtmB1 in the presence of C6 N2-L-lysine. MS/MS data obtained from an m/z 798.91802+ ion.

2.3.6 The epsilon-nitrogen from one lysine molecule is eliminated during pyrrolysine biosynthesis

With mass spectrometric experiments indicating that all carbon and all nitrogen atoms in pyrrolysine are derived from two molecules of lysine, and considering there are three nitrogen atoms in pyrrolysine but four in two lysine molecules, one nitrogen thus must be lost in the pathway of pyrrolysine

13 15 biosynthesis. Using the same methodology as described for the C6 N2-L-lysine studies, we utilized minimal media supplemented with either !-15N-L-lysine or "-

15N-L-lysine to more closely investigate at the incorporation of specific lysine nitrogens within pyrrolysine.

The pyrrolysine-containing peptide 194AGRPGMGVOGPETSL208 was first analyzed after MtmB expression in the presence of !-15N-L-lysine. Both the peptide (Table 2.6) and the pyrrolysine residue (Table 2.6, Table 2.7) increased in mass by 2 Da under these conditions. The measured m/z of the peptide was within 0.25 ppm of the theoretical m/z if two 15N are present. This indicates that both alpha amine groups of two lysine molecules are retained in the synthesis of pyrrolysine.

After expression of mtmB1 in the presence of "-15N-L-lysine, both the peptide mass (Table 2.6) and pyrrolysine residue mass (Table 2.6, Table 2.7,

Table 2.8) increased by 1 Da, indicating that one of the two epsilon amines are lost between two lysine molecules. The increase of 1 Da was observed when the amino acid at position 199 was either methionine or methionine sulfoxide, each

observed as multiple ions. The observed m/z differed from the theoretical m/z of the peptide with one 15N by 1.27-1.91 ppm.

12 14 2+ 2+ C, N 194AGRPGMGVOGPETSL208 783.4080 783.4089 0.77 - 237.05 - 522.60733+ 522.60833+ 1.91 - 2+ 2+ 194AGRPGM(OX)GVOGPETSL208 791.4065 791.4063 0.25 - 236.95 - 527.93963+ 527.94003+ 0.76 - 15 2+ 2+ !" N 194AGRPGM(OX)GVOGPETSL208 792.4031 792.4033 0.25 1.9936 239.14 1.99

15 2+ 2+ #- N 194AGRPGMGVOGPETSL208 783.9084 783.9074 1.27 0.9990 238.16 1.01 522.94173+ 522.94073+ 1.91 1.0000 2+ 2+ 194AGRPGM(OX)GVOGPETSL208 791.9061 791.9048 1.64 0.9996 238.15 1.00 66 528.27313+ 528.27233+ 1.51 0.9994

Table 2.7: Comparison of pyrrolysine-containing MtmB peptide and pyrrolysine residue after expression in the presence of L-lysine comprised of isotopes of naturally occurring abundances (12C, 14N) or L-lysine heavy labelled at either the alpha nitrogen (at 95-99% enrichment) or epsilon nitrogen (at 98% enrichment). Mass increase relative to unlabelled peptide is calculated after comparing the theoretical mass of unlabelled peptide to the observed mass of the labelled peptide. Pyrrolysine residue mass is the calculated average of the observed mass from b- and y-series ions generated by MS/MS. Pyrrolysine mass increase relative to unlabelled pyrrolysine is calculated using the average described above to the theoretical mass of unlabelled pyrrolysine (237.15 Da).

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala Gly +2 56.08 y13 728.58 Arg 285.22 b3 301.23 y12 1299.60 Pro (131+16+ 57+97) Gly 439.32 b5 154.10 (97+57) Met(ox) 586.37 b6 147.05 156.02 y9 998.37 Gly b7 (99+57) Val 742.38 b8 156.01 (57+99) 239.08 y7 842.35 Pyl 981.52 b9 239.14 (237+2) (237+2) 57.01 y6 603.27 Gly 1038.65 b10 57.13 226.19 y5 546.26 Pro (129+97) Glu 1264.67 b12 226.02 (97+129) y3 320.07 Thr 1365.83 b13 101.16 Ser 1453.12 b14 87.29 Leu

Table 2.8 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGM(ox)GVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing mtmB1 in the presence of !-15N-L-lysine. MS/MS data obtained from an m/z 792.40312+ ion.

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala 2 57.46 y14 748.63 Gly 156.21 y13 1438.80 Arg 285.24 b3 97.13 y12 1282.59 Pro 382.18 b4 96.94 56.93 y11 1185.46 Gly 439.37 b5 57.19 131.09 y10 1128.53 Met 570.29 b6 130.92 57.04 y9 997.44 Gly 627.42 b7 57.13 99.04 y8 940.40 Val 726.36 b8 98.94 238.11 y7 841.36 Pyl 964.52 b9 238.16 (237+1) (237+1) 56.99 y6 603.25 Gly 1021.59 b10 57.07 97.03 y5 546.26 Pro 1118.60 b11 97.01 y4 449.23 Glu 1247.60 b12 129 y3 320.20 Thr 1348.56 b13 100.96 Ser 1435.07 b14 86.51 Leu

Table 2.9 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing mtmB1 in the presence of "-15N-L-lysine. MS/MS data obtained from an m/z 783.90842+ ion.

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 56.90 y14 756.27 Gly 156.08 y13 1454.63 Arg 285.24 b3 96.89 y12 1298.55 Pro 382.33 b4 97.09 57.15 y11 1201.66 Gly 439.14 b5 56.81 147.05 y10 1144.51 Met(ox) 586.35 b6 147.21 57.04 y9 997.46 Gly 643.35 b7 57.00 99.02 y8 940.42 Val 742.35 b8 99.00 238.14 y7 841.40 Pyl 980.50 b9 238.15 (237+1) (237+1) 56.96 y6 603.26 Gly 1037.54 b10 57.04 97.30 y5 546.30 Pro 1134.55 97.01 y4 449.00 Glu 1263.60 b12 129.05 y3 320.15 Thr 1364.70 b13 101.10 Ser 1452.14 b14 87.44 Leu

Table 2.10 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVO(ox)GPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing mtmB1 in the presence of "-15N-L-lysine. MS/MS data obtained from an m/z 791.90612+ ion.

2.4 Discussion

Shortly after the discovery of pyrrolysine, it was hypothesized that the products of pylBCD would be, at least partially, responsible for pyrrolysine biosynthesis. This hypothesis arose from the conservation of these three genes in organisms found to encode both the pyrrolysyl-tRNA synthetase and tRNAPyl, the general maintenance of the gene order, and the homologies of the gene products to proteins of known function. Expression of pylBCD in E. coli demonstrated that the products of these three genes were necessary and sufficient for in vivo pyrrolysine biosynthesis. These sets of experiments established the genes necessary for in vivo pyrrolysine production and demonstrated that the pyrrolysine precursors are not unique to methanogens but rather are metabolites common between methanogenic archaea and enteric bacteria. Given the vast knowledge of E. coli metabolism, our studies into pyrrolysine biosynthesis became focused using the recombinant system.

It had been previously demonstrated that pyrrolysine, along with other metabolites, could be extracted from E. coli using methanol and ethyl acetate

(Larue, 2009). This extraction methodology was utilized to develop a TLC system in which pyrrolysine was separated as a distinct, spot from other ninhydrin- stainable E. coli metabolites. In E. coli lacking pylBCD, no visible spot co- migrates with pyrrolysine after staining with ninhydrin. This TLC system separates pyrrolysine from the twenty canonical amino acids as well as a close pyrrolysine analog 2-Thf-lys. Key to using this system for in vivo radiolabelling

studies, pyrrolysine also separated from cadavarine, the immediate degradation product of lysine.

Considering the structure of pyrrolysine and the homology of PylC to members of the carbamoyl phosphate synthetase family, it was hypothesized by our group as well as other groups (Ambrogelly et al., 2007; Longstaff et al., 2007) that lysine acts as a precursor to the lysyl chain portion of the pyrrolysine molecule, with the ring precursor likely being ligated onto the epsilon nitrogen of a lysine molecule in a PylC-dependent fashion. Using the newly developed TLC system and recombinant pyrrolysine biosynthesis, we demonstrated that uniformly 14C-labelled lysine is incorporated into pyrrolysine. Only spots co- migrating with lysine, cadaverine, and pyrrolysine were detectible in E. coli bearing pk13 following 14C-lysine labelling. This indicates that there is little accumulation of pyrrolysine biosynthetic intermediates, provided that the intermediates can be efficiently extracted in methanol and ethyl acetate and provided that any intermediates do not co-migrate with pyrrolysine, cadaverine, or lysine.

The TLC system developed to separate pyrrolysine in E. coli organic solvent extracts was also used to quantify the amount of pyrrolysine in these extracts as it relates to dry weight of cells. This provided a more direct approximation of pyrrolysine concentration extracted from E. coli than previous methods that relied on PylS activity assays. Approximately 2.3 µmol pyrrolysine is extracted using organic solvents per gram dry weight of E. coli expressing pylBCD cultured in LB. Unfortunately, however, pyrrolysine production in E. coli

cultured in M9-SAG is below the limit of detection for the ninhydrin staining methodology. Due to limitations with the production and accumulation of pyrrolysine in E. coli grown in M9 medium, we could not determine the specific activity of this labelled pyrrolysine. Thus, using only this TLC system, we could not determine the extent of radiolabel incorporation into pyrrolysine. To investigate how much of the pyrrolysine molecule was derived from lysine, we utilized the previously-developed recombinant MtmB expression system in conjunction with mass spectrometry.

Previous studies in our laboratory demonstrated by mass spectrometry that pyrrolysine was incorporated into MtmB at the UAG position when pylTSBCD and mtmB1 were expressed in E. coli cultured in LB. As with the radiolabelling experiment, however, tracking the extent of lysine incorporation into pyrrolysine using stable isotopes would require culturing in M9 minimal medium supplemented with amino acids. We were able to establish that pyrrolysine is incorporated into MtmB when grown in minimal medium, indicating that there are no pyrrolysine precursors are cannot be synthesized when switching from a complex, undefined medium to completely defined medium.

13 15 With this established, we demonstrated using C6 N2-L-lysine that the entire carbon nitrogen skeleton of pyrrolysine is derived from two molecules of lysine. It is notable that only pyrrolysine entirely comprised of heavy carbon and nitrogen was found; no peptides were detectable in which pyrrolysine was partially labelled.

Using the same methodology with lysine labelled at either the alpha or epsilon nitrogen position, we determined that both alpha nitrogens from two lysine molecules are retained in pyrrolysine biosynthesis while one epsilon nitrogen is eliminated. Again only peptides corresponding to the incorporation of one "-15N or two !-15N were detectable; no peptides were found in which pyrrolysine was either partially labelled or unlabelled.

Taking these data into account with the hypothesized enzyme functions, the data presented in this chapter is consistent with a biosynthetic pathway

(Figure 2.8) in which PylC ligates the carboxyl of either lysine or the lysine- derived ring precursor onto the epsilon nitrogen of a second lysine molecule in an

ATP-dependent fashion. PylB, using SAM as a cofactor, and PylD would likely catalyze the rearrangement and cyclization of one molecule of lysine resulting in the elimination of one epsilon nitrogen of one lysine molecule precursor.

However, the order of these enzymes could not be determined from this set of experiments and would be informed through precursor analog studies in Chapter

Figure 2.8 Pyrrolysine is synthesized from two lysine molecules, catalyzed by PylB, PylC, and PylD. Both alpha-nitrogens (depicted in blue) from the two lysine molecules are retained in the pyrrolysine molecule, likely becoming the alpha- nitrogen of the pyrrolysine molecule and the imine-nitrogen within the pyrroline ring. One epsilon-nitrogen (shown in red) is lost during the biosynthesis.

Chapter 3

DESMETHYLPYRROLYSINE IS A PYRROLYSINE ANALOG PRODUCED

FROM D-ORNITHINE AND LYSINE

3.1 Introduction

A number of possibilities had previously been suggested as the ring precursor of pyrrolysine, including D-proline, D-glutamate, D-isoleucine, and D- ornithine (Ambrogelly et al., 2007; Krzycki, 2004; Longstaff et al., 2007). Söll and colleagues, under the assumption that low ring precursor concentrations is what contributes to low pyrrolysine production in E. coli, used a recombinant E. coli pylBCD expression strain in conjunction with an in vivo UAG read-through reporter system to assess any potential increase in UAG read-through when growth medium is supplemented with possible precursors (Namy et al., 2007). A dual lacZ-luc fusion was used in which a UAG codon was inserted in-frame between the two genes, encoding for #-galactosidase and luciferase. UAG read- through was then assessed as a ratio of luciferase activity to #-galactosidase activity when the growth medium was supplemented with potential pyrrolysine ring precursors. A dramatic increase in read-through was observed with medium

supplemented with D-ornithine, whereas no increase was observable with medium supplemented with D-proline, D-glutamate, or D-isoleucine. It was thus suggested that D-ornithine is the ring precursor of pyrrolysine.

We established using stable isotope labelling studies that lysine serves as the ring precursor of pyrrolysine, as presented in Chapter 2. Here we show using thin layer chromatography that the presence of D-ornithine in media does not increase the amount of free pyrrolysine in the cell. However, supplementing media with D-ornithine does increase the amount of UAG read-through, as determined by immunoblot. Mass spectrometry of the read-through product suggests that D-ornithine serves as a ring precursor analog, resulting in a novel pyrrolysine analog, desmethylpyrrolysine. When pylBCD are expressed, both pyrrolysine and desmethylpyrrolysine are produced. Furthermore, we demonstrate that PylB is no longer necessary to achieve full-length monomethylamine methyltransferase (MtmB) in media supplemented with D- ornithine, but in the absence of PylB only desmethylpyrrolysine is synthesized.

The studies presented in this chapter allowed us to place PylB as the first enzyme to act in the pyrrolysine biosynthetic pathway as well as to propose the likely product of PylB enzymatic activity.

3.2 Experimental procedures

3.2.1 Organisms and plasmids

Escherichia coli BL21 Tuner (DE3) (Novagen, Inc, Madison, WI) transformed with pK13 (expressing pylBCD) or pACYCDuet-1 were used for thin layer chromatography (TLC) experiments. E. coli BL21 Tuner (DE3) co-transformed with pDLBADHis (expressing pylTS and hexahistidine-tagged mtmB1) and pK13

(expressing pylBCD), pK14 (pylBD), pK15 (pylCD), pK16 (pylBC) or the parent vector pACYCDuet-1 (Longstaff et al., 2007), as described in Chapter 2, were used for immunoblot and mass spectrometric analysis. Methanosarcina acetivorans C2A was used in experiments investigating the effects of D-ornithine on the ability of this organism to utilize trimethylamine as a growth substrate.

3.2.2 Growth conditions for recombinant pyrrolysine biosynthesis in the presence or absence of D-ornithine

E. coli bearing either pK13 or pACYCDuet-1 were incubated overnight at 37oC with shaking in 3 ml Luria-Bertani (LB) medium supplemented with 34 µg/ml chloramphenicol. These overnight cultures were then used to inoculate 250 ml

LB with 34 µg/ml chloramphenicol in either the absence or presence of 5 mM D- ornithine. Isopropyl "-D-1-thiogalactopyranoside (IPTG) at a concentration of 80

µM was added to cultures at OD600 0.4-0.6, and cultures were incubated for 3 hours after induction. Cells were subsequently pelleted and washed twice with 50 mM 3-(N-morpholino)propanesulfonic acid (MOPS), pH 7.2. Cell pellets were

stored at -20oC until they were subjected to organic solvent extraction and TLC analysis, as described in Chapter 2.

3.2.3 Growth conditions for MtmB(His)6 production in the presence or absence of D-ornithine

Cultures of E. coli bearing pDLBADHis and either pK13, pK14, pK15, pK16, or pACYCDuet-1 were incubated overnight at 37oC with shaking in 3 ml M9 minimal medium supplemented with 0.2% glucose, 2 mM MgSO4, 80 µM CaCl2, 36 µM

FeSO4, 1 mM each of the 20 canonical amino acids, 100 µg/ml ampicillin, and 34

µg/ml chloramphenicol (M9-SAG medium). For anti-MtmB immunoblot analysis only, 45 µl of the overnight culture was used to inoculate 3 ml M9-SAG medium in the presence or absence of 5 mM D-ornithine. Cultures were incubated at

37oC with shaking and pyl gene expression was induced with 80 µM IPTG at

OD600 0.4-0.6. Following one hour of further incubation, 0.02% arabinose was added to allow for the induction of mtmB1-his expression. Cultures were incubated for two additional hours. Final OD600 were standardized to 0.8 for all cultures, and 1 ml of the standardized cultures were pelleted and washed twice with 50 mM MOPS pH 7.2. Pellets were flash-frozen in liquid nitrogen, then cells were lysed in 40 µl 4x SDS-PAGE loading dye (250 mM Tris-HCl pH 6.8, 40% glycerol, 8% SDS, 0.08% bromophenol blue, 10% #-mercaptoethanol). Samples were heated at 95oC for 10 minutes, and were then loaded on an SDS-PAGE gel for analysis by anti-MtmB immunoblot, as described in Chapter 2.

One liter of M9-SAG medium supplemented with 5 mM D-ornithine was inoculated with the 3 ml overnight culture of E. coli bearing pDLBADHis and

o either pK13 or pK15 and incubated with shaking at 37 C. At OD600 0.4-0.6, cells were pelleted, washed with 50 mM MOPS, pH 7.2, and resuspended in 1 L fresh

M9-SAG medium supplemented with 5 mM D-ornithine and either 1 mM

12 14 13 15 C6 N2-L-lysine or 1 mM C6 N2 L-lysine where indicated. After 1 hour further incubation, 0.02% L-arabinose was added to the culture, and cells were incubated for two additional hours. Cells were pelleted, washed with 50 mM

o MOPS pH 7.2, and stored at -20 C. MtmB(His)6 was enriched using nickel affinity chromatography and fractions were screened using anti-MtmB immunoblot.

Fractions demonstrating the most full-length MtmB in the immunoblot were prepared for mass spectrometry as described in Chapter 2.

3.3 Results

3.3.1 Supplementing media with D-ornithine does not increase free intercellular pyrrolysine concentration

We previously established in Chapter 2 that pyrrolysine can be separated after spotting organic solvent extracts of E. coli expressing pylBCD on a cellulose

TLC plate and developing the plate twice in a solvent system of 35% butanol:38.5% acetone:3.5% glacial acetic acid:23% ddH2O (v/v/v/v). Pyrrolysine can be detected on this TLC plate using ninhydrin staining, and the measured pixel density of the pyrrolysine spot can be correlated to the concentration of

pyrrolysine extracted from the cells. We thus decided to use this TLC system to determine if supplementing LB medium with 5 mM D-ornithine would result in an increase in the concentration of free pyrrolysine in the cytoplasm of recombinant

E. coli.

Organic solvent extracts were prepared of E. coli bearing either pACYCDuet-1 or pK13 (pylBCD) that had been cultured in LB or in LB supplemented with 5 mM D-ornithine. The equivalent of 30 mg cells (wet weight) were spotted onto the TLC plate. After developing and staining with ninhydrin

(Figure 3.1), pixel density of the scanned pyrrolysine spot was measured using

ImageJ software. No difference could be measured between the density of the pyrrolysine spot between cells grown in LB and cells grown in LB supplemented with D-ornithine (Figure 3.2). Pixel density of two other spots commonly resolved in all E. coli extracts were measured to ensure that an equivalent amount of extract was spotted on the TLC plate. We thus concluded that media supplemented with D-ornithine does not increase the amount of free pyrrolysine in recombinant E. coli. However, as the previous study noted an increase in the amount of UAG read-through rather than an increase in free pyrrolysine, we turned to using the anti-MtmB immunoblot that was previously developed to better investigate the reported phenomenon.

Figure 3.1 Recombinant pyrrolysine production in the absence or presence of D- ornithine. A cellulose TLC plate was spotted with D-ornithine (1) and organic solvent extracts of E. coli bearing pACYCDuet-1 grown in the absence (2) or presence (3) of D-ornithine and extracts of E. coli bearing pK13 (pylBCD) grown in the absence (4) or presence (5) of D-ornithine. Pyrrolysine is indicated with the arrow.

Figure 3.2 Densitometric comparison of organic solvent extracts of recombinant E. coli cultured in the presence or absence of D-ornithine. (a) Relative pixel density after background correction. Numbers correspond to (b) the spots labelled on the TLC. The TLC image is the same as that in Figure 3.1. Spots 3 and 4 are pyrrolysine in the absence or presence of D-ornithine, respectively. Densitometry of spots 5 and 6 was measured and compared to each other to ensure equivalent amounts of extracts were spotted onto the TLC plate. Spots 7 and 8 were also measured to ensure equal loading.

3.3.2 D-ornithine, but not L-ornithine, increases UAG read-through

Anti-MtmB immunoblots were was used to assess any increase in UAG read-through in the presence of D-ornithine. Recombinant E. coli bearing pDLBADHis (pylTS and mtmB-his) and either pACYCDuet-1 or pK13 (pylBCD) were cultured in M9-SAG medium in the absence or presence of 5 mM D- ornithine or 5 mM L-ornithine. L-ornithine was included, as the stereochemistry of the ornithine-dependent increase of pylTSBCD dependent UAG suppression was not previously investigated.

An increased amount of MtmB was detected in E. coli expressing pylBCD cultured in M9-SAG medium supplemented with D-ornithine (Figure 3.3). This increase was stereospecific to D-ornithine, as M9-SAG medium supplemented with L-ornithine did not result in any increase in UAG read-through. Full-length

(50 kDa) MtmB could not be detected in the absence of pylBCD, regardless of ornithine supplementation to the media.

Figure 3.3 Anti-MtmB immunoblot of whole cell extracts of E. coli bearing pDLBADHis (pylTS and mtmB1-his) and either pACYCDuet-1 or pK13 (pylBCD). Sizes of molecular weight markers (kDa) are indicated. Supplementing M9-SAG medium with D-ornithine results in an increase in UAG read-through product (50 kDa) when pylBCD are expressed. No increase in full-length MtmB is detected when M9-SAG medium is supplemented with L-ornithine.

3.3.3 PylB is not required for full-length MtmB production in the presence of D-ornithine

After demonstrating that the amount of full-length MtmB increases in the presence of D-ornithine, we then investigated the dependence of UAG read- through on all three pyrrolysine biosynthesis genes in media supplemented with

D-ornithine using the same anti-MtmB immunoblot methodology. It had already been well established that the expression of all three pyrrolysine biosynthesis genes, pylBCD, were necessary for in vivo pyrrolysine synthesis and UAG read- through using recombinant E. coli strains (Longstaff et al., 2007).

E. coli bearing pDLBADHis and either pACYCDuet-1 (parent vector), pK13

(pylBCD), pK14 (pylBD), pK15 (pylCD), or pK16 (pylBC) were cultured in either

M9-SAG media or M9-SAG media supplemented with 5 mM D-ornithine. As was demonstrated in Figure 3.3, an increase in the amount of full-length MtmB is detected in E. coli bearing pK13 cultured in the presence of D-ornithine.

Surprisingly, a strong full-length MtmB signal can also be detected in E. coli bearing pK15 only when medium is supplemented with D-ornithine (Figure 3.4).

No UAG read-through is detected in E. coli transformed with pK15 the absence of D-ornithine. This was the only strain other than E. coli bearing pK13 in which full-length MtmB can be detected. Given the ability of E. coli bearing pK15 and pDLBADHis to produce full-length MtmB in the absence of PylB but presence of

D-ornithine, we then turned to mass spectrometry to determine what amino acid is incorporated at the UAG-encoded residue under these conditions.

Figure 3.4 Anti-MtmB immunoblot of whole cell extracts of E. coli bearing pDLBADHis (pylTS and mtmB1-his) and (lanes 1, 6) pACYCDuet-1, (lanes 2, 7) pK13 (pylBCD), (lanes 3, 8) pK14 (pylBD), (lanes 4, 9) pK15 (pylCD), or (lanes 5, 10) pK16 (pylBC) cultured in the presence (lanes 1-5) or absence (lanes 6-10) of D-ornithine. Sizes of molecular weight markers (kDa) are indicated.

3.3.4 Both pyrrolysine and pyrrolysine analog desmethylpyrrolysine are inserted at the UAG position in the presence of D-ornithine and pylBCD

Mass spectrometric studies described in Chapter 2 support the hypothesis that pyrrolysine is entirely biosynthesized from lysine. However, the dramatic increase in full-length MtmB achieved in the presence of D-ornithine, even in recombinant strains lacking pylB, suggested that D-ornithine may be incorporated into pyrrolysine. To investigate the residue encoded at the UAG position in MtmB, we used the same mass spectrometry methodology as was used in the lysine incorporation studies.

E. coli bearing pDLBADHis and pK13 was cultured in M9-SAG medium supplemented with 5 mM D-ornithine. MtmB(His)6 was enriched using differential centrifugation in increasing concentrations of urea, followed by nickel affinity chromatography in the presence of urea. Fractions with the highest amounts of full-length MtmB, as detected by anti-MtmB immunoblot, were concentrated and proteins were separated by SDS-PAGE. The 50 kDa band was subjected to in- gel chymotryptic digest and analysis by liquid chromatography/mass spectrometry (LC/MS). Ions corresponding to the pyrrolysine-containing peptide

194AGRPGMGVOGPETSL208 were further subjected to collision-induced dissociation (CID) and subsequent tandem mass spectrometry (MS/MS) to better characterize the pyrrolysyl-residue.

The 194AGRPGMGVOGPETSL208 peptide from MtmB produced in E. coli bearing pK13 in M9-SAG medium is found in two forms where the residue at

position 199 is either methionine or methionine sulfoxide (Table 3.1). Both peptides were found as both doubly-charged and triply-charged ions. When

MtmB expression is induced in the presence of D-ornithine, these same peptides were also observed as multiple ions, within 3.06-4.17 ppm of theoretical m/z values (Table 3.1). The results of CID MS/MS of parent ions 783.40652+,

2+ corresponding to 194AGRPGMGVOGPETSL208 (Table 3.1, 3.2) and 791.4034 ,

corresponding to 194AGRPGM(ox)GVOGPETSL208 (Table 3.1, 3.3) were consistent with the residue at position 202 of these peptides being pyrrolysine.

However, additional m/z signals were also present in this sample (Table 3.1), which were equivalent to peptides 194AGRPGMGVOGPETSL208 or

194AGRPGM(ox)GVOGPETSL208 being 14 Da smaller than is seen when authentic pyrrolysine is found at position 202. These peptides are observed as doubly- charged (m/z 776.39932+ and 784.39682+ respectively) and triply-charged ions

(m/z 517.93473+ and 523.26633+). CID MS/MS of the doubly-charged parent ions

(Table 3.1, 3.4, 3.5) indicated that the minus 14 Da mass difference is attributable only to the UAG-encoded residue. This mass difference is equivalent to a methyl group being absent from a saturated carbon. Both the peptide m/z and the CID data support the residue at this position having the empirical formula

C11H17N3O2, equivalent to pyrrolysine lacking a methyl group. The observed m/z values for the peptides described above are within 2.17-3.44 ppm of the theoretical m/z if the peptide contains a residue of the formula C11H17N3O2 in place of pyrrolysine. Considering that this residue is still inserted co- translationally at the UAG position, the structure of this amino acid must be

Table 3.1: Comparison of pyrrolysyl-containing MtmB peptide and pyrrolysyl residue after synthesis in the absence or presence of D-ornithine. Pyrrolysyl-peptides were identified from cells supplemented with D-ornithine and bearing either pylBCD or pylCD. Mass difference relative to pyrrolysine-containing peptide is calculated after comparing the 89 theoretical mass of the MtmB peptide in the absence of D-ornithine to the observed mass. Pyrrolysyl-residue mass is

the calculated average of the observed mass from b- and y-series ions generated by MS/MS. Desmethylpyrrolysine (O-me) mass change relative to pyrrolysine (O) is calculated using the average described above to the theoretical mass of unlabelled pyrrolysine (237.15 Da).

Table 3.1

Peptide sequence Observed Theoretical m/z Mass UAG- mass m/z m/z error difference encoded difference (ppm) relative to residue of UAG- Pyl- mass encoded containing (Da) residue peptide relative to (Da) Pyl residue (Da) 2+ 2+ pylBCD 194AGRPGMGVOGPETSL208 783.4080 783.4089 0.77 - 237.05 - 522.60733+ 522.60833+ 1.91 - 2+ 2+ 194AGRPGM(OX)GVOGPETSL208 791.4065 791.4063 0.25 - 236.95 - 527.93963+ 527.94003+ 0.76 - 90 2+ 2+

pylBCD + 194AGRPGMGVOGPETSL208 783.4065 783.4089 3.06 -0.0048 237.15 - D-ornithine 522.60622+ 522.60832+ 4.02 -0.0063 2+ 2+ 194AGRPGM(OX)GVOGPETSL208 791.4034 791.4063 3.66 -0.0058 237.14 - 527.93783+ 527.94003+ 4.17 -0.0065 2+ 2+ 194AGRPGMGVO-meGPETSL208 776.3993 776.4010 2.19 -14.0192 223.12 -14.03 517.93473+ 517.93643+ 3.28 -14.0210 2+ 2+ 194AGRPGM(OX)GVO-meGPETSL208 784.3968 784.3985 2.17 -14.0190 223.18 -13.97 523.26633+ 523.26813+ 3.44 -14.0210 2+ 2+ pylCD + D- 194AGRPGMGVO-meGPETSL208 776.4025 776.4010 1.93 -14.0128 223.13 -14.02 ornithine 517.93623+ 517.93643+ 0.39 -14.0163 2+ 2+ 194AGRPGM(OX)GVO-meGPETSL208 784.3968 784.3985 2.17 -14.0190 223.04 -14.11 523.26693+ 523.26813+ 2.29 -14.0193

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 57.38 y14 748.15 Gly +2 157.27 y13 719.46 Arg 285.14 b3 97.26 y12 1281.65 Pro 57.04 y11 1184.39 Gly 439.29 b5 154.15 (97+57) 131.04 y10 1127.35 Met 570.15 b6 130.86 56.95 y9 996.31 Gly 627.38 b7 57.23 99.04 y8 939.36 Val 726.24 b8 98.86 237.15 y7 840.32 Pyl 963.39 b9 237.15 57.09 y6 603.17 Gly 1020.37 b10 56.98 225.94 y5 546.08 Pro 1117.23 b11 96.86 (129+97) Glu 1246.54 b12 129.31 y3 320.14 Thr 1347.67 b13 101.13 +2 Ser 717.88 b14 87.09 Leu

Table 3.2 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylBCDTS 12 14 and mtmB1 in the presence of D-ornithine and C6 N2-L-lysine. MS/MS data obtained from an m/z 783.40652+ ion.

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 57.18 y14 756.01 Gly +2 156.33 y13 727.42 Arg 285.13 b3 97.17 y12 1297.51 Pro 382.33 b4 97.20 57.09 y11 1200.34 Gly 439.23 b5 56.90 146.90 y10 1143.25 Met(ox) 586.18 b6 146.95 57.03 y9 996.35 Gly 643.01 b7 56.83 99.09 y8 939.32 Val 742.11 b8 98.86 237.10 y7 840.23 Pyl 979.38 b9 237.27 57.07 y6 603.13 Gly 1036.41 b10 57.03 225.82 y5 546.06 Pro 1133.53 b11 97.12 (129+97) Glu 1262.57 b12 129.04 y3 320.24 Thr 1363.99 b13 101.42 +2 Ser 725.97 b14 86.95 Leu

Table 3.3 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGM(ox)GVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing 12 14 pylBCDTS and mtmB1 in the presence of D-ornithine and C6 N2-L-lysine. MS/MS data obtained from an m/z 791.40342+ ion.

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 56.58 y14 740.46 Gly +2 155.96 y13 712.17 Arg 285.07 b3 153.96 y12 1267.38 Pro 382.37 b4 97.30 (57+97) Gly 439.27 b5 56.90 131.14 y10 1113.42 Met 570.06 b6 130.79 56.92 y9 982.28 Gly 99.11 y8 925.36 Val 726.27 b8 156.21 (57+99) 223.22 y7 826.25 Pyl-me 949.32 b9 223.05 56.92 y6 603.03 Gly 1006.41 b10 57.09 226.02 y5 546.11 Pro 1103.59 b11 97.18 (129+97) Glu 1232.50 b12 128.91 y3 320.09 Thr 1333.50 b13 101.00 Ser 1420.46 b14 86.96 Leu

Table 3.4 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVO-meGPETSL208. The desmethylpyrrolysine (O-me, Pyl-me) containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylBCDTS and mtmB1 in the presence of D-ornithine and 12 14 2+ C6 N2-L-lysine. MS/MS data obtained from an m/z 776.3993 ion.

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 56.89 y14 748.84 Gly 156.31 y13 1439.79 Arg 285.13 b3 301.34 y12 1283.48 Pro (147+ 57+97) Gly 439.13 b5 154.00 (97+57) Met(ox) 586.28 b6 147.15 56.76 y9 982.14 Gly 643.31 b7 57.03 99.14 y8 925.38 Val 742.18 b8 96.87 223.17 y7 826.24 Pyl-me 965.37 b9 223.19 56.91 y6 603.07 Gly 1022.47 b10 57.10 226.28 y5 546.16 Pro (129+97) Glu 1248.61 b12 226.14 (97+129) y3 319.88 Thr 1349.47 b13 100.86 +2 Ser 718.90 b14 87.33 Leu

Table 3.5 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGM(ox)GVO-meGPETSL208. The desmethylpyrrolysine (O-me, Pyl-me) containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylBCDTS and mtmB1 in the presence of D-ornithine and 12 14 2+ C6 N2-L-lysine. MS/MS data obtained from an m/z 784.3968 ion.

recognized by pyrrolysyl-tRNA synthetase (PylRS). In conjunction with the substrate constraints for aminoacylation of tRNAPyl as understood from analog (Li et al., 2009; Polycarpo et al., 2006) and PylRS crystallography studies (Kavran et al., 2007; Lee et al., 2008; Nozawa et al., 2009), these data suggest that the structure of this residue is likely pyrroline-5-carboxylate in amide linkage to the !- nitrogen of lysine (Figure 3.5). We thus termed this new pyrrolysine analog desmethylpyrrolysine (abbreviated as Pyl-me or O-me). After establishing that both pyrrolysine and desmethylpyrrolysine are present in E. coli bearing pylBCD cultured in the presence of D-ornithine, we next looked at the identity of the residue at the UAG-encoded position in E. coli lacking pylB under the same growth conditions.

3.3.5 Only desmethylpyrrolysine is detectable in recombinant E. coli bearing pylCD in the presence of D-ornithine

It has been well established that all three pyrrolysine biosynthesis genes, pylBCD, are required for pyrrolysine biosynthesis. For the first time, however, a considerable amount of full-length MtmB was detectable from cell extracts of E. coli bearing pDLBADHis and pK15 (pylCD) only when cultured in the presence of

D-ornithine. We again turned to mass spectrometry to investigate the residue encoded at the UAG position of the full-length product in this strain. Using the same methodology as described in the preceding section, E. coli bearing pDLBADHis and pK15 were cultured in M9-SAG medium supplemented with 5 mM D-ornithine. Where both pyrrolysine and desmethylpyrrolysine containing

Figure 3.5 The structures of (a) pyrrolysine (Mr-H2O=237.15, C12H19N3O2) and (b) desmethylpyrrolysine (Mr-H2O= 223.13, C11H17N3O2).

peptides were detected in E. coli bearing pK13, only desmethylpyrrolysine peptides were detected in E. coli bearing pK15 (Table 3.1). Signals for both methionine and methionine sulfoxide containing peptides could be detected as doubly-charged (776.40252+ and 784.39682+ respectively) and triply-charged

(517.93623+ and 523.26693+) ions. These peptides all measure 14 Da smaller than the theoretical mass of pyrrolysine-containing peptides of the same sequence, indicating that the UAG-encoded residue is desmethylpyrrolysine. The observed m/z are within 0.39-2.29 ppm of theoretical m/z values calculated assuming that these peptides contain desmethylpyrrolysine. CID MS/MS of the doubly charged parent ions above confirmed that desmethylpyrrolysine is inserted rather than pyrrolysine in these peptides (Table 3.6, 3.7).

Taken together, these data suggest that D-ornithine is not a precursor of pyrrolysine, but rather can act as an analog of the PylB-catalyzed reaction product. D-ornithine is likely acting as the ring precursor analog, as we had hypothesized that one intact lysine molecule acts as the precursor of the acyl chain portion of the pyrrolysine molecule. We thus turned to a lysine labelling study to better understand D-ornithine incorporation into desmethylpyrrolysine and what, if any, contribution D-ornithine may play in pyrrolysine biosynthesis.

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 56.76 y14 740.72 Gly +2 156.37 y13 712.34 Arg 285.17 b3 97.16 y12 1267.31 Pro 382.30 b4 97.13 56.82 y11 1170.15 Gly 439.27 b5 56.96 131.13 y10 1113.33 Met 570.17 b6 130.91 56.86 y9 982.20 Gly 627.05 b7 56.88 99.08 y8 925.34 Val 726.22 b8 99.17 223.14 y7 826.26 Pyl-me 949.35 b9 223.13 56.95 y6 603.12 Gly 1006.38 b10 57.03 226.11 y5 546.17 Pro 1103.68 b11 97.30 (129+97) Glu 1232.31 b12 128.63 y3 320.06 Thr 1333.65 b13 101.34 Ser 1420.32 b14 86.67 Leu

Table 3.6 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVO-meGPETSL208. The desmethylpyrrolysine (O-me, Pyl-me) containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylCDTS and mtmB1 in the presence of D-ornithine and 12 14 2+ C6 N2-L-lysine. MS/MS data obtained from an m/z 776.4025 ion.

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 56.66 y14 748.74 Gly +2 156.43 y13 720.41 Arg 285.14 b3 154.08 y12 1283.39 Pro 382.60 b4 97.46 (57+97) Gly 147.17 y10 1129.31 Met(ox) 586.43 b6 203.83 (57+147) 155.90 y9 982.14 Gly 643.57 b7 57.14 (99+57) Val 742.27 b8 98.70 223.04 y7 826.24 Pyl-me 965.31 b9 223.04 57.11 y6 603.20 Gly 1022.32 b10 57.01 225.97 y5 546.09 Pro 1119.31 b11 96.99 (129+97) Glu 1248.47 b12 129.16 y3 320.12 Thr 1349.70 b13 101.23 +2 Ser 719.03 b14 87.35 Leu

Table 3.7 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGM(ox)GVO-meGPETSL208. The desmethylpyrrolysine (O-me, Pyl-me) containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylCDTS and mtmB1 in the presence of D-ornithine and 12 14 2+ C6 N2-L-lysine. MS/MS data obtained from an m/z 784.3968 ion.

3.3.6 D-ornithine acts as the ring precursor only in desmethylpyrrolysine

Stable isotope labelling studies were employed to observe the incorporation of D-ornithine into pyrrolysine and desmethylpyrrolysine. While tracking incorporation with labelled D-ornithine would have been ideal, this unfortunately is not a commercially available substrate and custom synthesis was

13 15 prohibitively expensive. We thus decided to investigate C6 N2-L-lysine incorporation into the pyrrolysine and desmethylpyrrolysine in recombinant MtmB isolated from E. coli bearing pDLBADHis and pK13 cultured in M9-SAG supplemented with 5 mM D-ornithine. Since we had characterized the

13 15 incorporation of C6 N2-L-lysine into pyrrolysine in the absence of D-ornithine

(Chapter 2), any changes in the labelling of the peptide and pyrrolysyl-residue masses could be attributable to the presence of D-ornithine in the media.

E. coli transformed with pDLBADHis and pK13 were cultured in M9-SAG

13 15 media supplemented with C6 N2-L-lysine and 5 mM D-ornithine. MtmB was enriched by differential centrifugation in urea and nickel affinity chromatography.

Column fractions containing the highest amount of full-length MtmB, as detected by anti-MtmB immunoblot, were subjected to SDS-PAGE and stained for in gel chymotryptic digestion and LC-MS/MS analysis. In the presence of D-ornithine, a signal was detected corresponding to a pyrrolysine-containing peptide (m/z

790.92242+) in which the entire carbon and nitrogen skeleton of pyrrolysine is isotopically labelled (Table 3.8). The observed m/z for this peptide is within 0.12

100

Peptide sequence Observed Theoretical m/z Mass O or O-me O or O-me m/z m/z error difference Residue mass (ppm) relative to Mass difference unlabelled (Da) relative to peptide unlabelled (Da) residue

2+ 2+ minus 194AGRPGMGVOGPETSL208 790.9225 790.9245 2.53 15.0272 252.05 14.90 D- 527.61633+ 527.61883+ 4.74 15.0238 2+ 2+ ornithine 194AGRPGM(OX)GVOGPETSL208 798.9180 798.9220 5.00 15.0314 252.08 14.93 532.94753+ 532.95043+ 5.44 15.0226 2+ 2+ plus 194AGRPGMGVOGPETSL208 790.9224 790.9245 0.12 15.0270 252.19 15.04

101 D- 2+ 2+ ornithine 194AGRPGMGVO-meGPETSL208 780.4099 780.4101 0.26 8.0178 231.16 8.03 520.60952+ 520.60913+ 0.77 8.0193

Table 3.8 Comparison of pyrrolysine (O) and desmethylpyrrolysine (O-me)-containing MtmB peptides produced in E. coli bearing pDLBADHis and pK13. Recombinant E. coli was cultured in M9-SAG medium supplemented with 1 mM 13 15 C6 N2-L-lysine in the absence or presence of 5 mM D-ornithine. Mass difference relative to unlabelled peptide is calculated after comparing the theoretical mass of the MtmB pyrrolysine-containing or desmethylpyrrolysine-containing 12 14 peptide in the presence of C6 N2-L-lysine to the observed mass. Pyrrolysyl or desmethylpyrrolysyl-residue mass is the calculated average of the observed mass from b- and y-series ions generated by MS/MS. Mass change relative to unlabelled residue is calculated using the average described above to the theoretical mass of unlabelled pyrrolysine (237.15 Da) or unlabelled desmethylpyrrolysine (223.13 Da).

ppm of the theoretical m/z of the same peptide when all carbons and all nitrogens of pyrrolysine are labelled. CID of this ion indicated that the pyrrolysine residue was biosynthesized entirely from lysine, in agreement with the isotope studies in

Chapter 2. No signal was detected that would indicate biosynthesis of unlabelled pyrrolysine or pyrrolysine made from less than two heavy lysines.

Peptides containing desmethylpyrrolysine at the UAG-encoded position were also detected. In this instance, the desmethylpyrrolysine-containing peptide

(Table 3.8) was observed as doubly (m/z 780.40992+) and triply charged ions

(m/z 520.60953+). These ions indicate that one intact lysine (8 heavy nuclei) is incorporated into desmethylpyrrolysine. No unlabelled desmethylpyrrolysine- containing peptides were detected, nor were other signals indicating incorporation other than one intact lysine. Comparing the b-series and y-series

CID spectra of desmethylpyrrolysyl-peptide produced in the presence of

12 14 C6 N2-L-lysine (Figure 3.6 a, c) to those of the peptide produced in the

13 15 presence of C6 N2-L-lysine (Figure 3.6 b, d) support the incorporation of one intact lysine incorporated into desmethylpyrrolysine. These data suggest that the entire carbon and nitrogen skeleton of lysine forms the acyl portion of desmethylpyrrolysine, whereas D-ornithine is the ring precursor of this pyrrolysine analog.

102

Figure 3.6 CID spectra of desmethylpyrrolysine-containing peptides generated after chymotryptic digestion of recombinant MtmB. Full-length MtmB was isolated from E. coli bearing pDLBADHis (mtmB-his and pylTS) and pK13 (pylBCD) that had been cultured in M9-SAG medium supplemented with D-ornithine and (a) 12 14 13 15 and (c) C6 N2-L-lysine or (b) and (d) C6 N2-L-lysine. CID-generated (a) b- series and (c) y-series ions from parent ion m/z 776.40242+; (b) b-series and (d) y-series ions from parent ion m/z 780.40992+.

103

Figure 3.6

104

3.3.7 Evidence of ring opening in desmethylpyrrolysine

A +18 Da signal was also observed in some desmethylpyrrolysine containing peptides. This signal was observed in peptides in which

13 15 desmethylpyrrolysine was either labelled with C6 N2-L-lysine or was unlabelled

(Table 3.9). This signal most likely indicates the addition of water to desmethylpyrrolysine, due to ring opening to the amino aldehyde form (Figure

3.7). The error is between 0.25-3.40 ppm when comparing the measured m/z these peptides to the theoretical m/z for peptides with the residue the 202 position is the opened ring form of desmethylpyrrolysine (C11H19N3O3). We never detected a similar signal in peptides containing pyrrolysine at the UAG-encoded position.

105

Sample Peptide sequence Observed Theoretical m/z mass Likely m/z m/z error difference composition (ppm) relative to of UAG O-me residue peptide (Da) 2+ 2+ D- 194AGRPGMGVO-meGPETSL208 776.4021 776.4010 1.42 - C11H17N3O2 ornithine, 517.93773+ 517.93643+ 2.51 - 12 14 2+ 2+ C6 N2 194AGRPGMGVO-meGPETSL208 785.4075 785.4063 1.53 18.0130 C11H19N3O3 lysine 523.94123+ 523.94003+ 2.29 18.0144 2+ 2+ 194AGRPGM(OX)GVO-meGPETSL208 784.4009 784.3985 3.06 - C11H17N3O2 523.26963+ 523.26813+ 2.87 - 2+ 2+ 194AGRPGM(OX)GVO-meGPETSL208 793.4065 793.4038 3.40 18.0160 C11H19N3O3 2+ 2+ 106 D- 194AGRPGMGVO-meGPETSL208 780.4103 780.4101 0.26 - C11H17N3O2 ornithine, 520.60953+ 520.60913+ 0.77 - 13 15 2+ 2+ C6 N2 194AGRPGM(OX)GVO-meGPETSL208 788.4062 788.4076 1.78 - C11H17N3O2 lysine 525.94003+ 525.94083+ 1.52 - 2+ 2+ 194AGRPGM(OX)GVO-meGPETSL208 797.4137 797.4139 0.25 18.0122 C11H19N3O3

Table 3.9 Some desmethylpyrrolysine (O-me)-containing MtmB peptides produced in E. coli bearing pDLBADHis and pK13 show evidence of the ring being hydrated to the opened aldehyde form. Recombinant E. coli was cultured in the 12 14 13 15 presence of 5 mM D-ornithine and either in C6 N2-L-lysine or C6 N2-L-lysine. Mass difference (Da) is calculated relative to the theoretical mass of either unlabelled or labelled desmethylpyrrolysly-peptides. In both unlabelled and labelled samples, desmethylpyrrolysine (C11H17N3O2) containing peptides were the predominant signals detected. Some peptides were detected in which the residue showed evidence of ring opening (C11H19N3O3) by hydration, thereby increasing the mass by 18 Da.

Figure 3.7 Mass spectrometry indicates that desmethylpyrrolysine is susceptible to ring opening by the addition of water to the imine, forming an amino aldehyde. This ring opening was only observed with desmethylpyrrolysine.

107

3.4 Discussion

Two molecules of lysine serve as the sole precursor of the pyrrolysine carbon nitrogen backbone, as we demonstrated in Chapter 2. However, a previous report suggesting that D-ornithine acts as the ring precursor was based on an increase in UAG read-through seen in a recombinant pylBCD expression system in E. coli only when cultured in the presence of D-ornithine (Namy et al.,

2007). We set out to explore this phenomenon.

We had previously demonstrated in Chapter 2 that densitometric measurements of ninhydrin-stained spots separated on a cellulose thin layer chromatography plate may be directly correlated to the concentration of pyrrolysine at that spot. E. coli transformed with pK13 (pylBCD) or the parent vector pACYCDuet-1 were cultured in LB medium in the absence or presence of

5 mM D-ornithine. Organic solvent extracts of these cultures were resolved by

TLC and visualized by ninhydrin staining. Densitometric measurements of the pyrrolysine spot showed no increase between cultures grown in the presence of

D-ornithine. However, monitoring UAG read-through by anti-MtmB immunoblot using E. coli co-transformed with pDLBADHis and pK13 or pACYCDuet-1 did show an increase in the amount of full-length MtmB when E. coli expressing pylBCD. It is possible that the increase seen in the translation-based detection system that was not seen when measuring free pyrrolysine is a reflection of feedback inhibition within the pyrrolysine biosynthetic pathway.

After culturing E. coli transformed with pDLBADHis and either pK13 or pACYCDuet-1 in M9-SAG media supplemented with either L-ornithine or D-

108

ornithine, we were able to establish by anti-MtmB immunoblot that the increase in full-length MtmB is specific to the D-isomer of ornithine. Mass spectrometry indicated that both pyrrolysine and a pyrrolysine analog could be found at the

UAG-encoded position in MtmB samples prepared from cells expressing pylBCD.

When comparing the observed m/z of peptides with the pyrrolysine analog to the theoretical m/z of peptides containing pyrrolysine, the mass of the analog- containing peptides were calculated to be 14 Da smaller, consistent with the empirical formula of the analog being C11H17N3O2. CID MS/MS results indicated that the mass difference was attributable only to the UAG-encoded residue. This empirical formula is the equivalent of pyrrolysine (C12H19N3O2) lacking a methyl group at a saturated carbon. Studies of pyrrolysyl-tRNA synthetase using pyrrolysine analogs (Li et al., 2009; Polycarpo et al., 2006) and crystallography

(Kavran et al., 2007; Lee et al., 2008; Nozawa et al., 2009) have indicated that features of pyrrolysine analogs that are well recognized by PylS and charged onto tRNAPyl include a five membered ring linked to L-lysine. The analog with the highest catalytic efficiency, 2-tetrahydrofuran-lysine (2-Thf-lys) has an oxygen in place of the imine nitrogen in the pyrroline ring; other analogs that lack an electronegative atom at the 2-position of ring have poorer catalytic efficiency.

Based on these considerations, we hypothesize the structure of this analog is the same as pyrrolysine, but lacking the methyl group on the ring (Figure 3.5). We thus termed this pyrrolysine analog desmethylpyrrolysine.

Surprisingly, we also observed a strong full-length anti-MtmB signal in immunoblots of recombinant strains lacking pylB, but only when cultured in the

109

presence of D-ornithine. Only desmethylpyrrolysine-containing peptides could be detected from mass spectrometry of full-length MtmB isolated from this strain. As no peptides containing pyrrolysine could be detected in these samples, we hypothesized that D-ornithine is not a precursor of pyrrolysine, but rather acts as an analog of the product of the reaction catalyzed by PylB.

To ensure that D-ornithine is not a pyrrolysine precursor and to better understand its contribution to desmethylpyrrolysine, we again turned to stable

13 15 isotope-labelling studies using C6 N2-L-lysine. Using the recombinant strain transformed with pDLBADHis and pK13, we could track how the label incorporates into both pyrrolysine and desmethylpyrrolysine when the medium is supplemented with D-ornithine. As was observed in Chapter 2, only signals corresponding to the labelling of the entire carbon nitrogen skeleton could be detected in peptides containing pyrrolysine. The lack of any partially-labelled pyrrolysine further supports the idea that D-ornithine is not an authentic intermediate in the pyrrolysine biosynthetic pathway. Desmethylpyrrolysine was only detected as having one intact lysine carbon and nitrogen skeleton incorporated, most likely to form the acyl chain. These data suggest that D- ornithine serves as the ring precursor of desmethylpyrrolysine, the biosynthesis of which is catalyzed by PylC and PylD. PylD most likely catalyzes the cyclization of D-ornithine, resulting in the elimination of the !-amine of D-ornithine. PylC catalyzes the ligation of D-ornithine or pyrroline-5-carboxylate to lysine (Figure

3.8). With these data, however, we cannot discern the order in which these two enzymes act in desmethylpyrrolysine biosynthesis.

110

Recently, the Geierstanger group independently observed the same pyrrolysine analog inserted into 25 UAG-encoded positions in 5 different proteins in a recombinant E. coli system (Cellitti et al., 2011). This observation was also seen in a recombinant mammalian HEK293 cell line. In agreement with our data presented here, desmethylpyrrolysine incorporation is only observed when growth media is supplemented with D-ornithine. Both pyrrolysine and desmethylpyrrolysine were observed when pylBCDTS are expressed, but only desmethylpyrrolysine was reported as detected in strains lacking pylB. This group also concluded that the residue encoded at the UAG-position likely has the structure presented here as desmethylpyrrolysine.

In some peptides with desmethylpyrrolysine at the UAG-encoded position, a signal 18 Da larger than expected was observed. This signal was only observed in desmethylpyrrolysine containing peptides, and was observed both

12 14 13 15 when C6 N2-L-lysine and C6 N2-L-lysine was incorporated. This signal most likely arises from the addition of water to the ring of desmethylpyrrolysine, resulting in a linear aldehyde form of the amino acid (Figure 3.7).

111

Figure 3.8 Desmethylpyrrolysine is biosynthesized from lysine and D-ornithine in recombinant strains expressing pylCD. Lysine is incorporated intact, and likely serves as the precursor of the acyl chain of desmethylpyrrolysine. Carbon and nitrogen derived from lysine is shown in red. D-ornithine likely is the ring precursor of pyrrolysine, shown in blue, with oxidative deamination leading !- nitrogen and subsequent cyclization of the ring

112

Signals corresponding to the hydrated-ring form of desmethylpyrrolysine was also detected by the Geierstanger group (Cellitti et al., 2011). This open ring form was recently invoked by this group as a mechanism for a reaction with 2- amino-benzaldehyde and 2-amino-acetophenone, which further allows site- specific conjugation with a number of different compounds such as fluors, oligonucleotides, and biotin (Ou et al., 2011). While the open aldehyde form of pyrrolysine was not detected by us nor reported to be detected by Geierstanger and colleagues, this group was able to utilize the same chemistry to conjugate pyrrolysine-containing proteins with the same efficiency as desmethylpyrrolysine- containing proteins. Because this system does not require any mutation of the pyrrolysyl-tRNA synthetase and can be used in E. coli or mammalian cell lines, the site-specific incorporation of desmethylpyrrolysine is an extremely useful tool to label or derivatized proteins.

Studies with D-ornithine have enabled us to better understand the pyrrolysine biosynthetic pathway (Figure 3.9). From Chapter 2, we established that two molecules of L-lysine serve as the sole precursors of the carbon- nitrogen backbone of pyrrolysine. Here, we establish that D-ornithine acts as an analog of the product of the reaction catalyzed by PylB. We hypothesize that

PylB is the first enzyme of the pathway, considering that desmethylpyrrolysine is synthesized in cells expressing pylCD. Using SAM as a cofactor, PylB catalyzes a radical lysine mutase reaction moving an internal carbon and changing the stereochemistry around the "-carbon, resulting in (3R)-3-methyl-D-ornithine.

PylB is a member of the radical SAM superfamily of enzymes, which have

113

previously been demonstrated to catalyze a variety of reactions including aminomutase, lyase, and sulfur insertion reactions (Frey et al., 2008). This type of mutase reaction, i.e. a carbon skeleton rearrangement, is unprecedented in the radical SAM superfamily. In vivo studies reported by the Geierstanger group support the hypothesis that 3-methyl-D-ornithine is the genuine product of the reaction catalyzed by PylB (Cellitti et al., 2011). Mass spectrometry studies of a

UAG read-through reporter protein reveal that only pyrrolysine is encoded at the

UAG position in recombinant E. coli expressing pylCDTS that had been cultured in medium supplemented with chemically-synthesized 3-methyl-D-ornithine.

The increase in the amount of and the incorporation of desmethylpyrrolysine into full-length MtmB seen in E. coli expressing pylBCD cultured in the presence of D-ornithine suggest that the reaction catalyzed by

PylB is the rate-limiting step of the pyrrolysine biosynthetic pathway. After the production of (3R)-3-methyl-D-ornithine, the pathway may take one of two different routes. In the first of the two possible routes (Figure 3.9a), PylC acts next in the pathway, catalyzing the ligation of the carboxyl group of 3-methyl- ornithine to the epsilon nitrogen of a second lysine in an ATP dependent reaction. Finally, PylD catalyzes the oxidative deamination of the ornithyl-moiety of the ligation product, thereby eliminating what was the #N of the first lysine, and forming D-Glutamyl-5-semialdehyde-N!-L-lysine. This product undergoes spontaneous dehydration and cyclization, resulting in pyrrolysine. In the second route (Figure 3.9b), PylD acts first on (3R)-3-methyl-D-ornithine in the same type

114

115

Figure 3.9 The pyrrolysine biosynthetic pathway begins with the radical rearrangement of lysine to (3R)-3-methyl-D- ornithine catalyzed by PylB. (3R)-3-methyl-D-ornithine then is either (a) ligated to the !N of a second lysine molecule by PylC, the product of which is converted to pyrrolysine by PylD; or (b) subjected to oxidative deamination by PylD and the resulting ring is ligated to a second molecule of lysine by PylC.

of reaction described above. The resulting methylated pyrroline ring is subsequently ligated to the !N of a second lysine molecule by PylC, resulting in the final pyrrolysine product.

Considering that the reaction catalyzed by PylB is likely the rate-limiting step in pyrrolysine biosynthesis and considering that no intermediate biosynthetic products were ever observed from E. coli expressing pylBC or pylBD using TLC, we turned to the D-ornithine analog to better analyze the possible reaction products of PylC and PylD in Chapter 4. We also look more closely at the reaction catalyzed by PylB using deuterium labelling studies.

116

Chapter 4

IN VIVO ANALYSIS OF THE ACTIVITIES OF PYRROLYSINE

BIOSYNTHETIC ENZYMES

4.1 Introduction

PylB acts as the first enzyme in the pyrrolysine biosynthetic pathway, most likely catalyzing the radical conversion of L-lysine to (3R)-3-methyl-D-ornithine.

We determined the placement of PylB in the pathway after discovering that D- ornithine acts as an analog of the PylB reaction product, as desmethylpyrrolysine is produced by recombinant E. coli expressing pylCD when D-ornithine is present in the growth media. However, the order of the remaining two enzymes in the pathway could follow one of two possibilities: PylC may first ligate the !N of lysine to the carboxyl group of (3R)-3-methyl-D-ornithine which is then the substrate for

PylD to catalyze oxidative deamination of the ornithyl moiety; alternatively PylD can catalyze the oxidative deamination of (3R)-3-methyl-D-ornithine, followed by the PylC-catalyzed ligation of the carboxyl group of the resulting (4R,5R)-4- methyl-pyrroline-5-carboxylate to the !N of lysine.

117

In order to better understand the next steps in the pyrrolysine biosynthetic pathway, studies using D-ornithine were employed. Here, we provide evidence using thin layer chromatography (TLC) and mass spectrometry that an intermediate in desmethylpyrrolysine biosynthesis accumulates in the cytoplasm of recombinant E. coli expressing only pylC. These data are consistent with D- ornithyl-N!-L-lysine as this intermediate. Furthermore, we present data suggesting that D-ornithyl-N!-L-lysine is a substrate for PylD. Taken together, we propose ordered pathways for both desmethylpyrrolysine and pyrrolysine biosynthesis. Additional labelling studies using lysine deuterated at non- exchangable hydrogen positions lend further insights into the mechanism of radical s-adenosylmethionine (SAM) enzyme, PylB.

4.2 Experimental procedures

4.2.1 Organisms and plasmids

Plasmids pK17, bearing pylD, and pK18, bearing pylC, were created using pK14 (pylBD) and pK16 (pylBC) (Longstaff et al., 2007) respectively as parent plasmids. The pylB gene was removed from both pK14 and pK16 after digestion with EagI (New England Biolabs, Ipswich, MA). The resulting digestion products were subjected to 0.8% agarose gel electrophoresis, and the bands corresponding to the linear fragments lacking pylB were excised from the gel.

These fragments were purified using a QIAquick Gel Extraction Kit (Qiagen Inc.,

Valencia, CA) and were each ligated to create pK17 and pK18. These plasmids

118

were transformed into Escherichia coli BL21 Tuner (DE3) (Novagen, Inc,

Madison, WI). Plasmids were confirmed by restriction mapping and DNA sequencing.

Escherichia coli BL21 Tuner (DE3) transformed with pDLBADHis (pylTS and mtmB1-his) and either pK17 or pACYCDuet-1 (Novagen, Inc., Madison, WI) were used for immunoblot analysis. Deuterium labelling studies were performed using E. coli BL21 Tuner (DE3) transformed with pDLBADHis and pK13. E. coli bearing pK13BHis, constructed from pK13 on which a gene for a C-terminally hexahistidine-tagged PylB is encoded in addition to PylC and PylD as previously described, was constructed by Joseph Krzycki.

4.2.2 Growth conditions for radiolabelling of desmethylpyrrolysine pathway intermediates

Overnight cultures of E. coli bearing pK17 or pK18 were grown in M9 minimal medium supplemented with 0.2% glucose, 2 mM MgSO4, 80 µM CaCl2,

36 µM FeSO4, 1 mM each of the 20 canonical amino acids, and 34 µg/ml chloramphenicol (M9-SAG). From these cultures, 300 µl were used as inoculum for 70 ml M9-SAG media supplemented with 5 mM D-ornithine. Cultures were

o grown with shaking at 37 C to OD600 0.4-0.6, at which point cells were pelleted by centrifugation and washed twice in 50 mM 3-(N-morpholino)propanesulfonic acid (MOPS), pH 7.2. Cell pellets were resuspended in 12.5 ml M9-SAG supplemented with 5 mM D-ornithine and in place of 1 mM 12C-L-lysine, 100 µM

L-lysine at 220 dpm/pmol uniformly labelled 14C-L-lysine (Moravek Biochemicals

119

and Radiochemicals, Brea CA). Expression of pylC and pylD was induced after the addition of 80 µM isopropyl !-D-1-thiogalactopyranoside (IPTG) to cell suspensions in water-jacketed flasks held at 37oC with stirring. After 1 hour, cells were pelleted by centrifugation and washed twice in 50 mM MOPS, pH 7.2. Cell wet weights were measured and pellets were held at -20oC until extracted with methanol and ethyl acetate, as described in section 2.2.4.

4.2.3 Thin layer chromatography of radiolabelled organic solvent extracts and chemically synthesized standards

Organic solvent extracts of cells prepared above were standardized using ninhydrin and metabolites separated by thin layer chromatography (TLC), as detailed in Chapter 2. TLC plates were exposed to a general purpose phosphor screen (GE Healthcare, Piscataway, NJ) for at least 72 hours before visualization using a STORM Phosphorimager. D-ornithyl-N!-L-lysine was prepared as a custom synthesis order from AAPPTec (Louisville, KY); DL-pyrroline-5- carboxylate was a gift from the lab of Dr. Donald Becker at the University of

Nebraska. Standards were visualized after ninhydrin staining.

4.2.4 Growth conditions for mass spectrometry analysis of intercellular metabolite pool

Overnight cultures of E. coli transformed with pK17, pK18, or the parent vector pACYCDuet-1 were prepared in 3 ml Luria-Bertani (LB) medium supplemented with 34 µg/ml chloramphenicol. These cultures were used to

120

inoculate 500 ml LB medium supplemented with 34 µg/ml chloramphenicol,

10 mM lysine, and either the presence or absence of 10 mM D-ornithine, and

o were grown at 37 C with shaking. At an OD600 of 0.6, pylC or pylD expression was induced by the addition of 80 µM IPTG. After two hours further incubation, cells were pelleted by centrifugation, then washed twice in 50 mM MOPS, pH 7.2. Cell pellets were stored at -20oC until subjected to hot methanol extraction.

4.2.5 Hot methanol extraction of intercellular Escherichia coli metabolite pool for mass spectrometry

Cell pellets prepared above were thawed on ice, then resuspended in 3 ml distilled-deionized H2O (ddH2O). Cellular metabolites were extracted with 9 ml of

66% methanol, then held at 70oC for 30 minutes. Insoluble cellular components were removed by centrifugation at 16,100 xg for 10 minutes (adapted from

(Maharjan & Ferenci, 2003)). The supernatant was removed to fresh tubes and concentrated to 250 µl by vacuum centrifugation. Samples were then analyzed by mass spectrometry by Liwen Zhang and Kari Green-Church (Gaston, Zhang et al., 2011).

4.2.6 Growth conditions for immunoblot analysis

E. coli bearing pDLBAD and pK17 or pACYCDuet-1 was cultured in M9-

SAG medium supplemented with 34 µg/ml chloramphenicol and 100 µg/ml ampicillin at 37oC with shaking overnight. From these, 20 µl was used to 121

inoculate 1 ml fresh M9-SAG medium. At OD600 0.6, 80 µM IPTG and 10 mM D- ornithyl-N!-L-lysine (AAPPTec, Louisville, KY) was added. After 1 hour further incubation, 0.02% arabinose was added and cultures were incubated for an additional 2 hours. Cells were pelleted by centrifugation and washed twice in 50 mM MOPS, pH 7.2. Cell pellets were flash frozen in liquid nitrogen and lysed in

40 µl 4x SDS-PAGE loading dye (250 mM Tris-HCl pH 6.8, 40% glycerol, 8%

SDS, 0.08% bromophenol blue, 10% "-mercaptoethanol). Samples were then heated at 95oC for 10 minutes before loading onto an SDS-PAGE gel for analysis by anti-MtmB immunoblot, as detailed in Chapter 2.

4.2.7 Recombinant PylB production and isolation

E. coli transformed with pK13BHis was cultured in 3 ml LB medium supplemented with 34 µg/ml chloramphenicol overnight at 37oC. This overnight culture was used to inoculate 1 L of the same medium and was incubated at

o 37 C with shaking. At OD600 0.4-0.6, 80 µM was added and the culture was allowed to grow under the same conditions for 2 hours further. Cells were subsequently pelleted, washed twice in 50 mM MOPS, pH 7.2, and were frozen in liquid nitrogen for at least 15 minutes. Cells were stored at -80oC until used for protein purification.

PylB purification was carried out by nickel affinity chromatography in an anoxic chamber (Coy Laboratory Products, Inc., Grass Lakes, MI). Solutions of

10 mM imidazole, 500 mM NaCl, 2 mM dithiothreitol (DTT) in 20 mM sodium phosphate buffer, pH 7.2; and 500 mM imidazole, 500 mM NaCl, 2 mM 122

dithiothreitol (DTT) in 20 mM sodium phosphate buffer, pH 7.2 were made anaerobic by multiple cycles flush/evacuation with nitrogen. All subsequent steps were carried out under anaerobic conditions. Frozen cells grown and stored as described above were thawed and suspended in the 10 mM imidazole buffer.

Cells were lysed using a French pressure cell operated at 10,000 PSI. Soluble proteins were separated from insoluble cellular components after centrifugation at 25,000 xg for 25 minutes. The resulting supernatant was applied to a 1 ml

Nickel-Nitrilotriacetic Acid (Ni-NTA) Superflow column (Qiagen Inc., Valencia,

CA) that had been equilibrated with the 10 mM imidazole solution. A linear gradient (1 ml/min) between 10 mM imidazole – 500 mM imidazole as prepared above over a total of 40 ml was used to elute PylB. Fractions (1 ml each) were collected and those showing the strongest absorbance at 280 nm were further analyzed for PylB purity by SDS-PAGE. Briefly, 4x SDS-PAGE loading dye (250 mM Tris-HCl pH 6.8, 40% glycerol, 8% SDS, 0.08% bromophenol blue, 10% "- mercaptoethanol)) was added to 15 µl of each fraction demonstrating strong absorbance at 280 nm, and these samples were subsequently heated at 95oC for

10 minutes. These fractions were then loaded onto a 12.5% acrylamide gel containing 1% SDS (SDS-PAGE) and electrophoresed at 120 V (Laemmli, 1970).

Proteins were visualized after gels were stained in a Coomassie stain (0.1%

(w/v) Coomassie R250, 40% methanol, 10% acetic acid) and destained in a solution of 40% methanol and 10% acetic acid. Pixel density measurements of contaminating protein bands from the scanned SDS-PAGE gel were measured

123

using ImageJ software. Fractions with the highest concentration of PylB were stored in anaerobic glass vials sealed with rubber stoppers at -80oC.

4.2.8 Iron analysis of PylB

Moles of iron in relation to moles of protein in fractions containing the highest concentrations of PylB was performed using an o-phenanthroline assay

(Lovenberg, Buchanan, & Rabinowitz, 1963). A 0.5 mM solution of ferrous ammonium sulfate was used to generate a standard curve. Briefly, increasing amounts of ferrous ammonium sulfate was added to ddH2O for a final volume of

100 µl. An equal volume of 0.2 N HCl was added to the diluted ferrous ammonium sulfate samples, heated at 80oC for 10 minutes, and any precipitate was pelleted by centrifugation at 16,000 xg for 5 minutes. After 100 µl of this supernatant was transferred to fresh tubes, 20 µl of a 10% hydroxylamine-HCl solution and 100 µl of a 0.1% solution of o-phenanthroline were added. Following incubation for 30 minutes at room temperature, absorbance was measured using a UV-Visible spectrophotometer at 512 nm.

Protein concentrations of fractions containing the highest PylB concentrations as observed by SDS-PAGE were estimated using Bradford reagent (Thermo Fisher Scientific Inc., Rockford, IL) with bovine serum albumin as a standard. These fractions were then used to analyze the total iron content in

PylB using the o-phenanthroline assay. Approximately 130 µg total protein was used in place of ferrous ammonium sulfate, and the assay was performed as described above. 124

4.2.9 Growth conditions for MtmB(His)6 production in the presence of deuterated lysine

A 3 ml overnight culture of E. coli transformed with pDLBADHis and pK13 that had been grown in M9-SAG medium was used to inoculate 1 L of the same

o medium. Cultures were grown at 37 C with shaking. OD600 0.4-0.6, cells were pelleted by centrifugation and washed twice in 50 mM MOPS, pH 7.2. Cells were then resuspended in 1 L M9-SAG medium with 1 mM 2,3,3,4,4,5,5,6,6-d9-L- lysine at 99% enrichment, 2,6,6-d3-L-lysine at 98% enrichment, or 4,4,5,5-d4-L- lysine at 98% enrichment (C/D/N Isotopes Inc., Quebec, Canada) taking the place of 1 mM lysine at natural isotopic distributions. At this time, 80 µM IPTG is added to the media to induce expression of pylBCDTS genes. After 1 hour further growth at 37oC with shaking, 0.02% arabinose is added to the growing culture to induce expression of mtmB1. Cultures continued at 37oC for 2 hours.

Cells were then pelleted by centrifugation and washed twice with 50 mM MOPS,

o pH 7.2. Cell pellets were stored at -20 C until MtmB(His)6 was enriched and prepared for mass spectrometry as described in Chapter 2.

125

4.3 Results

4.3.1 Identifying desmethylpyrrolysine intermediates using thin layer chromatography

To better understand the pyrrolysine biosynthesis step that follows the initial PylB catalyzed reaction, we studied the first step in desmethylpyrrolysine biosynthesis. In the event that PylC is the first enzyme in the desmethylpyrrolysine biosynthetic pathway, we hypothesized that a ligation product of the carboxyl-group of D-ornithine to the epsilon nitrogen of L-lysine would be detected from recombinant E. coli expressing pylC that had been cultured in the presence of D-ornithine (Figure 4.1a). A commercially synthesized standard of this hypothesized product (D-ornithyl-N!-L-lysine) migrates just above lysine when developed on a cellulose thin layer chromatography (TLC) plate in a resolving system of 35% butanol:38.5% acetone:3.5% glacial acetic acid:23% ddH2O (v/v/v/v). If PylD catalyzes the first step in desmethylpyrrolysine biosynthesis, we hypothesize that from D-ornithine as a substrate, the D-isomer of pyrroline-5-carboxylate will be the product (Figure 4.1b). Using a preparation of DL-pyrroline-5-carboxylate from the lab of Dr. Donald Becker at the University of Nebraska with the same TLC system, two spots appear at Rf=0.60 and 0.53.

We first analyzed the potential accumulation of desmethylpyrrolysine biosynthesis intermediates using E. coli transformed with either pK17 (pylD) or pK18 (pylC). These strains were cultured in M9-SAG in the presence of D- ornithine and universally labelled 14C-L-lysine. Radiolabelling provided a sensitive methodology for detecting potentially low levels of intermediates in

126

Figure 4.1 The most likely first step of desmethylpyrrolysine biosynthesis from D- ornithine and L-lysine in the event that either (a) PylC or (b) PylD act as the first enzyme in the pathway. In the event that PylD acts first, PylD catalyzes the oxidative deamination of the D-ornithine #-amine. The resulting semialdehyde would undergo a spontaneous dehydration, resulting in the D-isomer of pyrroline- 5-carboxylate.

127

desmethylpyrrolysine biosynthesis should PylC act as the first enzyme in the pathway. Sensitive detection of lysine derivatives was especially desirable, as polar compounds appear to be less efficiently extract by the methanol/ethyl acetate procedure employed.

After culturing in the presence of D-ornithine and 14C-L-lysine, the appearance of a new spot could only be detected in organic solvent extracts of cells expressing pylC (Figure 4.2). This product co-migrates with D-ornithyl-N!-L- lysine. No additional uncharacterized spots appeared in either pylC or pylD extracts. This result indicated that PylC is the first enzyme in the desmethylpyrrolysine biosynthetic pathway. This data also suggests that the product of the reaction that PylC catalyzes accumulates in recombinant E. coli and is likely to be D-ornithyl-N!-L-lysine. However, it was unlikely that any radiolabelled intermediate would appear in cells expressing pylD, as we hypothesize that only D-ornithine would be the only substrate for PylD in the event that this enzyme acts first. We thus turned to mass spectrometry to better identify the product that accumulates in E. coli transformed with pK18 (pylC) and to investigate any potential intermediates that may accumulate in E. coli transformed with pK17 (pylD).

128

Figure 4.2 TLC of organic solvent extracts of E. coli bearing pK17 (pylD) or pK18 (pylC) after incubation in M9-SAG supplemented with uniformly labelled 14C-L- lysine and 5 mM D-ornithine. Cellulose TLC plates were resolved in the same dimension twice in a solvent system of 35% butanol:38.5% acetone:3.5% glacial acetic acid:23% ddH2O (v/v/v/v). Spots were visualized by phosphor autoradiography after exposure to a general purpose phosphor screen for at least 24 hours. A unique spot is observed only in pylC extracts. The spot indicated by the arrow appears only in cells expressing pylC and co-migrates with commercially-synthesized D-ornithyl-N!-lysine. The spot above the arrow has the same Rf as cadaverine.

129

4.3.2 Product of PylC enzymatic activity detected by mass spectrometry

E. coli transformed with pK17 (pylD), pK18 (pylC), or the parent vector pACYCDuet-1 was used for mass spectrometry analysis for possible intermediates in the desmethylpyrrolysine pathway. We had previously observed higher amounts of pyrrolysine synthesis in cells grown in LB rather than M9-SAG.

Thus, these strains were cultured in LB supplemented with 10 mM D-ornithine and 10 mM L-lysine to potentially increase the synthesis of desmethylpyrrolysine pathway intermediates. Strains were also cultured in the absence of D-ornithine to serve as a negative control. Additionally, we employed a procedure with hot methanol which extracts the metabolite pool without discrimination towards polar compounds (Maharjan & Ferenci, 2003). We could only detect a signal corresponding to a desmethylpyrrolysine pathway intermediate in extracts of E. coli bearing pK18 that had been cultured in the presence of D-ornithine (Figure

4.3). This ion (M+H), m/z 261.1915 is within 2.30 ppm of the theoretical m/z

(261.1921) for D-ornithyl-N!-L-lysine. A second ion, m/z 262.1948, was detected as being approximately 12% relative intensity of the m/z 261.1915 signal. This corresponds very closely to the calculated m/z (262.1955) and predicted intensity

(11%) of anaticipated isotopic distribution pattern of for D-ornithyl-N!-L-lysine.

This signal was not detected in extracts of the same strain cultured in the absence of D-ornithine, nor could it be detected in extracts of E. coli bearing either pACYCDuet-1 or pK17 regardless of the presence of D-ornithine. We also could not detect any ion suggesting the accumulation of a D-ornithine oxidation

130

Figure 4.3 An ion (m/z 261.1915) within 2.30 ppm of the theoretical m/z (261.1921) of D-ornithyl-N!-L-lysine was detected only in extracts from E. coli transformed with pK18 (pylC) that had been cultured in the presence of D- ornithine. A second ion (observed m/z 262.1948), with a relative intensity of approximately 12% that of the m/z 261.1915 signal. This is consistent with the theoretical m/z (262.1955) and predicted relative intensity (11%) for the isotopic distribution of D-ornithyl-N!-L-lysine.

131

product in extracts of E. coli bearing pK17. In conjunction with the results seen in the radiolabelling experiment described above, we concluded that PylC catalyzes the first step in the desmethylpyrrolysine biosynthetic pathway, ligating the carboxyl group of D-ornithine to the epsilon nitrogen of L-lysine. If D-ornithyl-N!-

L-lysine is the product of the PylC catalyzed reaction, we hypothesize that it should serve as a substrate for PylD.

4.3.3 D-ornithyl-N!-L-lysine can serve as a substrate for PylD in vivo

TLC and mass spectrometry experiments indicate that D-ornithyl-N!-L- lysine is the product of the reaction catalyzed by PylC. We hypothesized that commercially synthesized D-ornithyl-N!-L-lysine should thus serve as a substrate for PylD, resulting in desmethylpyrrolysine which can then be co-translationally inserted into MtmB at the UAG position. E. coli bearing pDLBADHis and either pK17 (pylD) or pACYCDuet-1 were cultured in M9-SAG supplemented with 10 mM D-ornithyl-N!-L-lysine. Full-length MtmB could be detected from E. coli bearing pK17 but not pACYCDuet-1 (Figure 4.4). This indicates that the UAG read-through is dependent on PylD. We concluded that PylD can use D-ornithyl-

N!-L-lysine as a substrate to create a pyrrolysine analog, likely desmethylpyrrolysine, that is recognized by pyrrolysyl-tRNA synthetase for charging of tRNAPyl and incorporated into MtmB at the UAG position.

132

Figure 4.4 Anti-MtmB immunoblot of whole cell extracts of E. coli bearing pDLBADHis (pylTS and mtmB1-his) and either pACYCDuet-1 or pK17 (pylD). Supplementing M9-SAG medium with D-ornithyl-N!-lysine results in the production of full-length MtmB only when pylD is expressed. Full-length MtmB is not detectable in cell extracts of the vector only control.

133

4.3.4 Evidence that PylB is an iron-sulfur protein

As discussed in Chapter 1, it has been previously hypothesized that PylB is a radical SAM enzyme based on the presence of sequences which are hallmarks of the radical SAM superfamily of enzymes (Nicolet & Drennan, 2004;

Srinivasan et al., 2002). More specifically, the presence of a CXXXCXXC motif

(in which X represents any amino acid) characteristic of this superfamily has been the primary basis for placing PylB in this family. This motif coordinates the unique [4Fe-4S] cluster that is necessary for the reductive cleavage of SAM to methionine and a 5’-deoxyadenosine radical. Some members of the radical SAM family, such as biotin synthase, also include an additional iron sulfur cluster.

Therefore, we set out to determine the iron content per mole of purified recombinant PylB to confirm the incorporation of iron into preparations of the recombinant protein.

The [4Fe-4S] cluster is oxygen-labile, so all purification steps were carried out under anoxic conditions. After nickel-affinity chromatography, fractions demonstrating the strongest absorbance at 280 nm were analyzed for PylB purity by SDS-PAGE (Figure 4.5). Those fractions with the largest band at approximately 40 kDa coincided with those fractions appearing visibly brown, possibly due to high iron content. PylB elutes over nine 1 ml fractions, from approximately 171 mM – 270 mM imidazole. Pixel density measurements of scans of the PylB preparation following SDS gel electrophoresis indicated that contaminating proteins make up less than 10% of the total protein content within these fractions.

134

Figure 4.5 Coomassie-stained 12.5% SDS-PAGE gel of PylB-enriched fractions of a protein peak from nickel affinity chromatography. Fractions represented in lanes marked with an asterisk were used for total iron analysis.

135

O-phenanthroline was used to analyze total iron content of fractions with the highest putative PylB concentrations. Fractions used for analysis are indicated by asterisks in Figure 4.5. The preparations of recombinant PylB were found to contain an average of 4.2 mol iron per mol total protein.

4.3.5 Deuterium labelling studies

The studies using D-ornithine presented in Chapter 3 allowed us to place

PylB first in the pyrrolysine biosynthetic pathway. These studies also led us to hypothesize that PylB catalyzes a radical mutase reaction on L-lysine, resulting in (3R)-3-methyl-D-ornithine. Such a mutase reaction involving a carbon skeleton rearrangement has not been previously observed within the radical SAM superfamily of enzymes. We performed a series of labelling studies using lysine deuterated at specific non-exchangeable positions to provide further support to the hypothesis that PylB acts as a lysine mutase.

As with labelling studies detailed in Chapter 2, we used the E. coli strain transformed with pK13 (pylBCD) and pDLBADHis (pylTS and mtmB). Lysine incorporation into pyrrolysine was characterized in Chapter 2 by examining both the pyrrolysine-containing peptide and the pyrrolysine residue after growth in M9-

SAG media with lysine labelled at carbons and nitrogens. We used the same methodology here with deuterated lysine.

We first investigated how 2,3,3,4,4,5,5,6,6-d9-L-lysine is incorporated into pyrrolysine. If no hydrogens are exchanged during pyrrolysine biosynthesis, we expect pyrrolysine to increase in mass by 17 Da, as one of the deuterium at the

136

C6 position of the ring precursor is expected to be lost during oxidation. For the first time during isotopic labelling experiments, we detected ions corresponding to multiple pyrrolysine labelling patterns (Table 4.1). As with the incorporation of

13C- and 15N-lysine, 2H-lysine incorporated into the chymotryptic pyrrolysyl- peptide 194AGRPGMGVOGPETSL208 was localized to the pyrrolysine residue itself. Labelled pyrrolysyl-peptides were identified with both methionine and methionine sulfoxide at residue 199. Ions corresponding to pyrrolysyl-peptide with 15 deuterium (m/z 790.95302+ and 798.95262+) were observed. Collision- induced dissociation and tandem mass spectrometry (CID MS/MS) with these parent ions was consistent with only the pyrrolysine residue being deuterated, increasing by 15 Da (Table 4.2, Table 4.3). Peptide ions whose m/z values indicated they carried only 14 deuterium were also detected (Table 4.1). These signals were relatively weak, however, and MS/MS could not be obtained from these ions. Additionally, ions were detected that corresponded to the pyrrolysyl- peptide containing 9 deuterium (m/z 787.93592+ and 795.93412+) (Table 4.1). CID

MS/MS of these parent ions (Table 4.4, Table 4.5) indicated that the labelling was specific to the pyrrolysine residue. We hypothesize that in these peptides, pyrrolysine was biosynthesized from one intact d9-deuterated lysine and a second unlabelled lysine.

We could not determine which deuterium are exchanged during pyrrolysine biosynthesis from the labelling patterns observed with

2,3,3,4,4,5,5,6,6-d9-L-lysine. As we suspect that one deuterium is lost from the

137

Table 4.1: Comparison of MtmB pyrrolysyl-peptide and pyrrolysine residue after synthesis in the presence of L-lysine comprised of isotopes of naturally occurring abundances or: 2,3,3,4,4,5,5,6,6-d9-L-lysine, 2,6,6-d3-L-lysine, 4,4,5,5-d4- L-lysine. Mass increase relative to unlabelled peptide is calculated using the theoretical mass of unlabeled peptide and

138 the observed mass of the labeled peptide. Pyrrolysine (O) residue mass is the calculated average of the observed mass from b- and y-series ions generated by MS/MS. Dashes (-) in this column indicate that the parent ion was not abundant enough to obtain MS/MS data. Pyrrolysine mass increase relative to unlabeled pyrrolysine is calculated using the average described above relative to the theoretical mass of unlabeled pyrrolysine (237.15 Da).

Table 4.1

12 2+ 2+ C, 194AGRPGMGVOGPETSL208 783.4080 783.4089 0.77 - 237.05 - 14 1 2+ 2+ N, H 194AGRPGM(OX)GVOGPETSL208 791.4065 791.4063 0.25 - 236.95 - 2+ 2+ 2,3,3,4, 194AGRPGMGVOGPETSL208 790.9530 790.9551 2.66 15.0882 252.06 14.92 4, 787.93592+ 787.93662+ 0.89 9.0540 246.28 9.13 5,5,6,6- 790.45072+ 790.45202+ 1.64 14.0836 - - 2+ 2+

139 d9-L- 194AGRPGM(OX)GVOGPETSL208 798.9526 798.9517 1.13 15.0908 252.24 15.09 lysine 795.93412+ 795.93862+ 5.65 9.0646 246.11 8.96 798.44952+ 798.44922+ 0.36 14.0858 - - 2+ 2+ 2,6,6- 194AGRPGMGVOGPETSL208 785.9257 785.9245 1.53 5.0336 242.12 4.97 2+ 2+ d3-L- 784.9200 784.9183 2.17 3.0222 - - 2+ 2+ lysine 194AGRPGM(OX)GVOGPETSL208 793.9270 793.9220 6.30 5.0414 242.13 4.98 792.92012+ 792.91582+ 5.42 3.0276 - - 2+ 2+ 4,4,5,5 194AGRPGMGVOGPETSL208 786.4314 786.4276 4.83 6.0374 243.16 6.01 2+ 2+ -d4-L- 785.9290 785.9245 5.73 5.0312 242.14 4.99 lysine 785.42642+ 785.42142+ 6.37 4.0250 241.10 3.95

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 213.83 y14 755.67 Gly (156+57) Arg 285.27 b3 97.10 y12 1296.51 Pro 382.41 b4 97.14 56.89 y11 1199.41 Gly 439.19 b5 56.78 131.11 y10 1142.52 Met 570.22 b6 131.03 56.77 y9 1011.41 Gly 627.34 b7 57.12 99.24 y8 954.64 Val 726.38 b8 99.04 252.24 y7 855.40 Pyl 978.44 b9 252.06 (237+15) (237+15) 57.00 y6 603.16 Gly 1035.51 b10 57.07 97.13 y5 546.16 Pro 1132.72 b11 97.21 128.94 y4 449.03 Glu 1261.70 b12 128.98 y3 320.09 Thr 1362.56 b13 100.86 Ser 1449.10 b14 Leu

Table 4.2 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylBCDTS and mtmB1 in the presence of 2,3,3,4,4,5,5,6,6-d9-L-lysine. MS/MS data obtained from an m/z 790.95302+ ion.

140

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 57.18 y14 763.40 Gly +2 156.06 y13 734.81 Arg 285.23 b3 96.74 y12 1312.56 Pro 382.40 b4 97.17 57.10 y11 1215.82 Gly 439.41 b5 57.01 147.23 y10 1158.72 Met(ox) 586.25 b6 146.84 56.92 y9 1011.49 Gly 643.36 b7 57.11 99.11 y8 954.57 Val 742.24 b8 98.88 252.30 y7 855.46 Pyl 994.48 b9 252.24 (237+15) (237+15) 56.94 y6 603.16 Gly 1051.50 b10 57.02 226.03 y5 546.22 Pro 1148.24 b11 96.74 (129+97) Glu 1277.57 b12 129.33 y3 320.19 Thr 1378.65 b13 101.08 +2 Ser 733.10 b14 86.55 Leu

Table 4.3 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGM(OX)GVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylBCDTS and mtmB1 in the presence of 2,3,3,4,4,5,5,6,6-d9-L-lysine. MS/MS data obtained from an m/z 798.95172+ ion.

141

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 57.25 y14 752.54 Gly 156.40 y13 1446.83 Arg 285.12 b3 96.88 y12 1290.43 Pro 382.36 b4 97.24 57.38 y11 1193.55 Gly 439.34 b5 56.98 130.83 y10 1136.17 Met 570.30 b6 130.96 57.09 y9 1005.34 Gly 627.26 b7 56.96 98.72 y8 948.25 Val 726.21 b8 98.95 246.37 y7 849.53 Pyl 972.50 b9 246.28 (237+9) (237+9) 57.00 y6 603.16 Gly 1029.53 b10 57.03 97.10 y5 546.16 Pro 1126.38 b11 96.85 128.62 y4 449.06 Glu 1255.60 b12 129.22 y3 320.44 Thr 1356.60 b13 101.00 +2 Ser 722.25 b14 86.90 Leu

Table 4.4 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylBCDTS and mtmB1 in the presence of 2,3,3,4,4,5,5,6,6-d9-L-lysine. MS/MS data obtained from an m/z 787.93592+ ion.

142

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala Gly +2 156.23 y13 731.75 Arg 285.14 b3 153.78 y12 1306.27 Pro (57+97) Gly 439.45 b5 154.31 (97+57) 146.96 y10 1152.49 Met(ox) 586.23 b6 146.78 57.25 y9 1005.53 Gly 643.23 b7 57.00 98.86 y8 948.28 Val 742.32 b8 99.09 246.23 y7 849.42 Pyl 988.43 b9 246.11 (237+9) (237+9) 57.04 y6 603.19 Gly 1045.54 b10 57.11 +2 226.07 y5 546.15 Pro 571.88 b11 97.22 (129+97) Glu 1271.15 b12 128.39 y3 320.08 Thr 1372.72 b13 101.57 +2 Ser 730.22 b14 86.72 Leu

Table 4.5 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGM(OX)GVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylBCDTS and mtmB1 in the presence of 2,3,3,4,4,5,5,6,6-d9-L-lysine. MS/MS data obtained from an m/z 795.93862+ ion.

143

C6 position during oxidation of the ring precursor, we performed labelling studies of the pyrrolysyl-peptide with 2,6,6-d3-L-lysine. As was seen in the results of the labelling experiment using d9-L-lysine, signals corresponding to pyrrolysyl- peptide labelled with different amounts of deuterium could be detected. Again, peptides were detected with either methionine or methionine sulfoxide at position

199 (Table 4.1). The most abundant signals were consistent with the pyrrolysyl- peptide containing 5 deuterium (m/z 785.92572+ and 793.92702+). CID MS/MS of these parent ions indicated that the stable isotope was incorporated only at the pyrrolysine residue (Table 4.1, Table 4.6, Table 4.7). These data are consistent with the hypothesis that one hydrogen is lost during the synthesis of the ring moiety of pyrrolysine (Figure 4.6a). As was observed with the d9-L-lysine experiment, two additional signals were detected (m/z 784.92002+ and

792.92012+) that correspond to pyrrolysine containing one intact labelled lysine and one unlabelled lysine (Figure 4.6b). However, these ions were in such low abundance that MS/MS of these peptides could not be obtained. The results obtained in the d9-L-lysine labelling experiment indicated that three deuterium are lost during synthesis of pyrrolysine from two lysine molecules. The results with

2,6,6-d3-L-lysine indicate that one of the lost deuterium can be attributed to the

C2 or C6 position. This is in keeping with the prediction that during ring synthesis, a C6 proton would be lost from a precursor lysine as the terminal amine is oxidized to form the pyrroline ring.

144

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala Gly +2 156.18 y13 721.84 Arg 285.25 b3 96.96 y12 1286.50 Pro 382.25 b4 97.00 188.09 y11 1189.54 Gly 439.20 b5 56.95 (133+57) Met 570.30 b6 131.10 57.12 y9 1001.45 Gly 627.19 b7 56.89 99.02 y8 944.33 Val 726.37 b8 99.18 242.17 y7 845.31 Pyl 968.43 b9 242.06 (237+5) (237+5) 57.00 y6 603.14 Gly 1025.55 b10 56.99 97.09 y5 546.14 Pro 1122.49 b11 96.94 128.86 y4 449.05 Glu 1251.39 b12 128.90 y3 320.19 Thr 1352.72 b13 101.33 +2 Ser 720.48 b14 87.24 Leu

Table 4.6 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylBCDTS and mtmB1 in the presence of 2,6,6-d3-L-lysine. MS/MS data obtained from an m/z 785.92572+ ion.

145

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala +2 57.32 y14 758.48 Gly +2 156.06 y13 729.82 Arg 285.20 b3 96.81 y12 1302.258 Pro 57.24 1205.77 Gly 439.23 b5 154.03 (97+57) 147.27 y10 1148.53 Met(ox) 586.30 b6 146.07 56.92 y9 1001.26 Gly 643.34 b7 57.04 98.95 y8 944.34 Val 742.29 b8 98.95 242.14 y7 845.39 Pyl 984.41 b9 242.12 (237+5) (237+5) 56.98 y6 603.25 Gly 1041.56 b10 57.15 225.94 y5 546.27 Pro 1138.60 b11 97.04 (129+97) Glu 1267.47 b12 128.85 y3 320.33 Thr 1368.68 b13 101.23 +2 Ser 728.47 b14 87.26 Leu

Table 4.7 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGM(OX)GVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylBCDTS and mtmB1 in the presence of 2,6,6-d3-L-lysine. MS/MS data obtained from an m/z 793.92702+ ion.

146

Figure 4.6 Likely positions of deuterium incorporation in pyrrolysine synthesized by recombinant E. coli expressing pylBCDTS and mtmB1 in the presence of 2,6,6-d3-L-lysine. (a) Pyrrolysine with 5 deuterium incorporated. One deuterium at the C6 position of one lysine molecule is lost during formation of the pyrroline ring. (b) Pyrrolysine with 3 deuterium incorporated. One molecule of 2,6,6-d3-L- lysine serves as the precursor of the acyl portion of the pyrrolysine molecule, while one unlabelled lysine molecule acts as the ring precursor.

147

To better understand which other lysine deuterium might be labilized during pyrrolysine biosynthesis, the labelling pattern using 4,4,5,5-d4-L-lysine was investigated. As was observed with the results of the d9-L-lysine labelling experiment, signals corresponding to three different labelling states of pyrrolysine were detected in MtmB that was isolated from recombinant E. coli cultured in the presence of 4,4,5,5-d4-L-lysine (Table 4.1). Signals were detected that correlate to pyrrolysyl-peptide containing 6 deuterium (m/z 786.43142+), 5 deuterium (m/z

785.92902+), and 4 deuterium (m/z 785.42642+). CID MS/MS of these parent ions agreed with only the pyrrolysine residue increasing by 6 Da (Table 4.8), 5 Da

(Table 4.9), and 4 Da (Table 4.10) respectively.

The 4,4,5,5-d4-L-lysine label was directly analyzed by quadrupole time-of- flight liquid chromatography mass spectrometry (Q-TOF LC-MS). Signals were present that corresponded to lysine ions present as a monomer, dimer, and trimer. In each form, lysine was detected containing 4 deuterium (M+H 151, 301, and 451 respectively). Signals were also detected consistent with lysine containing 3 deuterium (M+H 150, 299, 300, 448, 449, 450). The presence of a mixture of d3-lysine and d4-lysine may contribute to the multiple signals observed for the pyrrolysyl-residue synthesized using this preparation of labelled 4,4,5,5- d4-L-lysine.

148

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala Gly Arg 285.20 b3 154.29 y12 1287.49 Pro (57+97) Gly 439.40 b5 154.20 (97+57) 130.83 y10 1133.20 Met 570.29 b6 130.89 56.89 y9 1002.37 Gly 627.14 b7 56.85 99.07 y8 945.48 Val 726.33 b8 99.19 243.24 y7 846.41 Pyl 969.41 b9 243.08 (237+6) (237+6) 56.99 y6 603.17 Gly 1026.46 b10 57.05 97.04 y5 546.18 Pro 1123.65 b11 97.19 128.94 y4 449.14 Glu 1252.64 b12 128.99 y3 320.20 Thr 1353.64 b13 101.00 Ser Leu

Table 4.8 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylBCDTS and mtmB1 in the presence of 4,4,5,5-d4-L-lysine. MS/MS data obtained from an m/z 786.43142+ ion.

149

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala Gly +2 155.56 y13 721.51 Arg 285.20 b3 154.12 y12 1286.46 Pro (57+97) Gly 439.40 b5 154.20 (97+57) 130.93 y10 1132.34 Met 570.29 b6 130.89 57.00 y9 1001.41 Gly 627.14 b7 56.85 99.10 y8 944.41 Val 726.33 b8 99.19 242.14 y7 845.31 Pyl 968.46 b9 242.13 (237+5) (237+5) 56.99 y6 603.17 Gly 1025.53 b10 57.07 97.04 y5 546.18 Pro 1122.26 b11 96.73 128.94 y4 449.14 Glu 1251.71 b12 129.45 y3 320.20 Thr 1352.66 b13 100.95 Ser Leu

Table 4.9 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylBCDTS and mtmB1 in the presence of 4,4,5,5-d4-L-lysine. MS/MS data obtained from an m/z 785.92902+ ion.

150

!m Fragment Measured Sequence Measured Fragment !m between Ion m/z m/z Ion between yn and bn and yn-1 bn-1 Ala Gly +2 156.56 y13 721.51 Arg 285.20 b3 284.97 y12 1285.46 Pro (131+57 +97) Gly 439.40 b5 154.20 (97+57) Met 570.29 b6 130.89 57.16 y9 1000.49 Gly 627.14 b7 56.85 99.18 y8 943.33 Val 726.33 b8 99.19 240.98 y7 844.15 Pyl 967.54 b9 241.21 (237+4) (237+4) 56.99 y6 603.17 Gly 1024.55 b10 57.01 97.04 y5 546.18 Pro 1121.55 b11 97.00 128.94 y4 449.14 Glu b12 y3 320.20 Thr 1351.72 b13 230.17 (129+ 101) Ser Leu

Table 4.10 The calculated masses and measured m/z of b- and y-series ions generated after collision-induced dissociation of MtmB peptide 194AGRPGMGVOGPETSL208. The pyrrolysine-containing peptide was analyzed from the chymotryptic digest of MtmB isolated from E. coli expressing pylBCDTS and mtmB1 in the presence of 4,4,5,5-d4-L-lysine. MS/MS data obtained from an m/z 785.42642+ ion.

151

4.4 Discussion

Studies described in Chapter 3 using recombinant E. coli strains cultured in the presence of D-ornithine allowed us to assign PylB as the first enzyme in the pyrrolysine biosynthetic pathway, catalyzing the formation of (3R)-3-methyl-

D-ornithine from lysine. However, the order of PylC and PylD within the rest of the pathway could not be determined. The desmethylpyrrolysine biosynthetic pathway was used to gain insight into the order of enzymes in the pyrrolysine biosynthetic pathway. We hypothesized that desmethylpyrrolysine biosynthetic pathway intermediates would accumulate in the cytoplasm of recombinant E. coli expressing either pylC or pylD when cultured in media supplemented with D- ornithine. PylC has been suggested to ligate L-lysine and the ring precursor of pyrrolysine, based on sequence homology to D-alanine-D-alanine ligase and carbamoyl phosphate synthetase (Gaston et al., 2011; Longstaff et al., 2007;

Srinivasan et al., 2002). In the event that it acts as the first enzyme in the desmethylpyrrolysine biosynthetic pathway, we expect that PylC will catalyze the ligation of the carboxyl carbon of D-ornithine to the epsilon nitrogen of L-lysine in an ATP-dependent reaction, resulting in D-ornithyl-N!-L-lysine (Figure 4.1a).

Alternatively, should PylD catalyze the first reaction of the desmethylpyrrolysine biosynthetic pathway, we anticipated that the D-isomer of pyrrolyine-5- carboxylate would accumulate in the cytoplasm of E. coli transformed with pK17

(pylD) when cultured in the presence of D-ornithine (Figure 4.1b). This PylD- catalyzed reaction is hypothesized based on the closest sequence homologies

PylD shares are to amino acid dehydrogenases (Gaston et al., 2011; Longstaff

152

et al., 2007; Srinivasan et al., 2002). Using TLC, we observed a new radiolabelled spot only in methanol/ethyl acetate extracts of recombinant E. coli expressing pylC and cultured in medium supplemented with D-ornithine and 14C-

L-lysine. This spot co-migrates with commercially-synthesized D-ornithyl-N!-L- lysine. A product with the same mass as D-ornithyl-N!-L-lysine could be detected by mass spectrometry in hot methanol extracts of E. coli transformed with pK18

(pylC) only when this strain was cultured in the presence of D-ornithine. A signal corresponding with the accumulation of pyrroline-5-carboxylate in E. coli transformed with pK17 (pylD) could not be detected. These data strongly suggest that PylC catalyzes the first reaction in desmethylpyrrolysine biosynthesis, ligating D-ornithine to L-lysine. We hypothesized that E. coli transformed with pK17 (pylD) should thus be able to use exogenously provided D-ornithyl-N!-L- lysine as a substrate for desmethylpyrrolysine biosynthesis. E.coli bearing either pK17 or the parent vector and pDLBADHis (pylTS and mtmB1-his) were cultured in M9-SAG supplemented D-ornithyl-N!-L-lysine. Full-length MtmB can be detected by anti-MtmB immunoblot only in extracts of E. coli transformed with pK17, suggesting that D-ornithyl-N!-L-lysine is converted into a pyrrolysine analog in a PylD-dependent reaction. Based on these data, we propose that PylC acts as the first enzyme in the desmethylpyrrolysine biosynthetic pathway, catalyzing the ligation of the carboxyl carbon of D-ornithine to the epsilon nitrogen of L-lysine, resulting in D-ornithyl-N!-L-lysine (Figure 4.7). This then acts as a substrate of PylD, which catalyzes the oxidative deamination of the "-amine

153

Figure 4.7 Desmethylpyrrolysine biosynthetic pathway. PylC first catalyzes the ligation of the carboxyl carbon of D-ornithine to the epsilon nitrogen of L-lysine in an ATP-dependent reaction, resulting in D-ornithyl-N!-L-lysine. This acts as a substrate for PylD, which catalyzes the oxidation of the terminal amine of the ornithyl moiety, forming D-glutamyl-5-semialdehyde-N!-L-lysine. Desmethylpyrrolysine is the final product of the pathway, resulting from the spontaneous dehydration of the semialdehyde species.

154

of the ornithyl moiety using NAD as a cofactor, thereby forming desmethylpyrrolysine after the spontaneous dehydration of D-glutamyl-5- semialdehyde-N!-L-lysine.

Most of our findings concerning desmethylpyrrolysine were recently published (Gaston, Zhang et al., 2011). Shortly after this, the Geierstanger group independently published similar findings, in which UAG read-through was achieved in reporter genes of E. coli expressing pylD, pylT, and pylS only when growth media is supplemented with D-ornithyl-N!-L-lysine (Cellitti et al., 2011).

Mass spectrometry of the reporter protein isolated from these cells confirmed the incorporation of desmethylpyrrolysine at the UAG encoded position. It is also notable these authors showed desmethylpyrrolysine is the only amino acid detected at the UAG-encoded position in protein isolated from these cells as well as from strains expressing pylB, pylD, pylT, and pylS. These data further support the hypotheses that PylB acts first in the pyrrolysine biosynthetic pathway and that D-ornithine is an analog of the reaction product catalyzed by PylB. Additional in vivo experiments showed that PylD exhibits substrate stereospecificity for D- ornithyl-N!-L-lysine, as no UAG read-through was detected when cells were cultured in medium supplemented with L-ornithyl-N!-L-lysine.

PylB has been hypothesized to belong to the radical SAM superfamily of enzymes based on the characteristic CXXXCXXC motif found in the enzyme’s amino acid sequence (Nicolet & Drennan, 2004; Srinivasan et al., 2002). This motif has been shown in other enzymes belonging to the radical SAM family to coordinate a [4Fe-4S] cluster. The iron-sulfur cluster is responsible for the

155

cleavage of SAM into methionine and the 5’-deoxyadenosine radical, which in turn initiates the reaction specific to the enzyme. In addition to the characteristic

[4Fe-4S] cluster, some radical SAM enzymes, including biotin synthase, coordinate additional iron sulfur clusters. PylB was purified and total iron content analyzed to ensure that recombinant PylB incorporates the predicted amounts of iron (4 mol Fe/mol protein). Our analysis of total iron content from purified PylB indicates that there are approximately 4 mol Fe per mol PylB. This supports the hypothesis that had been derived from sequence data that PylB contains one iron sulfur cluster per mol protein, a [4Fe-4S] cluster that is characteristic of radical SAM enzymes. This also indicates that PylB purified from recombinant E. coli possesses a [4Fe-4S] cluster is thus likely to be active.

Based on data presented in Chapter 2 and Chapter 3, we anticipate PylB acts as a lysine mutase. Labilization of some hydrogen bound to lysine carbon as a consequence of PylB activity may occur during the conversion of lysine to (3R)-

3-methyl-D-ornithine. We performed a series of mass spectrometry studies to investigate pyrrolysine biosynthesized in recombinant E. coli cultured in media supplemented with deuterium-labelled lysine to better understand the mechanism of PylB catalysis. All isotopically-labelled lysine used for these studies contained deuterium at non-exchangeable positions, ensuring that the labelling patterns observed were due to enzymatic activity rather than non-enzymatic exchange of these positions with water. Recombinant E. coli expressing pylBCDTS and mtmB1-his was first cultured in the presence of 2,3,3,4,4,5,5,6,6-d9-L-lysine. We hypothesized that if all deuterium are retained during radical PylB reaction,

156

pyrrolysine would increase in mass by 17 Da. Nine deuterium would be incorporated into the acyl chain as an intact lysine, while one deuterium at the C6 position of one lysine molecule is likely lost during PylD-catalyzed cyclization of the (3R)-3-methyl-D-ornithyl moiety. Thus, only 8 deuterium would be retained in the pyrroline ring of pyrrolysine. However, the observed peptides indicate that 3-4 deuterium are exchangeable during pyrrolysine biosynthesis, with the loss of 3 deuterium as the predominant signal.

We next provided evidence that these deuteriums are lost at specific positions using commercially available deuterated lysine compounds: 2,6,6-d3-L- lysine and 4,4,5,5-d4-L-lysine. Observed m/z for both the pyrrolysyl-containing peptide and pyrrolysyl residue from MtmB isolated from recombinant E. coli cultured in the presence of 2,6,6-d3-L-lysine were consistent with pyrrolysine increasing in mass by 5 Da (Figure 4.6a). These data support our hypothesis that one hydrogen at the C6 position is lost during the last step of pyrrolysine biosynthesis. We thus hypothesize that 2-3 hydrogens are exchangeable during the radical rearrangement of lysine by PylB. To better assign at which position these exchangeable hydrogens are on the lysine molecule, we investigated

MtmB isolated from E. coli cultured in medium supplemented with 4,4,5,5-d4-L- lysine. Observed m/z of both peptides and the pyrrolysyl residue indicate that 2-3 exchangeable hydrogens are at the C4 and/or C5 positions, with a loss of two deuterium as the predominant signal. However, when analyzing the 4,4,5,5-d4-L- lysine directly, signals corresponding to lysine labelled with three deuterium were detectable. Thus, it is possible that some signals showing a loss of deuterium

157

may be contributable to this contaminating label rather than enzymatic activity.

However, this data still shows that at a minimum, two deuterium must be lost from C4/C5 during biosynthesis of the pool of pyrrolysine which is subsequently incorporated into protein.

The deuterium labelling studies led us to propose a mechanism for PylB.

As this type of intramolecular carbon skeleton rearrangement has not yet been characterized for radical SAM enzymes, the PylB mechanism we present here is guided by the mechanism proposed for coenzyme B12-dependent glutamate mutase. Glutamate mutase catalyzes the radical rearrangement of L-glutamate to methylaspartate (Marsh, 2009). This reaction is initiated by cleavage of the carbon-cobalt bond of adenosylcobalamin, generating a 5’-deoxyadenosine radical. This radical subsequently abstracts a hydrogen from glutamate, at which point the reaction may proceed in a forward direction to form methylaspartate or backwards to glutamate, depending on the energy barriers of the reaction. Using these studies of glutamate mutase, we propose a similar mechanism for PylB in which some, or all, steps are reversible (Figure 4.8). The reaction is initiated with the production of methionine and a 5’-deoxyadenosyl radical from the reductive cleavage of SAM by the [4Fe-4S] cluster of PylB. The 5’-deoxyadenosyl radical abstracts a hydrogen from the C4 carbon of L-lysine (Figure 4.8 I), resulting in 5’- deoxyadenosine and a lysyl radical (Figure 4.8 II). The subsequent fragmentation

(Figure 4.8 III) and recombination (Figure 4.8 IV) results in (3R)-3-methyl-D- ornithine (Figure 4.8 V) after the abstraction of a hydrogen from either

158

Figure 4.8 Possible mechanism of PylB, in which hydrogen atom abstraction from C4 results in the fragmentation and radical rearrangement of L-lysine to (3R)-3-methyl-D-ornithine. In this model, C3 of lysine serves as the methyl group. If SAM is used as a cofactor, it is regenerated in the last step of the reaction mechanism. Alternatively, an unknown hydrogen donor may participate in this final step if PylB uses SAM as a substrate in the reaction. Figure courtesy of Joseph Krzycki.

159

5’-deoxyadenosine to regenerate SAM, or another unknown hydrogen donor in the event that SAM is used as a substrate. In this mechanism, the C3 carbon of lysine would serve as the methyl group on the pyrroline ring of pyrrolysine. As each of these steps might be reversible, it is possible that more than one hydrogen from C4 is abstracted from lysine during formation of 3-methyl-D- ornithine. This possibility would account for the loss of two deuterium from the two molecules of 4,4,5,5-d4-L-lysine during the synthesis of the majority of the pyrrolysyl-peptide in vivo.

For all deuterium labelling experiments, signals were detected in which only one isotopically labelled lysine was incorporated into pyrrolysine in addition to the signals described above. Signals corresponding to the incorporation of only one isotopically labelled lysine in pyrrolysine were searched for and not detected in labelling experiments using lysine comprised of 14C and/or 15N

(Chapter 2, Chapter 3). All of the signals suggesting partial incorporation are consistent with the acyl-portion of pyrrolysine derived from the deuterated lysine whereas the ring precursor is most likely biosynthesized from unlabelled lysine.

These labelling patterns might be explainable by kinetic isotope effects. Kinetic isotope effects are larger with bond breakage in increasing mass ratio of isotopes; thus these effects are larger with hydrogen isotopes relative to those with other isotopes such as carbon or nitrogen (Kohen & Klinman, 1999). Such effects have been reported with glutamate mutase and coenzyme B12 enzyme methylmalonyl-CoA mutase using deuterium and tritium labelled compounds, especially in reactions involving carbon-deuterium and carbon-tritium bond

160

breaking (Marsh, 2009). Signals corresponding to pyrrolysine made with one intact deuterated lysine and one unlabelled lysine are seen as more intense when using labelled lysine in which deuterium are most likely involved in a carbon-deuterium bond breaking step. It is possible that the slower kinetics of the

PylB reaction using lysine deuterated at positions where carbon-deuterium bond breakage must occur during catalysis results in a higher abundance of pyrrolysine in which residual or biosynthesized lysine lacking deuterium serves as the ring precursor. It is possible that unlabelled lysine contamination may have resulted from lysine biosynthesis or residual amounts remaining in the growth media. However, incorporation of unlabelled lysine into pyrrolysine was not observed in the 13C-lysine and 15N-lysine labelling experiments described in

Chapters 2 and 3 using the same methodologies.

Together with data presented in Chapter 2 and 3, we can now propose a single complete pathway for pyrrolysine biosynthesis (Figure 4.9). PylB acts as the first enzyme in the pathway, catalyzing the radical rearrangement of lysine in a SAM-dependent reaction. This rearrangement also results in a change in stereochemistry around the #-carbon, forming (3R)-3-methyl-D-ornithine. PylC then catalyzes the ligation of the carboxyl carbon of (3R)-3-methyl-D-ornithine to the epsilon nitrogen of a second lysine in an ATP-dependent reaction. This

(2R,3R)-3-methyl-D-ornithyl-N!-L-lysine acts as a substrate for PylD, which uses

NAD as a cofactor to catalyze the oxidative deamination of the ornithyl moiety to form (2R,3R)-3-methyl-glutamyl-5-semialdehyde-N!-L-lysine. A spontaneous

161

dehydration step completes the formation of the pyrroline ring, with pyrrolysine as the final product.

162

163

Figure 4.9 Pyrrolysine biosynthetic pathway from two molecules of lysine. Carbon and nitrogen positions retained in pyrrolysine are shown in red. PylB catalyzes the first reaction, a radical rearrangement of lysine to (3R)-3-methyl-D- ornithine. PylC ligates the carboxyl carbon to the epsilon nitrogen of a second molecule of lysine, forming (2R,3R)-3- methyl-D-ornithyl-N!-L-lysine. This is the substrate for PylD to catalyze the oxidative deamination of the terminal amine of the ornithyl moiety. Pyrrolysine is the product of the resulting spontaneous dehydration of the (2R,3R)-3-methyl- glutamyl-5-semialdehyde-N!-L-lysine.

Chapter 5

FUTURE DIRECTIONS

Since pyrrolysine was first characterized as the 22nd genetically encoded amino acid, a number of studies have advanced the understanding of the genetic encoding of pyrrolysine and the proteins required for pyrrolysine biosynthesis.

The work in this document has led to the first presentation of an ordered pathway of pyrrolysine biosynthesis. The data and conclusions reached here also raise new questions for future investigation, particularly about the action of each of the three enzymes in the pyrrolysine biosynthetic pathway as well as the function of the methyl group of the pyrroline ring of pyrrolysine in methylamine methyl transfer.

The pathway presented in Figure 4.9 is consistent with both the data contained in this dissertation (Gaston, Zhang, Green-Church, & Krzycki, 2011) as well as data that has been published by other investigators (Cellitti et al., 2011).

However as all studies that are described in this document have been performed in vivo, this pathway remains a hypothesis until each PylB, PylC, and PylD and the reactions they catalyze are characterized in vitro. Such in vitro investigations

164

will not only provide further support for the proposed pathway, but may also shed light on individual enzyme mechanisms, necessary cofactors, and any interactions between these enzymes that may be important for pyrrolysine biosynthesis.

In Chapter 3, we propose that PylB is a radical S-adenosylmethionine

(SAM) enzyme that catalyzes a lysine mutase reaction, producing (3R)-3-methyl-

D-ornithine from L-lysine. As this type of carbon skeleton rearrangement has not previously been demonstrated for enzymes in the radical SAM superfamily, the characterization of PylB is of especial interest. Developing an in vitro assay for

PylB should be of primary focus. It may be possible to monitor PylB activity through chiral chromatographic separation of L-lysine from (3R)-3-methyl-D- ornithine. Additionally, nuclear magnetic resonance (NMR) may be utilized to monitor the production of (3R)-3-methyl-D-ornithine. Deuterium labeling studies described in Chapter 4 suggest that both hydrogens at the C4 position of one lysine molecule are exchangeable during conversion to 3-methyl-D-ornithine. We posit that this exchange may occur between the hydrogens of SAM and those of the C4 of lysine due to the reversibility of the first step in the mechanism of PylB catalysis (Figure 4.8). Monitoring the possible accumulation of radioactivity in

SAM using [4,5-3H]-L-lysine during in vitro PylB assays may further the understanding of the PylB mechanism. While using purified recombinant PylB would be ideal for such an assay, it may be that this reaction can be more readily detectable in cell-free extracts. In the event that in vitro PylB assays are unsuccessful, it may be possible to demonstrate the in vivo production of (3R)-3-

165

methyl-D-ornithine from L-lysine in recombinant E. coli strains expressing only pylB.

PylC is proposed to act as a ligase in the pyrrolysine biosynthetic pathway, forming the amide bond between the epsilon nitrogen of L-lysine and the carboxyl group of (3R)-3-methyl-D-ornithine in an ATP-dependent reaction

(Figure 4.9). As D-ornithine is commercially available but 3-methyl-D-ornithine would need to be synthesized, reaction conditions should first be established for

PylC-mediated formation of D-ornithyl-N!-L-lysine, the proposed intermediate in desmethylpyrrolysine biosynthesis (Figure 4.7). The incorporation of radiolabelled L-lysine into D-ornithyl-N!-L-lysine could be monitored using either thin layer chromatography (TLC) or high performance liquid chromatography.

Chemically-synthesized D-ornithyl-N!-L-lysine is already in hand in the laboratory, making it feasible to first determine a separation methodology using this standard. As sequence homologous to an ATP-binding domain is found in

PylC, it may be possible to monitor D-ornithine-dependent ATP hydrolysis in reactions with purified homologous PylC. Such reactions can be monitored using

["-32P]-ATP and TLC methodology established for separating ATP and ADP.

In vitro PylD activity has been reported using purified recombinant PylD and monitoring the production of desmethylpyrrolysine from D-ornithyl-N!-L- lysine, using NAD as a cofactor (Cellitti et al., 2011). However, detailed kinetic studies using purified PylD still need to be explored. Moreover, the ability of PylD to catalyze the formation of pyrrolysine from (2R,3R)-3-methyl-D-ornithyl-N!-L- lysine must still be demonstrated. 166

As mentioned in Chapter 3, the pyrrolysine biosynthetic pathway may be subject to a feedback inhibition loop. The establishment of in vitro assays and kinetic studies for the pyrrolysine biosynthetic enzymes will allow for the testing of possible enzyme inhibition by feedback inhibition. Sites of inhibitor binding as well as a better understanding of each enzyme can be garnered from x-ray crystallographic studies of PylB, PylC, and PylD. As the likely substrates or substrate analogs are each enzyme are commercially available, these enzymes may also be crystallized in the presence of their substrate to present a clearer picture of how each biosynthetic enzyme catalyzes its respective reaction.

The incorporation of desmethylpyrrolysine into MtmB at the UAG codon has raised the question of what function, if any, the methyl group on the pyrroline ring of pyrrolysine plays in the catalytic activity of MtmB. Current models for pyrrolysine function in methylamine methyl transfer do not invoke a necessity for the methyl group of the pyrroline ring of pyrrolysine. Site-directed mutagenesis of the pyrrolysine residue of MtmB to alanine, lysine, arginine, and isoleucine in

Methanosarcina acetivorans indicate that pyrrolysine is critical for catalysis

(Longstaff, 2007b). The current work presents the biosynthesis of desmethylpyrrolysine and its incorporation into MtmB using recombinant E. coli, thereby presenting a ready opportunity to determine what role the methyl group of pyrrolysine might play in methyl transfer. Unfortunately, MtmB is produced as inclusion bodies in E. coli and has not been purified as an active recombinant enzyme to date. Thus, desmethylpyrrolysine synthesis and incorporation at UAG codons in methylamine methyltransferases would need to be established in M.

167

acetivorans. It may be necessary to create a pylB knock-out strain of M. acetivorans to ensure incorporation of only desmethylpyrrolysine. Once desmethylpyrrolysine production and incorporation is demonstrated, it may be informative to monitor the ability of strains incorporating desmethylpyrrolysine to use methylamines as a growth substrate versus wild-type M. acetivorans. In vitro kinetic data using purified MtmB containing pyrrolysine or desmethylpyrrolysine from M. acetivorans will allow this question to be addressed in more detail.

Alternatively, if techniques allowing MtmB to be produced as a soluble protein in

E. coli can be employed, it may be possible to utilize recombinant strains in which desmethylpyrrolysine production and incorporation has already been demonstrated.

Future studies into each PylB, PylC, and PylD and the reactions they catalyze are necessary to confirm the steps of the pyrrolysine biosynthetic pathway. Additionally, a better understanding of these enzymatic reactions may be useful for developing unnatural amino acids which can be biosynthesized by these enzymes and co-translationally inserted at UAG codons using the pyrrolysyl-tRNA synthetase/tRNAPyl orthogonal pair. Furthermore, desmethylpyrrolysine and the biosynthesis of other pyrrolysine analogs may shed light on how pyrrolysine functions during methyl transfer from methylamines. The work presented here provides a basis from which future investigators can study these questions in more detail.

168

References

Alifano, P., Fani, R., Lio, P., Lazcano, A., Bazzicalupo, M., Carlomagno, M. S., et al. (1996). Histidine biosynthetic pathway and genes: Structure, regulation, and evolution. Microbiological Reviews, 60(1), 44-69.

Ambrogelly, A., Palioura, S., & Soll, D. (2007). Natural expansion of the genetic code. Nature Chemical Biology, 3(1), 29-35.

Anderson, P. M., & Meister, A. (1965). Evidence for an activated form of carbon dioxide in the reaction catalyzed by escherichia coli carbamyl phosphate synthetase. Biochemistry, 4(12), 2803-2809.

Berry, M. J., Banu, L., Chen, Y. Y., Mandel, S. J., Kieffer, J. D., Harney, J. W., et al. (1991). Recognition of UGA as a selenocysteine codon in type I deiodinase requires sequences in the 3' untranslated region. Nature, 353(6341), 273-276.

Blight, S. K., Larue, R. C., Mahapatra, A., Longstaff, D. G., Chang, E., Zhao, G., et al. (2004). Direct charging of tRNA(CUA) with pyrrolysine in vitro and in vivo. Nature, 431(7006), 333-335.

Brochier-Armanet, C., Boussau, B., Gribaldo, S., & Forterre, P. (2008). Mesophilic crenarchaeota: Proposal for a third archaeal phylum, the thaumarchaeota. Nature Reviews.Microbiology, 6(3), 245-252.

Brochier-Armanet, C., Forterre, P., & Gribaldo, S. (2011). Phylogeny and evolution of the archaea: One hundred genomes later. Current Opinion in Microbiology, 14(3), 274-281.

Burke, S. A., Lo, S. L., & Krzycki, J. A. (1998). Clustered genes encoding the methyltransferases of methanogenesis from monomethylamine. Journal of Bacteriology, 180(13), 3432-3440.

Carlson, B. A., Xu, X. M., Kryukov, G. V., Rao, M., Berry, M. J., Gladyshev, V. N., et al. (2004). Identification and characterization of phosphoseryl- tRNA[ser]sec kinase. Proceedings of the National Academy of Sciences of the United States of America, 101(35), 12848-12853.

Cavicchioli, R. (2011). Archaea--timeline of the third domain. Nature Reviews.Microbiology, 9(1), 51-61.

169

Cellitti, S. E., Ou, W., Chiu, H. P., Grunewald, J., Jones, D. H., Hao, X., et al. (2011). D-ornithine coopts pyrrolysine biosynthesis to make and insert pyrroline-carboxy-lysine. Nature Chemical Biology, 7(8), 528-530.

Chambers, I., Frampton, J., Goldfarb, P., Affara, N., McBain, W., & Harrison, P. R. (1986). The structure of the mouse glutathione peroxidase gene: The selenocysteine in the active site is encoded by the 'termination' codon, TGA. The EMBO Journal, 5(6), 1221-1227.

Chavatte, L., Brown, B. A., & Driscoll, D. M. (2005). Ribosomal protein L30 is a component of the UGA-selenocysteine recoding machinery in eukaryotes. Nature Structural & Molecular Biology, 12(5), 408-416.

Cone, J. E., Del Rio, R. M., Davis, J. N., & Stadtman, T. C. (1976). Chemical characterization of the selenoprotein component of clostridial glycine reductase: Identification of selenocysteine as the organoselenium moiety. Proceedings of the National Academy of Sciences of the United States of America, 73(8), 2659-2663.

Copeland, P. R., Fletcher, J. E., Carlson, B. A., Hatfield, D. L., & Driscoll, D. M. (2000). A novel RNA binding protein, SBP2, is required for the translation of mammalian selenoprotein mRNAs. The EMBO Journal, 19(2), 306-314.

Cunin, R., Glansdorff, N., Pierard, A., & Stalon, V. (1986). Biosynthesis and metabolism of arginine in bacteria. Microbiological Reviews, 50(3), 314-352.

Elkins, J. G., Podar, M., Graham, D. E., Makarova, K. S., Wolf, Y., Randau, L., et al. (2008). A korarchaeal genome reveals insights into the evolution of the archaea. Proceedings of the National Academy of Sciences of the United States of America, 105(23), 8102-8107.

Ferry, J. G. (1997). Enzymology of the fermentation of acetate to methane by methanosarcina thermophila. BioFactors (Oxford, England), 6(1), 25-35.

Forchhammer, K., Leinfelder, W., & Bock, A. (1989). Identification of a novel translation factor necessary for the incorporation of selenocysteine into protein. Nature, 342(6248), 453-456.

Forchhammer, K., Leinfelder, W., Boesmiller, K., Veprek, B., & Bock, A. (1991). Selenocysteine synthase from escherichia coli. nucleotide sequence of the gene (selA) and purification of the protein. The Journal of Biological Chemistry, 266(10), 6318-6323.

170

Forchhammer, K., Rucknagel, K. P., & Bock, A. (1990). Purification and biochemical characterization of SELB, a translation factor involved in selenoprotein synthesis. The Journal of Biological Chemistry, 265(16), 9346- 9350.

Fox, G. E., Magrum, L. J., Balch, W. E., Wolfe, R. S., & Woese, C. R. (1977). Classification of methanogenic bacteria by 16S ribosomal RNA characterization. Proceedings of the National Academy of Sciences of the United States of America, 74(10), 4537-4541.

Frey, P. A. (1993). Lysine 2,3-aminomutase: Is adenosylmethionine a poor man's adenosylcobalamin? The FASEB Journal : Official Publication of the Federation of American Societies for Experimental Biology, 7(8), 662-670.

Frey, P. A., Ballinger, M. D., & Reed, G. H. (1998). S-adenosylmethionine: A 'poor man's coenzyme B12' in the reaction of lysine 2,3-aminomutase. Biochemical Society Transactions, 26(3), 304-310.

Frey, P. A., Hegeman, A. D., & Ruzicka, F. J. (2008). The radical SAM superfamily. Critical Reviews in Biochemistry and Molecular Biology, 43(1), 63-88.

Frey, P. A., & Magnusson, O. T. (2003). S-adenosylmethionine: A wolf in sheep's clothing, or a rich man's adenosylcobalamin? Chemical Reviews, 103(6), 2129-2148.

Gaston, M. A., Jiang, R., & Krzycki, J. A. (2011). Functional context, biosynthesis, and genetic encoding of pyrrolysine. Current Opinion in Microbiology, 14(3), 342-349.

Gaston, M. A., Zhang, L., Green-Church, K. B., & Krzycki, J. A. (2011). The complete biosynthesis of the genetically encoded amino acid pyrrolysine from lysine. Nature, 471(7340), 647-650.

Hao, B., Gong, W., Ferguson, T. K., James, C. M., Krzycki, J. A., & Chan, M. K. (2002). A new UAG-encoded residue in the structure of a methanogen methyltransferase. Science (New York, N.Y.), 296(5572), 1462-1466.

Hao, B., Zhao, G., Kang, P. T., Soares, J. A., Ferguson, T. K., Gallucci, J., et al. (2004). Reactivity and chemical synthesis of L-pyrrolysine- the 22(nd) genetically encoded amino acid. Chemistry & Biology, 11(9), 1317-1324.

171

Hatfield, D. L., & Gladyshev, V. N. (2002). How selenium has altered our understanding of the genetic code. Molecular and Cellular Biology, 22(11), 3565-3576.

Heinemann, I. U., O'Donoghue, P., Madinger, C., Benner, J., Randau, L., Noren, C. J., et al. (2009). The appearance of pyrrolysine in tRNAHis guanylyltransferase by neutral evolution. Proceedings of the National Academy of Sciences of the United States of America, 106(50), 21103- 21108.

Herring, S., Ambrogelly, A., Gundllapalli, S., O'Donoghue, P., Polycarpo, C. R., & Soll, D. (2007). The amino-terminal domain of pyrrolysyl-tRNA synthetase is dispensable in vitro but required for in vivo activity. FEBS Letters, 581(17), 3197-3203.

Herring, S., Ambrogelly, A., Polycarpo, C. R., & Soll, D. (2007). Recognition of pyrrolysine tRNA by the desulfitobacterium hafniense pyrrolysyl-tRNA synthetase. Nucleic Acids Research, 35(4), 1270-1278.

Huber, H., Hohn, M. J., Rachel, R., Fuchs, T., Wimmer, V. C., & Stetter, K. O. (2002). A new phylum of archaea represented by a nanosized hyperthermophilic symbiont. Nature, 417(6884), 63-67.

James, C. M., Ferguson, T. K., Leykam, J. F., & Krzycki, J. A. (2001). The amber codon in the gene encoding the monomethylamine methyltransferase isolated from methanosarcina barkeri is translated as a sense codon. The Journal of Biological Chemistry, 276(36), 34252-34258.

Kaiser, J. T., Gromadski, K., Rother, M., Engelhardt, H., Rodnina, M. V., & Wahl, M. C. (2005). Structural and functional investigation of a putative archaeal selenocysteine synthase. Biochemistry, 44(40), 13315-13327.

Kavran, J. M., Gundllapalli, S., O'Donoghue, P., Englert, M., Soll, D., & Steitz, T. A. (2007). Structure of pyrrolysyl-tRNA synthetase, an archaeal enzyme for genetic code innovation. Proceedings of the National Academy of Sciences of the United States of America, 104(27), 11268-11273.

Kohen, A., & Klinman, J. P. (1999). Hydrogen tunneling in biology. Chemistry & Biology, 6(7), R191-8.

Krzycki, J. A. (2004). Function of genetically encoded pyrrolysine in corrinoid- dependent methylamine methyltransferases. Current Opinion in Chemical Biology, 8(5), 484-491.

172

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227(5259), 680-685.

Larue, R. C. (2009). A novel aminoacyl-tRNA synthetase and its amino acid, pyrrolysine, the 22nd genetically encoded amino acid.

Lee, M. M., Jiang, R., Jain, R., Larue, R. C., Krzycki, J., & Chan, M. K. (2008). Structure of desulfitobacterium hafniense PylSc, a pyrrolysyl-tRNA synthetase. Biochemical and Biophysical Research Communications, 374(3), 470.

Leinfelder, W., Forchhammer, K., Veprek, B., Zehelein, E., & Bock, A. (1990). In vitro synthesis of selenocysteinyl-tRNA(UCA) from seryl-tRNA(UCA): Involvement and characterization of the selD gene product. Proceedings of the National Academy of Sciences of the United States of America, 87(2), 543-547.

Leinfelder, W., Zehelein, E., Mandrand-Berthelot, M. A., & Bock, A. (1988). Gene for a novel tRNA species that accepts L-serine and cotranslationally inserts selenocysteine. Nature, 331(6158), 723-725.

Li, W. T., Mahapatra, A., Longstaff, D. G., Bechtel, J., Zhao, G., Kang, P. T., et al. (2009). Specificity of pyrrolysyl-tRNA synthetase for pyrrolysine and pyrrolysine analogs. Journal of Molecular Biology, 385(4), 1156-1164.

Liu, Y., & Whitman, W. B. (2008). Metabolic, phylogenetic, and ecological diversity of the methanogenic archaea. Annals of the New York Academy of Sciences, 1125, 171-189.

Longstaff, D. G. (2007a). Personal communication

Longstaff, D. G. (2007b). Requirements and rationale for amber translation as pyrrolysine.

Longstaff, D. G., Blight, S. K., Zhang, L., Green-Church, K. B., & Krzycki, J. A. (2007). In vivo contextual requirements for UAG translation as pyrrolysine. Molecular Microbiology, 63(1), 229-241.

Longstaff, D. G., Larue, R. C., Faust, J. E., Mahapatra, A., Zhang, L., Green- Church, K. B., et al. (2007). A natural genetic code expansion cassette enables transmissible biosynthesis and genetic encoding of pyrrolysine. Proceedings of the National Academy of Sciences of the United States of America, 104(3), 1021-1026.

173

Lovenberg, W., Buchanan, B. B., & Rabinowitz, J. C. (1963). Studies on the chemical nature of clostridial ferredoxin. The Journal of Biological Chemistry, 238, 3899-3913. Maharjan, R. P., & Ferenci, T. (2003). Global metabolite analysis: The influence of extraction methodology on metabolome profiles of escherichia coli. Analytical Biochemistry, 313(1), 145-154.

Marsh, E. N. (2009). Insights into the mechanisms of adenosylcobalamin (coenzyme B12)-dependent enzymes from rapid chemical quench experiments. Biochemical Society Transactions, 37(Pt 2), 336-342.

Namy, O., Rousset, J. P., Napthine, S., & Brierley, I. (2004). Reprogrammed genetic decoding in cellular gene expression. Molecular Cell, 13(2), 157-168.

Namy, O., Zhou, Y., Gundllapalli, S., Polycarpo, C. R., Denise, A., Rousset, J. P., et al. (2007). Adding pyrrolysine to the escherichia coli genetic code. FEBS Letters, 581(27), 5282-5288.

Neuhaus, F. C. (1960). The enzymatic synthesis of D-alanyl-D-alanine. Biochemical and Biophysical Research Communications, 3, 401-405.

Nicolet, Y., & Drennan, C. L. (2004). AdoMet radical proteins--from structure to evolution--alignment of divergent protein sequences reveals strong secondary structure element conservation. Nucleic Acids Research, 32(13), 4015-4025.

Nishida, H., Nishiyama, M., Kobashi, N., Kosuge, T., Hoshino, T., & Yamane, H. (1999). A prokaryotic gene cluster involved in synthesis of lysine through the amino adipate pathway: A key to the evolution of amino acid biosynthesis. Genome Research, 9(12), 1175-1183.

Nozawa, K., O'Donoghue, P., Gundllapalli, S., Araiso, Y., Ishitani, R., Umehara, T., et al. (2009). Pyrrolysyl-tRNA synthetase-tRNA(pyl) structure reveals the molecular basis of orthogonality. Nature, 457(7233), 1163-1167.

Ou, W., Uno, T., Chiu, H. P., Grunewald, J., Cellitti, S. E., Crossgrove, T., et al. (2011). Site-specific protein modifications through pyrroline-carboxy-lysine residues. Proceedings of the National Academy of Sciences of the United States of America, 108(26), 10437-10442.

Paul, L., Ferguson, D. J.,Jr, & Krzycki, J. A. (2000). The trimethylamine methyltransferase gene and multiple dimethylamine methyltransferase genes of methanosarcina barkeri contain in-frame and read-through amber codons. Journal of Bacteriology, 182(9), 2520-2529.

174

Polycarpo, C. R., Herring, S., Berube, A., Wood, J. L., Soll, D., & Ambrogelly, A. (2006). Pyrrolysine analogues as substrates for pyrrolysyl-tRNA synthetase. FEBS Letters, 580(28-29), 6695-6700.

Raushel, F. M., Thoden, J. B., & Holden, H. M. (1999). The amidotransferase family of enzymes: Molecular machines for the production and delivery of ammonia. Biochemistry, 38(25), 7891-7899.

Rother, M., & Krzycki, J. A. (2010). Selenocysteine, pyrrolysine, and the unique energy metabolism of methanogenic archaea. Archaea (Vancouver, B.C.), 2010, 453642.

Soares, J. A., Zhang, L., Pitsch, R. L., Kleinholz, N. M., Jones, R. B., Wolff, J. J., et al. (2005). The residue mass of L-pyrrolysine in three distinct methylamine methyltransferases. The Journal of Biological Chemistry, 280(44), 36962- 36969.

Sprenger, G. (2007). Aromatic amino acids. In V. Wendisch (Ed.), Amino acid biosynthesis: Pathways, regulation, and metabolic engineering. Heidelberg, Germany: Springer.

Srinivasan, G., James, C. M., & Krzycki, J. A. (2002). Pyrrolysine encoded by UAG in archaea: Charging of a UAG-decoding specialized tRNA. Science (New York, N.Y.), 296(5572), 1459-1462.

Starcher, B. (2001). A ninhydrin-based assay to quantitate the total protein content of tissue samples. Analytical Biochemistry, 292(1), 125-129.

Theobald-Dietrich, A., Giege, R., & Rudinger-Thirion, J. (2005). Evidence for the existence in mRNAs of a hairpin element responsible for ribosome dependent pyrrolysine insertion into proteins. Biochimie, 87(9-10), 813-817.

Tormay, P., Wilting, R., Lottspeich, F., Mehta, P. K., Christen, P., & Bock, A. (1998). Bacterial selenocysteine synthase--structural and functional properties. European Journal of Biochemistry / FEBS, 254(3), 655-661.

Umbarger, H. E. (1978). Amino acid biosynthesis and its regulation. Annual Review of Biochemistry, 47, 532-606.

Vey, J. L., & Drennan, C. L. (2011). Structural insights into radical generation by the radical SAM superfamily. Chemical Reviews, 111(4), 2487-2506.

175

Viola, R. (2001). The central enzymes of the aspartate family of amino acid biosynthesis. Accounts of Chemical Research, 34(5), 339-349. Wilting, R., Schorling, S., Persson, B. C., & Bock, A. (1997). Selenoprotein synthesis in archaea: Identification of an mRNA element of Methanococcus jannaschii probably directing selenocysteine insertion. Journal of Molecular Biology, 266(4), 637-641.

Woese, C. R., Kandler, O., & Wheelis, M. L. (1990). Towards a natural system of organisms: Proposal for the domains archaea, bacteria, and eucarya. Proceedings of the National Academy of Sciences of the United States of America, 87(12), 4576-4579.

Yanagisawa, T., Ishii, R., Fukunaga, R., Kobayashi, T., Sakamoto, K., & Yokoyama, S. (2008). Crystallographic studies on multiple conformational states of active-site loops in pyrrolysyl-tRNA synthetase. Journal of Molecular Biology, 378(3), 634-652.

Yuan, J., Palioura, S., Salazar, J. C., Su, D., O'Donoghue, P., Hohn, M. J., et al. (2006). RNA-dependent conversion of phosphoserine forms selenocysteine in eukaryotes and archaea. Proceedings of the National Academy of Sciences of the United States of America, 103(50), 18923-18927.

Zhang, Y., Baranov, P. V., Atkins, J. F., & Gladyshev, V. N. (2005). Pyrrolysine and selenocysteine use dissimilar decoding strategies. The Journal of Biological Chemistry, 280(21), 20740-20751.

Zhang, Y., & Gladyshev, V. N. (2007). High content of proteins containing 21st and 22nd amino acids, selenocysteine and pyrrolysine, in a symbiotic deltaproteobacterium of gutless worm olavius algarvensis. Nucleic Acids Research, 35(15), 4952-4963.

Zinoni, F., Birkmann, A., Stadtman, T. C., & Bock, A. (1986). Nucleotide sequence and expression of the selenocysteine-containing polypeptide of formate dehydrogenase (formate-hydrogen-lyase-linked) from escherichia coli. Proceedings of the National Academy of Sciences of the United States of America, 83(13), 4650-4654.

Zinoni, F., Heider, J., & Bock, A. (1990). Features of the formate dehydrogenase mRNA necessary for decoding of the UGA codon as selenocysteine. Proceedings of the National Academy of Sciences of the United States of America, 87(12), 4660-4664.

176