DOCSLIB.ORG

Original Article Selenoproteins Translated by SECIS-Deficient Mrna Induce Apoptosis in Hela Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Original Article Selenoproteins Translated by SECIS-Deficient Mrna Induce Apoptosis in Hela Cells Int J Clin Exp Med 2018;11(10):10881-10888 www.ijcem.com /ISSN:1940-5901/IJCEM0081467 Original Article Selenoproteins translated by SECIS-deficient mRNA induce apoptosis in Hela cells Lifang Tian1, Fumeng Huang1, Li Wang1, Zhao Chen1, Jin Han1, Dongmin Li2, Shemin Lu2, Rongguo Fu1 1Department of Nephrology, The Second Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi, China; 2Department of Genetics and Molecular Biology in College of Medicine, Xi’an Jiaotong University, Xi’an, Shaanxi, China Received June 19, 2018; Accepted September 6, 2018; Epub October 15, 2018; Published October 30, 2018 Abstract: Objective: The aim of this study was to explore the biological function of selenoproteins translated by SECIS-deficient mRNAs of selenoprotein S (SelS), glutathione peroxidase 4 (Gpx4), and thioredoxin reductase 1 (TrxR1). Methods: Recombinant plasmids of normal and selenocysteine insertion sequence (SECIS)-deficient mRNAs of SelS, Gpx4, and TrxR1 were constructed and transfected into Hela cells. Total RNA was collected by TRIzol method and cDNA were obtained by mRNA reverse transcription. To ensure that target selenoprotein genes were successfully transfected into cells and highly expressed, PCR was performed for only 15 circulations. Bright bands were then observed of target genes. Results: After transfection for 24 hours, expression of green fluorescent protein was noted and the transfection efficiency was detected up to 40% by fluorescein activated cell sorter analysis. After transfection for 48 hours, cells were collected to stain for fluorescein activated cell sorter analysis. Results showed that Hela cell apoptosis could be induced by selenoproteins translated by SECIS-deficient mRNAs but not normal selenoproteins. Conclusion: Selenoproteins translated by SECIS-deficient mRNAs of SelS, Gpx4, and TrxR1 induce Hela cells apoptosis, providing the underlying mechanisms of selenium deficiency conditions or diseases. Keywords: Selenoproteins, SECIS-deficient, apoptosis, Hela cells Introduction for UGA decoding in the process of selenopro- tein expression [8] and results are greatly influ- Selenium is an essential micronutrient. Much enced by dietary selenium [9]. Decoding of the of its biological function on human health has UGA codon requires multiple factors, such as been attributed to the presence of more than the selenocysteine insertion sequence (SECIS) 30 selenoproteins in the human body [1]. element and other essential protein factors [6]. Selenoproteins play roles in a variety of physio- Secondary structures of the SECIS element logical processes, such as regulation of redox are highly conserved and contain consensus homeostasis [2], immune function [3], repro- sequences that are indispensable for Sec incor- duction [4] and biosynthesis of thyroid hormone poration [10]. SECIS is located within the [5]. 3’-untranslated region (UTR) of mRNA in eukary- otes [11]. In the process of the selenoprotein Unlike other metal elements that interact with- synthesis, abnormality of any of the above fac- in proteins in the form of cofactors, selenium tors would terminate the peptide chain without becomes co-translationally incorporated into Sec incorporation. the polypeptide chain as part of the amino acid selenocysteine (Sec) [6]. A remarkable feature In a low selenium environment, a different splic- of Sec incorporated into proteins is its shared ing form of selenoprotein induces lots of se- UGA with termination codon [7]. However, the lenocysteine-deficient selenoprotein produc- UGA codon plays the role of termination of pep- tions. Until now, the mechanisms of biologic or tide chain translation. In fact, there is competi- pathological effects caused by selenoprotein tion between Sec-tRNA and the release factor splicing form of terminating in advance or Selenocysteine-deficient selenoproteins induce apoptosis Table 1. Primers used for amplification of selenoproteins kit (OMEGA, USA) and we- NCBI N0. Gene Primer sequences (5’-3’) re screened by XhoI and NM_018445.4 SelS For: CCGCTCGAGATGGAACGCCAAGAGG ApaI digestion and agarose gel electrophoresis. Posi- Rev: GCGGGCCCTTAATATACAGAAACAAACCCCATC tive plasmids were sent for trun-SelS For: CCGCTCGAGATGGAACGCCAAGAGGAGTC sequencing (Sangong Bio- Rev: GCGGGCCCTTAGCCTCATCCGCCAG tech, Shanghai, China). NM_002085.3 Gpx4 For: CCGCTCGAGATGAGCCTCGGCCGCC Rev: GCGGGCCCTTACCCACAAGGTAGCCAGG Cell culture and transfec- trun-Gpx4 For: CCGCTCGAGATGAGCCTCGGCCGCC tion with recombinant plas- Rev: GCGGGCCCCTAGAAATAGTGGGGCAGGTCC mids in Hela cells NM_182743.1 trun-TrxR1 For: CCGCTCGAGATGAACGGCCCTGAAG Rev: GCGGGCCCTTAACCTCAGCAGCCAG Hela cells were purchased from Chinese Academy of Science Affiliated Shanghai its translation product-selenocysteine-deficient Cell Bank. Cells were cultured in DMEM media peptide chain have remained unclear. The pres- (Hyclone, Logan, UT, USA) containing 10% fetal ent study proposed the hypotheses that sele- calf serum (Hyclone, Logan, UT, USA) at 37°C in nocysteine-deficient selenoproteins could in- a 100% humidified atmosphere of 5% CO2. duce cell apoptosis. Thus, five recombinant plasmids of normal and SECIS-deficient seleno- Transfection of recombinant plasmids to the protein genes of selenoprotein S (SelS), gluta- cells was performed with LipofectamineTM thione peroxidase 4 (Gpx4), and thioredoxin 2000 reagent (Invitrogen, San Diego, CA, USA), reductase 1 (Trx1) were constructed and trans- according to manufacturer instructions. Briefly, fected into Hela cells. Cell apoptosis was then 1 day before transfection, exponentially grow- tested. ing cells were seeded into six-well plates at a density of 1.5 × 105 cells/well in the medium Materials and methods without antibiotics. When they reached 70% confluence, cells were transfected with 2 μg Construction of normal and SECIS-deficient DNA of plasmids per well using Lipofectamine selenoprotein gene plasmids 2000. Green Fluorescent Protein (GFP) expres- sion of Hela cells was observed by a fluores- For construction of pEGFP-C1-selenoprotein cence microscope (Nikon, ELIPSE Ti, Japan) 6 or pEGFP-C1-SECIS-deficient-selenoprotein re- hours after transfection. Transfection efficiency combinant plasmids, human cDNA was used was evaluated with GFP by the fluorescence for amplification. Target genes of SECIS-de- activated cell sorter (FACS) 24 hours after ficient-selenoprotein amplified by PCR only transfection. comprised the coding sequence (CDS) of the mRNA, but without the 5’untranslated region Reverse transcription-PCR (UTR) or 3’UTR. Normal selenoproteins ampli- fied by PCR included CDS and 3’UTR, which Total RNA of the cells after transfection of contain the SECIS elements without 5’UTR. recombinant plasmids for 24 hours was extract- Primers of the five selenoprotein genes are ed using TRIzol (Invitrogen, USA). RNA purity shown in the Table 1. PCR products and the and content were determined with UV/visible pEGFP-C1 plasmids were digested by XhoI and spectrophotometer. Synthesis of cDNA was ApaI. Fragments of double enzyme-digested conducted from 2 μg total RNA using the First- products were subjected to agarose gel electro- Strand cDNA Synthesis Kit (Fermentas, Burling- phoresis and purified by the DNA Purification ton, ON, Canada), according to manufacturer Kit (BioDev-Tech, Beijing, China). Fragments of instructions. RT-PCR was performed as follows: selenoprotein genes and pEGFP-C1 vectors 1 cycle at 94°C for 3 minutes, followed by 15 were ligated by T4 ligase (Sigma, USA) at 4°C cycles at 94°C for 30 seconds, 60°C for 30 overnight to generate new plasmids. The plas- seconds, 72°C for 30 seconds, and finally 1 mids were transfected into the DH5α E. coli. cycle at 72°C for 7 minutes. PCR products were New plasmids were extracted by the Plasmid subjected to agarose gel electrophoresis. 10882 Int J Clin Exp Med 2018;11(10):10881-10888 Selenocysteine-deficient selenoproteins induce apoptosis Figure 1. Agarose gel electrophoresis of recombi- nant plasmids of SECIS-deficient-SelS and SelS (A), SECIS-deficient-GPx4 and GPx4 (B), and SECIS- deficient-TrxR1 (C). Lane M is the 100 bp marker, lane 1 is the PCR products of SECIS-deficient sele- noproteins, lane 2 is the double restriction enzyme- digested products of the recombined SECIS-defi- cient selenoproteins and vector, lane 3 is the PCR products of selenoproteins, lane 4 is the double restriction enzyme-digested product of recombined selenoproteins and vector. Cell death and apoptosis assay Gpx4 and SECIS-deficient-Gpx4 Figure( 1B), and SECIS-deficient-TrxR1 Figure( 1C). Gel elec- After transfection of recombinant plasmids for trophoresis demonstrated that 5 recombinant 48 hours, cell apoptosis was detected by plasmids were digested to two fragments with Annexin V-PE/7-AAD apoptosis detection kit different lengths, respectively. Judging from the (Byotime Biotech, Jiangsu, China), according to lengths, the longer products corresponded to manufacturer instructions. Briefly, cells were the pEGFP-C1 vector and the shorter products trypsinized and resuspended in binding buffer corresponded to selenoprotein and SECIS- with 5 μL 7-AAD and 1 μL Annexin V-PE. After deficient-selenoprotein genes. According to incubating for 15 minutes in the dark, samples sequencing results, no deletion, insertion, or TM were analyzed using a GuavaeasyCyt Flow mutation was found and the consistency rate Cytometer (EMDMillipore, Darmstadt, Germany) was 100%. It was confirmed that the clones and percentages of 7-AAD positive and Annexin were successfully constructed. V-PE positive were valuated.
Load more

Recommended publications
  • Identification and Characterization of a Selenoprotein Family Containing a Diselenide Bond in a Redox Motif
    Identification and characterization of a selenoprotein family containing a diselenide bond in a redox motif Valentina A. Shchedrina, Sergey V. Novoselov, Mikalai Yu. Malinouski, and Vadim N. Gladyshev* Department of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664 Edited by Arne Holmgren, Karolinska Institute, Stockholm, Sweden, and accepted by the Editorial Board July 13, 2007 (received for review April 16, 2007) Selenocysteine (Sec, U) insertion into proteins is directed by trans- notable exception. Vertebrate selenoprotein P (SelP) has 10–18 lational recoding of specific UGA codons located upstream of a Sec, whose insertion is governed by two SECIS elements (11). It is stem-loop structure known as Sec insertion sequence (SECIS) ele- thought that Sec residues in SelP (perhaps with the exception of the ment. Selenoproteins with known functions are oxidoreductases N-terminal Sec residue present in a UxxC motif) have no redox or containing a single redox-active Sec in their active sites. In this other catalytic functions. work, we identified a family of selenoproteins, designated SelL, Selenoproteins with known functions are oxidoreductases con- containing two Sec separated by two other residues to form a taining catalytic redox-active Sec (12). Their Cys mutants are UxxU motif. SelL proteins show an unusual occurrence, being typically 100–1,000 times less active (13). Although there are many present in diverse aquatic organisms, including fish, invertebrates, known selenoproteins, proteins containing diselenide bonds have and marine bacteria. Both eukaryotic and bacterial SelL genes use not been described. Theoretically, such proteins could exist, but the single SECIS elements for insertion of two Sec.
    [Show full text]
  • Selenocysteine, Pyrrolysine, and the Unique Energy Metabolism of Methanogenic Archaea
    Hindawi Publishing Corporation Archaea Volume 2010, Article ID 453642, 14 pages doi:10.1155/2010/453642 Review Article Selenocysteine, Pyrrolysine, and the Unique Energy Metabolism of Methanogenic Archaea Michael Rother1 and Joseph A. Krzycki2 1 Institut fur¨ Molekulare Biowissenschaften, Molekulare Mikrobiologie & Bioenergetik, Johann Wolfgang Goethe-Universitat,¨ Max-von-Laue-Str. 9, 60438 Frankfurt am Main, Germany 2 Department of Microbiology, The Ohio State University, 376 Biological Sciences Building 484 West 12th Avenue Columbus, OH 43210-1292, USA Correspondence should be addressed to Michael Rother, [email protected] andJosephA.Krzycki,[email protected] Received 15 June 2010; Accepted 13 July 2010 Academic Editor: Jerry Eichler Copyright © 2010 M. Rother and J. A. Krzycki. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Methanogenic archaea are a group of strictly anaerobic microorganisms characterized by their strict dependence on the process of methanogenesis for energy conservation. Among the archaea, they are also the only known group synthesizing proteins containing selenocysteine or pyrrolysine. All but one of the known archaeal pyrrolysine-containing and all but two of the confirmed archaeal selenocysteine-containing protein are involved in methanogenesis. Synthesis of these proteins proceeds through suppression of translational stop codons but otherwise the two systems are fundamentally different. This paper highlights these differences and summarizes the recent developments in selenocysteine- and pyrrolysine-related research on archaea and aims to put this knowledge into the context of their unique energy metabolism. 1. Introduction found to correspond to pyrrolysine in the crystal structure [9, 10] and have its own tRNA [11].
    [Show full text]
  • Identification and Characterization of Fep15, a New Selenocysteine-Containing Member of the Sep15 Protein Family
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Vadim Gladyshev Publications Biochemistry, Department of March 2006 Identification and characterization of Fep15, a new selenocysteine-containing member of the Sep15 protein family Sergey V. Novoselov University of Nebraska-Lincoln Deame Hua University of Nebraska-Lincoln A. V. Lobanov University of Nebraska-Lincoln Vadim N. Gladyshev University of Nebraska-Lincoln, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/biochemgladyshev Part of the Biochemistry, Biophysics, and Structural Biology Commons Novoselov, Sergey V.; Hua, Deame; Lobanov, A. V.; and Gladyshev, Vadim N., "Identification and characterization of Fep15, a new selenocysteine-containing member of the Sep15 protein family" (2006). Vadim Gladyshev Publications. 62. https://digitalcommons.unl.edu/biochemgladyshev/62 This Article is brought to you for free and open access by the Biochemistry, Department of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Vadim Gladyshev Publications by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Published in Biochemical Journal 394:3 (March 15, 2006), pp. 575–579. doi: 10.1042/BJ20051569. Copyright © 2005 The Biochemical Society, London. Used by permission. Submitted September 22, 2005; revised October 18, 2005; accepted and prepublished online October 20, 2005; published online February 24, 2006. Identifi cation and characterization of Fep15, a new selenocysteine-containing member of the Sep15 protein family Sergey V. Novoselov, Deame Hua, Alexey V. Lobanov, and Vadim N. Gladyshev* Department of Biochemistry, University of Nebraska–Lincoln, Lincoln, NE 68588 *Corresponding author; email: [email protected] Abstract: Sec (selenocysteine) is a rare amino acid in proteins.
    [Show full text]
  • A Regulatory Role for Sec Trna in Selenoprotein Synthesis
    Downloaded from rnajournal.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press A regulatory role for Sec tRNA[Ser]Sec in selenoprotein synthesis RUTH R. JAMESON and ALAN M. DIAMOND Department of Human Nutrition, University of Illinois at Chicago, Chicago, Illinois 60612, USA ABSTRACT Selenium is biologically active through the functions of selenoproteins that contain the amino acid selenocysteine. This amino acid is translated in response to in-frame UGA codons in mRNAs that include a SECIS element in its 3؅ untranslated region, and this process requires a unique tRNA, referred to as tRNA[Ser]Sec. The translation of UGA as selenocysteine, rather than its use as a termination signal, is a candidate restriction point for the regulation of selenoprotein synthesis by selenium. A specialized reporter construct was used that permits the evaluation of SECIS-directed UGA translation to examine mechanisms of the regulation of selenoprotein translation. Using SECIS elements from five different selenoprotein mRNAs, UGA translation was quantified in response to selenium supplementation and alterations in tRNA[Ser]Sec levels and isoform distributions. Although each of the evaluated SECIS elements exhibited differences in their baseline activities, each was stimulated to a similar extent by increased selenium or tRNA[Ser]Sec levels and was inhibited by diminished levels of the methylated isoform of tRNA[Ser]Sec achieved using a dominant-negative acting mutant tRNA[Ser]Sec. tRNA[Ser]Sec was found to be limiting for UGA translation under conditions of high selenoprotein mRNA in both a transient reporter assay and in cells with elevated GPx-1 mRNA.
    [Show full text]
  • Open Full Page
    [CANCER RESEARCH 61, 2307–2310, March 1, 2001] Distribution and Functional Consequences of Nucleotide Polymorphisms in the 3؅-Untranslated Region of the Human Sep15 Gene1 Ya Jun Hu, Konstantin V. Korotkov, Rajeshwari Mehta, Dolph L. Hatfield, Charles N. Rotimi, Amy Luke, T. Elaine Prewitt, Richard S. Cooper, Wendy Stock, Everett E. Vokes, M. Eileen Dolan, Vadim N. Gladyshev,2 and Alan M. Diamond2 Departments of Human Nutrition and Dietetics [Y. J. H., A. M. D.], Surgical Oncology [R. M.], and Hematology/Oncology [W. S.], University of Illinois at Chicago, Chicago, Illinois 60612; Department of Biochemistry, University of Nebraska, The Beadle Center, Lincoln, Nebraska 68588 [K. V. K., V. N. G.]; Section on the Molecular Biology of Selenium, Basic Research Laboratory, National Cancer Institute, NIH, Bethesda, Maryland 20892 [D. L. H.]; Department of Genetic Epidemiology, National Human Genome Center, Howard University, Washington DC 20059 [C. N. R.]; Department of Preventive Medicine and Epidemiology, Loyola University, Stritch School of Medicine, Maywood, Illinois 60153 [A. L., T. E. P., R. S. C.]; and Department of Medicine [E. E. V., M. E. D.], University of Chicago, Chicago, Illinois 60637 ABSTRACT translation requires a recognition element within the 3Ј-UTR3 (3) of the corresponding mRNA referred to as a SECIS element (7). SECIS ele- Selenium has been shown to prevent cancer in a variety of animal ments are present in the mRNAs of all of the selenocysteine-containing model systems. Both epidemiological studies and supplementation trials proteins and share structural features, including an approximately 80- have supported its efficacy in humans. However, the mechanism by which nucleotide stem-loop structure containing both an internal and apical loop selenium suppresses tumor development remains unknown.
    [Show full text]
  • Cellular Selenoprotein Mrna Tethering Via Antisense Interactions with Ebola and HIV-1 Mrnas May Impact Host Selenium Biochemistry
    Send Orders for Reprints to [email protected] 1530 Current Topics in Medicinal Chemistry, 2016, 16, 1530-1535 Cellular Selenoprotein mRNA Tethering via Antisense Interactions with Ebola and HIV-1 mRNAs May Impact Host Selenium Biochemistry Ethan Will Taylor1,*, Jan A. Ruzicka1, Lakmini Premadasa1 and Lijun Zhao2 1Department of Nanoscience, University of North Carolina at Greensboro, Joint School of Nano- science and Nanoengineering, 2907 E. Gate City Blvd., Greensboro, NC 27401 USA; 2Key Laboratory of Ministry of Education for Medicinal Plant Resource and Natural Pharmaceutical Chemistry, Col- lege of Life Sciences, Shaanxi Normal University, Xi'an 710062, China cor s) size s Abstract: Regulation of protein expression by non-coding RNAs typically involves effects on mRNA degradation and/or ribosomal translation. The possibility of virus-host mRNA-mRNA antisense teth- ering interactions (ATI) as a gain-of-function strategy, via the capture of functional RNA motifs, has not been hitherto considered. We present evidence that ATIs may be exploited by certain RNA viruses in order to tether the mRNAs of host selenoproteins, potentially exploiting the proximity of a captured host selenocysteine insertion sequence (SECIS) element to enable the expression of virally-encoded selenoprotein mod- ules, via translation of in-frame UGA stop codons as selenocysteine. Computational analysis predicts thermodynamically stable ATIs between several widely expressed mammalian selenoprotein mRNAs (e.g., isoforms of thioredoxin reductase) and specific Ebola virus mRNAs, and HIV-1 mRNA, which we demonstrate via DNA gel shift assays. The probable func- tional significance of these ATIs is further supported by the observation that, in both viruses, they are located in close proximity to highly conserved in-frame UGA stop codons at the 3′ end of open reading frames that encode essential viral proteins (the HIV-1 nef protein and the Ebola nucleoprotein).
    [Show full text]
  • A Highly Efficient Form of the Selenocysteine Insertion Sequence Element in Protozoan Parasites and Its Use in Mammalian Cells
    A highly efficient form of the selenocysteine insertion sequence element in protozoan parasites and its use in mammalian cells Sergey V. Novoselov*†, Alexey V. Lobanov*, Deame Hua*, Marina V. Kasaikina*, Dolph L. Hatfield‡, and Vadim N. Gladyshev*§ *Department of Biochemistry, University of Nebraska, Lincoln, NE 68588; and ‡Section on the Molecular Biology of Selenium, Laboratory of Cancer Prevention, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892 Edited by W. Ford Doolittle, Dalhousie University, Halifax, NS, Canada, and approved February 21, 2007 (received for review December 12, 2006) Selenoproteins are an elite group of proteins containing a rare fully applied in genomic searches to identify these stem–loop amino acid, selenocysteine (Sec), encoded by the codon, UGA. In structures, and thereby selenoprotein genes, in nucleotide sequence eukaryotes, incorporation of Sec requires a Sec insertion sequence databases (5, 7, 17–19). SECIS) element, a stem–loop structure located in the 3؅-untrans- It has been established that the quartet is involved in the) lated regions of selenoprotein mRNAs. Here we report identifica- interaction with SECIS-binding protein 2 (SBP2) (20, 21), which, in tion of a noncanonical form of SECIS element in Toxoplasma gondii turn, is essential for the formation of a complex with the Sec-specific and Neospora canine, single-celled apicomplexan parasites of hu- elongation factor, known as EFsec, and tRNA[Ser]Sec (22, 23). This mans and domestic animals. This SECIS has a GGGA sequence in the protein–RNA complex functions by inserting Sec in response to SBP2-binding site in place of AUGA previously considered invari- UGA codons (24).
    [Show full text]
  • The SBP2 and 15.5 Kd/Snu13p Proteins Share the Same RNA Binding Domain: Identification of SBP2 Amino Acids Important to SECIS RNA Binding
    Downloaded from rnajournal.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press RNA (2002), 8:1308–1318+ Cambridge University Press+ Printed in the USA+ Copyright © 2002 RNA Society+ DOI: 10+1017/S1355838202020034 The SBP2 and 15.5 kD/Snu13p proteins share the same RNA binding domain: Identification of SBP2 amino acids important to SECIS RNA binding CHRISTINE ALLMANG, PHILIPPE CARBON, and ALAIN KROL Structure des Macromolécules Biologiques et Mécanismes de Reconnaissance, Unité Propre de Recherche 9002 du Centre National de la Recherche Scientifique–Université Louis Pasteur, Institut de Biologie Moléculaire et Cellulaire, 67084 Strasbourg Cedex, France ABSTRACT Selenoprotein synthesis in eukaryotes requires the selenocysteine insertion sequence (SECIS) RNA, a hairpin in the 39 untranslated region of selenoprotein mRNAs. The SECIS RNA is recognized by the SECIS-binding protein 2 (SBP2), which is a key player in this specialized translation machinery. The objective of this work was to obtain structural insight into the SBP2-SECIS RNA complex. Multiple sequence alignment revealed that SBP2 and the U4 snRNA-binding protein 15.5 kD/Snu13p share the same RNA binding domain of the L7A/L30 family, also found in the box H/ACA snoRNP protein Nhp2p and several ribosomal proteins. In corollary, we have detected a similar secondary structure motif in the SECIS and U4 RNAs. Combining the data of the crystal structure of the 15.5 kD-U4 snRNA complex, and the SBP2/15.5 kD sequence similarities, we designed a structure-guided strategy predicting 12 SBP2 amino acids that should be critical for SECIS RNA binding. Alanine substitution of these amino acids followed by gel shift assays of the SBP2 mutant proteins identified four residues whose mutation severely diminished or abolished SECIS RNA binding, the other eight provoking intermediate down effects.
    [Show full text]
  • Microrna 214 Is a Potential Regulator of Thyroid Hormone
    ORIGINAL RESEARCH published: 09 March 2016 doi: 10.3389/fendo.2016.00022 MicroRNA 214 Is a Potential Regulator of Thyroid Hormone Levels in the Mouse Heart Following Myocardial Infarction, by Targeting the Thyroid-Hormone-Inactivating Enzyme Deiodinase Type III Rob Janssen1 , Marian J. Zuidwijk1 , Alice Muller1 , Alain van Mil2 , Ellen Dirkx3 , Cees B. M. Oudejans4 , Walter J. Paulus1 and Warner S. Simonides1* 1 Department of Physiology, Institute for Cardiovascular Research, VU University Medical Center, Amsterdam, Netherlands, 2 Department of Cardiology, Division of Heart and Lungs, University Medical Center Utrecht, Utrecht, Netherlands, Edited by: 3 Department of Cardiology, Faculty of Health, Medicine and Life Sciences, CARIM School for Cardiovascular Diseases, Alessandro Antonelli, Maastricht University, Maastricht, Netherlands, 4 Department of Clinical Chemistry, Institute for Cardiovascular Research, VU University of Pisa, Italy University Medical Center, Amsterdam, Netherlands Reviewed by: Anthony Martin Gerdes, New York Institute of Technology- Cardiac thyroid-hormone signaling is a critical determinant of cellular metabolism and College of Osteopathic Medicine, function in health and disease. A local hypothyroid condition within the failing heart in USA rodents has been associated with the re-expression of the fetally expressed thyroid-hor- Pieter De Lange, Seconda Università di Napoli, Italy mone-inactivating enzyme deiodinase type III (Dio3). While this enzyme emerges as a *Correspondence: common denominator in the development of heart failure, the mechanism underlying its Warner S. Simonides regulation remains largely unclear. In the present study, we investigated the involvement [email protected] of microRNAs (miRNAs) in the regulation of Dio3 mRNA expression in the remodeling Specialty section: left ventricle (LV) of the mouse heart following myocardial infarction (MI).
    [Show full text]
  • Structural RNA Has Lower Folding Energy Than Random RNA of the Same Dinucleotide Frequency
    Downloaded from rnajournal.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press BIOINFORMATICS Structural RNA has lower folding energy than random RNA of the same dinucleotide frequency PETER CLOTE,1 FABRIZIO FERRÉ,1 EVANGELOS KRANAKIS,2 and DANNY KRIZANC3 1Department of Biology, Boston College, Chestnut Hill, Massachusetts 02467, USA 2School of Computer Science, Carleton University, Ottawa, Ontario, K1S 5B6, Canada 3Department of Mathematics and Computer Science, Wesleyan University, Middletown, Connecticut 06459, USA ABSTRACT We present results of computer experiments that indicate that several RNAs for which the native state (minimum free energy secondary structure) is functionally important (type III hammerhead ribozymes, signal recognition particle RNAs, U2 small nucleolar spliceosomal RNAs, certain riboswitches, etc.) all have lower folding energy than random RNAs of the same length and dinucleotide frequency. Additionally, we find that whole mRNA as well as 5؅-UTR, 3؅-UTR, and cds regions of mRNA have folding energies comparable to that of random RNA, although there may be a statistically insignificant trace signal in 3؅-UTR and cds regions. Various authors have used nucleotide (approximate) pattern matching and the computation of minimum free energy as filters to detect potential RNAs in ESTs and genomes. We introduce a new concept of the asymptotic Z-score and describe a fast, whole-genome scanning algorithm to compute asymptotic minimum free energy Z-scores of moving-window contents. Asymptotic Z-score computations offer another filter, to be used along with nucleotide pattern matching and mini- mum free energy computations, to detect potential functional RNAs in ESTs and genomic regions.
    [Show full text]
  • Characterization of the SECIS Binding Protein 2 Complex Required for the Co-Translational Insertion of Selenocysteine in Mammals Scott A
    5172–5180 Nucleic Acids Research, 2005, Vol. 33, No. 16 doi:10.1093/nar/gki826 Characterization of the SECIS binding protein 2 complex required for the co-translational insertion of selenocysteine in mammals Scott A. Kinzy, Kelvin Caban and Paul R. Copeland* Department of Molecular Genetics, Microbiology and Immunology, UMDNJ—Robert Wood Johnson Medical School, Piscataway, NJ 08854, USA Received June 16, 2005; Revised August 3, 2005; Accepted August 23, 2005 ABSTRACT insertion sequence (SECIS) element that is found in all euka- ryotic selenoprotein mRNA 30 untranslated regions, and was Selenocysteine is incorporated into at least 25 originally thought to be the sole RNA element required for Sec human proteins by a complex mechanism that is a incorporation. This concept has been recently challenged, unique modification of canonical translation elonga- however, by the discovery of a stem–loop sequence in the tion. Selenocysteine incorporation requires the con- coding region of selenoprotein N that is able to support certed action of a kink-turn structural RNA (SECIS) UGA readthrough in the absence of a SECIS element, albeit element in the 30 untranslated region of each seleno- for both UGA and UAG codons (3). Mammalian Sec incorp- protein mRNA, a selenocysteine-specific translation oration also requires the function of a Sec-specific translation elongation factor (eEFSec/mSelB) that specifically and elongation factor (eEFSec) and a SECIS binding [Ser]Sec protein (SBP2). Here, we analyze the molecular con- exclusively binds to the Sec-tRNA (4,5). In addition, text in which SBP2 functions. Contrary to previous two specific binding partners have been identified for the SECIS element: SECIS binding protein 2 (SBP2) and ribo- findings, a combination of gel filtration chromato- somal protein L30 (rpL30).
    [Show full text]
  • Selenium-Gene Interactions Involving Micrornas
    Selenium-gene interactions involving microRNAs Anabel Maciel Domínguez Thesis submitted in partial fulfilment of the requirements of the regulations for the degree of Doctor of Philosophy Newcastle University Faculty of Medical Sciences Institute for Cell and Molecular Biosciences July / 2012 1 Declaration The material contained within this thesis has not been previously submitted for a degree at the University of Newcastle or any other university. The research here has been conducted by the author. All help by other has been acknowledged and all sources of information are indicated in the text. i Abstract Selenium (Se) is an essential nutrient for health. In mammals Se is incorporated into ~25 selenoproteins in the form of the amino-acid selenocysteine encoded by the UGA codon through a complex interacting with selenocysteine insertion sequence (SECIS) in the 3’Unstralated Region. The selenoproteins have functions in antioxidant defence and redox control, thyroid hormone metabolism and mitochondrial metabolism. Previous scientific work has found that Se also affects a group of downstream targets. The aim of my work is to investigate whether expression of selenoproteins or the downstream targets affected by Se is regulated through epigenetic mechanisms involving microRNAs, a small non-coding RNA species that regulates a gene or groups of genes by binding to the mRNA 3’UTR. Gut epithelial Caco-2 cells were grown in either Se deficient or Se-supplemented medium for 72h. RNA extracted and miRNA expression analysed using a custom-designed human genome V2 Agilent 8x15K array. In addition, global mRNA transcriptome expression was analysed using an Illumina HumanRef-8 v3 microarray.
    [Show full text]