Research Article 983 Chemotactic activation of Dictyostelium AGC-family kinases AKT and PKBR1 requires separate but coordinated functions of PDK1 and TORC2

Xin-Hua Liao, Jonathan Buggey* and Alan R. Kimmel‡ Laboratory of Cellular and Developmental Biology, NIDDK, National Institutes of Health, Bethesda, MD 20892-8028, USA *Present address: School of Medicine, Georgetown University, Washington, DC 20057, USA ‡Author for correspondence ([email protected])

Accepted 21 December 2009 Journal of Cell Science 123, 983-992 © 2010. Published by The Company of Biologists Ltd doi:10.1242/jcs.064022

Summary Protein kinases AKT and PKBR1 of Dictyostelium belong to the AGC protein kinase superfamily. AKT and PKBR1 are phosphorylated at similar sites by phosphoinositide-dependent kinase 1 (PDK1) and TORC2 kinases; however, they have different subcellular localizing domains. AKT has a phosphoinositide 3-kinase (PI3K)/phosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P3]-regulated PH (pleckstrin homology) domain whereas PKBR1 is myristoylated and persistently membrane localized. Using strains defective for PI3K/PtdIns(3,4,5)P3-, PDK1- and TORC2-signaling or strains that express phospho-site mutants of AKT and PKBR1, we dissect the different roles of PI3K/PtdIns(3,4,5)P3, PDK1 and TORC2. We show that activation of AKT and PKBR1 requires PDK1-site phosphorylation, but that phosphorylation by TORC2 is insufficient for AKT or PKBR1 activation. However, PDK1-site phosphorylation is dependent on phosphorylation by TORC2, which suggests that there is regulatory coordination among PDK1, TORC2 and their phospho-site targets. This defines a separate input for signaling in control of chemotaxis and dependency on PDK1 function. We also demonstrate that PDK1 in Dictyostelium functions independently of PI3K/PtdIns(3,4,5)P3. Finally, we show that AKT and PKBR1 exhibit substrate selectivity and identify two novel lipid-interacting proteins preferentially phosphorylated by AKT. Despite certain similarities, AKT and PKBR1 have distinct regulatory paths that impact activation and effector targeting, with PDK1 serving a central role.

Key words: PDK1, Chemotaxis, PI3K/PtdIns(3,4,5)P3, BAR domains, PH domains, TORC2

Journal of Cell Science Introduction The closely related protein kinases AKT and PKBR1 of AKT protein kinases have consensus kinase, regulatory, and Dictyostelium are integrated in multiple pathways to organize cell PH (pleckstrin homology) localization domains (Song et al., 2005); polarity, chemoattractant sensing, and differentiation (Kamimura et the latter allows recruitment to membrane-associated al., 2008; McMains et al., 2008; Meili et al., 2000; Meili et al., 1999). phosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P3], a Dictyostelium AKT is a definitive ortholog of metazoan AKT, product of phosphoinositide 3-kinase (PI3K) and related lipid sharing highly related kinase, regulatory, and N-terminal PH domains moieties (Park et al., 2008). Full activation of mammalian AKT (Tanaka et al., 1999). Although PKBR1 has similar kinase and C- requires phosphorylation at two sites, a phosphoinositide-dependent terminal regulatory domains, it lacks the defining PH domain (Meili kinase 1 (PDK1) site within the kinase activation loop and a PDK2 et al., 2000). PKBR1 is myristoylated and associates with membrane site within the C-terminal hydrophobic motif (HM) (Alessi et al., compartments independently of PtdIns(3,4,5)P3. The shared kinase 1996a; Chan and Tsichlis, 2001). The former is phosphorylated by and regulatory domains, but different localization motifs, suggest phosphoinositide-dependent kinase 1 (PDK1), and the latter by functional overlap and specialized activities of AKT and PKBR1. TORC2, a multi-protein complex that includes the TOR (target Previous data had shown that AKT and PKBR1 are phosphorylated of rapamycin) kinase (Sarbassov et al., 2005). Once activated, at both PDK1 and PDK2/HM sites during development in response AKT phosphorylates substrates at the consensus motif to the chemoattractant cAMP (Kamimura et al., 2008). But the (R/K)X(R/K)XX(S/T) (Alessi et al., 1996b; Obata et al., 2000). separate functions of these phosphorylations in the regulation of AKT Dictyostelium discoideum has been proven a unique and powerful and PKBR1 activity had not been addressed and the specific role of model for functional studies of AKT and related AGC [cAMP- PDK1 is unknown. Using a series of Dictyostelium strains that are dependent protein kinase (PKA), cGMP-dependent protein kinase defective in PtdIns(3,4,5)P3-, PDK1- and TORC2-signaling or that (PKG) and protein kinase C (PKC)] protein kinases during cellular express phospho-site mutants of AKT and PKBR1, we investigated signaling, chemotaxis, and development (McMains et al., 2008; Meili common and distinct pathways that regulate AKT and PKBR1 in et al., 2000; Meili et al., 1999). Individual Dictyostelium chemotax response to stimulation during growth by folate and development by toward nutrient signals (e.g. folate) and propagate under nutrient- cAMP. We demonstrate that PDK1 in Dictyostelium is activated abundant conditions but, upon starvation, initiate multicellular independently of PI3K/PtdIns(3,4,5)P3 signaling, but that PDK1-site development; developing cells secrete cAMP, which functions as a phosphorylation is absolutely required for activation of both AKT primary signaling molecule, a chemoattractant, and a morphogen to and PKBR1; phosphorylation by TORC2 is insufficient to activate direct multicellular development (McMains et al., 2008). either kinase. However, PDK1 and TORC2 show cooperative 984 Journal of Cell Science 123 (6)

interactions. Loss of phosphorylation at the PDK2/HM site prevents AKT and PKBR1 are differentially sensitive to regulation phosphorylation at the PDK1 site. Thus, previously defined functions by TORC2 of TORC2 are dependent upon PDK1. In addition, loss of PDK1 The PDK2/HM site within the C-terminal regulatory domain of AGC enzyme may lead to reduced phosphorylation at the PDK2/HM site. kinases is primarily phosphorylated by the TOR kinase, as part of PDK1 thus defines a new regulatory input for signaling downstream TORC2 (Kamimura et al., 2008; Lee et al., 2005; Sarbassov et al., of the chemoattractant receptors. Finally, we show that AKT and 2005). Loss of the TORC2 subunit Rictor [rapamycin-insensitive PKBR1 exhibit substrate selectivity and identify two novel lipid- companion of mTOR; Dictyostelium Pia, (pianissimo)] does not alter interacting proteins preferentially phosphorylated by AKT. Our data expression of AKT or PKBR1 (Lee et al., 2005), but blocks cAMP- provide unique mechanistic differences for the regulation and function induced phosphorylation at both PDK1 and PDK2/HM sites of of AKT and PKBR1 and context for the complexity of PDK1 and PKBR1 (Kamimura et al., 2008), and mostly blocks phosphorylation TORC2 regulation of multiple AGC protein kinases. of AKT (Fig. 2A); substrate phosphorylations (P78, P65 and P53) by AKT and PKBR1 are also blocked (Fig. 2A). Whereas folate- Results stimulated phosphorylation of AKT and PKBR1 is inhibited in AKT and PKBR1 are differentially phosphorylated and rictor(pia)-null cells, basal phosphorylation of AKT at both PDK1 activated by stimulation with folate and cAMP and PDK2/HM sites persists and AKT substrates P53 and P78 exhibit We compared regulation of AKT and PBR1 by chemotactic constitutive basal phosphorylation (Fig. 2A). Thus, Rictor(Pia) (or signaling during growth and development. We chose antibodies that perhaps even TORC2) is not required for all PDK2/HM specifically recognize phosphorylated sequences within the kinase phosphorylations in Dictyostelium. [PDK1 site; pTFCGTPEYLAPE (pT278 for AKT and pT309 for Because the PDK1 site of PKBR1 is not phosphorylated PKBR1)] and C-terminal HM regulatory [PDK2/HM site; following cAMP stimulation of rictor(pia)-null cells, PDK1 FEGFpTYVA (pT435 for AKT and pT470 for PKBR1)] domains phosphorylation must be dependent upon phosphorylation at the identical in both AKT and PKBR1 (Fig. 1A). AKT and PKBR1 PDK2/HM site. A similar observation has been described in certain show low PDK1- and PDK2/HM-site phosphorylations in quiescent mammalian cells in which TORC2 activity has been biochemically cells, but rapid (<15 seconds), transient phosphorylation during inhibited (Garcia-Martinez et al., 2009). Although TORC2 is growth in response to folate and development in response to cAMP required to activate PKBR1 (Kamimura et al., 2008; Lee et al., (Fig. 1B). Although the predicted sizes of AKT and PKBR1 are 2005), it may not directly regulate enzymatic activity, but could nearly identical, they migrate differently. Mobilities were confirmed function primarily to facilitate phosphorylation by PDK1, a principal using purified proteins, and phosphorylation specificity confirmed regulatory pathway for activity of metazoan AKTs (Balendran et with akt-, pkbR1- and akt/pkbR1-null strains (Fig. 1B, al., 1999; Yang et al., 2002). supplementary material Fig. S1A,B). We also examined TORC2 regulation of AKT and PKBR1 in cells deficient in TORC2 components Lst8 (lethal with sec-thirteen AKT and PKBR1 exhibit substrate preferences protein 8) and SIN1 [SAPK (stress-activated MAP kinase) The AKT and PKBR1 kinase domains are extremely related and interacting protein 1; Dictyostelium RIP3 (Ras-interacting protein phosphorylate the same substrate motif (R/K)X(R/K)XX(pS/pT) 3)]. lst8-null cells resemble a weaker phenotype of rictor(pia)-nulls,

Journal of Cell Science as mammalian AKTs (Alessi et al., 1996b; Kamimura et al., 2008; with reduced PDK1- and PDK2/HM-site phosphorylations, and Obata et al., 2000). Following stimulation with folate or cAMP, delayed and suppressed AKT/PKBR1 substrate phosphorylation we detected a series of phospho-proteins (P300, P250, P165, P105, (Fig. 2B). More dramatic differences between PDK2/HM phospho- P95, P78, P65 and P53) using the -AKT phospho-substrate probe regulation of AKT and PKBR1 are observed in cells lacking (Fig. 1C). Although each protein generally responds to both folate SIN1(RIP3) (Fig. 2C). sin1(rip3)-null cells show weak and cAMP, their relative stimulations to each vary. This suggests phosphorylation of PKBR1, but phosphorylation of AKT is that there may be differential actions of AKT and PKBR1 during significantly upregulated by both folate and cAMP when compared growth compared with development. Partly this relates to the with that in wildtype (WT) cells. sin1(rip3)-null cells also exhibit differing relative expression levels of AKT and PKBR1 during a significant increase in the phosphorylation of the AKT substrates growth and development (Meili et al., 2000; Meili et al., 1999). P78 and P53. These data partially explain the comparatively weak Regardless of chemoattractant, the substrate phosphorylations developmental phenotype of sin1(rip3)-null cells compared with follow similar induction kinetics for AKT/PKBR1 phosphorylation rictor(pia)-nulls (Lee et al., 2005) and suggest that the subunit and are absent in cells lacking both AKT and PKBR1 composition of TORC2 can influence its substrate targeting. (supplementary material Fig. S1C). Some of the proteins may have been previously identified (Kamimura et al., 2008); P250 may be AKT and PKBR1 are differentially sensitive to PI3K Talin B, P105 may be RasGef5 or PI5K, and P65 may be signaling RhoGAP/GacQ. P300, P165 and P95 are not yet characterized; Class I PI3Ks are the primary kinases that generate PtdIns(3,4,5)P3. proteins P78 and P53 had not been previously identified (see Dictyostelium has at least five class I PI3Ks. pi3k1-5-null strain has below). low levels of PtdIns(3,4,5)P3 during development. Whereas AKT We focused on the preferential targets for each kinase. kinase activity is unresponsive to cAMP stimulation in this strain, Phosphorylation of P78 and P53 is most sensitive to loss of AKT PKBR1 is membrane-associated independently of PtdIns(3,4,5)P3 (Fig. 1D), but is enhanced in folate- and cAMP-stimulated pkbR1- levels and is activated independently (Kamimura et al., 2008; Lee null cells, whereas P65 phosphorylation levels are significantly et al., 2005; Meili et al., 2000; Takeda et al., 2007). To understand suppressed in pkbR1-null cells (Fig. 1E). Other proteins are less mechanistic differences, we monitored effects of varying levels of specifically impacted by loss of either AKT or PKBR1. We PtdIns(3,4,5)P3 in response to folate and cAMP. conclude that P78/P53 and P65 phosphorylations represent specific pi3k1-6-null cells are mutated for all five PI3K class I genes plus readouts for the activities of AKT and PKBR1, respectively. a more distantly related PI3K gene, pikH (Hoeller and Kay, 2007). PDK1/TORC2 regulation of Dictyostelium AGC kinases 985

Basal and stimulated phosphorylation of AKT at PDK1 and of AKT targets P78 and P53. P78 and P53 responses were also PDK2/HM sites are significantly inhibited in pi3k1-6-null and pi3k1- enhanced in pten-null cells compared with those in WT cells; 5-null strains (Fig. 3A,B). By contrast, phosphorylation of PKBR1 phosphorylation of PKBR1 was unchanged in both PTEN-deficient was unchanged. strains (Fig. 3B,C). We reasoned that loss of the PtdIns(3,4,5)P3 phosphatase PTEN To follow PtdIns(3,4,5)P3 signaling further we studied dose- might stabilize the minimal levels of PtdIns(3,4,5)P3 synthesized dependent effects of LY294002 (LY), a phosphoinositide kinase- in cells lacking PI3K1-5 and rescue AKT response, without related kinase (PIKK)-family inhibitor, on phosphorylation at impacting PKBR1 (Fig. 3B). Secondary loss of PTEN in cells PDK1 and PDK2/HM sites. LY is often presumed to have lacking PI3K1-5 showed rescue of AKT phosphorylation in ‘specificity’ for PI3K, but at high concentrations can target response to both folate and cAMP, and increased phosphorylation mammalian TOR kinase (Brachmann et al., 2009; Toral-Barza et Journal of Cell Science

Fig. 1. AKT and PKBR1 are activated by chemoattractant stimulation with cAMP and folate and phosphorylate preferential substrates. (A)Generic diagram of AKT and PKBR1 with phosphorylated threonine at PDK1 and PDK2/HM sites. (B-E)WT, akt–/pkbR1–, akt–, and pkbR1– cells were collected seconds (S) following stimulation with cAMP or folate and assayed by immunoblot with -phospho-PDK1 site (p-PDK1), -phospho-PDK2 site (p-PDK2), -actin, and/or -AKT substrate motif (p-Substrate). Wildtype (WT) substrate bands are indicated. P78 and P53 are preferentially phosphorylated by AKT. P65 is preferentially phosphorylated by PKBR1. 986 Journal of Cell Science 123 (6)

Fig. 2. AKT and PKBR1 are differentially sensitive to regulation by TORC2. (A-C)WT, rictor–(pia–), and SIN1–(rip3–)

Journal of Cell Science cells were collected following stimulation with cAMP or folate and assayed by immunoblot with -phospho-PDK1 site (p- PDK1), -phospho-PDK2 site (p-PDK2), - actin and -AKT substrate motif (p- Substrate).

al., 2005). LY effects on AKT and PKBR1 were markedly distinct of LY on PI3K, PDK1 kinase activity in Dictyostelium must function (Fig. 3D). AKT phosphorylation at both PDK1 and PDK2/HM sites independently of PtdIns(3,4,5)P3 signaling. was identically inhibited with an EC50 of ~15 M, whereas ~100 M of LY was required to inhibit both PKBR1-site Dictyostelium PDK1 regulates AKT and PKBR1, phosphorylations to 50%. chemotaxis and development independently of At low concentrations (<30 M), LY is relatively specific for PtdIns(3,4,5)P3 PI3K/AKT and inhibits recruitment of AKT to membrane As genetic and biochemical inactivation of TORC2 simultaneously compartments and availability for phosphorylation by PDK1 and blocks phosphorylation at both PDK2/HM and PDK1 sites, TORC2. Thus, the inhibitory effects of LY on PDK1- and PDK2/HM- significance of PDK1 phosphorylation in the regulation of AKT site phosphorylations are perfectly superimposable for AKT. and PKBR1 is unknown. To separate the PDK1 and TORC2 kinase At higher concentrations (>100 M) of LY, PDK2/HM-site functions, we identified two Dictyostelium PDK1 orthologs, PdkA phosphorylation of PKBR1 is inhibited. Because phosphorylation and PdkB, with conserved PDK1-type kinase domains as well as at the PDK2/HM site is required for PDK1 phosphorylation, the C-terminal PH domains characteristic of all PDK1 kinases. We also inhibitory effects of LY on PDK1- and PDK2/HM-site generated strains deficient in either gene or in both. phosphorylations are also perfectly superimposable. These pdkA- and pdkA/B-null cells showed no detectable PDK1 conclusions differ from previous assumptions about the effects of phosphorylation of PKBR1 when stimulated with folate, and only LY in Dictyostelium, which have uniformly viewed LY as specific minimal levels with cAMP (Fig. 4A). Loss of PdkB alone had only for PI3K and AKT, regardless of the concentrations used. minimal impact on the phosphorylations and activities of AKT and Furthermore, since both PDK1- and PDK2/HM-site PKBR1. Thus, PdkA appears to be the predominant regulatory phosphorylations of PKBR1 are resistant to the inhibitory effects kinase for both PKBR1 and AKT. PDK2/HM phosphorylation of PDK1/TORC2 regulation of Dictyostelium AGC kinases 987

Fig. 3. AKT and PKBR1 are differentially regulated by PI3K signaling. (A-C)WT, pi3k1–6–, pi3k1-5–, pi3k1-5–/pten– and pten– cells were collected following stimulation with cAMP or folate and assayed by immunoblot with -phospho-PDK1 site (p- Journal of Cell Science PDK1), -phospho-PDK2 site (p-PDK2), - actin and -AKT substrate motif (p- Substrate). (D)Differential effects of LY on PDK1/2 phosphorylation of AKT and PKBR1. WT cells were pre-treated with various doses of LY and collected 15 seconds following stimulation with folate; they were assayed by immunoblot with -phospho- PDK1 site (p-PDK1), -phospho-PDK2 site (p-PDK2) and -actin. Band phosphorylations were quantified and normalized to 1 for 0M LY.

PKBR1 was observed in folate- and cAMP-stimulated pdkA- and WT cells (data not shown). When plated on solid substrata at high pdkA/B-null cells but, compared with WT and pdkB-null cells, P65 cell densities, pdkA-null cells formed much smaller aggregates and phosphorylation was undetected in folate-treated cells, and highly terminal developmental structures compared with those of WT cells reduced in cAMP-treated cells. Thus, PDK2/HM-site (Fig. 4C), whereas pdkB-null cells formed smaller aggregates than phosphorylation, in the absence of PDK1-site phosphorylation, is did the WT. However, the pdkA/B-null cells have more severe not sufficient for activation of PKBR1. AKT regulation was developmental defects and fail to develop during the 24 hour time- similarly impacted. In folate-treated pdkA- and pdkA/B-null cells, course, which suggests there are developmental regulatory functions AKT has basal PDK1 phosphorylation and activated PDK2/HM- for PDK1 beyond AKT and PKBR1. site phosphorylation, but only poor phosphorylation of the AKT Although phosphorylation at the PDK1 site is critical for activation substrates P78 and P53. In cAMP-treated pdkA- and pdkA/B-null of AKT and PKBR1, PKBR1 is activated independently of PI3K. cells, PDK2/HM-site phosphorylation of AKT was reduced slightly. The LY and pi3k-null data reconcile these observations and show As expected of cells that poorly activate AKT and PKBR1, pdkA- that PDK1 phosphorylation in Dictyostelium occurs independently null cells do not aggregate at low density in submerged culture (Fig. of PtdIns(3,4,5)P3-signaling. To examine this more directly, we 4B), whereas aggregation of pdkB-null cells is similar to that in expressed a GFP-PdkA fusion in pdkA-null cells and monitored lipid 988 Journal of Cell Science 123 (6)

interaction specificity (Fig. 4D). Although GFP-PdkA can rescue the phosphorylation at the PDK2/HM site, but data from pdkA- and mutant phenotype, it exhibits no PtdIns(3,4,5)P3-binding specificity pdkA/B-null cells indicate that PDK2/HM-site phosphorylations when compared with a control, the PH domain of CRAC. Further, alone are insufficient for activation of AKT and PKBR1. To address structural predictions of the PdkA and PdkB PH domain are not inter-dependency of PDK1 and PDK2/HM phosphorylation more consistent with PtdIns(3,4,5)P3 interaction (Park et al., 2008). In directly, we studied cells expressing PDK1- or PDK2/HM-site- contrast to mammalian PDK1, Dictyostelium PDK1 functions specific mutants of AKT and PKBR1, respectively; T309A and independently of PtdIns(3,4,5)P3 signaling (Fig. 4D). T470A for PKBR1, and T278A and T435A for AKT. Re-expression of PKBR1WT in pkbR1-null cells fully rescued PDK2/HM-site phosphorylation of PKBR1 and AKT is not folate- and cAMP-regulated phosphorylation of PKBR1, substrate sufficient for kinase activation by folate or cAMP phosphorylation of P65, and development (Fig. 5A,B). pkbR1-null The TORC2-inactivation studies indicate that PDK1-site cells expressing the PDK2/HM mutant PKBR1T470A was similar to phosphorylation of AKT and PKBR1 is dependent upon the pkbR1-null parental. There was no rescue of PDK1 Journal of Cell Science

Fig. 4. Dictyostelium PDK1 regulates AKT and PKBR1, and chemotaxis and development – independently of PtdIns(3,4,5)P3. (A)WT, pdkA , pdkB– and pdkA/B– cells were collected following stimulation with cAMP or folate and assayed by immunoblot with -phospho-PDK1 (p-PDK1), - phospho-PDK2 site (p-PDK2), -actin and -AKT substrate motif (p-Substrate). (B)WT and pdkA– cells were plated in submerged culture at 1ϫ105 cells/cm2 and imaged after 8 hours. (C)WT, pdkA–, pdkB– and pdkA/B– cells were plated on solid substrata and developed for 24 hours; arrows indicate sori of terminally differentiated organisms. (D)Lipid binding assay for PdkA. Cell extracts from pdkA-nulls expressing functional GFP-PdkA were incubated with a PIP lipid strip, as indicated. Bound proteins were detected with -GFP. WT cells expressing GFP or GFP fused to CRAC were controls. Relative expression was determined by immunoblot with -GFP. (E)PI3K, PDK1 and TORC2 regulation of AKT and PKBR1. PI3K regulates PtdIns(3,4,5)P3 accumulation and recruitment of AKT to membranes. Membrane-bound AKT and PKBR1 are phosphorylated by PDK1 and TORC2 independently of PI3K. PDK1/TORC2 regulation of Dictyostelium AGC kinases 989

phosphorylation, consistent with PDK1-site phosphorylation development; despite the high levels of PDK2/HM phosphorylation, requiring phosphorylation at the PDK2/HM site, and no rescue of the PKBR1T309A-expressing cells are phenocopies of the pkbR1- p65 substrate phosphorylation or of development. null parent. Focus on the PDK1 mutant PKBR1T309A is more revealing (Fig. Similar functional conclusions can be derived from studies of 5A,B). Expressed PDK1 mutant PKBR1T309A in pkbR1-null cells mutated AKT. Expression of AKTWT rescues phosphorylation of fails to phenotypically rescue P65 substrate phosphorylation or AKT, P78 and P53 (Fig. 5C). Expression of the PDK1 mutant Journal of Cell Science

Fig. 5. PDK2/HM phosphorylation of PKBR1 and AKT is not sufficient for activation by cAMP. (A)pkbR1– cells transfected with control vector or vectors engineered to express PKBR1WT, PKBR1T309A, or PKBR1T470A and collected following stimulation with cAMP or folate and assayed by immunoblot with - phospho-PDK1 (p-PDK1), -phospho-PDK2 site (p-PDK2), -actin, and -AKT substrate motif (p-Substrate). (B)The various pkbR1– strains (see Fig. 5A) were plated on solid substrata and developed for 24 hours; arrows indicate terminally differentiated organisms. (C)akt– cells transfected with control vector or vectors engineered to express AKTWT, AKTT278A, or AKTT435A and collected following stimulation with either cAMP or folate and assayed by immunoblot with -phospho-PDK1 (p-PDK1), -phospho-PDK2 site (p-PDK2), - actin and -AKT substrate motif (p-Substrate). (D)A generic diagram of AGC kinases AKT and PKBR1 indicating the coordination of kinases PDK1 and TORC2 to phosphorylate the threonine residues in the kinase and C-terminal domains, respectively, at PDK1 and PDK2/HM sites. 990 Journal of Cell Science 123 (6)

AKTT278A in akt-null cells shows PDK2/HM-site phosphorylation, null cells. We purified the substrates using immobilized antibodies no PDK1-site phosphorylation, and no rescue of P78 and P53 to the AKT phospho-substrate site. Immunoblot confirmed enriched phosphorylation above vector controls. Only weak PDK1 recovery of AKT substrates P78 and P53 from the rip3- and pten- phosphorylation of AKT is observed with the PDK2/HM mutant null cells (Fig. 6A). AKTT435A. Immunopurified proteins from akt- and rip3-null cells were We conclude that PDK1-site phosphorylation is an obligatory separated by electrophoresis, extracted from the 78 and 53 kDa gel activation step for both PKBR1 and AKT, but phosphorylation by regions, and analyzed by LC/MS/MS peptide sequencing. For P78, TORC2 is wholly insufficient for their activations. Although we obtained 25 unique peptides/25 unique spectra that identified TORC2 is essential for the activation of AKT and PKBR1, it may (100% probability) a novel 86 kDa protein from Dictyostelium. No primarily function to make AKT and PKBR1 permissive for Dictyostelium peptides were identified in the 78 kDa region from targeting by PDK1 (Fig. 5D). Potentially, TORC2 has only minimal the akt-null control. For the 53 kDa region, we also identified a impact on the overall enzymatic activity of AKT and PKBR1. single Dictyostelium protein (53 kDa) (99% probability). To confirm Possibly other interacting and coordinating processes regulate that both P78 and P53 were AKT targets, we fused a TAP-coding PDK1 and TORC2 phosphorylation of AKT and PKBR1. Although sequence with the endogenous genomic loci and demonstrated that PDK2/HM-site phosphorylation of AKT and PKBR1 is unaffected both P78 and P53 exhibited a gel mobility shift to a new protein if the PDK1 is unphosphorylated, PDK2/HM-site phosphorylation band that was co-detected with -TAP (Fig. 6B). may be impacted by loss of the PDK1 enzymes (Fig. 4A,D). The amino acid sequence of P78 offers several interesting characteristics (Fig. 6C). Its N-terminus is defined by a protein- The two preferential AKT substrates possess protein interacting SAM (sterile alpha motif) module and a lipid-interacting motifs downstream PH-domain; we refer to P78 as PHAPS, PH/AKT- To identify substrates preferentially targeted by AKT, we used folate preferential substrate. Structural considerations suggest that the PH to stimulate strains fully deficient (i.e. akt-null) or hyper-activated domain of PHAPS would not interact strongly with PtdIns(3,4,5)P3 (e.g. rip3- or pten-null) for AKT (see Fig. 1D, Fig. 2C, Fig. 3C). (Park et al., 2008) and so it would not be simultaneously recruited Cell extracts from rip3-null cells that had been stimulated with folate to membrane compartments with AKT. Re-examination of the for 15 seconds show very high levels of P78 and P53 LC/MS/MS peptide sequencing data confirms the phospho-peptide phosphorylation, whereas these phosphorylations are highly TTpTISIGK, within a consensus AKT recognition motif, suppressed in folate-treated akt-null cells (Fig. 6A). By contrast, KKRTTpTISIGK (Fig. 6C). During characterization studies, we phosphorylation of the PKBR1 substrate P65 is observed in akt- detected two PHAPS genes (supplementary material Fig. S2). P53 has an N-terminal BAR (Bin/Amphiphysin/Rvs) domain and a C-terminal SH3 domain and is termed SHAPS, SH3/AKT- preferential substrate (Fig. 6C). The SH3 motif is a well characterized protein-protein interaction domain and the BAR motif is implicated in lipid binding and membrane curvature sensing (Frost et al., 2009; Itoh and Takenawa, 2009; Peter et al.,

Journal of Cell Science 2004). SHAPS may be a Dictyostelium equivalent of the bridging integrator (or amphiphysin) proteins implicated in cell polarization and phagocytosis in several species (Prendergast et al., 2009).

Discussion Dictyostelium AGC kinases AKT and PKBR1 are phosphorylated at PDK1 and PDK2/HM sites, have similar kinase domains, and phosphorylate the same substrate motif (Fig. 1A). However, they have distinct regulatory inputs. Dictyostelium AKT activation requires PI3K signaling; inhibition of PtdIns(3,4,5)P3 signaling blocks AKT recruitment to membrane compartments and consequent phosphorylation by both PDK1 and TORC2. PKBR1 lacks a defining AKT regulatory PH-domain and is activated Fig. 6. Purification and identification of AKT preferential substrates independently of PI3K/PtdIns(3,4,5)P3 (Kamimura et al., 2008; Lee PHAPS and SHAPS. (A)akt– and rip3– cells were lysed 15 seconds after et al., 2005; Meili et al., 2000; Meili et al., 1999). We now folate stimulation. Samples from cell lysates and AKT-substrate demonstrate an essential function for PtdIns(3,4,5)P3-independent immunoprecipitations (IP) were immunoblotted with -phospho-AKT regulation of PDK1 in the activation of both AKT and PKBR1 (Fig. substrate. (B)Confirmation of P78 and P53 as AKT substrates. The TAP 4E). We also describe unique interactions and dependencies of epitope was fused to the endogenous P78 and P53 gene loci by targeted PDK1 and TORC2 in AKT and PKBR1 regulations and differential homologous recombination; there are two P78 genes in Dictyostelium specificity toward downstream targets (Fig. 5D). These data (supplementary material Fig. S2) and only 1 P53 gene. Equivalent cell sample emphasize a new regulatory input in the pathway through PDK1 volumes of WT, P78-TAP or P53-TAP cells were collected at various times that is separate from PI3K or TORC2 (Fig. 4E). following stimulation with folate and assayed by immunoblot with -phospho- Phosphorylation of the PDK2/HM site by Dictyostelium TORC2 AKT substrate and -TAP. A new band detected by both antibodies is indicated by an arrow in each TAP cell and is absent in WT cells. P53 is has been well described. However, its contribution to AKT and detected only in WT cells. (C)Structure of PHAPS and SHAPS. PHAPS (P78) PKBR1 activity has not been clear and the function of PDK1 contains SAM and PH domains and the phosphorylated AKT motif phosphorylation has been entirely unknown. We now show that KKRTTpT. SHAPS (P53) contains BAR and SH3 domains. phosphorylation of the PDK2/HM site is completely insufficient PDK1/TORC2 regulation of Dictyostelium AGC kinases 991

for activation of either PKBR1 or AKT. Neither is activated in the Materials and Methods Strains and genes absence of PDK1-site phosphorylation, data and conclusions Dictyostelium strain ID names are: akt– (DBS0236784), pkbR1– (DBS0236785), consistent with observations in other systems, where activation of akt–/pkbR1– (DBS0236785), pi3k1-6– (DBS0252653), pi3k1-5– (DBS0252652), AKT absolutely requires phosphorylation by PDK1 (Bellacosa et pi3k1-5–/pten– (DBS0252654), pten– (DBS0252655), rip3– and pia– strains were – – – al., 1998; Mora et al., 2003; Williams et al., 2000). In contrast to courtesy of Richard Firtel (UCSD, La Jolla, CA). akt /pkbR1 and pi3k1-6 strains were grown in association with Klebsiella aerogenes bacteria. mammalian PDK1, Dictyostelium PDK1 lacks PtdIns(3,4,5)P3- Gene ID names are SHAPS (DDB_G0288895), PHAPS (DDB_G0271552), PdkA binding specificity and functions independently of (DDB_G0281471), PdkB (DDB_G0284489), AKT (pkbA DDB_G0268620) and PKBR1 (pkbG DDB_G0290157). PI3K/PtdIns(3,4,5)P3 signaling (Fig. 4E). These conclusions are further supported by structural analysis of the PH domains of PdkA Dictyostelium development and PdkB (Park et al., 2008). Growing cells were washed and spread evenly on pre-boiled black filters on wet While activation of both PKBR1 and AKT requires paper pads. For aggregation, growing cells were washed and incubated in microtitre phosphorylation by PDK1, phosphorylation by PDK1 is mediated wells. After 8 hours, cells in the center of each well were imaged. by PDK2/HM-site phosphorylation (Fig. 5D); PKBR1 (or AKT) is AKT and PKBR1 phosphorylation inactive in cells that lack functional TORC2 or that express PKBR1 cAMP and folate stimulations are modifications (Liao and Kimmel, 2009). (or AKT) carrying a PDK2/HM phospho-site mutation. PDK2/HM- Immunoblots used -phospho-PDK1 site (Cell Signaling), -phospho-PDK2/HM site (Cell signaling), -phospho-AKT Substrate (Cell Signaling), and -Actin (Santa Cruz site phosphorylation by TORC2 in the regulation of AKT activity Biotechnology). is complex and has differing functions. PDK2/HM-site phosphorylation can allosterically enhance AKT activity (Biondi AKT, PKBR1, PdkA, SHAPS and PHAPS AKT and PKBR1 were mutated using QuikChange II (Stratagene). pGEX was used et al., 2000), can slightly broaden substrate specificity of activated for bacterial expression and PDXA was used for Dictyostelium expression. AKT (Jacinto et al., 2006), but can also promote interactions with We used primer pairs 5Ј-GGATCCATGTCAACAGCACCAATTAAACATG-3Ј PDK1 to promote AKT phosphorylation at the PDK1 site within and 5Ј-CTCGAGTTATCTTAAATGTTCAGATTCAGCGAC-3Ј to amplify AKT and Ј Ј Ј its kinase activation loop (Balendran et al., 1999; Yang et al., 2002). primers pairs 5 -GGATCCATGGGAAAAGGACAAAGTAAAATAAAG-3 and 5 - CTCGAGTTAATCCTTTAAGATTGAATCAGCTACA-3Ј to amplify PKBR1 protein This latter mechanism may be the significant regulatory role of coding regions from mRNA. Point mutations at PDK1 and PDK2/HM sites were TORC2 in the activation of AKT and PKBR1 in Dictyostelium. made in the TA vector using QuikChange II site-Directed Mutagenesis Kit However, PDK1 and PDK2/HM-site phosphorylations may be too (Stratagene). pGEX was used for bacterial expression and PXDA was used for expression in Dictyostelium. rapid to demonstrate that PDK2/HM-site phosphorylation precedes pGEX-6p-1-AKT or pGEX-6p-1-PKBR1 cells were grown overnight, diluted to OD that of PDK1 (Fig. 4E, Fig. 5D). Alternatively, in the absence of ~0.1, and shaken at 23°C to OD ~0.4. 0.3 mM IPTG was added to induce expression. PDK2/HM-site phosphorylation, phosphorylation of the PDK1 site After 6 hours, bacteria were pelleted and resupended in 1ϫ PBS plus protease inhibitor may occur normally, but become rapidly de-phosphorylated. cocktail. Lysozyme was added to 100 ng/ml for 10 minutes and samples were frozen in a dry ice-isopropanol bath and thawed at 4°C overnight. The thawed samples were Although PDK1 phosphorylation of AKT and PKBR1 requires centrifuged at 50,000 g for 1 hour. Supernatant was added to 500 l of equilibrated phosphorylation at the PDK2/HM site, the opposite is not the case. sepharose 4B beads and rotated gently for 1 hour. After 3 rounds of wash, beads were PDK2/HM-site phosphorylation persists in AKT and PKBR1 added with cleavage buffer and precession protease (GE healthcare). After rotating gently at 4°C for 4 hours, the AKT or PKBR1 was eluted from beads. protein kinases that carry PDK1 phospho-site mutations. The PdkA locus was targeted using pLPBPP. pLPBLP-TAP contained the TAP- Nonetheless, data from cells lacking PdkA suggest the potential for coding sequence fused upstream of BlastR in pLPBLP and was used for TAP tag fusions to PHAPS and SHAPS. Journal of Cell Science functional interaction between PDK1 and TORC2 that mediates To construct the pdkA-null strain, PDKA genomic DNA was amplified using primer efficient phosphorylation of AKT and PKBR1 at both PDK1 and pairs 5Ј-CCTTAATGCTAAAATTTCGGTGTC-3Ј and 5Ј-TTTTTGAGGATTAT- PDK2/HM sites (Fig. 5D). Dictyostelium may provide a unique GAGCAACATCTTCT-3Ј and cloned into pCR4-TOPO (Invitrogen). The resulting approach to study interactions among PDK1 and PDK2/HM sites plasmid was linearized within the genomic sequence with BglII and blunt-end ligated and their upstream kinases, PDK1 and TORC2. It should be noted to the SmaI sites flanking the Blasticidin resistant cassette in pLPBPP (Faix et al., 2004). To construct the pdkB-null strain, we prepared left and right arm recombination that, although absolute cross-dependency of PDK1- and PDK2/HM- fragments. Primer pairs 5Ј-GCGGCCGCAACAATGGCTA GATG ATCA AGTT - site phosphorylations is not universal, similar mechanisms may ATTC-3Ј and 5Ј-ACTAGTCTTCTTTTTGGTAACGACCATTTATC-3Ј were used to occur in other systems (Garcia-Martinez et al., 2009; Jacinto et al., amplify the left arm from genomic DNA; the right arm was amplified using primer pairs 5Ј-AAGCTTTCCAAGATATATAAATCCATTACCAACTC-3Ј and 5Ј-GTC- 2006; Williams et al., 2000). GACGAAATGTCTTGATCTTCCTTTTGAG-3Ј. The left arm and right arms were Despite the differences in their regulation and localization (Fig. then inserted into pLPBLP. 4E), AKT and PKBR1 have been viewed as functionally identical For PHAPS mutagenesis, we prepared left and right arm recombination fragments. and inferred to exhibit minimal substrate preference (Kamimura et Primer pairs 5Ј-GCGGCCGCGAGTTGTGTTGTGGTTTACACGTC-3Ј and 5Ј- ACTAGTGCAACCAAATCATCTTCTGTTAATTCTG-3Ј were used to amplify the al., 2008). However, in addition to the distinct regulatory paths for left arm from genomic DNA; the right arm was amplified using primer pairs 5Ј- activation of AKT and PKBR1, we now demonstrate that these AAGCTTCAACCTATGCTCTTCAAGATAAAG-3Ј and 5Ј-GTCGACGATTTCC - kinases have substrate preferences and identify two novel AKT CAGAAAGTTGAACGG-3Ј. The left arm and right arms were then inserted into pLPBLP. substrates, PHAPS and SHAPS. Both PHAPS and SHAPS have pLPBLP-TAP contained the TAP coding sequence fused upstream of BlastR in lipid-binding motifs and protein interaction domains. No equivalent pLPBLP. The TAP sequence was amplified from plasmid PKK4 (kindly provided by PHAPS protein is identified in other systems. SHAPS, however, is Ralf Graph, Ludwig-Maximilians University, Munich, Germany) using primer pairs part of the BIN/amphiphysin family. Consistent with the targeted 5Ј-AAGCTTGC ATGCTCAATGGAAAAGAGAAGATGGAAAAAG-3Ј and 5Ј- CCATGGTCAGGTT GACTTCCCCGCGGAAT-3 Ј. The TAP fragment was excised phosphorylation of SHAPS following chemotactic stimulation, with HindIII and NcoI and inserted into pLPBLP, generating pLPBLP-TAP. For BIN/amphiphysin proteins are implicated in a wide array of PHAPS-TAP fusion mutagenesis we prepared left and right arm recombination membrane processes, including actin function, interaction with small fragments. The PHAPS left recombination arm was amplified using primer pairs 5Ј- GTC GACGAATGGAATATTAATGGTAAAGAACC and 5Ј-AAGCTTACCA - GTPases and other signaling pathways, and clathrin-mediated CCACCATTAGTTTTTTCATCTTTTTTAGCAGTC-3 Ј; the left arm terminated just endocytosis (Frost et al., 2009; Peter et al., 2004; Yamada et al., upstream of the UAA stop codon in the genomic DNA. The PHAPS right 2007). PHAPS and SHAPS may function as adapters to recruit recombination arm was amplified from genomic DNA using primer pairs 5Ј-ACTA- Ј Ј components to membrane compartments and are potentially GTTAAAAATAGGCATTTTGCTCAAAC-3 and 5 -GCGGCCGCATACACTTA - ATGGTACCATTAAAGTGTG-3Ј. The left arm was then inserted in-frame with TAP regulated by differential states of phosphorylation. into pLPBLP-TAP; the right arm was ligated downstream. 992 Journal of Cell Science 123 (6)

For SHAPS-TAP fusion mutagenesis we prepared left and right arm recombination Brachmann, S., Fritsch, C., Maira, S. M. and Garcia-Echeverria, C. (2009). PI3K and fragments. The SHAPS left recombination arm was amplified using primer pairs 5Ј- mTOR inhibitors: a new generation of targeted anticancer agents. Curr. Opin. Cell Biol. GTCGACCAATTCAGAGATATTAGATCTCGTCTTG-3Ј and 5Ј-AAGCTTACCA- 21, 194-198. CCACCACCACTTGTATGATTACATGGAACTAAAC-3Ј; the left arm terminated Chan, T. O. and Tsichlis, P. N. (2001). PDK2: a complex tail in one Akt. Sci STKE 2001, just upstream of the UAA stop codon in the genomic DNA. The SHAPS right PE1. recombination arm was amplified from genomic DNA using primer pairs 5Ј- Comer, F. I., Lippincott, C. K., Masbad, J. J. and Parent, C. A. (2005). The PI3K- ACTAGTTTATCAACATTCACTCTTTTTAACTTTATC-3Ј and 5Ј-GCGGCC - mediated activation of CRAC independently regulates adenylyl cyclase activation and Ј chemotaxis. Curr. Biol. 15, 134-139. GCGTTGATTTGACACCAGTCTACCC-3 . The left arm was then inserted in-frame Faix, J., Kreppel, L., Shaulsky, G., Schleicher, M. and Kimmel, A. R. (2004). A rapid with TAP into pLPBLP-TAP; the right arm was ligated downstream. and efficient method to generate multiple gene disruptions in Dictyostelium discoideum The knock-out or TAP knock-in constructs were linearized and electroporated into using a single selectable marker and the Cre-loxP system. Nucleic Acids Res. 32, e143. AX3 strain and transformants were selected for growth under blasticidin selection Frost, A., Unger, V. M. and De Camilli, P. (2009). The BAR domain superfamily: pressure. Homologous recombinants were identified by genomic PCR and RT-PCR. membrane-molding macromolecules. Cell 137, 191-196. TAP knock-in strains were also confirmed by immunoblot with TAP antibody (Open Garcia-Martinez, J. M., Moran, J., Clarke, R. G., Gray, A., Cosulich, S. C., Chresta, Biosystems CAB1001). C. M. and Alessi, D. R. (2009). Ku-0063794 is a specific inhibitor of the mammalian target of rapamycin (mTOR). Biochem. J. 421, 29-42. PIP-strip binding assay Hoeller, O. and Kay, R. R. (2007). Chemotaxis in the absence of PIP3 gradients. Curr. The protocol for the PIP-strip binding assay has been described previously (Comer Biol. 17, 813-817. et al., 2005). Briefly, 2ϫ108 cells were collected, differentiated for 2 hours with cAMP, Itoh, T. and Takenawa, T. (2009). Mechanisms of membrane deformation by lipid-binding and resuspended in 2.5 ml of lysis buffer (10 mM Tris, pH 7.5, 0.2 M EGTA, 0.2 domains. Prog. Lipid Res. 48, 298-305. Jacinto, E., Facchinetti, V., Liu, D., Soto, N., Wei, S., Jung, S. Y., Huang, Q., Qin, J. M sucrose and protease inhibitor). Cells were lysed through a 5 m filter membrane, and Su, B. (2006). SIN1/MIP1 maintains rictor-mTOR complex integrity and regulates samples were centrifuged at 9500 g for 15 minutes, and the supernatant diluted into Akt phosphorylation and substrate specificity. Cell 127, 125-137. 12 ml of TBST containing 1% nonfat dry milk and protease inhibitor. Extracts were Kamimura, Y., Xiong, Y., Iglesias, P. A., Hoeller, O., Bolourani, P. and Devreotes, P. incubated overnight at 4°C with PIP strips (Echelon Bioscience) that had been pre- N. (2008). PIP3-independent activation of TorC2 and PKB at the cell’s leading edge blocked with 1% nonfat dry milk in TBST. Strips were washed and assayed by binding mediates chemotaxis. Curr. Biol. 18, 1034-1043. to -GFP (COVANCE). Lee, S., Comer, F. I., Sasaki, A., McLeod, I. X., Duong, Y., Okumura, K., Yates, J. R., 3rd, Parent, C. A. and Firtel, R. A. (2005). TOR complex 2 integrates cell movement Immunopurification of AKT preferential substrates during chemotaxis and signal relay in Dictyostelium. Mol. Biol. Cell 16, 4572-4583. Cells were resuspended in PB (11.4 mM sodium phosphate, pH 6.5) at a density of Liao, X. H. and Kimmel, A. R. (2009). Biochemical responses to chemoattractants in 5ϫ107 cells/ml and starved for 30 minutes. Cells were stimulated at 50 M folic Dictyostelium: ligand-receptor interactions and downstream kinase activation. Methods acid and lysed with an equal volume 2ϫ NP-40 lysis buffer [2ϫ PB, 1% NP-40, 100 Mol. Biol. 571, 271-281. mM NaF, 4 mM Na3VO4, 50 mM sodium pyrophosphate, 400 M PMSF, 1 complete McMains, V. C., Liao, X. H. and Kimmel, A. R. (2008). Oscillatory signaling and network mini, EDTA-free, protease inhibitor cocktail tablet (Roche)]. Cell lysates were responses during the development of Dictyostelium discoideum. Ageing Res. Rev. 7, incubated on ice for 5 minutes and then centrifuged at 4°C for 30 minutes at 20,000 234-248. Meili, R., Ellsworth, C., Lee, S., Reddy, T. B., Ma, H. and Firtel, R. A. (1999). g. Immobilized -phospho-AKT substrate resin [Cell Signaling Immobilized Phospho- Chemoattractant-mediated transient activation and membrane localization of Akt/PKB (Ser/Thr) Akt substrate antibody] was added to the supernatant in a 1:10 ratio and is required for efficient chemotaxis to cAMP in Dictyostelium. EMBO J. 18, 2092-2105. allowed to incubate at 4°C overnight with gentle rotating. The resin was washed ϫ ϫ Meili, R., Ellsworth, C. and Firtel, R. A. (2000). A novel Akt/PKB-related kinase is twice with 1 NP-40 lysis buffer and twice with 1 RIPA buffer [150 mM NaCl, essential for morphogenesis in Dictyostelium. Curr. Biol. 10, 708-717. 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl (pH 8.0)]. The Mora, A., Davies, A. M., Bertrand, L., Sharif, I., Budas, G. R., Jovanovic, S., Mouton, proteins were eluted by gentle shaking with 8 M urea. The protein samples were V., Kahn, C. R., Lucocq, J. M., Gray, G. A. et al. (2003). Deficiency of PDK1 in concentrated and the buffer was replaced with 100 mM NaCl with sequential washes cardiac muscle results in heart failure and increased sensitivity to hypoxia. EMBO J. using a Microcon YM-30 column (Millipore). The samples were resolved on a 3- 22, 4666-4676. 8% gel, with prior reduction and alkylation, and visualized by silver staining Obata, T., Yaffe, M. B., Leparc, G. G., Piro, E. T., Maegawa, H., Kashiwagi, A., (SilverQuest Silver Staining Kit, Invitrogen). Experimental and control gel bands Kikkawa, R. and Cantley, L. C. (2000). Peptide and protein library screening defines were excised, de-stained and washed according to SilverQuest, and subjected to in- optimal substrate motifs for AKT/PKB. J. Biol. Chem. 275, 36108-36115. gel trypsin digestion and peptide extraction (Shevchenko et al., 2006) using a MassPrep Park, W. S., Heo, W. D., Whalen, J. H., O’Rourke, N. A., Bryan, H. M., Meyer, T. and Journal of Cell Science robot (Micromass/Waters modified Packard Multiprobe II). The resulting peptide Teruel, M. N. (2008). Comprehensive identification of PIP3-regulated PH domains from extracts were analyzed by LC/MS/MS (NanoAquity, Waters). Data were automatically C. elegans to H. sapiens by model prediction and live imaging. Mol. Cell 30, 381-392. Perkins, D. N., Pappin, D. J., Creasy, D. M. and Cottrell, J. S. (1999). Probability-based searched using the Mascot Daeomon and the NIH-CIT Mascot Server (Perkins et al., protein identification by searching sequence databases using mass spectrometry data. 1999). Flat files from these searches were used to generate Scaffold files (Proteome Electrophoresis 20, 3551-3567. Software). Peter, B. J., Kent, H. M., Mills, I. G., Vallis, Y., Butler, P. J., Evans, P. R. and McMahon, H. T. (2004). BAR domains as sensors of membrane curvature: the amphiphysin BAR We thank Xiuli Huang, Marielle Young and Colette Young for structure. Science 303, 495-499. assistance in gene targeting experiments. David Eric Anderson was Prendergast, G. C., Muller, A. J., Ramalingam, A. and Chang, M. Y. (2009). BAR the door: cancer suppression by amphiphysin-like genes. Biochim. Biophys. Acta 1795, 25-36. invaluable for mass spectrometric analyses. Finally, we thank Dictybase Sarbassov, D. D., Guertin, D. A., Ali, S. M. and Sabatini, D. M. (2005). Phosphorylation and colleagues for various strains. This research was supported by the and regulation of Akt/PKB by the rictor-mTOR complex. Science 307, 1098-1101. Intramural Research Program of the National Institutes of Health, the Shevchenko, A., Tomas, H., Havlis, J., Olsen, J. V. and Mann, M. (2006). In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nat. Protoc. 1, 2856- National Institute of Diabetes and Digestive and Kidney Diseases. 2860. Deposited in PMC for release after 12 months. Song, G., Ouyang, G. and Bao, S. (2005). The activation of Akt/PKB signaling pathway and cell survival. J. Cell Mol Med 9, 59-71. Supplementary material available online at Takeda, K., Sasaki, A. T., Ha, H., Seung, H. A. and Firtel, R. A. (2007). Role of http://jcs.biologists.org/cgi/content/full/123/6/983/DC1 phosphatidylinositol 3-kinases in chemotaxis in Dictyostelium. J. Biol. Chem. 282, 11874- 11884. References Tanaka, K., Adachi, H., Konishi, H., Iwamatsu, A., Ohkawa, K., Shirai, T., Nagata, Alessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P. and S., Kikkawa, U. and Fukui, Y. (1999). Identification of protein kinase B (PKB) as a Hemmings, B. A. (1996a). Mechanism of activation of protein kinase B by insulin and phosphatidylinositol 3,4,5-trisphosphate binding protein in Dictyostelium discoideum. IGF-1. EMBO J. 15, 6541-6551. Biosci. Biotechnol. Biochem. 63, 368-372. Alessi, D. R., Caudwell, F. B., Andjelkovic, M., Hemmings, B. A. and Cohen, P. (1996b). Toral-Barza, L., Zhang, W. G., Lamison, C., Larocque, J., Gibbons, J. and Yu, K. Molecular basis for the substrate specificity of protein kinase B; comparison with (2005). Characterization of the cloned full-length and a truncated human target of MAPKAP kinase-1 and p70 S6 kinase. FEBS Lett. 399, 333-338. rapamycin: activity, specificity, and enzyme inhibition as studied by a high capacity Balendran, A., Casamayor, A., Deak, M., Paterson, A., Gaffney, P., Currie, R., assay. Biochem. Biophys. Res. Commun. 332, 304-310. Downes, C. P. and Alessi, D. R. (1999). PDK1 acquires PDK2 activity in the presence Williams, M. R., Arthur, J. S., Balendran, A., van der Kaay, J., Poli, V., Cohen, P. and of a synthetic peptide derived from the carboxyl terminus of PRK2. Curr. Biol. 9, 393- Alessi, D. R. (2000). The role of 3-phosphoinositide-dependent protein kinase 1 in 404. activating AGC kinases defined in embryonic stem cells. Curr. Biol. 10, 439-448. Bellacosa, A., Chan, T. O., Ahmed, N. N., Datta, K., Malstrom, S., Stokoe, D., Yamada, H., Ohashi, E., Abe, T., Kusumi, N., Li, S. A., Yoshida, Y., Watanabe, M., McCormick, F., Feng, J. and Tsichlis, P. (1998). Akt activation by growth factors is Tomizawa, K., Kashiwakura, Y., Kumon, H. et al. (2007). Amphiphysin 1 is a multiple-step process: the role of the PH domain. Oncogene 17, 313-325. important for actin polymerization during phagocytosis. Mol. Biol. Cell 18, 4669-4680. Biondi, R. M., Cheung, P. C., Casamayor, A., Deak, M., Currie, R. A. and Alessi, D. Yang, J., Cron, P., Good, V. M., Thompson, V., Hemmings, B. A. and Barford, D. R. (2000). Identification of a pocket in the PDK1 kinase domain that interacts with PIF (2002). Crystal structure of an activated Akt/protein kinase B ternary complex with GSK3- and the C-terminal residues of PKA. EMBO J. 19, 979-988. peptide and AMP-PNP. Nat. Struct. Biol. 9, 940-944.