California State University, Northridge Production Of

CALIFORNIA STATE UNIVERSITY, NORTHRIDGE

PRODUCTION OF SIALIC ACID AFFECTED BY GNE GENE MUTATIONS

A thesis submitted in partial fulfillment of the requirements For the degree of Master of Science In Biology

Atefeh Rajaei

August, 2012

Atefeh Rajaei

The thesis of Atefeh Rajaei is approved:

Dr. Aida Metzenberg Date

Dr. Daniel Darvish Date

Dr. Yadira Valles-Ayoub Date

Dr. Stan Metzenberg, Chair Date

California State University, Northridge

iii

Acknowledgements

Though it is ceremonious to write an acknowledgment, this is not merely to formalize the custom but to express my cordial gratitude to all those who have directly or indirectly helped me through the course of this work as it is the fruit of the outcome of a set of seemingly unrelated yet intertwined and dependent factors that by His grace worked in my favour. Any accomplishment requires the efforts of many people and this work of Thesis project is no different. I have been fortunate enough to get the help and guidance from many people. It is a pleasure to acknowledge them, though it is still inadequate appreciation for their contribution. I shall forever be highly grateful to Dr. Stan Metzenberg. He unravelled each and every riddle in my project with his prodigious knowledge. I would also like to express my sincere gratitude towards Dr. Aida Metzenberg for extending her support throughout my project and in widening my knowledge. I express my sincerest gratitude and thanks to Dr. Yadira Valles. Under her brilliant untiring guidance I have completed the project successfully on time. Dr. Daniel Darvish who has helped me in simplifying the problem involved in the work. His meticulous attention and invaluable suggestions are admirable.

I also convey my cordial thanks to Zeshan Khokher, Rosangela Carbajo and other members of HIBM research group for their support and help. Special mention of Ishita Shah, Bansari Shah, and other members of Dr. Stan Metzenberg’s and Dr. Aida Metzenberg’s lab for their constant enthusiastic encouragement and valuable suggestions without which this would not have been successfully completed.

TABLE OF CONTENTS

Signature page iii

Acknowledgements iv

List of Figure viii

List of Tables ix

Abstract x

CHAPTER 1: INTRODUCTION

Distal Myopathy Overview and History 1

Clinical Description of HIBM 3

Diagnosis of HIBM 3

Molecular Basis of HIBM 4

Structure of GNE enzyme 6

Sialic acid 9

Sialuria 19

GNE Mutations Examined in this Study 20

Purpose of the Study 21

Hypothesis 21

CHAPTER 2: MATERIALS AND METHODS

Materials 22

Sample: GNE/Topoblunt II plasmid 22

Site Directed Mutagenesis 23

Generation of the Mutated Gene 26

Agarose Gel Electrophoresis 28

Gel Extraction 28

Digestion of GNE DNA insert after PCR 29

Digestion of Vector 30

Ligation 31

Transformation 31

Clone Confirmation 32

Sequencing of GNE gene 33

Plasmid DNA Isolation 33

Cell Culture 34

CHO Cells Transfection 35

Cell Viability Assay 35

DNA Extraction Assay 36

PCR for CMV Promoter Detection 36

RNA Extraction Assay 37

Reverse Transcription PCR 38

Protein Extraction Assay 39

Sialic Acid Assay 40

CHAPTER 3: RESULTS

Site Directed Mutagenesis of the GNE Gene 41

Sequencing of GNE Gene 44

CHO Cells Transfection 46

Cell Viability Assay 47

CMV Promoter Presence in Cells Post-Transfection 48

Confirmation of Transcription of GNE Post-Transfection 49

Products of GNE Enzyme Post-Transfection 50

CHAPTER 4: DISCUSSION

Expression of Mutated GNE Genes in CHO Cells 52

Significance of the Study 54

Future Directions 55

REFERENCES 57

APPENDIX

Appendix I: Homosapiens GNE gene sequence cDNA (variant I) 64

Appendix II: Homosapiens GNE gene sequence cDNA(variant II) 66

Appendix III: Homosapiens GNE protein sequence isoform1 68

Appendix IV: Homosapiens GNE protein sequence isoform 2 69

vii

LIST OF FIGURES

Figure 1: Diagram of Human Chromosome 9 4

Figure 2: Secondary structure of GNE enzyme 7

Figure 3: Tertiary structure of the active site of epimerase domain of GNE/MNK enzyme 8 Figure 4: The N-acetylmannosamine kinase (MNK) domain of the human GNE/MNK enzyme 9

Figure 5: Schematic diagram of the sialic acid biosynthetic pathway 10

Figure 6: pUMVC3 Mammalian expression plasmid 30

Figure 7: Two segments of mutated GNE gene amplified 42

Figure 8: Amplified GNE gene with N-Term and C-Term primers 43

Figure 9: Screening of supercoiled DNA sizes for clone Candidates 44

Figure 10: Electropherograms of mutated region in each GNE constructs 44

Figure 11: CHO cells 0 hour post-transfection 46

Figure 12: CHO cells 48 hours post-transfection 47

Figure 13: CHO Cell Viability Post-Transfection 48

Figure 14: CMV Promoter Detection 49

Figure 15: Detection of transcription of GNE gene 50

Figure 17: Bar graph of sialic acid amount produced in CHO cells 51

viii

LIST OF TABLES

Table 1: Reported patients from different origins with HIBM phenotype 12

Table 2: Reported patients with GNE gene mutations 17

Table 3: Primers for amplification of GNE D176V segments 23

Table 4: Primers for amplification of GNE R263L segments 24

Table 5: Primers for amplification of GNE M265T segments 24

Table 6: Primers for amplification of GNE V572L segments 25

Table 7: PCR reaction mix for GNE gene amplification 25

Table 8: PCR conditions, temperature and time for each step 26

Table 9: Primers for amplification of GNE gene 26

Table 10: PCR reaction mix for GNE gene amplification 27

Table 11: PCR conditions, temperature and time for each step 27

Table 12: Restriction enzyme digestion reaction mix 29

Table 13: Ligation reaction mix 31

Table 14: Primers used for sequencing 33

Table 15: PCR reaction mix for CMV promoter presence 36

Table 16: PCR conditions for CMV promoter presence 37

Table 17: RT PCR reagent mix 38

Table 18: RT PCR conditions, temperatures, times and cycles 39

Abstract Production of Sialic Acid Affected by GNE Gene Mutations. By Atefeh Rajaei Masters of Science Biology

Hereditary Inclusion Body Myopathy (HIBM) is an autosomal recessive disorder characterized by adult onset muscle-wasting, affecting both proximal and distal muscles.

HIBM is caused by different mutations in the GNE gene including the common Middle

Eastern founder allele, p.M712T. The GNE gene is located on chromosome 9p13.3 of humans. The GNE gene encodes a bifunctional rate limiting enzyme UDP N-acetyl glucosamine 2-epimerase/N-acetyl mannosamine kinase (UDP-GNE/MNK). This enzyme catalyzes the first two steps in the sialic acid biosynthetic pathway. Mutations in the GNE gene may lead to, either decreased sialic acid biosynthesis and reduced sialylation of a variety of proteins like alpha-dystroglycan, Neprilysin and NCAM,

(Huizing et al., Broccolini et al., Ricci et al.,) or to increased sialic acid production.

Glycosylation defects have recently become recognized as an important cause of muscular dystrophy (Muntoni et al.). The functional capacity of sialic acid production can be restored by introduction and expression of the wild-type GNE gene. In order to demonstrate this, I used lectin resistant Chinese Hamster Ovary (CHO) cells (Lec3), which lack GNE/MNK activity. The CHO cells were transfected with pUMVC3-GNE recombinant constructs expressing either a wild-type GNE, D176V, R263L, M265T,

V572L, M712T or R266Q mutant insert. CHO cells transfected with the R263L and

R266Q GNE expression plasmid had an increase in sialic acid production. Those transfected with the D176V, M265T, V572L, and M712T GNE expression plasmid

x showed significantly lower amounts of sialic acid production. We intend to use these data to construct a model for gene therapy in mice and investigate its safety and effectiveness in the alleviation of muscle degeneration manifested in HIBM.

Chapter 1: Introduction

Distal Myopathy or Distal Muscular Dystrophy is a type of disease that affects the muscles of the extremities such as the hands, feet, lower arms, or lower legs. It is challenging to determine the cause of this dystrophy in each patient because it can be a mutation in any of several genes, all of which are not yet known. These mutations can be inherited from one parent, autosomal dominant, or from both parents, autosomal recessive.

Distal Myopathy Overview and History:

The first case of a distal myopathy was reported by Growers in 1902. In 1951

Welander reported a large group of patients in Sweden with a hereditary form of distal myopathy which was a late onset familial form, with an autosomal dominant inheritance pattern (Welander L, 1951). Through this landmark publication, this group of disorders became firmly established. Other forms of myopathies, inherited dominantly, recessively, or with a mitochondrial pattern of inheritance, have since been recognized and reported from different populations.

Inclusion-Body Myopathy (IBM) is a term used by Yunis and Samaha in 1971 for a slowly progressive myopathy that clinically mimicked a chronic polymyositis (Kagen

L.J., 2009). The first case of Inclusion Body Myositis was reported by Chou in 1967.

Light and electron microscopic pathological observations were reported by him (Chou

S.M., 1967). In 1971, a patient was reported with Hereditary Inclusion Body Myopathy

(HIBM) due to mutations in a gene on chromosome 9 (Yunis et al. 1971). This patient had onset of leg weakening at the age of 18.

The most common form of HIBM was first described in 1984 by Professor Zohar

Argov from the Department of Neurology of the Hebrew University-Hadassah

Medical School in Jerusalem. HIBM was first recognized in individuals of Iranian-Jewish decent, and nearly 104 affected individuals from 47 Middle Eastern families were found to have the same mutation in a homozygous state in the gene that encodes the enzyme

(UDP-N-acetyl) glucosamine 2-epimerase/N-acetylmannosamine kinase (GNE)

(Eisenberg et al., 2001). Affected individuals in families of other ethnic origins were found to be compound heterozygotes for other distinct mutations in the GNE gene.

Hereditary inclusion body myopathies are rare genetic disorders, with a primary characteristic being a slow progression of skeletal muscle wasting and a weakening of the muscles. The weakening begins in young adulthood and can increase in severity within one or two decades. The early signs of HIBM are difficulty running, walking on heels, weakening of the index finger, and loss of balance. (HIBM.org) The majority of HIBM patients are found among Middle Eastern, Iranian-Jewish or Japanese populations. Some patients however, have been identified in Asian populations including (Korean, Chinese,

Indian and others) as well as in European, South American and African populations.

HIBM is also referred to as Distal Myopathy with Rimmed Vacuoles (DMRV),

Quadriceps Sparing Myopathy (QSM), and GNE related muscle disorder (Valles Ayoub et al., 2008). The onset of this disease typically occurs when the patient is 20-30 years of age. In extreme cases however, early onset before the age of 17 and late onset after the age of 52 have also been reported. Within a decade or more after the onset, the patient is confined to a wheelchair (Jay et al., 2008). The weakness and severity is patient specific

2 and it varies among individuals. The quadriceps muscles are spared and remain strong until late stages. (Asaka et al., 2001)

Clinical Description of HIBM

Hereditary Inclusion Body Myopathy has been characterized by progressive weakening and wasting of proximal and distal muscles of the upper and lower limbs

(Argov et al. 1984). The onset of the symptoms normally occurs after the age of 20. The weakening of the muscles progresses gradually for one or two decades and by the second or third decade after the onset of symptoms, the patient requires a wheelchair for mobility. A unique feature of this disease is the partial or complete sparing of quadriceps muscles, even during the advanced stages of the disease (Huizing et al., 2009). During the early stages, the weakness and atrophy of the foot extensor muscles is observed, followed by the involvement of forearm flexor muscles, girdle and axial muscles. In more advanced stages of this disorder the muscles of the shoulder girdle as well as deltoid, biceps and triceps muscles are widely affected. Even at the most progressed stages, the ocular, pharyngeal and respiratory muscles are unaffected. Similarly, the cranial nerves, sensory system and sensation, cognition, and coordination remain functional. HIBM has however been associated with cardiac involvement in a small number of patients with a severely progressed form of HIBM. (Huizing et al., 2009)

Diagnosis of HIBM

Symptoms and the pattern of muscle weakness are the most useful indicators of

HIBM. If the skeletal muscles hamstrings and iliopsoas are severely affected and weakened but the quadriceps are spared in a person between the ages of 20 and 40, it is

3 very likely that he or she is affected with HIBM. Tests to confirm HIBM include a blood test for serum Creatine Kinase (CK or CPK), Nerve Conduction Studies (NCS)

/Electromyography (EMG), muscle biopsy, Magnetic Resonance Imaging (MRI) or

Computer Tomography (CT) scan to determine true sparing of quadriceps, blood test or buccal swab for genetic testing, and molecular diagnosis involving sequencing of the

GNE alleles from the patient with comparison of the sequence with a wild-type GNE gene to search for possible mutations causing HIBM disease.

Molecular Basis of HIBM The mutations that cause Hereditary Inclusion Body Myopathy are all located in the GNE gene, located on the short arm of chromosome 9at position 9p13.3. Other names of GNE and GNE gene products include: bifunctional UDP-N-acetylglucosamine 2- epimerase/N-acetylmannosamine kinase, DMRV, GLCNE, GLCNE_HUMAN, IBM2,

N-acylmannosamine kinase, Uae1, UDP-GlcNAc-2-epimerase/ManAc kinase, and UDP-

N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase.

(http://ghr.nlm.nih.gov/gene/GNE)

Figure 1: Diagram of human chromosome 9, with a GNE gene shown via arrow. Bands are indicated with vertical stripes. Location of GNE gene is at 9p 13.3 4

The GNE gene encodes a dual functional enzyme with both epimerase and kinase activities. This enzyme catalyses the first two steps in the biosynthesis of sialic acid.

Sialic acid is one of several sugars that are often attached to proteins after they are translated, through a process called sialylation, and is the most abundant terminal monosaccharide on glycoconjugates in eukaryotic cells. Sialic acid plays an essential role in cell-cell interactions, signal transduction, and processes such as cell migration, tissue transformation, inflamation and wound healing. (Salma et al., 2005).

Pathogenic mutations in the GNE gene result in decreased sialylation of glycoproteins. One of the proteins affected by the loss of sialylation is alpha dystroglycan which is an important muscle protein. In order for an individual to develop the HIBM phenotype, a mutated GNE allele must be inherited from both parents. These mutated genes are then expressed as the hypofunctional enzyme. HIBM-associated GNE mutations have been shown to reduce sialic acid production and evidence suggests that proper folding, stabilization, and function of skeletal muscle glycoproteins require muscle fiber protein sialylation. (Huizing, Hermos et al. 2002; Vasconcelos, Raju et al. 2002).

Therefore, GNE mutations resulting in hyposialylation of muscle glycoproteins appear to contribute to myofibrillar degeneration and loss of normal muscle function.

GNE is expressed in all tissues of the body. The levels of expression, however, differ in each tissue. Liver cells contain relatively high levels of GNE expression compared to skeletal muscles that express relatively low levels. Previous studies have shown that GNE protein is expressed in skeletal muscle at equal levels in HIBM patients and normal control subjects. In addition, no mislocalization of GNE in skeletal muscle of

HIBM patients was revealed by immunofluorescence detection of GNE. Therefore, most

5 in the field conclude that the key pathologic factor in HIBM is impaired GNE function, not lack of expression (Eisenberg et al., 2008).

More than 40 different mutations in the GNE gene have been reported to cause

HIBM. Each of the mutation analyzed showed a reduction in GNE activity. Different mutations showed different degrees of reduction. (Effertz et al.,1999, Hinderlich et al.,2004). For example, there is a 20% decrease in the enzyme activity in the A631T and

A631V mutations, and there is an 80% reduction in at least one of the two GNE activities

(epimerase and kinase) in case of D378Y and N519S mutations (Penner et.al, 2006).

There is an 80% reduction of both the epimerase and kinase activities of the GNE enzyme in the presence of G576E mutation (Penner et.al, 2006). The GNE enzyme acts in two ways in the biosynthesis of sialic acid. The GNE enzyme first converts a molecule known as UDP-GlcNAc to a similar molecule ManNAc. In the next step, the enzyme transfers a phosphate group to ManNAc to create ManNAc-6-phosphate. Other enzymes then convert ManNAc-6-phosphate to sialic acid. Therefore, the function of the kinase domain is to bind to the sugar and transfer the phosphate group to the sugar. (Kurochkina et al., 2009)

Structure of the GNE enzyme:

GNE is the only human protein that contains a kinase domain belonging to the

ROK (repressor, ORF, kinase) family.

Figure 2: Secondary structure of GNE enzyme. Yellow arrows are the β-sheets and red spirals are α-helices. Figure adapted from the database of secondary structures (DSSP)

The GNE epimerase domain of humans is structurally similar to the bacterial enzyme 2-epimerase and phosphoglucosyl transferases, and there is 27% amino acid sequence similarity between the human and Vibrio cholera genes (Kruchkina et al. 2009).

The GNE protein has two domains α and β, which form a cleft at the interface forming an active site. The dimensions of both the domains are similar to that of the Rossmann fold motif (Rao and Rossmann, 1973). There are 7-stranded parallel β-sheets and 7α-helices in the N-terminal region, with β1–β7 sandwiched between the α-helices. The C-terminal region contains a β-sheet that is 6 stranded, β8 – β13, and surrounded by 7α- helices, α8 –

α15. Interfaces between secondary structure elements of 2-epimerases consist of α–α

(between a pair of α-helices) and α–β (between α-helix and β-sheet) types. The overall

7 similarity between the H. sapiens 2-epimerase and bacterial 2-epimerases is low (18-

27%), but the similarity at the helix-helix interface is much higher (42%) suggesting a conservation of secondary structure elements. (Kruchkina et al., 2009)

Figure 3: A. Structure of the active site of epimerase domain of GNE/MNK enzyme, comparing E. coli GNE epimerase domain with the human GNE epimerase domain. The wire model shows the side chains of the active site residues. B. Primary sequence alignment of the active-site region of the human (GNE/MNK) and E. coli (Mlc) genes. Adapted from Kurochkina et al., 2009

Figure 4: The N-acetylmannosamine kinase (MNK) domain of the human GNE/MNK enzyme. Methionine 712 is at the interface of the α-helices shown in green and β-sheets shown in blue. Proposed glucose binding residues Asn516, Asp517, Glu566 are shown. The two ATP binding motifs characteristic for sugar kinases are in magenta. Adapted from Kurochkina et al., 2009

Sialic acid

Sialic acid is a simple sugar that binds to proteins and lipids to form glycoproteins and glycolipids. These glycoconjugates form cell surface receptors on human and other mammalian cells. The sialic acid-rich oligosaccharides found on glycolipids, glycoproteins and proteoglycans on cell membranes helps to exclude water at the cell surface. GlcNAc contributes to the negative charge to the cell surface, attracting water

9 and causing fluid uptake. Different ranges of sialylation of cell surface molecules is observed to play a role in the tumorigenicity and metastatic behavior of cancerous cells.

Sialic acid is a derivative of neuraminic acid and most commonly is known as N- acetylneuraminic acid (Neu5Ac) (Chefalo et al., 2011). Neu5Ac is the most abundant sugar found on glycoproteins and glycolipids on the surface of eukaryotic cells, and is very important for various functions of the cell such as cell migration, cell adhesion, tissue transformation, wound healing, inflammation and metastasis.

Figure 5: Schematic diagram of the sialic acid biosynthetic pathway. GNE is the rate limiting bifunctional enzyme that catalyzes the first two steps of sialic acid biosynthesis. CMP-sialic acid serves in negative feedback regulator. Adapted from Galeano et al., 2007.

Reduced production of GlcNAc in skeletal muscle due to a dysfunctional GNE gene is the hallmark of HIBM. The role of GlcNAc as a negatively charged cell surface macromolecule may not be easily replaced by other biologically available oligosaccharide moieties. More than 40 different GlcNAc compounds have been identified with various biological functions. GlcNAc can be found as part of cell surface glycoproteins, glycolipids, gangliosides, and polysaccharides. The sialic acid modifications of cell surface glycoproteins are crucial for cell adhesion and signal transduction and may result in muscle fiber degeneration.

Most transmembrane proteins of the skeletal muscles are post-translationally modified by addition of sugar residues. For example, voltage-gated channel proteins are glycosylated to an extent that 40% of the molecular weight of the functional voltage gated channel is comprised of sugars. If sugar residues are missing from the channel protein then the activity of the channel is reduced: Greater depolarization is needed to activate the channel, and the channel is less excitable (it is hypoexcitable) at its resting membrane potential. Sialylation of the voltage-gated sodium channels is very important to maintain effective initiation and propagation of action potentials in nerve and muscle.

When sialic acid levels decreases the channel gating is fixed in a depolarized state. With inhibition of an effective action potential, there is a failure of nerve and muscle activation and a malfunction of muscle cells.

Table 1: Reported patients from different location and origins having mutations in the GNE gene and HIBM phenotype. It is also indicated whether the mutated allele is homozygous or heterozygous in the patient. (HIBM.org)

Family Pts Geographic Location Allele 1 Allele 2 Origin Iranian E12: p.M712T 148 Middle-East, USA, Europe Homozygous Jewish (atg>acg) E10: p.V572L 15 Japan Japanese Homozygous (gtg>ctg) E02: p.V572L 4 Korea Korean Homozygous (gtg>ctg) Mid East E12: p.M712T 5 Middle East Homozygous Muslim (atg>acg) E04: p.D225N 4 Bahamas Bahaman E04: p.R246Q (cgg>cag) (gac>aac) Iranian E12: p.M712T 3 CA, USA Non- Homozygous (atg>acg) Jewish Asian E05: p.C303X 2 India E12: p.V696M (gtg>atg) Indian (tgt>tga) E03: p.M171V 2 Italy Italian E12: p.M712T (atg>acg) (atg>gtg) Am-South E09: p.A524V 2 TX, USA E12: p.Y675H (tat>cat) American (gcg>gtg) E03: p.R162C 2 Italy Italian E03-E09 deletion (cgc>tgc) E10: p.G576E 2 GA, USA American E11: p.A631T (gcg>acg) (ggg>gag) E10: p.I587T 2 USA American Homozygous (att>act) E11: p.A631V 2 Germany German E09: p.F528C (ttt>tgt) (gcg>gtg) E02: p.P36L 2 Italy Italian E10: p.I557T (atc>acc) (cct>ctt) E07: p.D378Y 2 Ireland Irish E11: p.A631V (gcg>gtg) (gat>tat) E08: p.A460V 2 Japan Japanese E10: p.V572L (gtg>ctg) (gct>gtt)

E03: p.D176V 1 Japan Japanese E10: p.V572L (gtg>ctg) (gat>gtt) E04: p.V216A 2 USA American E11: p.A631V (gcg>gtg) (gtt>gct) Asian E05: p.C303X 2 USA E11: p.A631T (gcg>acg) Indian (tgt>tga) E09: p.I472T 2 Japan Japanese E10: p.V572L (gtg>ctg) (att>act) American E03: p.G135V 1 CA, USA E04: p.R246W (cgg>tgg) European (ggt>gtt) E03: p.I200F 1 USA American E07: p.D378Y (gat>tat) (atc>ttc) E03: p.D176V 1 Japan Japanese Homozygous (gat>gtt) I04: IVS4+4 1 Japan Japanese E10: p.V572L (gtg>ctg) (Skip E04) E03: p.D176V 1 Japan Japanese E06: p.V331A (gtt>gct) (gat>gtt) E03: p.D176V 1 Japan Japanese E03: p.H132Q (cacgtt) E03: p.D176V 1 Japan Japanese E11: p.A630T (gctgtt) E03: p.D176V 1 Japan Japanese E09: p.I472T (att>act) (gat>gtt) E03: p.D176V 1 Japan Japanese E05: p.R306Q (cga>caa) (gat>gtt) E02: 10c.- 1 Japan Japanese E10: p.V572L (gtg>ctg) ins>frameshift E03: p.R177C 1 Japan Japanese E10: p.V572L (gtg>ctg) (cgc>tgc) E11: p.A631V 1 Japan Japanese Homozygous (gcg>gtg) E10: p.V572L 1 Japan Japanese E05: p.C303V (tgt>gtt) (gtg>ctg) Iran- E07: p.V367I 1 Germany Homozygous NonJew (gtt>att) Asian E02: p.R11W 1 Asia Homozygous Indian (cgg>tgg) 2 Italy Italian E09: p.N519S Homozygous

(aac>agc) E02: p.P27S 1 Italy Italian Homozygous (cct>tct) E10: p.A600T E03: p.G206fsX4 2 Italy Italian (gca>aca) (ggt>delG, V209X) I06: Alternative Splicing E04: p.R246Q 1 Italy Italian Q355_C357del/G352fsX15 (cgg>cag) (c.1070+2dupT, insertion) E03: p.G206S E07: p.I377fsX16 1 Italy Italian (ggt>agt) (1130delT] E12: p.M712T 5 Tunisia Tunisia Homozygous (atg>acg) E07: p.L379H 4 Tunisia Tunisia Homozygous (ctt>cat) E04: p.I241S 2 Taiwan Chinese E09: p.W513X (tgg>tga) (atc>agc) E10: p.V572L 9 Japan Japanese Homozygous (gtg>ctg) E10: p.I557T 1 Japan Japanese E10: p.V572L (gtg>ctg) (atc>acc) E11: p.A631V 1 Japan Japanese E12: p.M712T (atg>acg) (gcg>gtg) E07: p.V421A 1 Japan Japanese E10: p.V572L (gtg>ctg) (gtt>gct) E11: p.A631V 1 Japan Japanese Homozygous (gcg>gtg) E02: p.C13S 1 Japan Japanese E10: p.V572L (gtg>ctg) (tgt>tct) E02: p.C13S 1 Korea Korean E10: p.V572L (gtg>ctg) (tgt>tct) E02: p.C13S 1 Korea Korean E02: p.M29T (atg>acg) (tgt>tct) E03: p.D176V 1 Japan Japanese E10: p.V572L (gtg>ctg) (gat>gtt) E03: p.D176V 1 Japan Japanese P.P283S (cca>tca) (gat>gtt) E03: p.R129Q 1 Japan Japanese E03: p.D176V (gat>gtt) (cga>caa) 1 Japan Japanese E07: p.V421A E12: G708S (ggt>agt)

(gtt>gct) E07: p.R420X 1 Japan Japanese E10: p.V572L (gtg>ctg) (cga>tga) E02: p.C13S 1 Japan Japanese E03: p.D176V (gat>gtt) (tgt>tct) E10: p.V572L 1 Korea Korean E10: A591T (gcc>acc) (gtg>ctg) E03: p.R129Q 1 Korea Korean E10: p.V572L (gtg>ctg) (cga>caa) E06: p.L347del, 1 USA ?Italy E06: p.R335W (cgg>tgg) p.H348N (ctgcac>aac) E10: p.V572L 1 Asia Asian homozygous (gtg>ctg) E04: p.I241S 2 Taiwan Taiwanese E04: p.R246Q (cgg>cag) (atc>agc) E03: p.G89R 1 Thailand Thai E12: p.V696M (gtg>atg) (ggc>cgc) E09: p.A524V 1 Thailand Thai E12: p.V696M (gtg>atg) (gcg>gtg) E09: p.P511L 1 Thailand Thai E12: p.V696M (gtg>atg) (cct>ctt) E11: p.I656N 1 Thailand Thai E12: p.V696M (gtg>atg) (atc>aac) E03: p.D176V 1 Asia Asian E09: p.P511H (cct>cat) (gat>gtt) 2 France E05: p.R277C 1 France (cgt>tgt) E12: p.V679G 1 France (gtc>ggc) New patients, previously 19 Various reported mutations Am/Eur E02: p.R8X 1 USA E11: p.A631V (gcg>gtg) Caucasian (cga>tga) 1 USA Am/Eur E03: p.R71W Homozygous

Caucasian (agg>tgg) Am/Eur E03: p.I142T 1 USA E04: p.R246Q (cgg>cag) Caucasian (att>act) Am/Eur E03: p.W204X 1 USA E11: p.A631V (gcg>gtg) Caucasian (tgg>tga) Asian E05: p.I298T 1 USA/India E12: p.V696M (gtg>atg) Indian (att>act) E08: p.Q436X 1 USA/Taiwan Taiwanese E04: p.R246Q (cgg>cag) (cag>tag) Am/Eur E10: p.L556S 1 USA E06: p.R335W (cgg>tgg) Caucasian (ttg>tcg) Am/Eur E11: p.S615X 1 USA E12: p.Y675H (tat>cat) Caucasian (tca>tga) Am/Eur E02: p.E2G 1 USA Homozygous Caucasian (gag>ggg) E08: 2 Netherland Caucasian p.K432RfsX17 E12: p.V696M (gtg>atg) (aag>ag) Egyptian E12: p.M712T 1 Italy Homozygous Muslim (atg>acg) E03: p.L179F 1 Italy Italian E10: p.I587T (att>act) (ctt>ttt) E04: p.R246W 2 Germany Italian E05: p.A310P (gct>cct) (cgg>tgg)

Table 2: HIBM caused by different mutations in the exons of the GNE gene, number of patients reported with that mutation and origin of the patient. (HIBM.org)

No of Exon Probable Allele GNE Mutation Patien Phenotype Intron Origin t E02 p.E2G (gag>ggg) 1 Am/Eur IBM2/DMRV E02 p.R8X (cga>tga) 1 Am/Eur IBM2/DMRV E02 p.R11W (cgg>tgg) 1 India IBM2/DMRV E02 Exon-02(10b insert), frame-shift 1 Japan IBM2/DMRV E02 C13S (tgt>tct) 4 Japan IBM2/DMRV E02 p.P27S (cct>tct) 1 Italy IBM2/DMRV E02 p.M29T (atg>acg) 1 Korea IBM2/DMRV E02 p.P36L (cct>ctt) 1 Italy IBM2/DMRV E02 p.R71W (agg>tgg) 1 Am/Eur IBM2/DMRV E03 p.G89R (ggc>cgc) 1 Thailand IBM2/DMRV E03 p.R129Q (cga>caa) 2 Japan, Korea IBM2/DMRV E03 p.H132Q (cac>cag) 1 Japan IBM2/DMRV E03 p.G135V (ggt>gtt) 1 Europe IBM2/DMRV E03 p.I142T (att>act) 1 Am/Eur IBM2/DMRV E03 p.R162C (cgc>tgc) 2 Italy IBM2/DMRV E03 p.M171V (atg>gtg) 1 Italy IBM2/DMRV E03 p.D176V (gat>gtt) 12 Japan IBM2/DMRV E03 p.R177C (cgc>tgc) 1 Japan IBM2/DMRV E03 p.L179F (ctt>ttt) 1 Italy IBM2/DMRV E03 p.I200F (atc>ttc) 1 America IBM2/DMRV E03 p.W204X(tgg>tga) 1 Am/Eur IBM2/DMRV E04 p.G206S (ggt>agt) 1 Italy IBM2/DMRV E04 p.G206fsX4 (ggt>gt, V209X) 2 Italy IBM2/DMRV E04 p.V216A (gtt>gct) 2 America IBM2/DMRV E04 p.D225N (gac>aac) 4 Bahamas IBM2/DMRV E04 p.I241S (atc>agc) 4 Chinese, Taiwan IBM2/DMRV E04 p.R246W (cgg>tgg) 3 America IBM2/DMRV Bahamas, E04 p.R246Q (cgg>cag) 7 IBM2/DMRV Taiwan

I04 IVS4+4 (Skips E04) 1 Japan IBM2/DMRV E05 p.R277C (cgt>tgt) 1 France IBM2/DMRV E05 p.P283S (cca>tca) 1 Japan IBM2/DMRV E05 p.I298T(att>act) 1 India IBM2/DMRV E05 p.C303Xstop (tgt>tga) 4 India IBM2/DMRV E05 p.C303V (tgt>gtt) 1 Japan IBM2/DMRV E05 p.R306Q (cga>caa) 1 Japan IBM2/DMRV E05 p.A310P (gct>cct) 2 Italian IBM2/DMRV E05 p.V315M (gtg>atg) 1 America IBM2/DMRV E06 p.V331A (gtt>gct) 1 Japan IBM2/DMRV E06 p.R335W (cgg>tgg) 1 USA IBM2/DMRV p.L347del, p.H348N E06 1 USA IBM2/DMRV (ctgcac>aac) E06 p.R335W(cgg>tgg) 1 Am/Eur IBM2/DMRV Alternative Splicing I06 Q355_C357del/G352fsX15 1 Italy IBM2/DMRV (c.1070+2dupT, insertion) E07 p.V367I (gtt>att) 1 Iran IBM2/DMRV E07 p.L319H (ctt>cat) 4 Tunisia IBM2/DMRV E07 p.I377fsX16 (1130delT] 1 Italy IBM2/DMRV E07 p.D378Y (gat>tat) 4 Japan IBM2/DMRV E07 p.R420X (cga>tga) 1 Japan IBM2/DMRV E07 p.V421A (gtt>gct) 2 Japan IBM2/DMRV E08 p.Q436X(cag>tag) 1 Taiwan IBM2/DMRV E08 p.K432RfsX17(aag>ag) 1 Netherland/Euro IBM2/DMRV E08 p.A460V (gct>gtt) 2 Japan IBM2/DMRV E09 p.I472T (att>act) 3 Japan IBM2/DMRV E09 p.P511H (cct>cat) 1 Asia IBM2/DMRV E09 p.P511L (cct>ctt) 1 Thailand IBM2/DMRV E09 p.W513X (tgg>tga) 2 Chinese IBM2/DMRV E09 p.N519S (aag>agc) 2 Italy IBM2/DMRV E09 p.A524V (gcg>gtg) 1,1 South Am IBM2/DMRV E09 p.F528C (ttt>tgt) 2 Germany IBM2/DMRV E10 p.L556S(ttg>tcg) 1 Am/Eur IBM2/DMRV

E10 p.I557T (atc>acc) 3 Italy IBM2/DMRV E10 p.V572L (gtg>ctg) 43 Japan, Korea IBM2/DMRV E10 p.G576E (ggg>gag) 2 America IBM2/DMRV E10 p.I587T (att>act) 2 Italy IBM2/DMRV E10 p.A591T (gcc>acc) 1 Korea IBM2/DMRV E10 p.A600T (gca>aca) 2 Italy IBM2/DMRV E11 p.A630T (gct>act) 1 Japan IBM2/DMRV E11 p.S615X (tca>tga) 1 Am/Eur IBM2/DMRV E11 p.A631T (gcg>acg) 4 Asia IBM2/DMRV E11 p.A631V (gcg>gtg) 10 Japan IBM2/DMRV E11 p.I656N (atc>aac) 1 Thailand IBM2/DMRV E12 p.Y675H (tat>cat) 3 South Am- IBM2/DMRV E12 p.V679G (gtc>ggc) 1 French IBM2/DMRV India,Thai,Am,E E12 p.V696M (gtg>atg) 7 IBM2/DMRV ur E12 p.G708S (ggt>agt) 1 Japan IBM2/DMRV E12 p.M712T (atg>acg) 160 Middle East IBM2/DMRV OTHE E3-E9 deletion 2 Italy IBM2/DMRV R

Sialuria

Sialuria is a rare inborn metabolic genetic disorder. It is primarily characterized by the accumulation of sialic acid in the cytoplasm and increased excretion of free NeuAc in the urine. Increased expression of NeuAc is a result of the loss of feedback inhibition of UDP-GlcNAc 2-epimerase by cytidine monophosphate- N-acetylneuraminic acid

(CMP-Neu5Ac). (Seppala et al., 1999) Human cDNA that expresses the epimerase was cloned and sequenced to determine the mutations in 3 sialuria patients in order to fully understand the molecular mechanism for regulation of defective allosteric UDP-GlcNAc

2-epimerase in Sialuria. Mutations responsible for Sialuria include: R266Q, R266W, and

R263L. (Seppala et al., 1999)

These three heterozygous mutations have indicated that codons present in the region 263 to 266 contain the allosteric site of the epimerase enzyme. The mutants were heterozygous in all 3 patients, meaning the mutated allele yields a dominant phenotype; unlike mutations leading to HIBM, heterozygosity for a mutation in the allosteric site is enough to cause the disorder sialuria. CMP-Neu5Ac is responsible for regulating the production of sialic acid, by inhibiting UDP-GlcNAc 2-epimerase when enough of it has been synthesized. However, it does not have the same inhibitory effects on the mutated

UDP-GlcNAc 2-epimerase, and the intracellular free sialic acid levels increase due to lack of UDP-GlcNAc 2-epimerase inhibition. (Leroy et al., 2001)

GNE Mutations Examined in this Study

Six mutations of the GNE gene have been examined in this study. These mutations include:

 D176V, a mutation in Exon 3 that has been observed in HIBM patients of

Japanese descent.

 R263L, a mutation in the epimerase domain of the gene, which causes Sialuria.

 M265T, a mutation in the epimerase domain of the gene, which causes HIBM in

patients of Middle Eastern descent.

 R266Q, a mutation in the epimerase domain of the gene, which causes Sialuria.

 V572L, a mutation in exon 10 that has been observed in patients of Japanese

descent.

 M712T, a mutation in exon 12 that has been observed in patients of

Iranian/Jewish descent.

Purpose of the Study

To perform preliminary experiments that form the basis for developing gene therapy treatments for HIBM patients

Hypothesis

The GNE gene expression can be obtained under the control of a robust CMV promoter in the pUMVC3 expression vector (Aldeveron, Fargo, ND) following transfection of a specialized Chinese Hamster Ovary Cell lines (Lec3) that lacks its native

GNE activity. It is my hypothesis that phenotypes in cell culture will reproduce those seen in human populations: That the wild-type GNE will complement the loss of function of a mutated GNE gene in paired transfections.

Chapter 2: Materials and Methods

Materials:

Human GNE cDNA inserts for wild-type and R266Q mutant alleles were derived from clinical mRNAs and were provided by HIBM Research Group. CHO cells were obtained from Albert Einstein College of Medicine. The vector, pUMVC3 was purchased from Aldevron (Fargo, ND). N-acetylneuraminic acid was obtained from New Zealand

Pharmaceuticals (NZP) (Palmerston North, New Zealand). Sodium periodate, phosphoric acid, sodium meta-arsenite, 2-thiobarbituric acid, sulfuric acid, and cyclohexanone were obtained from Sigma-Aldrich (Saint Louis, MO). The optical density readings for nucleic acid or sialic acid were performed by spectrophotometry using the NanoDrop ND-1000

(Wilmington, DE). DNA sequencing of plasmid clones was performed by Retrogen Inc.

(San Diego, CA).

Sample: GNE/Topoblunt II plasmid:

The GNE gene was isolated from blood cells. For isolation of the gene, first the

RNA was isolated from the patient blood cells using a Total RNA purification kit

(Norgen Biotek corporation www.norgenbiotek.com) This RNA was then reverse transcribed to produce complementary DNA (cDNA) using SuperScriptTM First-Strand synthesis system for RT-PCR (Invitrogen life technologies). cDNA was used as a template for the amplification of GNE gene using GNE specific primers. The forward and reverse primers had EcoRI and BamHI restriction sites respectively which were used for

22 digesting the insert and ligating it with the TopoBluntII vector digested with EcoRI and

BamHI (Promega Corporation)

Site Directed Mutagenesis

Site Directed Mutagenesis was performed in two separate steps to create each construct. First, two fragments were amplified by (PCR), using the wild type GNE gene, internal primers specific for each GNE variant, and common external primers containing

BamHI and EcoRI sites. The primer pairs used for each construct are shown in tables bellow.

GNE Fragment Primer Sequence Construct

ATGCGAACATGGTCCTCACACAT GNE_D176V_R 5´ End GG

GNE hGNE- GCGAATTCATGGAGAAGAATGGA

D176V Nterm(EcoR1) AAT

GGACCATGTTCGCATCCTTTTGGC GNE_D176V_F 3´ End AGG

hGNE- TGGATCCTAGTAGATCCTGCGTGT

Cterm(BamH1) TGTG

Table 3: Names and sequences of the primers used for amplification of each segment of GNE D176V

GNE Fragment Primer Sequence Construct

GNE_R263L_R CATCACTAGAACCATCTCTTTGCTC

5´ End CCTG

GNE hGNE- GCGAATTCATGGAGAAGAATGGA

R263L Nterm(EcoR1) AAT

GNE_R263L_F ATGGTTCTAGTGATGCGGAAGAAG

3´ End GGCA

hGNE- TGGATCCTAGTAGATCCTGCGTGT

Cterm(BamH1) TGTG

Table 4: Names and sequences of the primers used for amplification of each segment of GNE R263L

GNE Fragment Primer Sequence Construct

GNE_M265T_R CTTCCGCGTCACTCGAACCATCTCT

5´ End TTG

GNE hGNE- GCGAATTCATGGAGAAGAATGGA

M265T Nterm(EcoR1) AAT

GNE_M265T_F CGAGTGACGCGGAAGAAGGGCAT

3´ End TGAG

hGNE- TGGATCCTAGTAGATCCTGCGTGT

Cterm(BamH1) TGTG

Table 5: Names and sequences of the primers used for amplification of each segment of GNE M265T

GNE Fragment Primer Sequence Construct

GNE_V572L_R AGAGACAGAACAAGGTGGCCCAG

5´ End TTC

GNE hGNE- GCGAATTCATGGAGAAGAATGGA

V572L Nterm(EcoR1) AAT

GNE_V572L_F CCTTGTTCTGTCTCTGGATGGGCCT

3´ End hGNE- TGGATCCTAGTAGATCCTGCGTGT

Cterm(BamH1) TGTG

Table 6: Names and sequences of the primers used for amplification of each segment of GNE V572L

PCR was performed to amplify GNE fragments containing the mutations

described above. The reagents used to carry out the PCR are listed in table 7.

Reagents Volume (µl)

3D H20 32

10x Pfu Buffer (Stratagene) 4

primer 1 (10µM) 1

primer 2 (10µM) 1

Pfu Turbo® DNA Polymerase 1

(Stratagene)

Template DNA (100 pg) 1

Total 40µl

Table 7: PCR reaction mix for GNE gene amplification

PCR cycles:

Steps Temperature 0C Time Cycles

Initial Denaturation 97 ºC 5 min 1

Denaturation 97 ºC 30 sec

Annealing 55 ºC 30 sec 25

Extension 74 ºC 2 min

Final Extension 74 ºC 7 min 1

Table 8: PCR conditions, temperature and time for each step

The two fragments amplified for each GNE construct in the first step of mutagenesis were then brought together using both fragments as template in a third PCR, with the common external primers containing BamHI and EcoRI sites. The primer pair

(Table 9) used for amplification was designed in such a way that forward primer has

EcoRI restriction site and the reverse primer has BamHI site.

Primer Sequence Forward N-Term EcoRI GCGAATTCATGGAGAAGAATGGAAAT Reverse C-Term BamHI TGGATCCTAGTAGATCCTGCGTGTTGTG Table 9: Names and sequences of the primers used for GNE gene amplification

The oligonucleotide primers (XX IDT, Integrated DNA Technologies) were dissolved in nano pure H2O to the desired concentration of 10µM in a working stock.

Generation of the Mutated Gene

PCR of the GNE gene was performed using 23µl of triple distilled H2O, 4 μl of

10x Pfu Buffer (Stratagene), 1µl of each 10µM forward primer and reverse primer, 1µl (2

26 units) of Pfu Turbo® DNA Polymerase (Stratagene), and 10µl of template DNA (5µl of each fragment PCR product). This made a total reaction volume of 40µl. (Table 10). The samples were subjected to 25 cycles of PCR (Table 11).

Reagents Volume (µl)

3D H20 23

10x Pfu polymerase buffer 4

Forward primer N-term EcoRI 1

10µM

Reverse primer C-term BamHI 1

10µM

Pfu DNA polymerase (2 u) 1

Template DNA (100ng) 10

Total 40µl

Table 10: PCR reaction mix for GNE gene amplification

PCR was carried out in 5 tubes each with 40µl such that a total of 200µl of PCR product was run on a polyacrylamide gel after amplification. A “no DNA” negative control was included, as well as a positive control with wtGNE/pUMVC3 as a template.

Number of cycles of the middle 3 steps

Steps Temperature 0C Time Cycles

Initial Denaturation 97 ºC 5 min 1

Denaturation 97 ºC 30 sec

Annealing 50 ºC 2 min 5

Extension 74 ºC 2 min

Denaturation 97 ºC 30 sec

Annealing 55 ºC 30 sec 20

Extension 74 ºC 2 min

Table 11: PCR conditions, temperature and time for each step

Agarose Gel Electrophoresis Agarose gel electrophoresis was carried out in a 1% agarose gel at 100 V and run time of 60 minutes in 40 mM Tris-acetate (pH 8.2), 2 mM EDTA. The gel was observed under UV transilluminator and the desired band size of 2169bp was observed.

Gel Extraction

The extraction and purification of DNA from the Gel was carried out using the

IsoPure™ DNA purification Kit (Denville Scientific Inc.). The DNA fragment was excised from the gel using a razor blade. It was weighed (to estimate its volume) and transferred to a 15 ml falcon tube. 4 volumes of Binding Solution II was added to each volume of the gel (e.g for 100mg of gel slice 400µl of Binding Solution was added). The tube with gel slice and the added Binding Solution was incubated at 600C for 10 minutes to dissolve the gel completely. The melted agarose solution was transferred to the IsoPure column in a collection tube and incubated at room temperature for 2 minutes. The column was then centrifuged at 8,000 x g for 1 minute. The flow-through was discarded and

500µl of Wash Solution (provided by the kit) was added to the column and again

28 centrifuged at 16,000 x g for 1 minute. The wash step was repeated and the column was centrifuged for an additional minute to ensure the complete removal of wash solution.

50µl of water was directly added to the column matrix, the column was placed into a 1.5 ml collection tube and centrifuged for 1 minute at 16,000 x g to elute DNA. The eluted

DNA was stored at -20ºC.

Digestion of GNE DNA fragment after PCR

The fragment purified from the gel was then digested with EcoRI and BamHI.

The DNA used in digestion was the mutated GNE, amplified with N term EcoRI and C term BamHI oligonucleotides. The digestion was carried out at 370C for 3 hours, and consisted of 18µl of 3D H2O, 3µl of 10x NEB buffer 3 in which both EcoRI and BamHI enzymes have their optimum activities, 3 µl of 10 mg/ml acetylated BSA, 4µl of

Template DNA (1000ng) and 1µl (10-20 units) of the BamH1 and EcoRI enzymes

(Promega Corporation).

Reagents Volume(ul)

3d H2O 18

10x NEB buffer 3 3

10mg/ml acetylated BSA 3

Template DNA (223ng/ul) 4

BamHI 1

EcoRI 1

Total Volume 30

Table 12: Restriction enzyme digestion reaction mix

Digestion of Vector

The vector used for cloning was pUMVC3, purchased from Aldevron (Fargo,

ND), which is a mammalian expression plasmid. It has a robust CMV promoter, polylinker, rabbit beta-globin polyadenylation signal sequence, and kanamycin resistancegene used for selection. The vector was digested in its polylinker with EcoRI and BamHI restriction enzymes to prepare it for insertion of the mutated GNE gene fragments.

Figure 6: pUMVC3 expression plasmid. The insert of wild-type, and mutated variant were ligated at the EcoRI and BamHI sites in the polylinker region. The GNE genes were expressed under the control of the CMV promoter. Kanamycin resistance allowed for selection

Ligation

Ligation of Mutated GNE gene and pUMVC3 vector was carried out using the

Quick Ligation Kit (New England BioLabs Inc., Beverly, MA). 2µl of pUMVC3 (27 fmoles) was combined with 7µl of mutated GNE gene (81 fmoles) and the volume was brought up to 10µl with 3dH2O. 10µl of 2x Quick Ligase Reaction Buffer and 1µl of

Quick Ligase Enzyme were added and mixed thoroughly by pipetting up and down. The mixture was incubated at room temperature for 5 minutes, chilled on ice for 10 minutes and then stored at -20ºC to be used later for transformation.

Reagents Volume (ul)

3d H2O 1

Ligase buffer (2x, provided in kit) 10

Digested vector pUMVC3 (36ng/ul, 13.5fmoles/ul) 2 (27 fmoles)

Digested insert M712T GNE (16ng/ul, 11.18fmoles/ul) 7 (81 fmoles)

T4 DNA Ligase 1 (1U/µl)

Total 20

Table 13: Ligation reaction mix for ligation of GNE genes with pUMVC3 expression vector.

Transformation

Transformation of ligated DNA into E.coli cells was carried out for each GNE variant. The vial containing the ligation reaction was centrifuged and placed on ice. One

50µl vial of Turbo F’ competent cells (Thermo-Fisher, Inc.) was thawed on ice for each transformation. 1-5µl of each ligation reaction was added to the vial of competent cells

31 and mixed. The vial was incubated on ice for 30 minutes. The cells were given heat shock at 420C water bath for 30 seconds and then immediately transferred back on ice. 250µl of pre-warmed S.O.C. medium (Thermo Fisher) was added to each vial and then the vial agitated at 370C for 1 hour at 225 rpm in a shaking incubator. 25µl, 50µl, and 100µl of culture was spread in Luria-Bertani agar plates with 50µg/ml kanamycin. The plates were inverted and incubated at 370C overnight. Colonies were selected and analyzed by PCR and plasmid DNA isolation.

Clone confirmation

Positive candidates were initially identified by agarose gel electrophoresis of supercoiled DNA plasmids, with large colonies lysed in a sample buffer containing 0.2 M

NaOH and 1% SDS. The plasmids with large DNA insertions were identified and studied further by DNA sequencing (described below), using 500 ng of plasmid isolated from a 2 ml overnight culture. The cells were collected by centrifugation (3,000 x g, 10 min) and resuspended in 50 µl of dH2O, 50 µl of 0.2 M NaOH, 1% SDS, and then 50 µl of 4.7 M

KOAc pH 4.8. The lysate was separated by centrifugation (20,000 x g, 10 min) and the supernatant was retained and precipitated with 0.8 volumes isopropanol. The nucleic acids in the isopropanol solution were then collected by centrifugation (20,000 x g, 10 min) and purified by the IsoPure™ DNA purification Kit (Denville Scientific Inc.) as described previously.

Sequencing of GNE gene

DNA sequencing was performed initially by the CSUN DNA sequencing facility and later by Retrogen Inc., using primers provided by HIBM Research Group.

Forward primers Reverse Primers

hGNE-F1 hGNE-R1

pUMVC-F1 pUMVC-R1

Jay_GNE-F1 Jay_GNE-R1

Jay_GNE-F2 Jay_GNE-R2

Table 14: Primers used for sequencing

Plasmid DNA Isolation

Plasmid DNA was isolated from each confirmed clone. The clone was grown in

500ml Luria Bertani medium with kanamycin (25µg/ml). The plasmid DNA of each construct was isolated using the UltraClean™ Endotoxin Free Maxi Plasmid Prep Kit

(Mo Bio Laboratories). The cells were pelleted by centrifugation at 2500 x g for 20 minutes. The cell pellet was resuspended in 2.5ml of Solution EF1 and homogenized by pipetting up and down several times. 5ml of Solution EF 2 was added and the mixture was inverted twice. 7.5ml of Solution EF3 was added and the mixture was inverted 4 times to mix. The mixture was centrifuged at 2500 x g for 20 minutes and the liquid lysate on top was collected into a new tube. 1.5ml of EF4 (Endotoxin Removal Solution) was added to the lysate and vortexed at top speed. It was then incubated to -20ºC for 7 minutes followed by heating at 65ºC for 12 minutes, then centrifuged at 2500 x g for 15 minutes. The top aqueous phase was collected and transferred to a new tube. This step

33 was repeated and the top aqueous phase was collected. 15ml of Solution EF5 was added to the lysate and vortexed. The lysate was added to a Spin Filter and centrifuged at 2500 x g for 1 minute and the flow-through was discarded. 20ml of Wash Solution EF6 was added to the filter and centrifuged for 10 minutes. The flow-through was discarded and the centrifugation was repeated for 5 minutes to ensure complete removal of wash solution. Filter cup was placed into a new tube, and 3ml of Elution Solution EF7 was added to the filter and centrifuged at 2500 x g for 5 minutes. Endotoxin free DNA was collected and stored at -20ºC.

The recombinant plasmids were isolated from different clones. Eight types of plasmids were isolated. Empty vector (pUMVC3), and seven recombinant constructs:

GNE wild-type pUMVC3 vector, GNE D176V pUMVC3 vector, GNE R263L pUMVC3 vector, GNE M265T pUMVC3 vector, GNE V572L pUMVC3 vector, GNE M712T pUMVC3 vector, and GNE R266Q pUMVC3 vector, were isolated in large quantities.

Cell Culture

Lec3 CHO cells obtained from Dr. Pamela Stanley (Albert Einstein College of

Medicine) were initially grown in -MEM media (Invitrogen), containing 10% fetal bovine serum (FBS) (Invitrogen). The cells received subsequent passages of -MEM

FBS medium by 2.5% decrements until 2.5% FBS was achieved. At each passage, the cells were checked under the microscope for confluency. The spent medium was aspirated and replaced with 10ml of PBS solution for 2-3 minutes to wash the cells. The

PBS was then aspirated and replaced with 3ml of 0.05% Trypsin-EDTA and placed in the

37C in 5% CO2 incubator to dislodge the cells from the bottom of the flask. 7ml of PBS

34 was then added to the trypsinized cells to deactivate the trypsin. The cells were then transferred to a conical tube and centrifuged at 2,000 rpm for 4 minutes. The cell pellets were resuspended in 1ml of -MEM media with the appropriate percentage of added

FBS. The appropriate number of cells was added to a new flask with 35ml total volume.

CHO Cells Transfection:

Nine sets of transfections were prepared in triplicate using 2.0x106 CHO cells,

2.5mL of Freestyle Media (Invitrogen), 500µl of Opti-MEM (Invitrogen), 10µl of

Lipofectamine (Invitrogen) and 4µg of DNA (except for the no vector control) and incubated at 37C in 5% CO2. Sets prepared included GNE wild-type pUMVC3 vector,

GNE D176V pUMVC3 vector, GNE R263L pUMVC3 vector, GNE M265T pUMVC3 vector, GNE V572L pUMVC3 vector, GNE M712T pUMVC3 vector, GNE R266Q pUMVC3 vector, empty pUMVC3 vector, and no vector (media alone). Cells were collected 48 hours post-transfection, washed with PBS, and resuspended in Freestyle

Media. In order to carry out 5 different assays, the cells collected from each well were split into 5 equal parts.

Cell Viability Assay

The Cell Viability assay was performed using the CCK-8 Cell Counting Kit

(Dojindo Molecular Technologies). 3000 cells from each well were counted and transferred to a 1.5ml centrifuge tube and the volume was adjusted to 100µl using Free

Style media. 10µl of CCK-8 solution was added to each tube and the tubes were

35 incubated at 37C in 5% CO2 for 2 hours. The optical density of each sample was measured at 450 nm.

DNA Extraction Assay

DNA was extracted from the CHO cells by adding 500µl of lysis buffer to the cells along with 5µl of proteinase K and the mixture was placed in 58ºC overnight. 500µl of isopropanol was added to the mixture, vortexed briefly and centrifuged at 13,000rpm for 10 minutes. Isopropanol was decanted and replaced with 500µl of 70% ethanol. The tube was vortexed briefly and centrifuged at 13,000rpm for 10 minutes. The ethanol was decanted and the pellet was allowed to air dry for 7 minutes. The pellet was then resespended in 50µl of 3d H2O and stored in -20ºC.

PCR for CMV Promoter Detection

Real Time PCR was performed on the extracted DNA from the CHO cells using

CMV specific primers (provided by HIBM Reasearch Group), in order to check for the presence of CMV promoter in the cells and therefore ensure the success of transfection.

The reagents used to perform the PCR (shown in table 15) are from LighyCycler DNA

Master HYBProbe, (Roche, catalog # 12158825001) and the PCR cycles and temperatures are shown in table 16.

Reagents Volume(ul)

3d H2O 7.5

MgCl2 (25mM) 2

Probe (10µM) 0.5

F:R Primer Mix (10µM) 2

Fast Start Taq Polymerase 1

DNA Template (5ng/µl) 2

Total Volume 15

Table 15: PCR reagent mix for CMV promoter presence

Steps Temperature 0C Time Cycles

Denaturation 95 ºC 10 min 1

95 ºC 15 sec Amplification 28 60 ºC 1 min

Cooling 45 ºC 1 min 1

Table 16: PCR conditions for CMV promoter presence

RNA Extraction Assay

The RNA Extraction assay was performed using the Quick-RNA™ MiniPrep Kit

(Zymo Research Corp). The suspension was gently centrifuged for 5 minutes at 500 x g, and the supernatant was discarded. Each pellet was resuspended in 600µl of ZR RNA

Buffer and briefly vortexed. The lysate was transferred to a Zymo-Spin IIIC Column and centrifuged at 12,000 x g for 1 minute. 400µl of RNA Pre-Wash Buffer was added to the column and centrifuged at 12,000 x g for 1 minute. 700µl of RNA Wash Buffer was added to the column and centrifuged at 12,000 x g for 30 seconds. This step was repeated with 400µl of Wash Buffer. The columns were centrifuged for an additional 2 minutes at

12,000 x g to ensure complete removal of wash buffer. RNA was then eluted from each column by adding 35µl of DNase/RNase-Free Water (provided) and incubating at room temperature for 1 minute, then centrifuging at top speed for 30 seconds. RNA was stored at -80ºC to be used for Reverse Transcription Assay.

Reverse Transcription PCR

Real time reverse transcription was performed with the RNA extracted from the

CHO cells after transfection in order to confirm the transcription of the human GNE gene in the CHO cells. The reagents used to perform the reverse transcription were obtained from Taqman MicroRNA Reverse Transcription Kit (Applied BioSystems). The used for

PCR amplification were from LightCycler DNA Master HYBProbe Kit (Roche,

12158825001). The primers and probe used in this assay are from Taqman Gene

Expression Assays Kit (Applied BioSystems, p111027). The PCR conditions are shown in table 18.

Reagents Volume(ul)

3d H2O 2.16

MgCl2 (25mM) 2

Probe (5µM) 1

F:R Primer Mix (10µM) 1

Fast Start Taq Polymerase 2

RNA Template 10

RT Buffer (10x) 1.5

dNTP mix 0.15

RNase inhibitor 0.19

Multiscribe RT Enzyme 1

Total 21

Table 17: RT PCR reagent mix

Steps Temperature 0C Time Cycles

RT Annealing 28ºC 30 min 1

Reverse Transcription 42ºC 30 min 1

Denaturation 95ºC 10 min 1

95ºC 15 sec Amplification 20 60ºC 60 sec

Cooling 45ºC 1 min 1

Table 18: RT PCR conditions, temperatures, times, and cycles

Protein Extraction Assay

The Protein extraction Assay was carried out using the Mem-PER® Eukaryotic

Membrane Protein Extraction Reagent Kit (Thermo Scientific). The cell suspension samples were centrifuged at 850 x g for 2 minutes and supernatant was discarded. 150µl of reagent A was added to each cell pellet and the homogenous suspension was incubated at room temperature for 10 minutes. The lysed cells were placed on ice after the 10 minute incubation time. A 450µl mixture of reagent B and reagent C (1:2 dilution) was added to each tube of lysed cells and the cells were incubated on ice for 30 minutes. The

39 tubes were centrifuged at 10,000 x g for 3 minutes, and the supernatant was separated and incubated in a 37ºC water bath for 20 minutes to separate the protein membrane fraction.

The tubes were centrifuged at 10,000 x g for 2 minutes and the hydrophilic layer (top layer) and hydrophobic layer (bottom layer) were separated into different tubes. The protein of interest is expected to be in the hydrophobic layer. Both layers were stored at -

20ºC to be used for protein Normalization.

Sialic Acid Assay

The Sialic Acid Assay was performed using the EnzyChrom™ Sialic Acid Assay

Kit (BioAssay Systems). In this assay, the cells were divided into two sets and both bound sialic acid levels as well as free sialic acid levels were measured. Before beginning the Sialic Acid Assay, the Bound Sialic Acid Hydrolysis Procedure was performed on the first set of cells in order to prepare them for the assay. 20µl of sample was mixed with

80µl of Hydrolysis Reagent and incubated at 80ºC for 60 minutes and allowed it to briefly cool to room temperature. 20µl of Neutralization Reagent was then added to the mixture and it was vortexed briefly. The tubes were then centrifuged at 14,000rpm.

To perform the Sialic Acid Assay, 10µl of sample (both hydrolyzed cells and non hydrolyzed cells) were mixed with 93µl of Assay Buffer, 1µl of Dye Reagent and 1µl of

Enzyme. The mixtures were incubated at room temperature for 60 minutes and their

Optical Density was measured at 570nm.

Chapter 3: Results

Site Directed Mutagenesis of the GNE Gene

The GNE gene was mutagenized by a series of PCR reactions, first generating two segments of the GNE gene with the site directed change incorporated into the ends, and second generating a fused gene with the mutation incorporated internally. For the first stage, the two segments of the gene were amplified and the size of the bands was confirmed with gel electrophoresis. The oligonucleotides used in generation of these fragments is indicated in the Materials and Methods, and they were designed to allow for a 15 bp overlap in sequence between the 5’ or “left” and 3’ or “right” segments of the gene. Shown below in Figure 7 is a photograph of an ethidium bromide stained agarose gel with bands representing the two segments of the gene with an incorporated M265T mutation. The bands sizes are 794bp for the 5´ end of the gene, and 1475bp for the 3´ end.

Lane 1 Lane 2 Lane 3 Lane 4 Lane 5

Figure 7: Two segments of the mutated GNE gene amplified. Lane 1: Lambda HindIII DNA Ladder, Lanes 2 and 3: 5´ segment of GNE (794bp), Lanes 4 and 5: 3´ segment of GNE (1475bp)

The two segments of the gene were isolated from the gel, as described in the

Materials and Methods, and introduced as a combined template into a third PCR reaction using the distal 5’ and 3’ oligonucleotides. With the 15 bp overlapping sequence between these segments, the initial stages of the combined PCR reaction allow for cross-priming and generation of a full-length GNE gene (with incorporated mutation). The product of this combined PCR was similarly isolated by gel electrophoresis (see Figure 8), and the size of the amplified gene was confirmed to be approximately 2169bp.

Lane 1 Lane 2 Lane 3

Figure 8: Amplified GNE gene using primers. Lane 1: Lambda HindIII DNA Ladder, Lanes 2 and 3: amplified GNE M265T (2169bp)

The isolated gel purified GNE DNA fragments (for each mutation) were treated with the enzymes EcoR1 and BamH1 to generate cohesive ends to match the vector

(pUMVC3) polylinker, and inserted into the vector by ligation, as described in the

Materials and Methods. DNA was isolated from kanamycin-resistant colonies by alkaline lysis, and screened by agarose gel electrophoresis for large insertions that would increase the supercoiled DNA size (see example in Figure 9).

Figure 9: Screening of supercoiled DNA sizes of candidates for D176V mutation Lanes 1-14 and 16-20: Supercoiled DNA sizes reflective of an unmodified pUMVC3 vector. Lane 15: Supercoiled DNA showing a relative decrease in mobility, making this a candidate for insertion of the 2169 bp GNE. The smear at the bottom of the gel is bacterial RNA.

Sequencing of GNE Gene

The CMV promoter and GNE clones were subjected to full nucleotide sequence determination for verification. Electropherograms were compared against GenBank GNE sequence (AF051852) and sequence alignments were performed using the NCBI program

BLAST2. No mutations were detected in the wild-type clone and only the expected mutation was found in D176V, R263L, M265T, V572L, M712T, and R266Q clones. The sequencing traces of each mutation are shown in Figure 10.

R266Q (cag)

M712T (acg)

Figure 10: Electropherograms of mutated region in each GNE construct. The Black arrow indicates the mutated base pair

CHO Cells Transfection:

CHO Cells were transfected with empty pUMVC3 vector, wild type GNE, and with all the mutated constructs to check for sialic acid levels. Shown below are light microscopy images (phase contrast) of CHO Cells before transfection (Figure 11), as well as one of CHO cells 48 hours post transfection (Figure 12). The images were taken at the same magnification.

Figure 11: CHO Cells in Free Style Media and Lipofectamine, 0 hours post transcription (magnification 1000 X)

Figure 12: CHO Cells in Free Style Media and Lipofectamine, 48 hours post transfection (magnification 1000 X)

Cell Viability Assay

A Cell Viability Assay was performed 48 hours post transfection to make sure the

CHO Cells were alive before other assays were performed. In order to determine cell viability, the optical density of each sample was measured at 450 nm, as described in the

Materials and Methods. The chart below in Figure 13 shows the viability of each cell population post transfection (samples with lower absorbance reading have fewer cells alive than samples with higher absorbance reading).

Figure 13: Number of living cells of each sample after transfection

CMV Promoter Presence in Cells Post-Transfection

PCR was performed on the extracted DNA from each CHO cell sample post transfection to check for the presence of the CMV Promoter, in order to ensure successful expression after transfection. As expected, the negative control and the CHO cells that were not transfected with any GNE construct (Media Only) did not show any traces of the CMV Promoter whereas all transfected cells as well as the positive control showed the presence of the CMV Promoter (see Figure 14).

Figure 14: The crossing point at which the CMV promoter was detected for each sample

Confirmation of Transcription of the GNE Gene Post-Transfection

Reverse Transcription and real time PCR was performed on the RNA extracted from each sample, using the distal GNE primers to ensure the expression of the GNE gene, and ultimately successful transfection of the CHO cells. As expected, the empty pUMVC3 vector, the CHO cells that were not transfected with any GNE construct, and the negative control did not show the expression of the GNE gene (see Figure 15). All other CHO cells transfected with the GNE constructs, however, showed the expression

(transcription) of GNE cDNA.

Figure 15: The crossing point at which GNE transcript was detected for each sample

Products of GNE Enzyme Post-Transfection

Sialic Acid Assay was performed to determine the levels of sialic acid production in CHO cells transfected with the different GNE constructs, as well as empty pUMVC3 vector and non transfected CHO cells. As expected, the two constructs with Sialuria mutations, R263L and R266Q produced much greater amounts of total sialic acid in comparison with the HIBM carrying constructs, wild-type GNE, and empty pUMVC3 vector. There appears to be no significant difference between the sialic acid levels of constructs with HIBM mutations and that of wild-type GNE and empty pUMVC3 vector.

This observation however, is due to the lack of sensitivity of the assay at low sialic acid levels. Therefore, no clear conclusion can be drawn in regards to the sialic acid production levels of HIBM carrying constructs versus that of wild-type GNE construct.

Figure 16: Amount of free and total sialic acid detected in empty pUMVC3 vector, wild- type GNE and constructs carrying HIBM and Sialuria mutations.

Chapter 4: Discussion

Expression of mutated GNE genes in CHO cells

The current research was performed in order to determine the expression and activity of mutated GNE genes under the control of a robust CMV promoter in Chinese

Hamster Ovary (CHO) cells. This cell line has been shown to be an excellent system for study of the effect of GNE gene mutations. For this study a special CHO cell line Lec3 was used, which has unusual lectin binding behavior. These Lec 3 cells have an inactive endogenous GNE gene and lack GNE activity (ref?). The cells were transfected with recombinant plasmids carrying wild-type, hypermorphic (GNE constructs that encode the enzyme with increased function), or hypomorphic constructs (which encode an enzyme with reduced function) of the GNE gene. This was done in order to study the effect of each recombinant construct on the levels of sialic acid production in the CHO cells.

Seven different GNE pUMVC3 expression constructs were produced with human cDNA; one carrying the wild-type GNE insert, four carrying mutations that cause HIBM

(D176V, M265T, V572L, and M712T), and two carrying mutations that cause Sialuria

(R263L and R266Q).

After transfection, DNA from the CHO cells was isolated to check for the presence of CMV promoter in the cells, and this was used as an indication that transfection was carried out successfully since the CMV promoter is a marker for the pUMVC3 vector. The results from this experiment were consistent with the expectation that all transfected cell samples showed the presence of the CMV promoter, except for the mock-transfected cells.

Reverse Transcription followed by Real Time PCR was performed using the extracted RNA from the cells. This was done to ensure that transfection was done successfully and that it led to actual transcription of GNE in the CHO cells. As expected,

GNE cDNA was detected in all cell samples that were transfected with wild-type GNE or with constructs carrying either HIBM or Sialuria mutations. In the cells that were not transfected (Media Only), those transfected with empty pUMVC3 vector, and the negative control, there was no detection of GNE transcription.

In the case of the sialic acid assay it was predicted that the Lec3 CHO cells, which do not have any native GNE activity, would only show background levels of sialic acid.

The cells that were transfected with any of the GNE genes, wild-type, HIBM Carrying constructs, or Sialuria carrying constructs should produce different levels of sialic acid based on their allele phenotypes.

Cells transfected with R263L and R266Q GNE gene showed very high levels of sialic acid, due to disruption of the feedback inhibition mechanism. Cells transfected with D176V, M265T, V572L, and M712T GNE gene showed very low levels of sialic acid compared to R263L and R266Q containing cells. However, there was not a very significant difference between the levels of sialic acid produced from wild-type and

HIBM-carrying construct. This is due to the fact that the Sialic Acid Assay used is not sensitive enough to detect sialic acid levels at such low concentrations.

The HIBM causing mutations only partially reduce the activity of GNE. When a specific level of sialic acid is produced, both wild-type and HIBM-causing mutants will stop production of sialic acid. The cellular effect of GNE with an active inhibitory site will be dependent on the amount of GNE expressed.

Previous studies have demonstrated that the effect of HIBM causing mutations such as M712T is different in different cell types. Normal sialic acid levels in lymphoblastoid cell lines with an HIBM mutation was observed while muscle cells with the same mutation showed variable sialic acid levels ranging from normal to a very low level (Huizing et al 2009,). The effect of mutation could be better understood by studying sialic acid production in muscle cell lines by allowing GNE gene expression under the control of muscle specific promoters.

Significance of the Study

Abnormal sialic acid levels or sialic acid metabolism results in severe clinical disorders in humans, (Gahl et al., 1996; Sillanaukee et al., 1999) including HIBM and

Sialuria (Seppala et al.,1999). HIBM is associated with mutations in the key regulatory enzyme of sialic acid biosynthesis, GNE/MNK, Glucosamine (UDP N-Acetyl 2 epimerase N-acetyl Mannosamine kinase), which is a bifunctional enzyme having both epimerase and kinase activities. Mutations in the GNE gene lead to lower GNE/MNK enzyme activities resulting in decreased production of sialic acid. These mutations cause reduced sialylation of muscle proteins and muscle fiber degeneration. HIBM cells also show impaired apoptotic signaling which indicates that sialylated proteins are important for apoptotic pathways and are involved in HIBM pathophysiology.

Compensation for low sialic acid levels using expression constructs may repair physiopathologic mechanisms associated with muscle fiber degeneration in HIBM, including defective glycosylation associated with apoptosis. It is hoped that restoration of sialic acid levels in muscle cells will lead to correct glycosylation of muscle-specific

54 proteins and normalize apoptosis. Gene therapy could be an effective treatment for

HIBM by providing an active or hyperactive enzyme to affected tissues to complement the mutant hypofunctional enzyme.

Future Directions

Future studies would involve validating the sialic acid assay results in transgenic animal models, by testing the effect of mutations in the mice. It would be important to test the hypothesis that wild-type GNE genes and hypermorphic GNE genes can compensate for low levels of sialic acid in HIBM models. These results can be further used for creating gene based therapies in which a normal or hyperactive gene is transferred into an HIBM patient. Another form of therapy might be cell-based therapy, involving the use of specialized stem cells capable of regenerating muscle and expressing

GNE enzyme in a normal or hyperactive form. Also, other genes may be studied which have a role in growth and regeneration of muscle cells, and they can be studied for their contribution to HIBM. This knowledge may be used to develop alternative therapies.

Further investigation of the molecular biology of HIBM may help to support development of effective therapy. It will be helpful to learn about the various signaling pathways that are involved, and interaction of other proteins and enzymes with GNE that are required for muscle development and function. The sialic acid metabolic pathway and its interaction with other pathways needs to be better characterized. Better understanding of how a decrease in sialic acid production leads to impaired muscle function will be helpful in finding an effective therapeutic treatment for HIBM. It is uncertain why the effect of the HIBM mutations is observed in skeletal muscles cells but not in other tissues

55 of the body. Further attention needs to be given to find out the reason for the sparing of quadriceps in HIBM patients. Increased understanding of HIBM etiology could lead to improved therapies for the treatment of this devastating disorder.

References

Arai, A., Tanaka, K., Ikeuchi, T., Igarashi, S., Kobayashi, H., Asaka, T.,Tsuji, S. (2002). A novel mutation in the GNE gene and a linkage disequilibrium in Japanese pedigrees. Ann Neurol, 52, 516–519.

Argov, A., & Yarom, R. (1984). Rimmed vacuole myopathy sparing the quadriceps: A unique disorder in Iranian Jews. J. Neurol. Sci., 64, 33-43.

Amsili, S., Shlomai, Z., Levitzki, R., Krause, S., Lochmuller, H., Ben-Bassat, H., & Mitrani-Rosenbaum, S. (2007). Characterization of hereditary inclusion body myoblasts: Possible primary impairment of apoptotic events. Cell Death Differ.,14(11), 1916-24.

Asaka, T., Ikeuchi, K., Okino, S., Takizawa, Y., Satake, R., Nitta, E.,Takamori, M. (2001). Homozygosity and linkage disequilibrium mapping of autosomal recessive distal myopathy (Nonaka distal myopathy). J. Hum. Genet., 46, 649-655.

Broccolini, A., Pescatori, M., D'Amico, A., Sabino, A., Silvestri, G., Ricci,E., Mirabella, M. (2002). An Italian family with autosomal recessive inclusionbody myopathy and mutations in the GNE gene. Neurology, 59, 1808-1809.

Chefalo, P., Pan, Y., Nagy, N., Harding, C., Guo, Z. (2004). Preparation and Immunological Studies of Protein Conjugates of N-Acylneuraminic Acids. Glycoconi 20 (6), 407-414.

Chou, S.M., (1967). Myxovirus-like structures in a case of human chronic polymyositis. Science, 158, 1453-1455

Christodoulou, K., Papadopoulou, E., Tsingis, M., Askanas, V., Engel, W. K., McFerrin, J., Middleton, L. T. (1998). Narrowing of the gene locus for autosomal recessive quadriceps sparing inclusion-body myopathy (ARQS-IBM) to chromosome 9p1. Acta Myol., 2, 7-9.

Eisenberg, I., Avidan, N, Potikha, T., Hochner, H., Chen, M., Olender, T., Mitrani- Rosenbaum, S. (2001a). The UDP-N-acetylglucosamine 2- epimerase/Nacetylmannosamine kinase gene is mutated in recessive hereditary inclusion body myopathy. Nature Genet., 29, 83 87.

Eisenberg, I., Hochner, H., Shemesh, M., Levi, T., Potikha, T., Sadeh, M., Mitrani- Rosenbaum, S. (2001b). Physical and transcriptional map of the hereditary inclusion body myopathy locus on chromosome 9p12-p13. Europ. J. Hum. Genet., 9, 501-509.

Eisenberg, I., Novershtern, N., Itzhaki, Z., Becker-Cohen, M., Sadeh, M., Willems, P.H.G.M., Friedman, N., Koopman, W.J.H., Mitrani-Rosenbaum, S. (2008). Mitochondrial processes are impaired in hereditary inclusion body myopathy. Human Molecular Genetics, 17 (23).

Eisenberg, I., Thiel, C., Levi, T., Tiram, E., Argov, Z., Sadeh, …Mitrani-Rosenbaum, S. (1999). Fine structure mapping of the hereditary inclusion body myopathy locus. Genomics, 55, 43-48.

Galeano, B., Klootwijk, R., Manoli, I., Sun, M., Ciccone, C., Darvish, D., Huizing, M. (2007). Mutation in the key enzyme of sialic acid biosynthesis causes severe glomerular proteinuria and is rescued by N-acetylmannosamine. J Clin Invest., 117(6), 1585–1594.

HIBM.org. (2008). About HIBM: Living with HIBM. Retrieved June 20, 2012 from http://www.hibm.org/arm/about_hibm:living_with_hibm.

Hinderlich, S., Stache, R., Zeitler, R., &Reutter W. 1997. A bifunctional enzyme catalyzes the first two steps in N-acetylneuraminic acid biosynthesis in rat liver: Purification and characterization of the UDP-N-acetylglucosamine 2-epimerase/N- acetylmannosamine kinase. J. Biol. Chem., 272(39), 24313-24318.

Huizing, M., Rakocevic, G., Sparks, S.E., Mamali, I., Shatunov, A., Goldfarb,L., Dalakas, M.C. (2004). Hypoglycosylation of alpha-dystroglycan in patients with hereditary IBM due to GNE mutations. Mol Genet Metab., 81(3), 196–202.

Ikeuchi, T., Asaka, T., Saito, M., Tanaka, H., Higuchi, S., Tanaka, K.,…Tsuji, S. (1997). Gene locus for autosomal recessive distal myopathy with rimmed vacuoles maps to chromosome 9. Ann. Neurol., 41, 432-437.

Jay, C., Nemunaitis, G., Nemunaitis, J., Senzer, N., Hinderlich, S., Darvish, D., Maple, P. (2008). Preclinical assessment of wt GNE gene plasmid for management of hereditary inclusion body myopathy 2 (HIBM2). Gene Regul Syst Biol., 2, 243-252.

Kagen, L.J. (2009). The Inflammatory Myopathies. DOL, 10, 1007/978-1-60327-827-0_5

Keppler, O.T., Hinderlich, S., Langner, J., Schwartz-Albiez, R., Reutter, W., & Pawlita, M. (1999). UDP-GlcNAc 2-epimerase: a regulator of cell surface sialylation. Science, 284(5418), 1372–6.

Kim, B.J., Ki, C.S, Kim, J.W., Sung, D.H., Choi, Y.C., Kim, S.H. (2006). Mutation analysis of the GNE gene in Korean patients with distal myopathy with rimmed vacuoles. Journal of Human Genetics, 51(2), 137-140.

Liewluck, T., Pho-lam, T., Limwongse, C., Thongnoppakhun, W., Boonyapisit, K., Raksadawan, N., …& Sangruchi, T. (2005). Mutation analysis of the GNE gene in distal myopathy with rimmed vacuoles (DMRV) patients in Thailand. Muscle Nerve, 34(6), 775-778.

Malicdan, M. C. V., Noguchi, S., Hayashi, Y. K., Nonaka, I., &Nishino, I. (2009). Prophylactic treatment with sialic acid metabolites precludes the development of the myopathic phenotype in the DMRV-hIBM mouse model. Nature Med., 15, 690-695.

Massa, R., Weller, B., Karpati, G., Shoubridge, E., & Carpenter, S. (1991). Familial inclusion body myositis among Kurdish-Iranian Jews. Arch. Neurol., 48, 519- 522.

Mitrani-Rosenbaum, S., Argov, Z., Blumenfeld, A., Seidman, C. E., & Seidman, J. G. (1996). Hereditary inclusion body myopathy maps to chromosome 9p1-q1. Hum Molec. Genet., 5, 159-163.

Nishino, I., Noguchi, S., Murayama, K., Driss, A., Sugie, K., Oya, Y.,…Nonaka, I. (2002). Distal myopathy with rimmed vacuoles is allelic to hereditary inclusion body myopathy. Neurology, 59, 1689–1693.

Nonaka, I., Sunohara, N., Ishiura, S., & Satoyoshi, E. (1981). Familial distal myopathy with rimmed vacuole and lamellar (myeloid) body formation. J. Neurol. Sci., 51, 141-155.

Noguchi, S., Keira, Y., Murayama, K., Ogawa, M., Fujita, M., Kawahara, G., Nishino, (2004). Reduction of UDP-N-acetylglucosamine 2 epimerase/Nacetylmannosamine kinase activity and sialylation in distal myopathy with rimmed vacuoles. J Biol Chem, 279(12), 11402-7.

Ricci, E., Broccolini, A., Gidaro, T., Morosetti, R., Gliubizzi, C., Frusciante, R. Mirabella, M. (2006). NCAM is hyposialylated in hereditary inclusion body myopathy due to GNE mutations. Neurology, 66, 755-758.

Reinke, S.O., & Hinderlich, S. (2007). Prediction of three different isoforms of the human UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase. FEBS Lett., 581 (17), 3327-3331.

Reinke, S.O., Eidenschink, C., Jay, C.M., Hinderlich, S. (2008). Biochemical characterization of human and murine isoforms of UDP-N-acetylglucosamine 2- epimerase/N-acetylmannosamine kinase (GNE). Glycoconj J., 26(4), 415-422.

Sparks, S., Rakocevic, G., Joe, G., Manoli, I., Shrader, J., Harris-Love, M., Gahl, W. (2007). Intravenous immune globulin in hereditary inclusion body myopathy: A pilot study. BMC Neurology 7:3 doi:10.1186/1471-2377-7-3.52

Tomimitsu, H., Ishikawa, K., Shimizu, J., Ohkoshi, N., Kanazawa, I., & Mizusawa, H. (2002). Distal myopathy with rimmed vacuoles: novel mutations in the GNE gene. Neurology, 59, 451-454.

Tomimitsu, H., Shimizu, J., Ishikawa, K., Ohkoshi, N., Kanazawa, I., & Mizusawa, H. (2004). Distal myopathy with rimmed vacuoles: new GNE mutations and splice variant. Neurology, 62(9), 1607-1610.

Tong, Y., Tempel, W., Nedyalkova, L., MacKenzie, F., & Park, H.W. (2009). Crystal Structure of the N-Acetylmannosamine Kinase Domain of GNE. PLoS ONE 4(10):e7165.doi:10.1371/journal.pone.0007165

Valles-Ayoub, Y., Saechao, C., Haghighatgoo, A., Neshat, M.S., Esfandiarifard, S., Pietruszka, M., & Darvish, D. (2008). Validation of GNE:p.M712T Identification by Melting Curve Analysis. Genetic Testing, 12 (1), 101-110.

Varki, A. (2008). Sialic acids in human health and disease. Trends Mol Med,. 14(8), 351– 360.

Vasconcelos, O. M., Raju, R., & Dalakas, M. C. (2002). GNE mutations in an American family with quadriceps-sparing IBM and lack of mutations in s- IBM. Neurology, 59, 1776-1779.

Welander, L., (1951). Myopathia Distalis Tarda Hereditaria. Acta Medica Scandanavica 141 (Suppl 265), 1-124.

Yunis, E.J., Samaha, F.J. (1971). Inclusion body myositis. Lab Invest, 25, 240-248

Zlotogora, J. (1995). Hereditary disorders among Iranian Jews. Am. J. Med. Genet,. 58, 32-37.

Appendix I

Homosapiens glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase (GNE) gene sequences cDNA size 2262bp (Transcript variant I)

Accession number: NG_008246

1 atggaaacct atggttatct gcagagggag tcatgctttc aaggacctca tgaactctat

61 tttaagaacc tctcaaaacg aaacaagcaa atcatggaga agaatggaaa taaccgaaag

121 ctgcgggttt gtgttgctac ttgtaaccgt gcagattatt ctaaacttgc cccgatcatg

181 tttggcatta aaaccgaacc tgagttcttt gaacttgatg ttgtggtact tggctctcac

241 ctgatagatg actatggaaa tacatatcga atgattgaac aagatgactt tgacattaac

301 accaggctac acacaattgt gaggggagaa gatgaggcag ccatggtgga gtcagtaggc

361 ctggccctag tgaagctgcc agatgtcctt aatcgcctga agcctgatat catgattgtt

421 catggagaca ggtttgatgc cctggctctg gccacatctg ctgccttgat gaacatccga

481 atccttcaca ttgaaggtgg ggaagtcagt gggaccattg atgactctat cagacatgcc

541 ataacaaaac tggctcatta tcatgtgtgc tgcacccgca gtgcagagca gcacctgata

601 tccatgtgtg aggaccatga tcgcatcctt ttggcaggct gcccttccta tgacaaactt

661 ctctcagcca agaacaaaga ctacatgagc atcattcgca tgtggctagg tgatgatgta

721 aaatctaaag attacattgt tgcactacag caccctgtga ccactgacat taagcattcc

781 ataaaaatgt ttgaattaac attggatgca cttatctcat ttaacaagcg gaccctagtc

841 ctgtttccaa atattgacgc agggagcaaa gagatggttc gagtgatgcg gaagaagggc

901 attgagcatc atcccaactt tcgtgcagtt aaacacgtcc catttgacca gtttatacag

961 ttggttgccc atgctggctg tatgattggg aacagcagct gtggggttcg agaagttgga

1021 gcttttggaa cacctgtgat caacctggga acacgtcaga ttggaagaga aacaggggag

1081 aatgttcttc atgtccggga tgctgacacc caagacaaaa tattgcaagc actgcacctt

1141 cagtttggta aacagtaccc ttgttcaaag atatatgggg atggaaatgc tgttccaagg

1201 attttgaagt ttctcaaatc tatcgatctt caagagccac tgcaaaagaa attctgcttt

1261 cctcctgtga aggagaatat ctctcaagat attgaccata ttcttgaaac tctaagtgcc

1321 ttggccgttg atcttggcgg gacgaacctc cgagttgcaa tagtcagcat gaagggtgaa

1381 atagttaaga agtatactca gttcaatcct aaaacctatg aagagaggat taatttaatc

1441 ctacagatgt gtgtggaagc tgcagcagaa gctgtaaaac tgaactgcag aattttggga

1501 gtaggcattt ccacaggtgg ccgtgtaaat cctcgggaag gaattgtgct gcattcaacc

1561 aaactgatcc aagagtggaa ctctgtggac cttaggaccc ccctttctga cactttgcat

1621 ctccctgtgt gggtagacaa tgatggcaac tgtgctgccc tggcggaaag gaaatttggc

1681 caaggaaagg gactggaaaa ctttgttaca cttatcacag gcacaggaat cggtggtgga

1741 attatccatc agcatgaatt gatccacgga agctccttct gtgctgcaga actgggccac

1801 cttgttgtgt ctctggatgg gcctgattgt tcctgtggaa gccatgggtg cattgaagca

1861 tacgcctctg gaatggcctt gcagagggag gcaaaaaagc tccatgatga ggacctgctc

1921 ttggtggaag ggatgtcagt gccaaaagat gaggctgtgg gtgcgctcca tctcatccaa

1981 gctgcgaaac ttggcaatgc gaaggcccag agcatcctaa gaacagctgg aacagctttg

2041 ggtcttgggg ttgtgaacat cctccatacc atgaatccct cccttgtgat cctctccgga

2101 gtcctggcca gtcactatat ccacattgtc aaagacgtca ttcgccagca ggccttgtcc

2161 tccgtgcagg acgtggatgt ggtggtttcg gatttggttg accccgccct gctgggtgct

2221 gccagcatgg ttctggacta cacaacacgc aggatctact ag

Appendix II

Homosapiens glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine

kinase (GNE) gene sequences cDNA size 2169bp (Transcript variant 2)

Accession number: NG_008246

1 atggagaaga atggaaataa ccgaaagctg cgggtttgtg ttgctacttg taaccgtgca

61 gattattcta aacttgcccc gatcatgttt ggcattaaaa ccgaacctga gttctttgaa

121 cttgatgttg tggtacttgg ctctcacctg atagatgact atggaaatac atatcgaatg

181 attgaacaag atgactttga cattaacacc aggctacaca caattgtgag gggagaagat

241 gaggcagcca tggtggagtc agtaggcctg gccctagtga agctgccaga tgtccttaat

301 cgcctgaagc ctgatatcat gattgttcat ggagacaggt ttgatgccct ggctctggcc

361 acatctgctg ccttgatgaa catccgaatc cttcacattg aaggtgggga agtcagtggg

421 accattgatg actctatcag acatgccata acaaaactgg ctcattatca tgtgtgctgc

481 acccgcagtg cagagcagca cctgatatcc atgtgtgagg accatgatcg catccttttg

541 gcaggctgcc cttcctatga caaacttctc tcagccaaga acaaagacta catgagcatc

601 attcgcatgt ggctaggtga tgatgtaaaa tctaaagatt acattgttgc actacagcac

661 cctgtgacca ctgacattaa gcattccata aaaatgtttg aattaacatt ggatgcactt

721 atctcattta acaagcggac cctagtcctg tttccaaata ttgacgcagg gagcaaagag

781 atggttcgag tgatgcggaa gaagggcatt gagcatcatc ccaactttcg tgcagttaaa

841 cacgtcccat ttgaccagtt tatacagttg gttgcccatg ctggctgtat gattgggaac

901 agcagctgtg gggttcgaga agttggagct tttggaacac ctgtgatcaa cctgggaaca

961 cgtcagattg gaagagaaac aggggagaat gttcttcatg tccgggatgc tgacacccaa

1021 gacaaaatat tgcaagcact gcaccttcag tttggtaaac agtacccttg ttcaaagata

1081 tatggggatg gaaatgctgt tccaaggatt ttgaagtttc tcaaatctat cgatcttcaa

1141 gagccactgc aaaagaaatt ctgctttcct cctgtgaagg agaatatctc tcaagatatt

1201 gaccatattc ttgaaactct aagtgccttg gccgttgatc ttggcgggac gaacctccga

1261 gttgcaatag tcagcatgaa gggtgaaata gttaagaagt atactcagtt caatcctaaa

1321 acctatgaag agaggattaa tttaatccta cagatgtgtg tggaagctgc agcagaagct

1381 gtaaaactga actgcagaat tttgggagta ggcatttcca caggtggccg tgtaaatcct

1441 cgggaaggaa ttgtgctgca ttcaaccaaa ctgatccaag agtggaactc tgtggacctt

1501 aggacccccc tttctgacac tttgcatctc cctgtgtggg tagacaatga tggcaactgt

1561 gctgccctgg cggaaaggaa atttggccaa ggaaagggac tggaaaactt tgttacactt

1621 atcacaggca caggaatcgg tggtggaatt atccatcagc atgaattgat ccacggaagc

1681 tccttctgtg ctgcagaact gggccacctt gttgtgtctc tggatgggcc tgattgttcc

1741 tgtggaagcc atgggtgcat tgaagcatac gcctctggaa tggccttgca gagggaggca

1801 aaaaagctcc atgatgagga cctgctcttg gtggaaggga tgtcagtgcc aaaagatgag

1861 gctgtgggtg cgctccatct catccaagct gcgaaacttg gcaatgcgaa ggcccagagc

1921 atcctaagaa cagctggaac agctttgggt cttggggttg tgaacatcct ccataccatg

1981 aatccctccc ttgtgatcct ctccggagtc ctggccagtc actatatcca cattgtcaaa

2041 gacgtcattc gccagcaggc cttgtcctcc gtgcaggacg tggatgtggt ggtttcggat

2101 ttggttgacc ccgccctgct gggtgctgcc agcatggttc tggactacac aacacgcagg

2161 atctactag

Appendix III

Homo sapiens UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase

isoform 1(753aa) protein sequence

Accession number: NP_001121699

1 metygylqre scfqgphely fknlskrnkq imekngnnrk lrvcvatcnr adysklapim

61 fgiktepeff eldvvvlgsh liddygntyr mieqddfdin trlhtivrge deaamvesvg

121 lalvklpdvl nrlkpdimiv hgdrfdalal atsaalmnir ilhieggevs gtiddsirha

181 itklahyhvc ctrsaeqhli smcedhdril lagcpsydkl lsaknkdyms iirmwlgddv

241 kskdyivalq hpvttdikhs ikmfeltlda lisfnkrtlv lfpnidagsk emvrvmrkkg

301 iehhpnfrav khvpfdqfiq lvahagcmig nsscgvrevg afgtpvinlg trqigretge

361 nvlhvrdadt qdkilqalhl qfgkqypcsk iygdgnavpr ilkflksidl qeplqkkfcf

421 ppvkenisqd idhiletlsa lavdlggtnl rvaivsmkge ivkkytqfnp ktyeerinli

481 lqmcveaaae avklncrilg vgistggrvn pregivlhst kliqewnsvd lrtplsdtlh

541 lpvwvdndgn caalaerkfg qgkglenfvt litgtgiggg iihqhelihg ssfcaaelgh

601 lvvsldgpdc scgshgciea yasgmalqre akklhdedll lvegmsvpkd eavgalhliq

661 aaklgnakaq silrtagtal glgvvnilht mnpslvilsg vlashyihiv kdvirqqals

721 svqdvdvvvs dlvdpallga asmvldyttr riy

Appendix IV

Homo sapiens UDP-N-acetyl glucosamine 2-epimerase/N-acetylmannosamine kinase

isoform 2 (722aa) protein sequence

Accession number: NP_005467

1 mekngnnrkl rvcvatcnra dysklapimf giktepeffe ldvvvlgshl iddygntyrm

61 ieqddfdint rlhtivrged eaamvesvgl alvklpdvln rlkpdimivh gdrfdalala

121 tsaalmniri lhieggevsg tiddsirhai tklahyhvcc trsaeqhlis mcedhdrill

181 agcpsydkll saknkdymsi irmwlgddvk skdyivalqh pvttdikhsi kmfeltldal

241 isfnkrtlvl fpnidagske mvrvmrkkgi ehhpnfravk hvpfdqfiql vahagcmign

301 sscgvrevga fgtpvinlgt rqigretgen vlhvrdadtq dkilqalhlq fgkqypcski

361 ygdgnavpri lkflksidlq eplqkkfcfp pvkenisqdi dhiletlsal avdlggtnlr

421 vaivsmkgei vkkytqfnpk tyeerinlil qmcveaaaea vklncrilgv gistggrvnp

481 regivlhstk liqewnsvdl rtplsdtlhl pvwvdndgnc aalaerkfgq gkglenfvtl

541 itgtgigggi ihqhelihgs sfcaaelghl vvsldgpdcs cgshgcieay asgmalqrea

601 kklhdedlll vegmsvpkde avgalhliqa aklgnakaqs ilrtagtalg lgvvnilhtm

661 npslvilsgv lashyihivk dvirqqalss vqdvdvvvsd lvdpallgaa smvldyttrr

721 iy