Metabolism of Methiocarb and Carbaryl by Rat and Human Livers and Plasma, and Effect on Their PXR, CAR and Pparα Activities

The Journal of Toxicological Sciences (J. Toxicol. Sci.) 677 Vol.41, No.5, 677-691, 2016

Original Article Metabolism of methiocarb and carbaryl by rat and human livers and plasma, and effect on their PXR, CAR and PPARα activities

Chieri Fujino1, Yuki Tamura2, Satoko Tange1, Hiroyuki Nakajima3,4, Seigo Sanoh1, Yoko Watanabe2, Naoto Uramaru2, Hiroyuki Kojima5, Kouichi Yoshinari3,4, Shigeru Ohta1 and Shigeyuki Kitamura2

1Graduate School of Biomedical and Health Sciences, Hiroshima University, Kasumi 1-2-3, Minami-ku, Hiroshima 734-8553, Japan 2Nihon Pharmaceutical University, Komuro 10281, Ina-machi, Kitaadachi-gun, Saitama 362-0806, Japan 3Graduate School of Pharmaceutical Sciences, Tohoku University, 6-3 Aramaki-Aoba, Aoba-ku, Sendai 980-8578, Japan 4School of Pharmaceutical Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka 422-8526, Japan 5Hokkaido Institute of Public Health, Kita-19, Nishi-12, Kita-ku, Sapporo 060-0819, Japan

(Received April 14, 2016; Accepted August 2, 2016)

ABSTRACT — The oxidative, reductive, and hydrolytic metabolism of methiocarb and the hydrolyt- ic metabolism of carbaryl by liver microsomes and plasma of rats or humans were examined. The effects of the metabolism of methiocarb and carbaryl on their nuclear receptor activities were also examined. When methiocarb was incubated with rat liver microsomes in the presence of NADPH, methiocarb sul- foxide, and a novel metabolite, methiocarb sulfone were detected. Methiocarb sulfoxide was oxidized to the sulfone by liver microsomes and reduced back to methiocarb by liver cytosol. Thus, the intercon- version between methiocarb and the sulfoxide was found to be a new metabolic pathway for methiocarb by liver microsomes. The product of methiocarb hydrolysis, which is methylthio-3,5-xylenol (MX), was also oxidized to sulfoxide form by rat liver microsomes. The oxidations were catalyzed by human flavin- containing monooxygenase isoform (FMO1). CYP2C19, which is a human cytochrome P450 (CYP) iso- form, catalyzed the sulfoxidations of methiocarb and MX, while CYP1A2 also exhibited oxidase activi- ty toward MX. Methiocarb and carbaryl were not enzymatically hydrolyzed by the liver microsomes, but they were mainly hydrolyzed by plasma and albumin to MX and 1-naphthol, respectively. Both methio- carb and carbaryl exhibited PXR and PPARα agonistic activities; however, methiocarb sulfoxide and sul- fone showed markedly reduced activities. In fact, when methiocarb was incubated with liver microsomes, the receptor activities were decreased. In contrast, MX and 1-naphthol showed nuclear receptor activities equivalent to those of their parent carbamates. Thus, the hydrolysis of methiocarb and carbaryl and the oxidation of methiocarb markedly modified their nuclear receptor activities.

Key words: Carbaryl, Hydrolysis, Methiocarb, Oxidative metabolism, PXR, Reductive metabolism

INTRODUCTION can be absorbed through the skin and mucous membranes (Bouchard et al., 2008). These pesticides as well as orga- Methiocarb [3,5-dimethyl-4-(methylthio)phenol meth- nophosphate pesticides act as acetylcholinesterase inhib- ylcarbamate] and carbaryl (1-naphthalenol methylcar- itors. The anticholinesterase activity of organophosphate bamate) are esters of carbamic acid and are known as car- pesticides is irreversible while the carbamylation process bamates. They are used as broad-spectrum insecticides. by methiocarb and carbaryl is reversible. Some carbamate Methiocarb and carbaryl are considered as the most effec- pesticides exhibit neurotoxicity via inactivation of acetyl- tive pesticides for a variety of crops, as well as agricul- cholinesterase, which is a key enzyme in nervous trans- tural animals and pets. However, methiocarb and carbaryl mission (Gupta et al., 2007). The neurotoxicity of car- Correspondence: Shigeyuki Kitamura (E-mail: [email protected])

Vol. 41 No. 5 678

C. Fujino et al. bamate pesticides was demonstrated using postnatal rats cell proliferation and transactivation assays using MCF-7 and the potential effect in human infants was discussed human breast cancer cells. Kojima et al. (2004) examined (Vidair, 2004). Furthermore, carbaryl showed immunoto- the estrogenicity of 22 carbamate pesticides and found xic effects and contributed to the development of allergic that methiocarb activates estrogen receptors (ER) α and diseases (Ali Jorsaraei et al., 2014). Methiocarb induc- β. The anti-androgenic activity of methiocarb has also es oxidative stress such as lipid peroxidation and anti- been reported in two other studies (Birkhøj et al., 2004; oxidant defense systems in rats (Ozden et al., 2013). Kojima et al., 2004). Recently, we reported the effect of Some carbamates also influence the reproductive sys- the metabolic transformation of methiocarb and carbaryl tem by inhibiting steroidogenesis in animals and humans. on their estrogenic and anti-androgenic activities (Tange Carbaryl inhibits progesterone biosynthesis by prima- et al., 2016). In addition to endocrine-disruption by the ry human granulosa-lutein cells (Cheng et al., 2006). transcriptional activation of hormonal receptors, the dis- In mice, there was a significant decrease in the number ruption of hormone levels via nuclear receptors that are of estrous cycles, duration of the phases of each cycle, associated with the regulation of hormone levels should and number of healthy follicles (Baligar and Kaliwal, also be considered. The nuclear receptors include pregnane 2002). Carbamates are considered safe because they are X receptor (PXR), constitutive androstane receptor (CAR), easily metabolized and degraded in the environment. and peroxisome proliferator-activated receptor α (PPARα). However, carbamates have been reported to accumulate PXR plays a critical role in the transcriptional regu- in fish and invertebrates (Soler et al., 2007). With regard lation of CYP3A. Many compounds including xenobiot- to toxicity to wildlife, carbaryl has shown cardiac effects ics such as clinical drugs and pesticides have been shown in zebrafish embryos (Lin et al., 2007). Exposure of car- to be PXR agonists. CAR is a nuclear receptor close- baryl to catfish resulted in the suppression of serum lev- ly related with PXR. The activation of CAR results in an el of thyroxin (Sinha et al., 1991). Sun et al. (2008) have increased expression of CYP2B and CYP2C genes. The reported of the inhibitory effects of carbaryl, 1-naphthol, CAR ligand-binding pocket is smaller and less flexible and 2-naphthol on the receptor-mediated transcription of than that of PXR (Kretschmer and Baldwin, 2005; Timsit thyroid hormones. Carbaryl also induces oxidative stress and Negishi, 2007). Some compounds have both PXR and in snails (Leomanni et al., 2015). CAR activities whereas others are either PXR agonists or Carbamate pesticides are metabolized via hydroly- CAR agonists. PPARα functions as the receptor for the sis and/or oxidation in animals and humans. Carbamates induction of CYP4A gene, which is involved in fatty acid are hydrolyzed in plasma. The oxidation of sulfur-con- metabolism (Reddy and Hashimoto, 2001). PPARα ago- taining carbamates such as ethiofencarb, methiocarb, and nists have been reported to induce the gene expression of aldicarb to sulfoxide derivatives is a well-known pathway 17β-hydroxysteroid dehydrogenase type IV, which cata- (Montesissa et al., 1994; Pelekis and Krishnan, 1997; lyzes the conversion of estradiol to its inactive metabo- Risher et al., 1987), reportedly catalyzed by cyto- lite estrone (Fan et al., 1998). Furthermore, these nucle- chrome P450 (CYP) and flavin-containing monooxygen- ar receptors regulate the expression of phase II enzymes, ase (FMO) (Buronfosse et al., 1995; Furnes and Schlenk, which act as regulators of hormonal metabolism. Some 2005; Schlenk et al., 2002; Usmani et al., 2004; Hajjar carbamates have been reported to activate both PXR and and Hodgson, 1980). However, the metabolic fate of the CAR. As for the activation of PXR and CAR of methio- sulfoxide formed has not been extensively investigated. carb and carbaryl, both positive and negative results have In this study, the metabolism of methiocarb to the sulfox- been reported (Kojima et al., 2010; Abass et al., 2012). ide, the oxidation of methiocarb sulfoxide to the sulfone, There are no reports currently available on the effects of and the reduction of the sulfoxide to methiocarb by liver carbamates on PPARα. preparations were examined in rats and humans. Regard- The effects of metabolic modification of chemicals ing the endocrine-disrupting activities of the carbamates, toward ER and androgen receptor (AR) activities have which occur by the transcriptional activation of hormonal been investigated. Some chemicals such as methoxychlor, receptors, some positive results with respect to hormonal trans-stilbene, benzo[a]pyrene, 2-nitrofluorene, and sty- receptor-disruption have been reported. Klotz et al. (1997) rene oligomers are negative in in vitro estrogen screening reported that aldicarb, bendiocarb, and carbaryl weakly tests but exhibit estrogenic activity after they are metab- activated estrogen- or progesterone-responsive reporter olized by the microsomal CYP system (Kitamura et al., genes in breast MCF-7 and endometrial (Ishikawa) can- 2008). The anti-androgenic activity of fenthion, which is cer cells. Andersen et al. (2002) also reported that methi- an organophosphate pesticide, was markedly decreased ocarb exhibits estrogenic and anti-androgenic activities in after its oxidative metabolism by liver microsomes

Vol. 41 No. 5 679

Metabolism of carbamate pesticides and nuclear receptor activity

(Kitamura et al., 2003). Thus, it is important to consider co-treated with PB (80 mg/kg intraperitoneally) and MC the effects of metabolic modification of pesticides. How- (25 mg/kg orally), once a day for 3 consecutive days. ever, studies on the metabolic activation and inactiva- All experiments were conducted in accordance with the tion of the agonistic activities of carbamates against PXR, "Guide for the Care and Use of Laboratory Animals" of CAR and PPARα have not been conducted so far. Hiroshima University and Nihon Pharmaceutical Univer- In our previous study, the oxidative metabolism of sity. methiocarb to methiocarb sulfoxide by rat liver micro- somes and the hydrolytic metabolism of methiocarb Tissue preparations and carbaryl by rat plasma were examined. The estro- Rat livers were removed and homogenized in 4 vol- genic and anti-androgenic activities of the metabolites umes of 1.15% potassium chloride. The homogenates were also shown (Tange et al., 2016). In this study, the were centrifuged for 20 min at 9,000 × g. The supernatant effects of methiocarb and carbaryl on the activities of fractions were further separated into cytosol and micro- PXR, CAR and PPARα have been examined using report- somes by centrifugation for 60 min at 105,000 × g. The er gene assays. Furthermore, we have investigated the in microsomes were washed by resuspension in 2 volumes vitro metabolism of methiocarb and carbaryl in rats and of the potassium chloride solution and resedimentation humans, as well as the effects of the metabolites on the for 60 min at 105,000 × g. activities of PXR, CAR and PPARα. Assay method for the oxidase activities of MATERIALS AND METHODS microsomal methiocarb and MX The incubation mixture consisted of 0.1 μmol of methi- Materials ocarb or MX, 0.5 μmol of NADPH and 0.1 mL of liv- Methiocarb, carbaryl, 1-naphthol, methiocarb sulfox- er microsomes, in 0.1 M K,Na-phosphate buffer (pH 7.4) ide, methiocarb sulfone, 4-methylthio-3,5-xylenol (MX), making a final volume of 1 mL. The incubation was done 3,5-dimethyl-4-(methylsulfinyl)phenol (SP), 3,5-dime- at 37°C for 10 min. After incubation, 10 nmol of benzo- thyl-4-(methylsulfonyl)phenol (SOP), menadione, 2-hy- phenone was added as an internal standard, and the mix- droxypyrimidine, rat albumin and human albumin were ture was extracted with 5 mL of ethyl acetate. The extract purchased from Wako Pure Chemical Industries (Osaka, was evaporated to dryness and the residue was subject- Japan). Eserine, 2-chloro-3,4-dimethoxybenzyl (CDMB), ed to analysis by high-performance liquid chromatogra- bis(4-nitrophenyl)phosphate (BNPP), 5-pregnen-3β-ol- phy (HPLC). 20-one-16α-carbonitrile (PCN), artemisinin, and bezaf- ibrate (BZF) were purchased from Sigma-Aldrich (St. Assay method for the oxidation of methiocarb Louis, MO, USA). Infinity pure dimethyl sulfoxide and MX by human CYPs and FMOs (DMSO; > 99.5% pure) was purchased from Wako Pure The incubation mixture (1 mL) consisted of 0.1 μmol Chemical Industries. Human recombinant CYP and of methiocarb or MX, 0.5 μmol of NADPH and 40 μL of FMO isoforms expressed in a baculovirus system and recombinant human CYP isoform (about 0.04 nmol CYP) pooled human plasma were purchased from BD Gentest or recombinant human FMO isoform in 0.1 M K,Na- (Woburn, MA, USA). phosphate buffer (pH 7.4). The incubation was carried out at 37°C for 10 min. After incubation, 10 nmol of benzo- Animals phenone was added as an internal standard, and the mix- Male Sprague-Dawley rats (Slc:SD, 180-210 g, Japan ture was extracted with 5 mL of ethyl acetate. The extract SLC, Shizuoka, Japan) were used for the study. The ani- was evaporated to dryness and the residue was subjected mals were housed at a temperature of 22°C and a humidity to analysis with HPLC. of 55% in a 12-hr light/dark cycle, and given free access to tap water and a standard pellet diet MM-3 (Funabashi Assay method for the reductase activity of Farm, Chiba, Japan). The rats were given either sodi- methiocarb sulfoxide um phenobarbital (PB) in saline (80 mg/kg intraperi- The incubation mixture consisted of 0.1 μmol of methi- toneally), once a day for 3 consecutive days; 3-methyl- ocarb sulfoxide, 0.5 μmol of 2-hydroxypyrimidine, and cholanthrene (MC) or dexamethasone (Dex) in corn oil liver cytosol (0.2 mL), in 0.1 M K,Na-phosphate buffer (25 or 100 mg/kg, respectively, orally), once a day for 3 (pH 7.4) making a final volume of 1 mL. The incubation consecutive days; or acetone (4.8 g/kg single oral dose) was done at 37°C for 10 min under anaerobic conditions. 24 hr before sacrifice. In other experiments, rats were After incubation, 10 nmol of benzophenone was added as

Vol. 41 No. 5 680

C. Fujino et al. an internal standard, and the mixture was extracted with polymerase chain reaction (PCR) with KOD FX 5 mL of ethyl acetate. The extract was evaporated to dry- Neo (Toyobo, Tokyo, Japan) using a set of prim- ness and the residue was subjected to analysis by HPLC. ers: 5′-GCGGAGATGAGACCTGAGGAGAG-3′ and 5′-GCGCTCAGCCGTCCGTGCTGCTG-3′ for Assay method for the hydrolase activity of PXR and 5′-CCTGGCCACAACCATTCAAC-3′ and plasma 5′-AGTGGCAACGGCCTACCATC-3′ for PPARα. Rat The incubation mixture consisted of 0.1 μmol of methi- liver cDNA was used as a template and subcloned into ocarb, methiocarb sulfoxide, or carbaryl, and plasma pTarget (Promega, Madison, WI, USA). To prepare rat (0.1 mL) or serum albumin (1 mg), in 0.1 M K,Na-phos- CAR expression plasmid, its cDNA was amplified by PCR phate buffer (pH 7.4) making a final volume of 1 mL. The as described above with a set of primers: 5′-GCCGGATC incubation was done at 37°C for 20 min. After incubation, CACCATGACAGCTACTCTAACA-3′ and 5′-ATTGCG 10 nmol of benzophenone was added as an internal stand- GCCGCCGCTGCAAATCTCCCCAAG-3′, and insert- ard, and the whole was extracted with 5 mL of ethyl ace- ed into the BamHI and NotI sites of pcDNA3.1/V5-His tate. The extract was evaporated to dryness and the resi- (Invitrogen, Carlsbad, CA, USA). The reporter plasmids due was subjected to HPLC analysis. p3A4 (Watanabe et al., 2013), (NR1)5-tk-pGL3 (Imai et al., 2013), and tk-pGL3 (Kawamoto et al., 1999) have HPLC been reported previously. To prepare 3 × rAox-PPRE-tk- HPLC was performed using a Hitachi L-7110 HPLC pGL3, a set of oligonucleotides — 5′-GTACCCAGGAC system (Tokyo, Japan) equipped with an ultraviolet AAAGGTCACGCCAGGACAAAGGTCACGCCAGGA absorption detector. An Inertsil ODS-3 column (5 μm par- CAAAGGTCACGC-3′ and 5′-TCGAGCGTGACCTTT ticle size: 4.6 I.D. × 150 mm) (GL Science, Tokyo, Japan) GTCCTGGCGTGACCTTTGTCCTGGCGTGACCTTT- was used for the separation of compounds. The mobile GTCCTGG-3′ were annealed and inserted into the KpnI/ phase was acetonitrile-water (1:1, v/v). A flow rate of XhoI sites of tk-pGL3. The sequences and orientations of 0.4 mL/min was used, and the detection wavelength was these plasmids were confirmed by direct sequences. Inter- set at 230 nm. The retention times for SP, methiocarb sul- nal control plasmid phRL-tk was obtained from Promega. foxide, SOP, methiocarb sulfone, benzophenone, MX, methiocarb, carbaryl, and 1-naphthol were 4.9, 5.2, 8.1, Reporter gene assays 9.7, 18.8, 24.9, 27.9, 33.9, and 42.4 min, respectively. COS-1 cells were plated in 96-well plates (Thermo The amounts of metabolites formed were calculated from Fisher Scientific, Waltham, MA, USA) at 1 × 104 cells/ the peak areas. well in D-MEM supplemented with 10% FBS, 1% Anti- Anti, and 1% MEM NEAA. COS-1 cells were transfected Cells and cell culture conditions simultaneously with 6.25 ng/well of the expression plas- COS-1 cells derived from African green monkey kid- mid, 100 ng/well of the reporter plasmid, and 10 ng/well of ney were obtained from RIKEN BioResource Center the internal control plasmid using jetPEI (PolyPlus Trans- (Ibaraki, Japan). Dulbecco’s Modified Eagle Medium fection, Illkirch, France). After 24 hr (assays for PXR and (high glucose) containing L-glutamine, phenol red, and PPARα) or 12 hr (assay for CAR), the cells were exposed sodium pyruvate (D-MEM) was purchased from Wako to various concentrations of test compounds or 0.1% Pure Chemical Industries. Fetal bovine serum (FBS) was DMSO (vehicle control) in D-MEM supplemented with purchased from Sigma-Aldrich. Antibiotic-antimycotic 1% Anti-Anti and 1% MEM NEAA (FBS was not add- (Anti-Anti), MEM Non-Essential Amino Acids (MEM ed). After 24 hr incubation with the chemicals, cells were NEAA), and 0.5% trypsin-ethylenediamine tetra-acetic harvested with 25 μL of passive lysis buffer (Promega). acid (EDTA) disodium salt solution were obtained from The firefly and renilla luciferase activities were deter- Life Technologies (Carlsbad, CA, USA). mined with a Dual-Luciferase Reporter Assay System The cells were routinely cultured in D-MEM supple- (Promega) and luminescence was measured with a lumi- mented with 10% FBS, 1% Anti-Anti, and 1% MEM nometer (Luminoskan Ascent, Thermo Fisher Scientific).

NEAA at 37°C, in an atmosphere of 5% CO2/95% air Firefly luciferase activity was normalized to Renilla luci- under saturating humidity. ferase activity from phRL-tk. Results have been expressed as mean ± standard deviation (S.D.) from at least three Plasmids independent experiments, each performed in duplicate. To prepare rat PXR and PPARα expression plas- DMSO was used as a vehicle and all test compounds mids, the corresponding cDNAs were amplified by used were dissolved in DMSO at a concentration of

Vol. 41 No. 5 681

Metabolism of carbamate pesticides and nuclear receptor activity

30 mM. The final DMSO concentration in the culture respectively (Fig. 8). When methiocarb was incubated medium did not exceed 0.1% in order to maintain cell with boiled liver microsomes or native liver microsomes, viability. All compounds were diluted to the desired con- MX was detected at the same amounts in each case (data centrations in the appropriate medium immediately before not shown). This indicates that in the experiments using use. liver microsomes, the MX of methiocarb were not enzy- The metabolic modification of methiocarb for nucle- matically formed. ar receptor activity was determined as follows. Methio- carb (1 μmol) was incubated with an NADPH-generating Oxidase activity of rat liver microsomes toward system (1 μmol of NADPH, 5 μmol of D-glucose-6-phos- methiocarb and MX phate, and 1 unit of glucose-6-phosphate dehydroge- The oxidase activities of liver microsomes from nase) and liver microsomes from PB- and MC-treated rats untreated, and PB-, MC-, Dex- and acetone-treated rats (60 mg protein), in 0.1 M K,Na-phosphate buffer toward methiocarb were investigated. The oxidation of (pH 7.4) to make a final volume of 20 mL. Rat liver methiocarb to the sulfoxide with the liver microsomes microsomes incubated at 90°C for 10 min were used as was not significantly changed by treatment with CYP control. The incubation was continued at 37°C for 30 min. inducers, although it tended to increase by treatment with After incubation, the mixture was extracted with 25 mL of ethyl acetate. The extract was evaporated to dryness and the residue was dissolved in DMSO at a concentration of 30 mM to obtain the initial unchanged methiocarb, which was diluted stepwise various test concentrations. Aliquots were then taken to examine the effect of metabolism on the agonistic activities of methiocarb.

Statistical analysis Data analysis was conducted using Mini StatMate soft- ware (ATMS, Tokyo, Japan). The Dunnet method was used to evaluate the differences of formed metabolites between the groups incubated with the inducers treated microsomes and the group incubated with the untreated microsomes. The Dunnet method was also used to eval- uate the differences in transcriptional levels between the experiment groups and the control group (0.1% DMSO alone). The student’s t-test was used to evaluate the dif- ferences in transcriptional levels between the test group (extract of incubation mixture with native microsome) and the control group (extract of incubation mixture with boiled microsome).

RESULTS

Metabolism of methiocarb by rat liver microsomes Oxidative, reductive, and hydrolytic metabolism of Fig. 1. Oxidase activity of rat liver microsomes toward me- thiocarb to the sulfoxide (A) and the sulfone (B). The methiocarb by liver microsomes from untreated rats were oxidase activities of liver microsomes from untreated, examined. When methiocarb was incubated with rat liv- PB-, MC-, Dex- or acetone-treated rats are shown. er microsomes in the presence of NADPH, a novel oxida- Each bar represents the mean ± S.D. of four rats. There tive metabolite, methiocarb sulfone was detected as well is no significant difference between untreated micro- as methiocarb sulfoxide, which was stated in our previous somes group and other groups (Dunnet’s test). Incuba- tion was performed at 37°C for 10 min with 0.1 mL of report (Tange et al., 2016). Furthermore, the hydrolysis rat liver microsomes. Metabolites formed were deter- products of methiocarb, methiocarb sulfoxide and methi- mined by HPLC. Other details are described in Materi- ocarb sulfone, were also detected as MX, SP, and SOP, als and Methods.

Vol. 41 No. 5 682

C. Fujino et al.

Fig. 2. Oxidase activities of recombinant human CYP (A) and FMO (B) isoforms expressed in a baculovirus system toward me- thiocarb and MX. Each value represents the mean of duplicate experiments. A mixture containing 0.1 μmol of methiocarb or MX, 0.5 μmol of NADPH and 40 μL of human recombinant CYP isoform (about 0.04 nmol CYP equivalent) and human recombinant FMO isoform in 0.1 M phosphate buffer (pH 7.4) was incubated at 37ºC for 10 min. Oxidized metabolites formed were determined using HPLC as described in Materials and Methods. ND: not detected, MX: methylthio-3,5-xyle- nol

MC and Dex (Fig. 1A). The amount of methiocarb sul- various human recombinant CYP and FMO isoforms. In fone formed was also not significantly increased by the each case, the amount of sulfoxide metabolite formed liver microsomes from CYP inducer-treated rats, but the from MX was greater than that from methiocarb except in oxidation to the sulfone tended to be enhanced with liver the case of CYP1A2. Generally, methiocarb sulfoxide and microsomes from Dex-treated rats (Fig. 1B). SP were generated by CYP isoforms more than by FMO Furthermore, MX, which is a hydrolysis prod- isoforms. Although CYP2C19 catalyzed the sulfoxidation uct of methiocarb, was also oxidized to the sulfoxide, of methiocarb to the highest extent among the enzymes SP, by liver microsomes from untreated rats at a rate of studied, other CYP isoforms also contributed to the reac- 0.75 nmol/min/mg protein. The activity was enhanced by tion. The oxidation of MX to SP was mainly catalyzed about 3- and 11-fold with liver microsomes from PB- and by CYP2C19 and CYP1A2. CYP2B6 and CYP2D6 also MC-treated rats, respectively (data not shown). exhibited oxidase activities. The oxidations were also cat- alyzed by human FMO1; however, FMO3 barely showed Human CYP isoforms and FMO isoforms any oxidase activity (Fig. 2). involved in the oxidation of methiocarb and MX We attempted to identify CYP and FMO isoforms involved in the oxidations of methiocarb and MX using

Vol. 41 No. 5 683

Metabolism of carbamate pesticides and nuclear receptor activity

Oxidase and reductase activities of rat liver shown our previous report. The methiocarb-hydrolyzing preparations toward methiocarb sulfoxide activity of human plasma was about 10-fold higher than The oxidase and reductase activities of rat liver prepa- its carbaryl-hydrolyzing activity. These hydrolytic activi- rations toward methiocarb sulfoxide were studied. Methi- ties were markedly inhibited by BNPP used at a concen- ocarb sulfoxide was oxidized to methiocarb sulfone by rat tration of 100 μM. Eserine (physostigmine) and CDMB liver microsomes from untreated rats in the presence of inhibited the carbaryl-hydrolyzing activity (Fig. 4). Rat NADPH. The oxidase activity was significantly enhanced and human albumins also showed hydrolyzing activity with liver microsomes from Dex-treated rats (Fig. 3A). In toward methiocarb and carbaryl. In this case, rat albumin contrast, methiocarb sulfoxide was reduced back to methi- showed a higher activity than human albumin. Hydrolyz- ocarb by untreated rat liver cytosol in the presence of ing activities were also inhibited by BNPP used at a con- 2-hydroxypyrimidine, which is an electron donor of alde- centration of 100 μM (Fig. 5). hyde oxidase (Fig. 3B). The reductase activity was com- pletely inhibited by the addition of menadione (100 μM), PXR, CAR and PPARα activities of methiocarb which is a specific inhibitor of aldehyde oxidase (Kitamura and carbaryl and their metabolites et al., 2006). The rat PXR, rat CAR and rat PPARα activating activi- ties of methiocarb and carbaryl and their metabolites were Hydrolytic metabolism of methiocarb and investigated by luciferase reporter assays in COS-1 cells. carbaryl by plasma and albumin of rats and Methiocarb was positive in PXR and PPARα reporter humans assays at a concentration of 30 μM. MX was also positive As with the case of the hydrolysis of methiocarb by in the reporter assay against PXR at a concentration of liver microsomes presented earlier, carbaryl was also not 30 μM. However, no activity of these compounds against enzymatically hydrolyzed to 1-naphthol by rat liver micro- CAR was observed. Methiocarb sulfoxide showed a mark- somes (data not shown). Methiocarb and carbaryl were edly lower PXR activity than the parent compound methi- enzymatically hydrolyzed by rat plasma, and this activity ocarb. The PXR activation by methiocarb sulfone was not was inhibited by BNPP (100 μM) as shown in our previ- observed. The activity of methiocarb sulfoxide and sul- ous report (Tange et al., 2016). In this study, human plas- fone toward CAR and PPARα were negative. Methiocarb ma also exhibited hydrolyzing activity toward methiocarb sulfoxide and sulfone, SP, and SOP were negative in the and carbaryl. The hydrolyzing activities in human plas- reporter assays against PXR, CAR, and PPARα. Carbar- ma occurred to a greater extent than those in rat plasma as yl and its metabolite, 1-naphthol, each at a concentration

Fig. 3. Oxidase (A) and reductase (B) activities of rat liver preparations toward methiocarb sulfoxide. Oxidase activities of rat liver microsomes and reductase activity of rat liver cytosol are shown. Rat liver microsomes were prepared from untreated, PB-, MC-, Dex- or acetone-treated rats. Rat liver cytosol was prepared from untreated rats. Each bar represents the mean ± S.D. of four rats. *p < 0.05 compared with the untreated microsomes group (Dunnet’s test). Incubation (1 mL) was performed at 37°C for 10 min with 0.1 mL of rat liver microsomes or 0.2 mL of liver cytosol. Metabolites formed were determined by HPLC. Other details are described in Materials and Methods.

Vol. 41 No. 5 684

C. Fujino et al.

the microsomes in the presence of NADPH, the extract from the incubation mixture exhibited lower PXR activity compared with the extracts from the control experiment, in which methiocarb was incubated with boiled liver microsomes. There is no significant difference in PPARα activity between the extracts from the test group (native microsomes) and the control group (boiled microsomes) (Fig. 7).

DISCUSSION

In this study, the in vitro metabolism of methiocarb and carbaryl in rats and humans, as well as their effects and that of their metabolites on PXR, CAR and PPARα activities were examined. Carbamate pesticides have been noted to be endocrine-disruptors in view of their estro- genic and anti-androgenic activities. Hitherto, we have shown the metabolism of methiocarb and carbaryl by the liver microsomes and plasma of rats, and the effects on the estrogenic and anti-androgenic activities (Tange et al., 2016). In the report, it was indicated that the activity of methiocarb was decreased after its oxidative metabolism but enhanced after its hydrolytic metabolism. The activ- ity of carbaryl was found to be retained after hydrolytic metabolism. Furthermore, disruption of hormonal activity via nuclear receptor activation is crucial and needs to be taken into consideration. In the present study, methiocarb and carbaryl showed agonistic activity against rat PXR. Fig. 4. Hydrolytic activity of human plasma toward methio- The activity of methiocarb was decreased after incuba- carb (A) and carbaryl (B) and the effects of inhibitors tion with liver microsomes from rats co-treated with PB on the activities. Each value represents the mean of duplicate determinations. Incubation was performed at and MC, which indicated that methiocarb is detoxified by 37°C for 10 min with 0.1 mL of human plasma in the the metabolic process. PPARα agonistic activity of methi- presence or absence of inhibitors. ND: not detected, ocarb was also observed (Fig. 6C). The activity of methi- BNPP: bis(4-nitrophenyl)phosphate, CDMB: 2-chloro- ocarb was not significantly changed after incubation with 3,4-dimethoxybenzyl, MX: methylthio-3,5-xylenol liver microsomes, although the microsomal metabolites (methiocarb sulfoxide and sulfone) showed no PPARα agonistic activity (Fig. 7B). We have no data to explain of 10-30 μM were positive in the PXR, CAR, and PPARα the reason, but one possibility is that the lipid extract reporter assays. After hydrolytic metabolism, some of the from the liver microsomes have some agonistic activity to agonistic activities of methiocarb and carbaryl toward PPARα. In contrast, carbaryl activated CAR and PPARα PXR, CAR and PPARα were not changed while the activ- in this study; however, this ability may be maintained by ity of methiocarb was inactivated after it was oxidatively hydrolytic metabolism. metabolized (Fig. 6). Kojima et al. (2011) demonstrated the active response of pyributicarb against mouse PXR (mPXR) and human Metabolic modification of the nuclear receptor PXR (hPXR); however, methiocarb and carbaryl were activities of methiocarb with a rat liver negative when estimated from the REC20 value (20% rela- microsomal system tive effective concentration). REC20 is the concentration of The effects of the metabolism of methiocarb by a liv- a test compound which shows 20% of the agonist activity er microsomal system on nuclear receptor activities were of the positive control at 10 μM. Abass et al. (2012) also examined using liver microsomes from PB- and MC- investigated the hPXR activation by carbaryl, carbofuran, co-treated rats. When methiocarb was incubated with carbosulfan, benfuracarb, and furathiocarb at two concen-

Vol. 41 No. 5 685

Metabolism of carbamate pesticides and nuclear receptor activity

Fig. 5. Hydrolytic activity of rat and human albumin toward methiocarb (A) and carbaryl (B) and the effect of BNPP on the activi- ties. Each value represents the mean of duplicate determinations. Incubation was performed at 37°C for 10 min with 1 mg of rat and human albumin. MX and 1-naphthol formed were determined by HPLC. Other details are described in Materials and Methods. ND: not detected, BNPP: bis(4-nitrophenyl)phosphate, MX: methylthio-3,5-xylenol trations (10 μM and 50 μM). Carbaryl exhibited the high- to aldicarb sulfoxide but the formation of aldicarb sulfone est activity among these carbamates (i.e. 3-fold induction by rat and pig liver microsomes was found to be negligi- compared to vehicle control). It seemed that the ability ble or very low (Pelekis and Krishnan, 1997; Montesissa for rat PXR activation by carbamates is almost the same et al., 1994). However, aldicarb sulfone was also detected as that for mouse and human PXRs. In contrast, CAR as a minor in vivo metabolite of aldicarb in rats and pigs activation by carbaryl was shown to be relatively low- (Risher et al., 1987; Montesissa et al., 1994). In plants, er compared with other carbamates (Abass et al., 2012). ethiofencarb is hydrolyzed to its phenol derivative, con- However, we observed activations of rat PXR and CAR verted to the sulfoxide, and then slowly to the sulfone by methiocarb and carbaryl. Concerning the PPARα acti- (Cabras et al., 1989). However, the sulfone formation vation by carbamates, Takeuchi et al. (2006) investigat- pathway for methiocarb metabolism has not been demon- ed 22 carbamates and showed that there is limited affinity strated in animals. In the current study, we have shown of carbamates for PPARα. The results demonstrated that that methiocarb is metabolized to methiocarb sulfone via only pirimicarb was slightly positive at a concentration of methiocarb sulfoxide. 10 μM; however, the other carbamates, including methi- We have also demonstrated that methiocarb sulfox- ocarb and carbaryl were negative in mouse PPARα assay ide is oxidized to the sulfone by rat liver microsomes, systems. In the present study, both methiocarb and carbar- and reduced to the parent methiocarb by rat liver cytosol yl were positive in the rat PPARα activation assay. At this (Fig. 3). The oxidase activity to methiocarb sulfoxide moment, we are unable to explain the cause of the differ- from methiocarb was not significantly enhanced in the ences in these results; however, one possible reason may liver microsomes from CYP inducer-treated rats, but was be the difference in the affinities between methiocarb and observed to be slightly induced by treatment with MC and carbaryl for rat and mouse PPARαs. Dex. This is probably because the oxidation is catalyzed The metabolism of sulfur-containing carbamates to by several rat CYP isoforms including CYP1A, CYP2B, their sulfoxides, via sulfide oxidation is a well-known CYP2C and CYP3A enzymes, some of which are induc- pathway in insects, animals, and humans (Schlenk et al., ible by MC and Dex. In contrast, the oxidase activities 2002; Abass et al., 2009, 2010, 2014a, 2014b; Marsden to methiocarb sulfone from methiocarb and the sulfoxide et al., 1982; Pelekis and Krishnan, 1997; Tanaka et al., tended to be enhanced with liver microsomes from Dex- 1985; Usui and Umetsu, 1986). Methiocarb is oxidized treated rats (Fig. 1B and Fig. 3A). The oxidizing activ- to its sulfoxide, which also has anticholinesterase activ- ity that produces the sulfoxide appears to be exhibit- ity (Buronfosse et al., 1995). Aldicarb is easily oxidized ed by both CYPs and FMOs in rats and humans. Human

Vol. 41 No. 5 686

C. Fujino et al.

Fig. 6. Agonistic activities of methiocarb, carbaryl and their metabolites against rat PXR (A, D), CAR (B, E), and PPARα (C, F) in luciferase reporter assays. Nuclear receptor activations by test compounds are expressed as fold-induction versus the vehicle control. Each value represents the mean ± S.D. of four individual experiments. *p < 0.05, **p < 0.01, ***p < 0.001 com- pared with the vehicle control (Dunnet’s test). Other details are described in Materials and methods. PCN: 5-pregnen-3β-ol- 20-one-16α-carbonitrile, BZF: bezafibrate, MX: methylthio-3,5-xylenol, SP: 3,5-dimethyl-4-(methylsulfinyl)phenol, SOP: 3,5-dimethyl-4-(methylsulfonyl)phenol

Vol. 41 No. 5 687

Metabolism of carbamate pesticides and nuclear receptor activity

methiocarb may be mediated by aldehyde oxidase. A sim- ilar observation has been made in the reduction of fen- thion sulfoxide (Kitamura et al., 2003). The carbamoyl moiety in carbamate pesticides con- tains either an ester bond or an amide bond. Usually, the ester bond is more easily hydrolyzed by esterases as com- pared with the amide bond. We have shown that methi- ocarb, methiocarb sulfoxide, and carbaryl are hydro- lyzed to MX, SP, and 1-naphthol, respectively, via ester hydrolysis. Methiocarb and carbaryl were nonenzymati- cally hydrolyzed to some extent in liver but enzymati- cally hydrolyzed in plasma efficiently. It has been shown that some carbamates are nonenzymatically hydrolyzed (Vacondio et al., 2010). Sogorb and Vilanova (2002) demonstrated that some carbamate pesticides were not hydrolyzed by carboxylesterases in livers but were hydro- lyzed in the plasma of animals and humans. We previous- Fig. 7. Agonistic activity of methiocarb against rat PXR (A) ly reported that methiocarb and carbaryl are hydrolyzed and PPARα (B) after incubation with native or boiled in rat plasma. Because the metabolites from the hydroly- liver microsomes in luciferase reporter assay. Methio- sis showed estrogenic and anti-androgenic activities sim- carb was incubated with native or boiled liver micro- ilar to or higher than those of the parent compounds, the somes in the presence of NADPH, and the extracts of conversion may be an activation process to some extent the incubation mixtures were assayed. Activity is ex- pressed as fold-induction versus the vehicle control. (Tange et al., 2016). Hydrolases contained in human plas- Each value represents the mean ± S.D. of four individ- ma include albumin, acetylcholinesterase, butyrylcho- ual experiments. **Significant differences (p < 0.01) linesterase, and paraoxonase while the hydrolase present between the test group (metabolites) and the control in rat plasma is carboxylesterase. Albumin, butyrylcho- group (boiled microsome) (Student’s t-test). Other linesterase, and paraoxonase are present in high concen- details are described in Materials and methods. PCN: 5-pregnen-3β-ol-20-one-16α-carbonitrile, BZF: bezafi- trations in humans, enough to contribute to ester hydrol- brate ysis (Li et al., 2005). Carbaryl is easily hydrolyzed by serum albumin but not by carboxylesterase (Sogorb and Vilanova, 2002). In this study, the hydrolytic metabo- FMO1 was found to contribute to the sulfoxidation of lism of methiocarb and carbaryl in human plasma have aldicarb, ethiofencarb, and methiocarb (Grothusen et al., been shown. When the results were compared with those 1996; Schlenk et al., 2002; Furnes and Schlenk, 2005). obtained in rat plasma (Tange et al., 2016), the suscep- Usmani et al. (2004) have shown the involvement of tibilities of methiocarb and carbaryl to the metabolism human CYP2C and FMO1 in methiocarb sulfoxida- seemed equivalent in both plasmas. tion. We also showed that methiocarb was converted to In the present study, carboxylesterase did not func- the sulfoxide by CYP2C19 and FMO1, but other CYP tion as a hydrolase toward methiocarb or carbaryl. Car- isoforms also showed some activities for the sulfoxi- bamate compounds have been reported to inhibit car- dation of methiocarb (Fig. 2). The oxidation of methio- boxylesterase activity both in vivo and in vitro (Barata et carb to the sulfoxide by rat liver microsomes tended to be al., 2004; Crow et al., 2012; Gupta and Dettbarn, 1993). induced by treatment with MC and Dex, but not with PB Barata et al. (2004) reported an inhibitory effect of carbo- (Fig. 1A). This discrepancy may be explained by the pos- furan on carboxylesterase, which is why carbofuran is not sibility that multiple rat CYP isoforms contributed to the hydrolyzed by carboxylesterase. Following single dose sulfoxidation, or by the species differences of CYP met- administrations to rats, aldicarb and carbofuran showed abolic activities between rats and humans. Furthermore, greater inhibitory activities toward carboxylesterase than in the present study, we have found that a hydrolysis toward acetylcholinesterase (Gupta and Dettbarn, 1993). metabolite of methiocarb, MX, is also metabolized to a This may be the reason why carbamate pesticides are not sulfur-oxidized metabolite, SP, by CYP1A2, CYP2C19, hydrolyzed by carboxylesterase. In this study, methio- CYP2B6, CYP2D6 and FMO1 in humans. In contrast, carb and carbaryl were enzymatically hydrolyzed in rat reverse reductive metabolism of methiocarb sulfoxide to and human plasmas; however, these hydrolytic activities

Vol. 41 No. 5 688

C. Fujino et al.

Fig. 8. Proposed metabolic pathways of methiocarb by rat liver preparations and plasma, and the effects of metabolism on their PXR, CAR and PPARα activation. MX: methylthio-3,5-xylenol, SP: 3,5-dimethyl-4-(methylsulfinyl)phenol, SOP: 3,5- dimethyl-4-(methylsulfonyl)phenol were inhibited by BNPP (100 μM), which is a nonspecific ic activities may be a consequence of reduced affinity of carboxylesterase inhibitor. The hydrolytic activity of car- methiocarb for the receptors involved. This may be due baryl was also inhibited by eserine (physostigmine) and to an increased hydrophilicity or steric hindrance around CDMB. Eserine is a cholinesterase inhibitor while CDMB the methyl-thioether-sulfur moiety in the compound. The is a carboxylesterase 2 selective inhibitor. The inhibito- reduction pathway of methiocarb sulfoxide to methiocarb ry effect of these chemicals on plasma esterases, other was also newly demonstrated in this study. The intercon- than carboxylesterase cannot be explained. The inhibito- version between methiocarb and methiocarb sulfoxide ry effect of BNPP on albumin-mediated hydrolytic activ- may contribute to the maintenance of the biological activ- ity was observed in this study although the mechanism of ities of PXR, CAR and PPARα. In fact, we have report- BNPP to inhibit albumins is unknown. ed that the anti-androgenic activity of fenthion, an orga- In summary, our study indicated that rat liver micro- nophosphate pesticide, is lost upon oxidation to fenthion somes converted methiocarb to methiocarb sulfoxide, and sulfoxide by rat liver microsomes. However, the fenthion MX to SP. Furthermore, methiocarb was converted to MX is recovered by the reduction of the sulfoxide (Kitamura by the plasma and albumin of both rats and humans. The et al., 2003). In contrast, the metabolites from the hydrol- further oxidation of methiocarb sulfoxide to methiocarb ysis of methiocarb and carbaryl showed activities similar sulfone by liver microsomes has also been shown in this to or higher than those of the parent compounds. Thus, study. Carbaryl is hydrolyzed to 1-naphthol. Methiocarb the nuclear receptor activities of these pesticides seem to and carbaryl showed PXR, CAR and PPARα activities in be exhibited by the aryl moieties in them. The metabol- reporter gene assays. It was reported that the inhibitory ic pathways of methiocarb and the effects of the metabo- effects of aldicarb sulfoxide and sulfone against acetyl- lism on the activities of PXR, CAR, and PPARα are sum- cholinesterase were similar with those of aldicarb (Risher marized in Fig. 8. These results suggest that methiocarb is et al., 1987). We also observed in our study that the nucle- metabolically converted by liver microsomes to methio- ar receptor activities of methiocarb were almost abrogated carb sulfoxide and sulfone, which are nuclear receptor-in- owing to conversion to its sulfoxide and sulfone metab- active. However, some receptor activity was retained by olites. In our previous study, the estrogenic and anti-an- the formation of the products from hydrolysis. drogenic activities of methiocarb were similarly lost by There is a possibility of human exposure to carbamate the oxidation of methiocarb to methiocarb sulfoxide. The pesticides. Infants and children are potentially exposed to reason for the decreased estrogenic and anti-androgen- carbamates and organophosphates after household appli-

Vol. 41 No. 5 689

Metabolism of carbamate pesticides and nuclear receptor activity cations of these pesticides. This is because the chemicals olism of carbosulfan. I. Species differences in the in vitro accumulate on toys and other surfaces accessible to the biotransformation by mammalian hepatic microsomes including human. Chem. Biol. Interact., 181, 210-219. children. Exposure may also occur via dust particles onto Abass, K., Reponen, P., Mattila, S. and Pelkonen, O. (2010): Metab- which these pesticides are adsorbed. In men, carbofuran olism of carbosulfan. II. Human interindividual variability in its decreases the weight of the testes, delays spermatogene- in vitro hepatic biotransformation and the identification of the sis, and induces necrosis of spermatogonia and sperma- cytochrome P450 isoforms involved. Chem. Biol. Interact., 185, tocytes. Sperm shape abnormalities in workers exposed 163-173. Abass, K., Reponen, P., Mattila, S., Rautio, A. and Pelkonen, O. to carbaryl, and immunomodulatory effects of mancozeb (2014a): Comparative metabolism of benfuracarb in in vitro in agricultural workers have also been reported (Wyrobek mammalian hepatic microsomes model and its implications for et al., 1981; Xia et al., 2005; Corsini et al., 2005). The chemical risk assessment. Toxicol. Lett., 224, 290-299. effect of pesticides including carbamates, on chronic dis- Abass, K., Reponen, P., Mattila, S., Rautio, A. and Pelkonen, O. eases such as cancers, reproductive disorders and diabetes (2014b): Human variation and CYP enzyme contribution in ben- furacarb metabolism in human in vitro hepatic models. Toxicol. in humans has been reviewed (Mostafalou and Abdollahi, Lett., 224, 300-309. 2013). Our present results indicate that methiocarb and Ali Jorsaraei, S.G., Maliji G., Azadmehr, A., Moghadamnia, A.A. carbaryl are metabolized by esterase, aldehyde oxidase, and Faraji, A.A. (2014): Immunotoxicity effects of carbaryl in FMO, and the CYP system. Hydrolytic, reductive, and vivo and in vitro. Environ. Toxicol. Pharmacol., 38, 838-844. oxidative metabolism are important determinants for the Andersen, H.R., Vinggaard, A.M., Rasmussen, T.H., Gjermandsen, I.M. and Bonefeld-Jørgensen, E.C. (2002): Effects of cur- biological activities of carbamate pesticides. Further stud- rently used pesticides in assays for estrogenicity, andro- ies in humans, on the inter-individual variations in the genicity, and aromatase activity in vitro. Toxicol. Appl. activities of these enzymes are necessary. Pharmacol., 179, 1-12. In conclusion, we investigated the metabolism of Baligar, P.N. and Kaliwal, B.B. (2002): Reproductive toxicity of carbofuran to the female mice: Effects on estrous cycle and folli- methiocarb and carbaryl, and their effects on the activi- cles. Ind. Health, 40, 345-352. ties of PXR, CAR and PPARα. Methiocarb and carbaryl Barata, C., Solayan, A. and Porte, C. (2004): Role of B-esterases in were hydrolyzed by plasma and albumin. Methiocarb and assessing toxicity of organophosphorus (chlorpyrifos, malathion) the product of its hydrolysis, MX, were further oxidized and carbamate (carbofuran) pesticides to Daphnia magna. Aquat. to their sulfoxides by CYP and FMO. Methiocarb sulfox- Toxicol., 66, 125-139. Birkhøj, M., Nellemann, C., Jarfelt, K., Jacobsen, H., Andersen, ide was oxidized to a sulfone and reduced back to methi- H.R., Dalgaard, M. and Vinggaard, A.M. (2004): The com- ocarb by liver preparations. Methiocarb and MX exhib- bined antiandrogenic effects of five commonly used pesticides. ited PXR and PPARα activities but their sulfoxides did Toxicol. Appl. Pharmacol., 201, 10-20. not. The products of methiocarb and carbaryl hydrolysis Bouchard, M., Carrier, G. and Brunet, R.C. (2008): Assessment of exhibited PXR and PPARα activities to the same extent as absorbed doses of carbaryl and associated health risks in a group of horticultural greenhouse workers. Int. Arch. Occup. Environ. the parent compounds. Health, 81, 355-370. Buronfosse, T., Moroni, P., Benoît, E. and Rivière, J.L. (1995): Ster- ACKNOWLEDGMENTS eoselective sulfoxidation of the pesticide methiocarb by fla- vin-containing monooxygenase and cytochrome P450-depend- ent monooxygenases of rat liver microsomes. Anticholinesterase This work was supported by Grants-in-Aid from activity of the two sulfoxide enantiomers. J. Biochem. Toxicol., Food Safety Commission, Japan (No. 1302), Grant-in- 10, 179-189. Aid (#25340049 to S.K.) from the Japanese Ministry of Cabras, P., Meloni, M., Plumitallo, A. and Gennari, M. (1989): Education, Science, Sports, and Culture, and Nihon Phar- High-performance liquid chromatographic determination of maceutical University Research Grant (#201405 to N.U. ethiofencarb and its metabolic products. J. Chromatogr. A, 462, 430-434. and #201401 to Y.W.). Cheng, S., Chen, J., Qui, Y., Hong, X., Xia, Y., Feng, T., Liu, J., Song, L., Zhang, Z. and Wang, X. (2006): Carbaryl inhibits basal Conflict of interest---- The authors declare that there is and FSH-induced progesterone biosynthesis of primary human no conflict of interest. granulosa-lutein cells. Toxicology, 220, 37-45. Corsini, E., Birindelli, S., Fustinoni, S., De Paschale, G., Mammone, T., Visentin, S., Galli, C.L., Marinovich, M. and REFERENCES Colosio, C. (2005): Immunomodulatory effects of the fungicide mancozeb in agricultural workers. Toxicol. Appl. Pharmacol., Abass, K., Lämsä, V., Reponen, P., Küblbeck, J., Honkakoski, P., 208, 178-185. Mattila, S., Pelkonen, O. and Hakkola, J. (2012): Characterization Crow, J.A., Bittles, V., Borazjani, A., Potter, P.M. and Ross, M.K. of human cytochrome P450 induction by pesticides. Toxicology, (2012): Covalent inhibition of recombinant human carboxyleste- 294, 17-26. rase 1 and 2 and monoacylglycerol lipase by the carbamates Abass, K., Reponen, P., Mattila, S. and Pelkonen, O. (2009): Metab- JZL184 and URB597. Biochem. Pharmacol., 84, 1215-1222.

Vol. 41 No. 5 690

C. Fujino et al.

Fan, L.Q., Cattley, R.C. and Corton, J.C. (1998): Tissue-specific Cantareus apertus exposed to the carbamate pesticide Carbaryl. induction of 17 beta-hydroxysteroid dehydrogenase type IV by Comp. Biochem. Physiol. C Toxicol. Pharmacol., 168, 20-27. peroxisome proliferator chemicals is dependent on the peroxi- Li, B., Sedlacek, M., Manoharan, I., Boopathy, R., Duysen, E.G., some proliferator-activated receptor alpha. J. Endocrinol., 158, Masson, P. and Lockridge, O. (2005): Butyrylcholinesterase, 237-246. paraoxonase, and albumin esterase, but not carboxylesterase, are Furnes, B. and Schlenk, D. (2005): Extrahepatic metabolism of car- present in human plasma. Biochem. Pharmacol., 70, 1673-1684. bamate and organophosphate thioether compounds by the flavin- Lin, C.C., Hui, M.N. and Cheng, S.H. (2007): Toxicity and cardi- containing monooxygenase and cytochrome P450 systems. Drug ac effects of carbaryl in early developing zebrafish (Danio rerio) Metab. Dispos., 33, 214-218. embryos. Toxicol. Appl. Pharmacol., 222, 159-168. Grothusen, A., Hardt, J., Bräutigam, L., Lang, D. and Böcker, R. Marsden, P.J., Kuwano, E. and Fukuto, T.R. (1982): Metabolism (1996): A convenient method to discriminate between cyto- of carbosulfan [2,3-dihydro-2,2-dimethylbenzofuran-7-yl (di-n- chrome P450 enzymes and flavin-containing monooxygenases in butylaminothio)methylcarbamate] in the rat and house fly. Pesti- human liver microsomes. Arch. Toxicol., 71, 64-71. cide Biochem. Physiol., 18, 38-48. Gupta, R.C. and Dettbarn, W.-D. (1993): Role of carboxylesterases Montesissa, C., Huveneers, M.B., Hoogenboom, L.A., Amorena, in the prevention and potentiation of N-methylcarbamate toxici- M., De Liguoro, M. and Lucisano, A. (1994): The oxidative ty. Chem. Biol. Interact., 87, 295-303. metabolisms of aldicarb in pigs: in vivo-in vitro comparison. Gupta, R.C., Milatovic, S., Dettbarn, W.-D., Aschner, M. and Drug Metabol. Drug Interact., 11, 127-138. Milatovic, D. (2007): Neuronal oxidative injury and dendrit- Mostafalou, S. and Abdollahi, M. (2013): Pesticides and human ic damage induced by carbofuran: Protection by memantine. chronic diseases: Evidences, mechanisms, and perspectives. Toxicol. Appl. Pharmacol., 219, 97-105. Toxicol. Appl. Pharmacol., 268, 157-177. Hajjar, N.P. and Hodgson, E. (1980): Flavin adenine dinucleotide- Ozden, S., Catalgol, B., Gezginci-Oktayoglu, S., Karatug, A., dependent monooxygenase: its role in the sulfoxidation of pesti- Bolkent, S. and Alpetunga, B. (2013): Acute effects of methio- cides in mammals. Science, 209, 1134-1136. carb on oxidative damage and the protective effects of vitamin Imai, J., Yamazoe, Y. and Yoshinari, K. (2013): Novel cell-based E and taurine in the liver and kidney of Wistar rats. Toxicol. Ind. reporter assay system using epitope-tagged protein for the iden- Health, 29, 60-71. tification of agonistic ligands of constitutive androstane receptor Pelekis, M. and Krishnan, K. (1997): Determination of the rate of (CAR). Drug Metab. Pharmacokinet., 28, 290-298. aldicarb sulphoxidation in rat liver, kidney and lung microsomes. Kawamoto, T., Sueyoshi, T., Zelko, I., Moore, R., Washburn, K., Xenobiotica, 27, 1113-1120. and Negishi, M. (1999): Phenobarbital-responsive nuclear trans- Reddy, J.K. and Hashimoto, T. (2001): Peroxisomal beta-oxidation location of the receptor CAR in induction of the CYP2B gene. and peroxisome proliferator-activated receptor alpha: An adap- Mol. Cell Biol., 19, 6318-6322. tive metabolic system. Annu. Rev. Nutr., 21, 193-230. Kitamura, S., Suzuki, T., Ohta, S. and Fujimoto, N. (2003): Antian- Risher. J.F., Mink, F.L. and Stara, J.F. (1987): The toxicolog- drogenic activity and metabolism of the organophosphorus pesti- ic effects of the carbamate insecticide aldicarb in mammals: A cide fenthion and related compounds. Environ. Health Perspect., review. Environ. Health Perspect., 72, 267-281. 111, 503-508. Schlenk, D., Cashman, J.R., Yeung, C., Zhang, X. and Rettie, A.E. Kitamura, S., Sugihara, K. and Ohta, S. (2006): Drug-metab- (2002): Role of human flavin-containing monooxygenases in the olizing ability of molybdenum hydroxylases. Drug Metab. sulfoxidation of [14C]aldicarb. Pesticide Biochem. Physiol., 73, Pharmacokinet., 21, 83-98. 67-73. Kitamura, S., Sugihara, K., Sanoh, S., Fujimoto, N. and Ohta, S. Sinha, N., Lal, B. and Singh, T.P. (1991): Carbaryl-induced thy- (2008): Metabolic activation of proestrogens in the environment roid dysfunction in the freshwater catfish Clarias batrachus. by cytochrome P450 system. J. Health Sci., 54, 343-355. Ecotoxicol. Environ. Safety, 21, 240-247. Klotz, D.M., Arnold, S.F. and McLachlan, J.A. (1997): Inhibition of Sogorb, M.A. and Vilanova, E. (2002): Enzymes involved in the 17 beta-estradiol and progesterone activity in human breast and detoxification of organophosphorus, carbamate and pyrethroid endometrial cancer cells by carbamate insecticides. Life Sci., insecticides through hydrolysis. Toxicol. Lett., 128, 215-228. 60, 1467-1475. Soler, C., Hamilton, B., Furey, A., James, K.J., Mañes, J. and Picó, Kojima, H., Takeuchi, S. and Nagai, T. (2010): Endocrine-disrupt- Y. (2007): Liquid chromatography quadrupole time-of-flight ing potential of pesticides via nuclear receptors and aryl hydro- mass spectrometry analysis of carbosulfan, carbofuran, 3-hy- carbon receptor. J. Health Sci., 56, 374-386. droxycarbofuran, and other metabolites in food. Anal. Chem., Kojima, H., Katsura, E., Takeuchi, S., Niiyama, K. and Kobayashi, K. 79, 1492-1501. (2004): Screening for estrogen and androgen receptor activities in Sun, H., Shen, O.X., Xu, X.L., Song, L. and Wang, X.R. (2008): 200 pesticides by in vitro reporter gene assays using Chinese ham- Carbaryl, 1-naphthol and 2-naphthol inhibit the beta-1 thyroid ster ovary cells. Environ. Health Perspect., 112, 524-531. hormone receptor-mediated transcription in vitro. Toxicology, Kojima, H., Sata, F., Takeuchi, S., Sueyoshi, T. and Nagai, T. 249, 238-242. (2011): Comparative study of human and mouse pregnane X Takeuchi, S., Matsuda, T., Kobayashi, S., Takahashi, T. and receptor agonistic activity in 200 pesticides using in vitro report- Kojima, H. (2006): In vitro screening of 200 pesticides for ago- er gene assays. Toxicology, 280, 77-87. nistic activity via mouse peroxisome proliferator-activated recep- Kretschmer, X.C. and Baldwin, W.S. (2005): CAR and PXR: Xeno- tor (PPAR)α and PPARγ and quantitative analysis of in vivo sensors of endocrine disrupters? Chem. Biol. Interact., 155, induction pathway. Toxicol. Appl. Pharmacol., 217, 235-244. 111-128. Tanaka, A.K., Umetsu, N. and Fukuto, T.R. (1985): Metabolism Leomanni, A., Schettino, T., Calisi, A., Gorbi, S., Mezzelani, M., of benfuracarb in young cotton, bean, and corn plants. J. Agric. Regoli, F. and Lionetto, M.G. (2015): Antioxidant and oxi- Food Chem., 33, 1049-1055. dative stress related responses in the Mediterranean land snail Tange, S., Fujimoto, N., Uramaru, N., Wong, F.F., Sugihara, K., Ohta,

Vol. 41 No. 5 691

Metabolism of carbamate pesticides and nuclear receptor activity

S. and Kitamura, S. (2016): In vitro metabolism of methiocarb and Vidair, C.A. (2004): Age dependence of organophosphate and car- carbaryl in rats, and its effect on their estrogenic and antiandro- bamate neurotoxicity in the postnatal rat: extrapolation to the genic activities. Environ. Toxicol. Pharmacol., 41, 289-297. human. Toxicol. Appl. Pharmacol., 196, 287-302. Timsit, Y.E. and Negishi, M. (2007): CAR and PXR: the xenobiot- Watanabe, K., Sakurai, K., Tsuchiya, Y., Yamazoe, Y. and Yoshinari, ic-sensing receptors. Steroids, 72, 231-246. K. (2013): Dual roles of nuclear receptor liver X receptor α Usmani, K.A., Karoly, E.D., Hodgson, E. and Rose, R.L. (2004): (LXRα) in the CYP3A4 expression in human hepatocytes as a In vitro sulfoxidation of thioether compounds by human cyto- positive and negative regulator. Biochem. Pharmacol., 86, 428-36. chrome P450 and flavin-containing monooxygenase isoforms Wyrobek, A.J., Watchmaker, G., Gordon, L., Wong, K., Moore II, D. with particular reference to the CYP2C subfamily. Drug Metab. and Whortont, D. (1981): Sperm shape abnormalities in carbar- Dispos., 32, 333-339. yl-exposed employees. Envirn. Health Perspect., 40, 255-265. Usui, M. and Umetsu, N. (1986): Metabolism of the insecticide ben- Xia, Y., Cheng, S., Bian, Q., Xu, L., Collins, M.D., Chang, H.C., furacarb in the housefly. J. Pesticide Sci., 11, 401-408. Song, L., Liu, J., Wang, S. and Wang, X. (2005): Genotoxic Vacondio, F., Silva, C., Mor, M. and Testa, B. (2010): Qualita- effects on spermatozoa of carbaryl-exposed workers. Toxicol. tive structure-metabolism relationships in the hydrolysis of car- Sci., 85, 615-623. bamates. Drug Metab. Rev., 42, 551-589.

Vol. 41 No. 5