DOCSLIB.ORG

Bulletin Number / Numero 1 Entomological Society of Canada Société D'entomologie Du Canada March / Mars 2005

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Bulletin Number / Numero 1 Entomological Society of Canada Société D'entomologie Du Canada March / Mars 2005 Volume 37 Bulletin Number / numero 1 Entomological Society of Canada Société d'entomologie du Canada March / mars 2005 ........................................................................ Published quarterly by the Entomological Society of Canada Publication trimestrielle par la Société d'entomologie du Canada ○○○○○○○○○○○○○○○○○○○○○○○○○ .................................................................. ............. ...................................................................................................................................................................................... ............................................... ............................................................................................................................... ............ ......................................................................................................................................................................................... ......... ........................................................................................ ................................................. List of contents / Table des matières Volume 37 (1), March / mars 2005 Up front / Avant-propos ....................................................................................................................1 Moth balls / Boules à Mites ...............................................................................................................3 Gold medal address / Allocution du médaillé d'or ..........................................................................4 Heritage lecture / Allocution du patrimoine ...................................................................................10 Tricks of the trade / Trucs et astuces ..............................................................................................20 The adventures of Ento-man / Les aventures d’Ento-homme ....................................................23 Lab profile / Profil de labo ...............................................................................................................24 The student wing / L'aile étudiante .................................................................................................28 Joint annual meeting / Congrès conjoint .......................................................................................34 Book reviews / Critiques de livres ...................................................................................................42 Biological survey of Canada / Commission biologique du Canada.............................................45 In memory / En souvenir de ............................................................................................................48 Meeting announcements / Réunions futures .................................................................................53 Society business / Affaires de la société ..........................................................................................54 Governing board / Conseil d’administration ................................................................................62 Officers of affiliated societies / Dirigeants des sociétés associées .................................................63 The Buzz / Bourdonnements ..........................................................................................................64 Images Sur le dos : La cicindèle à six points, Cicindela sexguttata Fabricius (Cicindellidae), un coléoptère prédateur commun dans l'est de l'Amérique du Nord, photo : H. Goulet. Sous le titre : L'agrile du frêne, Agrilus planipennis Fairmaire (Buprestidae), un coléoptère exotique originaire d'Asie qui menace les frênes d'Amérique du Nord, photo : K. Bolte. Page titre : 1. Acyrthosiphon pisum (Harris) (Aphididae), une espèce utilisée dans les études sur la saisonnalité, photo : R. Lamb. 2. Pièges utilisés en verger de pommier pour déterminer les niveaux de population de l'hoplocampe des pommes, Hoplocampa testudinea (Klug) (Tenthredinidae), photo : C. Vincent. 3. Pins tordus tués par le dendroctone du pin ponderosa, Dendroctonus ponderosae Hopkins (Scolyti- dae), en Colombie-Britannique, photo : A. Carroll. 4. Syrphus ribesii Linnaeus (Syrphidae), une espèce de syrphe se nourrissant de nectar et communément trouvée dans les jardins, les haies et les boisés, photo : S. Marshall. 5. Parcelles de recherche utilisées pour étudier l'impact de Macrosiphum euphorbiae (Thomas) (Aphidi- dae) sur le lin, photo : R. Lamb. Verso : Ixodes gregsoni Lindquist, Wu and Redner (Ixodidae), une tique parasite des mustélidés, photo : K. Bolte. 1 5 4 2 3 Up front / Avant-propos Robert Lamb, President of ESC / Président de la SEC Que fait votre Président? éaliser que je suis Président depuis presque trois mois fut une surprise. Ma Rfonction principale en tant que Président du comité exécutif est de m'assurer que les affair- es de la Société sont exécutées. En fait, la majorité des affaires de la SEC sont exécutées par des fiduciaires et des comités, qui les prennent en P. MacKay P. charge de façon très efficace avec bien peu What does your President do? d'interventions de ma part. Ma première tâche était de réunir les présidents de ces comités. Je veux ealizing that I have already been Presi- remercier tous les présidents et leur comité, ainsi dent for almost three months came as a que les fiduciaires, pour leur rôle dans les affaires surprise. My prime task, as chair of the de la Société. R Je reçois également de la correspondance, par- executive, is to assure that Society business is executed. In fact, most ESC business is executed fois intéressante, parfois un peu moins, mais toute by Trustees and Committees, who carry on very doit être répondue. Par exemple, j'ai dû refuser effectively with little input from me. My first duty poliment de prendre en faveur d'un groupe de was to appoint the Chairs of these Committees. I citoyens voulant bannir les pesticides de leur ville. want to thank all the Chairs and their Commit- Par contre, correspondre avec un étudiant vou- tees, as well as the Trustees, for their roles in the lant en savoir plus sur l'entomologie judiciaire fut business of the Society. un plaisir. Encore plus intéressant fut un message I also receive correspondence, some interest- électronique demandant de l'information sur un ing, some less so, but all must be answered. For père décédé durant une expédition entomologique example, I had to politely decline to weigh in on quarante ans plus tôt. Je n'avais qu'un nom. Ma behalf of a citizen's group wanting to ban pesti- première pensée a été : ceci va me prendre toute la cides from their city. Corresponding with a stu- journée. Puis, Paul Fields m'a rappelé l’Index des dent interested in finding out more about forensic biographies des entomologistes dans les publi- entomology was a pleasure. Most interesting was cations canadiennes de Eidt, Riegert et Becker, an e-mail requesting information on a father who affichée dans la section membre de notre site in- died on an entomological expedition four dec- ternet. Cinq minutes plus tard, j'avais une notice ades ago. I had only a name. My first thought nécrologique détaillée. Regardant dans la biogra- was: this is going to take all day. Then Paul Fields phie pour la première fois, j'ai réalisé quels serv- reminded me of the Biography of Entomologists ices ces trois membres de la SEC ont rendu pour in Canadian Publications by Eidt, Riegert and l'histoire de l'entomologie canadienne. Becker, posted in the members area of our web- Une autre réalisation récente, bien quelle ne site. Five minutes later, I had a detailed obituary. soit pas de moi, a été la création d'une nouvelle Looking through the Biography for the first time couverture, ainsi qu'une mise à jour du format I realized what a service these three ESC mem- pour The Canadian Entomologist. Ces change- bers have performed for the history of Canadian ments ont impliqué de solliciter et d'évaluer des entomology. photographies d'insectes, de réviser et de con- A recent accomplishment, although not mine, denser le texte fourni sur les couvertures, et de was a new cover for The Canadian Entomolo- donner au journal un style plus moderne et plus Volume 37(1) mars, 2005 Bulletin de la Société d'entomologie du Canada 1 Up front gist, and an update of its format. These changes attrayant. Merci au trésorier Gary Gibson, au involved soliciting and judging photographs of Président sortant Charles Vincent, et au rédacteur insects, revising and condensing text that is pro- en chef Richard Ring pour leur contribution, ain- vided on the covers, and giving the journal a more si que le président du comité Allan Carrol et les modern and eye-catching look. Thanks to then membres du Comité des publications pour le tra- Treasurer Gary Gibson, Past-President Charles vail complété à temps pour les numéros de 2005 Vincent, and Editor-in-Chief Richard Ring for du journal. their contribution, and Chair Allan Carroll and Un objectif important pour cette année est une members of the Publications Committee for com- révision stratégique, telle que mentionnée par le pleting the work in time for 2005 issues of the Président sortant Vincent dans le numéro de journal. décembre 2004. La dernière révision, complétée An important goal for this year is a Strategic en 1996, était centrée sur la structure organisa- Review, mentioned by then-President Vincent in tionnelle, les publications, l'amélioration des rev- the December 2004 issue. The last review, com- enus, les
Load more

Recommended publications
  • Integration of Entomopathogenic Fungi Into IPM Programs: Studies Involving Weevils (Coleoptera: Curculionoidea) Affecting Horticultural Crops
    insects Review Integration of Entomopathogenic Fungi into IPM Programs: Studies Involving Weevils (Coleoptera: Curculionoidea) Affecting Horticultural Crops Kim Khuy Khun 1,2,* , Bree A. L. Wilson 2, Mark M. Stevens 3,4, Ruth K. Huwer 5 and Gavin J. Ash 2 1 Faculty of Agronomy, Royal University of Agriculture, P.O. Box 2696, Dangkor District, Phnom Penh, Cambodia 2 Centre for Crop Health, Institute for Life Sciences and the Environment, University of Southern Queensland, Toowoomba, Queensland 4350, Australia; [email protected] (B.A.L.W.); [email protected] (G.J.A.) 3 NSW Department of Primary Industries, Yanco Agricultural Institute, Yanco, New South Wales 2703, Australia; [email protected] 4 Graham Centre for Agricultural Innovation (NSW Department of Primary Industries and Charles Sturt University), Wagga Wagga, New South Wales 2650, Australia 5 NSW Department of Primary Industries, Wollongbar Primary Industries Institute, Wollongbar, New South Wales 2477, Australia; [email protected] * Correspondence: [email protected] or [email protected]; Tel.: +61-46-9731208 Received: 7 September 2020; Accepted: 21 September 2020; Published: 25 September 2020 Simple Summary: Horticultural crops are vulnerable to attack by many different weevil species. Fungal entomopathogens provide an attractive alternative to synthetic insecticides for weevil control because they pose a lesser risk to human health and the environment. This review summarises the available data on the performance of these entomopathogens when used against weevils in horticultural crops. We integrate these data with information on weevil biology, grouping species based on how their developmental stages utilise habitats in or on their hostplants, or in the soil.
    [Show full text]
  • A Review of Natural Joint Systems and Numerical Investigation of Bio-Inspired GFRP-To-Steel Joints
    materials Article A Review of Natural Joint Systems and Numerical Investigation of Bio-Inspired GFRP-to-Steel Joints Evangelos I. Avgoulas and Michael P. F. Sutcliffe * Department of Engineering, University of Cambridge, Trumpington Street, Cambridge CB2 1PZ, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-1223-332-996 Academic Editor: Frank Müller Received: 25 April 2016; Accepted: 1 July 2016; Published: 12 July 2016 Abstract: There are a great variety of joint types used in nature which can inspire engineering joints. In order to design such biomimetic joints, it is at first important to understand how biological joints work. A comprehensive literature review, considering natural joints from a mechanical point of view, was undertaken. This was used to develop a taxonomy based on the different methods/functions that nature successfully uses to attach dissimilar tissues. One of the key methods that nature uses to join dissimilar materials is a transitional zone of stiffness at the insertion site. This method was used to propose bio-inspired solutions with a transitional zone of stiffness at the joint site for several glass fibre reinforced plastic (GFRP) to steel adhesively bonded joint configurations. The transition zone was used to reduce the material stiffness mismatch of the joint parts. A numerical finite element model was used to identify the optimum variation in material stiffness that minimises potential failure of the joint. The best bio-inspired joints showed a 118% increase of joint strength compared to the standard joints. Keywords: natural joints; adhesive joints; biomimetics; bio-inspiration; composites 1. Introduction In recent years, the use of composite materials in automotive and aerospace industries has shown an upward trend due to their good stiffness-to-weight (E/r) and strength-to-weight (s/r) ratios.
    [Show full text]
  • An Annotated Checklist of Wisconsin Scarabaeoidea (Coleoptera)
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Center for Systematic Entomology, Gainesville, Insecta Mundi Florida March 2002 An annotated checklist of Wisconsin Scarabaeoidea (Coleoptera) Nadine A. Kriska University of Wisconsin-Madison, Madison, WI Daniel K. Young University of Wisconsin-Madison, Madison, WI Follow this and additional works at: https://digitalcommons.unl.edu/insectamundi Part of the Entomology Commons Kriska, Nadine A. and Young, Daniel K., "An annotated checklist of Wisconsin Scarabaeoidea (Coleoptera)" (2002). Insecta Mundi. 537. https://digitalcommons.unl.edu/insectamundi/537 This Article is brought to you for free and open access by the Center for Systematic Entomology, Gainesville, Florida at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Insecta Mundi by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. INSECTA MUNDI, Vol. 16, No. 1-3, March-September, 2002 3 1 An annotated checklist of Wisconsin Scarabaeoidea (Coleoptera) Nadine L. Kriska and Daniel K. Young Department of Entomology 445 Russell Labs University of Wisconsin-Madison Madison, WI 53706 Abstract. A survey of Wisconsin Scarabaeoidea (Coleoptera) conducted from literature searches, collection inventories, and three years of field work (1997-1999), yielded 177 species representing nine families, two of which, Ochodaeidae and Ceratocanthidae, represent new state family records. Fifty-six species (32% of the Wisconsin fauna) represent new state species records, having not previously been recorded from the state. Literature and collection distributional records suggest the potential for at least 33 additional species to occur in Wisconsin. Introduction however, most of Wisconsin's scarabaeoid species diversity, life histories, and distributions were vir- The superfamily Scarabaeoidea is a large, di- tually unknown.
    [Show full text]
  • Cephalcia Lariciphila
    Prepared by CABI and EPPO for the EU under Contract 90/399003 Data Sheets on Quarantine Pests Cephalcia lariciphila IDENTITY Name: Cephalcia lariciphila Wachtl Synonyms: Cephalcia alpina Klug Cephalcia annulata Hartig Lyda alpina Klug Taxonomic position: Insecta: Hymenoptera: Pamphiliidae Common names: European web-spinning larch sawfly (English) Lärchen-Gespinstblattwespe (German) Bayer computer code: CEPCAL EU Annex designation: II/B HOSTS This insect attacks Larix spp., e.g. L. decidua and L. leptolepis. Interspecific hybrids are also attacked. GEOGRAPHICAL DISTRIBUTION EPPO region: Austria, Belgium, Czech Republic, Denmark, Finland, France, Germany, Italy, Netherlands, Russia (European, Siberia), Slovakia, Sweden, Switzerland, UK. EU: Present. BIOLOGY Adults fly in May-June, males often being more common. Eggs are deposited singly on short-shoot needles. Larvae spin a web-tube at the bases of the short shoots and remain in the web while consuming the needles. Most feeding takes place in July. The old larvae drop to the ground where they remain free as eonymphs without a cocoon 5-20 cm below the surface. In September they develop into pronymphs which overwinter. Pupation occurs in spring. Larvae may however remain in the soil as eonymphs for as many as four winters before they pupate (Röhrig, 1953; Pschorn-Walcher, 1982). A development cycle of 1-2 years is normal but, in some places, e.g. the Netherlands, up to 44% of the population was reported to have at least a 3-year generation cycle (Luitjes & Minderman, 1959). During outbreaks, population densities of 57-372 nymphs/m2 of soil were found. DETECTION AND IDENTIFICATION Symptoms C. lariciphila cuts the needle at the bases and pulls it into the web where it is eaten.
    [Show full text]
  • Next-Generation Barcoding of Bulked Arthropod Samples
    We’re getting there: a first look at (cheap!) next-generation barcoding of bulked arthropod samples Matt Bowser1 Eighth annual meeting of the Alaska Entomological Society January 24, 2015 Fairbanks, Alaska 1USFWS Kenai National Wildlife Refuge, [email protected] Outline • Background: working through the taxonomic impediment • Conventional (morphological) workflow • Classical DNA barcoding workflow • Next-gen DNA barcoding workflow • A trial of NGS methods on bulked samples • Methods • Results • Discussion Conventional Workflow Classical DNA Barcoding Workflow TACCTTATACTTCTTATTTGGAGCTTGAGCTGGAATAGT AGGAACTTCTTTAAGTATCTTAATTCGAGCCGAATTAGG ACATCCAGGAGCCTTAATTGGAGATGACCAAATTTATAA CGTAATTGTAACTGCCCATGCTTTTGTCATAATTTTTTT TATAGTTATACCTATTATAATTGGTGGATTTGGAAATTG ATTGGTACCCTTAATATTAGGAGCTCCAGATATAGCATT TCCTCGAATAAATAATATAAGCTTCTGAATACTTCCCCC TTCTCTTACGCTACTATTAATGAGCAGTATAGTTGAAAA TGGGGCTGGTACAGGTTGAACTGTATACCCTCCCCTATC TTCCACTATTGCACATGGGGGAGCTTCAGTTGATTTAGC AATTTTTAGTTTACATCTAGCTGGAATTTCATCTATTTT AGGAGCTGTAAATTTTATTACTACAGTAATTAATATACG TTCTAACGGAATTACTTTTGATCGAATACCCCTATTTGT TTGATCGGTAGTAATTACAGCTCTTTTATTACTATTGTC TTTACCTGTATTGGCTGGAGCAATTACAATATTACTTAC AGACCGAAATTTAAATACTTCTTTTTTTGACCCCGCTGG AGGAGGAGATCCAATTTTATACCAACATTTATTT Next-Gen DNA Barcoding Workflow Methods: field 3 samples, all from Headquarters Lake, Soldotna • 2 sweep net (one 100 m2 circular plot split in half), 16.Sept.2013 KNWR:Ento:10656, KNWR:Ento:10657 • 1 malaise (leftovers), 27-28.June.2011 KNWR:Ento:7114 Methods: lab • Vial contents recorded (quick, coarse identifications).
    [Show full text]
  • Chrysomela 43.10-8-04
    CHRYSOMELA newsletter Dedicated to information about the Chrysomelidae Report No. 43.2 July 2004 INSIDE THIS ISSUE Fabreries in Fabreland 2- Editor’s Page St. Leon, France 2- In Memoriam—RP 3- In Memoriam—JAW 5- Remembering John Wilcox Statue of 6- Defensive Strategies of two J. H. Fabre Cassidine Larvae. in the garden 7- New Zealand Chrysomelidae of the Fabre 9- Collecting in Sholas Forests Museum, St. 10- Fun With Flea Beetle Feces Leons, France 11- Whither South African Cassidinae Research? 12- Indian Cassidinae Revisited 14- Neochlamisus—Cryptic Speciation? 16- In Memoriam—JGE 16- 17- Fabreries in Fabreland 18- The Duckett Update 18- Chrysomelidists at ESA: 2003 & 2004 Meetings 19- Recent Chrysomelid Literature 21- Email Address List 23- ICE—Phytophaga Symposium 23- Chrysomela Questionnaire See Story page 17 Research Activities and Interests Johan Stenberg (Umeå Univer- Duane McKenna (Harvard Univer- Eduard Petitpierre (Palma de sity, Sweden) Currently working on sity, USA) Currently studying phyloge- Mallorca, Spain) Interested in the cy- coevolutionary interactions between ny, ecological specialization, population togenetics, cytotaxonomy and chromo- the monophagous leaf beetles, Altica structure, and speciation in the genus somal evolution of Palearctic leaf beetles engstroemi and Galerucella tenella, and Cephaloleia. Needs Arescini and especially of chrysomelines. Would like their common host plant Filipendula Cephaloleini in ethanol, especially from to borrow or exchange specimens from ulmaria (meadow sweet) in a Swedish N. Central America and S. America. Western Palearctic areas. Archipelago. Amanda Evans (Harvard University, Maria Lourdes Chamorro-Lacayo Stefano Zoia (Milan, Italy) Inter- USA) Currently working on a phylogeny (University of Minnesota, USA) Cur- ested in Old World Eumolpinae and of Leptinotarsa to study host use evolu- rently a graduate student working on Mediterranean Chrysomelidae (except tion.
    [Show full text]
  • A Passion for Rhinoceros and Stag Beetles in Japan
    SCARABS CZ CN MNCHEM, NBYS QCFF WIGY. Occasional Issue Number 67 Print ISSN 1937-8343 Online ISSN 1937-8351 September, 2011 A Passion for Rhinoceros and Stag Beetles WITHIN THIS ISSUE in Japan Dynastid and Lucanid Enthusiasm in Japan ........ 1 by Kentaro Miwa University of Nebraska-Lincoln Bug People XXIV ........... 10 Department of Entomology In Past Years XLVI ......... 11 [email protected] Guatemala Scarabs IV ... 20 BACK ISSUES Available At These Sites: Coleopterists Society www.coleopsoc.org/de- fault.asp?Action=Show_ Resources&ID=Scarabs University of Nebraska A large population of the general public in Japan enjoys collecting and www-museum.unl.edu/ rearing insects. Children are exposed to insects at early ages because their research/entomology/ parents are interested in insects. My son went on his first collecting trip Scarabs-Newsletter.htm on a cool day in March in Nebraska when he was four months old. EDITORS I am from Shizuoka, Japan. I am currently pursuing my Ph.D in En- Rich Cunningham tomology at the University of Nebraska-Lincoln and studying biology [email protected] and applied ecology of insets in cropping systems. Among many insect Olivier Décobert taxa I am interested in, dynastines and lucanids are my favorite groups. [email protected] I have enjoyed collecting and rearing these beetles throughout my life. Barney Streit I began collecting beetles with my parents and grandparents when barneystreit@hotmail. com I was two years old. When I was about six, I learned to successfully rear some Japanese species. Since I came to the United States, I have been enjoying working with American species.
    [Show full text]
  • Effect of Achillea Millefolium Strips And
    & Herpeto gy lo lo gy o : h C it u n r r r e Almeida, et al., Entomol Ornithol Herpetol 2017, 6:3 O n , t y R g e o l Entomology, Ornithology & s DOI: 10.4172/2161-0983.1000199 o e a m r o c t h n E ISSN: 2161-0983 Herpetology: Current Research Research Article Open Access Effect of Achillea millefolium Strips and Essential Oil on the European Apple Sawfly, Hoplocampa testudinea (Hymenoptera: Tenthredinidea) Jennifer De Almeida1, Daniel Cormier2* and Éric Lucas1 1Département des Sciences Biologiques, Université du Québec à Montréal, Montréal, Canada 2Research and Development Institute for the Agri-Environment, 335 rang des Vingt-Cinq Est, Saint-Bruno-de-Montarville, Qc, Canada *Corresponding author: Daniel Cormier, Research and Development Institute for the Agri-Environment, 335 rang des Vingt-Cinq Est, Saint-Bruno-de-Montarville, Qc, J3V 0G7, Canada, Tel: 450-653-7368; Fax: 653-1927; E-mail: [email protected] Received date: August 15, 2017; Accepted date: September 05, 2017; Published date: September 12, 2017 Copyright: © 2017 Almeidal JD, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract The European apple sawfly Hoplocampa testudinea (Klug) (Hymenoptera: Tenthredinidae) is a pest in numerous apple orchards in eastern North America. In Quebec, Canada, the European apple sawfly can damage up to 14% of apples and growers use phosphate insecticide during the petal fall stage to control the pest.
    [Show full text]
  • 25Th U.S. Department of Agriculture Interagency Research Forum On
    US Department of Agriculture Forest FHTET- 2014-01 Service December 2014 On the cover Vincent D’Amico for providing the cover artwork, “…and uphill both ways” CAUTION: PESTICIDES Pesticide Precautionary Statement This publication reports research involving pesticides. It does not contain recommendations for their use, nor does it imply that the uses discussed here have been registered. All uses of pesticides must be registered by appropriate State and/or Federal agencies before they can be recommended. CAUTION: Pesticides can be injurious to humans, domestic animals, desirable plants, and fish or other wildlife--if they are not handled or applied properly. Use all pesticides selectively and carefully. Follow recommended practices for the disposal of surplus pesticides and pesticide containers. Product Disclaimer Reference herein to any specific commercial products, processes, or service by trade name, trademark, manufacturer, or otherwise does not constitute or imply its endorsement, recom- mendation, or favoring by the United States government. The views and opinions of wuthors expressed herein do not necessarily reflect those of the United States government, and shall not be used for advertising or product endorsement purposes. The U.S. Department of Agriculture (USDA) prohibits discrimination in all its programs and activities on the basis of race, color, national origin, sex, religion, age, disability, political beliefs, sexual orientation, or marital or family status. (Not all prohibited bases apply to all programs.) Persons with disabilities who require alternative means for communication of program information (Braille, large print, audiotape, etc.) should contact USDA’s TARGET Center at 202-720-2600 (voice and TDD). To file a complaint of discrimination, write USDA, Director, Office of Civil Rights, Room 326-W, Whitten Building, 1400 Independence Avenue, SW, Washington, D.C.
    [Show full text]
  • Integrated Noxious Weed Management Plan: US Air Force Academy and Farish Recreation Area, El Paso County, CO
    Integrated Noxious Weed Management Plan US Air Force Academy and Farish Recreation Area August 2015 CNHP’s mission is to preserve the natural diversity of life by contributing the essential scientific foundation that leads to lasting conservation of Colorado's biological wealth. Colorado Natural Heritage Program Warner College of Natural Resources Colorado State University 1475 Campus Delivery Fort Collins, CO 80523 (970) 491-7331 Report Prepared for: United States Air Force Academy Department of Natural Resources Recommended Citation: Smith, P., S. S. Panjabi, and J. Handwerk. 2015. Integrated Noxious Weed Management Plan: US Air Force Academy and Farish Recreation Area, El Paso County, CO. Colorado Natural Heritage Program, Colorado State University, Fort Collins, Colorado. Front Cover: Documenting weeds at the US Air Force Academy. Photos courtesy of the Colorado Natural Heritage Program © Integrated Noxious Weed Management Plan US Air Force Academy and Farish Recreation Area El Paso County, CO Pam Smith, Susan Spackman Panjabi, and Jill Handwerk Colorado Natural Heritage Program Warner College of Natural Resources Colorado State University Fort Collins, Colorado 80523 August 2015 EXECUTIVE SUMMARY Various federal, state, and local laws, ordinances, orders, and policies require land managers to control noxious weeds. The purpose of this plan is to provide a guide to manage, in the most efficient and effective manner, the noxious weeds on the US Air Force Academy (Academy) and Farish Recreation Area (Farish) over the next 10 years (through 2025), in accordance with their respective integrated natural resources management plans. This plan pertains to the “natural” portions of the Academy and excludes highly developed areas, such as around buildings, recreation fields, and lawns.
    [Show full text]
  • The Biodiversity of Flying Coleoptera Associated With
    THE BIODIVERSITY OF FLYING COLEOPTERA ASSOCIATED WITH INTEGRATED PEST MANAGEMENT OF THE DOUGLAS-FIR BEETLE (Dendroctonus pseudotsugae Hopkins) IN INTERIOR DOUGLAS-FIR (Pseudotsuga menziesii Franco). By Susanna Lynn Carson B. Sc., The University of Victoria, 1994 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Department of Zoology) We accept this thesis as conforming To t(p^-feguired standard THE UNIVERSITY OF BRITISH COLUMBIA 2002 © Susanna Lynn Carson, 2002 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. 1 further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia Vancouver, Canada DE-6 (2/88) Abstract Increasing forest management resulting from bark beetle attack in British Columbia's forests has created a need to assess the impact of single species management on local insect biodiversity. In the Fort St James Forest District, in central British Columbia, Douglas-fir (Pseudotsuga menziesii Franco) (Fd) grows at the northern limit of its North American range. At the district level the species is rare (representing 1% of timber stands), and in the early 1990's growing populations of the Douglas-fir beetle (Dendroctonus pseudotsuage Hopkins) threatened the loss of all mature Douglas-fir habitat in the district.
    [Show full text]
  • This Work Is Licensed Under the Creative Commons Attribution-Noncommercial-Share Alike 3.0 United States License
    This work is licensed under the Creative Commons Attribution-Noncommercial-Share Alike 3.0 United States License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/3.0/us/ or send a letter to Creative Commons, 171 Second Street, Suite 300, San Francisco, California, 94105, USA. QUAESTIONES ENTOMOLOGICAE ISSN 0033-5037 A periodical record of entomological investigation published at the Department of Entomology, University of Alberta, Edmonton, Alberta. Volume 20 Number 3 1984 CONTENTS Ashe-Generic Revision of the Subtribe Gyrophaenina (Coleoptera: Staphylinidae: Aleocharinae) with Review of the Described Subgenera and Major Features of Evolution 129 GENERIC REVISION OF THE SUBTRIBE GYROPHAENINA (COLEOPTERA: STAPHYLINIDAE: ALEOCHARINAE) WITH A REVIEW OF THE DESCRIBED SUBGENERA AND MAJOR FEATURES OF EVOLUTION James S. Ashe Field Museum of Natural History Roosevelt Road at Lakeshore Drive Chicago, Illinois 60605 Quaestiones Entomologicae U. S. A. 20:129-349 1984 ABSTRACT The world genera of the subtribe Gyrophaenina are revised and described; subgenera are reviewed. Comparative morphological studies of adults reveal a great variety of characters available for taxonomic and phylogenetic study when gyrophaenines are examined in sufficient detail. Structures in the mouthparts, particularly the maxilla, proved especially useful. Illustrations of variation in structural features are provided. Gyrophaenines are inhabitants of polypore and gilled mushrooms, where both larvae and adults feed by scraping maturing spores, basidia, cystidea and hyphae from the hymenium surface. Known features of natural history of gyrophaenines are reviewed. Many of these features are related to unusual features of mushrooms as habitats. The subtribe is redefined, characterized, and larval characteristics are reviewed.
    [Show full text]