LY6E Impairs Coronavirus Fusion and Confers Immune Control of Viral Disease

bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

LY6E impairs coronavirus fusion and confers immune control of viral disease

Stephanie Pfaender1,2,3#, Katrina B. Mar4#, Eleftherios Michailidis5, Annika Kratzel1,2, Dagny Hirt1,2,

Philip V`kovski1,2, Wenchun Fan4, Nadine Ebert1,2, Hanspeter Stalder1,2, Hannah Kleine-Weber6,7,

Markus Hoffmann6, H. Heinrich Hoffmann5, Mohsan Saeed5,8, Ronald Dijkman1,2, Eike Steinmann3,

Mary Wight-Carter9, Natasha W. Hanners10, Stefan Pöhlmann6,7, Tom Gallagher11, Daniel Todt3,12, Gert

Zimmer1,2, Charles M. Rice5*, John W. Schoggins4*, and Volker Thiel1,2*

1Institute of Virology and Immunology, Bern and Mittelhäusern, Switzerland. 2Department of Infectious

Diseases and Pathobiology, Vetsuisse Faculty, University of Bern, Bern, Switzerland. 3Department for

Molecular & Medical Virology, Ruhr-Universität Bochum, Germany. 4Department of Microbiology,

University of Texas Southwestern Medical Center, Dallas, TX, USA. 5Laboratory of Virology and

Infectious Disease, The Rockefeller University, New York, NY, USA. 6Deutsches Primatenzentrum

GmbH, Leibniz-Institut für Primatenforschung, Göttingen, Germany. 7Faculty of Biology and

Psychology, University Göttingen, Göttingen, Germany. 8Department of Biochemistry, Boston

University School of Medicine, Boston, MA, USA; National Emerging Infectious Diseases

Laboratories, Boston University, Boston, MA, USA. 9Animal Resource Center, University of Texas

Southwestern Medical Center, Dallas, TX, USA. 10Department of Pediatrics, University of Texas

Southwestern Medical Center, Dallas, TX, USA 11Department of Microbiology and Immunology,

Loyola University Chicago, Chicago, USA. 12European Virus Bioinformatics Center (EVBC), Jena,

Germany

#equally contributing authors, *equal senior authorship

*e-mail: [email protected], [email protected], [email protected]

1 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

ABSTRACT

Zoonotic coronaviruses (CoVs) are significant threats to global health, as exemplified by the recent emergence of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)1. Host immune responses to CoV are complex and regulated in part through antiviral interferons.

However, the interferon-stimulated gene products that inhibit CoV are not well characterized2.

Here, we show that interferon-inducible lymphocyte antigen 6 complex, locus E (LY6E) potently restricts cellular infection by multiple CoVs, including SARS-CoV, SARS-CoV-2, and Middle

East respiratory syndrome coronavirus (MERS-CoV). Mechanistic studies revealed that LY6E inhibits CoV entry into cells by interfering with spike protein-mediated membrane fusion.

Importantly, mice lacking Ly6e in hematopoietic cells were highly susceptible to murine CoV infection. Exacerbated viral pathogenesis in Ly6e knockout mice was accompanied by loss of hepatic and splenic immune cells and reduction in global antiviral gene pathways. Accordingly, we found that Ly6e directly protects primary B cells and dendritic cells from murine CoV infection. Our results demonstrate that LY6E is a critical antiviral immune effector that controls

CoV infection and pathogenesis. These findings advance our understanding of immune-mediated control of CoV in vitro and in vivo, knowledge that could help inform strategies to combat infection by emerging CoV.

2 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Coronaviruses (CoVs) are enveloped RNA viruses with broad host tropism and documented capability to cross the species barrier to infect humans3. The mammalian innate immune response controls CoV infection partly through the action of interferons (IFNs)2,4,5. IFNs inhibit viral infection by inducing hundreds of genes, many of which encode antiviral effectors6. The interferon-stimulated genes (ISGs) that inhibit CoV infection are not well defined2. To address this knowledge gap, we screened our published library of >350 human ISG cDNAs7,8 in human hepatoma cells for antiviral activity against the endemic human CoV 229E (HCoV-229E) (Extended Data Table 1, Extended Data

Table 2). The ISG lymphocyte antigen 6 complex, locus E (LY6E) strikingly inhibited HCoV-229E infection (Fig. 1a-b, Extended Data Fig. 1a). This was unexpected since we and others previously reported that LY6E enhances cellular infection by influenza A virus, flaviviruses, and HIV-19-11, with

HIV-1 being an exception as opposing roles of LY6E have been described12. To verify this result, we generated stable cell lines ectopically expressing LY6E and infected cells with diverse CoVs. In addition to HCoV-229E (Fig. 1c), LY6E significantly inhibited infection by HCoV-OC43, MERS-CoV, SARS-

CoV, and the recently emerged SARS-CoV-2 (Fig. 1d-g). The antiviral effect of LY6E extended beyond human CoVs and blocked infection by the murine CoV murine hepatitis virus (MHV) (Fig. 1h). Given the zoonotic origin of SARS-CoV and MERS-CoV, both suspected to originate from bats, we next tested the antiviral potential of select LY6E orthologues. An alignment of LY6E orthologues of human, rhesus macaque, mouse, bat, and camel origin revealed strong conservation across species (Extended Data

Fig. 1b-c). All LY6E orthologues inhibited HCoV-229E (Extended Data Fig. 1d). Recent surveillance of Kenyan camels, the main viral reservoir for MERS-CoV, indicates active circulation of the zoonotic

CoV13. Human and camel LY6E restricted MERS-CoV infection (Extended Data Fig. 1e). To test the role of endogenous LY6E in controlling CoV infections, we used CRISPR-Cas9 gene editing to ablate

LY6E expression in human lung adenocarcinoma cells (Fig. 1i). This cell line was selected as human hepatoma cells do not express LY6E irrespective of IFN treatment9. LY6E knockout (KO) cells were more susceptible to HCoV-229E (Fig. 1j). Reconstitution with a CRISPR-resistant LY6E variant (CR

LY6E) restored antiviral activity in KO cells (Fig. 1k-l). Strikingly, the LY6E-mediated restriction in

3 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. hepatoma cells was largely specific to CoV. Among 10 genetically divergent viruses tested, only hepatitis C virus was also restricted (Extended Data Fig. 1f).

LY6E is a member of the LY6/uPAR family of GPI-anchored proteins, and is implicated in diverse cellular processes14. To evaluate the specificity of LY6E for inhibiting CoV, we ectopically expressed select LY6/uPAR proteins9 and infected with HCoV-229E. Only LY6E inhibited CoV infection

(Extended Data Fig. 1g). We previously showed that a conserved residue (L36) is required for LY6E- mediated enhancement of influenza A virus9. L36 was also required to restrict HCoV-229E infection

(Extended Data Fig. 1h). These data suggest a conserved functional domain that is responsible for both the virus-enhancing and -restricting phenotypes.

Next, we investigated the effect of LY6E on specific steps of the virus replication cycle. First, we tested whether LY6E restricts HCoV-229E attachment to the cell surface and observed no effect

(Extended Data Fig. 2a). In accordance, LY6E had no effect on surface expression of CD13, the specific receptor for HCoV-229E (Extended Data Fig. 2b). To test whether LY6E restricts viral entry, we used a vesicular stomatitis virus (VSV) pseudoparticle (pp) system bearing CoV spike (S) proteins.

Strikingly, LY6E significantly inhibited VSVpp entry mediated by S proteins from HCoV-229E (Fig.

2a), MERS-CoV (Fig. 2b), SARS-CoV (Fig. 2c), and SARS-CoV-2 (Fig. 2d). Entry mediated by VSV glycoprotein G was only marginally impacted by LY6E (Extended Data Fig. 2c, d). To test whether

LY6E interferes with the fusion of viral and cellular membranes, we performed a syncytia formation assay using propagation competent VSV pseudoviruses co-expressing CoV S protein and a GFP reporter

(VSV*ΔG(CoV S)) (Extended Data Fig. 3a). LY6E potently inhibited CoV S protein-mediated syncytia formation (Fig. 2e-f). To determine whether LY6E impairs S protein expression or maturation, we also performed a heterologous syncytia formation assay. CoV-resistant hamster cells infected with trans-complemented GFP reporter VSV*ΔG(CoV) were co-cultured with susceptible target cells that ectopically expressed LY6E. LY6E again significantly blocked syncytia formation, demonstrating that

LY6E inhibits S protein-mediated fusion and not S protein expression or maturation (Extended Data

Fig. 3b-c). As membrane fusion can occur without syncytia formation, we also performed a quantitative fusion assay in which mixing of cell contents results in complementation of split luciferase (Fig. 2g).

4 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Cells co-transfected with plasmids encoding CoV S proteins and split luciferase 1-7 were mixed with susceptible target cells co-expressing LY6E or vector control and split luciferase 8-11. LY6E reduced

CoV S-mediated cell-cell fusion, indicating that LY6E blocks fusion of viral and cellular membranes

(Fig. 2h). Time-course experiments revealed that LY6E had no effect on HCoV-229E translation, replication, assembly, or release (Extended Data Fig. 2e-i). Collectively, our results demonstrate that

LY6E specifically inhibits CoV S protein-mediated membrane fusion, which is required for viral entry.

We next addressed whether LY6E modulates proteolytic activation of the S protein. Upon S protein- mediated binding to the respective receptor, host proteases cleave the S protein and make it fusion competent for “early entry” at the cell surface or “late entry” in endosomes15,16. Pharmacological inhibition of cell surface and endosomal proteases had no effect on LY6E-mediated restriction of CoV infection (Extended Data Fig. 4a-c). Next, we addressed whether LY6E directly interferes with the proteolytic activation of S protein. Mutation of S1/S2 and S2′ in the S protein prevents activation

(Extended Data Fig. 4d)16,17. Ectopic LY6E expression had no effect on MERS-CoV S cleavage or infection by cleavage-resistant MERS-CoV pp (Extended Data Fig. 4e-g). Collectively, our data indicate that restriction of viral fusion is independent of S protein activation.

Next, we aimed to evaluate LY6E-mediated CoV restriction in vivo. Systemic genetic ablation of

Ly6e in mice is embryonic lethal18. Therefore, we generated transgenic Ly6efl/fl mice, which are functionally 'wild-type (WT)' for Ly6e expression, and crossed them with Vav1-iCre mice to ablate Ly6e in cells that originate from a hematopoietic stem cell (HSC) progenitor (Extended Data Fig. 5a-b). This genetic model was chosen since immune cells are critical for protection from CoV in vivo5,19-23. Bone- marrow derived macrophages (BMDM) from Ly6eΔHSC mice had reduced Ly6e mRNA levels (Extended

Data Fig. 5c). The natural mouse pathogen MHV is a well-studied model CoV that causes hepatitis and encephalomyelitis in mice24. Ly6eΔHSC BMDM were more susceptible to MHV infection than Ly6efl/fl

BMDM, demonstrating that murine Ly6e is a restriction factor for murine CoV (Extended Data Fig.

5d).

To determine whether Ly6e is important for controlling CoV infection in vivo, Ly6efl/fl and Ly6eΔHSC

4 mice were infected with a high dose (5 x 10 PFU) of MHV that causes sub-lethal hepatitis in WT

5 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

C57BL/6J mice25. Since MHV pathogenesis is influenced by sex26, we performed independent experiments in male and female mice. Ly6eΔHSC mice of both sexes rapidly succumbed to MHV infection by day 6 (Fig. 3a-b, Extended Data Fig. 6a-b). To examine viral pathogenesis and immunopathology in infected mice, Ly6efl/fl and Ly6eΔHSC mice were infected with the same high dose of MHV and euthanized 3- or 5-days post-infection. At both time points, female Ly6eΔHSC mice exhibited significantly higher levels of liver damage as measured by serum ALT while no difference was observed in male mice (Fig. 3c,i, Extended Data Fig. 6c,i). However, hepatic viral burden did not differ in either sex

(Fig. 3d,j, Extended Data Fig. 6d,j), possibly due to tissue saturation at this high dose. Indeed, female but not male Ly6eΔHSC mice exhibited increased liver damage and viral burden at a low dose (5 PFU) of

MHV (Extended Data Fig. 7a-b, f-g). Spleen viral burden was elevated in female and male Ly6eΔHSC mice at both time points and doses of MHV (Fig. 3e,k, Extended Data Fig. 6e,k, Extended Data Fig.

7c,h). At 3 days post-infection, there was no difference in liver necrosis, but inflammation was moderately reduced in female but not male Ly6eΔHSC mice (Fig. 3f-h, Extended Data Fig. 6f-h). By 5 days post-infection and at both low and high doses of MHV, female Ly6eΔHSC mice had significantly higher levels of liver necrosis and a reduced presence of mononuclear immune cells (Fig. 3l-n,

Extended Data Fig. 7d-e), whereas no difference was observed in male mice (Extended Data Fig. 6l- n, Extended Data Fig. 7i-j). Liver damage in Ly6eΔHSC mice was further corroborated at an intermediate viral dose (5 x 103 PFU), which resulted in visibly apparent brittleness, pallor, and necrotic foci

(Extended Data Fig. 7k-n). These data demonstrate that Ly6e in hematopoietic cells is important for controlling murine CoV infection.

We next used a transcriptomic approach to evaluate the effect of Ly6e ablation on global gene expression in liver and spleen of female Ly6efl/fl and Ly6eΔHSC mice injected with PBS or the high dose of MHV at 3- and 5- days post-infection. In infected tissues, loss of Ly6e in hematopoietic cells correlated with differential gene expression in pathways associated with tissue damage, such as liver- specific metabolic genes, angiogenesis, wound healing, and immune response to viruses (Fig. 4a-c). We also observed a striking loss of genes associated with the type I IFN response, inflammation, antigen presentation, and B cells in infected Ly6eΔHSC mice (Fig. 4d-e, Extended Data Fig. 8).

6 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

The histopathology (Fig. 3h,n) and transcriptome data (Fig 4a-e, Extended Data Fig. 8) prompted us to determine how loss of Ly6e affects immune cell numbers during infection. Absolute numbers of different immune cell subsets were quantified from Ly6eΔHSC and Ly6efl/fl mice 5 days after injection with PBS or the intermediate dose of MHV (Extended Data Fig. 7k-n, Extended Data Fig. 9). Multiple cell types were depleted in livers and spleens of infected Ly6eΔHSC mice, irrespective of sex (Figure 4f- g, Extended Data Fig. 10a-b). B cells were dramatically reduced in livers from infected Ly6eΔHSC mice.

Hepatic CD4+ T cells, NK cells, dendritic cells (DC), macrophages, and neutrophils were also depleted in infected Ly6eΔHSC mice, whereas CD8+ T cells were unchanged (Fig. 4f, Extended Data Fig. 10a).

Infected Ly6eΔHSC mice had a reduction in all splenic immune cell subsets except for CD4+ and CD8+ T cells (Fig. 4g, Extended Data Fig. 10b). Depletion of immune cell populations in Ly6eΔHSC organs was

MHV-dependent, as cell numbers were not altered in PBS-injected mice.

To determine whether loss of immune cells in MHV-infected Ly6eΔHSC mice correlates with increased permissiveness to infection, we assessed MHV infection in splenocytes cultured from Ly6eΔHSC, Ly6efl/fl, and Ifnar-/- mice. In Ly6efl/fl splenocyte cultures, MHV infected macrophages, neutrophils, DC, and B cells, but not CD4+ or CD8+ T cells, as previously published (Fig. 4h, Extended Data Fig. 10c)23.

Strikingly, B cells from both male and female Ly6eΔHSC mice were highly susceptible to MHV infection when compared to B cells from Ly6e fl/fl or Ifnar-/- mice. DC from female Ly6eΔHSC mice were also more susceptible to MHV infection. Surprisingly, no other cell type demonstrated a strong Ly6e-dependent susceptibility to MHV infection.

Together, our data demonstrate an important role for Ly6e in immune cell-mediated control of CoV infection. Higher viral burden and lower liver inflammation suggests that liver damage in MHV-infected female Ly6eΔHSC mice may be due to viral pathogenesis that exceeds the ability of the immune system to control the infection. Notably, we observed MHV-induced loss of three classes of cells: 1) cells that are not permissive to the virus (CD4+ T cells), 2) cells that are permissive to MHV but do not demonstrate Ly6e KO-dependent infection (NK cells, macrophages, and neutrophils), and 3) cells that are permissive to MHV in a Ly6e KO-dependent manner (B cells and DC). This latter group is capable of antigen-presentation to CD4+ T cells27,28. Thus, in the absence of Ly6e, unrestricted MHV infection

7 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. of B cells or DC may impair T cell priming, thereby negatively impacting recruitment and activation of

NK cells, macrophages, and neutrophils that contribute to control of viral disease.

In conclusion, we identified LY6E as a pan CoV restriction factor that limits CoV entry and protects the host from severe viral disease. Our findings are striking given that LY6E has been primarily associated with an enhancing phenotype in which LY6E promotes entry of multiple viruses29. However, our data clearly expand the role of LY6E during coronaviral infection and establishes a novel function in protecting the host immune cell compartment. Determining the precise molecular mechanism underlying how LY6E inhibits CoV S protein-mediated membrane fusion will advance our understanding of cellular antiviral defenses against these important human pathogens. Antiviral membrane fusion inhibitors have been successfully implemented for treatment of HIV-1 infection30. A therapeutic approach mimicking the mechanism of action of LY6E could provide a first line of defense against novel emerging CoV infections. Furthermore, delineating which Ly6e-expressing immune cells protect mice from MHV will provide new insight into how individual antiviral effectors in distinct cellular compartments modulate viral pathogenesis.

8 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

References

1 Zhu, N. et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N Engl J

Med, doi:10.1056/NEJMoa2001017 (2020).

2 Kindler, E., Thiel, V. & Weber, F. Interaction of SARS and MERS Coronaviruses with the

Antiviral Interferon Response. Adv Virus Res 96, 219-243, doi:10.1016/bs.aivir.2016.08.006

(2016).

3 Corman, V. M., Muth, D., Niemeyer, D. & Drosten, C. Hosts and Sources of Endemic Human

Coronaviruses. Adv Virus Res 100, 163-188, doi:10.1016/bs.aivir.2018.01.001 (2018).

4 Wang, B. X. & Fish, E. N. Global virus outbreaks: Interferons as 1st responders. Semin

Immunol 43, 101300, doi:10.1016/j.smim.2019.101300 (2019).

5 Cervantes-Barragan, L. et al. Control of coronavirus infection through plasmacytoid dendritic-

cell-derived type I interferon. Blood 109, 1131-1137, doi:10.1182/blood-2006-05-023770

(2007).

6 Schoggins, J. W. Interferon-Stimulated Genes: What Do They All Do? Annu Rev Virol 6, 567-

584, doi:10.1146/annurev-virology-092818-015756 (2019).

7 Schoggins, J. W. et al. A diverse range of gene products are effectors of the type I interferon

antiviral response. Nature 472, 481-485, doi:10.1038/nature09907 (2011).

8 Dittmann, M. et al. A serpin shapes the extracellular environment to prevent influenza A virus

maturation. Cell 160, 631-643, doi:10.1016/j.cell.2015.01.040 (2015).

9 Mar, K. B. et al. LY6E mediates an evolutionarily conserved enhancement of virus infection

by targeting a late entry step. Nature Communications 9, 3603, doi:10.1038/s41467-018-

06000-y (2018).

10 Hackett, B. A. & Cherry, S. Flavivirus internalization is regulated by a size-dependent

endocytic pathway. Proc Natl Acad Sci U S A 115, 4246-4251, doi:10.1073/pnas.1720032115

(2018).

11 Yu, J., Liang, C. & Liu, S. L. Interferon-inducible LY6E Protein Promotes HIV-1 Infection. J

Biol Chem 292, 4674-4685, doi:10.1074/jbc.M116.755819 (2017). 9 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

12 Yu, J., Liang, C. & Liu, S. L. CD4-Dependent Modulation of HIV-1 Entry by LY6E. J Virol

93, doi:10.1128/JVI.01866-18 (2019).

13 Sikkema, R. S. et al. Global status of Middle East respiratory syndrome coronavirus in

dromedary camels: a systematic review. Epidemiol Infect 147, e84,

doi:10.1017/S095026881800345X (2019).

14 Upadhyay, G. Emerging Role of Lymphocyte Antigen-6 Family of Genes in Cancer and

Immune Cells. Front Immunol 10, 819, doi:10.3389/fimmu.2019.00819 (2019).

15 Heald-Sargent, T. & Gallagher, T. Ready, set, fuse! The coronavirus spike protein and

acquisition of fusion competence. Viruses 4, 557-580, doi:10.3390/v4040557 (2012).

16 Park, J. E. et al. Proteolytic processing of Middle East respiratory syndrome coronavirus spikes

expands virus tropism. Proc Natl Acad Sci U S A 113, 12262-12267,

doi:10.1073/pnas.1608147113 (2016).

17 Kleine-Weber, H., Elzayat, M. T., Hoffmann, M. & Pohlmann, S. Functional analysis of

potential cleavage sites in the MERS-coronavirus spike protein. Sci Rep 8, 16597,

doi:10.1038/s41598-018-34859-w (2018).

18 Langford, M. B., Outhwaite, J. E., Hughes, M., Natale, D. R. C. & Simmons, D. G. Deletion of

the Syncytin A receptor Ly6e impairs syncytiotrophoblast fusion and placental morphogenesis

causing embryonic lethality in mice. Sci Rep 8, 3961, doi:10.1038/s41598-018-22040-2

(2018).

19 Matthews, A. E. et al. Antibody is required for clearance of infectious murine hepatitis virus

A59 from the central nervous system, but not the liver. J Immunol 167, 5254-5263,

doi:10.4049/jimmunol.167.9.5254 (2001).

20 Phares, T. W. et al. CD4 T cells promote CD8 T cell immunity at the priming and effector site

during viral encephalitis. J Virol 86, 2416-2427, doi:10.1128/JVI.06797-11 (2012).

21 Wijburg, O. L., Heemskerk, M. H., Sanders, A., Boog, C. J. & Van Rooijen, N. Role of virus-

specific CD4+ cytotoxic T cells in recovery from mouse hepatitis virus infection. Immunology

87, 34-41 (1996).

10 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

22 Wijburg, O. L., Heemskerk, M. H., Boog, C. J. & Van Rooijen, N. Role of spleen macrophages

in innate and acquired immune responses against mouse hepatitis virus strain A59.

Immunology 92, 252-258, doi:10.1046/j.1365-2567.1997.00340.x (1997).

23 Cervantes-Barragan, L. et al. Type I IFN-mediated protection of macrophages and dendritic

cells secures control of murine coronavirus infection. J Immunol 182, 1099-1106 (2009).

24 Weiss, S. R. & Leibowitz, J. L. Coronavirus pathogenesis. Adv Virus Res 81, 85-164,

doi:10.1016/B978-0-12-385885-6.00009-2 (2011).

25 Eriksson, K. K., Cervantes-Barragan, L., Ludewig, B. & Thiel, V. Mouse hepatitis virus liver

pathology is dependent on ADP-ribose-1''-phosphatase, a viral function conserved in the alpha-

like supergroup. J Virol 82, 12325-12334, doi:10.1128/JVI.02082-08 (2008).

26 Karnam, G. et al. CD200 receptor controls sex-specific TLR7 responses to viral infection.

PLoS Pathog 8, e1002710, doi:10.1371/journal.ppat.1002710 (2012).

27 Hong, S. et al. B Cells Are the Dominant Antigen-Presenting Cells that Activate Naive CD4(+)

T Cells upon Immunization with a Virus-Derived Nanoparticle Antigen. Immunity 49, 695-708

e694, doi:10.1016/j.immuni.2018.08.012 (2018).

28 Mempel, T. R., Henrickson, S. E. & Von Andrian, U. H. T-cell priming by dendritic cells in

lymph nodes occurs in three distinct phases. Nature 427, 154-159, doi:10.1038/nature02238

(2004).

29 Yu, J. & Liu, S. L. Emerging Role of LY6E in Virus-Host Interactions. Viruses 11,

doi:10.3390/v11111020 (2019).

30 Lalezari, J. P. et al. Enfuvirtide, an HIV-1 fusion inhibitor, for drug-resistant HIV infection in

North and South America. N Engl J Med 348, 2175-2185, doi:10.1056/NEJMoa035026 (2003)

11 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figures

Figure 1. ISG screen identifies LY6E as a potent coronavirus restriction factor. a, Duplicate screens depicting HCoV-229E infection (24 hours post-infection) in Huh7 cells ectopically expressing ISGs. b,

HCoV-229E infection of Huh7 cells expressing LY6E or control vector (Empty). Blue: DAPI, green:

HCoV-229E N protein, red: TagRFP encoded in SCRPSY vector. c-h, Effect of LY6E expression on diverse coronaviruses. Stably transduced cells were infected with HCoV-229E (c), HCoV-OC43 (d),

MERS-CoV (e), SARS-CoV (f), SARS-CoV-2 (g), MHV-Gluc (h). i, Western blot of WT A549 or two

LY6E KO clones (#3, #4). j, HCoV-229E infection of WT or LY6E KO A549. k, Western blot of WT or LY6E KO A549 reconstituted with CRISPR-resistant LY6E (CR LY6E) or control vector (Empty). l, HCoV-229E infection of CR LY6E-reconstituted WT or LY6E KO A549. Viral replication readouts included: titer determination by plaque assay (c), infectivity by nucleoprotein staining and quantitation by flow cytometry (d), limiting dilution assay (e,f,g), luciferase activity shown as relative light units

(RLU) (h,j,l). Data represent average of independent biological replicates, n=3 (c-d,f-h), n=4 (e,j,l). In b, scale bars are 200 µM. Statistical significance was determined by unpaired student’s t-test with

Welch’s correction (c-d, f-g), one-tailed Mann-Whitney U test (e), ratio paired student’s t-test (g), 2way

ANOVA followed by Sidak’s or Dunnett’s multiple comparison test (j,l). Error bars: SD. P values: c,

** p=0.0088; d, *** p=0.0001; e, * p=0.0143; f, * p=0.0286; g, * p=0.0101; h, *** p=0.0010; j, ** p=0.0073, p=0.0033; l, ns=0.0740, ** p=0.0013, *** p=0.0001.

12 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 2. LY6E inhibits viral membrane fusion and syncytia formation. a-d, VSV pseudoparticles

(PP) harboring spike proteins from HCoV-229E (a), MERS-CoV (b), SARS-CoV (c), SARS-CoV-2 (d) were inoculated on LY6E- or empty vector-expressing cells. Virus entry efficiency was quantified by measuring virus-encoded luciferase reporter activity. e, VSV pseudoparticles expressing VSV G protein on their surface and encoding CoV S protein and GFP (VSV*∆G(CoV S)) were inoculated with LY6E- or empty vector-expressing Huh7. Syncytia formation was analyzed by immunofluorescence microscopy. Blue: DAPI, green: GFP, red: TagRFP inserted in SCRPSY vector. f, Quantification of

VSV*∆G(CoV S) induced syncytia depicted as percentage syncytia area. Three independent areas were analyzed per biological replicate (circle, square, triangle). g, Schematic depiction of the cell-cell fusion assay created with BioRender. h, Cell-cell fusion was measured by co-incubating cells transfected with plasmids encoding CoV S proteins and a split-luciferase construct (DSP1-7) together with CoV permissive LY6E-expressing or control cells transfected with the second fragment of split-luciferase

(DSP8-11). Data represent averages of independent biological replicates, n=8 (a,b), n=6 (c,d), n=3 (f), n=4 (h). Statistical significance was determined by unpaired student’s t-test with Welch’s correction (a- d) and 2way ANOVA followed by Sidak’s multiple comparison test (f,h). Outliers were removed using

Grubbs outlier test (a). In e, scale bar is 20 µM. Error bars: SD. P values: a, **** p=<0.0001; b, ****

13 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. p=<0.0001; c, **p=0.0066; d, **** p=<0.0001; f, **** p=<0.0001; h, ns p=0.9975, ** p=0.0054, ns p=0.1520, 0.9892.

14 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 3. Ly6eΔHSC mice are more susceptible to murine hepatitis virus. a-b, Female Ly6efl/fl and

Ly6eΔHSC mice were injected with PBS or MHV and monitored for survival (a) and weight loss (b). c- n, Mice were assessed at 3 (c-h) or 5 (i-n) days post-infection for serum ALT (c,i), viral titers in liver

(d,j) and spleen (e,k), and liver necrosis and inflammation (f-h, l-n). For a-b, n=13 for days 0-14

(Ly6efl/fl), n=11 for day 0-3, n= 10 for days 4-5, n=5 for days 5-6, n=3 for days 6-14 (Ly6eΔHSC) from

15 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. three pooled experiments. For c-g, n=9 (Ly6efl/fl), n=10 (Ly6eΔHSC), n=6 (PBS) from two pooled experiments. For i-m, n=9 (Ly6efl/fl,), n=7 (Ly6eΔHSC), n=6 (PBS) from two pooled experiments. In h,n, scale bars are 500 µM (4x) and 100 µM (20x). Statistical significance was determined by Mantel-Cox test (a), two-tailed unpaired student’s t-test with Welch’s correction (c-e, i-k), two-tailed Mann-Whitney

U test (f-g, l-m). Error bars: SEM (b), SD (c-g, i-m). P values: a, *** p=0.0002; c, ** p=0.0031; d, ns p=0.2136; e, **** p=5.759 x 10-7; f, ns p=0.3698; g, ** p=0.0054; i, * p=0.0430; j, ns p=0.1321; k, ** p=0.0094; l, ** p=0.0072; m, **** p=8.741 x 10-5.

16 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 4. Murine hepatitis virus infection alters hepatic and splenic immune responses in female

Ly6eΔHSC mice. a-e, Transcriptomic analysis from Ly6efl/fl (WT) and Ly6e∆HSC (KO) mice. a-b, Heat

17 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. maps displaying significant changes (mean RPKM > 0.5; fold change > 2; FDR ≤ 0.05) in liver (a) and spleen (b). Dendrograms are normalized read data (row z-score) clustered with complete linkage method employing Spearman Rank correlation distance measurement. c, Pathway analysis of KO versus WT.

Up- (red) or down-regulated (blue) pathways indicated by activation z-score. Numbers show significantly dysregulated genes as percentage of total gene number included in pathway. d-e,

Expression of select genes in liver (d) and spleen (e). f-g, Immune cell counts from liver (f) and spleen

(g). h, Infection of cultured splenocytes. For a-e, n=3. For f-g, n=8 MHV-injected, n=4 PBS-injected from two pooled experiments. For h, n=3 (Ly6efl/fl and Ly6eΔHSC) or n=2 (Ifnar-/-) from two pooled experiments. Significance for f-h was determined by two-tailed unpaired student’s t-test with Welch’s correction. Error bars: SD (d-h). P values (left-right): f, **** p=1.3644 x 10-6, ns p=0.7952, ns p=0.0781, ns p=0.7732, ** p=0.0016, ns p=0.6261, ** p=0.0068, ns p=0.9494, * p=0.0141, ns p=0.7639,

* p=0.0436, ns p=0.9600, * p=0.0174, ns p=0.3096; g, ** p=0.0052, ns p=0.9447, ns p=0.1579, ns p=0.7769, ns p=0.4104, ns p=0.6924, *** p=1.754 x 10-4, ns p=0.9842, ** p=0.0034, ns p=0.9848, * p=0.0169, ns p=0.8591, ** p=0.0076, ns p=0.8623; h, ** p=0.0051, ns p=0.4525, ns p=0.7379, ns p=0.0702, * p=0.0119, ns p=0.6787, ns p=0.4112.

18 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Methods

Viruses

Recombinant HCoV-229E31, HCoV-229E-Rluc (expressing Renilla luciferase [Rluc] by replacing the majority of HCoV-229E ORF4)32, HCoV-OC4333, MHV strain A5934, MHV-Gluc, strain A59

(expresses a Gaussia luciferase [Gluc] replacing accessory gene 4)35, MHV-GFP strain A5925, MERS-

CoV strain EMC36, and SARS-CoV strain Frankfurt-137 have been described previously. SARS-CoV-2

(BetaCoV/Wuhan/IVDC-HB-01/2019, GISAID Accession ID: EPI_ISL_402119) stocks were propagated on VeroE6 cells. HCoV-229E viruses were propagated on Huh-7 cells, MERS-CoV and

SARS-CoV were propagated on VeroB4 cells, HCoV-OC43 was propagated on HCT-8 cells38, and

MHV stocks were propagated on 17Cl1 cells. Lentivirus particles using the SCRPSY lentiviral backbone were generated as described previously7,8.

VSV*ΔG(Fluc) (G glycoprotein-deficient VSV encoding green fluorescent protein [GFP] and firefly luciferase [Fluc]) was generated as described previously and was propagated on BHK-G43 cells39.

The generation of viral stocks for the following viruses has been previously described: hPIV-3-GFP40

(based on strain JS, generously provided by P.L. Collins), RSV-GFP41 (based on strain A2, generously provided by P.L. Collins), YFV-Venus42 (derived from YF17D-5′C25Venus2AUbi), DENV-GFP43

(derived from IC30P-A, a full-length infectious clone of strain 16681), WNV-GFP44 (derived from pBELO-WNV-GFP-RZ, generously provided by I. Frolov), HCV-Ypet45 (based on the chimeric Jc1 virus of strains: J6 and JFH-1), SINV-GFP46 (derived from pS300/pS300-GFP, generously provided by

M.T. Heise), VEEV-GFP47 (derived from pTC83-GFP infectious clone, generously provided by I.

Frolov), CHIKV-GFP48 (derived from pCHIKV-LR 5′GFP, generously provided by S. Higgs). ZIKV

(PRVABC59, obtained from the CDC, Ft. Collins) was amplified and titrated as described previously49.

Viral infection assays

HCoV-229E: 1.5 x 105 stable LY6E expressing or control cells were seeded in a 12-well plate and infected with HCoV-229E in a serial dilution. Cells were incubated for 2 hours at 33°C, then viral supernatant was removed, and an overlay of 1:1 Avicel (2.4%) (Avicel RC-581NF) and 2x DMEM,

19 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. supplemented with 10% FBS and 1x penicillin/streptomycin (p-s), was added. Cells were incubated for

3 days at 33°C before medium was removed, cells were washed, and stained with crystal violet (Sigma-

Aldrich). Plaque forming units (PFU) were calculated.

HCoV-OC43: 5.0 x 104 stable LY6E expressing or control cells were seeded in a 24-well plate and infected at 33°C for 1 hour with HCoV-OC43 (MOI=1). Virus was aspirated and 10% FBS/1x NEAA/1x p-s/RPMI (cRPMI) was added back to cells. 24 hours post-infection, cells were dissociated using

Accumax (Sigma-Aldrich), fixed in 1% PFA, permeabilized per manufacturer’s protocol (BD

Cytofix/Cytoperm), and stained for nucleoprotein (1:500) and a goat anti-mouse AlexaFluor488- conjugated secondary antibody (1:2000). Infection was analyzed by flow cytometry.

MERS-CoV/ SARS-CoV/ SARS-CoV-2: 1 x 104 stable LY6E expressing or control cells were seeded in a 96-well plate and infected at 37°C in a serial dilution assay. 3-4 days post-infection supernatant was removed, and cells were stained with crystal violet (Sigma-Aldrich). Cytopathic effect (CPE) was determined upon visual inspection and TCID50/ml calculated according to the Reed and Muench method. MHV-Gluc: 1 x 105 stable LY6E expressing or control cells were seeded in a 24-well plate and infected with MHV-Gluc (MOI=0.1) at 37°C. After 2 hours, virus inoculum was removed, cells were washed with PBS, and cRPMI added back. 24 hours post-infection, cell culture supernatant was harvested, and Gluc activity was measured using Pierce Gaussia Luciferase Glow Assay Kit

(ThermoFisher Scientific) and a plate luminometer (EnSpire 2300 Multilabel reader by Perkin Elmer).

For testing the virus panel against LY6E, 1 x 104 stable LY6E expressing or control Huh7.5 cells were seeded in a 96-well plate. Cells were infected with the following viruses and harvested after the indicated time: HCoV-229E (MOI=0.001, 72 hours), HCV-Ypet (MOI=1, 72 hours), CHIKV-GFP (MOI=0.005,

24 hours), hPIV-3-GFP (MOI=0.015, 24 hours), RSV-GFP (MOI=1.5, 24 hours), SINV-GFP

(MOI=0.1, 24 hours), VEEV-GFP (MOI=0.0075, 24 hours), WNV-GFP (MOI=1.5, 24 hours), ZIKV

PRVABC59 (MOI=0.01, 48 hours), YFV 17D-venus (MOI=0.01, 48 hours) and DENV-GFP

(MOI=0.05, 72 hours). At the indicated time points, cells were fixed with 4% paraformaldehyde

(PFA)/PBS. ZIKV-infected cells were stained for viral E protein and an AlexaFluor488-conjugated goat

20 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. anti-mouse secondary antibody. Images were acquired with a fluorescence microscope and analyzed using ImageXpress Micro XLS (Molecular Devices, Sunnyvale, CA).

HCoV-229E-Rluc infection assay of KO cells

For infection assays, 1 x 105 target cells were seeded in a 24-well plate one day prior infection. Cells were infected with HCoV-229E-Rluc (MOI 0.1) in OptiMEM (Gibco) for 2 hours at 33°C. Cells were washed 1x with PBS and 10% FBS/1x NEAA/1x p-s/DMEM (cDMEM) was added back. Cells were incubated at 33°C for 24 hours, then washed with PBS and lysed using the Renilla Luciferase Assay

System kit (Promega). Rluc activity was measured using a plate luminometer (EnSpire 2300 Multilabel reader by Perkin Elmer). For the reconstitution with CRISPR resistant LY6E (CR LY6E), 2.5 x 104 cells were seeded in a 24-well plate. One day post-seeding, cells were either left untransduced or transduced with a lentiviral vector encoding for CR LY6E or the empty control. 48 hours post-transduction, cell lysates were either infected with HCoV-229E-Rluc (MOI=0.1) for 24 hours as described above or harvested for Western blot.

VSV pseudoparticles

Pseudotyping of VSV*ΔG(Fluc) was performed as previously described50. Briefly, 6 x 105 293LTV cells were seeded in a 6-well plate and transfected using Lipofectamine 2000 (Invitrogen) which was complexed with DNA plasmids driving the expression of either VSV G protein (positive control), the respective CoV S proteins, or the fluorophore mCherry (negative control). Expression vectors for vesicular stomatitis virus (VSV, serotype Indiana) glycoprotein (VSV-G, Genbank accession number:

NC_001560), HCoV-229E S (pCAGGS-229E S, Genbank accession number: X16816), MERS-CoV S

(pCAGGS-MERS S, Genbank accession number: JX869059 with silent point mutation (C4035A, removing internal XhoI), SARS-CoV S (pCAGGS-SARS S, Genbank accession number: AY291315.1 with two silent mutation (T2568G, T3327C)), have been described previously51-53. The expression plasmid for SARS-CoV-2 was generated as follows: the coding sequence of a synthetic, codon- optimized (for human cells) SARS-CoV-2 DNA (GeneArt Gene Synthesis, Thermo Fisher Scientific)

21 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. based on the publicly available protein sequence in the National Center for Biotechnology Information database (NCBI Reference Sequence: YP_009724390.1) was PCR-amplified and cloned into the pCG1 expression vector between BamHI and XbaI restriction sites. The MERS-CoV S cleavage mutants have been described before17. pCAGGS_mCherry was generated upon cloning of the mCherry reporter gene into the pCAGGS expression vector (primer sequences and cloning procedure are available upon request). At 20 hours post-transfection, cells were infected with VSV-G-trans-complemented

VSV*ΔG(FLuc) (MOI=5) for 30 minutes at 37°C, washed with PBS, and further incubated for 1 hour in cDMEM that was supplemented with Mab I1 (ATCC), a neutralizing monoclonal antibody directed to the VSV G protein. Cells were then washed and cDMEM was added back. Viral supernatant was harvested at 16 – 24 hours post-infection. Cellular debris was removed by centrifugation (3,000 × g for

10 minutes) and used to inoculate 2 x 104 target cells in a 96-well plate (6 technical replicates). Cells were incubated for 16–18 hours at 37°C before Fluc activity in cell lysates was detected using a plate luminometer (EnSpire 2300 Multilabel reader by Perkin Elmer) and the Bright-Glo Luciferase Assays

System (Promega). Experiments with pseudotyped SARS-CoV and SARS-CoV-2 were performed as previously described17.

Split luciferase fusion assay

The split luciferase fusion assay has been described before, with slight modifications54. Briefly, 6 x 105

293LTV cells were transfected with plasmids encoding CoV S proteins (pCAGGS-HCoV-229E, pCAGGS-MERS-CoV) together with a split-luciferase construct (Rluc8155-156 DSP1-7). The empty expression plasmid (pCAGGS-mCherry) as well as a construct encoding for VSV G served as negative and positive control, respectively. 2 x 105 stable LY6E expressing or empty control Huh7 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) with a plasmid encoding the second half of the split-luciferase protein (Rluc8155-156 DSP8-11). Approximately 30 hours post-transfection, both cell populations were dissociated (TryPLE Express, Gibco), counted, and equal cell numbers

(2x104 cells each) were co-cultured for 16 – 20 hours at 37°C. Supernatant was harvested and cells lysed using ice-cold passive lysis buffer (Promega). Cells were immediately transferred to -80°C for at least

22 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 hour, before Rluc activity was determined using the Renilla Luciferase Assay System (Promega). Cells were kept on ice during all times post-cell lysis to eliminate DSP post-lysis complementation.

Generation of recombinant VSV vector driving CoV S protein expression (VSV*∆G(CoV))

Following extraction of total RNA from MERS-CoV (strain EMC) infected VeroE6 cells, the cDNA encoding the MERS-CoV S protein was generated by reverse transcription (RevertAid Premium

Reverse Transkriptase, ThermoScientific). Three overlapping cDNA fragments were amplified by PCR

(Phusion Hot Start II High Fidelity Polymerase, Thermo Scientific) and subsequently assembled by overlapping PCR. The cDNAs encoding the S proteins of either MERS-CoV (strain EMC) or HCoV-

229E (truncated variant lacking the 10 amino acids at the C terminus, original plasmid pCAGGS-229E

S) were amplified by PCR and inserted into the pVSV* plasmid55 between MluI and BstEII restriction sites. The resulting plasmids were used to generate the recombinant viruses VSV*ΔG(MERS S) and

VSV*ΔG(229E S) according to a published procedure56. All viruses were propagated on BHK-G43 cells57, resulting in viruses predominantly containing the homotypic VSV glycoprotein G in the envelope.

Syncytia formation assay

Cells expressing LY6E or empty control were infected with VSV*ΔG(MERS S) or VSV*ΔG(229E S) at a MOI of 0.01. At 20 hours post-infection, the cells were fixed with 3% PFA/PBS and the nuclei stained with 4',6-diamidine-2'-phenylindole (DAPI, Sigma). An inverted fluorescence microscope

(Zeiss) was used to determine area percentage area covered by syncytia.

For heterologous cell-cell fusion assay, BHK-21 cells were infected with VSV*ΔG(CoV S) at a MOI of

1. After 2 hours, the cells were treated with trypsin/EDTA (Life Technologies, Zug, Switzerland) and resuspended in DMEM supplemented with 5% FBS (2x104 cells/mL). The infected BHK-21 cell suspension (500 µL) was seeded into 24-well cell culture plates along with LY6E- or empty control- expressing Huh7 (1 x 104 cells). Cell co-cultures were incubated for 7 hours at 37°C, fixed with 3.6%

23 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. formaldehyde diluted in PBS, (Grogg-Chemie AG, Stettlen, Switzerland) and stained with DAPI. The percentage area covered by syncytia was calculated as above.

Mice

Ly6etm1a ES cells were obtained from the EUCOMM consortium58 and microinjected into C57BL/6J blastocysts by the UTSW Transgenic Technology Center. Chimeric mice with germline transmission were bred to obtain Ly6etm1a/+ offspring. Ly6etm1a/+ mice were crossed with FLPe-expressing mice

(B6N.129S4-Gt(ROSA)26Sortm1(FLP1)Dyn/J, #16226, Jackson Laboratories) to obtain Ly6efl/+ offspring, which were bred to homozygosity. Conditional Ly6efl/fl mice were bred to Vav1-iCre transgenic mice

(B6.Cg-Commd10Tg(Vav1-icre)A2Kio/J, #008610, Jackson Laboratories) to obtain Ly6eΔHSC/+ (Ly6efl/+;

Vav1-iCre) offspring. Ly6eΔHSC/+ mice were bred to obtain Ly6eΔHSC (Ly6efl/fl; Vav1-iCre) offspring, which harbor a deletion of exon 3 and 4 in hematopoietic stem cells (HSC). Experimental animals were obtained by crossing Ly6eΔHSC and Ly6efl/fl mice. Genotype was confirmed by PCR of genomic DNA in- house or outsourced to Transnetyx. Ablation of Ly6e was confirmed by qPCR in immune cells from spleen, liver, or bone marrow. Animal studies were carried out in specific-pathogen-free barrier facilities managed and maintained by the UTSW Animal Resource Center. All procedures used in this study complied with federal and institutional guidelines enforced by the UTSW Institutional Animal Care and

Use Committee (IACUC).

In vivo infection, viral titers, liver ALT, and liver histology

Six to twelve-week-old female and male mice were injected intraperitoneally with MHV-A59 diluted in

PBS to the indicated titers or PBS for a mock infection control. All infected mice were monitored daily for weight and mortality. Animals that lost more than 20% of their original body weight were euthanized per IACUC guidelines.

Viral titers in liver and spleen were determined from frozen organs after weighing, homogenization, and plaque assay on L929 cells. Alanine aminotransferase (ALT) was measured in fresh, unfrozen serum using VITROS MicroSlide Technology by the UTSW Mouse Metabolic Core. Livers were fixed in 10%

24 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. neutral buffer formalin, embedded in paraffin, sectioned at 5 µM, and stained with hematoxylin and eosin (H&E). Slides were analyzed by an independent pathologist (UTSW Animal Resource Center) who was blinded to experimental conditions. A numerical score was assigned for degree of inflammation and degree of necrosis for each liver. Inflammatory cell infiltration was scored using the following criteria: 0 = none, 1 = minimal, 2 = mild, 3 = moderate, and 4 = marked. The necrosis score was defined by the percent necrosis. 0 = none, 1 = <2%, 2 = 2-20%, 3 = 21-40%, and 4 = >40%.

Primary cell preparation for flow cytometry

All primary cells were maintained in 10% FBS/10 mM HEPES/1 mM sodium pyruvate/2 mM L- glutamine/1x p-s/RPMI (cRPMI2) unless otherwise indicated.

Primary bone marrow derived macrophages (BMDM) were prepared as described previously60. Viable cells were quantified using trypan blue exclusion. BMDM were plated at 2.5 x 104 cells per well in non- treated 24-well tissue culture plates. Cells were infected the next day with 0.1 MOI MHV-A59-GFP and isolated 6 hours post-infection for analysis by flow cytometry.

Splenocytes were prepared by mashing whole spleens against a 70 µM cell strainer. Red blood cells were removed by using RBC lysis buffer (Tonbo Biosciences). Viable cells were quantified using trypan blue exclusion. For in vitro infection, splenocytes were plated at 1x106 cells per well in non-treated 6- well tissue culture plates. Cells were infected the next day with 1 MOI MHV-A59-GFP and isolated 6 hours post-infection. Infected cells were stained with a fluorescent viability dye (Ghostdye Violet 450,

Tonbo Biosciences) and fixed in 1% PFA/PBS. The next day, fixed cells were treated with anti-

CD16/CD32 (Tonbo Biosciences) and then stained with antibodies that recognize surface lineage markers and analyzed by flow cytometry.

Livers were perfused by PBS injection into the inferior vena cava and out of the portal vein. Blanched livers were minced with sterile scissors and mashed against a 70 µM cell strainer. Hepatocytes and large debris were pelleted at 60 x g for 1 minute, 22°C, with no brake. Intrahepatic immune cell (IHIC) and residual hepatocyte containing supernatants were pelleted at 480 x g for 8 minutes, 22°C, with max brake and resuspended in 37.5% Percoll (Sigma-Aldrich)/cRPMI2. Remaining hepatocytes were

25 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. separated from IHIC by centrifugation at 850 x g for 30 minutes, 22°C, with no brake. Red blood cells were removed from the resulting pellet with RBC lysis buffer (Tonbo Biosciences). Viable cells were quantified using trypan blue exclusion. IHIC and splenocytes (4 x 105) from infected or mock-infected mice were stained with a fluorescent viability dye (Ghostdye Violet 450, Tonbo Biosciences), treated with anti-CD16/CD32 (Tonbo Biosciences), stained with antibodies that recognize surface lineage markers, and then fixed in 1% PFA/PBS. Fixed volumes of cell suspensions were analyzed by flow cytometry the next day. Absolute cell counts were determined by multiplying final number of lineage marker-positive cells by dilution factor used to normalize cell counts for antibody staining.

All primary cell samples were resuspended in 3% FBS/PBS and analyzed using a S1000 Flow Cytometer with a A600 96-well plate high throughput extension and compensated using CellCapture software

(Stratedigm). Data was analyzed with FlowJo Software (Treestar). The flow gating strategy for liver and spleen immune cells is included in Extended Data Figure 9.

Statistical analysis

Differences in data were tested for significance using GraphPad Prism v8.3.1 for Windows (GraphPad).

For details regarding the statistical tests applied, please refer to the figure legends. P values < 0.05 were considered significant.

Data availability

The authors declare that the data supporting the findings of this study are available within the article and its Supplementary Information files or are available on request. The RNAseq data discussed in this publication have been deposited in the Gene Expression Omnibus (GEO) database, https://www.ncbi.nlm.nih.gov/geo (GSE146074).

26 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Acknowledgements

We would like to thank the following people for their generous contribution of reagents and infrastructure which greatly enhanced this study, especially the sequencing facility in Bern, the diagnostic facility of IVI, and the Animal Resource Center at UTSW. Furthermore, we are grateful to

Robin Pohorelsky, Shay Elias, and Nina Garcia from the UTSW Animal Resource Center for assisting in the in vivo experiments. We are grateful to Samira Locher (IVI, Bern, Switzerland) for cloning the

MERS spike cDNA. Furthermore, we would like to thank Berend Jan Bosch, Marcel Müller and

Christian Drosten for reagents and the SARS-CoV-2 virus stocks. We thank the following investigators for contributing viral molecular clones or viral stocks: P.L. Collins (RSV, hPIV-3), I. Frolov (VEEV),

M.T. Heise (SINV), S. Higgs (CHIKV), and the CDC (ZIKV).

Finally, we’d like to thank all members, past and present, of Institute of Virology and Immunology, the Schoggins lab, and the Rice lab for useful discussions.

S.P. was supported by the European Commission’s Horizon 2020 Research and Innovation Program under the Marie Skłodowska-Curie grant agreement 748627 and BMBF, RAPID Consortium, grant

01KI1723D. K.B.M. and J.W.S. were supported in part by The Clayton Foundation and The American

Lung Association. J.W.S. was additionally supported by NIH grant AI117922 and a Burroughs

Wellcome Fund 'Investigators in the Pathogenesis of Infectious Diseases' Award. NH was supported by

NIH grant AI132751. E.M., H.H.H., M.S. and C.M.R. were supported in part by NIH grant AI091707.

G.Z. was supported by a grant from the Swiss National Science Foundation grant 166265. VT was supported by the Swiss National Science Foundation (SNF; grants: 310030_173085; CRSII3_160780), and the Federal Ministry of Education and Research (BMBF; grant RAPID, #01KI1723A).

Author contributions

S.P., K.B.M., E.M., C.M.R., J.W.S., and V.T. designed the project. S.P., K.B.M., E.M., A.K., D.H.,

P.V., W.F., N.E., H.S., H.K-W., M.H., H.H.H., M.S., M.W-C., N.W.H. and G.Z. performed experiments. R.D., S.Pö., E.S., and T.G. contributed to the design and implementation of the research.

27 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

D.T. performed statistical analysis and analysis of RNA-Seq dataset. S.P., K.B.M., and J.W.S. wrote the manuscript, and all authors contributed to editing.

Competing interest declaration

The authors declare no competing interests.

Supplementary Information is available for this paper.

Materials & Correspondence

Correspondence and requests for materials should be addressed to Volker Thiel, John W. Schoggins, and Charles M. Rice.

28 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data

Extended Data Figure 1. The antiviral activity of LY6E is evolutionarily conserved and specific to

CoVs. a, Duplicate screens depicting HCoV-229E infection (48 hours post-infection) in Huh7 cells expressing ISGs. b, Multiple sequence alignment of Ly6e amino acid sequences of different species. c,

Phylogenetic tree of mammalian LY6E orthologues. d, HCoV-229E infection of Huh7.5 cells expressing vector control or human (H. sapiens), camel (C. dromedarius), bat (P. alecto), mouse (M. musculus), or rhesus (M. mulatta) LY6E orthologues. e, Stable LY6E or empty vector expressing 29 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Huh7.5 cells infected with MERS-CoV in a limiting dilution assay. f, Stable Huh7.5 cells expressing either LY6E or containing empty vector infected with HCoV-229E, HCV, CHIKV, hPIV-3, RSV,

SINV, VEEV, WNV, ZIKV, YFV, and DENV. g, HCoV-229E-Rluc infection of naïve or stably transduced Huh7 cells expressing empty vector control or LY6/uPAR family members. h, HCoV-229E-

Rluc infection of Huh7 cells transduced with lentiviruses expressing firefly luciferase (Fluc) control,

LY6E WT, LY6E HA or specific block mutants9. Data represent average of independent biological replicates, n=3 (d), n=3 (e), n=3 (f), n=3 (g), n=3 (h). Statistical significance was determined by ordinary one-way ANOVA with Dunnett`s correction for multiple comparison (d, e, g, h), 2way ANOVA followed by Sidak's multiple comparisons test (f). Error bars: SD. P values: d, **** p=<0.0001, ** p=0.0030; e, * p=0.0118, ** p=0.0013; f, **** p=>0.0001, ** p=0.0095, ns= >0.9999 (CHIKV)

>0.9999 (PIV) >0.9999 (RSV) >0.9999 (SINV) >0.9999 (VEEV) 0.9679 (WNV) 0.8794 (ZIKV) 0.3172

(YFV) 0.7667 (DENV) (For CHIKV one outlier was removed in the control cells); g, **** p=<0.0001, ns p=0.9993 (GPFHBPI) 0.9998 (LY6H) 0.9991 (PSCA) 0.9990 (Ly6G6D) 0.9997 (CD59) >0.9999

(LYPD1) 0.9994 (LYPD2) 0.9997 (GML) 0.9997 (LY6D) 0.9992 (LY6K); h, **** p=<0.0001,

<0.0001, *** p=0.0005, ns p=0.8472, **** p=<0.0001, *** p=0.0003, **** p=<0.0001, <0.0001,

<0.0001, *** p=0.0001, **** p=<0.0001.

30 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Figure 2. LY6E does not affect CoV binding, replication, translation, assembly, or release. a, Stable LY6E expressing or empty control Huh7 cells were incubated with HCoV-229E and binding analyzed immediately (t=0 h) or after incubation for 24 hours (t=24 h) by RT-qPCR. b, Stable LY6E or empty vector expressing Huh7 cells were assessed for surface CD13 expression by flow cytometry. c,d,

VSV pseudoparticles (PP) harboring VSV-G were inoculated on stable LY6E or empty vector Huh7 cells (c) or VeroE6 cells (d). e-i, Stable LY6E expressing or control Huh7 cells were mock-infected or infected with HCoV-229E-Rluc. Cell lysates were harvested at the indicated time points and intracellular viral RNA was extracted, and viral replication detected via qRT-PCR (e). Cell supernatant

31 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. was harvested and extracellular viral RNA was extracted and viral replication detected via qRT-PCR

(f). Cell lysates were harvested and intracellular Renilla luciferase activity was detected upon cell lysis

(g). Cells were subjected to 3 rounds of freeze/thaw cycles. Cell debris was removed and the supernatant titrated on naïve Huh7 cells. Intracellular infectivity was determined (h). Supernatant was harvested and titrated on naïve Huh7 cells to determine extracellular infectivity (i). Data represent averages of independent biological replicates, n=3 (a), n=3 (b), n=9 (c), n=6 (d), n=3 (e-i). Statistical significance was determined by 2way ANOVA followed by Sidak's multiple comparisons test (a), unpaired student’s t-test with Welch’s correction (b, c, d). Error bars: SD. P values: a, ns p=0.9448 0.0752; b, ns p=0.5188; c, ns p=0.3857; d, * p=0.0112.

32 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Figure 3. Generation of recombinant VSV vector driving CoV S protein expression

(VSV*∆G(CoV)) and heterologous cell-cell fusion assay. a, Schematic depiction of the generation of recombinant VSV*∆G(CoV S) expressing both CoV S protein and GFP reporter protein. The respective CoV S genes were inserted into the genomic VSV*∆G cDNA and recombinant virus was generated in BHK-G43 cells expressing the VSV G protein. The recombinant virus produced in this way harbored the VSV G protein in the envelope allowing CoV S protein-independent infection of cells. Infection of cells with VSV*∆G(CoV S) led to the expression of

CoV S protein and consequent syncytia formation. b, Heterologous syncytia formation assay. BHK-21 cells were infected with VSV G protein trans-complemented VSV*∆G(CoV S) viruses or were mock- infected, followed by co-culture with LY6E or empty control Huh7 cells. Syncytia formation was determined. Blue: DAPI, green: GFP, red: TagRFP encoded in SCRPSY vector. c, Quantification of

VSV*∆G(CoV S) induced syncytia depicted as percentage syncytia area. Three independent areas were analyzed per biological replicate (circle, square, triangle). Data represent averages of independent biological replicates, n=3 (c). In b, scale bar is 20 µM. Statistical significance was determined by 2way

33 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

ANOVA followed by Sidak's multiple comparisons test (c). Error bars: SD. P values: c, **** p=<0.0001

<0.0001.

34 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Figure 4. The antiviral effect of LY6E is independent of proteolytic cleavage of

CoV spike protein. a, Schematic depiction of cell entry routes of CoVs and intervention by selected compounds. b-c, LY6E or empty control-expressing Huh7 cells naïve for (b) or ectopically overexpressing TMPRSS2 (c) were pre-treated with the indicated compounds before infection with HCoV-229E-Rluc. d, Schematic depiction of the CoV spike (S) protein containing the subunits S1 and S2. Arrows indicate the S1/S2' cleavage site, a proposed cleavage site for cathepsin L (CTSL') and the S2' cleavage site. Amino acid exchanges disrupting the respective cleavage sites are depicted in red17. e, Western blot of S cleavage in LY6E or empty control-expressing Huh7 cells transfected with a plasmid encoding for MERS-CoV

S protein (S0= uncleaved, S2= S2 subunit). f, MERS CoV S cleavage was analyzed by quantification of S0 and S2 bands. g, LY6E or empty control-expressing Huh7 cells inoculated with CoV- pseudoparticles (PP) harboring MERS-CoV S WT or MERS-CoV S proteins containing various

35 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. cleavage site mutations. Data represent average of independent biological replicates, n=3 (b), n=3 (c), n=3 (e), n=3 (f), n=5 (g). Statistical significance was determined by 2way ANOVA followed by Sidak's multiple comparisons (b-c, g), unpaired student’s t-test with Welch’s correction (f). Error bars: SD. P values: b, **** p=<0.0001, <0.0001, <0.0001, <0.0001, <0.0001, * p=0.0179; c, *** p=0.0007, 0.0005,

0.0006, **** p=<0.0001, <0.0001, ns p=0.1909; f, ns p=0.4968; g, ns p=0.9999 (WT) >0.9999 (NYT)

>0.9999 (ASAA) >0.9999 (ASVA) >0.9999 (ASAA+ASVA) >0.9999 (SSVR) 0.9867 (VSV).

36 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Figure 5. Generation of hematopoietic Ly6e conditional knockout mouse. a, Strategy used to generate Ly6eΔHSC mice. Hematopoietic-tissue specific ablation of Ly6e was achieved by crossing Ly6efl/fl mice with transgenic Vav1-iCre mice to remove the LoxP-flanked exon III and IV, resulting in a 17 amino acid truncated variant of the 130 amino acid full-length protein. Primers used for tissue genotyping and gene expression are also depicted as arrows. b, Gel electrophoresis of tissue genotyping PCR, representing Ly6efl/fl, Ly6efl/+, and Ly6e+/+ mice. c, Ly6e gene expression in bone marrow-derived macrophages (BMDM). d, Infection of BMDM. For c-d, n=9 (Ly6efl/fl) or n=8

(Ly6eΔHSC) mice from three pooled experiments. Data for c-d is shown normalized to Ly6efl/fl values.

Statistical significance was determined by using two-tailed unpaired student’s t-test with Welch’s correction (c), two-tailed ratio-paired t-test (d). Error bars: SD. P values: c, *** p=0.0010; d, ** p=0.0021.

37 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Figure 6. Ly6eΔHSC mice are susceptible to murine hepatitis virus. a-b, Male Ly6efl/fl and Ly6eΔHSC mice injected with PBS or MHV and monitored for survival (a) and weight loss (b). c-n,

Mice were euthanized at 3- (c-h) or 5- (i-n) days post-infection for determination of serum ALT (c,i), viral titers in liver (d,j) and spleen (e,k), and liver necrosis and inflammation (f-h, l-n). For a-b, n=15 for days 0-6, n=14 for days 6-14, (Ly6efl/fl), n=10 for days 0-5, n=4 for days 5-6, n=0 for days 6-14

(Ly6eΔHSC) from three pooled experiments. For c-g, n=8 (Ly6efl/fl,), n=6 (Ly6eΔHSC), or n=6 (PBS) from 38 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. two pooled experiments. For i-m, n=8 (Ly6efl/fl,), n=6 (Ly6eΔHSC), or n=3 (PBS) from two pooled experiments. In h,n, scale bars are 500 µM (4x) and 100 µM (20x). Significance for was tested by

Mantel-Cox test (a), two-tailed unpaired student’s t-test with Welch’s correction (c-e, i-k), two-tailed

Mann-Whitney U test (f-g, l-m). Error bars: SEM (b), SD (c-g, i-m). P value: a, **** p=3.946 x 10-6; c, ns p=1144; d, ns p=0.1407; e, ** p=0.0026; f, ns p=0.1708; g, ns p=0.0779; i, ns p=0.6191; j, ns p=0.6842; k, * p=0.0119; l, ns p>0.9999; m, ns p=0.0779.

39 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Figure 7. Ly6eΔHSC mice have enhanced sensitivity to murine hepatitis virus. a-j, Female (a-e) and male (f-g) Ly6efl/fl and Ly6eΔHSC mice injected with PBS or MHV and assessed for serum ALT (a,f), viral titers in liver (b,g) and spleen (c,h), and liver necrosis and inflammation (d-e, i- j). k-n, Female Ly6efl/fl and Ly6eΔHSC mice injected with PBS or MHV and whole livers were imaged.

Mock-infected (PBS) Ly6eΔHSC mice (k), mock-infected Ly6efl/fl mice (l), MHV-infected Ly6eΔHSC mice 40 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

(m), MHV-infected Ly6efl/fl mice (n). For a-e, n=8 (Ly6efl/fl,), n=8 (Ly6eΔHSC), or n=3 (PBS) from two pooled experiments. For f-j, n=9 (Ly6efl/fl,), n=7 (Ly6eΔHSC), or n=3 (PBS) two pooled experiments. For k-n, n=3. Statistical significance was determined by two-tailed unpaired student’s t-test with Welch’s correction (a-c, f-h), two-tailed Mann-Whitney U test (d-e, i-j). Error bars: SD. P value: a, * p=0.0234; b, * p=0.0428; c, *** p=0.0004; d, * p=0.0210; e, ** p=0.0054; f, ns p=0.1544; g, ns p=0.5322; h, ns p=0.0662; i, ns p=0.0592; j, ns p=0.9064.

41 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

42 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Figure 8. Dynamic transcriptional changes in liver and spleen of Ly6eΔHSC vs

Ly6efl/fl mice. Depicted are fold changes in liver and spleen gene expression from Ly6eΔHSC mice compared to Ly6efl/fl mice. RPKM values from RNAseq data for liver (a) and spleen (b) were used to calculate fold changes. Crossed out genes were not detected in either KO or WT mice at respective conditions.

43 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Figure 9. Gating strategy for intrahepatic and splenic immune cell identification.

Antibody-stained suspensions of isolated intrahepatic immune cells or splenic immune cells were first analyzed by forward scatter/side scatter to remove debris events, then gated for exclusion of a viability dye, and finally for selection of single cell events. A dump-gate strategy was used to identify immune cell populations as indicated in the diagram.

44 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Figure 10. Murine hepatitis virus infection significantly alters hepatic and splenic immune cell populations in male Ly6eΔHSC mice. a-b, Immune cell counts from liver (a) and spleen

(b). c, Infection of cultured splenocytes. For a-b, n=8 (infected Ly6efl/fl), n=7 (infected Ly6eΔHSC), n=4

PBS-injected from two pooled experiments. For h, n=6 (Ly6efl/fl), n=3 (Ly6eΔHSC), or n=e (Ifnar-/-) mice from two pooled experiments. Statistical significance was determined by two-tailed unpaired student’s t-test with Welch’s correction (a-c). Error bars: SD. P values (left-right): a, ** p=0.0053, ns p=0.5297, ns p=0.0641, ns p=0.4066, * p=0.0429, ns p=0.8678, * p=0.0163, ns p=0.2261, * p=0.0148, ns p=0.9694, *** p=0.0001, ns p=0.7840, ** p=0.0011, ns p=0.3465; b, * p=0.0284, ns p=0.3291, ns p=0.4421, ns p=0.6188, ns p=0.9412, ns p=0.2802, *** p=0.0082, ns p=0.4336, * p=0.0105, ns p=0.6763, * p=0.0419, ns p=0.9712, ** p=0.0046, ns p=0.6857; c, * p=0.0105, ns p=0.7080, ns p=0.2470, ns p=0.0503, ns p=0.0568, ns p=0.4637, ns p=0.7915.

45 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Table 1. Large scale ISG screen: HCoV-229E in Huh7 at 24 h (page 1 of 2)

Percent Z Percent Z Percent Z Percent Z Gene Infected score Gene Infected score Gene Infected score Gene Infected score CDKN1A 135.7 3.52 CXCL10 107.1 1.01 ANKRD22 101.8 0.55 MTHFD2L 98.0 0.22 SSBP3 129.8 3.00 ALDH1A1 106.9 1.00 THBD 101.8 0.55 NAPA 98.0 0.21 ZNF295 128.2 2.86 TMEM51 106.5 0.96 GLRX 101.7 0.54 TNFAIP6 97.8 0.20 MAFB 127.2 2.78 HES4 106.3 0.94 FAM134B 101.2 0.50 ADM 97.7 0.19 PAK3 126.1 2.68 MX1 106.3 0.94 MSR1 101.1 0.49 CCL8 97.7 0.19 CASP7 121.1 2.24 IL28RA 106.2 0.93 BCL2L14 101.1 0.49 MCL1 97.6 0.18 IFIT2 121.0 2.23 SOCS1 105.9 0.91 DNAPTP6 101.1 0.48 PAD12 97.6 0.18 HK2 120.7 2.20 NMI 105.8 0.90 PRAME 101.0 0.48 CCL19 97.6 0.18 SLC25A28 119.7 2.11 CPT1A 105.7 0.89 CNP 100.9 0.47 BATF2 97.5 0.17 STAT3 118.3 1.99 PARP12 105.7 0.89 USP18 100.9 0.47 CXCL9 97.4 0.17 GCH1 118.1 1.98 HCP5 105.5 0.87 IFI16 100.8 0.46 CREB3L3 97.4 0.16 CTCFL 118.1 1.98 SLC15A3 105.5 0.87 PNRC1 100.7 0.45 GMPR 97.3 0.16 SOCS2 118.0 1.97 ATF3 105.4 0.86 NCF1 100.7 0.45 B4GALT5 97.3 0.15 AHNAK2 117.8 1.95 PPM1K 105.3 0.85 PSMB8 100.6 0.45 TRAFD1 97.2 0.15 CD80 117.1 1.89 CD74 104.9 0.82 LOC400759 100.6 0.45 MAFF 97.2 0.14 EPAS1 117.0 1.88 DTX3L 104.7 0.80 IRF7 100.6 0.44 PDGFRL 97.1 0.14 ARHGAP17 116.4 1.83 DEFB1 104.6 0.80 HSPA6 100.5 0.44 CEACAM1 97.0 0.13 BCL3 116.2 1.81 IGFBP2 104.6 0.79 FLJ39739 100.5 0.44 CHMP5 97.0 0.12 SMAD3 115.3 1.73 MKX 104.2 0.76 MCOLN2 100.4 0.43 C4orf32 96.9 0.12 XAF1 114.9 1.70 FLJ23556 104.2 0.76 CRY1 100.4 0.43 CLEC4A 96.8 0.11 DDX3X 113.3 1.55 UBA7 104.0 0.74 N4BP1 100.3 0.42 PFKFB4 96.7 0.11 IFI44L 112.6 1.49 MICB 104.0 0.74 TRIM5 100.2 0.41 CCL2 96.7 0.11 TREX1 111.9 1.43 RBM43 104.0 0.74 ERLIN1 99.9 0.39 MDA5 96.7 0.10 HESX1 111.8 1.42 TBX3 103.9 0.73 PSCD1 99.9 0.38 TRIM25 96.6 0.10 STAP1 111.4 1.39 TNK2 103.7 0.72 IL6ST 99.7 0.37 RBM25 96.6 0.10 HPSE 111.1 1.36 LGMN 103.7 0.72 EHD4 99.7 0.36 PCTK2 96.5 0.09 FNDC4 110.9 1.34 ARHGEF3 103.6 0.70 EXT1 99.6 0.35 INDO 96.5 0.09 PUS1 110.8 1.33 VEGFC 103.5 0.70 BLZF1 99.5 0.35 RIPK2 96.5 0.08 RSAD2 110.7 1.33 RPL22 103.4 0.69 AQP9 99.5 0.34 LRG1 96.4 0.08 TRIM34 110.7 1.33 ZNF385B 103.4 0.69 ANGPTL1 99.4 0.34 ABLIM3 96.4 0.07 TMEM49 110.6 1.32 SP110 103.4 0.69 IFITM1 99.4 0.34 GZMB 96.2 0.06 MT1G 110.5 1.31 DHX58 103.2 0.67 FCGR1A 99.3 0.33 MAFF 96.2 0.06 TFEC 110.4 1.30 PRKD2 103.1 0.67 DUSP5 99.3 0.33 C9orf19 96.1 0.05 ARNTL 110.2 1.29 SIRPA 103.0 0.66 Empty 1 99.1 0.32 RGS1 96.1 0.05 C15orf48 109.9 1.26 IRF2 103.0 0.65 SIGLEC1 98.9 0.30 PBEF1 96.0 0.04 BAG1 109.8 1.25 SAA1 102.9 0.65 TRIM14 98.9 0.29 GEM 95.9 0.03 NT5C3 109.5 1.23 ADFP 102.9 0.65 P2RY6 98.9 0.29 DCP1A 95.9 0.03 SERPINB9 109.4 1.21 TNFSF10 102.9 0.64 GALNT2 98.8 0.29 S100A8 95.8 0.02 SERPINE1 109.3 1.20 FUT4 102.9 0.64 BUB1 98.8 0.29 TNFAIP3 95.8 0.02 KIAA0040 108.3 1.12 FKBP5 102.5 0.61 VAMP5 98.7 0.28 GBP2 95.7 0.02 HLA-E 108.0 1.09 CCDC92 102.3 0.60 ETV7 98.6 0.27 SAMHD1 95.7 0.02 C10orf10 108.0 1.09 ZNF313 102.3 0.60 MT1L 98.5 0.26 TRIM38 95.7 0.02 SCARB2 107.9 1.09 OPTN 102.3 0.59 CCL5 98.5 0.26 IFI30 95.7 0.02 C9orf91 107.9 1.08 ETV6 102.3 0.59 IDO1 98.4 0.25 C19orf66 95.6 0.01 MS4A4A 107.8 1.08 LINCR 102.3 0.59 Hercb 98.3 0.24 PADI2 95.6 0.00 JUNB 107.8 1.07 CD69 102.0 0.56 LAMP3 98.2 0.24 IFI6 95.3 -0.02 STEAP4 107.6 1.06 CXCL11 102.0 0.56 MTHFD2L 98.2 0.23 NFIL3 95.2 -0.03 COMMD3 107.6 1.05 MT1M 102.0 0.56 TXNIP 98.1 0.22 GBP5 95.2 -0.03 PHF15 107.5 1.05 NOS2A 102.0 0.56 SAMD4A 98.0 0.22 RTP4 95.1 -0.03 LEPR 107.4 1.04 DDIT4 102.0 0.56 ANKFY1 98.0 0.22 PDK1 95.1 -0.04

46 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Table 1. Large scale ISG screen: HCoV-229E in Huh7 at 24 h (page 2 of 2)

Percent Z Percent Z Percent Z Percent Z Gene Infected score Gene Infected score Gene Infected score Gene Infected score MT1F 95.1 -0.04 PTMA 91.5 -0.36 NOD2 88.3 -0.63 SAT1 79.8 -1.38 ATP10D 94.8 -0.06 ISG15 91.3 -0.37 C22orf28 88.3 -0.63 BST2 79.6 -1.39 CD38 94.8 -0.06 OAS1 91.3 -0.37 IFI35 88.2 -0.65 UPP2 79.2 -1.43 C5orf27 94.8 -0.07 IL1R 91.2 -0.38 ABTB2 87.9 -0.67 CYP1B1 79.1 -1.44 APOL2 94.8 -0.07 THOC4 91.2 -0.38 ZNF107 87.7 -0.69 ELF1 78.9 -1.45 LGALS9 94.7 -0.07 AIM2 91.2 -0.38 RASGEF1B 87.6 -0.69 NCOA3 78.1 -1.53 CRP 94.7 -0.07 CMAH 91.1 -0.39 IRF9 87.4 -0.71 APOL3 77.9 -1.55 IL17RB 94.7 -0.08 IL15 91.0 -0.40 MAFF 87.3 -0.72 ENPP1 77.8 -1.56 FNDC3B 94.5 -0.09 MOV10 90.9 -0.40 EIF3EIP 87.3 -0.72 GBP3 77.7 -1.56 CX3CL1 94.5 -0.09 IFI44 90.9 -0.41 HEG1 87.2 -0.73 PI4K2B 77.5 -1.58 PABPC4 94.3 -0.10 IFIT1 90.9 -0.41 WARS 87.2 -0.73 MAP3K5 77.0 -1.62 TRIM56 94.3 -0.11 MT1H 90.8 -0.41 PIM3 86.9 -0.76 APOL1 76.9 -1.63 LGALS3 94.1 -0.12 UNC93B1 90.7 -0.42 PMM2 86.8 -0.76 RAB27A 76.4 -1.68 Empty 2 94.0 -0.13 MASTL 90.7 -0.43 MX2 86.8 -0.77 CD274 75.5 -1.76 GBP1 93.9 -0.14 ARG2 90.6 -0.43 FBXO6 86.5 -0.80 IFI27 74.8 -1.82 PMAIP1 93.9 -0.14 PCTK3 90.5 -0.44 ISG20 86.2 -0.81 RNF24 73.4 -1.94 TGFB1 93.8 -0.15 RGL-1 90.4 -0.45 STAT2 86.2 -0.82 UNC84B 73.3 -1.95 TAP1 93.8 -0.15 MARCK 90.4 -0.45 BLVRA 86.1 -0.82 G6PC 73.3 -1.95 FAM70A 93.8 -0.15 CD163 90.3 -0.45 CLEC4D 86.1 -0.83 FAM46A 73.1 -1.96 TNFSF13B 93.8 -0.15 FER1L3 90.3 -0.46 NUP50 85.6 -0.87 supernatantN 73.0 -1.98 TIMP1 93.6 -0.17 GK 90.3 -0.46 MYD88 85.6 -0.87 SPSB1 72.9 -1.98 FAM348 93.4 -0.18 CCL4 90.3 -0.46 GJA4 85.3 -0.90 SLFN12 70.7 -2.17 RBCK1 93.4 -0.19 SLFN5 90.1 -0.47 HLA-C 85.3 -0.90 HERC5 69.0 -2.33 ZBP1 93.3 -0.19 CCNA1 90.1 -0.47 SPTLC2 85.2 -0.91 OAS2 68.5 -2.37 B2M 93.3 -0.20 IRF2 90.1 -0.48 IRF1 85.0 -0.92 NRN1 66.2 -2.57 PML 93.2 -0.20 NDC80 90.1 -0.48 UBE2L6 85.0 -0.93 IFIH2 64.8 -2.69 GTPBP2 93.2 -0.21 CASP1 90.0 -0.48 LMO2 84.9 -0.93 IFITM2 61.2 -3.01 BTN3A3 93.1 -0.22 HERC6 89.8 -0.50 CFB 84.8 -0.94 FAM46C 59.4 -3.17 KIAA0082 93.1 -0.22 CCDC75 89.8 -0.50 STAT1 84.7 -0.95 STARD5 58.7 -3.23 CSDA 92.9 -0.23 C4orf33 89.7 -0.51 SECTM1 84.3 -0.98 SLC1A1 53.5 -3.68 IFNGR1 92.8 -0.24 AMPH 89.7 -0.51 IFITM3 83.6 -1.05 TLR3 44.5 -4.47 RNF19B 92.8 -0.24 ADAMDEC1 89.6 -0.52 RARRES3 83.5 -1.05 SQLE 43.6 -4.55 TAGAP 92.7 -0.25 EPSTI1 89.6 -0.52 IMPA2 83.3 -1.07 LY6E 6.7 -7.78 SLC25A30 92.7 -0.25 CCR1 89.4 -0.53 MAB21L2 83.1 -1.09 ZC3HAV1 92.7 -0.25 PLSCR1 89.4 -0.53 MAX 83.1 -1.09 CCND3 92.5 -0.26 GPX2 89.2 -0.55 PFKFB3 83.1 -1.09 CES1 92.5 -0.26 SLC16A1 89.2 -0.55 KIAA1618 82.9 -1.11 WHDC1 92.4 -0.27 ODC1 89.2 -0.55 SCO2 82.8 -1.12 CEBPD 92.4 -0.28 NPAS2 89.2 -0.56 GBP4 82.7 -1.12 HSH2D 92.3 -0.28 TDRD7 89.1 -0.56 FFAR2 82.7 -1.12 HLA-F 92.2 -0.29 FAM125B 89.1 -0.57 C6orf150 82.5 -1.14 ADAR 92.2 -0.29 GCA 89.0 -0.57 FLT1 82.1 -1.18 AKT3 92.1 -0.30 SERPING1 88.7 -0.59 BIRC3 82.1 -1.18 CCDC109B 92.1 -0.30 PSMB9 88.7 -0.60 TLR7 82.1 -1.18 APOL6 92.0 -0.31 AXUD1 88.7 -0.60 TAP2 81.7 -1.21 RNASE4 91.9 -0.32 LAP3 88.6 -0.60 CLEC2B 81.4 -1.23 PXK 91.8 -0.32 ULK4 88.6 -0.61 CD9 81.3 -1.25 Empty 3 91.8 -0.33 OASL 88.6 -0.61 C1S 81.2 -1.26 HLA-G 91.7 -0.33 RASSF4 88.4 -0.63 IL15RA 81.1 -1.26 GAK 91.5 -0.35 LIPA 88.3 -0.63 C2orf31 81.1 -1.27

47 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Table 2. Large scale ISG screen: HCoV-229E in Huh7 at 48 h (page 1 of 2)

Percent Z Percent Z Percent Z Percent Z Gene Infected score Gene Infected score Gene Infected score Gene Infected score ZNF107 131.1 3.00 GAK 103.7 0.73 WARS 101.2 0.53 TLR7 98.8 0.33 PAK3 119.7 2.05 C5orf27 103.7 0.73 MT1H 101.2 0.53 IGFBP2 98.7 0.32 PNRC1 118.4 1.95 CLEC4D 103.6 0.72 C15orf48 101.1 0.52 IFIT1 98.7 0.32 LEPR 116.9 1.83 B4GALT5 103.6 0.72 SECTM1 101.1 0.52 COMMD3 98.7 0.32 HSPA6 116.6 1.80 SIGLEC1 103.5 0.72 SSBP3 101.0 0.52 GALNT2 98.7 0.32 CDKN1A 116.4 1.78 SMAD3 103.4 0.71 RPL22 101.0 0.51 TDRD7 98.6 0.31 IL28RA 113.2 1.52 GEM 103.3 0.70 TRIM34 101.0 0.51 NCF1 98.6 0.31 ZBP1 112.6 1.47 OASL 103.3 0.70 LMO2 101.0 0.51 CXCL11 98.6 0.31 KIAA0040 111.5 1.38 MAFF 103.2 0.70 CD69 100.8 0.50 CD274 98.6 0.31 EPAS1 111.3 1.36 SLC16A1 103.1 0.69 MCL1 100.7 0.49 SERPINB9 98.4 0.30 MAFB 109.8 1.24 NAPA 103.1 0.69 FAM125B 100.7 0.48 UBA7 98.3 0.29 RIPK2 109.5 1.21 SP110 103.1 0.69 Empty 1 100.6 0.48 BAG1 98.2 0.28 HES4 109.4 1.20 HCP5 103.0 0.68 PFKFB4 100.5 0.47 AQP9 98.0 0.27 AHNAK2 109.0 1.17 Hercb 103.0 0.67 PRKD2 100.5 0.47 LAP3 98.0 0.27 BATF2 108.8 1.16 RTP4 103.0 0.67 NMI 100.4 0.46 MT1G 97.8 0.25 PLEKHA4 108.7 1.15 AXUD1 102.9 0.67 PML 100.4 0.46 GPX2 97.7 0.24 ALDH1A1 108.4 1.12 ADFP 102.7 0.65 HLA-G 100.4 0.46 DEFB1 97.7 0.24 DDX60 108.2 1.11 SPTLC2 102.7 0.65 ADM 100.3 0.46 PDK1 97.7 0.24 APOL6 108.1 1.10 MICB 102.6 0.65 FUT4 100.2 0.45 IFIT2 97.7 0.24 SLC25A28 108.1 1.10 P2RY6 102.6 0.64 TMEM51 100.1 0.44 C10orf10 97.7 0.24 CTCFL 107.9 1.08 CMAH 102.6 0.64 TLR3 100.1 0.44 LAMP3 97.6 0.23 SCARB2 107.4 1.04 SAA1 102.6 0.64 DCP1A 100.0 0.43 FER1L3 97.6 0.23 TNK2 107.4 1.04 JUNB 102.5 0.64 C6orf150 100.0 0.43 C1S 97.5 0.23 MSR1 107.4 1.04 IL17RB 102.5 0.64 PHF15 99.9 0.42 NDC80 97.5 0.22 TAGAP 107.0 1.01 PMM2 102.4 0.63 PCTK2 99.9 0.42 UNC84B 97.4 0.21 PCTK3 106.6 0.98 SIRPA 102.4 0.63 TBX3 99.8 0.41 APOL3 97.2 0.20 DDX3X 106.3 0.95 BCL3 102.4 0.63 OAS1 99.8 0.41 C4orf32 97.0 0.18 IL6ST 106.2 0.94 TNFSF10 102.4 0.63 CCNA1 99.7 0.41 TNFSF13B 97.0 0.18 PUS1 105.8 0.91 PSMB8 102.3 0.62 PRAME 99.6 0.40 STAT3 96.9 0.18 ZC3HAV1 105.7 0.90 IFI44 102.3 0.62 USP18 99.6 0.40 CCR1 96.9 0.17 HPSE 105.5 0.89 MT1M 102.3 0.62 SAMHD1 99.6 0.40 NOS2A 96.9 0.17 DDIT4 105.5 0.88 ARNTL 102.1 0.61 FLJ39739 99.6 0.40 TFEC 96.9 0.17 LOC400759 105.3 0.87 TAP2 102.0 0.60 GBP2 99.6 0.40 GCA 96.8 0.17 RSAD2 105.2 0.86 SLC15A3 102.0 0.59 CASP7 99.6 0.39 RAB27A 96.8 0.16 NT5C3 105.0 0.84 FAM134B 102.0 0.59 FNDC3B 99.6 0.39 DDX58 96.7 0.16 CX3CL1 104.9 0.83 HK2 102.0 0.59 HLA-C 99.5 0.39 TRIM56 96.7 0.16 VAMP5 104.8 0.83 HLA-F 102.0 0.59 RBM43 99.5 0.39 FAM348 96.6 0.15 IFNGR1 104.8 0.82 CYP1B1 101.9 0.58 HEG1 99.4 0.38 MAX 96.5 0.14 STAT1 104.6 0.81 KIAA1618 101.9 0.58 CCDC109B 99.4 0.38 ADAMDEC1 96.5 0.14 LINCR 104.6 0.81 IFITM1 101.7 0.57 CLEC4A 99.4 0.38 TRIM38 96.5 0.14 MAFF 104.5 0.80 NFIL3 101.7 0.57 CD80 99.3 0.37 EHD4 96.4 0.14 N4BP1 104.5 0.80 CD163 101.6 0.56 TIMP1 99.2 0.36 PBEF1 96.4 0.13 S100A8 104.4 0.80 CRP 101.5 0.56 MS4A4A 99.2 0.36 CXCL10 96.4 0.13 TGFB1 104.3 0.78 IFI44L 101.5 0.55 GBP1 99.1 0.36 MTHFD2L 96.3 0.13 TXNIP 104.2 0.78 MAFF 101.4 0.54 ETV6 99.1 0.35 BIRC3 96.3 0.13 MKX 104.2 0.78 ARHGEF3 101.3 0.54 LRG1 99.0 0.35 PXK 96.2 0.12 ATF3 104.0 0.76 C4orf33 101.3 0.54 HLA-E 98.9 0.34 IL15 96.1 0.11 FKBP5 103.8 0.75 BUB1 101.3 0.54 PSCD1 98.9 0.34 GBP3 96.1 0.10 SERPINE1 103.8 0.75 STAP1 101.3 0.53 EPSTI1 98.9 0.34 ULK4 96.0 0.10 ZNF295 103.8 0.74 RBCK1 98.8 0.33 KIAA0082 96.0 0.10

48 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Extended Data Table 2. Large scale ISG screen: HCoV-229E in Huh7 at 48 h (page 2 of 2)

Percent Z Percent Z Percent Z Percent Z /. Infected score Gene Infected score Gene Infected score Gene Infected score RGS1 96.0 0.10 APOL2 93.6 -0.10 DNAPTP6 90.9 -0.32 RBM25 83.8 -0.91 MARCK 96.0 0.10 MT1F 93.5 -0.11 IRF1 90.9 -0.32 EIF2AK2 83.1 -0.97 IFI16 96.0 0.10 ABTB2 93.5 -0.11 SAMD4A 90.8 -0.33 SOCS2 82.3 -1.04 CCL19 95.9 0.09 PMAIP1 93.5 -0.11 TNFAIP3 90.7 -0.34 FNDC4 81.9 -1.07 FLJ11286 95.8 0.08 CD38 93.5 -0.11 TRIM21 90.6 -0.35 ANGPTL1 81.8 -1.08 CEBPD 95.8 0.08 RNASE4 93.5 -0.11 FCGR1A 90.0 -0.40 GBP4 81.7 -1.08 MX2 95.8 0.08 AKT3 93.4 -0.12 RASSF4 89.9 -0.41 B2M 81.7 -1.08 TAP1 95.8 0.08 SERPING1 93.3 -0.12 ETV7 89.8 -0.41 CNP 81.5 -1.10 PARP12 95.7 0.08 SAT1 93.3 -0.13 CSDA 89.8 -0.41 HERC6 81.4 -1.11 UBE2L6 95.7 0.07 supernatantN 93.3 -0.13 FBXO6 89.8 -0.41 LGALS3 81.2 -1.12 DTX3L 95.7 0.07 MX1 93.3 -0.13 VEGFC 89.8 -0.41 IFI27 81.0 -1.14 IFI30 95.7 0.07 ENPP1 93.1 -0.14 G6PC 89.7 -0.42 MAB21L2 80.0 -1.22 EXT1 95.4 0.05 XAF1 93.1 -0.14 BLZF1 89.7 -0.42 PSMB9 78.6 -1.34 CHMP5 95.4 0.05 CEACAM1 93.0 -0.15 CFB 89.4 -0.45 PLSCR1 78.5 -1.34 CXCL9 95.4 0.05 CCDC75 92.9 -0.16 IRF7 89.4 -0.45 LIPA 78.3 -1.37 ABLIM3 95.2 0.03 PABPC4 92.9 -0.16 CCND3 89.1 -0.47 TMEM49 78.1 -1.38 FAM70A 95.2 0.03 C5orf27 92.8 -0.17 RGL-1 89.0 -0.48 IRF2 77.8 -1.40 TRIM25 95.2 0.03 ZNF313 92.8 -0.17 ANKRD22 89.0 -0.48 IL1R 77.5 -1.43 ERLIN1 95.2 0.03 FLJ23556 92.8 -0.17 FFAR2 88.9 -0.48 NPAS2 75.8 -1.57 WHDC1 95.2 0.03 IFITM3 92.6 -0.18 DHX58 88.7 -0.50 IFI6 73.9 -1.72 RARRES3 95.2 0.03 IRF9 92.6 -0.18 IL15RA 88.6 -0.51 RASGEF1B 73.4 -1.76 IRF2 95.1 0.03 NUP50 92.6 -0.18 EIF3EIP 88.5 -0.52 OAS3 73.4 -1.77 ZNF385B 95.1 0.03 CD9 92.5 -0.19 APOL1 88.3 -0.53 HERC5 71.5 -1.93 CCL2 95.1 0.03 CES1 92.5 -0.19 TNFAIP6 88.3 -0.53 SPSB1 71.3 -1.94 MCOLN2 95.0 0.02 STAT2 92.3 -0.20 IDO1 88.2 -0.55 ELF1 71.0 -1.97 CCDC92 95.0 0.02 SLFN12 92.3 -0.21 PADI2 88.1 -0.55 IFITM2 70.7 -1.99 GLRX 94.9 0.01 ARG2 92.3 -0.21 NOD2 88.0 -0.56 NRN1 65.1 -2.45 INDO 94.9 0.01 TRAFD1 92.2 -0.22 LGMN 88.0 -0.56 FAM46A 64.4 -2.52 RNF19B 94.9 0.01 RNF24 92.2 -0.22 ADAR 87.7 -0.59 BST2 62.7 -2.65 CPT1A 94.9 0.01 NCOA3 92.1 -0.22 GK 87.6 -0.60 STARD5 56.9 -3.13 TRIM14 94.9 0.01 PDGFRL 92.0 -0.23 LGALS9 87.4 -0.61 MDA5 56.0 -3.21 GCH1 94.8 0.00 ISG20 92.0 -0.23 STEAP4 87.3 -0.62 IFIH2 51.8 -3.55 C9orf91 94.7 0.00 SOCS1 91.9 -0.24 C9orf19 87.3 -0.62 BCL2L14 48.7 -3.81 GMPR 94.7 -0.01 PIM3 91.8 -0.24 IFI35 87.1 -0.64 OAS2 37.8 -4.71 THOC4 94.7 -0.01 UNC93B1 91.8 -0.25 PI4K2B 86.9 -0.65 SLC1A1 34.1 -5.01 ATP10D 94.6 -0.01 CCL4 91.8 -0.25 GTPBP2 86.7 -0.67 SQLE 17.5 -6.39 BLVRA 94.6 -0.02 MT1L 91.6 -0.26 ANKFY1 86.0 -0.72 LY6E 4.7 -7.45 ISG15 94.4 -0.03 CREB3L3 91.6 -0.26 DYNLT1 85.9 -0.73 CCL5 94.4 -0.04 C22orf28 91.4 -0.28 CCL8 85.9 -0.73 TREX1 94.3 -0.04 THBD 91.3 -0.29 TRIM5 85.9 -0.73 CD74 94.1 -0.06 MASTL 91.3 -0.29 SLFN5 85.4 -0.77 UPP2 94.1 -0.06 C2orf31 91.3 -0.29 PFKFB3 85.4 -0.78 AIM2 94.1 -0.06 MYD88 91.3 -0.29 HSH2D 85.2 -0.80 GJA4 94.0 -0.07 ODC1 91.2 -0.30 GBP5 85.1 -0.80 DUSP5 94.0 -0.07 CRY1 91.2 -0.30 PTMA 85.0 -0.81 AMPH 93.9 -0.08 CASP1 91.1 -0.31 GZMB 85.0 -0.81 PAD12 93.8 -0.08 CLEC2B 91.0 -0.32 FAM46C 84.9 -0.81 Empty 2 93.8 -0.09 ZNF107 91.0 -0.32 MOV10 84.2 -0.87 HESX1 93.6 -0.10 OPTN 90.9 -0.32 BTN3A3 84.2 -0.88 IMPA2 93.6 -0.10 SLC25A30 90.9 -0.32 MAP3K5 83.9 -0.90

49 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Common ISG Aliases

DDX3X - DDX3, VIPERIN - RSAD2, SERPINE1 - PAI 1, IL28RA - CRF2, VEGFC – VRP, SP110 -

IFI41, IRF2 - PRIC285, ZNF313 - RNF114, DNAPTP6 - LOC26010, LOC400759 – PSEUDOGENE,

PSCD1 - CYTH1, IFITM1 - IFI17, SIGLEC1 – FRAG, CCL5 - SYCA5, CXCL9 – MIG, IFIH1 -

MDA5, INDO – IDO, C9orf19 - GLIPR2, PBEF1 – NAMPT, FLJ11286 - C19orf66, TAP1 - ABCB2,

IFIT1 - IFI56/ISG56, FER1L3 – MYOF, CCR1 - CMKBR1, TDRD7 - PCTAIRE2BP, SERPING1 -

C1NH, ENPP1 - PDNP1, BST2 - THN

50 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Supplementary Information

Methods

Cell lines

Huh7 hepatocarcinoma cells (kind gift from V. Lohnmann), Huh7.5, STAT1−/− fibroblasts (kind gift from J.-L. Casanova), VeroE6 cells and VeroB4 cells (kindly provided by M.Müller/C.Drosten),

293LTV (Cell Biolabs), and A549 cells (ATCC cat# CCL-185) were maintained in Dulbecco’s

Modified Eagle Medium-GlutaMAX (Gibco) supplemented with, 1 mM sodium pyruvate (Gibco), 10%

(v/v) heat-inactivated fetal bovine serum (FBS) (Gibco), 100 µg/ml streptomycin (Gibco), 100 IU/ml penicillin (Gibco) and 1% (w/v) non-essential amino acids (NEAA; Gibco) (cDMEM) BHK-21 (ATCC cat# CCL-10) were maintained in Glasgow’s minimal essential medium (MEM) with 5% FBS and 1% tryptose. BHK-G4357 were cultured in Glasgow’s minimal essential medium with 5% FBS. 17Cl1 fibroblasts (gift from S.G. Sawicki) were cultured in MEM supplemented with 10% (v/v) heat inactivated FBS, 100 µg/ml streptomycin and 100 IU/ml penicillin. Cells were either newly purchased or cell line identities (human cells only) verified by a Multiplex human cell line authentication test.

Huh7 cells expressing TMPRSS2 were generated as follows. In order to generate TMPRSS2-encoding retroviral vectors, the open reading frame of human TMPRRS2 was first PCR amplified with primers adding an N-terminal cMYC epitope to the TMPRSS2 coding sequence. The resulting sequence was inserted into a modified version of the pQCXIP plasmid that contains a blasticidin resistance cassette instead of the usual puromycin resistance cassette17. Huh7 cells stably expressing human TMPRSS2 were generated by retroviral transduction and selection with the antibiotic blasticidin (50 µg/ml).

Following selection, cells were maintained in culture medium (cDMEM) supplemented with 10 µg/ml blasticidin. To generate STAT1-/-_CEACAM1 cells, human STAT1−/− fibroblasts were transduced with lentiviruses encoding for the murine CoV receptor CEACAM1 (kind gift from David Wentworth, CDC,

Atlanta, USA59 and subsequently selected with 1 µg/mL puromycin. Stable LY6E expressing cell lines were generated upon lentiviral transduction with SCRPSY LY6E or as control SCRPSY Empty in

DMEM containing 4 µg/ml polybrene (Millipore) and 20 mM HEPES buffer solution (Gibco). Cells

51 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. were selected using 2-4 µg/mL puromycin and were passaged until all cells in control wells without lentivirus were killed. The puromycin selected cells were further passaged and frozen down for subsequent experiments. The stable cell lines harboring LY6E orthologues have been described before, with the exception of C. dromedarius9. For this, a gBlock was ordered (XM_031439745.1) and Gateway cloning performed as described previously to generate pENTR and pSCRPSY plasmids9. Constructs encoding for Ly6/uPAR family members and LY6E ASM mutants have been described before9.

To generate clonal LY6E KO cells and CRISPR-resistant LY6E, A549 cells were transduced with lentivirus containing a LY6E-specific sgRNA and Cas9 as described previously9. To generate a clonal cell line, the bulk transduced population was plated at single cell dilutions. Candidate clones were screened by Western blot for LY6E expression and Sanger sequencing. Silent mutations in the region targeted by the LY6E-specific sgRNA were introduced into HA-tagged LY6E to generate CRISPR- resistant LY6E (CR LY6E). LY6E KO A549 cells were reconstituted with CR-LY6E by lentiviral transduction and expression confirmed by Western blot.

All cell lines were regularly tested to check they were free of mycoplasma contamination using a commercially available system (PCR Mycoplasma test kit I/RT Variant C, PromKine).

ISG screen.

The ISG screen was performed as described previously with slight modifications7,8. Briefly, 5 x 103

Huh7 cells were seeded, transduced with individual lentiviruses, and 48 hours post-transduction infected with HCoV-229E at 33°C. Infection was stopped 24 hours (MOI=0.1) or 48 hours (MOI=0.01) post- infection and plates were immuno-stained as described previously61 with an anti-HCoV-229E N protein antibody and a AlexaFluor488-conjugated donkey anti-mouse secondary antibody (Extended methods;

Antibodies for immunofluorescence and flow cytometry). For high-content high-throughput imaging analysis ImageXpress Micro XLS (Molecular Devices, Sunnyvale, CA) was used as previously described8. Hits were normalized to cells expressing the empty vector. Depicted are genes that were

52 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. expressed in two independent screens with a transduction efficiency of at least 1 % (cut off). ISGs which were cytotoxic for the cells were excluded from the analysis. Normalized data can be found in Extended

Data Table 1 and Extended Data Table 2.

Western blotting.

For SDS-PAGE and Western blot analysis, lysates from cultured cells were prepared using the M-PER

Mammalian Protein Extraction Reagent (Thermo) supplemented with protease inhibitors (cOmplete

Mini, Roche). Proteins were separated on 10% (w/v) SDS-polyacrylamide gels (Bio-Rad), and electroblotted on nitrocellulose membranes (in a Mini Trans-Blot cell (eBlot L1 GenScript). Membranes were incubated in PBS 0.1% Tween (Merck Millipore) 5% milk (Dietisa, Biosuisse), probed with the respective primary antibodies, followed by incubation with horseradish peroxidase-conjugated secondary antibodies. LY6E was detected using anti-LY6E rabbit monoclonal antibody GEN-93-8-1

(Genentech) at a dilution of 1:5,000 and secondary Peroxidase-AffiniPure Donkey Anti-Rabbit IgG

(Jackson Immunoresearch, 711-035-152) at a dilution of 1:10,000. MERS-CoV spike was detected using the monoclonal anti-human 1.6c7 ab (0.12 mg/ml)62 (kindly provided by B.J. Bosch) at a dilution of 1:1,000 and a secondary Peroxidase-AffiniPure Donkey Anti-Human IgG (Jackson Immunoresearch,

709-035-098) at a dilution of 1:10,000. β-actin was detected using Monoclonal Anti-β-Actin-Peroxidase clone AC-15 (Sigma-Aldrich, A3854) at a dilution of 1:25,000. Proteins were visualized using

WesternBright enhanced chemiluminescence horseradish peroxidase substrate (Advansta) and quantified in a Fusion FX7 Spectra (Vilber-Lourmat). Bands were quantified using the respective software (FusionCapt Software Version 18.05).

RNA extraction and RT-qPCR

Viral RNA was extracted from cell lysates (NucleoMag-96RNA kit, Macherey Nagel) or supernatant

(NucleoMag-Vet kit, Macherey Nagel) using the KingFisher Flex robot according to the manufacturer’s recommendations. The commercially available TaqManTM Fast Virus 1-Step Master Mix (Applied

Biosystems) was used for RT-qPCR with 2 µl of RNA input added to 8 µl of prepared mastermix per

53 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. sample. Viral RNA was detected using HCoV-229E specific primers normalized to a qRT-PCR standard for HCoV-229E (contains the M gene of HCoV-229E63). Intracellular viral RNA was normalized to total RNA (determined via the housekeeping gene Beta-2-Microglobulin (B2M)). Cellular RNA was extracted from cell lysates of Huh7 cells using the Nucleospin RNA kit (Machery Nagel) according to the manufacturer’s recommendations, quantified via NanoDrop, and used to generate a standard curve.

PCR conditions are available upon request.

Cellular CD13 expression

LY6E expressing or control cells were dissociated (TryPLE Express, Gibco) and enumerated. 3 x 105 cells were stained in duplicate using Zombie Aqua™ Fixable Viability Kit (Biolegend) according to the manufacturer’s recommendations. Cells were resuspended in 0.1% FBS/PBS and stained for CD13 expression (See ‘Antibodies for immunofluorescence and flow cytometry’). Cells were washed with

0.1% FBS/PBS and resuspend in equal volumes. Cell suspensions were analyzed by flow cytometry using a FACS Canto (BD) and analyzed with FlowJo Software (Treestar).

Binding experiment

Stable LY6E expressing or control Huh7 cells were seeded in a 24-well plate (4 x 104 cells) and mock infected or inoculated with HCoV-229E (MOI=5) in OptiMEM (Gibco) on ice for 1 hour. Cells were washed at least 3x with PBS and harvested immediately (t=0 h) or incubated at 33°C for 24 hours (t=24 h), before cell lysis and extraction of viral RNA as described above. Viral RNA was detected via RT- qPCR normalized to the housekeeping gene B2M as described above.

Time course experiment

8 x 104 cells stable LY6E expressing or control Huh7 cells were seeded in 12-well plates and mock infected or infected with 229E-CoV-Rluc (MOI=0.1) for 2 hours at 33°C in OptiMEM. Cells were washed 3x with PBS and samples harvested at the indicated time points. To determine intracellular replication, cell lysates were collected and viral RNA extracted (NucleoMag-96RNA kit, Macherey

54 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Nagel), followed by RT-qPCR as described before, or cells were lysed using the Renilla Luciferase

Assay System kit (Promega) according to the manufacturer’s recommendations and Rluc activity determined. To determine extracellular viral replication, viral supernatant was harvested, and viral RNA extracted (NucleoMag-Vet kit, Macherey Nagel), followed by RT-qPCR as described before. To determine intracellular infectivity, cells were subjected to 3 rounds of freeze/thaw cycles, centrifuged to remove debris (4,000 × g for 10 min), and the supernatant titrated on naïve Huh7 cells. To determine extracellular infectivity, supernatant was harvested at the indicated time points and titrated on naïve

Huh7 cells. For titration, 1 x 104 Huh7 cells were seeded in a 96-well plate and infected with 22 µl of virus containing supernatant and incubated at 33°C. Cells were lysed 24 hours post-infection and infectivity determined using the Renilla Luciferase Assay System kit (Promega) according to the manufacturer’s recommendations.

Protease inhibitor treatment

To test various protease inhibitors, 2 x 104 naïve or TMPRSS2-expressing, control or LY6E cells were seeded in a 96-well plate. One day post seeding, cells were pre-treated with the following compounds for 1 hour in OptiMEM, at 37°C: DMSO (1:500, Sigma-Aldrich), E64 D (10 µM, Sigma-Aldrich), and/or Camostat (100 µM, Sigma-Aldrich). Cells were mock infected or infected with HCoV-229E-

Rluc (MOI 0.1) in the presence of the inhibitors for 2 hours at 33°C. Medium was changed to DMEM and cells incubated for 24 hours at 33°C. Cells were lysed and Rluc activity detected using the Renilla

Luciferase Assay System kit (Promega) according to the manufacturer’s recommendations.

Spike cleavage assays.

LY6E expressing or control Huh7 (2 x 105 cells) were seeded in 6-well cell culture plates. Cells were transfected using Lipofectamine 2000 (Invitrogen) with an expression plasmid encoding for MERS-

CoV S (pCAGGS-MERS S). Cell lysates were harvested 48 hours post-transfection and subjected to

Western blot analysis as described.

55 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Multiple Sequence alignment and phylogeny

Multiple sequence alignment of LY6E amino acid sequences of different species (NCBI accession numbers provided in the figure) was performed using the EBI web based Clustal Omega tool (doi:

10.1093/nar/gkz268). The phylogenetic tree was built with the “one click” mode for phylogenetic analysis (http://www.phylogeny.fr/) with standard settings (doi: 10.1093/nar/gkn180; doi:

10.1186/1471-2148-10-8).

RNA isolation from primary tissues

Sections of liver and spleen were preserved in RNAlater Stabilization Solution (Thermo Fisher

Scientific) and frozen. Thawed samples were transferred to PBS and homogenized. One-eighth of the homogenate was mixed with TRIzol Reagent (Thermo Fisher Scientific). BMDM were directly lysed in

TRIzol Reagent and frozen. Total RNA was isolated according to the manufacturer’s protocol. Liver and spleen RNA were subject to DNase treatment (TURBO DNA-Free kit, Thermo Fisher Scientific) per the manufacturer’s protocol prior to RNA-Seq analysis. BMDM RNA was analyzed by one-step qRT-PCR using QuantiFast SYBR Green RT-PCR Kit (Qiagen) using Applied Biosciences 7500 Fast

Real-Time PCR System.

RNA library construction and sequencing

The quantity and quality of the extracted RNA was assessed using a Thermo Fisher Scientific qubit 2.0 fluorometer with the Qubit RNA BR Assay Kit (Thermo Fisher Scientific, Q10211) and an Advanced

Analytical Fragment Analyzer System using a Fragment Analyzer RNA Kit (Agilent, DNF-471), respectively. Sequencing libraries were prepared using an Illumina TruSeq Stranded Total RNA Library

Prep Gold kit (Illumina, 20020599) in combination with TruSeq RNA UD Indexes (Illumina, 20022371) according to the Illumina guidelines. Sequencing libraries were sequenced paired-end (2 x 50 bp) using an Illumina NovaSeq 6000 S1 Reagent Kit (100 cycles; Illumina, 20012865) on an Illumina NovaSeq

6000 sequencer. The quality control assessments, generation of libraries and sequencing run were all performed at the Next Generation Sequencing Platform, University of Bern, Switzerland.

56 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Data generated from individual samples (>30 million read per sample, single read 50-mers) were mapped separately against the GRCm38 murine reference genome. Gene expression was calculated for individual transcripts as reads per kilobase per million bases mapped (RPKM). All transcriptomic analyses were performed using CLC Genomics Workbench 20 (Qiagen, Aarhaus).

Differentially expressed genes (DEGs) were identified by calculating fold changes in expression, p- values were corrected by taking false discovery rate (FDR) for multiple comparison into account.

Mus Musculus EBI Gene Ontology Annotation Database was used to execute Gene ontology (GO)

Enrichment Analyses for biological processes. Gene identifiers for DEGs absolute FC > 5, RPKM > 2) were used as input and identification of significantly enriched GO categories. P-values for specific GO categories were generated after Bonferroni correction for multiple testing. Z-scores, used as indicator for activation of biological processes (positive value) or inactivation (negative value), were calculated based on the expression fold change as follows:

(��-�� − ��-��) �-�� = √��

Antibodies for immunofluorescence and flow cytometry

HCoV-229E infection was detected by staining permeabilized cells for N protein (Anticuerpo

Monoclonal, 1E7, Ingenasa) and a secondary donkey anti-mouse AlexaFluor488-conjugated antibody

(Jackson Immuno Research). HCoV-OC43 infection was detected by staining permeabilized cells for nucleoprotein (MAB9013, Millipore) and a secondary goat anti-mouse AlexaFluor488-conjugated antibody (Thermo Fisher Scientific). ZIKV infected cells were stained for viral antigen using a monoclonal antibody anti-flavivirus group antigen 4G2 (MAB10216; RRID: AB_827205, EMD

Millipore) as primary antibody and AlexaFluor488 (A-11001, RRID: AB_2534069, Thermo Fisher

Scientific) as secondary antibody. CD13 was stained anti-human CD13 Antibody, APC conjugated

(clone WM15, BioLegend). The following antibodies were used to differentiate immune cell populations: anti-CD3e-PE (145-2C11, Tonbo Biosciences), anti-CD3e-FITC (145-2C11, Tonbo

57 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Biosciences), anti-CD11c-PECy7 (N418, Tonbo Biosciences), anti-Ly6G-PE (1A8, Tonbo

Biosciences), anti-Ly6G-FITC (1A8, Tonbo Biosciences), anti-Ly6g-PerCPCy5.5 (1A8, Tonbo

Biosciences), anti-CD11b-PECy7 (M1/70, Tonbo Biosciences), anti-CD19-PE (6D5, BioLegend), anti-

CD19-FITC (1D3, Tonbo Biosciences), anti-CD19-PECy5 (6D5, BioLegend), anti-F4/80-PECy5

(BM8, BioLegend), anti-Nkp46-PECy7 (29A1.4, BioLegend), anti-CD4-PECy5 (GK1.5, Tonbo

Biosciences), anti-CD8-PECy7 (53-6.7, Tonbo Biosciences).

58 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Primers and gBlocks

Primer name Usage Sequence Ly6e tissue genotyping Generation of Ly6efl/fl actcgagttgtcttaatggctacc forward mice Ly6e tissue genotyping Generation of Ly6efl/fl cttcagactttggtactggagtgg reverse mice Ly6e gene expression qPCR for Ly6e atcttcggggcctcttcac forward expression Ly6e gene expression qPCR for Ly6e atgagaagcacatcagggaat reverse expression Rpl32 gene expression qPCR for Rpl32 aagcgaaactggcggaaac forward (housekeeping gene) expression Rpl32 gene expression qPCR for Rpl32 taaccgatgttgggcatcag reverse (housekeeping gene) expression HCoV-229E M forward qPCR detection of ttccgacgtgctcgaacttt HCoV-229E HCoV-229E M reverse qPCR detection of ccaacacggttgtgacagtga HCoV-229E FAM/BHQ1 probe qPCR detection of FAM-tgggcatggaatcctgaggttaatgc- HCoV-229E BHQ1 B2M gene expression qPCR detection of B2M tgctcgcgctactctctctttc forward (housekeeping gene) expression B2M gene expression qPCR detection of B2M gtcaacttcaatgtcggatgga reverse (housekeeping gene) expression YYE/BHQ1 probe qPCR detection of B2M YYE- aggctatccagcgtactccaaagattcaggtt- BHQ1

gBlock Gene Fragment Usage Sequence Gateway Cloning-compatible Reconstitution of LY6E Ggggacaagtttgtacaaaaaagcaggcttca LY6E sgRNA #4-resistant expression in A549 ccatgaagatcttcttgccagtgctgctggctgc human LY6E with N- LY6E-/- clonal cell lines ccttctgggtgtggagcgagccagctcgctgat terminal HA epitope tag gtgcttctcctgcttgaaccagaagagcaatctg tactgcctgaagccaacaatatgttcagatcag CRISPR-resistant LY6E gacaactactgcgtgactgtgtctgctagtgcc (CR-LY6E) ggcattgggaatctcgtgacatttggccacagc ctgagcaagacctgttccccggcctgccccatc ccagaaggcgtcaatgttggtgtggcttccatg ggcatcagctgctgccagagctttctgtgcaatt tcTACCCATACGATGTTCCAG ATTACGCTagtgcggccgatggcgggc tgcgggcaagcgtcaccctgctgggtgccgg gctgctgctgagcctgctgccggccctgctgc ggtttggcccctgaacccagctttcttgtacaaa gtggtcccc Gateway Cloning-compatible Expression of camel (C. ggggacaagtttgtacaaaaaagcaggcttca Camelus dromedarius LY6E dromedarius) LY6E ccatgaaggtcttcctgccggtgctgctggctg ccctcctgggtgtggagcgagcccgctccctg gtgtgcttctcctgcacgaataagaacagcaac tggtactgcctgaagcccaccgtctgctccgac tccgacaactactgcgtgaccatatctgcatcc 59 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

gctggcatcgggaacgtggtggactttggctac accctgaacaagggctgctccccgatctgtccc ggcccgagcgtcaatcttggagtggcgtccgt gggcacccactgctgccagagcttcctgtgca acatcagtgcagccgacggcgggctgcgggc cagcacccacgtgctgggcctcgggctcctgc tcagcctgctgtccgccctgctgcggcttggcc cctgaacccagctttcttgtacaaagtggtcccc

60 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

References

31 Thiel, V. & Siddell, S. G. Reverse genetics of coronaviruses using vaccinia virus vectors. Curr

Top Microbiol Immunol 287, 199-227, doi:10.1007/3-540-26765-4_7 (2005).

32 van den Worm, S. H. et al. Reverse genetics of SARS-related coronavirus using vaccinia virus-

based recombination. PLoS One 7, e32857, doi:10.1371/journal.pone.0032857 (2012).

33 Bruckova, M., McIntosh, K., Kapikian, A. Z. & Chanock, R. M. The adaptation of two human

coronavirus strains (OC38 and OC43) to growth in cell monolayers. Proc Soc Exp Biol Med

135, 431-435, doi:10.3181/00379727-135-35068 (1970).

34 Coley, S. E. et al. Recombinant mouse hepatitis virus strain A59 from cloned, full-length

cDNA replicates to high titers in vitro and is fully pathogenic in vivo. J Virol 79, 3097-3106,

doi:10.1128/JVI.79.5.3097-3106.2005 (2005).

35 Lundin, A. et al. Targeting membrane-bound viral RNA synthesis reveals potent inhibition of

diverse coronaviruses including the middle East respiratory syndrome virus. PLoS Pathog 10,

e1004166, doi:10.1371/journal.ppat.1004166 (2014).

36 Kindler, E. et al. Efficient replication of the novel human betacoronavirus EMC on primary

human epithelium highlights its zoonotic potential. mBio 4, e00611-00612,

doi:10.1128/mBio.00611-12 (2013).

37 Thiel, V. et al. Mechanisms and enzymes involved in SARS coronavirus genome expression. J

Gen Virol 84, 2305-2315, doi:10.1099/vir.0.19424-0 (2003).

38 Richardson, R. B. et al. A CRISPR screen identifies IFI6 as an ER-resident interferon effector

that blocks flavivirus replication. Nat Microbiol 3, 1214-1223, doi:10.1038/s41564-018-0244-

1 (2018).

39 Berger Rentsch, M. & Zimmer, G. A vesicular stomatitis virus replicon-based bioassay for the

rapid and sensitive determination of multi-species type I interferon. PLoS One 6, e25858,

doi:10.1371/journal.pone.0025858 (2011).

61 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

40 Zhang, L. et al. Infection of ciliated cells by human parainfluenza virus type 3 in an in vitro

model of human airway epithelium. J Virol 79, 1113-1124, doi:10.1128/JVI.79.2.1113-

1124.2005 (2005).

41 Biacchesi, S. et al. Recovery of human metapneumovirus from cDNA: optimization of growth

in vitro and expression of additional genes. Virology 321, 247-259,

doi:10.1016/j.virol.2003.12.020 (2004).

42 Jones, C. T. et al. Real-time imaging of hepatitis C virus infection using a fluorescent cell-

based reporter system. Nat Biotechnol 28, 167-171, doi:10.1038/nbt.1604 (2010).

43 Schoggins, J. W. et al. Dengue reporter viruses reveal viral dynamics in interferon receptor-

deficient mice and sensitivity to interferon effectors in vitro. Proc Natl Acad Sci U S A 109,

14610-14615, doi:10.1073/pnas.1212379109 (2012).

44 McGee, C. E. et al. Infection, dissemination, and transmission of a West Nile virus green

fluorescent protein infectious clone by Culex pipiens quinquefasciatus mosquitoes. Vector

Borne Zoonotic Dis 10, 267-274, doi:10.1089/vbz.2009.0067 (2010).

45 Liu, D. et al. Fast hepatitis C virus RNA elimination and NS5A redistribution by NS5A

inhibitors studied by a multiplex assay approach. Antimicrob Agents Chemother 59, 3482-

3492, doi:10.1128/AAC.00223-15 (2015).

46 Suthar, M. S., Shabman, R., Madric, K., Lambeth, C. & Heise, M. T. Identification of adult

mouse neurovirulence determinants of the Sindbis virus strain AR86. J Virol 79, 4219-4228,

doi:10.1128/JVI.79.7.4219-4228.2005 (2005).

47 Petrakova, O. et al. Noncytopathic replication of Venezuelan equine encephalitis virus and

eastern equine encephalitis virus replicons in Mammalian cells. J Virol 79, 7597-7608,

doi:10.1128/JVI.79.12.7597-7608.2005 (2005).

48 Tsetsarkin, K. et al. Infectious clones of Chikungunya virus (La Reunion isolate) for vector

competence studies. Vector Borne Zoonotic Dis 6, 325-337, doi:10.1089/vbz.2006.6.325

(2006).

62 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

49 Hoffmann, H. H. et al. Diverse Viruses Require the Calcium Transporter SPCA1 for

Maturation and Spread. Cell Host Microbe 22, 460-470 e465, doi:10.1016/j.chom.2017.09.002

(2017).

50 Torriani, G. et al. Identification of Clotrimazole Derivatives as Specific Inhibitors of

Arenavirus Fusion. J Virol 93, doi:10.1128/JVI.01744-18 (2019).

51 Gorisek, J. & Marzan, B. [Changes in the blood picture and blood coagulation in calf poisoned

by the fern Pteridium aquilinum]. Wien Tierarztl Monatsschr 52, 530-538 (1965).

52 Gierer, S. et al. The spike protein of the emerging betacoronavirus EMC uses a novel

coronavirus receptor for entry, can be activated by TMPRSS2, and is targeted by neutralizing

antibodies. J Virol 87, 5502-5511, doi:10.1128/JVI.00128-13 (2013).

53 Hoffmann, M. et al. Differential sensitivity of bat cells to infection by enveloped RNA viruses:

coronaviruses, paramyxoviruses, filoviruses, and influenza viruses. PLoS One 8, e72942,

doi:10.1371/journal.pone.0072942 (2013).

54 Qing, E., Hantak, M., Perlman, S. & Gallagher, T. Distinct Roles for Sialoside and Protein

Receptors in Coronavirus Infection. mBio 11, doi:10.1128/mBio.02764-19 (2020).

55 Hoffmann, M. et al. Fusion-active glycoprotein G mediates the cytotoxicity of vesicular

stomatitis virus M mutants lacking host shut-off activity. J Gen Virol 91, 2782-2793,

doi:10.1099/vir.0.023978-0 (2010).

56 Locher, S., Schweneker, M., Hausmann, J. & Zimmer, G. Immunogenicity of propagation-

restricted vesicular stomatitis virus encoding Ebola virus glycoprotein in guinea pigs. J Gen

Virol 99, 866-879, doi:10.1099/jgv.0.001085 (2018).

57 Hanika, A. et al. Use of influenza C virus glycoprotein HEF for generation of vesicular

stomatitis virus pseudotypes. J Gen Virol 86, 1455-1465, doi:10.1099/vir.0.80788-0 (2005).

58 Skarnes, W. C. et al. A conditional knockout resource for the genome-wide study of mouse

gene function. Nature 474, 337-342, doi:10.1038/nature10163 (2011).

59 Schickli, J. H., Thackray, L. B., Sawicki, S. G. & Holmes, K. V. The N-terminal region of the

murine coronavirus spike glycoprotein is associated with the extended host range of viruses

63 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.05.979260; this version posted March 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

from persistently infected murine cells. J Virol 78, 9073-9083, doi:10.1128/JVI.78.17.9073-

9083.2004 (2004).

60 Agac, D., Estrada, L. D., Maples, R., Hooper, L. V. & Farrar, J. D. The beta2-adrenergic

receptor controls inflammation by driving rapid IL-10 secretion. Brain Behav Immun 74, 176-

185, doi:10.1016/j.bbi.2018.09.004 (2018).

61 Michailidis, E. et al. A robust cell culture system supporting the complete life cycle of

hepatitis B virus. Sci Rep 7, 16616, doi:10.1038/s41598-017-16882-5 (2017).

62 Widjaja, I. et al. Towards a solution to MERS: protective human monoclonal antibodies

targeting different domains and functions of the MERS-coronavirus spike glycoprotein. Emerg

Microbes Infect 8, 516-530, doi:10.1080/22221751.2019.1597644 (2019).

63 Vijgen, L. et al. Development of one-step, real-time, quantitative reverse transcriptase PCR

assays for absolute quantitation of human coronaviruses OC43 and 229E. J Clin Microbiol 43,

5452-5456, doi:10.1128/JCM.43.11.5452-5456.2005 (2005).