IDENTIFYING A ROLE FOR HEAT SHOCK PROTEINS IN

SCHISTOSOMA MANSONI

by

KENJI ISHIDA

Submitted in partial fulfillment of the requirements for the degree of

Doctor of Philosophy

Department of Biology

CASE WESTERN RESERVE UNIVERSITY

August 2017

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

Kenji Ishida

candidate for the degree of Doctor of Philosophy

Committee Chair Michael Benard

Committee Member Ronald Blanton

Committee Member Christopher Cullis

Committee Member Claudia Mieko Mizutani

Committee Member Emmitt R. Jolly

Date of Defense April 26, 2017

*We also certify that written approval has been obtained for any proprietary

material contained therin.

Table of Contents

Table of Contents

Table of Contents ...... iii

List of Figures ...... vii

List of Abbreviations ...... viii

Abstract ...... xiv

Chapter 1: Introduction ...... 1

1.1 Purpose ...... 1

1.2 Schistosomiasis ...... 1

1.3 Geographic distribution ...... 2

1.4 Parasite lifecycle ...... 3

1.5 Clinical manifestation and pathophysiology ...... 5

1.6 Diagnosis...... 6

1.7 Treatment ...... 8

1.8 Immunology ...... 9

1.9 Host invasion by schistosome cercariae ...... 11

1.9.1 Host identification and cercarial honing ...... 11

1.9.2 Penetration of host skin and key morphological features of cercariae ...... 12

1.10 Heat shock response ...... 14

1.11 Heat shock genes in schistosomes ...... 17

1.12 Thesis objective ...... 19

1.13 Study rationale ...... 19

1.14 Summary of findings...... 20

1.15 References ...... 21

iii

Table of Contents

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator ...... 29

2.1 Abstract ...... 30

2.2 Author Summary ...... 30

2.3 Introduction ...... 31

2.4 Materials and Methods ...... 35

2.4.1 Animals and parasites ...... 35

2.4.2 Preparation of schistosomal RNA ...... 35

2.4.3 Cloning ...... 36

2.4.4 Yeast transformation and modified yeast one-hybrid ...... 36

2.4.5 Electrophoretic mobility shift assay (EMSA) ...... 37

2.4.6 Comparison of protein sequences ...... 39

2.4.7 Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) ...... 39

2.4.8 Recombinant protein purification ...... 40

2.4.9 Custom antibody production ...... 41

2.4.10 Western blotting ...... 42

2.4.11 Immunohistochemistry ...... 42

2.4.12 Imaging ...... 43

2.5 Results ...... 44

2.5.1 Schistosome Hsf1 is a transcriptional activator...... 44

2.5.2 SmHsf1 recognizes the heat shock DNA binding element from the schistosome HSP70 promoter...... 47

2.5.3 SmHSF1 is expressed across schistosome developmental stages...... 51

2.5.4 A polyclonal antibody detects the SmHsf1 protein...... 52

iv

Table of Contents

2.5.5 Antibody raised against SmHsf1 localizes to the acetabular glands of S. mansoni cercariae...... 54

2.6 Discussion ...... 57

2.7 Acknowledgements ...... 61

2.8 Supporting information ...... 62

2.9 References ...... 64

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion ...... 71

3.1 Abstract ...... 72

3.2 Author summary ...... 73

3.3 Introduction ...... 74

3.4 Methods...... 79

3.4.1 Phylogenetic analysis of Hsp70 ...... 79

3.4.2 Animals and parasites ...... 79

3.4.3 Parasite observation and treatments ...... 79

3.5 Results ...... 80

3.5.1 Schistosome Hsp70 is highly conserved ...... 80

3.5.2 Establishment of cercarial swimming in culture ...... 81

3.5.3 Treatment of cercariae with human skin lipid, linoleic acid, and PES ...... 83

3.5.4 Treatment of cercariae with other Hsp70 modulators ...... 86

3.5.5 Treatment of cercariae with Hsp90 inhibitors ...... 88

3.5.6 Treatment of cercariae with other compounds ...... 89

3.6 Discussion ...... 93

3.7 Acknowledgments ...... 98

3.8 Supporting information ...... 99

v

Table of Contents

3.9 References ...... 101

Chapter 4: Discussion ...... 109

4.1 References ...... 119

List of References ...... 123

vi

List of Figures

List of Figures

Figure 1.1. Geographic distribution of schistosomiasis...... 3

Figure 1.2. Schistosome lifecycle...... 4

Figure 1.3. Development of the host immune response to schistosome infection...... 10

Figure 1.4. Electron micrograph of a cercaria...... 13

Figure 1.5. Heat shock response...... 15

Figure 1.6. Hsp70 chaperone model...... 17

Figure 2.1. SmHsf1 can drive transcription in a modified yeast one-hybrid system...... 46

Figure 2.2. SmHsf1 binds the heat shock binding element from the schistosome HSP70 promoter...... 49

Figure 2.3. Phylogram of SmHsf1...... 50

Figure 2.4. SmHSF1 is expressed across several schistosome life-cycle stages...... 51

Figure 2.5. The SmHsf1 antibody recognizes the SmHsf1 protein...... 53

Figure 2.6. SmHsf1 is localized to the acetabular glands in S. mansoni cercariae...... 56

Figure 2.7. Antibody raised against SmHsf1 localizes to the acetabular glands extending the entire length of the S. mansoni cercarial head...... 57

S2.2 Figure. MBP antibody recognizes the MBP-SmHsf1 fusion protein...... 63

Figure 3.1. Visual illustration of cercariae swimming...... 83

Figure 3.2. Cercariae treated with PES hone and transform more completely than those treated with skin lipid...... 84

Figure 3.3. Cercariae treated with other Hsp70 inhibitors do not hone...... 87

Figure 3.4. Cercariae treated with Hsp90 inhibitors do not hone...... 89

Figure 3.5. Predictive model of a role for Hsp70 in cercarial honing...... 92

Figure 3.6. Cercariae treated with ATP, AMP-PNP, and ADP...... 93

S3.1 Figure. Phylogenetic tree of Hsp70...... 99

vii

List of Abbreviations

List of Abbreviations

°C degrees Celsius

17-DMAG 17-dimethylaminoethylamino-17-demethoxygeldanamycin

A alanine (amino acid) aa amino acid

ADE2 phosphoribosylaminoimidazole carboxylase (gene, "ADEnine requiring")

ADP adenosine diphosphate

AMP adenosine monophospate

AMP-PNP adenylyl-imidodiphosphate

AP affinity purification

ATP adenosine triphosphate

AWA adult worm antigen

BLAST basic local alignment search tool

BLASTP basic local alignment search tool-protein bp base-pair

BRI Biomedical Research Institute

CAA circulating anodic antigen

CBP cyclic adenosine monophospate response element-binding protein(CREB)-binding protein

CCA circulating cathodic antigen

CCD charge-coupled device cDNA complementary deoxyribonucleic acid cm centimeter

CoIP complex-immunoprecipitation

viii

List of Abbreviations

COPT circumoval precipitin test

CT cycle threshold

CTF cercarial transformation fluid

D aspartic acid (amino acid)

DALYs disability-adjusted life years

DAPI 4',6-diamidino-2-phenylinodole

DBD deoxyribonucleic acid-binding domain

DIC differential inference contrast

DMSO dimethylsulfoxide

DNA deoxyribonucleic acid

DOI digital object identifier

ds double-stranded

ECL enhanced chemiluminescence

ELISA enzyme-linked immunosorbent assay

EMSA electrophoretic mobility shift assay

ER endoplasmic reticulum

ERK extracellular signal-regulated kinase

g acceleration due to gravity at the Earth's surface

G glycine (amino acid)

GA geldanamycin

Gal4 deoxyribonucleic acid-binding transcription factor required for activating GAL genes (protein, "GALactose metabolism")

GAL4 deoxyribonucleic acid-binding transcription factor required for activating GAL genes (gene, "GALactose metabolism")

HHF heat shock protein 70 (Hsp70) honing factor (protein, putative)

ix

List of Abbreviations

HIS3 imidazoleglycerol-phosphate dehydratase (gene, "HIStidine")

HRP horseradish peroxidase

Hs Homo sapiens

Hsc heat shock cognate (protein)

HSE heat shock deoxyribonucleic acid (DNA) binding element

HSF heat shock factor (gene)

Hsf heat shock factor (protein)

HSP heat shock protein (gene)

Hsp heat shock protein (protein)

IFA immunofluorescence assay

IgG immunoglobulin G

IHC immunohistochemistry

IHT indirect hemagglutination test

IL interleukin

INF interferon

IPTG isopropyl β-D-1-thiogalactopyranoside

Kd dissociation constant kDa kiloDalton kg kilogram

L leucine (amino acid)

LAMP loop-mediated isothermal amplification

LC liquid chromatography

M molar mA milliAmpere

x

List of Abbreviations

MAPK mitogen-activated protein kinase

MBP maltose binding protein

MEL1 secreted alpha-galactosidase (gene) mg milligram mJ milliJoule mM millimolar mRNA messenger ribonucleic acid

MS mass spectrometry

Msg1 melanocyte specific gene (protein)

MWCO molecular weight cut-off

N asparagine (amino acid)

NCBI National Center for Biotechnology Information

NEF nucleotide exchange factor

NIAID National Institute of Allergy and Infectious Diseases

NIH National Institutes of Health

NMRI Naval Medical Research Institute

P proline (amino acid)

PAGE polyacrylamide gel electrophoresis

PBS phosphate buffered saline

PBSTw phosphate buffered saline-Tween-20

PCR polymerase chain reaction

PES 2-phenylethynesulfonamide

PKC protein kinase C

PMSF phenylmethylsulfonyl fluoride

xi

List of Abbreviations

qPCR quantitative polymerase chain reaction

qRT-PCR quantitative reverse transcriptase-polymerase chain reaction

RAG recombination-activating gene

RNA ribonucleic acid

RT-PCR reverse transcriptase-polymerase chain reaction

SD synthetic dextrose medium

SD-Ade synthetic dextrose medium lacking adenine

SD-His synthetic dextrose medium lacking histidine

SDS sodium dodecyl sulfate

SD-Trp synthetic dextrose medium lacking tryptophan

SEA soluble egg antigen

Sj Schistosoma japonicum

Sm Schistosoma mansoni

Smad small body size (SMA)-mothers against decapentaplegic (MAD) (protein)

SODD silencer of death domain

TBE tris-boric acid-ethylenediaminetetraacetic acid

Th T helper

TNF tumor necrosis factor

TNFR tumor necrosis factor receptor

V Volt

WB Western blot

X-α-gal 5-bromo-4-chloro-3-indolyl-α-D-galactopyranoside

μg microgram

μL microliter

xii

List of Abbreviations

μm micrometer

μM micromolar

xiii

Abstract

Identifying a Role for Heat Shock Proteins in Schistosoma

mansoni

Abstract

by

KENJI ISHIDA

Parasitic schistosome worms infect more than 240 million people worldwide, causing the debilitating disease, schistosomiasis. The primary drug for treatment, praziquantel, has been used for decades, with rising concern for drug resistance. Therefore, a better understanding of the biology of schistosomes is necessary to identify targets for the development of novel chemotherapeutics.

In this thesis, we describe experiments involving heat shock genes and proteins performed in Schistosoma mansoni, one of the main species responsible for human schistosomiasis. From the understanding that schistosomes undergo many environmental transitions during their six-stage, two-host lifecycle, we can reason that heat shock response may play a vital role in helping the parasite survive these transitions. The studies here focus on the role of the heat shock transcription factor and heat shock proteins in cercariae, the infective stage for the mammalian host.

First, we characterized the heat shock transcription factor (SmHSF1) using several

xiv

Abstract methods. A modified yeast 1-hybrid assay verified the ability of SmHsf1 to activate transcription. In a bandshift DNA-binding assay, recombinant purified SmHsf1 demonstrated specific binding to DNA oligonucleotides containing sequences corresponding to those from the region upstream of schistosome heat shock protein 70

(gene, HSP70) and of the heat shock consensus sequence. Transcript analysis by quantitative PCR of cDNA from several parasite stages showed constitutive expression of

SmHSF1. Using a custom-raised antibody, Western blotting showed bands specific for

SmHsf1, and immunohistochemical staining of cercaria stage parasites showed a novel localization of SmHsf1 to the acetabular glands.

In the subsequent study, we focused on the role of heat shock protein 70 (protein, Hsp70), which is a downstream effector protein of the Hsf1 transcription factor, in cercaria stage parasites. Treatment of cercariae with an Hsp70 inhibitor led to a shift in swimming behavior, similar to the treatment of cercariae with human skin lipid, indicating that

Hsp70 may be a key mediator of the host sensing and invasion process.

Taken together, the studies presented here implicate for the first time, to our knowledge, an important role for heat shock response-associated proteins during the development of the infective cercaria stage and mammalian host invasion in schistosomes.

xv

Chapter 1: Introduction

Chapter 1: Introduction

1.1 Purpose

This chapter aims to provide the reader with 1) a brief background in schistosome

biology and associated disease, 2) a review of the current understanding of the behavior

of infective larval schistosomes in the scope of mammalian host invasion, and 3) a primer

on heat shock response and its associated genes and proteins: in general, then more

specifically in schistosomes. The subsequent chapters of this thesis present observations

that identify a novel role for schistosome heat shock response-associated proteins in host

invasion. In the final chapter, we summarize and interpret the findings of the studies here

and discuss future experiments to identify other molecular components involved in host

invasion.

1.2 Schistosomiasis

Over 240 million people worldwide have schistosomiasis, a disease resulting from

infection with parasitic trematodes of the Schistosoma genus [1]. Five species cause

human schistosomiasis: Schistosoma mansoni, S. japonicum, S. haematobium, S. mekongi, and S. intercalatum [2]. Infection with S. haematobium leads to the urogenital form of the disease, while infection with any of the other species leads to the gastrointestinal form of the disease [3]. Some estimates suggest that nearly 800 million people are at risk of infection [4] and that over 250,000 people die each year from associated organ dysfunction [5]. Schistosomiasis also causes significant morbidity, with the loss of 1.7 million to 56 million disability-adjusted life years (DALYs), depending on the method of

1

Chapter 1: Introduction calculation [6], placing it among the most important parasites in socioeconomic terms [7].

The disease pathology results not from the adult parasites directly, but from the eggs, which can become lodged in the bladder (S. haematobium) or liver (S. mansoni, S. japonicum), activating the host immune response to form granulomas, ultimately leading to obstructive disorders of the respective organs, including bloody urine, calcification of the bladder and bladder cancer; and portal hypertension, liver fibrosis, and enlarged liver

[2,3].

The primary treatment for schistosomiasis is the drug praziquantel. It has been used for several decades, and lack of equally effective alternative drugs [8], reports of reduced susceptibility [9–11], and demonstration of resistance in the laboratory [12,13] all raise concern for the continued efficacy of praziquantel. Cases of reduced susceptibility could be explained by heavy infection or high re-infection rates [14,15], as praziquantel does not prevent re-infection. Alternatively, the reason could be the parasite stage-specific efficacy of praziquantel: it can kill adult worms but not the juvenile human infective stages [16,17]. In any case, the need remains for the identification of new treatment strategies. While the findings presented in this thesis focus more on improving our knowledge of the molecular biology of schistosomes, such basic research provides the foundation for the identification of drug targets.

1.3 Geographic distribution

An estimated 78 countries worldwide are endemic for schistosomiasis [1], with the

2

Chapter 1: Introduction

majority in sub-Saharan Africa (Figure 1.1). S. haematobium and S. mansoni are

responsible for most of the infections in Africa and Arabian peninsula [2,3], while S.

japonicum resides exclusively in Asia [18]. Other schistosome species also have specific

geographic restrictions; for example, S. mekongi exists mostly in Laos and Cambodia

[19].

Figure 1.1. Geographic distribution of schistosomiasis. (From [3]).

1.4 Parasite lifecycle

Schistosomes have a complex lifecycle that includes six distinct stages and a molluscan

intermediate host and mammalian definitive host (Figure 1.2). Free-swimming freshwater

cercariae (singular: cercaria) infect their host via skin penetration. They lose their tails

during the skin invasion process, and the heads transform into schistosomula (singular: schistosomulum), enter the blood circulation, and pass through the lungs into the liver

3

Chapter 1: Introduction

and mesenteric veins of the intestine, developing into sexually dimorphic adult worms in

4-6 weeks. The adult worms pair and lay eggs: the retained eggs cause the disease, while

the excreted eggs, either through urine (S. haematobium) or stool (other schistosome species) reach freshwater and hatch into miracidia (singular: miracidium). Miracidia infect the molluscan host, in which they develop into mother and daughter sporocysts.

Asexual reproduction in the daughter sporocysts gives rise to cercariae, which exit from the molluscan host, in search for a mammalian host [3,20].

Figure 1.2. Schistosome lifecycle. (From [21]).

4

Chapter 1: Introduction

1.5 Clinical manifestation and pathophysiology

Human schistosomiasis begins with the cercaria stage invading and passing through the skin of the host. At the site(s) of entry, localized inflammation, or cercarial dermatitis, may occur, similar to the “swimmers’ itch” resulting from accidental infection of a human host with avian schistosomes [3,22]. In the acute phase of schistosomiasis, Katayama fever, or syndrome, whose symptoms can include fever, muscle pain, joint pain, diarrhea, may appear between 2 and 12 weeks following infection with cercariae, often coinciding with the deposition of eggs by the adult worms [23]. The host immune system responds to antigens released from the eggs, resulting in granuloma formation. The inflammatory granulomatous reaction can lead to hematuria and ulcer formation in the bladder and intestine and hepatomegaly in the liver [3].

Continued infection leads to the chronic phase of the disease, which can include bladder dysfunction and cancer, and continued polyp formation and diarrhea in the intestine, as well as the more serious periportal fibrosis and portal hypertension in the liver [24]. In this chronic hepatic form of the disease, the increased backpressure results in esophageal bleeding, which can cause anemia, growth stunting, or death in severe cases [3,24].

While the bladder, intestine, and liver represent the main organs affected by schistosomiasis, ectopic lesions in the lungs, genitals, and kidney may also occur. Most notably, neuroschistosomiasis occurs as a result of unusual migration of adult worm pairs to the central nervous system and subsequent inflammation in response to oviposition,

5

Chapter 1: Introduction

and it can cause myelitis, paresthesia, lower limb weakness, headache, dizziness, and

seizures [25,26].

1.6 Diagnosis

Several methods can be used to detect schistosome infection (for review, [17,27]). The

predominant method involves the direct detection of parasite eggs in urine or stool

samples [3]; in particular, the Kato-Katz stool smear microscopy method remains the long-standing standard for intestinal schistosomiasis because it does not require extensive equipment or labor [17,28,29]. While the Kato-Katz test works well for high-load infections, it may fail to detect infections with low egg density, uneven physical egg distribution, or variable temporal egg release/distribution [6,17].

As an alternative to direct detection of schistosomes, other detection methods test for the presence of schistosome-specific antigens, antibodies or nucleic acids. These tests usually offer improved sensitivity and specificity at the cost of expense and infrastructure requirements and have been recommended for application in areas that have progressed beyond morbidity and prevalence stages (into transmission, surveillance, and elimination stages) of helminth control programs [30].

In antigen tests, patient serum or urine is used with an enzyme-linked immunosorbent assay (ELISA) or antigen capture assay to detect known schistosome antigens from egg

(soluble egg antigen, SEA) and adult (adult worm antigen, AWA) stages [17]. Circulating

6

Chapter 1: Introduction

cathodic antigen and circulating anodic antigen (CCA and CAA, respectively) derived

from adult parasites have been used with success in a rapid detection dipstick format [31].

The method of detecting circulating antigens, however, has not demonstrated a significant improvement over microscopic detection methods [32,33].

Antibody detection methods test for the presence of host antibodies sensitive to schistosome products by exposing patient serum to known antigens. These tests include the circumoval precipitin test (COPT), indirect hemagglutination test (IHT), immunofluorescence assay (IFA), and enzyme-linked immunosorbent assay (ELISA) [17].

In COPT, serum is mixed with schistosome eggs; serum that forms a precipitate the around eggs indicates a positive test result. Similarly, in IHT, serum is mixed with red

blood cells coated with schistosome antigen (usually an adult worm antigen preparation);

again, a precipitate indicates a positive result [34]. In IFA, serum is used to probe cercaria,

adult, and egg stage parasites; a secondary antibody conjugated with a fluorophor is used

to detect the presence of schistosome-reactive antibodies. In ELISA, an antigen of choice,

such as SEA, is immobilized on the surface of a test plate, followed by the addition of

serum and secondary antibody conjugated with a chromogenic enzyme; a change in color

indicates a positive result. Cercarial transformation fluid (CTF) has also been used in

place of SEA for ELISA with comparable results and the advantage of lower cost of

production [35]. While these antibody detection methods can give higher sensitivity

results compared to microscopy detection methods, they also have the disadvantages that

antibodies may still exist after infection has resolved, leading to false-positive readings,

7

Chapter 1: Introduction

and that they often require specialized equipment and trained personnel, decreasing their

practical use in large surveys [17].

Schistosome infection can also be detected using nucleic acid methods, namely, PCR and its derivatives. PCR amplification of a 121 base-pair (bp) tandem repeat DNA fragment from stool samples has been shown to yield greater sensitivity compared to the Kato-Katz stool examination method [36]. Quantitative PCR extends on ordinary PCR in that it can be used to detect infection intensity and eliminates the need for electrophoresis [37].

These PCR methods, however, require costly equipment and reagents to perform. A low-cost alternative, loop-mediated isothermal amplification (LAMP), replaces the thermal cycler and electrophoresis with a water bath and dye. It has been tested using stool and serum samples from rabbits and humans infected with S. japonicum, showing a lower detection limit by orders of magnitude compared to conventional PCR in the range of sub-femtogram amounts of DNA [38].

1.7 Treatment

Praziquantel remains the drug of choice for schistosomiasis treatment since its

introduction in the 1970s, owing to its efficacy in treating infections of all schistosome

species, mild side effects, and low cost [39,40]. Upon exposure to praziquantel, adult worms undergo muscle contraction, tegumental disruption, and metabolic disruption, ultimately leading to detection and removal by the host immune system [41,42]. The exact mechanism of action of praziquantel still eludes researchers even after decades of

8

Chapter 1: Introduction use. An increase in intracellular calcium ions following praziquantel has been observed and is thought to play a role in muscle contraction, implicating calcium ion channels as the target of praziquantel [43]; however, pretreatment with cytochalasin D prevented praziquantel-mediated death while increasing calcium ion influx, suggesting that praziquantel acts through other mechanisms to induce parasite death [44].

Praziquantel treatment with a dose of 40 mg/kg is effective in causing 80-95% reduction in egg excretion; the inability to completely eliminate the infection may be the result of the stage-specific efficacy of praziquantel (effective against adult worms but not schistosomula), prompting repeated treatments [45,46]. For the concurrent elimination of the immature infection stage schistosomes, the anti-malarial artemisinin and derivative compounds have demonstrated efficacy; however, co-treatment with artemisinins has not become common practice because their increased use may lead to rise of resistant malaria strains [47]. Other drugs used for treatment include oxamniquine for S. mansoni and metrifonate for S. haematobium; unfortunately, these compounds do not affect S. japonicum infections, and, in the case of oxamniquine, drug resistant infections requiring treatment with a dosage several hundred-fold higher compared to susceptible infections have been demonstrated [45,47].

1.8 Immunology

Schistosomes have been of much interest immunologically because of their ability to evade the host immune response and live for up to several decades [48,49]. Over the

9

Chapter 1: Introduction course of infection, the host immune system adapts to the different phases of parasite development (Figure 1.3). The interaction of the parasite and host immune system begins with the acute stage of infection, during which a T helper 1 (Th1)-type immune response is observed. Th1 responses typically result in elevated serum levels of several cytokines, including tumor necrosis factor alpha (TNFα), interleukin (IL)-1, and IL-6. As the infection continues and adult worms deposit eggs, a Th2-type immune response, associated with the fibrogenic cytokines IL-4 and IL-13, becomes apparent [48].

Figure 1.3. Development of the host immune response to schistosome infection. (From [48]).

Interestingly, schistosomes require a mammalian host with a competent immune system to thrive [50,51]. Experimental schistosome infection of immune-compromised RAG-1 knockout mice showed slowed growth of parasites compared to those infecting normal

10

Chapter 1: Introduction mice [50]. Similarly, elevated temperature treatment of snail hosts has been shown to result in increased susceptibility to infection by schistosome miracidia, and that inhibition of heat shock protein 90 (Hsp90) reverses this effect [52], suggesting that schistosomes have the ability to sense the health of the host and adjust their development.

1.9 Host invasion by schistosome cercariae

1.9.1 Host identification and cercarial honing

In this thesis, we define the term, cercarial honing, as the change in cercarial swimming behavior following the identification of the host. With respect to host identification, infective schistosome cercariae respond to a variety of stimuli, including changes in light, heat, and components of host skin, such as fatty acids and L-arginine [53–58]. While the physiology of the molecular sensing is not well understood, exposure to such host molecules results in a change in swimming behavior (cercarial honing), which involves a shift in buoyancy and reduction in upward swimming motion [57]. After making contact with the host, the cercariae crawl along the surface of the skin for a suitable place to penetrate and increase the release of acetabular gland contents, which include mucins to help adhere to the skin and elastases to help penetrate the skin [59,60].

Many studies investigating the chemical requirements that stimulate a cercarial response have come from the Haas group [54,55,57,61]. Based on these in vitro studies, cercarial honing has been traditionally thought to be a highly chemotaxis-driven process, in which cercariae actively swim toward the source of host molecules. The question remains of

11

Chapter 1: Introduction whether and to what degree cercariae exhibit the same chemotactic behavior toward a host in the field, which typically features a larger distance between the parasite and the host.

Our observations following cercariae treatment with skin lipid have suggested a different behavior, in which cercariae that sense host molecules do not swim toward the source, but instead decrease their upward swimming motion, while, at the same time, increase their overall swimming motion. In a larger body of water, as in the wild, this new description of cercarial response to host molecules agrees with the reasoning that because cercariae typically cannot swim faster than a moving host, a chemotactic response would not necessarily increase the chance of catching their host. A binary, rather than a continuous or concentration gradient-dependent, determination of host presence or absence that controls the initiation of host contact behavior seems more plausible.

1.9.2 Penetration of host skin and key morphological features of cercariae

After exiting the snail host, cercariae have only several hours during which they must successfully invade a mammalian host [62,63]. The cercarial body is therefore equipped for rapid and efficient penetration of host skin. It has a total length of about 500 μm, and its tail features a bifurcation (Figure 1.4). To facilitate penetration into the host skin, the head contains several pairs of pre- and post- acetabular glands, whose respective bases extend from an anterior or posterior region around the acetabulum (ventral sucker) to the very anterior end, and which function as storage and release vessels for components

12

Chapter 1: Introduction necessary for host invasion such as mucins (for attachment to skin) and elastases (for degradation of skin) [64]. In contrast to a typical gland, which consists of a series of epithelial cells secreting substances into a lumen, each “gland” in cercariae actually represents an elongated individual cell filled with vesicles that are released intact and rupture after exiting the gland [60].

Figure 1.4. Electron micrograph of a cercaria. (a) oral sucker, (b) mouth, (c) acetabulum, (d) body/tail junction, (e) tail, and (f) tail bifurcation. (From [65]).

Penetration into the host skin involves the release of the contents from the acetabular glands and vigorous mechanical movement against the skin, eventually resulting in the separation of the head and tail. As the head penetrates through the skin, it loses its glycocalyx, a carbohydrate-rich coat that allows tolerance to the hypotonic freshwater environment, subsequently allowing the migration of multilaminate vesicles to the

13

Chapter 1: Introduction

surface and transforming the previously trilaminate (single-membrane) surface to a hepta-/multilaminate (double-/multi-membrane) one [66]. Activity of the proteases from the acetabular glands has been proposed to assist in the shedding of the glycocalyx, which has been demonstrated to activate the alternative pathway of complement innate immune response [67,68]. The shedding of the glycocalyx may therefore represent the first example of host immune system evasion over the course of infection. In addition to the separation of the head and tail, loss of the glycocalyx, and replacement of the single outer membrane with a double outer membrane, several other characteristics, including the loss of water tolerance, a negative Cercarienhüllen reaktion (a serodiagnosis method that results in pericercarial envelope formation), capability for cryopreservation, change from heterochromatic to euchromatic nuclei, and observation of migrating cyton granules or vesicles through cytoplasmic bridges in the tegument indicate that transformation of the cercarial head into a schistosomulum has occurred [69].

1.10 Heat shock response

Originally named for its discovery following elevated heat treatment, the heat shock

response is a well-conserved response across many different organisms to cellular stress

from a variety of sources such as heat, oxidative radicals, injury, and infection [70–72].

Such insults usually lead to proteotoxic conditions, under which proteins can no longer

function properly and adopt a non-native folding state, often resulting in protein

aggregation and cell cycle arrest or cell death [71]. The increased population of misfolded

proteins prompts a stressed cell to upregulate the transcriptional activity of the master

14

Chapter 1: Introduction regulator of the heat shock response, heat shock factor (Hsf), which, under normal

(unstressed) conditions and depending on the organism, is held transcriptionally inactive, by sequestration in a complex with chaperone heat shock proteins such as Hsp70 and

Hsp90, and/or by phosphorylation state. Activation of the heat shock response (stress) leads to the release of Hsf inhibition, resulting in elevated levels of heat shock protein transcripts and proteins (Figure 1.5).

Figure 1.5. Heat shock response. (From [71]).

These chaperone heat shock proteins function to bind and refold proteins in an

ATP-dependent manner. For example, in the Hsp70 chaperone model, a complex forms

15

Chapter 1: Introduction consisting of Hsp40, a misfolded client protein (alternatively called “S” for Substrate), and Hsp70 in the ATP-bound state (Hsp70*ATP), which has low affinity for the client protein (Figure 1.6). Hsp40 in this complex catalyzes the ATP hydrolysis activity of

Hsp70, converting Hsp70*ATP to the ADP-bound state (Hsp70*ADP), which has much higher affinity for the client protein. A nucleotide exchange factor (NEF), often a member of a different heat shock protein family, replaces ADP with ATP, returning Hsp70 to its

ATP-bound state and allowing the release of the (now properly folded) client protein

[73,74].

16

Chapter 1: Introduction

Figure 1.6. Hsp70 chaperone model. (From [74]).

1.11 Heat shock genes in schistosomes

Several heat shock response-related genes, including heat shock protein 40 (HSP40)

[75,76], HSP90 [77], HSP70 [78], and heat shock factor (HSF) [79,80], have been

identified in schistosomes. HSP40 was originally identified as a major 40 kDa protein in

S. mansoni eggs (p40) that showed homology to Drosophila small heat shock proteins

[75]. A subsequent study found that treatment of mice with either recombinant or native

p40 resulted in a Th1-type immune response with elevated IL-2 and IFN-γ levels,

17

Chapter 1: Introduction suggesting that egg deposition initially leads to p40-mediated Th1 response before progression toward a Th2 response [81]. Further studies have not yet been performed on schistosome HSP40 and HSP90.

Most studies on heat shock genes and proteins in schistosomes have centered on HSP70.

Recombinant Hsp70 protein from S. mansoni has been used in ELISA assays to detect the presence of host antibodies in the serum of chronically, but not acutely, infected human and mouse subjects, suggesting a potential diagnostic use for Hsp70 [82]. Interestingly, the host immune system shows exquisite specificity against Hsp70 proteins from different schistosome species, as demonstrated by the lack of cross-reactivity of sera from

S. japonicum-infected human and mouse to in vitro translated S. mansoni mRNA and vice versa [83]. Hsp70 has also been observed to be among the earliest synthesized proteins after host invasion, as measured by labeled methionine incorporation and two-dimensional gel electrophoresis [84].

A more recent series of studies on heat shock genes in schistosomes by the Schechter group began with the demonstration of the ability of schistosome protein extract to bind

DNA sequences contained in the Hsp70 promoter region, or heat shock DNA binding element (HSE) [79]. In subsequent papers, the group compared the DNA sequence recognition of schistosome extract and recombinant Drosophila Hsf and schistosome Hsf

[80,85,86], and showed the expression of different HSF isoforms in different parasite stages [80,87,88].

18

Chapter 1: Introduction

In addition to their work on SmHsf, the Schechter group also cloned the SmHSP70 gene

[89] and promoter [90], and showed stage-specific expression of HSP70 transcript by

Northern blot and the presence of Hsp70 protein in several stages by Western blot [91].

HSP70 has also been described in S. japonicum, in which the Wu group cloned and

characterized two genes belonging to the HSP70 family [92,93], and a further study

identified SjHsp70 as a potential vaccine candidate [94].

1.12 Thesis objective

This thesis has the following objective:

Characterize and identify a role for the heat shock response-related proteins 1) heat shock

factor (SmHsf1) and 2) heat shock protein 70 (SmHsp70) in Schistosoma mansoni, with a specific focus on the cercaria to schistosomulum stage transition.

1.13 Study rationale

We reasoned that heat shock response may play an important role during the transition of

schistosome parasites from the cercaria stage to schistosomulum stage because of the drastic change in the environment during this transition. Such changes are associated with cell stress, which can activate the heat shock response.

The Jolly lab has expertise in studying transcription factors [95], and, therefore, we undertook the investigation of the schistosome heat shock transcription factor (SmHsf1).

Our findings from this study implicated a role for SmHsf1 in the development of the

19

Chapter 1: Introduction

cercarial glands, which facilitate the invasion of the mammlian host. Because Hsf

regulates downstream effector proteins of the heat shock response, such as Hsp70, we

asked whether these heat shock effector proteins play a role in the cercaria stage,

especially in the context of cercarial honing.

So far, studies have identified host molecules and other stimulatory factors that serve as

the initial signals to activate cercarial honing. However, little is known about the

downstream signals and proteins involved following the reception of these initial factors.

The limited knowledge on this topic consists of some studies that suggest that protein

kinase C (PKC) and other kinases may play a role during cercarial honing, since various

stimuli, such as skin lipid and changes in light, have been observed to modulate the

activity of these kinases [96,97]. We address this gap in understanding in this thesis by

investigating and identifying a novel role for SmHsp70 in cercarial honing.

1.14 Summary of findings

With respect to the thesis objectives and study rationale above, this thesis demonstrates

that 1) SmHsf1 is localized to the acetabular glands of cercariae and 2) SmHsp70 may act as a regulatory factor that controls cercarial honing during mammalian host invasion.

These novel findings represent a major step forward in the understanding of the molecular components necessary during the host invasion process.

20

Chapter 1: Introduction

1.15 References

1. WHO. Schistosomiasis: number of people treated worldwide in 2013 Background. Wkly Epidemiol Rec. 2015;376: 25–32. doi:10.1016/j.actatropica.2012.04.013. 2. Davis A, Chitsulo L, Loverde P, Engels D, Mott KE, Bilharz T, et al. Schistosomiasis. Nat Rev Microbiol. 2004;2: 349–391. doi:10.1038/nrmicro801 3. Gryseels B, Polman K, Clerinx J, Kestens L. Human schistosomiasis. Lancet. 2006. pp. 1106–1118. doi:10.1016/S0140-6736(06)69440-3 4. Steinmann P, Keiser J, Bos R, Tanner M, Utzinger J. Schistosomiasis and water resources development: systematic review, meta-analysis, and estimates of people at risk. Lancet Infect Dis. 2006;6: 411–425. doi:10.1016/S1473-3099(06)70521-7 5. Van Der Werf MJ, De Vlas SJ, Brooker S, Looman CWN, Nagelkerke NJD, Habbema JDF, et al. Quantification of clinical morbidity associated with schistosome infection in sub-Saharan Africa. Acta Tropica. 2003. pp. 125–139. doi:10.1016/S0001-706X(03)00029-9 6. King CH. Parasites and poverty: The case of schistosomiasis. Acta Tropica. 2010. pp. 95–104. doi:10.1016/j.actatropica.2009.11.012 7. Sarvel AK, Oliveira ÁA, Silva AR, Lima ACL, Katz N. Evaluation of a 25-year-program for the control of schistosomiasis mansoni in an endemic area in Brazil. PLoS Negl Trop Dis. 2011;5. doi:10.1371/journal.pntd.0000990 8. Fenwick A, Savioli L, Engels D, Bergquist NR, Todd MH. Drugs for the control of parasitic diseases: Current status and development in schistosomiasis. Trends in Parasitology. 2003. pp. 509–515. doi:10.1016/j.pt.2003.09.005 9. Fallon PG, Sturrock RF, Capron A, Niang M, Doenhoff MJ. Short report: Diminished susceptibility to praziquantel in a Senegal isolate of Schistosoma mansoni. Am J Trop Med Hyg. 1995;53: 61–62. 10. Ismail M, Botros S, Metwally A, William S, Farghally A, Tao LF, et al. Resistance to praziquantel: Direct evidence from Schistosoma mansoni isolated from egyptian villagers. Am J Trop Med Hyg. 1999;60: 932–935. 11. Melman SD, Steinauer ML, Cunningham C, Kubatko LS, Mwangi IN, Wynn NB, et al. Reduced susceptibility to praziquantel among naturally occurring Kenyan isolates of Schistosoma mansoni. PLoS Negl Trop Dis. 2009;3. doi:10.1371/journal.pntd.0000504 12. Fallon PG, Doenhoff MJ. Drug-resistant schistosomiasis: Resistance to praziquantel and oxamniquine induced in Schistosoma mansoni in mice is drug specific. Am J Trop Med Hyg. 1994;51: 83–88. 13. Wang W, Wang L, Liang YS. Susceptibility or resistance of praziquantel in human schistosomiasis: A review. Parasitology Research. 2012. pp. 1871–1877.

21

Chapter 1: Introduction

doi:10.1007/s00436-012-3151-z 14. Gryseels B, Mbaye A, De Vlas SJ, Stelma FF, Guissé F, Van Lieshout L, et al. Are poor responses to praziquantel for the treatment of Schistosoma mansoni infections in Senegal due to resistance? An overview of the evidence. Tropical Medicine and International Health. 2001. pp. 864–873. doi:10.1046/j.1365-3156.2001.00811.x 15. Picquet M, Vercruysse J, Shaw DJ, Diop M, Ly A. Efficacy of praziquantel against Schistosoma mansoni in northern Senegal. Trans R Soc Trop Med Hyg. 1998;92: 90–93. doi:10.1016/S0035-9203(98)90971-3 16. Wu W, Wang W, Huang YX. New insight into praziquantel against various developmental stages of schistosomes. Parasitology Research. 2011. pp. 1501–1507. doi:10.1007/s00436-011-2670-3 17. Weerakoon KGAD, Gobert GN, Cai P, McManus DP. Advances in the diagnosis of human schistosomiasis. Clin Microbiol Rev. 2015;28: 939–967. doi:10.1128/CMR.00137-14 18. Chitsulo L, Engels D, Montresor A, Savioli L. The global status of schistosomiasis and its control. Acta Trop. 2000;77: 41–51. doi:10.1016/S0001-706X(00)00122-4 19. Elbaz T, Esmat G. Hepatic and Intestinal Schistosomiasis: Review. Journal of Advanced Research. 2013. pp. 445–452. doi:10.1016/j.jare.2012.12.001 20. Basch PF. Schistosomes: development, reproduction, and host relations. New York Oxford Univ Press 1991. 1991; 43. doi:10.1016/0169-4758(92)90149-V 21. CDC. CDC - DPDx - Schistosomiasis Infection [Internet]. [cited 3 Mar 2017]. Available: https://www.cdc.gov/dpdx/schistosomiasis/index.html 22. Kolářová L. Schistosomes causing cercarial dermatitis: A mini-review of current trends in systematics and of host specificity and pathogenicity. Folia Parasitologica. 2007. pp. 81–87. 23. Ross AGP, Bartley PB, Sleigh AC, Olds GR, Li Y, Williams GM, et al. Schistosomiasis. N Engl J Med. 2002;346: 1212–1220. doi:10.1056/NEJMra012396 24. Barsoum RS, Esmat G, El-Baz T. Human Schistosomiasis: Clinical Perspective: Review. J Adv Res. 2013;4. doi:10.1016/j.jare.2013.01.005 25. Ferrari TCA, Moreira PRR, Cunha AS. Clinical characterization of neuroschistosomiasis due to Schistosoma mansoni and its treatment. Acta Trop. 2008;108: 89–97. doi:10.1016/j.actatropica.2008.04.007 26. Ferrari TCA, Moreira PRR. Neuroschistosomiasis: Clinical symptoms and pathogenesis. The Lancet Neurology. 2011. pp. 853–864. doi:10.1016/S1474-4422(11)70170-3

22

Chapter 1: Introduction

27. Gomes LI, Enk MJ, Rabello A. Diagnosing schistosomiasis: Where are we? Revista da Sociedade Brasileira de Medicina Tropical. 2014. pp. 3–11. doi:10.1590/0037-8682-0231-2013 28. Katz N, Chaves A, Pellegrino J. A simple device for quantitative stool thick-smear technique in Schistosomiasis mansoni. Rev Inst Med Trop Sao Paulo. 1972;14: 397–400. doi:10.1590/S0036-46651999000200001 29. Krauth SJ, Coulibaly JT, Knopp S, Traoré M, N’Goran EK, Utzinger J. An In-Depth Analysis of a Piece of Shit: Distribution of Schistosoma mansoni and Hookworm Eggs in Human Stool. PLoS Negl Trop Dis. 2012;6. doi:10.1371/journal.pntd.0001969 30. Bergquist R, Johansen MV, Utzinger J. Diagnostic dilemmas in helminthology: what tools to use and when? Trends Parasitol. 2009;25: 151–156. doi:10.1016/j.pt.2009.01.004 31. Stothard JR, Kabatereine NB, Tukahebwa EM, Kazibwe F, Rollinson D, Mathieson W, et al. Use of circulating cathodic antigen (CCA) dipsticks for detection of intestinal and urinary schistosomiasis. Acta Trop. 2006;97: 219–228. doi:10.1016/j.actatropica.2005.11.004 32. Van Lieshout L, Polderman AM, Deelder AM. Immunodiagnosis of schistosomiasis by determination of the circulating antigens CAA and CCA, in particular in individuals with recent or light infections. Acta Trop. 2000;77: 69–80. doi:10.1016/S0001-706X(00)00115-7 33. Doenhoff MJ, Chiodini PL, Hamilton J V. Specific and sensitive diagnosis of schistosome infection: Can it be done with antibodies? Trends in Parasitology. 2004. pp. 35–39. doi:10.1016/j.pt.2003.10.019 34. van Gool T, Vetter H, Vervoort T, Doenhoff MJ, Wetsteyn J, Overbosch D. Serodiagnosis of Imported Schistosomiasis by a Combination of a Commercial Indirect Hemagglutination Test with Schistosoma mansoni Adult Worm Antigens and an Enzyme-Linked Immunosorbent Assay with S. mansoni Egg Antigens. J Clin Microbiol . 2002;40: 3432–3437. doi:10.1128/JCM.40.9.3432-3437.2002 35. Smith H, Doenhoff M, Aitken C, Bailey W, Ji M, Dawson E, et al. Comparison of Schistosoma mansoni Soluble Cercarial Antigens and Soluble Egg Antigens for Serodiagnosing Schistosome Infections. PLoS Negl Trop Dis. 2012;6. doi:10.1371/journal.pntd.0001815 36. Pontes LA, Oliveira MC, Katz N, Dias-Neto E, Rabello A. Comparison of a polymerase chain reaction and the Kato-Katz technique for diagnosing infection with Schistosoma mansoni. Am J Trop Med Hyg. 2003;68: 652–656. 37. Gomes ALDV, Melo FL, Werkhauser RP, Abath FGC. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA. Mem Inst Oswaldo Cruz. 2006;101 Suppl: 133–6. doi:10.1590/S0074-02762006000900021

23

Chapter 1: Introduction

38. Xu J, Rong R, Zhang HQ, Shi CJ, Zhu XQ, Xia CM. Sensitive and rapid detection of Schistosoma japonicum DNA by loop-mediated isothermal amplification (LAMP). Int J Parasitol. 2010;40: 327–331. doi:10.1016/j.ijpara.2009.08.010 39. Cioli D, Pica-Mattoccia L. Praziquantel. Parasitol Res. 2003;90 Supp 1: S3-9. doi:10.1007/s00436-002-0751-z 40. Doenhoff MJ, Kusel JR, Coles GC, Cioli D. Resistance of Schistosoma mansoni to praziquantel: Is there a problem? Transactions of the Royal Society of Tropical Medicine and Hygiene. 2002. pp. 465–469. doi:10.1016/S0035-9203(02)90405-0 41. Cioli D, Pica-Mattoccia L, Archer S. Antischistosomal drugs: Past, present ... and future? Pharmacology and Therapeutics. 1995. pp. 35–85. doi:10.1016/0163-7258(95)00026-7 42. Hagan P, Appleton CC, Coles GC, Kusel JR, Tchuem-Tchuenté LA. Schistosomiasis control: Keep taking the tablets. Trends in Parasitology. 2004. pp. 92–97. doi:10.1016/j.pt.2003.11.010 43. Greenberg RM. Are Ca2+ channels targets of praziquantel action? International Journal for Parasitology. 2005. pp. 1–9. doi:10.1016/j.ijpara.2004.09.004 44. Pica-Mattoccia L, Orsini T, Basso A, Festucci A, Liberti P, Guidi A, et al. Schistosoma mansoni: Lack of correlation between praziquantel-induced intra-worm calcium influx and parasite death. Exp Parasitol. 2008;119: 332–335. doi:10.1016/j.exppara.2008.03.012 45. Cioli D, Pica-Mattoccia L, Basso A, Guidi A. Schistosomiasis control: Praziquantel forever? Molecular and Biochemical Parasitology. 2014. pp. 23–29. doi:10.1016/j.molbiopara.2014.06.002 46. Pica-Mattoccia L, Cioli D. Sex- and stage-related sensitivity of Schistosoma mansoni to in vivo and in vitro praziquantel treatment. Int J Parasitol. 2004;34: 527–533. doi:10.1016/j.ijpara.2003.12.003 47. Gray DJ, Ross AG, Li Y-S, McManus DP. Diagnosis and management of schistosomiasis. BMJ. 2011;342: d2651. doi:10.1136/bmj.d2651 48. Pearce EJ, MacDonald AS. The immunobiology of schistosomiasis. Nat Rev Immunol. 2002;2: 499–511. doi:10.1038/nri843 49. Whitty CJ, Mabey DC, Armstrong M, Wright SG, Chiodini PL. Presentation and outcome of 1107 cases of schistosomiasis from Africa diagnosed in a non-endemic country. Trans R Soc Trop Med Hyg. 2000;94: 531–534. doi:10.1016/S0035-9203(00)90077-4 50. Davies SJ, Grogan JL, Blank RB, Lim KC, Locksley RM, McKerrow JH. Modulation of blood fluke development in the liver by hepatic CD4+ lymphocytes. Science. 2001;294: 1358–1361. doi:10.1126/science.1064462 51. Karanja DMS, Colley DG, Nahlen BL, Ouma JH, Secor WE. Studies on

24

Chapter 1: Introduction

schistosomiasis in western Kenya: I. Evidence for immune- facilitated excretion of schistosome eggs from patients with Schistosoma mansoni and human immunodeficiency virus coinfections. Am J Trop Med Hyg. 1997;56: 515–521. doi:10.1186/1756-3305-4-226 52. Ittiprasert W, Knight M. Reversing the resistance phenotype of the biomphalaria glabrata snail host schistosoma mansoni infection by temperature modulation. PLoS Pathog. 2012;8. doi:10.1371/journal.ppat.1002677 53. McKerrow J, Salter J. Invasion of skin by Schistosoma cercariae. Trends in Parasitology. 2002. pp. 193–195. doi:10.1016/S1471-4922(02)02309-7 54. Brachs S, Haas W. Swimming behaviour of Schistosoma mansoni cercariae: Responses to irradiance changes and skin attractants. Parasitol Res. 2008;102: 685–690. doi:10.1007/s00436-007-0812-4 55. Haas W, Grabe K, Geis C, Pach T, Stoll K, Fuchs M, et al. Recognition and invasion of human skin by Schistosoma mansoni cercariae : the key-role of L -arginine. Parasitology. 2002;124: 153–167. doi:10.1017 S0031182001001032 56. Haas W. Parasitic worms: strategies of host finding, recognition and invasion. Zoology (Jena). 2003;106: 349–364. doi:10.1078/0944-2006-00125 57. Haeberlein S, Haas W. Chemical attractants of human skin for swimming Schistosoma mansoni cercariae. Parasitol Res. 2008;102: 657–662. doi:10.1007/s00436-007-0807-1 58. Cai P, Gobert GN, You H, McManus DP. The Tao survivorship of schistosomes: Implications for schistosomiasis control. International Journal for Parasitology. 2016. pp. 453–463. doi:10.1016/j.ijpara.2016.01.002 59. Stirewalt MA, Walters M. Schistosoma mansoni: Histochemical analysis of the postacetabular gland secretion of cercariae. Exp Parasitol. 1973;33. doi:10.1016/0014-4894(73)90009-X 60. Fishelson Z, Amiri P, Friend DS, Marikovsky M, Petitt M, Newport G, et al. Schistosoma mansoni: Cell-specific expression and secretion of a serine protease during development of cercariae. Exp Parasitol. 1992;75: 87–98. doi:10.1016/0014-4894(92)90124-S 61. Haas W, Haeberlein S, Behring S, Zoppelli E. Schistosoma mansoni: Human skin ceramides are a chemical cue for host recognition of cercariae. Exp Parasitol. 2008;120: 94–97. doi:10.1016/j.exppara.2008.06.001 62. Whitfield PJ, Bartlett A, Khammo N, Clothier RH. Age-dependent survival and infectivity of Schistosoma mansoni cercariae. Parasitology. 2003;127: 29–35. doi:10.1017/S0031182003003263 63. Lee VST, Burgess JL, Sterling CR, Lutz EA. Schistosoma mansoni: Assessment of effects of oleic acid, cercarial age and water temperature on parasite-host attraction. Int J Parasitol. 2013;43: 837–842. doi:10.1016/j.ijpara.2013.05.005

25

Chapter 1: Introduction

64. Dorsey CH, Stirewalt MA. Schistosoma mansoni: Fine structure of cercarial acetabular glands. Exp Parasitol. 1971;30: 199–214. doi:10.1016/0014-4894(71)90084-1 65. Dorsey CH, Cousin CE, Lewis FA, Stirewalt MA. Ultrastructure of the Schistosoma mansoni cercaria. Micron. 2002. pp. 279–323. doi:10.1016/S0968-4328(01)00019-1 66. Skelly PJ, Alan Wilson R. Making Sense of the Schistosome Surface. Advances in Parasitology. 2006. pp. 185–284. doi:10.1016/S0065-308X(06)63003-0 67. Samuelson JC, Caulfield JP. The cercarial glycocalyx of Schistosoma mansoni. J Cell Biol. 1985;100: 1423–1434. doi:10.1083/jcb.100.5.1423 68. Samuelson JC, Caulfield JP. Cercarial glycocalyx of Schistosoma mansoni activates human complement. Infect Immun. 1986;51: 181–186. 69. Stirewalt MA, Cousin CE, Dorsey CH. Schistosoma mansoni: Stimulus and transformation of cercariae into schistosomules. Exp Parasitol. 1983;56: 358–368. doi:10.1016/0014-4894(83)90081-4 70. Jolly C, Morimoto RI. Role of the heat shock response and molecular chaperones in oncogenesis and cell death. J Natl Cancer Inst. 2000;92: 1564–72. doi:10.1093/JNCI/92.19.1564 71. Richter K, Haslbeck M, Buchner J. The Heat Shock Response: Life on the Verge of Death. Molecular Cell. 2010. pp. 253–266. doi:10.1016/j.molcel.2010.10.006 72. Verghese J, Abrams J, Wang Y, Morano KA. Biology of the heat shock response and protein chaperones: budding yeast (Saccharomyces cerevisiae) as a model system. Microbiol Mol Biol Rev. 2012;76: 115–58. doi:10.1128/MMBR.05018-11 73. Mayer MP. Hsp70 chaperone dynamics and molecular mechanism. Trends in Biochemical Sciences. 2013. pp. 507–514. doi:10.1016/j.tibs.2013.08.001 74. Zuiderweg ERP, Bertelsen EB, Rousaki A, Mayer MP, Gestwicki JE, Ahmad A. Allostery in the Hsp70 chaperone proteins. Top Curr Chem. 2013;328: 99–153. doi:10.1007/128-2012-323 75. Nene V, Dunne DW, Johnson KS, Taylor DW, Cordingley JS. Sequence and expression of a major egg antigen from Schistosoma mansoni. Homologies to heat shock proteins and alpha-crystallins. Mol Biochem Parasitol. 1986;21: 179–188. doi:10.1016/0166-6851(86)90021-6 76. Cao M, Chao H, Doughty BL. Cloning of a cDNA encoding an egg antigen homologue from Schistosoma mansoni. Mol Biochem Parasitol. 1993;58: 169–171. doi:http://dx.doi.org/10.1016/0166-6851(93)90102-4 77. Johnson KS, Wells K, Bock J V., Nene V, Taylor DW, Cordingley JS. The 86-kilodalton antigen from Schistosoma mansoni is a heat-shock protein

26

Chapter 1: Introduction

homologous to yeast HSP-90. Mol Biochem Parasitol. 1989;36: 19–28. doi:10.1016/0166-6851(89)90196-5 78. Blanton R, Loula EC, Parker J. Two heat-induced proteins are associated with transformation of Schistosoma mansoni cercariae to schistosomula. Proc Natl Acad Sci U S A. 1987;84: 9011–9014. doi:10.2307/34591 79. Levy-Holtzman R, Schechter I. Schistosome extracts with heat shock factor activity revealed by the gel shift assay. Parasitology. 1994;108 ( Pt 1: 35–42. doi:10.1017/S0031182000078495 80. Lantner F, Ziv E, Ram D, Schechter I. Different forms of the mRNA encoding the heat-shock transcription factor are expressed during the life cycle of the parasitic helminth Schistosoma mansoni. Eur J Biochem. 1998;253: 390–398. doi:10.1046/j.1432-1327.1998.2530390.x 81. Cai Y, Langley JG, Smith DI, Boros DL. A cloned major Schistosoma mansoni egg antigen with homologies to small heat shock proteins elicits Th1 responsiveness. Infect Immun. 1996;64: 1750–1755. 82. Moser D, Doumbo O, Klinkert MQ. The humoral response to heat shock protein 70 in human and murine Schistosomiasis mansoni. Parasite Immunol. 1990;12: 341–352. 83. Hedstrom R, Culpepper J, Schinski V, Agabian N, Newport G. Schistosome heat-shock proteins are immunologically distinct host-like antigens. Mol Biochem Parasitol. 1988;29: 275–282. doi:10.1016/0166-6851(88)90082-5 84. Yuckenberg PD, Poupin F, Mansour TE. Schistosoma mansoni: protein composition and synthesis during early development; evidence for early synthesis of heat shock proteins. Exp Parasitol. 1987;63: 301–311. Available: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dop t=Citation&list_uids=3582570 85. Levy-Holtzman R, Clos J, Schechter I. Differences in DNA sequence recognition by the heat-shock factors of Drosophila melanogaster and the parasitic helminth Schistosoma mansoni. BBA - Gene Struct Expr. 1995;1264: 134–140. doi:10.1016/0167-4781(95)00151-6 86. Lardans V, Ram D, Lantner F, Ziv E, Schechter I. Differences in DNA-sequence recognition between the DNA-binding domain fragment and the full-length molecule of the heat-shock transcription factor of schistosome. Biochim Biophys Acta - Gene Struct Expr. 2001;1519: 230–234. doi:10.1016/S0167-4781(01)00220-2 87. Levy-Holtzman R, Schechter I. Expression of different forms of the heat-shock factor during the life cycle of the parasitic helminth Schistosoma mansoni. Biochim Biophys Acta - Mol Basis Dis. 1996;1317: 1–4. doi:10.1016/0925-4439(96)00041-5

27

Chapter 1: Introduction

88. Ram D, Ziv E, Lantner F, Lardans V, Schechter I. Stage-specific alternative splicing of the heat-shock transcription factor during the life-cycle of Schistosoma mansoni. Parasitology. 2004;129: 587–596. doi:10.1017/S003118200400602X 89. Neumann S, Ziv E, Lantner F, Schechter I. Cloning and sequencing of an hsp70 gene of Schistosoma mansoni. Mol Biochem Parasitol. 1992;56: 357–360. doi:10.1016/0166-6851(92)90188-P 90. Levy-Holtzman R, Schechter I. Activity of the promoter of the hsp70 gene of the parasitic helminth Schistosoma mansoni in the mammalian CHO cell-line. BBA - Gene Struct Expr. 1995;1263: 96–98. doi:10.1016/0167-4781(95)00083-S 91. Neumann S, Ziv E, Lantner F, Schechter I. Regulation of HSP70 gene expression during the life cycle of the parasitic helminth Schistosoma mansoni. Eur J Biochem. 1993;212: 589–96. Available: http://www.ncbi.nlm.nih.gov/pubmed/8444195 92. He S, Yang L, Lv Z, Hu W, Cao J, Wei J, et al. Molecular and functional characterization of a mortalin-like protein from Schistosoma japonicum (SjMLP/hsp70) as a member of the HSP70 family. Parasitol Res. 2010;107: 955–966. doi:10.1007/s00436-010-1960-5 93. Yang J, Yang L, Lv Z, Wang J, Zhang Q, Zheng H, et al. Molecular cloning and characterization of a HSP70 gene from Schistosoma japonicum. Parasitol Res. 2012;110: 1785–1793. doi:10.1007/s00436-011-2700-1 94. Duan MM, Xu RM, Yuan CX, Li YY, Liu Q, Cheng GF, et al. SjHSP70, a recombinant Schistosoma japonicum heat shock protein 70, is immunostimulatory and induces protective immunity against cercarial challenge in mice. Parasitol Res. 2015;114: 3415–3429. doi:10.1007/s00436-015-4567-z 95. Milligan JN, Jolly ER. Identification and characterization of a Mef2 transcriptional activator in schistosome parasites. PLoS Negl Trop Dis. 2012;6. doi:10.1371/journal.pntd.0001443 96. Matsumura K, Mitsui Y, Sato K, Sakamoto M, Aoki Y. Schistosoma mansoni: possible involvement of protein kinase C in linoleic acid-induced proteolytic enzyme release from cercariae. Exp Parasitol. 1991;72: 311–320. 97. Ressurreição M, Kirk RS, Rollinson D, Emery AM, Page NM, Walker AJ. Sensory Protein Kinase Signaling in Schistosoma mansoni Cercariae: Host Location and Invasion. J Infect Dis. 2015;212: 1787–1797. doi:10.1093/infdis/jiv464

28

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular

glands of infectious schistosomes suggests a

non-transcriptional function for this transcriptional activator

Kenji Ishida1†, Melissa Varrecchia1†, Giselle M. Knudsen3, Emmitt R. Jolly1, 2*

1Department of Biology, 2Center for Global Health and Diseases, Case Western Reserve University, Cleveland, Ohio, USA

3Department of Pharmaceutical Chemistry, University of California, San Francisco, San Francisco, California, USA

†These authors contributed equally to this work

*Corresponding author E-mail: [email protected] (ERJ)

As part of my thesis research, this chapter has been published in PLoS Neglected Tropical Diseases 2014 Jul 31;8(7):e3051. doi: 10.1371/journal.pntd.0003051. eCollection 2014.

The numbering for the supporting information here differs from that in the published version. Digital object identifier (DOI) references are provided in section 2.8.

29

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

2.1 Abstract

Schistosomiasis is a chronically debilitating disease caused by parasitic worms of the

genus Schistosoma, and it is a global problem affecting over 240 million people. Little is

known about the regulatory proteins and mechanisms that control schistosome host

invasion, gene expression, and development. Schistosome larvae, cercariae, are

transiently free-swimming organisms and infectious to man. Cercariae penetrate human

host skin directly using proteases that degrade skin connective tissue. These proteases are

secreted from anucleate acetabular glands that contain many proteins, including heat

shock proteins. Heat shock transcription factors are strongly conserved activators that

play crucial roles in the maintenance of cell homeostasis by transcriptionally regulating

heat shock protein expression. In this study, we clone and characterize the schistosome

Heat shock factor 1 gene (SmHSF1). We verify its ability to activate transcription using a

modified yeast one-hybrid system, and we show that it can bind to the heat shock binding

element (HSE) consensus DNA sequence. Our quantitative RT-PCR analysis shows that

SmHSF1 is expressed throughout several life-cycle stages from sporocyst to adult worm.

Most interesting, using immunohistochemistry, a polyclonal antibody raised against an

Hsf1-peptide demonstrates novel localization for this conserved, stress-modulating activator. Our analysis suggests that schistosome Heat shock factor 1 may be localized to the acetabular glands of infective cercariae.

2.2 Author Summary

Schistosome parasites are the cause of human schistosomiasis and infect more than 200

30

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

million people worldwide. Schistosome larvae, termed cercariae, are a free-swimming mobile developmental stage responsible for host infection. These larvae produce enzymes

that degrade human skin allowing them to pass into the human host. After invasion, they

continue evade the immune system and develop into adult worms. The transition from

free-swimming larvae in freshwater to invasion into a warm-blooded saline environment

requires that the parasite regulate genes to adapt to these changes. Heat shock factor 1 is a

well-characterized activator of stress and heat response that functions in cellular nuclei.

Using immunohistochemistry, we observed non-nuclear localization for anti-Heat shock

factor 1 signal in the secretory glands necessary for the invasive function of schistosome

larvae. This observation expands the potential mechanistic roles for Heat shock factor 1

and may aid in our understanding of schistosome host invasion and early development.

2.3 Introduction

Schistosomiasis affects more than 240 million people worldwide, ranking second after

malaria in the World Health Organization listing of neglected tropical diseases. [1-6].

Resistance to praziquantel, the primary therapeutic used for decades to treat schistosome

infection has been reported [7] and partial efficacy is observed in some patients [8]. Thus,

the development of novel drug strategies and alternative treatment options are pressing

issues in schistosome research [9].

Understanding host-parasite interactions can lead to novel therapeutic strategies that can

interfere with infection or eliminate established infections. For example, topical

31

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator application of inhibitors against the proteases of infective cercariae can block skin invasion [10, 11]. We have been exploring heat-shock pathway components as a potential essential pathway in larval schistosomes. In protozoan parasites, heat shock proteins are essential for mediating changes in morphology during stage differentiation that are often concurrent with stress-related transitions from insect to mammalian host, or extracellular to intracellular conditions [12-17]. In human cancers, the heat shock proteins chaperone function mediates oncogenic transformation and blocks apoptosis [18, 19]. In our

Schistosoma mansoni system, heat shock proteins 70 and 89 were identified as abundant components of cercarial secretions used for host invasion [20, 21], suggesting a potential role in host-parasite interactions as well.

We have focused on characterizing Heat shock factor 1 in S. mansoni as a route to better understanding the role of heat shock pathway activation in infective larvae. Schistosome infections occur when the skin of a potential mammalian host is exposed to schistosome larvae in freshwater. The larvae penetrate the skin and begin development into adult worms. Identification of suitable targets via drug screening approaches are ongoing, but challenges remain to translate the results of these screens into useful anti-schistosomal drugs [22-26]. Therefore, a more thorough understanding of basic schistosome biology and schistosome infection strategies is necessary.

Schistosomes require both molluscan and mammalian hosts for parasite development.

The free-swimming and infectious schistosome larvae, cercariae, penetrate human skin

32

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator with the aid of proteolytic enzymes [21, 27-29]. During penetration, cercariae lose their tails, while the cercarial head continues to develop, transforming into the next developmental stage, the schistosomula. After invasion, schistosomula immediately begin host immune system evasion strategies, elongate, and develop into male and female adults. Worms pair in the liver, then travel to the veins of the bladder or small intestine, where they produce eggs, the pathologic agent in schistosomiasis. Once the eggs are excreted and reach fresh water, the eggs hatch into transient and free-swimming miracidia, which invade a molluscan host, develop into mother and daughter sporocysts, and mass produce infectious cercariae [27], completing the life-cycle.

The transformation from infectious cercariae to schistosomula involves not only a morphological change, but also includes a change in temperature (from the temperature of the external water to that of the host body (37°C)) and osmolarity (from relatively hypotonic freshwater to a saline environment in the bloodstream of the human host).

Before transforming into schistosomula, cercariae must first breach the host skin barrier.

Cercariae penetrate human skin by releasing the contents of two sets of acetabular glands

(preacetabular and postacetabular). These glands produce many substances, including the proteolytic enzyme cercarial elastase (which breaks down host skin) and mucins (which enable adhesion to the host skin) [11, 19, 29-33]. In addition, these glands contain a conglomerate of other proteins such as the heat shock proteins (HSPs) Heat shock protein

70 (Hsp70), Heat shock protein 90 (Hsp90), and Heat shock protein 60 (Hsp60) [20, 21,

28]. After the acetabular glands release their contents, they atrophy to make space for gut

33

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

and other organ development [34]. Since schistosomula effectively survive the

transformation from cercariae, we reasoned that a heat shock response system could be

involved in schistosome invasion, as well as adaptation to and survival in a

warm-blooded human host.

The heat shock response pathway is a highly conserved and adaptive response system

that has evolved to reduce stress-induced cellular damage (for review, see [35-37]). When cells are stressed by elevated temperature or by other cellular insults, HSPs such as

Hsp70 bind unfolded proteins to prevent protein aggregation [38] and to maintain cellular integrity and organismal viability. A major regulator of the heat shock pathway is Heat shock factor 1 (Hsf1), a transcriptional activator that is critical for positive regulation of

HSP transcript levels such as those of HSP70 [37, 39]. Under non-stress conditions, HSPs are thought to interact with Hsf1 and sequester its transcriptional activity [40, 41]. Under heat stress conditions, HSPs release Hsf1, allowing it to activate the transcription of

HSP70 and other genes encoding HSPs.

Recently, the view that heat shock factors (HSFs) function solely to regulate the heat shock pathway has been changing [42]. Mounting evidence suggests that HSFs have complex roles in development. In Drosophila, the HSF gene functions in oogenesis and larval development [43], and in mice, mutations in the HSF gene result in developmental defects, infertility, retarded growth and lethality [44]. Similarly, HSF promotes an extended lifespan in Caenorhabditis elegans [45, 46], and is involved in the regulation of

34

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator apoptosis in cancer cell lines [47, 48].

Parasitic schistosomes have a gene encoding Hsf1 [49, 50] that responds to heat stress

[51, 52]. A role for Hsf1 in the transformation from free-swimming cercariae to skin schistosomula has not been described. We reasoned that this transformation involves a heat shock response. To begin to address this question, we verified the existence of an

HSF1 homolog in the infective stage of schistosomes, tested its ability to activate transcription, assessed its expression profile across different schistosome developmental stages, and examined its capacity to bind DNA. We report here the identification of an antibody, raised against a sequence from SmHsf1, which specifically labels the acetabular glands of invasive cercariae, an observation which may have potential implications for novel functions of SmHsf1 in schistosome host invasion and development.

2.4 Materials and Methods

2.4.1 Animals and parasites

Infected Biomphalaria glabrata snails (strain NMRI, NR-21962) were obtained from the

Biomedical Research Institute (BRI, Rockville, MD). Schistosoma mansoni cercariae were shed from B. glabrata snails as previously described [53]. Sporocyst stage parasites were dissected from these snails.

2.4.2 Preparation of schistosomal RNA

Sporocyst, cercaria, and 4-hour schistosomulum, S. mansoni were each suspended in

35

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

TRIzol reagent (Invitrogen, Carlsbad, CA) and homogenized by Dounce homogenization.

As per manufacturer’s instructions for the PureLink RNA Mini kit (Invitrogen), the samples were then centrifuged, and a phenol-chloroform extraction was performed on the supernatant, followed by DNAse I treatment. The eluted RNA was quantitated on a

ND-8000 spectrophotometer (Thermo Scientific, Waltham MA). Adult stage and uninfected B. glabrata snail RNA was obtained from the BRI.

2.4.3 Cloning

Reverse transcriptase polymerase chain reaction (RT-PCR) was performed using mixed schistosome RNA (from sporocyst, cercaria, schistosomulum, and adult stages) and

Superscript III/Platinum Taq RT-PCR kit (Invitrogen) with forward primer oKI001 (5’-

CATATGATGTATGGTTTCACATCTGGACCTCCTGTA-3’) and reverse primer oKI002

(5’- GAATTCTCATTCCAATTCTTCCTCACAAAAATCAGG-3’) (Integrated DNA

Technologies, Coralville, IA) for the schistosome gene Smp_068270 (www.genedb.org) and with cycling conditions: single cycle of (45°C for 30 min, 95°C for 2 min) and 25 cycles of (94°C for 30 sec, 50.4°C for 30 sec, 72°C for 2.5 min) with a final extension at

72°C 10 min. The RT-PCR product was subcloned into the SmaI restriction site of the pGBKT7 vector (Clontech) to make plasmid pKI003, and sequenced (Elim

Biopharmaceuticals, Hayward, CA) for verification.

2.4.4 Yeast transformation and modified yeast one-hybrid

Saccharomyces cerevisiae yeast strain AH109 was transformed for a modified yeast

36

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

one-hybrid experiment (with pKI003 in this study) as previously described [54, 55]. Yeast

cells were plated on synthetic dextrose medium lacking tryptophan (SD-Trp).

Transformed colonies were patched onto SD-Trp plates overlaid with 1000 μg

5-bromo-4-chloro-3-indolyl-α-D-galactopyranoside (X-α-Gal) and incubated at 30°C for

1 day. The yeast cells were used for a serial dilution growth test, for which the cells were

grown to saturation in SD-Trp medium, diluted to a 600 nm absorbance (A600) value of

0.85 (“1” in the dilution series), serially diluted from 1 to 10-5, and grown on synthetic dextrose medium lacking histidine or adenine (SD-His or SD-Ade) plates at 30°C for 3 and 4 days, respectively.

2.4.5 Electrophoretic mobility shift assay (EMSA)

Biotin-labeled and non-labeled oligonucleotide probes containing DNA binding sequences were designed and obtained from Integrated DNA Technologies. The double-stranded, biotin-labeled oligonucleotide oKI068(ds)(5’-Biotin-ttagaagccgccgagagatct[aGAAagTTCtaGTAc]agatctacggaagactctcct

-3’) contains the genomic DNA sequence 112 base pairs upstream of the translation start

site (-112) for Smp_106930, the schistosome HSP70 homolog; the brackets indicate the heat shock binding element (HSE), which closely resembles the HSE consensus sequence, a repeating inverted pentameric sequence (nGAAnnTTCnGAAn) [42, 44, 56, 57].

Unlabeled oligonucleotides used for competition experiments include: oKI032

(5’-ttagaagccgccgagagatct[aGAAagTTCtaGTAc]agatctacggaagactctcct-3’) and oKI033

(reverse complement of oKI032), which match the sequence of oKI068(ds); oKI030

37

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

(5’-ttagaagccgccgagagatct[cGAAtTTCgaCTAg]agatctacggaagactctcct-3’) and oKI031

(reverse complement of oKI030), which contain the genomic sequence 239 base pairs upstream of the translation start site of SmHSP70 (-239); oKI034

(5’-ttagaagccgccgagagatct[cGAAtTTCg]agatctacggaagactctcct-3’) and oKI035 (reverse complement of oKI034), which contain a shortened binding sequence from -239; oKI036

(5'-ttagaagccgccgagagatct[aCTTagTTCtaGTAc]agatctacggaagactctcct-3') and oKI037

(reverse complement of oKI036), which contain three mutated nucleotides in the first pentameric repeat from -112; double-stranded oligonucleotide oAT012(ds)(5’-gctgaaggat[CTAAAAATAG]gcggatcggc-3’), which contains a DNA binding sequence for the putative schistosome myocyte enhancer factor 2 [54]; and oKI073 (5’-gatcgtcat[aGAAagTTCtaGAAc]gatc-3’) and oKI074 (reverse complement of oKI073), which contain the HSE consensus sequence [57]. To make the oligonucleotide probes double-stranded, matched single-stranded oligonucleotides were incubated at

100°C for 2 minutes, after which the temperature was reduced by 1°C each minute, ending when the temperature reached 30°C. The oligonucleotide names and sequences are summarized in S2.1 Table.

Biotin-labeled DNA was detected using the LightShift chemiluminescent EMSA kit

(Thermo Scientific) according to the manufacturer’s guidelines. Briefly, 3.5 μg each of purified maltose binding protein (MBP) and MBP-SmHsf1 fusion protein was incubated with 100 fmol of the biotin-labeled oligonucleotide probes either alone or together with

25 pmol of non-labeled oligonucleotide probes in binding buffer, glycerol, MgCl2,

38

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

poly-dIdC (nonspecific DNA competitor), and NP-40 detergent for 30 minutes. The protein-DNA complexes were run on a 5% native polyacrylamide gel in 0.5× TBE at 200

V for 1 hour, transferred to a nylon membrane in 0.5× TBE at 350 mA for 1 hour, and crosslinked on a CL-1000 Ultraviolet Crosslinker (CVP) at an energy setting of 120

mJ/cm2. After crosslinking, the membrane was blocked, incubated with a stabilized streptavidin-horseradish peroxidase conjugate, washed, incubated with luminol/enhancer and stable peroxide solution, and visualized on a CCD camera (Fotodyne, Hartland, WI).

2.4.6 Comparison of protein sequences

Hsf1 protein sequences from Schistosoma mansoni (GeneDB, Smp_068270.2),

Schistosoma japonicum (GeneDB, Sjp_0064040), Caenorhabditis elegans (GenBank:

AAS72410.1), Saccharomyces cerevisiae (Saccharomyces genome database, strain

S288C: YGL073W), Drosophila melanogaster (NCBI RefSeq: NP_476575.1), Xenopus laevis (NCBI RefSeq: NP_001090266.1), Mus musculus (GenBank: AAH94064.1), and

Homo sapiens (NCBI RefSeq: NP_005517.1), along with the protein sequence

corresponding to the conserved domain of Hsf1 (NCBI conserved domains,

Cdd:smart00415) [9, 10, 58], were aligned using ClustalW2

(http://www.ebi.ac.uk/Tools/msa/clustalw2/) [7, 8] using the default parameters.

TreeViewX software was used to generate a phylogram.

2.4.7 Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)

Primers specific to Smp_068270.2 (forward primer oKI040:

39

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

5’-TGGTAATGACGAGTGTGACGTA-3’, reverse primer oKI042:

5’-TCAACATTAAGGCCTACAGGAAA-3’) were designed using the Primer3 web

applet [59, 60]. One microgram each of sporocyst, cercaria, 4-hour schistosomulum, and

adult stage RNA was subjected to a reverse transcriptase reaction with oligo dT

(Promega), and 50 ng of the resulting cDNA was used for a relative ΔΔCT qPCR using

SYBR Green PCR Master Mix (Applied Biosystems) and primers oEJ548

(5’-AGTTATGCGGTGTGGGTCAT-3’) and oEJ549

(5’-TGCTCGAGTCAAAGGCCTAC-3’) with cytochrome c oxidase subunit 2 (TC7399,

TIGR database) as the reference gene. qRT-PCR products are intron-spanning. All experiments were done in triplicate. A two-tailed t-tested was applied to ΔCT values as

the statistical test to determine significant differences in transcript expression levels

relative to the cercaria stage.

2.4.8 Recombinant protein purification

Smp_068270.2 was subcloned into pMAL-c5X (NEB) at NdeI and EcoRI by ligation

using T4 DNA ligase (NEB, Ipswitch, MA) to make plasmid pKI058, and transformed

into BL21(DE3) chemically competent E. coli bacterial cells (Invitrogen). BL21(DE3)

cells carrying either plasmid pKI058 or empty vector pMAL-c5X were induced with

isopropyl β-D-1-thiogalactopyranoside (IPTG, Sigma-Aldrich, Saint Louis, MO) to a

concentration of 0.4 mM at 37°C for 6 hours, and cell pellets were frozen overnight.

Cells were lysed by pulse sonication (Sonifier 250, Branson, Danbury, CT) in a

phosphate lysis buffer (50 mM potassium phosphate at pH 8.0, 200 mM NaCl) containing

40

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

10 mM phenylmethylsulfonyl fluoride (PMSF) and 100 μL Halt Protease Inhibitor

Cocktail (Thermo Scientific). The lysate was cleared by centrifugation at 10,000 × g for

30 minutes at 4°C (Sorvall), and the cleared supernatant was incubated with amylose resin beads (NEB) at 4°C overnight with gentle rocking. Purified protein (MBP and

MBP-SmHsf1, respectively, from pMAL-c5X and pKI058) was eluted from the amylose beads (50 mM potassium phosphate at pH 8.0, 200 mM NaCl, 10 mM maltose), dialyzed against 3 changes of protein storage buffer (20 mM HEPES pH 7.9, 100 mM KCl, 0.1 mM EDTA, 1 mM DTT, 50% glycerol) Slide-a-lyzer, Thermo Scientific) and concentrated with 30k and 50k MWCO Amicon columns (Millipore, Billerica, MA). The proteins were quantified using the Bradford reagent (Bio-Rad, Hercules, CA) and an

ND-8000 spectrophotometer (Thermo Scientific).

2.4.9 Custom antibody production

A polyclonal antibody raised in New Zealand white rabbits against the peptide with sequence Cys-KYKKEPIRKQHKI from Smp_068270 (SmHsf1) was designed and purchased (Pacific Immunology, Ramona, CA). The peptide sequence used for antibody production was Blasted against the NCBI schistosome protein database to prevent production of an antibody cross-reactive with other schistosome proteins. IgG was purified from the pre-immune serum using Melon Gel IgG Spin Purification Kit (Thermo

Scientific).

41

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

2.4.10 Western blotting

To detect SmHsf1 protein, 1 μg purified MBP, 1 μg and 7 μg MBP-SmHsf1 fusion, and approximately 5 μg of cercarial protein extract were resolved on a 5% polyacrylamide gel and transferred to nitrocellulose membranes in ice-cold Towbin transfer solution (25 mM tris, 192 mM glycine, 20% methanol) at 400 mA for 2 hours. Following the transfer, the membranes were blocked in 5% milk dissolved in phosphate buffered saline, 0.1%

Tween-20 (PBSTw) on an orbital shaker at room temperature for 1 hour. Purified IgG from pre-immune serum or immune serum was added to a concentration of 0.5 µg/mL, and the membranes were gently rocked at 4°C overnight. The membranes were washed in

PBSTw on an orbital shaker for 5, 10, and 15 minutes, after which an HRP-linked goat anti-rabbit secondary antibody (GE Healthcare) was added at a dilution of 1:2500 in 1% milk/PBSTw, followed by orbital shaking at room temperature for 1 hour and washing in

PBSTw. Amersham ECL Western blotting detection reagent (GE Healthcare) was added

(2 mL per nitrocellulose membrane) and incubated at room temperature for 1 minute before the membranes were exposed to autoradiography film.

2.4.11 Immunohistochemistry

A protocol adapted from Collins et al. (2011) was used to prepare samples for immunohistochemistry [61]. Briefly, cercariae were fixed for 20 minutes at room temperature in a 4% paraformaldehyde/PBSTw (PBS/ 0.1% Tween-20) solution, washed in PBSTw, then dehydrated in a methanol/PBSTw series and stored in 100% methanol at

-20°C until use. Prior to use, cercariae were rehydrated, digested for 10 minutes at room

42

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

temperature in permeabilization solution (1× PBSTw, 0.1% SDS, and proteinase K (1

µg/mL)), and washed in PBSTw (all subsequent washes were carried out with nutation at

room temperature). Cercariae were re-fixed for 10 minutes at room temperature in a 4%

paraformaldehyde/PBSTw solution, and washed in PBSTw. Samples were incubated with

rocking in block solution (PBSTw, 5% horse serum (Jackson ImmunoResearch

Laboratories, West Grove, PA), 0.05% Tween-20, and 0.3% Triton X-100) for 2hrs at RT or overnight at 4°C. Samples were incubated with a polyclonal primary rabbit anti-SmHsf1 antibody (described above) in block solution at a concentration of 0.6

µg/mL or 2.5 μg/mL, overnight at 4°C and washed >2hrs at room temperature. Samples were then incubated with an Alexa 647 donkey anti-rabbit antibody (Jackson

ImmunoResearch Laboratories) at a concentration of 1:400 or 1:800 in block solution, overnight at 4°C. Samples were washed in PBSTw (>2hrs), at room temperature with the second wash containing DAPI (1 µg/mL). After washing, samples were mounted in Slow

Fade Gold (Invitrogen, Grand Island, NY). Pre-immune serum IgG (5 µg/mL), and no primary controls were run in parallel with experimental samples. For the no primary controls, samples were incubated in block solution alone during the primary incubation step.

2.4.12 Imaging

All samples were mounted in Slow Fade Gold mounting media. Samples were imaged on a Zeiss LSM 510 META confocal microscope (Carl Zeiss, Germany) (Plan-Apochromat

63×/1.2 W objective). The Alexa 647 fluorophore was excited with a 633 nm laser and

43

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

the DAPI with a 405 nm laser. Images were processed using Zeiss LSM Image Browser

(Carl Zeiss) or ImageJ.

2.5 Results

2.5.1 Schistosome Hsf1 is a transcriptional activator.

Hsf1 proteins function as activators of transcription. To test whether the Hsf1 protein

from schistosomes (Smp_068270.2) is able to activate transcription, we performed a

modified yeast one-hybrid analysis as previously described [54, 55]. Briefly, we made an

N-terminal fusion of the DNA binding domain of the yeast Galactose 4 protein

(Gal4DBD) with SmHSF1 to make the fusion protein Gal4DBD-SmHsf1. Gal4DBD can bind DNA, but it cannot activate transcription because its transactivation domain has

been removed. The Gal4DBD-SmHsf1 fusion protein was expressed in a yeast strain that

is auxotrophic for histidine and adenine (see Materials and Methods). Genes for alpha

galactosidase (encoded by MEL1), histidine metabolism (encoded by HIS3), and adenine

metabolism (encoded by ADE2), are regulated by promoter elements dependent on Gal4

binding and activation; these genes were used as reporters.

Expression of the Gal4DBD-SmHsf1 protein in yeast cells resulted in the induction of the

MEL1 reporter gene, which was visualized by blue-colored yeast cells on

SD-Trp/X-α-Gal plates (Figure 2.1A). To test whether SmHsf1 could also induce HIS3

and ADE2 reporter gene expression, yeast cells were selected for growth and viability by

a serial dilution assay on synthetic medium lacking the respective nutritional marker

44

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

(SD-His, SD-Ade). Yeast not expressing the selectable markers cannot survive. We found

that yeast cells expressing Gal4DBD-SmHsf1 protein were viable and conferred histidine

and adenine prototrophy to these cells (Figure 2.1B and C). Yeast cells expressing only

the Gal4DBD were unable to induce activity from any reporter: they showed no blue

color on SD-Trp/X-α-Gal plates and were not viable on SD-His and SD-Ade plates, while

the positive control yeast cells expressing the full length Gal4 activator (Gal4Full)

showed blue color on SD-Trp/X-α-Gal plates and were viable on SD-His and SD-Ade plates (Figure 2.1) These data demonstrate that SmHsf functions as a transcriptional activator.

45

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

Figure 2.1. SmHsf1 can drive transcription in a modified yeast one-hybrid system. Yeast cells expressing SmHsf1 fused to the Gal4 DNA binding domain (Gal4DBD-SmHsf1) were patched (A) or serially diluted (B and C, from 1 to 10-5) on different selective media to test the ability of SmHsf1 to activate transcription. The positive control yeast express a complete GAL4 gene (Gal4Full) and the negative control yeast express the GAL4 DNA binding domain alone (Gal4DBD). (A) Blue color on SD-Trp with X-α-Gal indicates expression of the MEL1 reporter gene. (B and C) Growth on the SD-His and SD-Ade plates indicates expression of the HIS3 and ADE2 reporter genes, respectively, and are essential for cell viability.

46

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

2.5.2 SmHsf1 recognizes the heat shock DNA binding element from the schistosome

HSP70 promoter.

Heat shock factors recognize promoter sequences that regulate several heat shock response genes (such as HSP70) by binding to heat shock factor DNA binding elements

(HSEs) consisting of repeating inverted pentameric sequences: nGAAnnTTCnnGAAn

[42, 56]. We tested whether SmHsf1 can bind to the HSE located 112 base pairs from the translation start site of the SmHSP70 gene using an electrophoretic mobility shift assay

(EMSA) (Figure 2.2). Recombinant, purified MBP-SmHsf1 fusion protein was incubated with a double-stranded DNA (dsDNA) oligonucleotide probe, oKI068(ds), containing the

HSE from the SmHSP70 promoter (Figure 2.2, lane 3). The dsDNA oligonucleotide sequence was labeled with biotin for chemiluminescent EMSA detection (see Materials and Methods). Unlabeled dsDNA oligonucleotide probes were used for competition experiments and matched the following: 1] an HSE sequence found at -239 base pairs from the SmHSP70 translation start site (DNA oligonucleotide pair oKI030/031), 2] an

HSE sequence found at -112 base pairs from the SmHSP70 translation start site (DNA oligonucleotide pairs oKI032/033), 3] an HSE sequence found at -239 base pairs from the

SmHSP70 translation start site lacking the third pentameric repeat (DNA oligonucleotide pair oKI034/035), 4] an HSE sequence found at -112 base pairs from the SmHSP70 translation start site with three base pairs of the first pentameric repeat mutated (DNA oligonucleotide pair oKI036/037), 5] a negative control sequence reported to bind the putative schistosome Myocyte enhancer factor 2 (dsDNA oligonucleotide oAT012(ds))

[54]; and the HSE consensus sequence (DNA oligonucleotide pair oKI073/074) (Figure

47

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

2.2, lanes 4-9) [57]. Consistent with previous findings [49, 57], we found that

MBP-SmHsf1 binds the HSE from the schistosome HSP70 promoter. Our competition experiments show that MBP-SmHsf1 also recognizes the consensus HSE with great affinity (Figure 2.2, lane 9). The HSE consensus sequence is found in the promoter region of Drosophila HSP70 [6, 62]. This led us to compare the protein sequence of the conserved domain (which contains the DNA binding domain) of SmHsf1 to that of Hsf1 from other species using ClustalW2 (Figure 2.3). Our analysis showed the expected result that Hsf1 from Schistosoma mansoni and the related species, Schistosoma japonicum, cluster together. However, these flatworm Hsf1 sequences appear to cluster more closely to sequences from Drosophila than to those from other organisms, including the roundworm C. elegans.

48

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

Figure 2.2. SmHsf1 binds the heat shock binding element from the schistosome HSP70 promoter. Recombinant SmHsf1 cloned as a fusion protein with maltose binding protein (MBP-SmHsf1), or maltose binding protein (MBP) alone, was incubated with the double-stranded biotin-labeled oligonucleotide oKI068(ds) containing the heat shock binding element sequence from the schistosome HSP70 promoter. Unlabeled competitor oligonucleotide probes were added at a 250-fold molar excess relative to oKI068(ds) in lanes 4-9. Labeled DNA was detected by chemiluminescence. Oligonucleotide sequences for the probes are shown in S2.1 Table.

49

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

Figure 2.3. Phylogram of SmHsf1. Protein sequences of the Hsf1 conserved domain from various species were aligned using ClustalW2, and the phylogram was generated using TreeViewX software. The following settings were used for the protein alignment: Protein Weight Matrix (Gonnet); Gap open (10); Gap extension (0.20), Gap distances (5); No end gaps allowed; Single iteration; Clustering (NJ).

50

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

2.5.3 SmHSF1 is expressed across schistosome developmental stages.

To determine the expression level of SmHSF1 during schistosome development, we used

quantitative reverse transcriptase PCR (qRT-PCR) to assess SmHSF1 transcript levels

from sporocyst, cercaria, 4-hour schistosomula, and adult stages. Relative to the cercaria

stage, SmHSF1 was expressed 2.3, 1.8, and 1.4-fold in sporocyst, 4-hour schistosomula,

and adult stages, respectively (Figure 2.4, p < 0.05). Thus, for all schistosome

developmental stages analyzed, SmHSF1 is expressed. Values of ΔCT were used for a

two-tailed t-test to determine significant differences in expression levels.

Figure 2.4. SmHSF1 is expressed across several schistosome life-cycle stages. qRT-PCR of SmHSF1 transcript was performed on sporocyst, cercaria, 4-hour schistosomula, and adult stages with 3 replicates. Cytochrome c oxidase was used as the reference gene and cercaria as the reference stage. The ΔΔCT method was used to analyze the qRT-PCR data.

51

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

2.5.4 A polyclonal antibody detects the SmHsf1 protein.

A custom polyclonal antibody was designed against peptide sequence

(Cys-KYKKEPIRKQHKI) that is common to the known splice variants of the SmHsf1

protein. Prior to antibody production, the peptide sequence was compared to known

schistosome protein sequences by BLASTP search and no statistically significant

alignment to other proteins was identified. To test whether the antibody recognizes

SmHsf1, we expressed and purified SmHsf1 as a fusion protein to the maltose binding

protein (MBP-SmHsf1) to increase solubility and to aid in purification. We performed a

Western blot on the recombinant MBP-SmHsf1 and cercarial protein extract separated by

SDS-PAGE, using both pre-immune serum and the purified polyclonal anti- SmHsf1 antibody (Figure 2.5). The antibody detected bands at approximately 130, 110, and 70 kDa for the recombinant MBP-SmHsf1 fusion protein (Figure 2.5, lanes 2 and 3), all of which were sequence confirmed to contain Hsf1 protein by LC-MS/MS. In cercarial extract, bands were observed at approximately 110, 65, and 50 kDa for the cercarial protein extract, (Figure 2.5, lane 4), and no non-specific reactivity was observed to the extract using IgG from pre-immune serum (Figure 2.5, lane 5). In the context of highly abundant background proteins in a complex lysate, it was not possible to detect Hsf1 peptides in the 110, 65, and 50 kDa bands from cercarial extract.

52

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

Figure 2.5. The SmHsf1 antibody recognizes the SmHsf1 protein. Purified IgG from SmHsf1-immunized rabbit bleeds (lanes 1–4) or pre-immune serum (lane 5) were used in a Western blot to test for reactivity against bacterially expressed recombinant proteins and cercarial extract; (lane 1), 1 µg MBP negative control; (lane 2), 1 µg MBP-SmHsf1 fusion protein; (lane 3), 7 µg MBP-SmHsf1 fusion protein; (lanes 4 & 5), 7 µg cercarial extract.

The expected molecular weight of SmHsf1 is approximately 73 kDa in molecular weight,

53

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

which when fused to 42 kDa MBP should result in an approximately 115 kDa

MBP-SmHsf1 fusion protein. Since Hsf1 can be highly post-translationally modified [63], we assessed whether treatment with alkaline phosphatase or deglycosidase could collapse the higher molecular weight bands at 130 and 110 kDa, but observed no band shift.

Analysis of MBP signal in these recombinant protein bands by Western blot (S2.2 Figure) demonstrated a similar band pattern to the anti-SmHsf1 blot. Treatment of recombinant

MBP-SmHsf1 with Factor Xa protease produced the desired cleavage result by liberating the 42 kDa MBP; however, after cleavage SmHsf1 is not detected using the antibody against Hsf1, suggesting the Hsf1 protein is not very stable (data not shown).

2.5.5 Antibody raised against SmHsf1 localizes to the acetabular glands of S. mansoni cercariae.

We used indirect immunohistochemistry to determine the location of SmHsf1 expression in fixed cercariae (Figure 2.6 and Figure 2.7; S2.3-S2.7 Movie). We predicted that

SmHsf1 should produce punctate staining to nuclei throughout the cercariae. We reasoned this because as a transcription factor, Hsf1 is usually localized to the nucleus to induce activation of HSPs [37, 39]. To our surprise, we observed targeted SmHsf1 localization to the cercarial acetabular glands, which run the length of, and comprise a large percentage of, the cercarial head (Figure 2.6I, Figure 2.6K, and Figure 2.7; S2.3 Movie and S2.6

Movie). Cercarial acetabular glands are composed of three pairs of postacetabular and two pairs of preacetabular glands, whose secretions are thought to be involved in host invasion [31, 64, 65]. These anucleated glands are unicellular, have large fundi located

54

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator anterior and posterior to the acetabulum (i.e., pre and post), and have ducts composed of long cellular processes that extend anteriorly to the tip of the oral sucker [64, 66]. Both sets of glands are filled with secretory granules whose contents are thought to be involved in attachment to, and subsequent penetration of, the definitive host. The postacetabular glands contain secretory granules of mucigen, and the preacetabular gland granules contain proteinases [29, 31, 65, 67]. Labeling with the SmHsf1 antibody occurred along the length of the glands, rather than being restricted to the fundus as might be expected of a transcription factor (Figure 2.6I and Figure 2.7; S2.3 Movie and S2.6 Movie). Our data show that SmHsf1 is primarily localized to the postacetabular glands. Additionally,

SmHsf1 localization and DAPI staining seem to be mutually exclusive (S2.5 Movie). The no primary and pre-immune controls did not show labeling (Figure 2.6, panels A and E, respectively).

55

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

Figure 2.6. SmHsf1 is localized to the acetabular glands in S. mansoni cercariae. (A-L) Single, representative confocal sections of cercariae. A custom, rabbit polyclonal primary antibody against S. mansoni Heat shock factor 1 protein (SmHsf1) and a donkey anti-rabbit Alexa 647 secondary antibody were used to detect SmHsf1 in cercariae. (A-D) No primary negative control. The anterior region (mouth) is located near the bottom of the panels. (E-H) Pre-immune serum IgG negative control. The anterior region is located to the left. (I-L) Anti-SmHsf1. In panel I, SmHsf1 is localized to the acetabular glands (red) which traverse the entire head of the cercariae from the posterior (left) to anterior (bottom right). Panels B, F, and J are stained with DAPI. Panels C, G, and K are merged Alexa 647 and DAPI images. Panels D, H, and L are Differential Interference Contrast (DIC) images for each treatment.

56

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

Figure 2.7. Antibody raised against SmHsf1 localizes to the acetabular glands extending the entire length of the S. mansoni cercarial head. Immune staining, as in Figure 2.6, was used to localize anti-SmHsf1 signal (red) to acetabular glands of the S. mansoni cercariae. The anterior (mouth) is to the bottom left of the image. The image is a maximum confocal projection, and the magnification is with a 63×/1.2 W objective.

2.6 Discussion

Hsf1 proteins are highly conserved and well-characterized transcriptional activators. Hsf1 in schistosomes has been previously described [49, 57, 68]. We expand the initial observations on SmHsf1, and we increase our knowledge of this protein. Hsf1 functions as a transcriptional activator of HSPs in other systems. We cloned the SmHSF1 gene and assessed whether SmHsf1 functions as an activator in a heterologous yeast reporter system. Our results confirm that SmHsf1 is a positive regulator of transcripton (Figure

2.1). Using qRT-PCR, we show that SmHSF1 transcript is expressed in all stages tested, but that the level of SmHSF1 is relatively high in sporocysts and relatively low in cercariae. Our findings of transcript levels of SmHSF1 support the idea that a larger pool

57

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

of heat shock proteins is required to maintain cell homeostasis in sporocysts because of

their elevated protein levels for the mass production of cercariae [69]. Alternatively, this

may reflect the general lower transcript levels observed in cercariae, or priming of

cercarial transcripts by production of some cercarial transcripts in sporocysts.

The transcript levels of the Hsf1 target, SmHSP70, do not change in response to salt or

temperature increases in cercariae as expected of a stress response gene [51]. It was

speculated that the lack of increase in HSP70 transcript levels in cercariae prior to the

loss of the cercarial tail during transformation is due to tail-dependent inhibitory signals that terminate the transcription of HSP70 [51]. In support of these observations, we found that the HSP activator, SmHsf1 protein, is primarily localized to the cercarial acetabular glands, which are unicellular and lack nuclei [64, 66]. We also found that the SmHsf1 staining does co-localize with the DAPI nuclear stain elsewhere in the cercariae. Thus, it appears that in the absence of nuclear localization, cercarial SmHsf1 would be unable to induce the transcription of new HSPs, including HSP70, despite expectations for this transformation to be a high stress condition. Furthermore, localization of anti-SmHsf1 signal to cercarial acetabular glands is suggestive of alternative function for this transcription factor. This motivates our further research into the specificity of this novel immunolocalization..

The schistosome acetabular glands are long, unicellular structures that produce, store, and release a variety of substances such as mucins and elastases/proteinases to assist in

58

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

adhesion and invasion of human skin [64]. Curiously, SmHsf1 has not been detected in cercarial secretions [20, 21], suggesting that SmHsf1 protein may be bound directly or indirectly to the acetabular cell membrane. At the time of host invasion, the acetabular glands are no longer nucleated [64, 66], raising the possibility of an alternative function for SmHsf1 beyond a transcriptional role in cercariae and newly transformed schistosomula. SmHsf1 may be required for the production of chaperone proteins during the development of the glands in early embryonic cercariae in the molluscan host. After fragmentation of the gland nucleus, SmHsf1 could be released into the cytoplasm, where it can interact with membrane-associated proteins (SmHsf1 has no known transmembrane domains), facilitating SmHsf1 to remain bound to the glands during the secretion of other gland contents. A non-nuclear Hsf1 is also observed in non-small cell lung cancer line cells, in which Hsf1 associates with and disables the anti-apoptotic membrane-bound

Ralbp1 protein [47, 48]. One scenario is that SmHsf1 functions to block a related anti-apoptotic factor, allowing apoptosis of the glands to occur. Indeed, in 5-day old schistosomula, the acetabular glands are disintegrated [34], and our immunohistochemical analysis using the anti-SmHsf1 antibody shows no acetabular

SmHsf1 localization in 5-day old schistosomula (data not shown). SmHsf1 could be involved in the degradation of acetabular glands in schistosomula, allowing space for the development of organs such as the gut. Additional investigation is required to reveal the the mechanism by which SmHsf1 remains in the glands, and whether it contributes to the controlled disintegration of the glands, will be of significant interest. In addition, our data suggest that the anti-SmHsf1 antibody is primarily localized to the postacetabular glands

59

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator in cercariae, although we do not exclude the preacetabular glands. It is not clear why there appears to be a preference for the postacetabular glands, responsible for the deposition of cercarial mucins and for providing an adhesive substrate for the parasite to remain attached to host skin [31, 64].

Hsf1 and HSPs could play even broader roles in schistosome developmental regulation.

Hsp70 was identified as being responsible for mediating the association and dissociation of the 26S proteasome in mouse embryonic fibroblasts [16]. The 26S proteasome is a conserved set of proteins that function in protein turnover and protein recycling, cell cycle progression through degradation of cyclins, and modulation of cell death [12-15,

17]. A major component of the 26S proteasome, the 20S proteasome is reported to bind tightly to Hsp90 in schistosomes, and it has different forms of reactive subunits in cercariae relative to newly transformed schistosomula [18], again connecting the heat shock pathway to cellular development. Examination of the role of SmHsf1 and HSPs during and after the invasion of human skin not only represents the study of a potentially novel developmental regulatory mechanism, but it can also help to identify key proteins necessary for parasite invasion and development that can be used as therapeutic targets to decrease schistosomula viability in the host. Alternatively, inhibiting the heat shock pathway in cercariae may have unpredictable effects on the ability of schistosomes to infect their host. The heat shock system used by schistosome cercariae during host invasion may also apply to other parasites that undergo environmental transitions, such as

Ancylostoma duodenale (hookworm), which transition from soil to host, or Toxoplasma

60

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator gondii, which transition from extracellular to intracellular during muscle and brain invasion.

Our data demonstrate that the antibody raised against a peptide in SmHsf1 can recognize

SmHsf1, but we cannot rule out the possibility that it does not interact with another cercarial protein, and that another protein is responsible for this unique localization to the acetabular glands. Given that our data support previous evidence that the SmHsf1 protein is extremely insoluble and unstable [49], we were unable to statistically identify the protein in cercariae using mass spectrometry. However, if SmHsf1 is not responsible for this novel acetabular localization and it is another protein, this observation provides a cellular marker and an excellent impetus to begin to explore molecular factors in acetabular regulatory mechanisms as well as an opportunity to further explore host-parasite interactions and parasite development. Understanding the mechanisms for schistosome invasion and development can promote the discovery of novel treatments to combat parasitic infections.

2.7 Acknowledgements

Infected snails and adult RNA were provided to E. Jolly by the BRI via the NIAID

Schistosomiasis resource center under NIH-NIAID contract No. HHSN27220100000051:

Schistosoma mansoni, Strain NMRI-exposed Biomphalaria glabrata, Strain NMRI,

NR-21962. We also thank Ronald Blanton and Blanton Tolbert for helpful discussions, and Anida Karahodza and Shuang Liang for critical review of the manuscript.

61

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

2.8 Supporting information

S2.1 Table. Names and sequences of oligonucleotides used for EMSA. doi:10.1371/journal.pntd.0003051.s007 (Table S1 in published version). Name Sequence Notes oKI030 5'-ttagaagccgccgagagatct[cG Contains sequence 239 bp AAtTTCgaCTAg]agatctacggaaga upstream of SmHSP70 ctctcct-3' translation start site oKI031 5'-aggagagtcttccgtagatct[ct Reverse complement of oKI030 agtcgaaattcg]agatctctcggcgg cttctaa-3' oKI032 5'-ttagaagccgccgagagatct[aG Contains sequence 112 bp AAagTTCtaGTAc]agatctacggaag upstream of SmHSP70 actctcct-3' translation start site oKI033 5'-aggagagtcttccgtagatct[gt Reverse complement of oKI032 actagaactttct]agatctctcggcg gcttctaa-3' oKI034 5'-ttagaagccgccgagagatct[cG Contains short sequence 239 bp AAtTTCg]agatctacggaagactctc upstream of SmHSP70 ct-3' translation start site oKI035 5'-aggagagtcttccgtagatct[cg Reverse complement of oKI034 aaattcg]agatctctcggcggcttct aa-3' oKI036 5'-ttagaagccgccgagagatct[aC Contains mutated sequence 112 TTagTTCtaGTAc]agatctacggaag bp upstream of SmHSP70 actctcct-3' translation start site oKI037 5'-aggagagtcttccgtagatct[gt Reverse complement of oKI036 actagaactaagt]agatctctcggcg gcttctaa-3' oAT012 (ds) 5'-gctgaaggat[CTAAAAATAG]gc Contains binding sequence for ggatcggc-3' schistosome Mef2 oKI068 (ds) 5'-Biotin-ttagaagccgccgagag Identical sequence to oKI032, atct[aGAAagTTCtaGTAc]agatct biotin-labeled on forward acggaagactctcct-3' strand oKI073 5'-gatcgtcat[aGAAagTTCtaGAA Contains Hsf1 consensus c]gatc-3' binding sequence oKI074 5'-gatcgttct[agaactttctatga Reverse complement of oKI073 c]gatc-3'

62

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

S2.2 Figure. MBP antibody recognizes the MBP-SmHsf1 fusion protein. An antibody against MBP-fused with HRP (Abcam, ab49923) was used in a Western blot to probe for MBP in recombinant proteins prepared from E. coli. (lane 1) 5 µg MBP positive control (lane 2) 5 µg intact MBP-SmHsf1 fusion protein (lane 3) 5 µg recombinant MBP-SmHsf1 cleaved with Factor Xa. Signal was detected by chemiluminescence (Pierce ECL western blotting substrate, 32209). doi:10.1371/journal.pntd.0003051.s001 (Figure S1 in published version).

S2.3 Movie. Anti-SmHsf1 antibody is localized to the cercarial head. Z-stack images of an S. mansoni cercarial head showing anti-SmHsf1 localization. The anterior end the cercarial head is toward the bottom right. doi:10.1371/journal.pntd.0003051.s002 (Movie S1 in published version).

S2.4 Movie. DAPI staining of the cercarial head. Z-stack images of an S. mansoni cercarial head stained with DAPI. The anterior end of the cercarial head is toward the bottom right. doi:10.1371/journal.pntd.0003051.s003 (Movie S2 in published version).

S2.5 Movie. Anti-SmHsf1 and DAPI staining in the cercarial head. Merged z-stack images of an S. mansoni cercarial head showing anti-SmHsf1 localization and DAPI staining. The anterior end of the cercarial head is toward the bottom right. doi:10.1371/journal.pntd.0003051.s004 (Movie S3 in published version).

63

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

S2.6 Movie. Rotational view of the cercarial head showing anti-SmHsf1 localization. Maximum projection images are shown. The anterior end of the cercarial head is toward the bottom. doi:10.1371/journal.pntd.0003051.s005 (Movie S4 in published version).

S2.7 Movie. Rotational view of the cercarial head stained with DAPI. Maximum projection images are shown. The anterior end of the cercarial head is toward the bottom. doi:10.1371/journal.pntd.0003051.s006 (Movie S5 in published version).

2.9 References

1. Chitsulo L, Engels D, Montresor A, Savioli L. The global status of schistosomiasis and its control. Acta tropica. 2000;77(1):41-51. Epub 2000/09/21. PubMed PMID: 10996119. 2. Chitsulo L, Loverde P, Engels D. Schistosomiasis. Nature reviews Microbiology. 2004;2(1):12-3. Epub 2004/03/24. doi: 10.1038/nrmicro801. PubMed PMID: 15035004. 3. Gryseels B, Polman K, Clerinx J, Kestens L. Human schistosomiasis. Lancet. 2006;368(9541):1106-18. Epub 2006/09/26. doi: 10.1016/S0140-6736(06)69440-3. PubMed PMID: 16997665. 4. King CH. Parasites and poverty: the case of schistosomiasis. Acta tropica. 2010;113(2):95-104. doi: 10.1016/j.actatropica.2009.11.012. PubMed PMID: 19962954; PubMed Central PMCID: PMC2812649. 5. Steinmann P, Keiser J, Bos R, Tanner M, Utzinger J. Schistosomiasis and water resources development: systematic review, meta-analysis, and estimates of people at risk. The Lancet infectious diseases. 2006;6(7):411-25. Epub 2006/06/23. doi: 10.1016/S1473-3099(06)70521-7. PubMed PMID: 16790382. 6. Engels D, Chitsulo L, Montresor A, Savioli L. The global epidemiological situation of schistosomiasis and new approaches to control and research. Acta tropica. 2002;82(2):139-46. PubMed PMID: 12020886. 7. Melman SD, Steinauer ML, Cunningham C, Kubatko LS, Mwangi IN, Wynn NB, et al. Reduced susceptibility to praziquantel among naturally occurring Kenyan isolates of Schistosoma mansoni. PLoS neglected tropical diseases. 2009;3(8):e504. doi: 10.1371/journal.pntd.0000504. PubMed PMID: 19688043; PubMed Central PMCID: PMC2721635. 8. Blanton RE, Blank WA, Costa JM, Carmo TM, Reis EA, Silva LK, et al. Schistosoma mansoni population structure and persistence after praziquantel treatment in two villages of Bahia, Brazil. International journal for parasitology. 2011;41(10):1093-9. doi: 10.1016/j.ijpara.2011.06.002. PubMed PMID: 21784077; PubMed Central PMCID: PMC3155667.

64

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

9. Prichard RK, Basanez MG, Boatin BA, McCarthy JS, Garcia HH, Yang GJ, et al. A research agenda for helminth diseases of humans: intervention for control and elimination. PLoS neglected tropical diseases. 2012;6(4):e1549. doi: 10.1371/journal.pntd.0001549. PubMed PMID: 22545163; PubMed Central PMCID: PMC3335868. 10. Cohen FE, Gregoret LM, Amiri P, Aldape K, Railey J, McKerrow JH. Arresting tissue invasion of a parasite by protease inhibitors chosen with the aid of computer modeling. Biochemistry. 1991;30(47):11221-9. PubMed PMID: 1958659. 11. Lim KC, Sun E, Bahgat M, Bucks D, Guy R, Hinz RS, et al. Blockage of skin invasion by schistosome cercariae by serine protease inhibitors. The American journal of tropical medicine and hygiene. 1999;60(3):487-92. PubMed PMID: 10466982. 12. Acharya P, Kumar R, Tatu U. Chaperoning a cellular upheaval in malaria: heat shock proteins in Plasmodium falciparum. Molecular and biochemical parasitology. 2007;153(2):85-94. doi: 10.1016/j.molbiopara.2007.01.009. PubMed PMID: 17307260. 13. Echeverria PC, Matrajt M, Harb OS, Zappia MP, Costas MA, Roos DS, et al. Toxoplasma gondii Hsp90 is a potential drug target whose expression and subcellular localization are developmentally regulated. Journal of molecular biology. 2005;350(4):723-34. doi: 10.1016/j.jmb.2005.05.031. PubMed PMID: 15967463. 14. Graefe SE, Wiesgigl M, Gaworski I, Macdonald A, Clos J. Inhibition of HSP90 in Trypanosoma cruzi induces a stress response but no stage differentiation. Eukaryotic cell. 2002;1(6):936-43. PubMed PMID: 12477794; PubMed Central PMCID: PMC138760. 15. Hammarton TC, Mottram JC, Doerig C. The cell cycle of parasitic protozoa: potential for chemotherapeutic exploitation. Progress in cell cycle research. 2003;5:91-101. PubMed PMID: 14593704. 16. Shonhai A. Plasmodial heat shock proteins: targets for chemotherapy. FEMS immunology and medical microbiology. 2010;58(1):61-74. doi: 10.1111/j.1574-695X.2009.00639.x. PubMed PMID: 20041948. 17. Wiesgigl M, Clos J. The heat shock protein 90 of Leishmania donovani. Medical microbiology and immunology. 2001;190(1-2):27-31. PubMed PMID: 11770104. 18. Jolly C, Morimoto RI. Role of the heat shock response and molecular chaperones in oncogenesis and cell death. Journal of the National Cancer Institute. 2000;92(19):1564-72. PubMed PMID: 11018092. 19. Whitesell L, Lindquist SL. HSP90 and the chaperoning of cancer. Nature reviews Cancer. 2005;5(10):761-72. doi: 10.1038/nrc1716. PubMed PMID: 16175177.

65

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

20. Curwen RS, Ashton PD, Sundaralingam S, Wilson RA. Identification of novel proteases and immunomodulators in the secretions of schistosome cercariae that facilitate host entry. Molecular & cellular proteomics : MCP. 2006;5(5):835-44. Epub 2006/02/14. doi: 10.1074/mcp.M500313-MCP200. PubMed PMID: 16469760. 21. Knudsen GM, Medzihradszky KF, Lim KC, Hansell E, McKerrow JH. Proteomic analysis of Schistosoma mansoni cercarial secretions. Molecular & cellular proteomics : MCP. 2005;4(12):1862-75. Epub 2005/08/23. doi: 10.1074/mcp.M500097-MCP200. PubMed PMID: 16112986. 22. Abdulla MH, Ruelas DS, Wolff B, Snedecor J, Lim KC, Xu F, et al. Drug discovery for schistosomiasis: hit and lead compounds identified in a library of known drugs by medium-throughput phenotypic screening. PLoS neglected tropical diseases. 2009;3(7):e478. doi: 10.1371/journal.pntd.0000478. PubMed PMID: 19597541; PubMed Central PMCID: PMC2702839. 23. Caffrey CR, Rohwer A, Oellien F, Marhofer RJ, Braschi S, Oliveira G, et al. A comparative chemogenomics strategy to predict potential drug targets in the metazoan pathogen, Schistosoma mansoni. PloS one. 2009;4(2):e4413. doi: 10.1371/journal.pone.0004413. PubMed PMID: 19198654; PubMed Central PMCID: PMC2635471. 24. Mansour NR, Bickle QD. Comparison of microscopy and Alamar blue reduction in a larval based assay for schistosome drug screening. PLoS neglected tropical diseases. 2010;4(8):e795. doi: 10.1371/journal.pntd.0000795. PubMed PMID: 20706580; PubMed Central PMCID: PMC2919390. 25. Paveley RA, Mansour NR, Hallyburton I, Bleicher LS, Benn AE, Mikic I, et al. Whole organism high-content screening by label-free, image-based Bayesian classification for parasitic diseases. PLoS neglected tropical diseases. 2012;6(7):e1762. doi: 10.1371/journal.pntd.0001762. PubMed PMID: 22860151; PubMed Central PMCID: PMC3409125. 26. Peak E, Chalmers IW, Hoffmann KF. Development and validation of a quantitative, high-throughput, fluorescent-based bioassay to detect schistosoma viability. PLoS neglected tropical diseases. 2010;4(7):e759. doi: 10.1371/journal.pntd.0000759. PubMed PMID: 20668553; PubMed Central PMCID: PMC2910722. 27. Basch PF. Schistosomes : development, reproduction, and host relations. New York: Oxford University Press; 1991. vii, 248 p. p. 28. Hansell E, Braschi S, Medzihradszky KF, Sajid M, Debnath M, Ingram J, et al. Proteomic analysis of skin invasion by blood fluke larvae. PLoS neglected tropical diseases. 2008;2(7):e262. doi: 10.1371/journal.pntd.0000262. PubMed PMID: 18629379; PubMed Central PMCID: PMC2467291.

66

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

29. McKerrow JH, Salter J. Invasion of skin by Schistosoma cercariae. Trends in parasitology. 2002;18(5):193-5. PubMed PMID: 11983589. 30. Fishelson Z, Amiri P, Friend DS, Marikovsky M, Petitt M, Newport G, et al. Schistosoma mansoni: cell-specific expression and secretion of a serine protease during development of cercariae. Experimental parasitology. 1992;75(1):87-98. Epub 1992/08/01. PubMed PMID: 1639166. 31. Stirewalt MA, Walters M. Schistosoma mansoni: histochemical analysis of the postacetabular gland secretion of cercariae. Experimental parasitology. 1973;33(1):56-72. Epub 1973/02/01. PubMed PMID: 4348075. 32. Curwen RS, Wilson RA. Invasion of skin by schistosome cercariae: some neglected facts. Trends in parasitology. 2003;19(2):63-6; discussion 6-8. PubMed PMID: 12586470. 33. Whitfield PJ, Bartlett A, Brown MB, Marriott C. Invasion by schistosome cercariae: studies with human skin explants. Trends in parasitology. 2003;19(8):339-40. PubMed PMID: 12901933. 34. Stirewalt MA. Cercaria vs. schistosomule (Schistosoma mansoni): absence of the pericercarial envelope in vivo and the early physiological and histological metamorphosis of the parasite. Experimental parasitology. 1963;13:395-406. PubMed PMID: 13984191. 35. Richter K, Haslbeck M, Buchner J. The heat shock response: life on the verge of death. Molecular cell. 2010;40(2):253-66. doi: 10.1016/j.molcel.2010.10.006. PubMed PMID: 20965420. 36. Schlesinger MJ. Heat shock proteins: the search for functions. The Journal of cell biology. 1986;103(2):321-5. PubMed PMID: 2426277; PubMed Central PMCID: PMC2113812. 37. Shamovsky I, Nudler E. New insights into the mechanism of heat shock response activation. Cellular and molecular life sciences : CMLS. 2008;65(6):855-61. Epub 2008/02/02. doi: 10.1007/s00018-008-7458-y. PubMed PMID: 18239856. 38. Sharma SK, Christen P, Goloubinoff P. Disaggregating chaperones: an unfolding story. Current protein & peptide science. 2009;10(5):432-46. Epub 2009/06/23. PubMed PMID: 19538153. 39. Anckar J, Sistonen L. Regulation of HSF1 function in the heat stress response: implications in aging and disease. Annual review of biochemistry. 2011;80:1089-115. Epub 2011/03/23. doi: 10.1146/annurev-biochem-060809-095203. PubMed PMID: 21417720. 40. Guo Y, Guettouche T, Fenna M, Boellmann F, Pratt WB, Toft DO, et al. Evidence for a mechanism of repression of heat shock factor 1 transcriptional activity by a multichaperone complex. The Journal of biological chemistry.

67

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

2001;276(49):45791-9. doi: 10.1074/jbc.M105931200. PubMed PMID: 11583998. 41. Shi Y, Mosser DD, Morimoto RI. Molecular chaperones as HSF1-specific transcriptional repressors. Genes & development. 1998;12(5):654-66. PubMed PMID: 9499401; PubMed Central PMCID: PMC316571. 42. Akerfelt M, Morimoto RI, Sistonen L. Heat shock factors: integrators of cell stress, development and lifespan. Nature reviews Molecular cell biology. 2010;11(8):545-55. doi: 10.1038/nrm2938. PubMed PMID: 20628411; PubMed Central PMCID: PMC3402356. 43. Jedlicka P, Mortin MA, Wu C. Multiple functions of Drosophila heat shock transcription factor in vivo. The EMBO journal. 1997;16(9):2452-62. doi: 10.1093/emboj/16.9.2452. PubMed PMID: 9171358; PubMed Central PMCID: PMC1169845. 44. Xiao X, Zuo X, Davis AA, McMillan DR, Curry BB, Richardson JA, et al. HSF1 is required for extra-embryonic development, postnatal growth and protection during inflammatory responses in mice. The EMBO journal. 1999;18(21):5943-52. doi: 10.1093/emboj/18.21.5943. PubMed PMID: 10545106; PubMed Central PMCID: PMC1171660. 45. Hsu AL, Murphy CT, Kenyon C. Regulation of aging and age-related disease by DAF-16 and heat-shock factor. Science. 2003;300(5622):1142-5. doi: 10.1126/science.1083701. PubMed PMID: 12750521. 46. Morley JF, Morimoto RI. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular biology of the cell. 2004;15(2):657-64. doi: 10.1091/mbc.E03-07-0532. PubMed PMID: 14668486; PubMed Central PMCID: PMC329286. 47. Hu Y, Mivechi NF. HSF-1 interacts with Ral-binding protein 1 in a stress-responsive, multiprotein complex with HSP90 in vivo. The Journal of biological chemistry. 2003;278(19):17299-306. Epub 2003/03/07. doi: 10.1074/jbc.M300788200. PubMed PMID: 12621024. 48. Singhal SS, Yadav S, Drake K, Singhal J, Awasthi S. Hsf-1 and POB1 induce drug sensitivity and apoptosis by inhibiting Ralbp1. The Journal of biological chemistry. 2008;283(28):19714-29. Epub 2008/05/14. doi: 10.1074/jbc.M708703200. PubMed PMID: 18474607; PubMed Central PMCID: PMC2443664. 49. Lantner F, Ziv E, Ram D, Schechter I. Different forms of the mRNA encoding the heat-shock transcription factor are expressed during the life cycle of the parasitic helminth Schistosoma mansoni. European journal of biochemistry / FEBS. 1998;253(2):390-8. Epub 1998/07/08. PubMed PMID: 9654088. 50. Neumann S, Ziv E, Lantner F, Schechter I. Cloning and sequencing of an hsp70

68

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

gene of Schistosoma mansoni. Molecular and biochemical parasitology. 1992;56(2):357-60. Epub 1992/12/01. PubMed PMID: 1484560. 51. Neumann S, Ziv E, Lantner F, Schechter I. Regulation of HSP70 gene expression during the life cycle of the parasitic helminth Schistosoma mansoni. European journal of biochemistry / FEBS. 1993;212(2):589-96. Epub 1993/03/01. PubMed PMID: 8444195. 52. Levy-Holtzman R, Schechter I. Activity of the promoter of the hsp70 gene of the parasitic helminth Schistosoma mansoni in the mammalian CHO cell-line. Biochimica et biophysica acta. 1995;1263(1):96-8. Epub 1995/07/25. PubMed PMID: 7632742. 53. Milligan JN, Jolly ER. Cercarial transformation and in vitro cultivation of Schistosoma mansoni schistosomules. Journal of visualized experiments : JoVE. 2011;(54). Epub 2011/08/31. doi: 10.3791/3191. PubMed PMID: 21876520; PubMed Central PMCID: PMC3217644. 54. Milligan JN, Jolly ER. Identification and characterization of a Mef2 transcriptional activator in schistosome parasites. PLoS neglected tropical diseases. 2012;6(1):e1443. Epub 2012/01/12. doi: 10.1371/journal.pntd.0001443. PubMed PMID: 22235355; PubMed Central PMCID: PMC3250504. 55. Titz B, Thomas S, Rajagopala SV, Chiba T, Ito T, Uetz P. Transcriptional activators in yeast. Nucleic acids research. 2006;34(3):955-67. Epub 2006/02/09. doi: 10.1093/nar/gkj493. PubMed PMID: 16464826; PubMed Central PMCID: PMC1361621. 56. Amin J, Ananthan J, Voellmy R. Key features of heat shock regulatory elements. Molecular and cellular biology. 1988;8(9):3761-9. Epub 1988/09/01. PubMed PMID: 3146692; PubMed Central PMCID: PMC365434. 57. Levy-Holtzman R, Clos J, Schechter I. Differences in DNA sequence recognition by the heat-shock factors of Drosophila melanogaster and the parasitic helminth Schistosoma mansoni. Biochimica et biophysica acta. 1995;1264(1):134-40. Epub 1995/10/17. PubMed PMID: 7578247. 58. Marchler-Bauer A, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, et al. CDD: specific functional annotation with the Conserved Domain Database. Nucleic acids research. 2009;37(Database issue):D205-10. Epub 2008/11/06. doi: 10.1093/nar/gkn845. PubMed PMID: 18984618; PubMed Central PMCID: PMC2686570. 59. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, et al. Primer3--new capabilities and interfaces. Nucleic acids research. 2012;40(15):e115. Epub 2012/06/26. doi: 10.1093/nar/gks596. PubMed PMID: 22730293; PubMed Central PMCID: PMC3424584. 60. Koressaar T, Remm M. Enhancements and modifications of primer design

69

Chapter 2: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

program Primer3. Bioinformatics. 2007;23(10):1289-91. Epub 2007/03/24. doi: 10.1093/bioinformatics/btm091. PubMed PMID: 17379693. 61. Collins JJ, 3rd, King RS, Cogswell A, Williams DL, Newmark PA. An atlas for Schistosoma mansoni organs and life-cycle stages using cell type-specific markers and confocal microscopy. PLoS neglected tropical diseases. 2011;5(3):e1009. doi: 10.1371/journal.pntd.0001009. PubMed PMID: 21408085; PubMed Central PMCID: PMC3050934. 62. Xiao H, Lis JT. Germline transformation used to define key features of heat-shock response elements. Science. 1988;239(4844):1139-42. Epub 1988/03/04. PubMed PMID: 3125608. 63. Guettouche T, Boellmann F, Lane WS, Voellmy R. Analysis of phosphorylation of human heat shock factor 1 in cells experiencing a stress. BMC biochemistry. 2005;6:4. Epub 2005/03/12. doi: 10.1186/1471-2091-6-4. PubMed PMID: 15760475; PubMed Central PMCID: PMC1079796. 64. Dorsey CH, Stirewalt MA. Schistosoma mansoni: fine structure of cercarial acetabular glands. Experimental parasitology. 1971;30(2):199-214. Epub 1971/10/01. PubMed PMID: 4331794. 65. Stirewalt MA, Austin BE. Collection of secreted protease from the preacetabular glands of cercariae of Schistosoma mansoni. The Journal of parasitology. 1973;59(4):741-3. PubMed PMID: 4722597. 66. Dorsey CH, Cousin CE, Lewis FA, Stirewalt MA. Ultrastructure of the Schistosoma mansoni cercaria. Micron. 2002;33(3):279-323. Epub 2001/12/18. PubMed PMID: 11742750. 67. McKerrow JH, Pino-Heiss S, Lindquist R, Werb Z. Purification and characterization of an elastinolytic proteinase secreted by cercariae of Schistosoma mansoni. The Journal of biological chemistry. 1985;260(6):3703-7. PubMed PMID: 3882713. 68. Ram D, Ziv E, Lantner F, Lardans V, Schechter I. Stage-specific alternative splicing of the heat-shock transcription factor during the life-cycle of Schistosoma mansoni. Parasitology. 2004;129(Pt 5):587-96. Epub 2004/11/24. PubMed PMID: 15552403. 69. Jolly ER, Chin CS, Miller S, Bahgat MM, Lim KC, DeRisi J, et al. Gene expression patterns during adaptation of a helminth parasite to different environmental niches. Genome biology. 2007;8(4):R65. Epub 2007/04/26. doi: 10.1186/gb-2007-8-4-r65. PubMed PMID: 17456242; PubMed Central PMCID: PMC1896014.

70

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

Chapter 3: Hsp70 may be a molecular regulator of schistosome

host invasion

Kenji Ishida1, Emmitt R. Jolly1,2*

1Department of Biology, Case Western Reserve University, Cleveland, Ohio, United States of America

2Center for Global Health and Diseases, Case Western Reserve University, Cleveland, Ohio, United States of America

*Corresponding author Email: [email protected] (ERJ)

As part of my thesis research, this chapter has been published in PLoS Neglected Tropical Diseases 2016 Sep 9;10(9):e0004986. doi: 10.1371/journal.pntd.0004986. eCollection 2016.

The numbering for the supporting information here differs from that in the published version. Digital object identifier (DOI) references are provided in section 3.8.

71

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

3.1 Abstract

Schistosomiasis is a debilitating disease that affects over 240 million people worldwide and is considered the most important neglected tropical disease following malaria.

Free-swimming freshwater cercariae, one of the six morphologically distinct schistosome life stages, infect humans by directly penetrating through the skin. Cercariae identify and seek the host by sensing chemicals released from human skin. When they reach the host, they burrow into the skin with the help of proteases and other contents released from their acetabular glands and transform into schistosomula, the subsequent larval worm stage upon skin penetration. Relative to host invasion, studies have primarily focused on the nature of the acetabular gland secretions, immune response of the host upon exposure to cercariae, and cercaria-schistosomulum transformation methods. However, the molecular signaling pathways involved from host-seeking through the decision to penetrate skin are not well understood. We recently observed that heat shock factor 1 (Hsf1) is localized to the acetabular glands of infectious schistosome cercariae, prompting us to investigate a potential role for heat shock proteins (HSPs) in cercarial invasion. In this study, we report that cercarial invasion behavior, similar to the behavior of cercariae exposed to human skin lipid, is regulated through an Hsp70-dependent process, which we show by using chemical agents that target Hsp70. The observation that biologically active protein activity modulators can elicit a direct and clear behavioral change in parasitic schistosome larvae is itself interesting and has not been previously observed. This finding suggests a novel role for Hsp70 to act as a switch in the cercaria-schistosomulum transformation, and it allows us to begin elucidating the pathways associated with

72

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

cercarial host invasion. In addition, because the Hsp70 protein and its structure/function

is highly conserved, the model that Hsp70 acts as a behavior transitional switch could be

relevant to other parasites that also undergo an invasion process and can apply more

broadly to other organisms during morphological transitions. Finally, it points to a new

function for HSPs in parasite/host interactions.

3.2 Author summary

Parasitic schistosome worms cause morbid disease in over 240 million individuals

worldwide. Acute infections with these worms can lead to Katayama fever, while chronic

infections can lead to portal hypertension, enlarged abdomen, and liver damage. The

infective larval stage, called cercariae, are free-swimming and can detect, seek, and

penetrate human skin to enter the human host circulatory system, eventually developing

into egg-laying adult worms that cause schistosomiasis. Molecular pathways associated with the initial cercarial invasion of the host, however, are largely unknown, especially with respect to the parasite-specific signals involved in host detection and subsequent decision to invade. Here, we describe a role for Hsp70 in cercarial invasion behavior. To date, only generic stimulation with skin lipid, linoleic acid or L-arginine are known to

induce cercarial invasion behavior; thus, we can begin an initial investigation of

molecular requirements for host invasion and environment transition for schistosomes

and possibly other parasitic organisms.

73

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

3.3 Introduction

Schistosome parasites have six different morphological stages during their life cycle, which requires an intermediate molluscan and a definitive mammalian host that the parasite must correctly identify and invade. Free-swimming, freshwater cercariae

(singular: cercaria) are released from infected molluscs and invade mammals and humans

for further development into larval worms called schistosomula (singular:

schistosomulum or schistosomule). Schistosomula adapt to survival in the host blood

environment, evade the immune system, develop a gut to begin digesting red blood cells,

elongate and traverse the human circulatory system, and eventually develop into

egg-laying adult worms [1].

Cercariae are highly adapted for swimming and invading their mammalian hosts.

Transcriptional studies show that cercariae have elevated expression of genes associated

with metabolism and motility when compared with other stages [2, 3]. Free-swimming

cercariae have a limited energy supply and a limited duration during which they can

infect their host [4]. Thus, they must correctly identify and quickly respond to an

appropriate host (or source of chemoattractant), swim toward it, and begin the host

penetration process. For the purposes of this report, we call this behavior cercarial honing

or simply, honing. Swimming cercariae respond to changes in light levels, to thermal

gradients, and to chemicals such as linoleic acid and L-arginine released from human skin

[5-9]. After reaching the skin, the cercariae crawl along the skin surface until they

identify a suitable location to penetrate. Parasite invasion through the skin involves the

74

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

physical motion of swimming into the skin, in coordination with release of their

acetabular gland contents, which include mucins to enhance the attachment to skin and

proteases to degrade skin molecules [10-12].

While the ultrastructure of cercariae has been described before and after entry into the

host [13-15], protein regulators of cercarial honing and invasion have not been studied,

with the exception of two reports [16, 17]. In 1991, Matsumura and others proposed that

protein kinase C and calcium metabolism are involved in proteolytic enzyme release from

cercariae acetabular glands [16]. Almost 25 years later, Ressurreição followed up on the

work by Matsumura and recently reported that PKC, ERK, and p38 MAPK

phosphorylation is involved in release of proteolytic enzymes from cercarial acetabular

glands following the observation that inhibition of PKC, ERK, and p38 MAPK activities

blocked linoleic acid-induced release of acetabular gland contents [17]. The current

report further explores the molecular requirements for cercarial host invasion. We identify

heat shock protein 70 (Hsp70) as a potential molecular component involved in cercarial

honing and show that inhibition of Hsp70 can bypass the requirement for linoleic acid,

L-arginine, or any host-derived signal to induce cercarial host targeting behavior.

Interestingly, numerous reports corroborate regulatory interplay between Hsp70, PKC,

ERK, and p38 MAPK activities [18-21].

Several studies led us to investigate the potential role for a heat shock pathway during

cercarial honing and invasion. First, the heat shock response has traditionally been

75

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

associated with cellular stress [22-24], and cercariae are no exception to this, since they

must transition from a cooler, low-saline and freshwater environment to the warmer,

saline environment of a human host. Second, we recently observed an unexpected

localization of heat shock factor 1 (Hsf1), the major transcriptional activator responsible

for transcribing heat shock genes (such as HSP70 and HSP90), to the acetabular glands of cercariae [25]. This observation helps corroborate the findings of another study that showed the presence of Hsp70 in released acetabular gland contents [26]. Third, the heat shock response may play a role in other stages of schistosome infection as well. In particular, an induced heat shock response in the schistosome intermediate host

Biomphalaria glabrata renders them susceptible to schistosome infection, while absence of a strong heat shock response leads to resistance [27]. Together, these studies suggest an important role for a heat shock pathway in parasitic schistosomes.

Hsp70, a member of the heat shock protein (HSP) superfamily, is structurally and evolutionarily conserved from prokaryotes to eukaryotes and generally functions as a chaperone protein that aids in (re)folding nascent and denatured proteins through interactions with its substrate domain and ATP hydrolysis (for review, [28]). However, additional roles for Hsp70 outside of its well-established chaperone functions have also been described. Together with various co-chaperones, Hsp70 can also direct signaling pathways that control cell death, differentiation, homeostasis, and proliferation by modulating the function of key regulatory proteins (client proteins) [29]. This is observed in the regulation of tumor necrosis factor receptor 1 (TNFR1) signaling [30]. Aggregation

76

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

of TNFR1 leads to cell death; however, TNFR1 aggregation is inhibited when TNFR1

interacts with silencer of death domain (SODD). Hsp70 is thought to bind to SODD,

modifying it to induce SODD/TNFR1 interaction, thereby inhibiting TNFR1-dependent

cell death [30]. Hsp70 also plays a role in modulating Smad-mediated transcription [31].

Smad proteins are essential transducers of the transforming growth factor superfamily.

Smad-mediated transcription is enhanced by the activity of the melanocyte specific gene

(Msg1) protein, a transcriptional activator that cannot independently bind DNA but does so indirectly through interaction with p300/CBP. Hsp70 forms a complex with Msg1, suppressing its interaction with p300/CBP, and consequently blocks Msg1 enhancement of Smad-mediated transcription [31]. As another example, in clathrin-mediated endocytosis, Hsp70 binds and holds clathrin triskelia, preventing their aggregation during the uncoating of clathrin-coated vesicles; in the other half of the clathrin cycle, Hsp70 releases the triskelia to allow the coating of new vesicles upon activation by some unknown signal(s) [32]. The role of Hsp70 in clathrin-mediated endocytosis resembles that which we propose here for cercarial honing, especially with respect to the

sequestering of important cellular components until Hsp70 receives an activating signal

to release its client protein. While identification of the mechanism for Hsp70 mediated

regulation for clathrin-mediated endocytosis is a topic of much interest [33-35], a similar

mechanism and question just as interesting may apply to the cercarial honing and

invasion process.

In this study, we treated cercariae with modulators of Hsp70 protein that inhibit or

77

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

activate Hsp70 via different mechanisms to explore whether Hsp70 functions in cercarial host invasion. Of interest, we found that 2-phenylethynesulfonamide (PES), also known

as pifithrin-µ, initiated the process of cercarial honing and invasion in the absence of any

host-specific stimulants such as skin lipids or linoleic acid, and it did so with 100%

effectivity, which is greater than that observed with either skin lipids or linoleic acid, albeit at a slower rate. PES specifically binds to Hsp70 (Kd ~ 2.9 µM), and its derivatives

do not interact with Grp75 or Grp78, organelle-specific members of the Hsp70 family [36,

37]. X-ray crystallographic analysis shows that PES interacts with residues L394, P398,

L401, G484, N505, and D506 in human Hsp70. We propose a model that Hsp70 is

involved in a signaling pathway that causes cercariae to begin host invasion maneuvers

and that inhibition of Hsp70 bypasses the need for upstream host signals that normally

initiate this process.

We have recorded and observed over 200 videos of cercarial mobility in response to small molecule modulators that target Hsp70, heat shock protein 90 (Hsp90), or apoptosis.

To our knowledge, this is the first investigation of a molecular signaling pathway in cercariae that points to a role for Hsp70 as a regulatory factor for the transition between parasite development stages. In addition to providing a potential pathway to which we can direct drug development against schistosomes, these data could apply more broadly to other parasites and to other organisms during transitions or periods of rapid development [38]. Finally, we add to the current model in describing cercarial host invasion.

78

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

3.4 Methods

3.4.1 Phylogenetic analysis of Hsp70

Protein sequences of Hsp70 from various species most closely related to that of

Schistosoma mansoni (NCBI accession numbers: CCD76164 (Smp_106930) and

CCD76236 (Smp_049550) were identified by the NCBI BLASTp function [39] and

aligned using ClustalW2 using its default parameters [40]. A phylogenetic tree was generated using the output of the ClustalW2 alignment and TreeView X software.

3.4.2 Animals and parasites

Biomphalaria glabrata snails infected with S. mansoni (NMRI strain) were obtained from

Biomedical Research Institute (BRI; Rockville, MD). Cercariae were collected from infected snails by light-induced shedding: the snails were kept in the dark overnight and then placed under bright light for 2 hours [41].

3.4.3 Parasite observation and treatments

Cercariae were observed in 12-well or 24-well culture plates (respectively about 1,000 or

500 cercariae per well) using an inverted (VanGuard 1493INi) and upright stereo

(Olympus SZ30) microscope fitted with a camera (Canon T5i). Videos were captured with the focus on the bottom of the wells at 40× and 10× magnification and a camera setting of 1280 by 720 at 60 fps. Images shown in figures are frames extracted from the videos.

79

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

Treatments of cercariae included the addition of the following substances; the treatment

concentrations were chosen based on those used in the studies indicated (typically

increased several-fold over those used in cell-based studies): human skin lipid (finger

swipe), linoleic acid (Sigma L1012) [42], Hsp70 modulators 2-phenylethynesulfonamide

(PES; Sigma P0122) [36], MKT-077 (Sigma M5449) [43], 115-7c (Stressmarq SIH-123)

[44], and VER-155008 (Sigma SML0271) [45], Hsp90 inhibitors geldanamycin and

17-dimethylaminoethylamino-17-demethoxygeldanamycin (17-DMAG; these Hsp90

inhibitors were a kind gift of Giselle Knudsen and Jonathan Choy from the Small

Molecule Discovery Center at UCSF) [46], pan-caspase inhibitor Z-VAD-FMK (Santa

Cruz Biotechnologies sc-3067) [47], anthelmintic praziquantel (Sigma P4668) [48], and

adenosine phosphates ATP (Sigma A1852), AMP-PNP (non-hydrolyzable ATP analog;

Sigma A2647), and ADP (Sigma A2754) [49, 50]. These substances were either vortexed

with a volume of water before treatment or added directly to water containing cercariae.

Cercariae were treated within 3 hours of collection, and the time points expressed in this

report refer to the time elapsed after the administration of a given treatment.

3.5 Results

3.5.1 Schistosome Hsp70 is highly conserved

We obtained a 637 amino acid protein sequence for S. mansoni Hsp70 from NCBI

(CCD76164) and used this sequence as a query (NCBI BLASTp) to identify homologous

Hsp70 proteins from different organisms. Using the available sequences (incomplete sequences were omitted), we performed an alignment using ClustalW2 to determine the

80

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

phylogenetic relationship among these proteins (S3.1 Figure). As expected, we found that

SmHsp70 proteins are highly conserved across organisms with greater than 50% identity

and that they cluster into different Hsp70 classes [51]. SmHsp70 (NCBI accession

CCD76164, 637 amino acids (aa)) clustered with the human Hsp70 (NCBI accession

NP_006588, 646 aa), which is constitutively expressed and recognized as the heat shock protein 70 cognate (Hsc70) protein. The second SmHsp70 protein (NCBI accession

CCD76236, 648 aa) represents a non-constitutive heat-inducible form of Hsp70, and it

clustered with HsHsp70 (NCBI accession AAI12964, 655 aa), also called heat shock

protein 70 family A (Hsp70) member 5, which is localized to the lumen of the

endoplasmic recticulum (ER) where it is thought to mediate protein trafficking of

ER-derived proteins, thereby regulating protein signaling [52].

3.5.2 Establishment of cercarial swimming in culture

Previously, we published the observation that SmHsf protein is localized to the acetabular

glands of schistosome cercariae [25]. SmHsf is a transcriptional activator of HSPs. While

we do not think that Hsf1 can directly regulate the actions of its transcriptional targets in

acetabular glands, we became interested in the idea that Hsf1 or HSPs may be involved in

the transition between cercariae and schistosomula, either for cercarial invasion or for

newly transformed schistosomula.

We began by experimentally repeating observations of cercarial responses to human skin

lipid that have been well established since the 1970s [26, 53]. Our descriptions of

81

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

cercariae are based on observations from inverted and upright microscopes. However,

because cercariae continuously moved vertically in our 1 mL water samples, a consistent

location to image between samples was not possible. Thus, images described here focus

on the bottom of the culture wells, with approximately 1,000 cercariae per well for a

12-well culture plate or 500 cercariae per well for a 24-well culture plate. When observing cercariae by microscopy in a culture well, the relatively large depth of the water column and the nature of standard microscopes precludes a meaningful side-view visualization. Swimming cercariae, in wait of a host, are distributed vertically in a water column with few touching the bottom surface of a culture well. Thus, most cercariae will not be seen at the bottom of a culture well from this viewpoint. In contrast, when the cercariae have settled in response to a stimulus, many more cercariae can be observed at the bottom of a culture well (Figure 3.1). The apparent lack of cercariae in some of the

images described later is not caused by a discrepancy in the number of cercariae added,

but rather by their specific distribution (vertical and horizontal) in the water column.

82

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

Figure 3.1. Visual illustration of cercariae swimming. During active swimming, most cercariae are found in the water column, while almost no cercariae can be seen at the bottom of the culture well. As cercariae hone, more of them can be seen at the bottom of the well when observed at higher magnification.

Since many drugs are often diluted or dissolved in DMSO, we established a baseline for

cercarial DMSO tolerance, relative to what we observed in water. We compared cercariae

treated with filtered water, 0.5% DMSO, and 1% DMSO. Cercariae treated with water

and 0.5% DMSO were distributed in a similar manner and exhibited a similar swim

(up)-sink-swim behavior at both 10 minutes and 2 hours (S3.2 Video).

3.5.3 Treatment of cercariae with human skin lipid, linoleic acid, and PES

Given the potential connection for a heat shock response during the

cercaria-schistosomulum transformation and that Hsp70 is widely conserved, we

compared the effect of treating cercariae with human skin lipid, linoleic acid, and PES

(Figure 3.2; S3.3 Video). PES has been shown to prevent Hsp70 from interacting with

several Hsp70 client proteins [36]. Experimentally, cercariae respond to a skin lipid

smear on the bottom of a petri dish by settling to the bottom of the petri dish and

83

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion beginning the penetration process [26]. Our observations confirmed this. However, only cercariae located in close proximity to the skin lipid smear seemed to gather at the site where skin lipid was placed; the majority of the cercariae settled to the bottom of the well without regard for the location of the lipid smear. It should be noted that when cercariae were exposed to human skin lipid or linoleic acid (mixed into water and added to cercariae), the cercarial honing response occurred within minutes. We also note that not all cercariae in our 1 mL sample responded to the skin lipid stimulus, as some cercariae could be seen swimming higher in the water column, out of the focal plane (S3.3 Video); this may correlate with the 60-70% cercarial response previously described in response to human lipids or L-arginine [9].

Figure 3.2. Cercariae treated with PES hone and transform more completely than those treated with skin lipid. Cercariae were treated with filtered water (A-C), 0.5% DMSO (D-F), human skin lipid (G-I), or 250 µM PES (J-L), and observed at various time points. The treatments and observation timings are as follows: (A) water, 8 minutes; (B) water, 56 minutes; (C) water, 1 hour 45 minutes; (D) DMSO, 9 minutes; (E) DMSO, 57 minutes; (F) DMSO, 1 hour 46 minutes; (G) lipid, 0 minutes; (H) lipid, 9 minutes; (I) lipid, 1 hour; (J) PES, 3 minutes; (K) PES, 51 minutes; (L) PES, 1 hour 42 minutes. Each treatment used about 1,000 cercariae in a volume of 1 mL in a 12-well plate well (40× view).

84

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

We next tested the effect of PES, a selective inhibitor of Hsp70. When cercariae were exposed to PES, they initially behaved similarly to the 0.5% DMSO control treatment, whereas the cercariae exposed to skin lipid responded immediately and started settling to the bottom of the well and swimming into or crawling along the surface (Figure 3.2D, G,

J; S3.3 Video). However, we were surprised by the result just minutes later. After 5-10 minutes, PES (250 µM)-treated cercariae began to swim to the bottom of the culture plate well, eventually losing their tails to transform into schistosomula (Figure 3.2J, K, L). We observed the same effect with a lower treatment concentration (50 µM) of PES but at a later time point (S3.5 Video). While the majority of the cercariae treated with human skin lipid or linoleic acid honed downward, we observed that 100% of the PES-treated cercariae settled to the bottom of the well and began the penetration behavior (S3.3

Video). When we co-treated cercariae with PES and skin lipid, the cercariae responded

with an effect similar to that of PES alone: all of the cercariae were present at the bottom

of the well (S3.4 Video).

We observed that after exposure to skin lipid (9 minutes) or PES (51 minutes), the

cercariae formed clusters (Figure 3.2H, K); this effect was not seen in the 0.5% DMSO

control treatment (57 minutes, Figure 3.2E; S3.3 Video). Cercariae under PES treatment

had not yet formed these clusters at 20 minutes (S3.5 Video). A majority of the cercariae

lost their tails by 1-3 hours in the PES treatment and 1 hour in the skin lipid treatment

(Figure 3.2L, I; S3.3, S3.5 Video); again, this effect was not seen in the 0.5% DMSO control treatment (1 hour 56 minutes, Figure 3.2F; S3.5 Video). Within 3 hours, both PES

85

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

and skin lipid-treated cercariae transformed into schistosomula. For PES-treated cercariae,

it should be noted that this honing and transformation occurred in the absence of any host

signaling molecules.

Transformation involves several events, notably the loss of tails and loss of water tolerance. The flat appearance of the heads of the cercariae in the skin lipid- and linoleic acid-treated sample at 2 hours indicates the loss of water tolerance and lysis, and further progression in the transformation to the schistosomulum stage, as compared with the corresponding PES-treated sample, in which the heads have a round appearance and are motile (S3.3 Video). We should also note that the timing for all events seemed to vary somewhat, albeit consistently between cercarial sheds. For example, in one cercarial shed, honing with skin lipids may begin within a minute, in another 3 minutes.

3.5.4 Treatment of cercariae with other Hsp70 modulators

To further determine whether the effect of PES is specific to Hsp70, we treated cercariae with several different Hsp70 modulators, including MKT-077, 115-7c, and VER-155008.

MKT-077 functions as an allosteric inhibitor of Hsp70, binding within the nucleotide binding domain of Hsp70 next to its ATP/ADP binding pocket and inhibiting ATP turnover rate. MKT-077 is a rhodacyanine dye originally identified as an anti-tumor agent, and it has been shown to bind mortalin, an Hsp70 family member, and disrupt its interaction with p53 [43]. However, we found no obvious change in behavior of the cercariae in our MKT-077 treatments at 100, 250, or 500 µM concentrations (Figure

86

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

3.3D), with the exception of increased death at 22 hours (S3.6 Video). Note that the mechanism of action of MKT-077 differs from that of PES, which binds to the Hsp70 substrate binding domain and competitively blocks protein-protein interactions of Hsp70 and its client proteins.

Figure 3.3. Cercariae treated with other Hsp70 inhibitors do not hone. Cercariae were treated with filtered water (A), 1% DMSO (B), 250 µM PES (C), 500 µM MKT-077 (D), 400 µM 115-7c (E), or 100 µM VER-155008 (F); observed at 2 hours. Each treatment used about 1,000 cercariae in a volume of 1 mL in a 12-well plate well (10× view).

While most pharmacological agents target and inhibit the function of proteins, 115-7c has the unusual property of acting as an activator of Hsp70 protein folding function, leading to an enhanced rate of substrate refolding [44]. It binds to Hsp70 and promotes complex formation between Hsp70 and Hsp40. In our treatments of cercariae with 115-7c, we observed the induction of honing behavior by 2 hours, especially in the 400 µM treatment

(Figure 3.3E); by 22 hours, a majority of the cercariae had lost their tails (S3.7 Video).

VER-155008 at the concentration used (100 µM) is insoluble in water, and it did not change the behavior of the cercariae (Figure 3.3F; S3.8 Video). While there are numerous

87

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion inhibitors of Hsp70, most utilize a similar mechanism of action. For example, all of the following Hsp70 modulators inhibit Hsp70 nucleotide binding activity or ATPase activity: apoptozole, JG-98, methylene blue, MKT-077, VER-155008, YM-01, and

YM-08 (stressmarq.com).

3.5.5 Treatment of cercariae with Hsp90 inhibitors

Since Hsp70 can work with other HSPs as a major effector of the heat shock response pathway, we asked whether another highly conserved HSP, Hsp90, could be involved. We treated cercariae with the Hsp90 inhibitors geldanamycin and 17-DMAG, a water-soluble derivative of geldanamycin. However, treatment with these compounds did not produce a change in cercarial behavior; the cercariae resembled those treated with 1% DMSO

(Figure 3.4; S3.9 Video).

88

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

Figure 3.4. Cercariae treated with Hsp90 inhibitors do not hone. Cercariae were treated with 1% DMSO (A), 250 µM PES (B), 100 µM geldanamycin (C), or 50 µM 17-DMAG (D); observed at 2 hours. Each treatment used about 1,000 cercariae in a volume of 1 mL in a 12-well plate well (10× view).

3.5.6 Treatment of cercariae with other compounds

Although PES is a potent inhibitor of Hsp70, it was initially described in a screen to identify molecules that block p53-dependent transcriptional activation and apoptosis [54,

55]. PES can also block cisplatin-induced p53 interaction with mitochondrial Bak, a pro-apoptotic molecule responsible for the permeabilization of the mitochondrial membrane, and which thereby blocks p53-dependent activation of apoptosis-associated caspases 8 and 3 [56]. However, it is thought that PES inhibition of p53 acts by inhibition of Hsp70, as PES does not directly interact with p53, BAK, BCL-xL, Grp78, Hsc70, or

Hsp90 [36]. The molecular targets or mechanism for p53 regulation of apoptosis is unclear. To determine whether the apoptosis pathway is involved in the honing behavior of cercariae, we blocked caspase activity by treating cercariae with a pan-caspase

89

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion inhibitor, Z-VAD-FMK. When cercariae were treated with Z-VAD-FMK, we found no change in cercarial honing behavior. Co-treatment with Z-VAD-FMK and PES resulted in a honing behavior similar to that of PES treatment alone (S3.10 Video).

As an additional treatment, we included praziquantel, the long-standing drug treatment for human schistosome infection. The efficacy of praziquantel treatment depends on the parasite stage for schistosomes; notably, while it can kill cercaria and adult stage schistosomes, it cannot kill the intermediate schistosomulum stage schistosomes [48, 57].

Our treatment of cercariae with 300 nM praziquantel resulted in settling, similar to honing behavior; however, at 24 hours, we observed that while most of the cercariae had died, very few had lost their tails, in contrast to the PES treatment, which resulted in tail loss (in addition to death) for nearly all of the cercariae (S3.11 Video).

Functional roles for Hsp70 in the regulation of signal transduction through the binding of client proteins have been recently described and correlate with its intrinsic ATPase activity [29]. When Hsp70 is in an ADP bound state (Hsp70*ADP), Hsp70 interacts with its client protein stably and the Hsp70 lid is in a “closed” state, preventing release of the client protein. When in the ATP bound state (Hsp70*ATP), the Hsp70 lid is opened, allowing the release of the client protein and increasing the on/off rate at the substrate interaction domain [58]. We propose in the regulation of cercarial honing that Hsp70 binds a client protein and functionally inhibits the client protein’s ability to initiate cercarial honing (Figure 3.5). In accordance with this, if Hsp70 is critical to honing, then

90

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion we predict that increasing the ATP concentration should cause the Hsp70 lid to open, leading to the release of the client protein and consequentially result in cercarial honing

(Figure 3.5). To test this, we treated cercariae with ATP, AMP-PNP (a non-hydrolyzable

ATP analog), and ADP, each at a concentration of 5 mM (intracellular ATP concentration in mammalian cells has been suspected to occur in the millimolar range [59]). While ATP and ADP treatments at this concentration did not show any difference compared to the water alone control treatment, AMP-PNP induced honing behavior within 2 hours 30 minutes (Figure 3.6; S3.12 Video).

91

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

Figure 3.5. Predictive model of a role for Hsp70 in cercarial honing. (A) In the absence of strong host signals, Hsp70 binds tightly to its client protein, HHF, inhibiting its activity. (B) Host signals are transmitted through a cercarial signal transduction pathway, releasing Hsp70 inhibition of HHF, which functions in cercarial honing. (C) The inhibitor PES blocks Hsp70 activity by binding to the Hsp70 substrate binding domain and releasing Hsp70 inhibition of HHF, resulting in cercarial honing. (D) Addition of 10 mM ATP leads to release of HHF, possibly by binding to the Hsp70 ATPase domain and reducing its affinity for HHF, resulting in cercarial honing. (E) Addition of a non-hydrolyzable form of ATP leads to release of HHF, possibly by preventing ATP hydrolysis and maintaining the weak affinity state of Hsp70 for binding client proteins, resulting in cercarial honing.

92

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

Figure 3.6. Cercariae treated with ATP, AMP-PNP, and ADP. Cercariae were treated with filtered water (A), 5 mM ATP (B), 5 mM AMP-PNP (C), or 5 mM ADP (D), and observed 2 hours 30 minutes after treatment. Each treatment used about 500 cercariae in a volume of 0.5 mL in a 24-well plate well (40× view).

3.6 Discussion

Understanding the requirements for schistosome infection at the parasite-host interface

can expedite the identification of novel targets for prevention of infection or the

elimination of newly established infections. This has been observed using a topical skin

treatment with inhibitors of the schistosome proteases used by the larval cercarial form,

during invasion [60, 61]. The process by which cercariae invade a mammalian host has

been well described, but molecular requirements regulating this process are unknown. We

present evidence that Hsp70 is involved in the process of cercarial honing and plays a

role in a signal transduction pathway to regulate cercarial invasion behavior. Cercariae

are released from their molluscan host and have less than 24 hours to find a mammalian

93

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

host before depletion of their glycogen stores in their tail and body prevents their ability

to penetrate host skin [4]. In search of a host, cercariae are distributed in the water

column with minimal up and down motion, presumably lying in wait in what might be

described as a “still hunting” mode. Cercariae swim randomly in response to water

turbulence, light and shadows, and it is thought that they swim toward their host through

gradients of body heat and skin chemicals, including linoleic acid, human skin lipid, and

L-arginine, with the latter two being the most directionally significant [8, 12, 62]. This

chemotactic process is modeled by placing cercariae in water and exposing them to a surface streaked with skin lipid as stimulus. We observed limited chemotaxis in our treatments of cercariae with skin lipid, such that only the cercariae in close proximity to

the site where the skin lipid was placed made contact with the lipid. This suggests that

cercariae do not swim toward the host over long distances, but lie in wait for a host that

comes into close proximity and swim more actively to increase the chance of making contact with the host.

Pharmacological targeting is one way to dissect the molecular pathways that may be involved in cercarial honing. Here, we used a selection of chemical compounds to query a role for Hsp70, Hsp90, and apoptosis in this honing behavior. Based on our observations, we propose that a heat shock pathway is specifically involved in cercarial honing for host invasion. HSPs have been identified in cercarial gland secretions [26, 63] and are among the highest abundance transcripts identified in newly transformed schistosomula [3]. In fact, HSPs have been correlated with cercarial transformation since the late 1980s [64].

94

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

However, the role of HSPs has traditionally been connected with the stress response (for review, [22-24]), correlating with the transition from cercaria to schistosomulum, which involves a temperature change from that of ambient water to 37ºC host body temperature.

Recent evidence in other systems has suggested that HSPs have more diverse functions outside of stress response, including roles in oogenesis and development, lifespan extension, regulation of cancer, fertility and viability [65-71]. In the schistosome molluscan host B. glabrata, the snail heat shock response is necessary for snail susceptibility to infection, such that a reduced heat shock response in the snail results in resistance to schistosome infection [27]; this suggests an important function in host HSP level for schistosome host invasion.

Our observation that cercariae treated with PES undergo a behavioral change is novel, and it allows for the initial identification of molecular components involved in cercarial honing. Honing occurs in response to skin lipid [72]; however, since cercariae treated with the Hsp70 inhibitor PES show a similar behavior to cercariae treated with skin lipid, we predicted that Hsp70 plays a regulatory role in the signaling required for the honing behavior. Honing induced by PES is concentration-dependent with time, such that lower concentrations require more time for induction to occur (S3.5 Video). Our treatment of cercariae with two other Hsp70 modulators, MKT-077 and 115-7c, resulted in different behaviors. MKT-077 treatment resulted in a lack of honing, similar to the water control treatment, while treatment with the Hsp70 activator 115-7c resulted in honing behavior, similar to the PES treatment. We propose that while all three Hsp70 modulators tested in

95

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

this study bind to Hsp70, only PES and 115-7c actively promote the release of its client

protein, which can then function to initiate cercarial honing.

Treatment with ATP and its non-hydrolyzable analog, AMP-PNP, could also cause Hsp70

to release its client protein by skewing the Hsp70*ATP/ADP binding state distribution

toward Hsp70*ATP (the state at which Hsp70 has low affinity for client proteins).

Specifically, we model that in the uninduced honing state (absence of lipid stimulus),

Hsp70 interacts with and negatively regulates or inhibits the function of an Hsp70 client protein, which we call Hsp70 Honing Factor (HHF). Upon upstream signal activation by skin lipid, Hsp70 releases HHF, which allows the activation of further signaling to trigger

the honing behavior (Figure 3.5). This model is not in disagreement with current models

describing a function for Hsp70 signaling [29].

A signaling pathway required to induce cercarial honing implies that many potential

signaling factors could be involved, beginning from the receptor(s) that senses skin lipid,

potential kinases or phosphatases, through Hsp70, HHF and its targets. We reasoned that

other HSPs, such as Hsp90, could be involved, as Hsp90 is reported to interact with client

proteins in signaling as well [73]. However, in our treatment of cercariae with Hsp90

inhibitors geldanamycin and 17-DMAG, a geldanamycin derivative, we did not observe

any obvious change in the behavior of the cercariae. Next, we considered the potential

involvement of apoptosis in honing induction. PES can block cisplatin-induced p53

activation of apoptosis [36]. Our treatment with the apoptosis inhibitor Z-VAD-FMK also

96

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

did not result in any obvious change in the behavior of the cercariae. Interestingly, praziquantel treatment led to honing behavior similar to that resulting from PES treatment; however, at 24 hours, most of the cercariae had not lost their tails, indicating

that transformation did not occur. In contrast, tail loss occurred for the skin lipid, linoleic

acid, PES, and 115-7c treatments by 24 hours (S3.3 Video). This observation leads us to

speculate that cercarial honing involves specific signaling to cause the loss of tails

(transformation) in addition to a change in the swimming pattern (settling).

Further effort will be necessary to identify the signaling components involved in cercarial

honing, including the proposed Hsp70 client protein, HHF, and to better understand the

relatively recently described role of Hsp70 in signaling [29]. Under ideal circumstances,

genetics approaches such as gene knock-downs and knock-outs would be appropriate to identify honing components. However, these tools have not been thoroughly developed for use in developing or mature cercariae. Our group and others are working on developing methods to overcome these technical challenges [74-79]. Analysis in cercariae is challenging, as cercariae are short lived, transient, and the necessary proteins

for swimming and host invasion have already been produced prior to exit from the snail

host. Genetic manipulations of early developing cercariae within sporocysts may be

possible, but in the case of Hsp70 and potentially other proteins, knock-down or

knock-out could result in the loss of viability or production, not because of protein

targeting problems, but because of the multipurpose nature of this particular protein.

HSPs are the most abundant proteins expressed in the schistosome egg and miracidium

97

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

[80]. However, a reduction of the hest shock response in the intermediate snail host, B.

glabrata, makes the snail resistant to schistosome infection [27], suggesting a critical role

for the heat shock pathway for intermediate host susceptibility. Consequently, it would

not be a far stretch to speculate whether inhibition of miracidial HSPs could affect

invasion of the snail host.

In this study, we have just pierced the surface and glimpsed at molecular components that

contribute to cercarial honing. We have found no similar observation where Hsp70

signaling affects a whole organism and its behavior directly, leading to stimulating

questions such as: how does signaling quickly and directly regulate cercarial behavior, and are there other organisms that are similarly regulated? Additionally, schistosomiasis affects nearly 240 million people globally. Understanding the molecular requirements for cercarial honing and invasion, as well as those for early schistosomulum survival, could

identify new potential drug targets and transition schistosome control from treatment to

prevention.

3.7 Acknowledgments

Animals and parasites were provided to ERJ by BRI via the NIAID Schistosomiasis

resource center under NIH-NIAID contract HHSN27220100000051: Schistosoma

mansoni, strain NMRI-exposed Biomphalaria glabata, strain NMRI, NR-21962. We also thank Giselle Knudsen for review of the manuscript, helpful discussions, and contribution of reagents, and Melissa Varrecchia for review of the manuscript.

98

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

3.8 Supporting information

S3.1 Figure. Phylogenetic tree of Hsp70. Peptide sequences of Hsp70 closely homologous to those of S. mansoni (NCBI accession CCD76164, labeled S. mansoni 637 aa; and CCD76236, labeled S. mansoni 648 aa) were chosen from several species (A. thaliana 651 aa, NP_195870; C. elegans 640 aa, NP_503068; D. melanogaster 641 aa, NP_524063; D. rerio 643 aa, AAH56709; D. rerio 650 aa, AAH63946; E. coli 638 aa, WP_000516131; H. sapiens 646 aa, NP_006588; H. sapiens 655 aa, AAI12964; M. musculus 646 aa, BAE30272; M. musculus 655 aa, AAH50927; S. cerevisiae 649 aa, NP_009478; S. haematobium 648 aa, KGB42118; S. japonicum 648 aa, AAC00519; X. laevis 650 aa, NP_001080068; X. laevis 655 aa, NP_001080064) and aligned using ClustalW2. The phylogenetic output was used to generate the tree using TreeView X software. doi:10.1371/journal.pntd.0004986.s001 (S1 Figure in published version).

99

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

S3.2 Video. Cercariae treated with filtered water or DMSO (0.5, 1%) at approximately 10 minutes and 2 hours (40× view). doi:10.1371/journal.pntd.0004986.s002 (S2 Video in published version).

S3.3 Video. Cercariae treated with 0.5% DMSO, human skin lipid, 0.1% linoleic acid, or 250 µM PES at approximately 10 minutes and 1 hour (40× view). doi:10.1371/journal.pntd.0004986.s003 (S3 Video in published version).

S3.4 Video. Cercariae treated with filtered water, human skin lipid, skin lipid / 250 µM PES, or 250 µM PES at approximately 10 minutes and 1 hour (40× view). doi:10.1371/journal.pntd.0004986.s004 (S4 Video in published version).

S3.5 Video. Cercariae treated with 0.5% DMSO or PES (50, 150, 250 µM) at approximately 2 minutes, 10 minutes, 20 minutes, 1 hour, 2 hours, 3 hours, 4 hours, and 22 hours (10× view). doi:10.1371/journal.pntd.0004986.s005 (S5 Video in published version).

S3.6 Video. Cercariae treated with filtered water or MKT-077 (50, 250, 500 µM) at approximately 2 minutes, 10 minutes, 20 minutes, 1 hour, 2 hours, 3 hours, 4 hours, and 22 hours (10× view). doi:10.1371/journal.pntd.0004986.s006 (S6 Video in published version).

S3.7 Video. Cercariae treated with 1% DMSO or 115-7c (100, 200, 400 µM) at approximately 2 minutes, 10 minutes, 20 minutes, 1 hour, 2 hours, 3 hours, 4 hours, and 22 hours (10× view). doi:10.1371/journal.pntd.0004986.s007 (S7 Video in published version).

S3.8 Video. Cercariae treated with filtered water, 0.1% DMSO, or 100 µM VER-155008 at approximately 10 minutes, 30 minutes, and 1 hour (10× view). doi:10.1371/journal.pntd.0004986.s008 (S8 Video in published version).

S3.9 Video. Cercariae treated with filtered water, 1% DMSO, human skin lipid, 0.1% linoleic acid, 100 µM geldanamycin, 50 µM 17-DMAG, 250 µM PES, 500 µM MKT-077, or 400 µM 115-7c at approximately 20 minutes, 40 minutes, 1 hour, 2 hours, 3 hours, 4 hours, and 24 hours (10× view). doi:10.1371/journal.pntd.0004986.s009 (S9 Video in published version).

S3.10 Video. Cercariae treated with 1% DMSO, 25 µM Z-VAD-FMK, 25 µM Z-VAD-FMK / 250 µM PES, or 250 µM PES at approximately 10 minutes, 30 minutes, and 2 hours (40× view). doi:10.1371/journal.pntd.0004986.s010 (S10 Video in published version).

S3.11 Video. Cercariae treated with filtered water, 0.1% ethanol, 300 nM praziquantel, or 250 µM PES at approximately 10 minutes, 4 hours, and 24 hours (10× view). doi:10.1371/journal.pntd.0004986.s011 (S11 Video in published version).

100

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

S3.12 Video. Cercariae treated with filtered water, 5 mM ATP, 5 mM AMP-PNP, or 5 mM ADP at approximately 6 minutes, 32 minutes, 1 hour 2 minutes, and 2 hours 32 minutes (40× view). doi:10.1371/journal.pntd.0004986.s012 (S12 Video in published version).

3.9 References

1. Basch PF. Schistosomes : development, reproduction, and host relations. New York: Oxford University Press; 1991. vii, 248 p. p. 2. Jolly ER, Chin CS, Miller S, Bahgat MM, Lim KC, DeRisi J, et al. Gene expression patterns during adaptation of a helminth parasite to different environmental niches. Genome biology. 2007;8(4):R65. doi: 10.1186/gb-2007-8-4-r65. PubMed PMID: 17456242; PubMed Central PMCID: PMC1896014. 3. Protasio AV, Tsai IJ, Babbage A, Nichol S, Hunt M, Aslett MA, et al. A systematically improved high quality genome and transcriptome of the human blood fluke Schistosoma mansoni. PLoS neglected tropical diseases. 2012;6(1):e1455. doi: 10.1371/journal.pntd.0001455. PubMed PMID: 22253936; PubMed Central PMCID: PMC3254664. 4. Whitfield PJ, Bartlett A, Khammo N, Clothier RH. Age-dependent survival and infectivity of Schistosoma mansoni cercariae. Parasitology. 2003;127(Pt 1):29-35. PubMed PMID: 12885186. 5. Brachs S, Haas W. Swimming behaviour of Schistosoma mansoni cercariae: responses to irradiance changes and skin attractants. Parasitology research. 2008;102(4):685-90. doi: 10.1007/s00436-007-0812-4. PubMed PMID: 18157546. 6. Haas W, Grabe K, Geis C, Pach T, Stoll K, Fuchs M, et al. Recognition and invasion of human skin by Schistosoma mansoni cercariae: the key-role of L-arginine. Parasitology. 2002;124(Pt 2):153-67. PubMed PMID: 11860033. 7. Haas W, Schmitt R. Characterization of chemical stimuli for the penetration of Schistosoma mansoni cercariae. I. Effective substances, host specificity. Zeitschrift fur Parasitenkunde. 1982;66(3):293-307. PubMed PMID: 7080610. 8. Haeberlein S, Haas W. Chemical attractants of human skin for swimming Schistosoma mansoni cercariae. Parasitology research. 2008;102(4):657-62. doi: 10.1007/s00436-007-0807-1. PubMed PMID: 18157547. 9. Granzer M, Haas W. The chemical stimuli of human skin surface for the attachment response of Schistosoma mansoni cercariae. International journal for parasitology. 1986;16(6):575-9. PubMed PMID: 3804568. 10. Fishelson Z, Amiri P, Friend DS, Marikovsky M, Petitt M, Newport G, et al. Schistosoma mansoni: cell-specific expression and secretion of a serine protease

101

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

during development of cercariae. Experimental parasitology. 1992;75(1):87-98. PubMed PMID: 1639166. 11. Stirewalt MA, Walters M. Schistosoma mansoni: histochemical analysis of the postacetabular gland secretion of cercariae. Experimental parasitology. 1973;33(1):56-72. PubMed PMID: 4348075. 12. McKerrow JH, Salter J. Invasion of skin by Schistosoma cercariae. Trends in parasitology. 2002;18(5):193-5. PubMed PMID: 11983589. 13. Cavalcanti MG, Araujo HR, Paiva MH, Silva GM, Barbosa CC, Silva LF, et al. Ultrastructural and cytochemical aspects of Schistosoma mansoni cercaria. Micron. 2009;40(3):394-400. doi: 10.1016/j.micron.2008.09.006. PubMed PMID: 19081261. 14. Dorsey CH, Cousin CE, Lewis FA, Stirewalt MA. Ultrastructure of the Schistosoma mansoni cercaria. Micron. 2002;33(3):279-323. PubMed PMID: 11742750. 15. Cousin CE, Stirewalt MA, Dorsey CH. Schistosoma mansoni: ultrastructure of early transformation of skin- and shear-pressure-derived schistosomules. Experimental parasitology. 1981;51(3):341-65. PubMed PMID: 7227486. 16. Matsumura K, Mitsui Y, Sato K, Sakamoto M, Aoki Y. Schistosoma mansoni: possible involvement of protein kinase C in linoleic acid-induced proteolytic enzyme release from cercariae. Experimental parasitology. 1991;72(3):311-20. PubMed PMID: 2015870. 17. Ressurreicao M, Kirk RS, Rollinson D, Emery AM, Page NM, Walker AJ. Sensory Protein Kinase Signaling in Schistosoma mansoni Cercariae: Host Location and Invasion. The Journal of infectious diseases. 2015. doi: 10.1093/infdis/jiv464. PubMed PMID: 26401028. 18. Gong X, Luo T, Deng P, Liu Z, Xiu J, Shi H, et al. Stress-induced interaction between p38 MAPK and HSP70. Biochemical and biophysical research communications. 2012;425(2):357-62. doi: 10.1016/j.bbrc.2012.07.096. PubMed PMID: 22842575. 19. Taylor AR, Robinson MB, Gifondorwa DJ, Tytell M, Milligan CE. Regulation of heat shock protein 70 release in astrocytes: role of signaling kinases. Developmental neurobiology. 2007;67(13):1815-29. doi: 10.1002/dneu.20559. PubMed PMID: 17701989. 20. Banerjee Mustafi S, Chakraborty PK, Dey RS, Raha S. Heat stress upregulates chaperone heat shock protein 70 and antioxidant manganese superoxide dismutase through reactive oxygen species (ROS), p38MAPK, and Akt. Cell stress & chaperones. 2009;14(6):579-89. doi: 10.1007/s12192-009-0109-x. PubMed PMID: 19291423; PubMed Central PMCID: PMC2866949. 21. Coaxum SD, Griffin TM, Martin JL, Mestril R. Influence of PKC-alpha

102

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

overexpression on HSP70 and cardioprotection. American journal of physiology Heart and circulatory physiology. 2007;292(5):H2220-6. doi: 10.1152/ajpheart.01080.2006. PubMed PMID: 17208995. 22. Richter K, Haslbeck M, Buchner J. The heat shock response: life on the verge of death. Molecular cell. 2010;40(2):253-66. doi: 10.1016/j.molcel.2010.10.006. PubMed PMID: 20965420. 23. Schlesinger MJ. Heat shock proteins: the search for functions. The Journal of cell biology. 1986;103(2):321-5. PubMed PMID: 2426277; PubMed Central PMCID: PMC2113812. 24. Shamovsky I, Nudler E. New insights into the mechanism of heat shock response activation. Cellular and molecular life sciences : CMLS. 2008;65(6):855-61. doi: 10.1007/s00018-008-7458-y. PubMed PMID: 18239856. 25. Ishida K, Varrecchia M, Knudsen GM, Jolly ER. Immunolocalization of anti-hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator. PLoS neglected tropical diseases. 2014;8(7):e3051. doi: 10.1371/journal.pntd.0003051. PubMed PMID: 25078989; PubMed Central PMCID: PMC4117452. 26. Knudsen GM, Medzihradszky KF, Lim KC, Hansell E, McKerrow JH. Proteomic analysis of Schistosoma mansoni cercarial secretions. Molecular & cellular proteomics : MCP. 2005;4(12):1862-75. doi: 10.1074/mcp.M500097-MCP200. PubMed PMID: 16112986. 27. Ittiprasert W, Knight M. Reversing the resistance phenotype of the Biomphalaria glabrata snail host Schistosoma mansoni infection by temperature modulation. PLoS pathogens. 2012;8(4):e1002677. doi: 10.1371/journal.ppat.1002677. PubMed PMID: 22577362; PubMed Central PMCID: PMC3343117. 28. Mayer MP, Bukau B. Hsp70 chaperones: cellular functions and molecular mechanism. Cellular and molecular life sciences : CMLS. 2005;62(6):670-84. doi: 10.1007/s00018-004-4464-6. PubMed PMID: 15770419; PubMed Central PMCID: PMC2773841. 29. Liu T, Daniels CK, Cao S. Comprehensive review on the HSC70 functions, interactions with related molecules and involvement in clinical diseases and therapeutic potential. Pharmacology & therapeutics. 2012;136(3):354-74. doi: 10.1016/j.pharmthera.2012.08.014. PubMed PMID: 22960394. 30. Miki K, Eddy EM. Tumor necrosis factor receptor 1 is an ATPase regulated by silencer of death domain. Molecular and cellular biology. 2002;22(8):2536-43. PubMed PMID: 11909948; PubMed Central PMCID: PMC133739. 31. Yahata T, de Caestecker MP, Lechleider RJ, Andriole S, Roberts AB, Isselbacher KJ, et al. The MSG1 non-DNA-binding transactivator binds to the p300/CBP coactivators, enhancing their functional link to the Smad transcription factors. The Journal of biological chemistry. 2000;275(12):8825-34. PubMed PMID:

103

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

10722728. 32. Sousa R, Lafer EM. The role of molecular chaperones in clathrin mediated vesicular trafficking. Frontiers in molecular biosciences. 2015;2:26. doi: 10.3389/fmolb.2015.00026. PubMed PMID: 26042225; PubMed Central PMCID: PMC4436892. 33. Morgan JR, Jiang J, Oliphint PA, Jin S, Gimenez LE, Busch DJ, et al. A role for an Hsp70 nucleotide exchange factor in the regulation of synaptic vesicle endocytosis. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2013;33(18):8009-21. doi: 10.1523/JNEUROSCI.4505-12.2013. PubMed PMID: 23637191; PubMed Central PMCID: PMC3707978. 34. Rapoport I, Boll W, Yu A, Bocking T, Kirchhausen T. A motif in the clathrin heavy chain required for the Hsc70/auxilin uncoating reaction. Molecular biology of the cell. 2008;19(1):405-13. doi: 10.1091/mbc.E07-09-0870. PubMed PMID: 17978091; PubMed Central PMCID: PMC2174180. 35. Xing Y, Bocking T, Wolf M, Grigorieff N, Kirchhausen T, Harrison SC. Structure of clathrin coat with bound Hsc70 and auxilin: mechanism of Hsc70-facilitated disassembly. The EMBO journal. 2010;29(3):655-65. doi: 10.1038/emboj.2009.383. PubMed PMID: 20033059; PubMed Central PMCID: PMC2830701. 36. Leu JI, Pimkina J, Frank A, Murphy ME, George DL. A small molecule inhibitor of inducible heat shock protein 70. Molecular cell. 2009;36(1):15-27. doi: 10.1016/j.molcel.2009.09.023. PubMed PMID: 19818706; PubMed Central PMCID: PMC2771108. 37. Leu JI, Zhang P, Murphy ME, Marmorstein R, George DL. Structural basis for the inhibition of HSP70 and DnaK chaperones by small-molecule targeting of a C-terminal allosteric pocket. ACS chemical biology. 2014;9(11):2508-16. doi: 10.1021/cb500236y. PubMed PMID: 25148104; PubMed Central PMCID: PMC4241170. 38. Wiesgigl M, Clos J. Heat shock protein 90 homeostasis controls stage differentiation in Leishmania donovani. Molecular biology of the cell. 2001;12(11):3307-16. PubMed PMID: 11694568; PubMed Central PMCID: PMC60256. 39. Altschul SF, Wootton JC, Gertz EM, Agarwala R, Morgulis A, Schaffer AA, et al. Protein database searches using compositionally adjusted substitution matrices. The FEBS journal. 2005;272(20):5101-9. doi: 10.1111/j.1742-4658.2005.04945.x. PubMed PMID: 16218944; PubMed Central PMCID: PMC1343503. 40. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23(21):2947-8. doi: 10.1093/bioinformatics/btm404. PubMed PMID: 17846036. 41. Milligan JN, Jolly ER. Cercarial transformation and in vitro cultivation of

104

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

Schistosoma mansoni schistosomules. Journal of visualized experiments : JoVE. 2011;(54). doi: 10.3791/3191. PubMed PMID: 21876520; PubMed Central PMCID: PMC3217644. 42. Salafsky B, Fusco AC, Whitley K, Nowicki D, Ellenberger B. Schistosoma mansoni: analysis of cercarial transformation methods. Experimental parasitology. 1988;67(1):116-27. PubMed PMID: 2458958. 43. Wadhwa R, Sugihara T, Yoshida A, Nomura H, Reddel RR, Simpson R, et al. Selective toxicity of MKT-077 to cancer cells is mediated by its binding to the hsp70 family protein mot-2 and reactivation of p53 function. Cancer research. 2000;60(24):6818-21. PubMed PMID: 11156371. 44. Wisen S, Bertelsen EB, Thompson AD, Patury S, Ung P, Chang L, et al. Binding of a small molecule at a protein-protein interface regulates the chaperone activity of hsp70-hsp40. ACS chemical biology. 2010;5(6):611-22. doi: 10.1021/cb1000422. PubMed PMID: 20481474; PubMed Central PMCID: PMC2950966. 45. Massey AJ, Williamson DS, Browne H, Murray JB, Dokurno P, Shaw T, et al. A novel, small molecule inhibitor of Hsc70/Hsp70 potentiates Hsp90 inhibitor induced apoptosis in HCT116 colon carcinoma cells. Cancer chemotherapy and pharmacology. 2010;66(3):535-45. doi: 10.1007/s00280-009-1194-3. PubMed PMID: 20012863. 46. Schwock J, Pham NA, Cao MP, Hedley DW. Efficacy of Hsp90 inhibition for induction of apoptosis and inhibition of growth in cervical carcinoma cells in vitro and in vivo. Cancer chemotherapy and pharmacology. 2008;61(4):669-81. doi: 10.1007/s00280-007-0522-8. PubMed PMID: 17579866. 47. Han H, Peng J, Gobert GN, Hong Y, Zhang M, Han Y, et al. Apoptosis phenomenon in the schistosomulum and adult worm life cycle stages of Schistosoma japonicum. Parasitology international. 2013;62(2):100-8. doi: 10.1016/j.parint.2012.09.008. PubMed PMID: 23159324. 48. Andrews P. Effect of praziquantel on the free living stages of Schistosoma mansoni. Zeitschrift fur Parasitenkunde. 1978;56(1):99-106. PubMed PMID: 706553. 49. Abravaya K, Myers MP, Murphy SP, Morimoto RI. The human heat shock protein hsp70 interacts with HSF, the transcription factor that regulates heat shock gene expression. Genes & development. 1992;6(7):1153-64. PubMed PMID: 1628823. 50. Azem A, Oppliger W, Lustig A, Jeno P, Feifel B, Schatz G, et al. The mitochondrial hsp70 chaperone system. Effect of adenine nucleotides, peptide substrate, and mGrpE on the oligomeric state of mhsp70. The Journal of biological chemistry. 1997;272(33):20901-6. PubMed PMID: 9252417. 51. Gupta RS, Singh B. Phylogenetic analysis of 70 kD heat shock protein sequences suggests a chimeric origin for the eukaryotic cell nucleus. Current biology : CB.

105

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

1994;4(12):1104-14. PubMed PMID: 7704574. 52. Shen J, Prywes R. ER stress signaling by regulated proteolysis of ATF6. Methods. 2005;35(4):382-9. doi: 10.1016/j.ymeth.2004.10.011. PubMed PMID: 15804611. 53. Shiff CJ, Cmelik SH, Ley HE, Kriel RL. The influence of human skin lipids on the cercarial penetration responses of Schistosoma haematobium and Schistosoma mansoni. The Journal of parasitology. 1972;58(3):476-80. PubMed PMID: 5042054. 54. Komarov PG, Komarova EA, Kondratov RV, Christov-Tselkov K, Coon JS, Chernov MV, et al. A chemical inhibitor of p53 that protects mice from the side effects of cancer therapy. Science. 1999;285(5434):1733-7. PubMed PMID: 10481009. 55. Strom E, Sathe S, Komarov PG, Chernova OB, Pavlovska I, Shyshynova I, et al. Small-molecule inhibitor of p53 binding to mitochondria protects mice from gamma radiation. Nature chemical biology. 2006;2(9):474-9. doi: 10.1038/nchembio809. PubMed PMID: 16862141. 56. Leu JI, George DL. Hepatic IGFBP1 is a prosurvival factor that binds to BAK, protects the liver from apoptosis, and antagonizes the proapoptotic actions of p53 at mitochondria. Genes & development. 2007;21(23):3095-109. doi: 10.1101/gad.1567107. PubMed PMID: 18056423; PubMed Central PMCID: PMC2081976. 57. Wu W, Wang W, Huang YX. New insight into praziquantel against various developmental stages of schistosomes. Parasitology research. 2011;109(6):1501-7. doi: 10.1007/s00436-011-2670-3. PubMed PMID: 21984370. 58. Schlecht R, Erbse AH, Bukau B, Mayer MP. Mechanics of Hsp70 chaperones enables differential interaction with client proteins. Nature structural & molecular biology. 2011;18(3):345-51. doi: 10.1038/nsmb.2006. PubMed PMID: 21278757. 59. Gribble FM, Loussouarn G, Tucker SJ, Zhao C, Nichols CG, Ashcroft FM. A novel method for measurement of submembrane ATP concentration. The Journal of biological chemistry. 2000;275(39):30046-9. doi: 10.1074/jbc.M001010200. PubMed PMID: 10866996. 60. Cohen FE, Gregoret LM, Amiri P, Aldape K, Railey J, McKerrow JH. Arresting tissue invasion of a parasite by protease inhibitors chosen with the aid of computer modeling. Biochemistry. 1991;30(47):11221-9. PubMed PMID: 1958659. 61. Lim KC, Sun E, Bahgat M, Bucks D, Guy R, Hinz RS, et al. Blockage of skin invasion by schistosome cercariae by serine protease inhibitors. The American journal of tropical medicine and hygiene. 1999;60(3):487-92. PubMed PMID: 10466982. 62. Hara I, Hara S, Fusco AC, Salafsky B, Shibuya T. Role of calcium ion in

106

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

Schistosoma mansoni cercarial tail loss induced by unsaturated fatty acids. The Journal of parasitology. 1993;79(4):504-9. PubMed PMID: 8331471. 63. Curwen RS, Ashton PD, Sundaralingam S, Wilson RA. Identification of novel proteases and immunomodulators in the secretions of schistosome cercariae that facilitate host entry. Molecular & cellular proteomics : MCP. 2006;5(5):835-44. Epub 2006/02/14. doi: 10.1074/mcp.M500313-MCP200. PubMed PMID: 16469760. 64. Blanton R, Loula EC, Parker J. Two heat-induced proteins are associated with transformation of Schistosoma mansoni cercariae to schistosomula. Proceedings of the National Academy of Sciences of the United States of America. 1987;84(24):9011-4. PubMed PMID: 3321064; PubMed Central PMCID: PMC299681. 65. Akerfelt M, Morimoto RI, Sistonen L. Heat shock factors: integrators of cell stress, development and lifespan. Nature reviews Molecular cell biology. 2010;11(8):545-55. doi: 10.1038/nrm2938. PubMed PMID: 20628411; PubMed Central PMCID: PMC3402356. 66. Hsu AL, Murphy CT, Kenyon C. Regulation of aging and age-related disease by DAF-16 and heat-shock factor. Science. 2003;300(5622):1142-5. doi: 10.1126/science.1083701. PubMed PMID: 12750521. 67. Hu Y, Mivechi NF. HSF-1 interacts with Ral-binding protein 1 in a stress-responsive, multiprotein complex with HSP90 in vivo. The Journal of biological chemistry. 2003;278(19):17299-306. Epub 2003/03/07. doi: 10.1074/jbc.M300788200. PubMed PMID: 12621024. 68. Jedlicka P, Mortin MA, Wu C. Multiple functions of Drosophila heat shock transcription factor in vivo. The EMBO journal. 1997;16(9):2452-62. doi: 10.1093/emboj/16.9.2452. PubMed PMID: 9171358; PubMed Central PMCID: PMC1169845. 69. Morley JF, Morimoto RI. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular biology of the cell. 2004;15(2):657-64. doi: 10.1091/mbc.E03-07-0532. PubMed PMID: 14668486; PubMed Central PMCID: PMC329286. 70. Singhal SS, Yadav S, Drake K, Singhal J, Awasthi S. Hsf-1 and POB1 induce drug sensitivity and apoptosis by inhibiting Ralbp1. The Journal of biological chemistry. 2008;283(28):19714-29. Epub 2008/05/14. doi: 10.1074/jbc.M708703200. PubMed PMID: 18474607; PubMed Central PMCID: PMC2443664. 71. Xiao X, Zuo X, Davis AA, McMillan DR, Curry BB, Richardson JA, et al. HSF1 is required for extra-embryonic development, postnatal growth and protection during inflammatory responses in mice. The EMBO journal. 1999;18(21):5943-52. doi: 10.1093/emboj/18.21.5943. PubMed PMID: 10545106; PubMed Central

107

Chapter 3: Hsp70 may be a molecular regulator of schistosome host invasion

PMCID: PMC1171660. 72. Haas W, Haeberlein S, Behring S, Zoppelli E. Schistosoma mansoni: human skin ceramides are a chemical cue for host recognition of cercariae. Experimental parasitology. 2008;120(1):94-7. doi: 10.1016/j.exppara.2008.06.001. PubMed PMID: 18585383. 73. Pratt WB, Toft DO. Regulation of signaling protein function and trafficking by the hsp90/hsp70-based chaperone machinery. Experimental biology and medicine. 2003;228(2):111-33. PubMed PMID: 12563018. 74. Beckmann S, Wippersteg V, El-Bahay A, Hirzmann J, Oliveira G, Grevelding CG. Schistosoma mansoni: germ-line transformation approaches and actin-promoter analysis. Experimental parasitology. 2007;117(3):292-303. doi: 10.1016/j.exppara.2007.04.007. PubMed PMID: 17531975. 75. Kines KJ, Morales ME, Mann VH, Gobert GN, Brindley PJ. Integration of reporter transgenes into Schistosoma mansoni chromosomes mediated by pseudotyped murine leukemia virus. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2008;22(8):2936-48. doi: 10.1096/fj.08-108308. PubMed PMID: 18403630; PubMed Central PMCID: PMC2493450. 76. Rinaldi G, Eckert SE, Tsai IJ, Suttiprapa S, Kines KJ, Tort JF, et al. Germline transgenesis and insertional mutagenesis in Schistosoma mansoni mediated by murine leukemia virus. PLoS pathogens. 2012;8(7):e1002820. doi: 10.1371/journal.ppat.1002820. PubMed PMID: 22911241; PubMed Central PMCID: PMC3406096. 77. Liang S, Knight M, Jolly ER. Polyethyleneimine mediated DNA transfection in schistosome parasites and regulation of the WNT signaling pathway by a dominant-negative SmMef2. PLoS neglected tropical diseases. 2013;7(7):e2332. doi: 10.1371/journal.pntd.0002332. PubMed PMID: 23936566; PubMed Central PMCID: PMC3723562. 78. Liang S, Varrecchia M, Ishida K, Jolly ER. Evaluation of schistosome promoter expression for transgenesis and genetic analysis. PloS one. 2014;9(5):e98302. doi: 10.1371/journal.pone.0098302. PubMed PMID: 24858918; PubMed Central PMCID: PMC4032330. 79. Da'dara AA, Skelly PJ. Gene suppression in schistosomes using RNAi. Methods in molecular biology. 2015;1201:143-64. doi: 10.1007/978-1-4939-1438-8_8. PubMed PMID: 25388112. 80. Mathieson W, Wilson RA. A comparative proteomic study of the undeveloped and developed Schistosoma mansoni egg and its contents: the miracidium, hatch fluid and secretions. International journal for parasitology. 2010;40(5):617-28. doi: 10.1016/j.ijpara.2009.10.014. PubMed PMID: 19917288.

108

Chapter 4: Discussion

Chapter 4: Discussion

There is little known about the molecular and signaling components important for

schistosome cercariae to sense and invade their human host. Our understanding of the components required for the processes after reaching the host, notably penetration of the host skin, tail loss, and transformation into schistosomula, is likewise limited. While investigation of the mechanism involved in these processes increases our potential to

identify targets for novel drugs for schistosomiasis, it will also increase our understanding

of schistosome biology and provides an opportunity to explore general mechanisms for

helminth host invasion. Given the conserved cytoprotective function of the heat shock

response and associated proteins from prokaryotes to eukaryotes, and because cercariae

undergo a change in environment from swimming in freshwater to invading a

warm-blooded host, we hypothesized that heat shock response proteins such as heat

shock transcription factor and heat shock effector proteins may play an important role

during this transition.

Our initial studies focused on the further characterization of the S. mansoni heat shock

transcription factor (SmHSF1), which followed a series of studies by the Schechter group

[1–6]. As expected for the conserved gene, we found that SmHSF1 has the ability to

function as a transcriptional activator and can also bind specific heat shock-related DNA

sequences. Further, we produced a custom antibody against a peptide with a sequence

corresponding to that of a C-terminal region of SmHsf1 and tested whether it could detect

purified recombinant maltose binding protein (MBP)-SmHsf1 protein. SDS gel

109

Chapter 4: Discussion electrophoresis separation and Western blotting of both purified recombinant full-length

MBP-SmHsf1 protein and cercaria protein extract in our study resulted in a larger apparent molecular weight than expected (Figure 2.5; ~140 kDa instead of ~110 kDa for the recombinant and ~110 kDa instead of ~70 kDa for the extract). We speculated that post-translational modifications and/or a limitation of the SDS separation method could cause such a discrepancy. Interestingly, the same phenomenon has been observed with

Drosophila [7] and yeast Hsf proteins [8], suggesting that conserved modifications or structures in Hsf are responsible for this shift in apparent size. This strengthens the assertion that SmHsf1 protein contains the same conserved structural characteristics, and will likely function in a similar way, as Hsf proteins from other species.

Following the positive result from the Western blot experiment, we asked whether

SmHsf1 protein has a specific localization in cercaria stage schistosomes. We expected and observed general punctate staining corresponding with nuclei because of its function as a transcription factor. However, immunostaining of cercariae using the anti-Hsf antibody gave the striking observation that Hsf is also localized to the cercarial acetabular glands, which play an important role as storage and release vessels for proteins required during host invasion. This localization is especially surprising because in mature cercariae, these glands no longer contain nuclei [9] and are instead full of vesicles that carry proteins such as mucins [10] and elastases [11] that aid in host skin penetration. A closer examination of the staining revealed that Hsf seems to be localized to the membrane of the glands, instead of throughout the lumen. Such membrane localization for Hsf has not been well described in the literature, with the exception of one study. In

110

Chapter 4: Discussion

non-small cell lung cancer line cells, Hsf has been shown to interact with Ralbp1, a

membrane-bound transport protein [12,13]. While a homolog of Ralbp1 does not exist in

schistosomes, a similar mechanism could explain this localization. In the future, the use

of higher resolution microscopy could help to better define the localization of Hsf within the glands. For example, it could determine whether the membrane localization exists throughout the entirety of the glands, from the most anterior end of the cercaria, to the fundus, or base of the glands.

Hsf localization to the acetabular glands of cercariae provokes further thought into the potential role that Hsf plays in the life of these glands, from the development of the glands while cercariae are produced in the sporocyst, to their disintegration after the transition to the schistosomulum stage. As cercariae develop within the sporocyst, the concurrently developing glands within the cercariae must produce all the proteins necessary for host skin invasion. This high protein production in the glands implies a need for increased surveillance of these proteins by chaperones such as Hsp70 so that these proteins do not aggregate. In support of this idea, mass spectrometry analysis of the gland secretions has indicated an abundance of Hsp70, a downstream product of Hsf [14].

Hsf could therefore play an important role in the development of these glands as an indirect protein homeostasis factor via Hsp70. Hsf may also function as a protein homeostasis factor in sporocysts, considering that they 1) each produce hundreds of cercariae every day [15], requiring high protein production, and 2) show the highest

SmHSF1 transcript levels among sporocyst, cercaria, schistosomulum, and adult stages according to our transcript expression analysis in the first study presented in this thesis.

111

Chapter 4: Discussion

Further experiments of Hsf localization in sporocysts and intermediate cercariae, while

technically difficult, may give more insight into Hsf function in the developing glands.

Similarly, immunohistochemical staining of Hsf, paired with apoptosis assays, in newly

transformed schistosomula at several time points up to 24 hours, could track the change

in gland morphology as the glands degrade.

If we could disable the ability of Hsf to interact with other proteins through treatment

with a small molecule inhibitor, we could determine whether Hsf contributes to the

apoptosis of the glands. Existing Hsf inhibitors block its ability to bind DNA, which, in

the anucleated cercarial glands, may not exhibit a significant effect. Fortunately, there

exist inhibitors against other heat shock response proteins, such as the chaperone proteins

Hsp70 and Hsp90, which may play an important role during cercarial host invasion.

While we have argued above that high levels of Hsp70 exist in the glands to support the

production of gland-related proteins, Hsp70 may also function more directly in host invasion, given the abrupt change in environment. To begin to address this question, we

asked whether inhibiting Hsp70 function would affect cercarial behavior during host invasion. This became the focus of the second major study in this thesis.

The second study we present here shows that treatment of cercariae with an inhibitor of

Hsp70, 2-phenylethynesulfonamide (PES), recapitulates the response of cercariae to human skin lipid. Cercariae execute a host invasion process, which begins with the detection of human skin lipid molecules, followed by the reduction of upward swimming motion (cercarial honing), an increase of acetabular gland secretions, and an increase of

112

Chapter 4: Discussion

penetrative swimming against the bottom of the vessel/culture well [14].

In the study of compounds that induce cercarial honing, chemotaxis of cercariae toward host molecules has been a topic of interest. A notable study by the Haas group demonstrated a chemotactic preference of cercariae for L-arginine [16]. This study further showed that human skin lipid extract (which contains L-arginine) elicited chemotaxis, while the L-arginase-treated extract did not [16]. However, we must carefully consider that many of the experiments that identified substances to which cercariae respond were performed in small volume vessels (with diameters on the order of one to tens of millimeters), which may not accurately recapitulate the larger physical dimensions (on the order of tens to hundreds of centimeters) in the field. In the L-arginine study, the authors observed chemotactic preference using a W-shaped vessel embedded within a cube measuring 5 mm per side in which the cercariae from the middle arm swam to other arms containing either empty agar or agar mixed with an experimental compound [16].

While this study shows statistical significance for cercarial swimming preference toward

L-arginine at this close distance, we can only guess at whether cercariae would show the same chemotactic preference over a distance of tens to hundreds of centimeters.

Our study of cercarial honing presented in this thesis involves treatments of cercariae with chemical compounds using slightly larger vessels (12 or 24-well plate vessels, respectively about 22 or 15 mm in diameter and 2 or 1 mL in volume). When we treated cercariae with skin lipid, we observed limited chemotaxis. This means that either the skin lipid concentration in our treatment had saturated the putative chemotactic receptors in

113

Chapter 4: Discussion the cercariae or that cercariae respond in an all-or-nothing fashion: once they sense skin lipid, they change their swimming behavior. Considering the physical problem that cercariae probably cannot swim fast enough to catch up with a moving host, the second explanation seems more likely. Future quantitative experiments could examine the amount of cercarial honing behavior-inducing substance necessary to activate such behavior to infer the distance at which cercariae can sense host molecules.

Cercariae activated by skin lipid that reach a surface eventually lose their tails and transform into schistosomula. Treatment with PES resulted in the honing behavior described here, with an inverse time-concentration correlation, such that higher treatment concentrations induced this change sooner compared to lower treatment concentrations.

To verify our observation with PES, we used another Hsp70 inhibitor, MKT-077, and an

Hsp70 activator, 115-7c. Treatment with MKT-077 resulted in no honing, while treatment with 115-7c resulted in honing. To understand these contradictory results, we must first discuss the chaperoning function of Hsp70.

Hsp70 undergoes a client protein chaperoning cycle, in which its association with either

ATP or ADP (ATP/ADP state) and other proteins such as Hsp40 and nucleotide exchange factor (NEF) control Hsp70-client protein binding. In this model, Hsp70 acts as a chaperone by interacting with nascent or unfolded client proteins (often abbreviated as

“S” for Hsp70 Substrate) to prevent undesirable protein aggregation [17]. Closer examination of the mechanism of action of the treatment compounds reveals that both

PES and 115-7c facilitate the release of Hsp70 client proteins, while MKT-077 inhibits

114

Chapter 4: Discussion

Hsp70 without releasing the client proteins. This brings us to the model in which Hsp70 could be interacting with and sequestering a putative honing factor, which we termed

Hsp70 honing factor (HHF), in unexposed cercariae. Upon reception of host molecules or facilitated release of client proteins by the appropriate chemical treatment, Hsp70 would release HHF, allowing it to activate downstream signaling that leads to cercarial honing.

While the Hsp70-HHF model asserts that Hsp70 holds a specific protein inactive, the client protein in the Hsp70 chaperone model can represent any nascent or unfolded protein. Another model that describes a specific client protein controlled by Hsp70 is the model for the role of Hsp70 in clathrin-mediated endocytosis. In clathrin-mediated endocytosis, a cell creates a vesicle coated with a network of clathrin proteins as it prepares to take up extracellular cargo. The clathrin coating needs to break down (uncoat) to allow the underlying vesicle to fuse with the appropriate downstream endosome.

During the uncoating process, the constitutive version of Hsp70, Hsc70, is known to specifically interact with clathrin to prevent its aggregation [18]. After the reception of an unknown signal, Hsc70 releases clathrin to allow for the coating cycle to proceed. The ability for Hsc70 to interact with clathrin and act as a regulatory switch opens the possibility that Hsc70/Hsp70 can also regulate other processes through interactions with specific client proteins, such as in the Hsp70-HHF model.

According to the Hsp70-HHF model, any process or manipulation that causes Hsp70 to release its client protein would result in HHF release and cercarial honing. Accordingly, treatment of cercariae with the Hsp70 activator, 115-7c, resulted in honing. Treatment

115

Chapter 4: Discussion

with AMP-PNP, a non-hydrolyzable ATP analog, which forces Hsp70 into a low-affinity

state for interaction with a client protein, leading to a decreased chance of client protein retention, also resulted in honing. Interestingly, elevation of the water temperature to

42°C caused the cercariae to stop swimming and settle to the bottom of the culture well; after the water returned to room temperature, the cercariae returned to normal swimming behavior (unpublished observations). This suggests that if Hsp70 released HHF, HHF could not activate downstream signaling because of the elevated temperature.

Alternatively, HHF could have become unfolded at the elevated temperature, and the majority remained bound with Hsp70, resulting in continued sequestration of HHF after the temperature returned to normal.

We do note, however, that, while similar, the cercarial responses to PES, 115-7c, or adenosine phosphates do not perfectly replicate the response to skin lipid, most noticeably in terms of time until response. Treatment with skin lipid results in a honing response within seconds, while the other substances take more time to elicit a response.

We can speculate that cercariae respond more rapidly to skin lipid owing to specific receptors that can quickly activate signaling pathways, although such receptors for skin lipid molecules have not yet been described. In contrast, the other compounds may require time to reach their intracellular targets to exert their effects. Behaviorally, while these treatments ultimately result in reduced upward swimming and increased overall swimming activity at the bottom of the vessel, the skin lipid treatment also induced a crawling behavior that is less prominent in the other treatments. This may suggest that different mechanisms or signaling pathways may control the change in swimming

116

Chapter 4: Discussion behavior and crawling behavior: skin lipid would activate both, while Hsp70 inhibition would mainly affect swimming behavior. Further studies to identify schistosome receptors for skin lipid components, as well as investigation of putative HHF and its upstream and downstream signaling components, will help answer this question.

In the future, we would aim to identify proteins involved in the cercarial host sensing and honing activation signaling pathway, beginning with putative HHF. An affinity purification/mass spectrometry (AP/MS) approach using an Hsp70 antibody, comparing

PES treatment against DMSO control treatment, could yield a list of possible HHF candidates. However, because Hsp70 also interacts with other proteins and PES does not discriminate between HHF and other client proteins, the AP/MS approach may only give broad possibilities for the identity of HHF. Genetic approaches, such as gene knockdown, have not been established in cercariae, mostly owing to the difficulty of introducing genetic material into developing cercariae while inside the snail host. Moreover, until transformation into schistosomula, cercariae have been demonstrated to undergo little transcription of HSP70 [19], and little transcription in general, likely resulting from histone methylation and histone position relative to transcriptional start sites [20]. This means that any transfected genetic material requiring transcription has little chance of affecting cercariae.

Manipulation of mature cercariae is limited to treatment with pharmacological agents or other compounds because all of the proteins necessary for host invasion have already been produced. Combining this idea with the observation that cercariae begin honing

117

Chapter 4: Discussion

within seconds of skin lipid exposure leads to the question of how HHF could rapidly

activate signaling. We propose that HHF is a kinase or other post-translational protein

modifying agent, considering three lines of evidence. First, phosphorylation has been

observed to increase seven-fold between cercaria and 3-hour schistosomulum stages [21].

Second, treatment of cercariae with phorbol esters, which induce protein kinase C (PKC)

activity, has been shown to result in penetration behavior and the release of host

invasion-associated proteolytic enzymes [22]. Third, PKC has been shown to interact with Hsp70 [23], and it, along with extracellular signal-regulated kinase (ERK) and p38 mitogen-activated kinase (p38 MAPK), responds to temperature elevation, light intensity modulation, and linoleic acid treatment [24]. An initial experiment could probe PKC activity upon exposure to PES, followed by the same experiment but with the addition of a PKC inhibitor. Additionally, we could evaluate cercarial behavior after exposure to PES or skin lipids in the presence of a PKC inhibitor to determine whether the activation of cercarial honing requires PKC activity. The AP/MS approach using a PKC-specific antibody, or alternatively, a complex-immunoprecipitation/Western blot (CoIP/WB) approach could determine whether PKC and Hsp70 interact in cercariae and whether PES or skin lipids affects this interaction.

The two independent, but related, studies in this thesis provide novel observations and insights into the function of heat shock response proteins in schistosomes, particularly

with regard to the development and behavior of the infective cercaria stage. Our

experiments led us to the intriguing topic of protein signaling during cercarial host

invasion, with a unique model that Hsp70 regulates a behavioral switch between naïve

118

Chapter 4: Discussion

swimming and honing. Together with the ideas that PKC, ERK, p38 MAPK transduce

potential host signals and that histone methylation/positioning status causes transcriptional stalling in cercariae, we have taken a step closer to understanding the

important molecular events that occur in cercariae, beginning from host detection to

transformation into schistosomula.

We have yet to explore the role of heat shock response proteins in other schistosome stages. Of interest may be the question of whether the Hsp70-HHF model applies to the

other host transition stage in which the schistosome miracidia infect the snail host.

Ittiprasert and Knight have reported that elevated heat treatment in the snail host leads to

increased susceptibility to infection [25], suggesting that Hsp70 and putative HHF could

play a role in this transition. Like schistosomes, other parasites also undergo significant

changes in living conditions between stages (e.g., insect to human host), during which

heat shock genes have been suspected to play an important role [26–28], and further

investigation could determine whether the Hsp70-HHF model applies more generally

across different parasites. The ideas and results presented here contribute to a better

understanding of schistosome biology and help inspire further investigation of the

molecular mechanisms that support parasite survival.

4.1 References

1. Levy-Holtzman R, Schechter I. Schistosome extracts with heat shock factor activity revealed by the gel shift assay. Parasitology. 1994;108 ( Pt 1: 35–42. doi:10.1017/S0031182000078495 2. Levy-Holtzman R, Clos J, Schechter I. Differences in DNA sequence recognition

119

Chapter 4: Discussion

by the heat-shock factors of Drosophila melanogaster and the parasitic helminth Schistosoma mansoni. BBA - Gene Struct Expr. 1995;1264: 134–140. doi:10.1016/0167-4781(95)00151-6 3. Levy-Holtzman R, Schechter I. Expression of different forms of the heat-shock factor during the life cycle of the parasitic helminth Schistosoma mansoni. Biochim Biophys Acta - Mol Basis Dis. 1996;1317: 1–4. doi:10.1016/0925-4439(96)00041-5 4. Lantner F, Ziv E, Ram D, Schechter I. Different forms of the mRNA encoding the heat-shock transcription factor are expressed during the life cycle of the parasitic helminth Schistosoma mansoni. Eur J Biochem. 1998;253: 390–398. doi:10.1046/j.1432-1327.1998.2530390.x 5. Lardans V, Ram D, Lantner F, Ziv E, Schechter I. Differences in DNA-sequence recognition between the DNA-binding domain fragment and the full-length molecule of the heat-shock transcription factor of schistosome. Biochim Biophys Acta - Gene Struct Expr. 2001;1519: 230–234. doi:10.1016/S0167-4781(01)00220-2 6. Ram D, Ziv E, Lantner F, Lardans V, Schechter I. Stage-specific alternative splicing of the heat-shock transcription factor during the life-cycle of Schistosoma mansoni. Parasitology. 2004;129: 587–596. doi:10.1017/S003118200400602X 7. Wu C, Wilson S, Walker B, Dawid I, Paisley T, Zimarino V, et al. Purification and properties of Drosophila heat shock activator protein. Science (80- ). 1987;238: 1247 LP-1253. Available: http://science.sciencemag.org/content/238/4831/1247.abstract 8. Clos J, Westwood JT, Becker PB, Wilson S, Lambert K, Wu C. Molecular cloning and expression of a hexameric Drosophila heat shock factor subject to negative regulation. Cell. 1990;63: 1085–1097. doi:10.1016/0092-8674(90)90511-C 9. Dorsey CH, Stirewalt MA. Schistosoma mansoni: Fine structure of cercarial acetabular glands. Exp Parasitol. 1971;30: 199–214. doi:10.1016/0014-4894(71)90084-1 10. Stirewalt MA, Walters M. Schistosoma mansoni: Histochemical analysis of the postacetabular gland secretion of cercariae. Exp Parasitol. 1973;33. doi:10.1016/0014-4894(73)90009-X 11. Fishelson Z, Amiri P, Friend DS, Marikovsky M, Petitt M, Newport G, et al. Schistosoma mansoni: Cell-specific expression and secretion of a serine protease during development of cercariae. Exp Parasitol. 1992;75: 87–98. doi:10.1016/0014-4894(92)90124-S 12. Hu Y, Mivechi NF. HSF-1 interacts with Ral-binding protein 1 in a stress-responsive, multiprotein complex with HSP90 in vivo. J Biol Chem. 2003;278: 17299–17306. doi:10.1074/jbc.M300788200

120

Chapter 4: Discussion

13. Singhal SS, Yadav S, Drake K, Singhal J, Awasthi S. Hsf-1 and POB1 induce drug sensitivity and apoptosis by inhibiting Ralbp1. J Biol Chem. 2008;283: 19714–19729. doi:10.1074/jbc.M708703200 14. Knudsen GM, Medzihradszky KF, Lim K-C, Hansell E, McKerrow JH. Proteomic Analysis of Schistosoma mansoni Cercarial Secretions. Mol Cell Proteomics. 2005;4: 1862–1875. doi:10.1074/mcp.M500097-MCP200 15. Gryseels B, Polman K, Clerinx J, Kestens L. Human schistosomiasis. Lancet. 2006. pp. 1106–1118. doi:10.1016/S0140-6736(06)69440-3 16. Haas W, Grabe K, Geis C, Pach T, Stoll K, Fuchs M, et al. Recognition and invasion of human skin by Schistosoma mansoni cercariae : the key-role of L -arginine. Parasitology. 2002;124: 153–167. doi:10.1017 S0031182001001032 17. Mayer MP, Bukau B. Hsp70 chaperones: Cellular functions and molecular mechanism. Cell Mol Life Sci. 2005;62: 670–684. doi:10.1007/s00018-004-4464-6 18. Mcpherson PS, Ritter B, Wendland B. Clathrin - Mediated Endocytosis. Clathrin-Mediated Endocytosis - Madame Curie Biosci Database - NCBI Bookshelf. 2015; 1–24. Available: http://www.ncbi.nlm.nih.gov/books/NBK6479/?report=printable 19. Neumann S, Ziv E, Lantner F, Schechter I. Regulation of HSP70 gene expression during the life cycle of the parasitic helminth Schistosoma mansoni. Eur J Biochem. 1993;212: 589–96. Available: http://www.ncbi.nlm.nih.gov/pubmed/8444195 20. Roquis D, Lepesant JMJ, Picard MAL, Freitag M, Parrinello H, Groth M, et al. The epigenome of schistosoma mansoni provides insight about how cercariae poise transcription until infection. PLoS Negl Trop Dis. 2015;9. doi:10.1371/journal.pntd.0003853 21. Wiest PM, Olds GR, Bowen WD. Schistosoma mansoni: Protein phosphorylation during transformation of cercariae to schistosomula. Exp Parasitol. 1991;73: 214–222. doi:10.1016/0014-4894(91)90024-Q 22. Matsumura K, Mitsui Y, Sato K, Sakamoto M, Aoki Y. Schistosoma mansoni: possible involvement of protein kinase C in linoleic acid-induced proteolytic enzyme release from cercariae. Exp Parasitol. 1991;72: 311–320. 23. Gao T, Newton AC. The turn motif is a phosphorylation switch that regulates the binding of Hsp70 to protein kinase C. J Biol Chem. 2002;277: 31585–31592. doi:10.1074/jbc.M204335200 24. Ressurreição M, Kirk RS, Rollinson D, Emery AM, Page NM, Walker AJ. Sensory Protein Kinase Signaling in Schistosoma mansoni Cercariae: Host Location and Invasion. J Infect Dis. 2015;212: 1787–1797. doi:10.1093/infdis/jiv464

121

Chapter 4: Discussion

25. Ittiprasert W, Knight M. Reversing the resistance phenotype of the biomphalaria glabrata snail host schistosoma mansoni infection by temperature modulation. PLoS Pathog. 2012;8. doi:10.1371/journal.ppat.1002677 26. Weiss LM, Ma YF, Takvorian PM, Tanowitz HB, Wittner M. Bradyzoite development in Toxoplasma gondii and the hsp70 stress response. Infect Immun. 1998;66: 3295–3302. 27. Van der Ploeg LH, Giannini SH, Cantor CR. Heat shock genes: regulatory role for differentiation in parasitic protozoa. Science. 1985;228: 1443–1446. doi:10.1126/science.4012301 28. Maresca B, Carratù L. The biology of the heat shock response in parasites. Parasitology Today. 1992. pp. 260–266. doi:10.1016/0169-4758(92)90137-Q

122

List of References

List of References

Abdulla MH, Ruelas DS, Wolff B, Snedecor J, Lim KC, Xu F, et al. Drug discovery for schistosomiasis: hit and lead compounds identified in a library of known drugs by medium-throughput phenotypic screening. PLoS neglected tropical diseases. 2009;3(7):e478. doi: 10.1371/journal.pntd.0000478. PubMed PMID: 19597541; PubMed Central PMCID: PMC2702839. Abravaya K, Myers MP, Murphy SP, Morimoto RI. The human heat shock protein hsp70 interacts with HSF, the transcription factor that regulates heat shock gene expression. Genes & development. 1992;6(7):1153-64. PubMed PMID: 1628823. Acharya P, Kumar R, Tatu U. Chaperoning a cellular upheaval in malaria: heat shock proteins in Plasmodium falciparum. Molecular and biochemical parasitology. 2007;153(2):85-94. doi: 10.1016/j.molbiopara.2007.01.009. PubMed PMID: 17307260. Akerfelt M, Morimoto RI, Sistonen L. Heat shock factors: integrators of cell stress, development and lifespan. Nature reviews Molecular cell biology. 2010;11(8):545-55. doi: 10.1038/nrm2938. PubMed PMID: 20628411; PubMed Central PMCID: PMC3402356. Altschul SF, Wootton JC, Gertz EM, Agarwala R, Morgulis A, Schaffer AA, et al. Protein database searches using compositionally adjusted substitution matrices. The FEBS journal. 2005;272(20):5101-9. doi: 10.1111/j.1742-4658.2005.04945.x. PubMed PMID: 16218944; PubMed Central PMCID: PMC1343503. Amin J, Ananthan J, Voellmy R. Key features of heat shock regulatory elements. Molecular and cellular biology. 1988;8(9):3761-9. Epub 1988/09/01. PubMed PMID: 3146692; PubMed Central PMCID: PMC365434. Anckar J, Sistonen L. Regulation of HSF1 function in the heat stress response: implications in aging and disease. Annual review of biochemistry. 2011;80:1089-115. Epub 2011/03/23. doi: 10.1146/annurev-biochem-060809-095203. PubMed PMID: 21417720. Andrews P. Effect of praziquantel on the free living stages of Schistosoma mansoni. Zeitschrift fur Parasitenkunde. 1978;56(1):99-106. PubMed PMID: 706553. Azem A, Oppliger W, Lustig A, Jeno P, Feifel B, Schatz G, et al. The mitochondrial hsp70 chaperone system. Effect of adenine nucleotides, peptide substrate, and mGrpE on the oligomeric state of mhsp70. The Journal of biological chemistry. 1997;272(33):20901-6. PubMed PMID: 9252417. Banerjee Mustafi S, Chakraborty PK, Dey RS, Raha S. Heat stress upregulates chaperone heat shock protein 70 and antioxidant manganese superoxide dismutase through reactive oxygen species (ROS), p38MAPK, and Akt. Cell stress & chaperones. 2009;14(6):579-89. doi: 10.1007/s12192-009-0109-x. PubMed PMID: 19291423; PubMed Central PMCID: PMC2866949.

123

List of References

Barsoum RS, Esmat G, El-Baz T. Human Schistosomiasis: Clinical Perspective: Review. J Adv Res. 2013;4. doi:10.1016/j.jare.2013.01.005 Basch PF. Schistosomes: development, reproduction, and host relations. New York Oxford Univ Press 1991. 1991; 43. doi:10.1016/0169-4758(92)90149-V Beckmann S, Wippersteg V, El-Bahay A, Hirzmann J, Oliveira G, Grevelding CG. Schistosoma mansoni: germ-line transformation approaches and actin-promoter analysis. Experimental parasitology. 2007;117(3):292-303. doi: 10.1016/j.exppara.2007.04.007. PubMed PMID: 17531975. Bergquist R, Johansen MV, Utzinger J. Diagnostic dilemmas in helminthology: what tools to use and when? Trends Parasitol. 2009;25: 151–156. doi:10.1016/j.pt.2009.01.004 Blanton R, Loula EC, Parker J. Two heat-induced proteins are associated with transformation of Schistosoma mansoni cercariae to schistosomula. Proc Natl Acad Sci U S A. 1987;84: 9011–9014. doi:10.2307/34591 Blanton RE, Blank WA, Costa JM, Carmo TM, Reis EA, Silva LK, et al. Schistosoma mansoni population structure and persistence after praziquantel treatment in two villages of Bahia, Brazil. International journal for parasitology. 2011;41(10):1093-9. doi: 10.1016/j.ijpara.2011.06.002. PubMed PMID: 21784077; PubMed Central PMCID: PMC3155667. Brachs S, Haas W. Swimming behaviour of Schistosoma mansoni cercariae: Responses to irradiance changes and skin attractants. Parasitol Res. 2008;102: 685–690. doi:10.1007/s00436-007-0812-4 Caffrey CR, Rohwer A, Oellien F, Marhofer RJ, Braschi S, Oliveira G, et al. A comparative chemogenomics strategy to predict potential drug targets in the metazoan pathogen, Schistosoma mansoni. PloS one. 2009;4(2):e4413. doi: 10.1371/journal.pone.0004413. PubMed PMID: 19198654; PubMed Central PMCID: PMC2635471. Cai P, Gobert GN, You H, McManus DP. The Tao survivorship of schistosomes: Implications for schistosomiasis control. International Journal for Parasitology. 2016. pp. 453–463. doi:10.1016/j.ijpara.2016.01.002 Cai Y, Langley JG, Smith DI, Boros DL. A cloned major Schistosoma mansoni egg antigen with homologies to small heat shock proteins elicits Th1 responsiveness. Infect Immun. 1996;64: 1750–1755. Cao M, Chao H, Doughty BL. Cloning of a cDNA encoding an egg antigen homologue from Schistosoma mansoni. Mol Biochem Parasitol. 1993;58: 169–171. doi:http://dx.doi.org/10.1016/0166-6851(93)90102-4 Cavalcanti MG, Araujo HR, Paiva MH, Silva GM, Barbosa CC, Silva LF, et al. Ultrastructural and cytochemical aspects of Schistosoma mansoni cercaria. Micron. 2009;40(3):394-400. doi: 10.1016/j.micron.2008.09.006. PubMed PMID: 19081261.

124

List of References

CDC. CDC - DPDx - Schistosomiasis Infection [Internet]. [cited 3 Mar 2017]. Available: https://www.cdc.gov/dpdx/schistosomiasis/index.html Chitsulo L, Engels D, Montresor A, Savioli L. The global status of schistosomiasis and its control. Acta Trop. 2000;77: 41–51. doi:10.1016/S0001-706X(00)00122-4 Chitsulo L, Loverde P, Engels D. Schistosomiasis. Nature reviews Microbiology. 2004;2(1):12-3. Epub 2004/03/24. doi: 10.1038/nrmicro801. PubMed PMID: 15035004. Cioli D, Pica-Mattoccia L, Archer S. Antischistosomal drugs: Past, present ... and future? Pharmacology and Therapeutics. 1995. pp. 35–85. doi:10.1016/0163-7258(95)00026-7 Cioli D, Pica-Mattoccia L, Basso A, Guidi A. Schistosomiasis control: Praziquantel forever? Molecular and Biochemical Parasitology. 2014. pp. 23–29. doi:10.1016/j.molbiopara.2014.06.002 Cioli D, Pica-Mattoccia L. Praziquantel. Parasitol Res. 2003;90 Supp 1: S3-9. doi:10.1007/s00436-002-0751-z Clos J, Westwood JT, Becker PB, Wilson S, Lambert K, Wu C. Molecular cloning and expression of a hexameric Drosophila heat shock factor subject to negative regulation. Cell. 1990;63: 1085–1097. doi:10.1016/0092-8674(90)90511-C Coaxum SD, Griffin TM, Martin JL, Mestril R. Influence of PKC-alpha overexpression on HSP70 and cardioprotection. American journal of physiology Heart and circulatory physiology. 2007;292(5):H2220-6. doi: 10.1152/ajpheart.01080.2006. PubMed PMID: 17208995. Cohen FE, Gregoret LM, Amiri P, Aldape K, Railey J, McKerrow JH. Arresting tissue invasion of a parasite by protease inhibitors chosen with the aid of computer modeling. Biochemistry. 1991;30(47):11221-9. PubMed PMID: 1958659. Collins JJ, 3rd, King RS, Cogswell A, Williams DL, Newmark PA. An atlas for Schistosoma mansoni organs and life-cycle stages using cell type-specific markers and confocal microscopy. PLoS neglected tropical diseases. 2011;5(3):e1009. doi: 10.1371/journal.pntd.0001009. PubMed PMID: 21408085; PubMed Central PMCID: PMC3050934. Cousin CE, Stirewalt MA, Dorsey CH. Schistosoma mansoni: ultrastructure of early transformation of skin- and shear-pressure-derived schistosomules. Experimental parasitology. 1981;51(3):341-65. PubMed PMID: 7227486. Curwen RS, Ashton PD, Sundaralingam S, Wilson RA. Identification of novel proteases and immunomodulators in the secretions of schistosome cercariae that facilitate host entry. Molecular & cellular proteomics : MCP. 2006;5(5):835-44. Epub 2006/02/14. doi: 10.1074/mcp.M500313-MCP200. PubMed PMID: 16469760. Curwen RS, Wilson RA. Invasion of skin by schistosome cercariae: some neglected facts. Trends in parasitology. 2003;19(2):63-6; discussion 6-8. PubMed PMID:

125

List of References

12586470. Da'dara AA, Skelly PJ. Gene suppression in schistosomes using RNAi. Methods in molecular biology. 2015;1201:143-64. doi: 10.1007/978-1-4939-1438-8_8. PubMed PMID: 25388112. Davies SJ, Grogan JL, Blank RB, Lim KC, Locksley RM, McKerrow JH. Modulation of blood fluke development in the liver by hepatic CD4+ lymphocytes. Science. 2001;294: 1358–1361. doi:10.1126/science.1064462 Davis A, Chitsulo L, Loverde P, Engels D, Mott KE, Bilharz T, et al. Schistosomiasis. Nat Rev Microbiol. 2004;2: 349–391. doi:10.1038/nrmicro801 Doenhoff MJ, Chiodini PL, Hamilton J V. Specific and sensitive diagnosis of schistosome infection: Can it be done with antibodies? Trends in Parasitology. 2004. pp. 35–39. doi:10.1016/j.pt.2003.10.019 Doenhoff MJ, Kusel JR, Coles GC, Cioli D. Resistance of Schistosoma mansoni to praziquantel: Is there a problem? Transactions of the Royal Society of Tropical Medicine and Hygiene. 2002. pp. 465–469. doi:10.1016/S0035-9203(02)90405-0 Dorsey CH, Cousin CE, Lewis FA, Stirewalt MA. Ultrastructure of the Schistosoma mansoni cercaria. Micron. 2002. pp. 279–323. doi:10.1016/S0968-4328(01)00019-1 Dorsey CH, Stirewalt MA. Schistosoma mansoni: Fine structure of cercarial acetabular glands. Exp Parasitol. 1971;30: 199–214. doi:10.1016/0014-4894(71)90084-1 Duan MM, Xu RM, Yuan CX, Li YY, Liu Q, Cheng GF, et al. SjHSP70, a recombinant Schistosoma japonicum heat shock protein 70, is immunostimulatory and induces protective immunity against cercarial challenge in mice. Parasitol Res. 2015;114: 3415–3429. doi:10.1007/s00436-015-4567-z Echeverria PC, Matrajt M, Harb OS, Zappia MP, Costas MA, Roos DS, et al. Toxoplasma gondii Hsp90 is a potential drug target whose expression and subcellular localization are developmentally regulated. Journal of molecular biology. 2005;350(4):723-34. doi: 10.1016/j.jmb.2005.05.031. PubMed PMID: 15967463. Elbaz T, Esmat G. Hepatic and Intestinal Schistosomiasis: Review. Journal of Advanced Research. 2013. pp. 445–452. doi:10.1016/j.jare.2012.12.001 Engels D, Chitsulo L, Montresor A, Savioli L. The global epidemiological situation of schistosomiasis and new approaches to control and research. Acta tropica. 2002;82(2):139-46. PubMed PMID: 12020886. Fallon PG, Doenhoff MJ. Drug-resistant schistosomiasis: Resistance to praziquantel and oxamniquine induced in Schistosoma mansoni in mice is drug specific. Am J Trop Med Hyg. 1994;51: 83–88. Fallon PG, Sturrock RF, Capron A, Niang M, Doenhoff MJ. Short report: Diminished susceptibility to praziquantel in a Senegal isolate of Schistosoma mansoni. Am J Trop Med Hyg. 1995;53: 61–62.

126

List of References

Fenwick A, Savioli L, Engels D, Bergquist NR, Todd MH. Drugs for the control of parasitic diseases: Current status and development in schistosomiasis. Trends in Parasitology. 2003. pp. 509–515. doi:10.1016/j.pt.2003.09.005 Ferrari TCA, Moreira PRR, Cunha AS. Clinical characterization of neuroschistosomiasis due to Schistosoma mansoni and its treatment. Acta Trop. 2008;108: 89–97. doi:10.1016/j.actatropica.2008.04.007 Ferrari TCA, Moreira PRR. Neuroschistosomiasis: Clinical symptoms and pathogenesis. The Lancet Neurology. 2011. pp. 853–864. doi:10.1016/S1474-4422(11)70170-3 Fishelson Z, Amiri P, Friend DS, Marikovsky M, Petitt M, Newport G, et al. Schistosoma mansoni: Cell-specific expression and secretion of a serine protease during development of cercariae. Exp Parasitol. 1992;75: 87–98. doi:10.1016/0014-4894(92)90124-S Gao T, Newton AC. The turn motif is a phosphorylation switch that regulates the binding of Hsp70 to protein kinase C. J Biol Chem. 2002;277: 31585–31592. doi:10.1074/jbc.M204335200 Gomes ALDV, Melo FL, Werkhauser RP, Abath FGC. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA. Mem Inst Oswaldo Cruz. 2006;101 Suppl: 133–6. doi:10.1590/S0074-02762006000900021 Gomes LI, Enk MJ, Rabello A. Diagnosing schistosomiasis: Where are we? Revista da Sociedade Brasileira de Medicina Tropical. 2014. pp. 3–11. doi:10.1590/0037-8682-0231-2013 Gong X, Luo T, Deng P, Liu Z, Xiu J, Shi H, et al. Stress-induced interaction between p38 MAPK and HSP70. Biochemical and biophysical research communications. 2012;425(2):357-62. doi: 10.1016/j.bbrc.2012.07.096. PubMed PMID: 22842575. Graefe SE, Wiesgigl M, Gaworski I, Macdonald A, Clos J. Inhibition of HSP90 in Trypanosoma cruzi induces a stress response but no stage differentiation. Eukaryotic cell. 2002;1(6):936-43. PubMed PMID: 12477794; PubMed Central PMCID: PMC138760. Granzer M, Haas W. The chemical stimuli of human skin surface for the attachment response of Schistosoma mansoni cercariae. International journal for parasitology. 1986;16(6):575-9. PubMed PMID: 3804568. Gray DJ, Ross AG, Li Y-S, McManus DP. Diagnosis and management of schistosomiasis. BMJ. 2011;342: d2651. doi:10.1136/bmj.d2651 Greenberg RM. Are Ca2+ channels targets of praziquantel action? International Journal for Parasitology. 2005. pp. 1–9. doi:10.1016/j.ijpara.2004.09.004 Gribble FM, Loussouarn G, Tucker SJ, Zhao C, Nichols CG, Ashcroft FM. A novel method for measurement of submembrane ATP concentration. The Journal of biological chemistry. 2000;275(39):30046-9. doi: 10.1074/jbc.M001010200.

127

List of References

PubMed PMID: 10866996. Gryseels B, Mbaye A, De Vlas SJ, Stelma FF, Guissé F, Van Lieshout L, et al. Are poor responses to praziquantel for the treatment of Schistosoma mansoni infections in Senegal due to resistance? An overview of the evidence. Tropical Medicine and International Health. 2001. pp. 864–873. doi:10.1046/j.1365-3156.2001.00811.x Gryseels B, Polman K, Clerinx J, Kestens L. Human schistosomiasis. Lancet. 2006. pp. 1106–1118. doi:10.1016/S0140-6736(06)69440-3 Guettouche T, Boellmann F, Lane WS, Voellmy R. Analysis of phosphorylation of human heat shock factor 1 in cells experiencing a stress. BMC biochemistry. 2005;6:4. Epub 2005/03/12. doi: 10.1186/1471-2091-6-4. PubMed PMID: 15760475; PubMed Central PMCID: PMC1079796. Guo Y, Guettouche T, Fenna M, Boellmann F, Pratt WB, Toft DO, et al. Evidence for a mechanism of repression of heat shock factor 1 transcriptional activity by a multichaperone complex. The Journal of biological chemistry. 2001;276(49):45791-9. doi: 10.1074/jbc.M105931200. PubMed PMID: 11583998. Gupta RS, Singh B. Phylogenetic analysis of 70 kD heat shock protein sequences suggests a chimeric origin for the eukaryotic cell nucleus. Current biology : CB. 1994;4(12):1104-14. PubMed PMID: 7704574. Haas W, Grabe K, Geis C, Pach T, Stoll K, Fuchs M, et al. Recognition and invasion of human skin by Schistosoma mansoni cercariae : the key-role of L -arginine. Parasitology. 2002;124: 153–167. doi:10.1017 S0031182001001032 Haas W, Haeberlein S, Behring S, Zoppelli E. Schistosoma mansoni: Human skin ceramides are a chemical cue for host recognition of cercariae. Exp Parasitol. 2008;120: 94–97. doi:10.1016/j.exppara.2008.06.001 Haas W, Schmitt R. Characterization of chemical stimuli for the penetration of Schistosoma mansoni cercariae. I. Effective substances, host specificity. Zeitschrift fur Parasitenkunde. 1982;66(3):293-307. PubMed PMID: 7080610. Haas W. Parasitic worms: strategies of host finding, recognition and invasion. Zoology (Jena). 2003;106: 349–364. doi:10.1078/0944-2006-00125 Haeberlein S, Haas W. Chemical attractants of human skin for swimming Schistosoma mansoni cercariae. Parasitol Res. 2008;102: 657–662. doi:10.1007/s00436-007-0807-1 Hagan P, Appleton CC, Coles GC, Kusel JR, Tchuem-Tchuenté LA. Schistosomiasis control: Keep taking the tablets. Trends in Parasitology. 2004. pp. 92–97. doi:10.1016/j.pt.2003.11.010 Hammarton TC, Mottram JC, Doerig C. The cell cycle of parasitic protozoa: potential for chemotherapeutic exploitation. Progress in cell cycle research. 2003;5:91-101. PubMed PMID: 14593704.

128

List of References

Han H, Peng J, Gobert GN, Hong Y, Zhang M, Han Y, et al. Apoptosis phenomenon in the schistosomulum and adult worm life cycle stages of Schistosoma japonicum. Parasitology international. 2013;62(2):100-8. doi: 10.1016/j.parint.2012.09.008. PubMed PMID: 23159324. Hansell E, Braschi S, Medzihradszky KF, Sajid M, Debnath M, Ingram J, et al. Proteomic analysis of skin invasion by blood fluke larvae. PLoS neglected tropical diseases. 2008;2(7):e262. doi: 10.1371/journal.pntd.0000262. PubMed PMID: 18629379; PubMed Central PMCID: PMC2467291. Hara I, Hara S, Fusco AC, Salafsky B, Shibuya T. Role of calcium ion in Schistosoma mansoni cercarial tail loss induced by unsaturated fatty acids. The Journal of parasitology. 1993;79(4):504-9. PubMed PMID: 8331471. He S, Yang L, Lv Z, Hu W, Cao J, Wei J, et al. Molecular and functional characterization of a mortalin-like protein from Schistosoma japonicum (SjMLP/hsp70) as a member of the HSP70 family. Parasitol Res. 2010;107: 955–966. doi:10.1007/s00436-010-1960-5 Hedstrom R, Culpepper J, Schinski V, Agabian N, Newport G. Schistosome heat-shock proteins are immunologically distinct host-like antigens. Mol Biochem Parasitol. 1988;29: 275–282. doi:10.1016/0166-6851(88)90082-5 Hsu AL, Murphy CT, Kenyon C. Regulation of aging and age-related disease by DAF-16 and heat-shock factor. Science. 2003;300(5622):1142-5. doi: 10.1126/science.1083701. PubMed PMID: 12750521. Hu Y, Mivechi NF. HSF-1 interacts with Ral-binding protein 1 in a stress-responsive, multiprotein complex with HSP90 in vivo. The Journal of biological chemistry. 2003;278(19):17299-306. Epub 2003/03/07. doi: 10.1074/jbc.M300788200. PubMed PMID: 12621024.

Ishida K, Varrecchia M, Knudsen GM, Jolly ER. Immunolocalization of anti-hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator. PLoS neglected tropical diseases. 2014;8(7):e3051. doi: 10.1371/journal.pntd.0003051. PubMed PMID: 25078989; PubMed Central PMCID: PMC4117452. Ismail M, Botros S, Metwally A, William S, Farghally A, Tao LF, et al. Resistance to praziquantel: Direct evidence from Schistosoma mansoni isolated from egyptian villagers. Am J Trop Med Hyg. 1999;60: 932–935. Ittiprasert W, Knight M. Reversing the resistance phenotype of the biomphalaria glabrata snail host schistosoma mansoni infection by temperature modulation. PLoS Pathog. 2012;8. doi:10.1371/journal.ppat.1002677 Jedlicka P, Mortin MA, Wu C. Multiple functions of Drosophila heat shock transcription factor in vivo. The EMBO journal. 1997;16(9):2452-62. doi: 10.1093/emboj/16.9.2452. PubMed PMID: 9171358; PubMed Central PMCID:

129

List of References

PMC1169845. Johnson KS, Wells K, Bock J V., Nene V, Taylor DW, Cordingley JS. The 86-kilodalton antigen from Schistosoma mansoni is a heat-shock protein homologous to yeast HSP-90. Mol Biochem Parasitol. 1989;36: 19–28. doi:10.1016/0166-6851(89)90196-5 Jolly C, Morimoto RI. Role of the heat shock response and molecular chaperones in oncogenesis and cell death. J Natl Cancer Inst. 2000;92: 1564–72. doi:10.1093/JNCI/92.19.1564 Jolly ER, Chin CS, Miller S, Bahgat MM, Lim KC, DeRisi J, et al. Gene expression patterns during adaptation of a helminth parasite to different environmental niches. Genome biology. 2007;8(4):R65. Epub 2007/04/26. doi: 10.1186/gb-2007-8-4-r65. PubMed PMID: 17456242; PubMed Central PMCID: PMC1896014. Karanja DMS, Colley DG, Nahlen BL, Ouma JH, Secor WE. Studies on schistosomiasis in western Kenya: I. Evidence for immune- facilitated excretion of schistosome eggs from patients with Schistosoma mansoni and human immunodeficiency virus coinfections. Am J Trop Med Hyg. 1997;56: 515–521. doi:10.1186/1756-3305-4-226 Katz N, Chaves A, Pellegrino J. A simple device for quantitative stool thick-smear technique in Schistosomiasis mansoni. Rev Inst Med Trop Sao Paulo. 1972;14: 397–400. doi:10.1590/S0036-46651999000200001 Kines KJ, Morales ME, Mann VH, Gobert GN, Brindley PJ. Integration of reporter transgenes into Schistosoma mansoni chromosomes mediated by pseudotyped murine leukemia virus. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2008;22(8):2936-48. doi: 10.1096/fj.08-108308. PubMed PMID: 18403630; PubMed Central PMCID: PMC2493450. King CH. Parasites and poverty: The case of schistosomiasis. Acta Tropica. 2010. pp. 95–104. doi:10.1016/j.actatropica.2009.11.012 Knudsen GM, Medzihradszky KF, Lim KC, Hansell E, McKerrow JH. Proteomic analysis of Schistosoma mansoni cercarial secretions. Molecular & cellular proteomics : MCP. 2005;4(12):1862-75. Epub 2005/08/23. doi: 10.1074/mcp.M500097-MCP200. PubMed PMID: 16112986. Kolářová L. Schistosomes causing cercarial dermatitis: A mini-review of current trends in systematics and of host specificity and pathogenicity. Folia Parasitologica. 2007. pp. 81–87. Komarov PG, Komarova EA, Kondratov RV, Christov-Tselkov K, Coon JS, Chernov MV, et al. A chemical inhibitor of p53 that protects mice from the side effects of cancer therapy. Science. 1999;285(5434):1733-7. PubMed PMID: 10481009. Koressaar T, Remm M. Enhancements and modifications of primer design program Primer3. Bioinformatics. 2007;23(10):1289-91. Epub 2007/03/24. doi:

130

List of References

10.1093/bioinformatics/btm091. PubMed PMID: 17379693. Krauth SJ, Coulibaly JT, Knopp S, Traoré M, N’Goran EK, Utzinger J. An In-Depth Analysis of a Piece of Shit: Distribution of Schistosoma mansoni and Hookworm Eggs in Human Stool. PLoS Negl Trop Dis. 2012;6. doi:10.1371/journal.pntd.0001969 Lantner F, Ziv E, Ram D, Schechter I. Different forms of the mRNA encoding the heat-shock transcription factor are expressed during the life cycle of the parasitic helminth Schistosoma mansoni. Eur J Biochem. 1998;253: 390–398. doi:10.1046/j.1432-1327.1998.2530390.x Lardans V, Ram D, Lantner F, Ziv E, Schechter I. Differences in DNA-sequence recognition between the DNA-binding domain fragment and the full-length molecule of the heat-shock transcription factor of schistosome. Biochim Biophys Acta - Gene Struct Expr. 2001;1519: 230–234. doi:10.1016/S0167-4781(01)00220-2 Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23(21):2947-8. doi: 10.1093/bioinformatics/btm404. PubMed PMID: 17846036. Lee VST, Burgess JL, Sterling CR, Lutz EA. Schistosoma mansoni: Assessment of effects of oleic acid, cercarial age and water temperature on parasite-host attraction. Int J Parasitol. 2013;43: 837–842. doi:10.1016/j.ijpara.2013.05.005 Leu JI, George DL. Hepatic IGFBP1 is a prosurvival factor that binds to BAK, protects the liver from apoptosis, and antagonizes the proapoptotic actions of p53 at mitochondria. Genes & development. 2007;21(23):3095-109. doi: 10.1101/gad.1567107. PubMed PMID: 18056423; PubMed Central PMCID: PMC2081976. Leu JI, Pimkina J, Frank A, Murphy ME, George DL. A small molecule inhibitor of inducible heat shock protein 70. Molecular cell. 2009;36(1):15-27. doi: 10.1016/j.molcel.2009.09.023. PubMed PMID: 19818706; PubMed Central PMCID: PMC2771108. Leu JI, Zhang P, Murphy ME, Marmorstein R, George DL. Structural basis for the inhibition of HSP70 and DnaK chaperones by small-molecule targeting of a C-terminal allosteric pocket. ACS chemical biology. 2014;9(11):2508-16. doi: 10.1021/cb500236y. PubMed PMID: 25148104; PubMed Central PMCID: PMC4241170. Levy-Holtzman R, Clos J, Schechter I. Differences in DNA sequence recognition by the heat-shock factors of Drosophila melanogaster and the parasitic helminth Schistosoma mansoni. BBA - Gene Struct Expr. 1995;1264: 134–140. doi:10.1016/0167-4781(95)00151-6

Levy-Holtzman R, Schechter I. Activity of the promoter of the hsp70 gene of the parasitic

131

List of References

helminth Schistosoma mansoni in the mammalian CHO cell-line. BBA - Gene Struct Expr. 1995;1263: 96–98. doi:10.1016/0167-4781(95)00083-S Levy-Holtzman R, Schechter I. Expression of different forms of the heat-shock factor during the life cycle of the parasitic helminth Schistosoma mansoni. Biochim Biophys Acta - Mol Basis Dis. 1996;1317: 1–4. doi:10.1016/0925-4439(96)00041-5 Levy-Holtzman R, Schechter I. Schistosome extracts with heat shock factor activity revealed by the gel shift assay. Parasitology. 1994;108 ( Pt 1: 35–42. doi:10.1017/S0031182000078495 Liang S, Knight M, Jolly ER. Polyethyleneimine mediated DNA transfection in schistosome parasites and regulation of the WNT signaling pathway by a dominant-negative SmMef2. PLoS neglected tropical diseases. 2013;7(7):e2332. doi: 10.1371/journal.pntd.0002332. PubMed PMID: 23936566; PubMed Central PMCID: PMC3723562. Liang S, Varrecchia M, Ishida K, Jolly ER. Evaluation of schistosome promoter expression for transgenesis and genetic analysis. PloS one. 2014;9(5):e98302. doi: 10.1371/journal.pone.0098302. PubMed PMID: 24858918; PubMed Central PMCID: PMC4032330. Lim KC, Sun E, Bahgat M, Bucks D, Guy R, Hinz RS, et al. Blockage of skin invasion by schistosome cercariae by serine protease inhibitors. The American journal of tropical medicine and hygiene. 1999;60(3):487-92. PubMed PMID: 10466982. Liu T, Daniels CK, Cao S. Comprehensive review on the HSC70 functions, interactions with related molecules and involvement in clinical diseases and therapeutic potential. Pharmacology & therapeutics. 2012;136(3):354-74. doi: 10.1016/j.pharmthera.2012.08.014. PubMed PMID: 22960394. Mansour NR, Bickle QD. Comparison of microscopy and Alamar blue reduction in a larval based assay for schistosome drug screening. PLoS neglected tropical diseases. 2010;4(8):e795. doi: 10.1371/journal.pntd.0000795. PubMed PMID: 20706580; PubMed Central PMCID: PMC2919390. Marchler-Bauer A, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, et al. CDD: specific functional annotation with the Conserved Domain Database. Nucleic acids research. 2009;37(Database issue):D205-10. Epub 2008/11/06. doi: 10.1093/nar/gkn845. PubMed PMID: 18984618; PubMed Central PMCID: PMC2686570. Maresca B, Carratù L. The biology of the heat shock response in parasites. Parasitology Today. 1992. pp. 260–266. doi:10.1016/0169-4758(92)90137-Q Massey AJ, Williamson DS, Browne H, Murray JB, Dokurno P, Shaw T, et al. A novel, small molecule inhibitor of Hsc70/Hsp70 potentiates Hsp90 inhibitor induced apoptosis in HCT116 colon carcinoma cells. Cancer chemotherapy and pharmacology. 2010;66(3):535-45. doi: 10.1007/s00280-009-1194-3. PubMed

132

List of References

PMID: 20012863. Mathieson W, Wilson RA. A comparative proteomic study of the undeveloped and developed Schistosoma mansoni egg and its contents: the miracidium, hatch fluid and secretions. International journal for parasitology. 2010;40(5):617-28. doi: 10.1016/j.ijpara.2009.10.014. PubMed PMID: 19917288. Matsumura K, Mitsui Y, Sato K, Sakamoto M, Aoki Y. Schistosoma mansoni: possible involvement of protein kinase C in linoleic acid-induced proteolytic enzyme release from cercariae. Exp Parasitol. 1991;72: 311–320. Mayer MP, Bukau B. Hsp70 chaperones: Cellular functions and molecular mechanism. Cell Mol Life Sci. 2005;62: 670–684. doi:10.1007/s00018-004-4464-6 Mayer MP. Hsp70 chaperone dynamics and molecular mechanism. Trends in Biochemical Sciences. 2013. pp. 507–514. doi:10.1016/j.tibs.2013.08.001 McKerrow J, Salter J. Invasion of skin by Schistosoma cercariae. Trends in Parasitology. 2002. pp. 193–195. doi:10.1016/S1471-4922(02)02309-7 McKerrow JH, Pino-Heiss S, Lindquist R, Werb Z. Purification and characterization of an elastinolytic proteinase secreted by cercariae of Schistosoma mansoni. The Journal of biological chemistry. 1985;260(6):3703-7. PubMed PMID: 3882713. McKerrow JH, Salter J. Invasion of skin by Schistosoma cercariae. Trends in parasitology. 2002;18(5):193-5. PubMed PMID: 11983589. Mcpherson PS, Ritter B, Wendland B. Clathrin - Mediated Endocytosis. Clathrin-Mediated Endocytosis - Madame Curie Biosci Database - NCBI Bookshelf. 2015; 1–24. Available: http://www.ncbi.nlm.nih.gov/books/NBK6479/?report=printable Melman SD, Steinauer ML, Cunningham C, Kubatko LS, Mwangi IN, Wynn NB, et al. Reduced susceptibility to praziquantel among naturally occurring Kenyan isolates of Schistosoma mansoni. PLoS Negl Trop Dis. 2009;3. doi:10.1371/journal.pntd.0000504 Miki K, Eddy EM. Tumor necrosis factor receptor 1 is an ATPase regulated by silencer of death domain. Molecular and cellular biology. 2002;22(8):2536-43. PubMed PMID: 11909948; PubMed Central PMCID: PMC133739. Milligan JN, Jolly ER. Cercarial transformation and in vitro cultivation of Schistosoma mansoni schistosomules. Journal of visualized experiments : JoVE. 2011;(54). Epub 2011/08/31. doi: 10.3791/3191. PubMed PMID: 21876520; PubMed Central PMCID: PMC3217644. Milligan JN, Jolly ER. Identification and characterization of a Mef2 transcriptional activator in schistosome parasites. PLoS Negl Trop Dis. 2012;6. doi:10.1371/journal.pntd.0001443 Morgan JR, Jiang J, Oliphint PA, Jin S, Gimenez LE, Busch DJ, et al. A role for an Hsp70 nucleotide exchange factor in the regulation of synaptic vesicle endocytosis. The

133

List of References

Journal of neuroscience : the official journal of the Society for Neuroscience. 2013;33(18):8009-21. doi: 10.1523/JNEUROSCI.4505-12.2013. PubMed PMID: 23637191; PubMed Central PMCID: PMC3707978. Morley JF, Morimoto RI. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular biology of the cell. 2004;15(2):657-64. doi: 10.1091/mbc.E03-07-0532. PubMed PMID: 14668486; PubMed Central PMCID: PMC329286. Moser D, Doumbo O, Klinkert MQ. The humoral response to heat shock protein 70 in human and murine Schistosomiasis mansoni. Parasite Immunol. 1990;12: 341–352. Nene V, Dunne DW, Johnson KS, Taylor DW, Cordingley JS. Sequence and expression of a major egg antigen from Schistosoma mansoni. Homologies to heat shock proteins and alpha-crystallins. Mol Biochem Parasitol. 1986;21: 179–188. doi:10.1016/0166-6851(86)90021-6 Neumann S, Ziv E, Lantner F, Schechter I. Cloning and sequencing of an hsp70 gene of Schistosoma mansoni. Mol Biochem Parasitol. 1992;56: 357–360. doi:10.1016/0166-6851(92)90188-P Neumann S, Ziv E, Lantner F, Schechter I. Regulation of HSP70 gene expression during the life cycle of the parasitic helminth Schistosoma mansoni. Eur J Biochem. 1993;212: 589–96. Available: http://www.ncbi.nlm.nih.gov/pubmed/8444195 Paveley RA, Mansour NR, Hallyburton I, Bleicher LS, Benn AE, Mikic I, et al. Whole organism high-content screening by label-free, image-based Bayesian classification for parasitic diseases. PLoS neglected tropical diseases. 2012;6(7):e1762. doi: 10.1371/journal.pntd.0001762. PubMed PMID: 22860151; PubMed Central PMCID: PMC3409125. Peak E, Chalmers IW, Hoffmann KF. Development and validation of a quantitative, high-throughput, fluorescent-based bioassay to detect schistosoma viability. PLoS neglected tropical diseases. 2010;4(7):e759. doi: 10.1371/journal.pntd.0000759. PubMed PMID: 20668553; PubMed Central PMCID: PMC2910722. Pearce EJ, MacDonald AS. The immunobiology of schistosomiasis. Nat Rev Immunol. 2002;2: 499–511. doi:10.1038/nri843 Pica-Mattoccia L, Cioli D. Sex- and stage-related sensitivity of Schistosoma mansoni to in vivo and in vitro praziquantel treatment. Int J Parasitol. 2004;34: 527–533. doi:10.1016/j.ijpara.2003.12.003 Pica-Mattoccia L, Orsini T, Basso A, Festucci A, Liberti P, Guidi A, et al. Schistosoma mansoni: Lack of correlation between praziquantel-induced intra-worm calcium influx and parasite death. Exp Parasitol. 2008;119: 332–335. doi:10.1016/j.exppara.2008.03.012 Picquet M, Vercruysse J, Shaw DJ, Diop M, Ly A. Efficacy of praziquantel against Schistosoma mansoni in northern Senegal. Trans R Soc Trop Med Hyg. 1998;92:

134

List of References

90–93. doi:10.1016/S0035-9203(98)90971-3 Pontes LA, Oliveira MC, Katz N, Dias-Neto E, Rabello A. Comparison of a polymerase chain reaction and the Kato-Katz technique for diagnosing infection with Schistosoma mansoni. Am J Trop Med Hyg. 2003;68: 652–656. Pratt WB, Toft DO. Regulation of signaling protein function and trafficking by the hsp90/hsp70-based chaperone machinery. Experimental biology and medicine. 2003;228(2):111-33. PubMed PMID: 12563018. Prichard RK, Basanez MG, Boatin BA, McCarthy JS, Garcia HH, Yang GJ, et al. A research agenda for helminth diseases of humans: intervention for control and elimination. PLoS neglected tropical diseases. 2012;6(4):e1549. doi: 10.1371/journal.pntd.0001549. PubMed PMID: 22545163; PubMed Central PMCID: PMC3335868. Protasio AV, Tsai IJ, Babbage A, Nichol S, Hunt M, Aslett MA, et al. A systematically improved high quality genome and transcriptome of the human blood fluke Schistosoma mansoni. PLoS neglected tropical diseases. 2012;6(1):e1455. doi: 10.1371/journal.pntd.0001455. PubMed PMID: 22253936; PubMed Central PMCID: PMC3254664. Ram D, Ziv E, Lantner F, Lardans V, Schechter I. Stage-specific alternative splicing of the heat-shock transcription factor during the life-cycle of Schistosoma mansoni. Parasitology. 2004;129: 587–596. doi:10.1017/S003118200400602X Rapoport I, Boll W, Yu A, Bocking T, Kirchhausen T. A motif in the clathrin heavy chain required for the Hsc70/auxilin uncoating reaction. Molecular biology of the cell. 2008;19(1):405-13. doi: 10.1091/mbc.E07-09-0870. PubMed PMID: 17978091; PubMed Central PMCID: PMC2174180. Ressurreição M, Kirk RS, Rollinson D, Emery AM, Page NM, Walker AJ. Sensory Protein Kinase Signaling in Schistosoma mansoni Cercariae: Host Location and Invasion. J Infect Dis. 2015;212: 1787–1797. doi:10.1093/infdis/jiv464 Richter K, Haslbeck M, Buchner J. The heat shock response: life on the verge of death. Molecular cell. 2010;40(2):253-66. doi: 10.1016/j.molcel.2010.10.006. PubMed PMID: 20965420. Rinaldi G, Eckert SE, Tsai IJ, Suttiprapa S, Kines KJ, Tort JF, et al. Germline transgenesis and insertional mutagenesis in Schistosoma mansoni mediated by murine leukemia virus. PLoS pathogens. 2012;8(7):e1002820. doi: 10.1371/journal.ppat.1002820. PubMed PMID: 22911241; PubMed Central PMCID: PMC3406096. Roquis D, Lepesant JMJ, Picard MAL, Freitag M, Parrinello H, Groth M, et al. The epigenome of schistosoma mansoni provides insight about how cercariae poise transcription until infection. PLoS Negl Trop Dis. 2015;9. doi:10.1371/journal.pntd.0003853 Ross AGP, Bartley PB, Sleigh AC, Olds GR, Li Y, Williams GM, et al. Schistosomiasis.

135

List of References

N Engl J Med. 2002;346: 1212–1220. doi:10.1056/NEJMra012396 Salafsky B, Fusco AC, Whitley K, Nowicki D, Ellenberger B. Schistosoma mansoni: analysis of cercarial transformation methods. Experimental parasitology. 1988;67(1):116-27. PubMed PMID: 2458958. Samuelson JC, Caulfield JP. Cercarial glycocalyx of Schistosoma mansoni activates human complement. Infect Immun. 1986;51: 181–186. Samuelson JC, Caulfield JP. The cercarial glycocalyx of Schistosoma mansoni. J Cell Biol. 1985;100: 1423–1434. doi:10.1083/jcb.100.5.1423 Sarvel AK, Oliveira ÁA, Silva AR, Lima ACL, Katz N. Evaluation of a 25-year-program for the control of schistosomiasis mansoni in an endemic area in Brazil. PLoS Negl Trop Dis. 2011;5. doi:10.1371/journal.pntd.0000990 Schlecht R, Erbse AH, Bukau B, Mayer MP. Mechanics of Hsp70 chaperones enables differential interaction with client proteins. Nature structural & molecular biology. 2011;18(3):345-51. doi: 10.1038/nsmb.2006. PubMed PMID: 21278757. Schlesinger MJ. Heat shock proteins: the search for functions. The Journal of cell biology. 1986;103(2):321-5. PubMed PMID: 2426277; PubMed Central PMCID: PMC2113812. Schwock J, Pham NA, Cao MP, Hedley DW. Efficacy of Hsp90 inhibition for induction of apoptosis and inhibition of growth in cervical carcinoma cells in vitro and in vivo. Cancer chemotherapy and pharmacology. 2008;61(4):669-81. doi: 10.1007/s00280-007-0522-8. PubMed PMID: 17579866. Shamovsky I, Nudler E. New insights into the mechanism of heat shock response activation. Cellular and molecular life sciences : CMLS. 2008;65(6):855-61. Epub 2008/02/02. doi: 10.1007/s00018-008-7458-y. PubMed PMID: 18239856. Sharma SK, Christen P, Goloubinoff P. Disaggregating chaperones: an unfolding story. Current protein & peptide science. 2009;10(5):432-46. Epub 2009/06/23. PubMed PMID: 19538153. Shen J, Prywes R. ER stress signaling by regulated proteolysis of ATF6. Methods. 2005;35(4):382-9. doi: 10.1016/j.ymeth.2004.10.011. PubMed PMID: 15804611. Shi Y, Mosser DD, Morimoto RI. Molecular chaperones as HSF1-specific transcriptional repressors. Genes & development. 1998;12(5):654-66. PubMed PMID: 9499401; PubMed Central PMCID: PMC316571. Shiff CJ, Cmelik SH, Ley HE, Kriel RL. The influence of human skin lipids on the cercarial penetration responses of Schistosoma haematobium and Schistosoma mansoni. The Journal of parasitology. 1972;58(3):476-80. PubMed PMID: 5042054. Shonhai A. Plasmodial heat shock proteins: targets for chemotherapy. FEMS immunology and medical microbiology. 2010;58(1):61-74. doi: 10.1111/j.1574-695X.2009.00639.x. PubMed PMID: 20041948.

136

List of References

Singhal SS, Yadav S, Drake K, Singhal J, Awasthi S. Hsf-1 and POB1 induce drug sensitivity and apoptosis by inhibiting Ralbp1. The Journal of biological chemistry. 2008;283(28):19714-29. Epub 2008/05/14. doi: 10.1074/jbc.M708703200. PubMed PMID: 18474607; PubMed Central PMCID: PMC2443664. Skelly PJ, Alan Wilson R. Making Sense of the Schistosome Surface. Advances in Parasitology. 2006. pp. 185–284. doi:10.1016/S0065-308X(06)63003-0 Smith H, Doenhoff M, Aitken C, Bailey W, Ji M, Dawson E, et al. Comparison of Schistosoma mansoni Soluble Cercarial Antigens and Soluble Egg Antigens for Serodiagnosing Schistosome Infections. PLoS Negl Trop Dis. 2012;6. doi:10.1371/journal.pntd.0001815 Sousa R, Lafer EM. The role of molecular chaperones in clathrin mediated vesicular trafficking. Frontiers in molecular biosciences. 2015;2:26. doi: 10.3389/fmolb.2015.00026. PubMed PMID: 26042225; PubMed Central PMCID: PMC4436892. Steinmann P, Keiser J, Bos R, Tanner M, Utzinger J. Schistosomiasis and water resources development: systematic review, meta-analysis, and estimates of people at risk. Lancet Infect Dis. 2006;6: 411–425. doi:10.1016/S1473-3099(06)70521-7 Stirewalt MA, Austin BE. Collection of secreted protease from the preacetabular glands of cercariae of Schistosoma mansoni. The Journal of parasitology. 1973;59(4):741-3. PubMed PMID: 4722597. Stirewalt MA, Cousin CE, Dorsey CH. Schistosoma mansoni: Stimulus and transformation of cercariae into schistosomules. Exp Parasitol. 1983;56: 358–368. doi:10.1016/0014-4894(83)90081-4 Stirewalt MA, Walters M. Schistosoma mansoni: histochemical analysis of the postacetabular gland secretion of cercariae. Experimental parasitology. 1973;33(1):56-72. Epub 1973/02/01. PubMed PMID: 4348075. Stirewalt MA. Cercaria vs. schistosomule (Schistosoma mansoni): absence of the pericercarial envelope in vivo and the early physiological and histological metamorphosis of the parasite. Experimental parasitology. 1963;13:395-406. PubMed PMID: 13984191. Stothard JR, Kabatereine NB, Tukahebwa EM, Kazibwe F, Rollinson D, Mathieson W, et al. Use of circulating cathodic antigen (CCA) dipsticks for detection of intestinal and urinary schistosomiasis. Acta Trop. 2006;97: 219–228. doi:10.1016/j.actatropica.2005.11.004 Strom E, Sathe S, Komarov PG, Chernova OB, Pavlovska I, Shyshynova I, et al. Small-molecule inhibitor of p53 binding to mitochondria protects mice from gamma radiation. Nature chemical biology. 2006;2(9):474-9. doi: 10.1038/nchembio809. PubMed PMID: 16862141. Taylor AR, Robinson MB, Gifondorwa DJ, Tytell M, Milligan CE. Regulation of heat

137

List of References

shock protein 70 release in astrocytes: role of signaling kinases. Developmental neurobiology. 2007;67(13):1815-29. doi: 10.1002/dneu.20559. PubMed PMID: 17701989. Titz B, Thomas S, Rajagopala SV, Chiba T, Ito T, Uetz P. Transcriptional activators in yeast. Nucleic acids research. 2006;34(3):955-67. Epub 2006/02/09. doi: 10.1093/nar/gkj493. PubMed PMID: 16464826; PubMed Central PMCID: PMC1361621. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, et al. Primer3--new capabilities and interfaces. Nucleic acids research. 2012;40(15):e115. Epub 2012/06/26. doi: 10.1093/nar/gks596. PubMed PMID: 22730293; PubMed Central PMCID: PMC3424584. Van der Ploeg LH, Giannini SH, Cantor CR. Heat shock genes: regulatory role for differentiation in parasitic protozoa. Science. 1985;228: 1443–1446. doi:10.1126/science.4012301 Van Der Werf MJ, De Vlas SJ, Brooker S, Looman CWN, Nagelkerke NJD, Habbema JDF, et al. Quantification of clinical morbidity associated with schistosome infection in sub-Saharan Africa. Acta Tropica. 2003. pp. 125–139. doi:10.1016/S0001-706X(03)00029-9 van Gool T, Vetter H, Vervoort T, Doenhoff MJ, Wetsteyn J, Overbosch D. Serodiagnosis of Imported Schistosomiasis by a Combination of a Commercial Indirect Hemagglutination Test with Schistosoma mansoni Adult Worm Antigens and an Enzyme-Linked Immunosorbent Assay with S. mansoni Egg Antigens. J Clin Microbiol . 2002;40: 3432–3437. doi:10.1128/JCM.40.9.3432-3437.2002 Van Lieshout L, Polderman AM, Deelder AM. Immunodiagnosis of schistosomiasis by determination of the circulating antigens CAA and CCA, in particular in individuals with recent or light infections. Acta Trop. 2000;77: 69–80. doi:10.1016/S0001-706X(00)00115-7 Verghese J, Abrams J, Wang Y, Morano KA. Biology of the heat shock response and protein chaperones: budding yeast (Saccharomyces cerevisiae) as a model system. Microbiol Mol Biol Rev. 2012;76: 115–58. doi:10.1128/MMBR.05018-11 Wadhwa R, Sugihara T, Yoshida A, Nomura H, Reddel RR, Simpson R, et al. Selective toxicity of MKT-077 to cancer cells is mediated by its binding to the hsp70 family protein mot-2 and reactivation of p53 function. Cancer research. 2000;60(24):6818-21. PubMed PMID: 11156371. Wang W, Wang L, Liang YS. Susceptibility or resistance of praziquantel in human schistosomiasis: A review. Parasitology Research. 2012. pp. 1871–1877. doi:10.1007/s00436-012-3151-z Weerakoon KGAD, Gobert GN, Cai P, McManus DP. Advances in the diagnosis of human schistosomiasis. Clin Microbiol Rev. 2015;28: 939–967. doi:10.1128/CMR.00137-14

138

List of References

Weiss LM, Ma YF, Takvorian PM, Tanowitz HB, Wittner M. Bradyzoite development in Toxoplasma gondii and the hsp70 stress response. Infect Immun. 1998;66: 3295–3302. Whitesell L, Lindquist SL. HSP90 and the chaperoning of cancer. Nature reviews Cancer. 2005;5(10):761-72. doi: 10.1038/nrc1716. PubMed PMID: 16175177. Whitfield PJ, Bartlett A, Brown MB, Marriott C. Invasion by schistosome cercariae: studies with human skin explants. Trends in parasitology. 2003;19(8):339-40. PubMed PMID: 12901933. Whitfield PJ, Bartlett A, Khammo N, Clothier RH. Age-dependent survival and infectivity of Schistosoma mansoni cercariae. Parasitology. 2003;127: 29–35. doi:10.1017/S0031182003003263 Whitty CJ, Mabey DC, Armstrong M, Wright SG, Chiodini PL. Presentation and outcome of 1107 cases of schistosomiasis from Africa diagnosed in a non-endemic country. Trans R Soc Trop Med Hyg. 2000;94: 531–534. doi:10.1016/S0035-9203(00)90077-4 WHO. Schistosomiasis: number of people treated worldwide in 2013 Background. Wkly Epidemiol Rec. 2015;376: 25–32. doi:10.1016/j.actatropica.2012.04.013. Wiesgigl M, Clos J. Heat shock protein 90 homeostasis controls stage differentiation in Leishmania donovani. Molecular biology of the cell. 2001;12(11):3307-16. PubMed PMID: 11694568; PubMed Central PMCID: PMC60256. Wiesgigl M, Clos J. The heat shock protein 90 of Leishmania donovani. Medical microbiology and immunology. 2001;190(1-2):27-31. PubMed PMID: 11770104. Wiest PM, Olds GR, Bowen WD. Schistosoma mansoni: Protein phosphorylation during transformation of cercariae to schistosomula. Exp Parasitol. 1991;73: 214–222. doi:10.1016/0014-4894(91)90024-Q Wisen S, Bertelsen EB, Thompson AD, Patury S, Ung P, Chang L, et al. Binding of a small molecule at a protein-protein interface regulates the chaperone activity of hsp70-hsp40. ACS chemical biology. 2010;5(6):611-22. doi: 10.1021/cb1000422. PubMed PMID: 20481474; PubMed Central PMCID: PMC2950966. Wu C, Wilson S, Walker B, Dawid I, Paisley T, Zimarino V, et al. Purification and properties of Drosophila heat shock activator protein. Science (80- ). 1987;238: 1247 LP-1253. Available: http://science.sciencemag.org/content/238/4831/1247.abstract Wu W, Wang W, Huang YX. New insight into praziquantel against various developmental stages of schistosomes. Parasitology Research. 2011. pp. 1501–1507. doi:10.1007/s00436-011-2670-3 Xiao H, Lis JT. Germline transformation used to define key features of heat-shock response elements. Science. 1988;239(4844):1139-42. Epub 1988/03/04. PubMed PMID: 3125608.

139

List of References

Xiao X, Zuo X, Davis AA, McMillan DR, Curry BB, Richardson JA, et al. HSF1 is required for extra-embryonic development, postnatal growth and protection during inflammatory responses in mice. The EMBO journal. 1999;18(21):5943-52. doi: 10.1093/emboj/18.21.5943. PubMed PMID: 10545106; PubMed Central PMCID: PMC1171660. Xing Y, Bocking T, Wolf M, Grigorieff N, Kirchhausen T, Harrison SC. Structure of clathrin coat with bound Hsc70 and auxilin: mechanism of Hsc70-facilitated disassembly. The EMBO journal. 2010;29(3):655-65. doi: 10.1038/emboj.2009.383. PubMed PMID: 20033059; PubMed Central PMCID: PMC2830701. Xu J, Rong R, Zhang HQ, Shi CJ, Zhu XQ, Xia CM. Sensitive and rapid detection of Schistosoma japonicum DNA by loop-mediated isothermal amplification (LAMP). Int J Parasitol. 2010;40: 327–331. doi:10.1016/j.ijpara.2009.08.010 Yahata T, de Caestecker MP, Lechleider RJ, Andriole S, Roberts AB, Isselbacher KJ, et al. The MSG1 non-DNA-binding transactivator binds to the p300/CBP coactivators, enhancing their functional link to the Smad transcription factors. The Journal of biological chemistry. 2000;275(12):8825-34. PubMed PMID: 10722728. Yang J, Yang L, Lv Z, Wang J, Zhang Q, Zheng H, et al. Molecular cloning and characterization of a HSP70 gene from Schistosoma japonicum. Parasitol Res. 2012;110: 1785–1793. doi:10.1007/s00436-011-2700-1 Yuckenberg PD, Poupin F, Mansour TE. Schistosoma mansoni: protein composition and synthesis during early development; evidence for early synthesis of heat shock proteins. Exp Parasitol. 1987;63: 301–311. Available: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt =Citation&list_uids=3582570 Zuiderweg ERP, Bertelsen EB, Rousaki A, Mayer MP, Gestwicki JE, Ahmad A. Allostery in the Hsp70 chaperone proteins. Top Curr Chem. 2013;328: 99–153. doi:10.1007/128-2012-323

140