DOCSLIB.ORG

Newly Isolated Malic Acid Fermenting Yeast Meyerozyma Caribbica AY 33-1 for Bioconversion of Glucose and Cassava Pulp

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Newly Isolated Malic Acid Fermenting Yeast Meyerozyma Caribbica AY 33-1 for Bioconversion of Glucose and Cassava Pulp Newly isolated malic acid fermenting yeast Meyerozyma caribbica AY 33-1 for bioconversion of glucose and cassava pulp Thannapat Rattanapatpokin(1), Chakrit Tachaapikoon (1,2), Rattiya Waeonukul(1,2), Songsak Wattanachaisaereekul (2), Khanok Ratanakhanokchai(1) and Patthra Pason (1,2, *) ( ) 1 School of Bioresources and Technology, King Mongkut’s University of Technology Thonburi, Bangkuntein, Bangkok, 10150, Thailand (2)Pilot Plant Development and Training Institute, King Mongkut’s University of Technology Thonburi, Bangkuntein, Bangkok, 10150, Thailand *Corresponding author: [email protected] ABSTRACT 1. INTRODUCTION This study investigated the yeast species associated Malic acid (2-hydroxybutanedioic acid) is a with fermented foods in Thailand, focusing on dicarboxylic acid and a potential C4 platform identifying those that could combine the chemical. Malic acid was first isolated in 1785 by saccharification and fermentation (SSF) steps of Carl Wilhelm Scheele from unripe apples and an malic acid production from cassava pulp. One hundred nighty six isolated yeast were investigated important intermediate in cellular metabolism and a their ability to produce malic acid from glucose and constituent of the TCA cycle (Meek, JS., 1975). It cassava pulp. The result showed that only one has many applications as an acidulant and flavor isolate, AY33-1, proved to have amylase, xylanase enhancer, which was widely used in the beverage and cellulase activities that crucial for cassava pulp and food industry and used in metal cleaning, saccharification ,which malic acid was identified as fabric dying, water treatment, textile finishing, a key product for the growth on cassava pulp. agriculture and pharmaceuticals (Wang et al., 2016; Sequence analysis of the internal transcribed spacer (ITS) and 26S rDNA region indicated that the Chi , et al.,2014 ) In general, malic acid synthesizes isolated strain was closely related to the species from petroleum-based through either hydration of Meyerozyma caribbica with 99.8% similarity. fumaric or maleic acid under high temperature and Malic acid production from strain AY33-1 on YPD pressure (Goldberg, et al., 2006). In recent years, supplement with 10% glucose was 11.5 g/L and the production of this organic acid from coproducts the productivity was 0.36 g/L/h. Maximum amount of industrial bioprocessing has been investigated. of malic acid production from 10% glucose was Microorganisms have been found to be able to 22.7 g/L and the productivity was 0.53 g/L/h in the basal medium. The yield of malic acid was produce malic acid from a variety of carbon increased with 4.45 folds compared with that of sources, including glucose, fructose, sucrose, Basal medium from YPD. Meyerozyma caribbica maltose and other carbohydrates (Battat, et al., AY33-1 was the multiple enzymatic yeasts 1991). Various microorganisms were reported to containing of 17.35U/mg amylase, 5.12 U/mg produce malic acid from mostly glucose by cellulase, 7.98 U/mg xylanase and also produced fermentation such as Aspergillus species (Battatet, pullulanase when grown on cassava pulp. Our results indicate that the isolated AY33-1 is et al., 1991; West, 2011), Penicillium sp. K034 effective on direct malic acid from cassava pulp (1 (Wang, et al., 2013) and also certain yeasts to g/L of malic acid), suggesting the promising yeast convert glucose into malic acid has been reported for developing high value-added products from (Taing &Taing., 2007) but no report for direct cassava pulp. malic acid from cassava plup before. Yeasts are used by humans for thousands of years with wide Keywords: Malic acid, Yeast, Cassava pulp, applications, both fundamental and industrial, in Meyerozyma caribbic. AY33-1, Direct fermentation science, food, medical and agricultural. Thus, the main objectives of this study were carried out to select yeasts from different sources that can be able to produce high levels of L-malic acid. 62 Ⓒ Shibaura Institute of Technology, ONLINE ISSN 2435-2993, SEATUC Journal of Science and Engineering, 2019. Volume 1 Fermentation process has been studied prior the colony was transferred into YPD broth containing actively transforming glucose to high levels of L- 10% glucose and incubated at 37°C, 200 rpm for malic acid but a few studies have been report about overnight. For medium preparation, the culture malic acid production from lignocellulose biomass. contained 50 ml of YPD into 250 ml shake-flasks. Thailand is the world’s largest cassava starch All medium was sterilized in the autoclave at exporter. Cassava pulp, a by-product of cassava 121°C and 15 psi for 15 min. The flasks were starch industry, is produced in large amounts and aerobically grown at 37°C and 200 rpm for 2 days. mainly contains starch (60%) and cellulose fiber The culture obtained was centrifuged at 8,000×g (20%)(Sriroth, K et al.,1994; Sriroth, K et al.2000). and 4°C for 5 min. Malic acid in the supernatant The transformation of these agro industrial wastes was obtained, and quantitative determination of with high level of starch into malic acid requires malic acid was performed as described below amylolytic, cellulolytoc and xylanolytic strains with strong potential to hydrolyze starch and fiber. 2.3 Analytical methods The challenge of using lignocellulosic biomass is the cost of enzymes (amylase, cellulases and For malic acid analysis, the fermentation broth was xylanases) to degrade the biomass to fermentable centrifuged at 8000 rpm for 10 min, and the sugars (glucose or xylose). Here carbohydrate supernatant was separated by ultrafiltration. The degrading yeast is promising technology for sample was analyzed for malic acid using high consolidate bioprocess of malic acid production performance liquid chromatography (HPLC; RID- from cassava pulp. However, multiple enzyme 10A, Shimadzu, Japan) with an Aminex HPX-87H yeast have not been cited frequently; few of the column (Bio-Rad, Hercules, CA) operated at 50°C notable examples of amylolytic and xylanolytic using 50 mM H2SO4 as the mobile phase at a flow yeast include Candida tropicalis, Pichia stiptis rate of 0.6 mL/min, and a UV detector at 230 nm (Lee, et al., 1987) and Aurobasidium pullulans (Dong, et al., 2014). (Leather, et al., 1984). Also, its ability to produce malic acid from glucose and cassava pulp by the yeast Meyerozyma caribbica in a fermentation 2.4 Morphological analysis and identification of process has not been studied before. AY33-1 Here, the main objectives of this study were to isolate and identify yeast strains and characteristic The yeast strain AY33-1 was inoculated on YPD of Meyerozyma caribbica to produce malic acid agar for microscopic analysis and colony characters. After overnight, it was observed by from glucose and cassava pulp with high cassava microscope for morphological characters. For DNA pulp degrading enzyme activity. extraction, PCR amplification, sequencing, and phylogenetic analysis, total genomic DNA from the 2. EXPERIMENT strain AY33-1 were extracted according to the methods described by Sambrook, et al. (1989),. 2.1 Isolate yeast strain for malic acid To estimate phylogenetic relationships among production. strain AY33-1 and the typical strains reported on internet, amplification and sequencing of ITS (Internal transcribed spacer) from the strain AY33- The yeast strain used in this study was isolated 1 were performed using the primers IT5:5’- from fermented fruit and rice, then purified single TCCGTAGGTGAACCTGCGG -3’ and IT6: 5’- colony using a streak plate technique on YPD agar TCCTCCGCTTATTGATATGC -3’ (Josefa,et al., plates containing 20 g/L glucose, 20 g/L peptone, 2004) and 26S rDNA, NL-1:5’-G CATATCAA 10 g/L yeast extract and 20 g/L agar. The forming TAAGCGGAGGAAAAG-3’ and NL-4:5’-GGT colonies on plates were incubated at 37°C for CCGTGTTTCAAGACGG-3’ (Sugita, et al., 2003). overnight. Then, a single colony was used and 2.5 Effect of the medium for malic acid transferred into YPD agar containing 1 g/L of production bromocresol green after that incubated at 37°C A total of 10% of the cultures was inoculated into 2.2 Screening of yeasts for malic acid production the flask containing 500 ml in YPD medium and limiting nitrogen medium (basal medium) For inoculum preparation, colonies of yeast strains contained glucose (100 g/L), KH PO (0.5 g/L), were sub-cultured on YPD plate and incubated at 2 4 MgSO .7H O (0.5 g/L), yeast extract (1 g/L) and 37°C for an overnight before use. Then, a single 4 2 63 Ⓒ Shibaura Institute of Technology, ONLINE ISSN 2435-2993, SEATUC Journal of Science and Engineering, 2019. Volume 1 CaCO3 (30 g/L) or YPD medium contained glucose 3. RESULTS AND DISCUSSION (100 g/L), peptone (20 g/L),yeast extract (1 g/L ) and CaCO3 (30 g/L). The samples were collected at 3.1 Screening of the yeast strain for their ability a time every 4 h. until 48 h. The sample was to produce high level of malic acid analyzed by HPLC to determine its malic acid content can be followed at step 2.3 and growth was From 196 yeast isolates obtained from fermented determined using a standard plate count (Chandra, fruit and fermented rice, only 98 strains could et al., 2018) and reducing sugar mainly (glucose) directly change the color bromocresol green of were determined by with the 3,5-dinitrosalicylic plate (Fig.1) and morphology was studied to select acid (DNS) colorimetric method (Hu, et al. , 2008) only yeast form. They were then screened to determine their ability to produce malic acid. 2.6 Malic acid production from cassava pulp Among of malic acid production yeast, highest malic acid (8.2 g/L) was produced by the strain Malic acid fermentation by yeast in cassava pulp AY33-1 (Fig. 2). Thus, the strain AY33-1 was substrate was studied.
Load more

Recommended publications
  • The Role and Use of Non-Saccharomyces Yeasts in Wine Production
    The Role and Use of Non-Saccharomyces Yeasts in Wine Production N.P. Jolly1*, O.P.H. Augustyn1 and I.S. Pretorius2** (1) ARC Infruitec-Nietvoorbij***, Private Bag X5026, 7599 Stellenbosch, South Africa. (2) Institute for Wine Biotechnology, Department of Viticulture & Oenology, Stellenbosch University, Private Bag X1, 7602 Matieland (Stellenbosch), South Africa. Submitted for publication: September 2005 Accepted for publication: April 2006 Key words: Non-Saccharomyces, yeasts, vineyards, cellars, fermentation, wine. The contribution by the numerous grape-must-associated non-Saccharomyces yeasts to wine fermentation has been debated extensively. These yeasts, naturally present in all wine fermentations, are metabolically active and their metabolites can impact on wine quality. Although often seen as a source of microbial spoilage, there is substantial contrary evidence pointing to a positive contribution by these yeasts. The role of non-Saccharomyces yeasts in wine fermentation is therefore receiving increasing attention by wine microbiologists in Old and New World wine producing countries. Species that have been investigated for wine production thus far include those from the Candida, Kloeckera, Hanseniaspora, Zygosaccharomyces, Schizosaccharomyces, Torulaspora, Brettanomyces, Saccharomycodes, Pichia and Williopsis genera. In this review the use and role of non-Saccharomyces yeast in wine production is presented and research trends are discussed. INTRODUCTION roles of the numerous non-Saccharomyces yeasts normally asso- ciated with grape must and wine. These yeasts, naturally present Wine is the product of a complex biological and biochemical in all wine fermentations to a greater or lesser extent, are meta- interaction between grapes (grape juice) and different microor- bolically active and their metabolites can impact on wine quality.
    [Show full text]
  • GRAS Notice for Pichia Kudriavzevii ASCUSDY21 for Use As a Direct Fed Microbial in Dairy Cattle
    GRAS Notice for Pichia kudriavzevii ASCUSDY21 for Use as a Direct Fed Microbial in Dairy Cattle Prepared for: Division of Animal Feeds, (HFV-220) Center for Veterinary Medicine 7519 Standish Place Rockville, Maryland 20855 Submitted by: ASCUS Biosciences, Inc. 6450 Lusk Blvd Suite 209 San Diego, California 92121 GRAS Notice for Pichia kudriavzevii ASCUSDY21 for Use as a Direct Fed Microbial in Dairy Cattle TABLE OF CONTENTS PART 1 – SIGNED STATEMENTS AND CERTIFICATION ................................................................................... 9 1.1 Name and Address of Organization .............................................................................................. 9 1.2 Name of the Notified Substance ................................................................................................... 9 1.3 Intended Conditions of Use .......................................................................................................... 9 1.4 Statutory Basis for the Conclusion of GRAS Status ....................................................................... 9 1.5 Premarket Exception Status .......................................................................................................... 9 1.6 Availability of Information .......................................................................................................... 10 1.7 Freedom of Information Act, 5 U.S.C. 552 .................................................................................. 10 1.8 Certification ................................................................................................................................
    [Show full text]
  • Challenges of the Non-Conventional Yeast Wickerhamomyces Anomalus in Winemaking
    fermentation Review Challenges of the Non-Conventional Yeast Wickerhamomyces anomalus in Winemaking Beatriz Padilla 1, Jose V. Gil 2,3 and Paloma Manzanares 2,* 1 INCLIVA Health Research Institute, 46010 Valencia, Spain; [email protected] 2 Department of Biotechnology, Instituto de Agroquímica y Tecnología de Alimentos (IATA), Consejo Superior de Investigaciones Científicas (CSIC), Paterna, 46980 Valencia, Spain; [email protected] 3 Departamento de Medicina Preventiva y Salud Pública, Ciencias de la Alimentación, Toxicología y Medicina Legal, Facultad de Farmacia, Universitat de València, Burjassot, 46100 Valencia, Spain * Correspondence: [email protected]; Tel.: +34-96 390-0022 Received: 27 July 2018; Accepted: 18 August 2018; Published: 20 August 2018 Abstract: Nowadays it is widely accepted that non-Saccharomyces yeasts, which prevail during the early stages of alcoholic fermentation, contribute significantly to the character and quality of the final wine. Among these yeasts, Wickerhamomyces anomalus (formerly Pichia anomala, Hansenula anomala, Candida pelliculosa) has gained considerable importance for the wine industry since it exhibits interesting and potentially exploitable physiological and metabolic characteristics, although its growth along fermentation can still be seen as an uncontrollable risk. This species is widespread in nature and has been isolated from different environments including grapes and wines. Its use together with Saccharomyces cerevisiae in mixed culture fermentations has been proposed to increase wine particular characteristics. Here, we review the ability of W. anomalus to produce enzymes and metabolites of oenological relevance and we discuss its potential as a biocontrol agent in winemaking. Finally, biotechnological applications of W. anomalus beyond wine fermentation are briefly described. Keywords: non-Saccharomyces yeasts; Wickerhamomyces anomalus; Pichia anomala; enzymes; glycosidases; acetate esters; biocontrol; mixed starters; wine 1.
    [Show full text]
  • Enzymatic Profiles and Antimicrobial Activity of the Yeast Metschnikowia Pulcherrima
    Acta Innovations ISSN 2300-5599 2017 no. 23: 17-24 17 Ewelina Pawlikowska, Dorota Kręgiel Technical University of Lodz, Faculty of Biotechnology and Food Sciences, Institute of Fermentation Technology and Microbiology Wólczańska 171/173, 90-924 Lodz, [email protected] ENZYMATIC PROFILES AND ANTIMICROBIAL ACTIVITY OF THE YEAST METSCHNIKOWIA PULCHERRIMA Abstract The aim of the study was to characterize the antimicrobial properties of 5 strains belonging to the yeast species Metschnikowia pulcherrima. The antimicrobial activity of the strains was studied by observing pulcherrimin production and inhibition of microbial growth on YPG plates. Enzymatic assays were carried out using API ZYM tests. All strains of M. pulcherrima showed α-glucosidase and leucine arylamidase activities. The widest spectrum of activity was observed for strains NCYC2321, CCY145, and CCY149. All tested strains produced pucherrimin, and the yeasts Wickerhamomyces anomalus and Dekkera bruxellensis, the bacterium Bacillus subtilis and the moulds Penicillium chrysogenum and Aspergillus brasiliensis were the most sensitive to M. pulcherrima. Key words Metschnikowia pulcherrima, pulcherrimin, enzymatic activity, antagonism. Introduction As the world's population continues to grow, the global demand for food will also continue to increase. The ability to feed everyone depends upon the increase in food production and the length of storage capacity. The most popular way to prolong food usefulness is to use artificial chemicals such as pesticides. However, many of these substances are toxic to humans and are very harmful to the environment [1]. Due to the growing awareness of public opinion regarding the harmful effects to health and the environment, as well as the increasing resistance to pathogens, scientists have been interested in natural alternatives for a long time.
    [Show full text]
  • Determination of Spoilage Yeasts in Different Red and White Wines
    Kantor A. et al./Scientific Papers: Animal Science and Biotechnologies, 2016, 49 (2) Determination of Spoilage Yeasts in Different Red and White Wines Attila Kántor1, Jana Petrová1, Lukáš Hleba1, Maciej Kluz2, Miroslava Kačániová1 1Slovak University of Agriculture in Nitra, 949 76, Tr. A. Hlinku 2, Nitra, Slovakia 2University of Rzeszów, Zelwerowicza 4, 35-601, Rzeszów, Poland Abstract The aim of this study was to isolate and identify yeast species in wine samples from five different countries, and determine the genera of spoilage yeasts. One hundred and thirty four (no. 134) wine samples (86 white and 48 red wine); (30 bottled, 104 tank wine) from five countries Slovakia (no. 53), Czech Republic (no. 17), Hungary (no. 6), Spain (no. 32) and Italy (no. 26) were used in this study. Yeasts were cultivated on Malt extract agar supplemented with bromocresol green. After cultivation, yeasts were identified on species level by MALDI-TOF mass spectrometry. We identify 10 yeasts genera from total of 285 isolates; Saccharomyces (97 isolates, 1 species), Pichia (120 isolates, 5 species), Kregervanrija (6 isolates, 1 species), Zygosaccharomyces (32 isolates, 2 species), Candida (13 isolates, 2 species), Rhodotorula (4 isolates, 1 species), Wickerhamomyces (7 isolates, 1 species) Meyerozyma (4 isolates, 1 species) and genera with only 1 isolate and species: Torulaspora, and Cyberlindnera. Keywords: yeasts; wine samples; MALDI-TOF MS. 1. Introduction Zygosaccharomyces. The last two genera of yeast are as ethanol tolerant as Saccharomyces In fermented alcoholic beverages, the concept of cerevisiae and may be found in bottled wine. spoilage yeast has a more complex meaning than Their presence is influenced by the degree of in non-fermented foods, where any yeast able to filtration that precedes bottling and cellar hygiene change food sensorial characteristics can be during bottling.
    [Show full text]
  • 1 May 31, 2016 Centromeres of the Yeast Komagataella Phaffii (Pichia Pastoris) Have a Simple Inverted-Repeat Structure Aisling Y
    bioRxiv preprint doi: https://doi.org/10.1101/056382; this version posted May 31, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. May 31, 2016 Centromeres of the yeast Komagataella phaffii (Pichia pastoris) have a simple inverted-repeat structure Aisling Y. Coughlan1, Sara J. Hanson1, Kevin P. Byrne1 and Kenneth H. Wolfe*,1 1UCD Conway Institute, School of Medicine, University College Dublin, Dublin 4, Ireland *Corresponding author: E-mail: [email protected] Abstract Centromere organization has evolved dramatically in one clade of fungi, the Saccharomycotina. These yeasts have lost the ability to make normal eukaryotic heterochromatin with histone H3K9 methylation, which is a major component of pericentromeric regions in other eukaryotes. Following this loss, several different types of centromere emerged, including two types of sequence-defined (‘point’) centromeres, and the epigenetically-defined ‘small regional’ centromeres of Candida albicans. Here we report that centromeres of the methylotrophic yeast Komagataella phaffii (formerly called Pichia pastoris) are structurally-defined. Each of its four centromeres consists of a 2-kb inverted repeat (IR) flanking a 1-kb central core (mid) region. The four centromeres are unrelated in sequence. CenH3 (Cse4) binds strongly to the cores, with a decreasing gradient along the IRs. This mode of organization resembles Schizosaccharomyces pombe centromeres but is much more compact and lacks the extensive flanking heterochromatic otr repeats. Different isolates of K. phaffii show polymorphism for the orientation of the mid regions, due to recombination in the IRs.
    [Show full text]
  • The Quest for a General and Reliable Fungal DNA Barcode
    The Open Applied Informatics Journal, 2011, 5, (Suppl 1-M6) 45-61 45 Open Access The Quest for a General and Reliable Fungal DNA Barcode Vincent Robert*,1, Szaniszlo Szöke1, Ursula Eberhardt1, Gianluigi Cardinali2, Wieland Meyer3, Keith A. Seifert4, C. Andre Lévesque4 and Chris T. Lewis4 1CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands 2Dipartimento Biologia Applicata- Microbiologia, Università degli Studi di Perugia, Perugia, Italy 3Molecular Mycology Research Laboratory, CIDM, Westmead Millennium Institute, SEIB, Sydney Medical School - Westmead Hospital, The University of Sydney, Sydney, Australia 4Biodiversity (Mycology & Botany), Eastern Cereal and Oilseed Research Centre, Agriculture & Agri-Food Canada, Ottawa, Canada Abstract: DNA sequences are key elements for both identification and classification of living organisms. Mainly for historical reasons, a limited number of genes are currently used for this purpose. From a mathematical point of view, any DNA segment, at any location, even outside of coding regions and even if they do not align, could be used as long as PCR primers could be designed to amplify them. This paper describes two methods to search genomic data for the most efficient DNA segments that can be used for identification and classification. Keywords: Genome, molecular, sequences, barcoding, identification, classification, fungi. 1. INTRODUCTION When first large molecular phylogenetic studies were completed, it was obvious that many clades were poorly Since the early days of classification, taxonomists have supported statistically when only one or two genes were struggled with the available information and characteristics used. Recently, several authors explored possibilities for of their organisms of interest to develop systems that reflect analyzing several genes to obtain the true phylogeny [1-7].
    [Show full text]
  • Applications of DNA Bar Coding in Molecular Systematics of Fungi: a Review
    Int. J. of Life Sciences, Special Issue, A7 | December, 2016 ISSN: 2320-7817 |eISSN: 2320-964X REVIEW ARTICLE Applications of DNA bar coding in molecular systematics of fungi: A review Gosavi Mahavir C Department of Botany, SIES College of Arts, Science & Commerce, Sion (W), Mumbai 400022. [email protected] Manuscript details: ABSTRACT Available online on Fungi are a large, diverse and economically important group of http://www.ijlsci.in organisms. Estimates of the actual number of fungal species vary widely from 1.5 million to 13.5 million, with fewer than 100,000 now known. ISSN: 2320-964X (Online) Some fungi have relative complex and conspicuous morphologies, but ISSN: 2320-7817 (Print) others have very simple morphologies. Identification of fungi isolated from samples in laboratories is mainly based on observing morphology Editor: Dr. Arvind Chavhan under the microscope and use of various cultural techniques. These conventional methods are very time-consuming and laborious. It usually Cite this article as: requires several weeks for the fungi to grow sufficiently on culture Gosavi Mahavir C (2016) media, and the identification processes on fungal phenotypic structure. Applications of DNA bar coding in DNA barcoding techniques have provided standardized, reliable and cost- molecular systematics of fungi: A effective methods for fungal species identification. Gene sequencing and review, Int. J.of. Life Sciences, Special phylogenetic analysis targeting the internal transcribed spacer (ITS) Issue, A7:111-115. region in the fungal genomes are the most commonly used molecular methods for fungal identification. The ITS region has been heavily used in both molecular methods and ecological studies of fungi, due to its high Copyright: © Author, This is an degree of interspecific variability, conserved primer sites and multiple open access article under the copy nature in the genome.
    [Show full text]
  • Prospects for Fungus Identification Using CO1 DNA Barcodes, with Penicillium As a Test Case
    Prospects for fungus identification using CO1 DNA barcodes, with Penicillium as a test case Keith A. Seifert*†, Robert A. Samson‡, Jeremy R. deWaard§, Jos Houbraken‡, C. Andre´ Le´ vesque*, Jean-Marc Moncalvo¶, Gerry Louis-Seize*, and Paul D. N. Hebert§ *Biodiversity (Mycology and Botany), Environmental Sciences, Agriculture and Agri-Food Canada, Ottawa, ON, Canada K1A 0C6; ‡Fungal Biodiversity Centre, Centraalbureau voor Schimmelcultures, 3508 AD, Utrecht, The Netherlands; §Biodiversity Institute of Ontario, University of Guelph, Guelph, ON, Canada N1G 2W1; and ¶Department of Natural History, Royal Ontario Museum, and Department of Ecology and Evolutionary Biology, University of Toronto, Toronto, ON, Canada M5S 2C6 Communicated by Daniel H. Janzen, University of Pennsylvania, Philadelphia, PA, January 3, 2007 (received for review September 11, 2006) DNA barcoding systems employ a short, standardized gene region large ribosomal subunit (2), the internal transcribed spacer (ITS) to identify species. A 648-bp segment of mitochondrial cytochrome cistron (e.g., refs. 3 and 4), partial ␤-tubulin A (BenA) gene c oxidase 1 (CO1) is the core barcode region for animals, but its sequences (5), or partial elongation factor 1-␣ (EF-1␣) se- utility has not been tested in fungi. This study began with an quences (6), and sometimes other protein-coding genes. examination of patterns of sequence divergences in this gene The concept of DNA barcoding proposes that effective, broad region for 38 fungal taxa with full CO1 sequences. Because these spectrum identification systems can be based on sequence results suggested that CO1 could be effective in species recogni- diversity in short, standardized gene regions (7–9). To date, this tion, we designed primers for a 545-bp fragment of CO1 and premise has been tested most extensively in the animal kingdom, generated sequences for multiple strains from 58 species of Pen- where a 648-bp region of the cytochrome c oxidase 1 (CO1) gene icillium subgenus Penicillium and 12 allied species.
    [Show full text]
  • Dual DNA Barcoding for the Molecular Identification of the Agents Of
    Dual DNA Barcoding for the Molecular Identification of the Agents of Invasive Fungal Infections Minh Thuy Vi Hoang, Laszlo Irinyi, Sharon Chen, Tania Sorrell, Wieland Meyer, The Isham Barcoding of Medical Fungi Working Group, Stephane Ranque To cite this version: Minh Thuy Vi Hoang, Laszlo Irinyi, Sharon Chen, Tania Sorrell, Wieland Meyer, et al.. Dual DNA Barcoding for the Molecular Identification of the Agents of Invasive Fungal Infections. Frontiers in Microbiology, Frontiers Media, 2019, 10, 10.3389/fmicb.2019.01647. hal-02481964 HAL Id: hal-02481964 https://hal-amu.archives-ouvertes.fr/hal-02481964 Submitted on 26 Mar 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License fmicb-10-01647 July 17, 2019 Time: 17:32 # 1 ORIGINAL RESEARCH published: 18 July 2019 doi: 10.3389/fmicb.2019.01647 Dual DNA Barcoding for the Molecular Identification of the Agents of Invasive Fungal Infections Minh Thuy Vi Hoang1,2, Laszlo Irinyi1,2,3, Sharon C. A. Chen1,3,4, Tania C. Sorrell1,2,3,
    [Show full text]
  • The Identification of Meyerozyma Guilliermondii from Blood Cultures
    + Models MYCMED-716; No. of Pages 8 Journal de Mycologie Médicale (2017) xxx, xxx—xxx Available online at ScienceDirect www.sciencedirect.com ORIGINAL ARTICLE/ARTICLE ORIGINAL The identification of Meyerozyma guilliermondii from blood cultures and surveillance samples in a university hospital in Northeast Turkey: A ten-year survey a, b b N. Cebeci Güler *, ˙I. Tosun , F. Aydin a Department of Medical Microbiology, Faculty of Medicine, Giresun University, Giresun, Turkey b Department of Medical Microbiology, Faculty of Medicine, Karadeniz Technical University, Trabzon, Turkey Received 8 March 2017; accepted 17 July 2017 KEYWORDS Summary Meyerozyma (Pichia) guilliermondii exists in human skin and mucosal surface Meyerozyma microflora. It can cause severe fungal infections like candidemia, which is an opportunistic guilliermondii; pathogen. One hundred and forty-one M. Guilliermondii isolates, consisting of 122 blood culture Candida isolates, belonging to 126 patients; 13 total parenteral nutrition solution isolates; and two rectal membranifaciens; swab isolates were identified according to carbohydrate assimilation reactions in a university Blood culture; hospital in Turkey between January 2006 and December 2015. Following Candida albicans ITS; (34.0%) and C. Parapsilosis (21.2%), the third yeast species most commonly isolated from blood IGSAF; cultures in the Farabi Hospital was M. guilliermondii (20.6%). The patients were hospitalised in Antifungal MIC 27 different departments. A total of 50% of the patients were in pediatric departments, 49.2% were in intensive care units, and 17.2% were in haematology-oncology departments. Molecular identification of the isolates was performed using DNA sequence analysis of ribosomal ITS gene regions and IGS amplification-AluI fingerprinting (IGSAF).
    [Show full text]
  • Metschnikowia Pulcherrima and Related Pulcherrimin-Producing Yeasts: Fuzzy Species Boundaries and Complex Antimicrobial Antagonism
    microorganisms Review Metschnikowia pulcherrima and Related Pulcherrimin-Producing Yeasts: Fuzzy Species Boundaries and Complex Antimicrobial Antagonism Matthias Sipiczki Department of Genetics and Applied Microbiology, University of Debrecen, 4032 Debrecen, Hungary; [email protected] Received: 29 June 2020; Accepted: 10 July 2020; Published: 12 July 2020 Abstract: Yeasts affiliated with the Metschnikowia pulcherrima clade (subclade) of the large ascomycetous genus Metschnikowia frequently turn out to produce the characteristic maroon-red pulcherrimin when tested for pigment production and prove to exert antagonistic effects on many types of microorganisms. The determination of the exact taxonomic position of the strains is hampered by the shortage of distinctive morphological and physiological properties of the species of the clade and the lack of rDNA barcode gaps. The rDNA repeats of the type strains of the species are not homogenized and are assumed to evolve by a birth-and-death mechanism combined with reticulation. The taxonomic division is further hampered by the incomplete biological (reproductive) isolation of the species: certain type strains can be hybridized and genome sequencing revealed chimeric genome structures in certain strains that might have evolved from interspecies hybrids (alloploid genome duplication). Various mechanisms have been proposed for the antimicrobial antagonism. One is related to pulcherrimin production. The diffusible precursor of pulcherrimin, the pulcherriminic acid is secreted by the cells into the environment where it forms the insoluble pulcherrimin with the ferric ions. The lack of free iron caused by the immobilization of ferric ions inhibits the growth of many microorganisms. Recent results of research into the complexity of the taxonomic division of the pulcherrimin-producing Metschnikowia yeasts and the mechanism(s) underlying their antimicrobial antagonism are discussed in this review.
    [Show full text]