Newly Isolated Malic Acid Fermenting Yeast Meyerozyma Caribbica AY 33-1 for Bioconversion of Glucose and Cassava Pulp

Newly isolated malic acid fermenting yeast Meyerozyma caribbica AY 33-1 for bioconversion of glucose and cassava pulp

Thannapat Rattanapatpokin(1), Chakrit Tachaapikoon (1,2), Rattiya Waeonukul(1,2), Songsak Wattanachaisaereekul (2), Khanok Ratanakhanokchai(1) and Patthra Pason (1,2, *) ( ) 1 School of Bioresources and Technology, King Mongkut’s University of Technology Thonburi, Bangkuntein, Bangkok, 10150, Thailand (2)Pilot Plant Development and Training Institute, King Mongkut’s University of Technology Thonburi, Bangkuntein, Bangkok, 10150, Thailand *Corresponding author: [email protected]

ABSTRACT 1. INTRODUCTION

This study investigated the yeast species associated Malic acid (2-hydroxybutanedioic acid) is a with fermented foods in Thailand, focusing on dicarboxylic acid and a potential C4 platform identifying those that could combine the chemical. Malic acid was first isolated in 1785 by saccharification and fermentation (SSF) steps of Carl Wilhelm Scheele from unripe apples and an malic acid production from cassava pulp. One hundred nighty six isolated yeast were investigated important intermediate in cellular metabolism and a their ability to produce malic acid from glucose and constituent of the TCA cycle (Meek, JS., 1975). It cassava pulp. The result showed that only one has many applications as an acidulant and flavor isolate, AY33-1, proved to have amylase, xylanase enhancer, which was widely used in the beverage and cellulase activities that crucial for cassava pulp and food industry and used in metal cleaning, saccharification ,which malic acid was identified as fabric dying, water treatment, textile finishing, a key product for the growth on cassava pulp. agriculture and pharmaceuticals (Wang et al., 2016; Sequence analysis of the internal transcribed spacer (ITS) and 26S rDNA region indicated that the Chi , et al.,2014 ) In general, malic acid synthesizes isolated strain was closely related to the species from petroleum-based through either hydration of Meyerozyma caribbica with 99.8% similarity. fumaric or maleic acid under high temperature and Malic acid production from strain AY33-1 on YPD pressure (Goldberg, et al., 2006). In recent years, supplement with 10% glucose was 11.5 g/L and the production of this organic acid from coproducts the productivity was 0.36 g/L/h. Maximum amount of industrial bioprocessing has been investigated. of malic acid production from 10% glucose was Microorganisms have been found to be able to 22.7 g/L and the productivity was 0.53 g/L/h in the basal medium. The yield of malic acid was produce malic acid from a variety of carbon increased with 4.45 folds compared with that of sources, including glucose, fructose, sucrose, Basal medium from YPD. Meyerozyma caribbica maltose and other carbohydrates (Battat, et al., AY33-1 was the multiple enzymatic yeasts 1991). Various microorganisms were reported to containing of 17.35U/mg amylase, 5.12 U/mg produce malic acid from mostly glucose by cellulase, 7.98 U/mg xylanase and also produced fermentation such as Aspergillus species (Battatet, pullulanase when grown on cassava pulp. Our results indicate that the isolated AY33-1 is et al., 1991; West, 2011), Penicillium sp. K034 effective on direct malic acid from cassava pulp (1 (Wang, et al., 2013) and also certain yeasts to g/L of malic acid), suggesting the promising yeast convert glucose into malic acid has been reported for developing high value-added products from (Taing &Taing., 2007) but no report for direct cassava pulp. malic acid from cassava plup before. Yeasts are used by humans for thousands of years with wide Keywords: Malic acid, Yeast, Cassava pulp, applications, both fundamental and industrial, in Meyerozyma caribbic. AY33-1, Direct fermentation science, food, medical and agricultural. Thus, the main objectives of this study were carried out to select yeasts from different sources that can be able to produce high levels of L-malic acid.

Ⓒ Shibaura Institute of Technology, ONLINE ISSN 2435-2993, SEATUC Journal of Science and Engineering, 2019. Volume 1 Fermentation process has been studied prior the colony was transferred into YPD broth containing actively transforming glucose to high levels of L- 10% glucose and incubated at 37°C, 200 rpm for malic acid but a few studies have been report about overnight. For medium preparation, the culture malic acid production from lignocellulose biomass. contained 50 ml of YPD into 250 ml shake-flasks. Thailand is the world’s largest cassava starch All medium was sterilized in the autoclave at exporter. Cassava pulp, a by-product of cassava 121°C and 15 psi for 15 min. The flasks were starch industry, is produced in large amounts and aerobically grown at 37°C and 200 rpm for 2 days. mainly contains starch (60%) and cellulose fiber The culture obtained was centrifuged at 8,000×g (20%)(Sriroth, K et al.,1994; Sriroth, K et al.2000). and 4°C for 5 min. Malic acid in the supernatant The transformation of these agro industrial wastes was obtained, and quantitative determination of with high level of starch into malic acid requires malic acid was performed as described below amylolytic, cellulolytoc and xylanolytic strains with strong potential to hydrolyze starch and fiber. 2.3 Analytical methods The challenge of using lignocellulosic biomass is the cost of enzymes (amylase, cellulases and For malic acid analysis, the fermentation broth was xylanases) to degrade the biomass to fermentable centrifuged at 8000 rpm for 10 min, and the sugars (glucose or xylose). Here carbohydrate supernatant was separated by ultrafiltration. The degrading yeast is promising technology for sample was analyzed for malic acid using high consolidate bioprocess of malic acid production performance liquid chromatography (HPLC; RID- from cassava pulp. However, multiple enzyme 10A, Shimadzu, Japan) with an Aminex HPX-87H yeast have not been cited frequently; few of the column (Bio-Rad, Hercules, CA) operated at 50°C notable examples of amylolytic and xylanolytic using 50 mM H2SO4 as the mobile phase at a flow yeast include Candida tropicalis, Pichia stiptis rate of 0.6 mL/min, and a UV detector at 230 nm (Lee, et al., 1987) and Aurobasidium pullulans (Dong, et al., 2014). (Leather, et al., 1984). Also, its ability to produce malic acid from glucose and cassava pulp by the yeast Meyerozyma caribbica in a fermentation 2.4 Morphological analysis and identification of process has not been studied before. AY33-1 Here, the main objectives of this study were to isolate and identify yeast strains and characteristic The yeast strain AY33-1 was inoculated on YPD of Meyerozyma caribbica to produce malic acid agar for microscopic analysis and colony characters. After overnight, it was observed by from glucose and cassava pulp with high cassava microscope for morphological characters. For DNA pulp degrading enzyme activity. extraction, PCR amplification, sequencing, and phylogenetic analysis, total genomic DNA from the 2. EXPERIMENT strain AY33-1 were extracted according to the methods described by Sambrook, et al. (1989),. 2.1 Isolate yeast strain for malic acid To estimate phylogenetic relationships among production. strain AY33-1 and the typical strains reported on internet, amplification and sequencing of ITS (Internal transcribed spacer) from the strain AY33- The yeast strain used in this study was isolated 1 were performed using the primers IT5:5’- from fermented fruit and rice, then purified single TCCGTAGGTGAACCTGCGG -3’ and IT6: 5’- colony using a streak plate technique on YPD agar TCCTCCGCTTATTGATATGC -3’ (Josefa,et al., plates containing 20 g/L glucose, 20 g/L peptone, 2004) and 26S rDNA, NL-1:5’-G CATATCAA 10 g/L yeast extract and 20 g/L agar. The forming TAAGCGGAGGAAAAG-3’ and NL-4:5’-GGT colonies on plates were incubated at 37°C for CCGTGTTTCAAGACGG-3’ (Sugita, et al., 2003). overnight. Then, a single colony was used and 2.5 Effect of the medium for malic acid transferred into YPD agar containing 1 g/L of production bromocresol green after that incubated at 37°C

A total of 10% of the cultures was inoculated into 2.2 Screening of yeasts for malic acid production the flask containing 500 ml in YPD medium and limiting nitrogen medium (basal medium) For inoculum preparation, colonies of yeast strains contained glucose (100 g/L), KH PO (0.5 g/L), were sub-cultured on YPD plate and incubated at 2 4 MgSO .7H O (0.5 g/L), yeast extract (1 g/L) and 37°C for an overnight before use. Then, a single 4 2

Ⓒ Shibaura Institute of Technology, ONLINE ISSN 2435-2993, SEATUC Journal of Science and Engineering, 2019. Volume 1 CaCO3 (30 g/L) or YPD medium contained glucose 3. RESULTS AND DISCUSSION (100 g/L), peptone (20 g/L),yeast extract (1 g/L ) and CaCO3 (30 g/L). The samples were collected at 3.1 Screening of the yeast strain for their ability a time every 4 h. until 48 h. The sample was to produce high level of malic acid analyzed by HPLC to determine its malic acid content can be followed at step 2.3 and growth was From 196 yeast isolates obtained from fermented determined using a standard plate count (Chandra, fruit and fermented rice, only 98 strains could et al., 2018) and reducing sugar mainly (glucose) directly change the color bromocresol green of were determined by with the 3,5-dinitrosalicylic plate (Fig.1) and morphology was studied to select acid (DNS) colorimetric method (Hu, et al. , 2008) only yeast form. They were then screened to determine their ability to produce malic acid. 2.6 Malic acid production from cassava pulp Among of malic acid production yeast, highest malic acid (8.2 g/L) was produced by the strain Malic acid fermentation by yeast in cassava pulp AY33-1 (Fig. 2). Thus, the strain AY33-1 was substrate was studied. Batch cultivation of isolated selected for further identification and research. strain AY33-1 was carried out in a shake flask containing YP medium with 1% (w/v) cassava pulp. The culture was grown under aerobic conditions with shaking 200 rpm at 37°C. The culture was examined at 0, 24, 48, 72, 120 and 168 h. Samples were centrifuged at 8,000 x g and the culture supernatant was assayed for malic acid and enzyme assay

2.7 Enzyme activity on plate Fig. 1 Organic acid production in bromocresol For detection of amylase, cellulase and xylanase green containing on plate production; the yeast strain was grown on YP broth (1% yeast and 2% peptone) containing 1% (w/v) starch, carboxymethyl cellulose (CMC) or xylan with 2% (w/v) agar, and were incubated at 37°C overnight. After incubation and formation of colonies, the plates were stained with iodine for amylase determination, and Congo red for CMCase and xylanase determination (Thongekkaew, et al., 2008). The formation of a clear zone “halo” around a colony indicated a positive test.

2.8 Enzyme activity assay

Amylase, pollulanase, glucoamylase, cellulase and xylanase were determined as described previous using starch, carboxymethyl cellulose (CMC) or Fig. 2 Titers of malic acid produced by various xylan as the substrate, respectively at pH 6 and yeast strains in shake-flasks at 37°C for 48 h. 60°C for 15 min. The released sugar was determined by the 3,5-dinitrosalicylic acid (DNS) colorimetric method (Hu et al. , 2008). Protein 3.2 Morphological analysis and identification of concentrations were measured by the Lowry AY 33-1 method (Lowry et al., 1951) using boving serum For screening the microorganism with high cassava albumin as the standard. One unit (U) of enzyme pulp degrading enzyme activity strain AY33-1 was activity was defined as the amount of 1 μmol of identified by colony assay. After culturing on reducing sugar per liter of enzymes per min, medium containing starch, xylan or CMC, and measured as glucose under the conditions of assay following the stain tests, strain AY33-1 showed (Ouédraogo,N et al.,2012). clear zones around the colonies stained with iodine and Congo red (Fig. 3). Therefore, it was considered an amylase, cellulase, and xylanase- producing strain. Relatively, a few yeasts can

Ⓒ Shibaura Institute of Technology, ONLINE ISSN 2435-2993, SEATUC Journal of Science and Engineering, 2019. Volume 1 produce lignocellulose-degrading enzymes. For Table 1 Similarity between ITSs or between example, Candida guilliermondi produces α- 26SrDNAs of the strain AY33-1 and other strains amylase (Ouédraogo, et al., 2012), Pichia stipites produces high-activity xylanases (Ding, et al., Similarity of The relatives 2018) and Tetracladium sp. and Mrakia gelida ITS or 26s produce amylase and cellulase, respectively 99.83 % Meyerozyma caribbica (LC415310.1) (Carrasco, et al., 2016). In this case, Meyerozyma 99.83 % Meyerozyma guilliermondii isolate SDG caribbica AY33-1 produced the entire 99.50 % Candida fermentati strain EXOC5 99.34 % Pichia caribbica strain ACE11 lignocellulolytic enzymes, consisting of amylase, cellulase, and xylanase. . Meyerozyma caribbica and Meyerozyma guilliermondii are closely related to yeast species complex (Bai, et al. 2000; Vaughan-Martini et al., 2005). It is interesting properties and applications (Papon, et al., 2013) such as employed in riboflavin production (Tanner, et al., 1945) and the bioconversion of xylose into xylitol (Zou, et al., 2010) and this is the first report about Meyerozyma Fig. 3 Activity test on amylase, xylanase and caribbica that can produce malic acid. cellulose activity on starch (a), xylan (b) and cellulose (c) containing agar plate 3.3 Effect of the medium for malic acid production

The phylogenetic affiliation of the strain AY33-1 Generally, three metabolic pathways for the was investigated by analyzing the sequence of production of L-malic acid from glucose include DNA ITS domains. The obtained 571-bp non-oxidative pathway, oxidative pathway and L- nucleotide DNA ITS sequence was aligned using malic acid from the glyoxylate cycle(Chi, et al., the National Center for Biotechnology Information 2014).The high C/N ratio in the medium must be (NCBI) database, and the comparison showed an for microbial malate biosynthesis containing a high excellent agreement of the sequences (Table 1) glucose concentration, a limiting amount of with those of Meyerozyma (Pichia) caribbica strain nitrogen and a neutralizing agent (CaCO3) and XTWJX (LC4153.1) and Meyerozyma caribbica malate dehydrogenase are essential for its malic (LC415310.1) (99%) (Fig. 4) acid production and accumulation (Knuf, et

al.,2013). The medium in which CaCO3 plays an

Fig 4 Characterization of the strain Ay 33-1 on morphology (a) microscopy of stained yeast cells (b) and phylogenetic tree (c)

Ⓒ Shibaura Institute of Technology, ONLINE ISSN 2435-2993, SEATUC Journal of Science and Engineering, 2019. Volume 1 important role in malate biosynthesis by keeping Therefore, this is the first report that the pH constant of around 6.5 and providing CO2 as a Meyerozyma caribbica strain can be a candidate for substrate for efficient production of malate. malic acid production. Under the basal medium (Goldberg et al., 2006). Time course of malic acid conditions, this medium contains the lowest total production, cell growth, pH and residual sugar nitrogen of those tested, malic acid production is concentration change during the batch fermentation supported by growth limitation the titer of malic in a shake-flask. Malic acid 11.5 g/L was produced acid was 22.7 g/L, and the productivity was 0.53 from 100 g/L of glucose, 20 g/L of peptone and g/L /h. The growth phase (lag and log) starts from 0 10 g/L of yeast extract at 42 h. in batch to 16 h. and the stationary phase after 16 h. Best of fermentation with a malic acid productivity of 0.36 cell growth took place within 16 h. accompanied by g/L.h. Malic acid accumulate after the growth consumption of about lost the glucose initially phase, after consumption of glucose and continued present that malic acid production takes place until 48 hours. The growth phase (lag and log) start primarily during growth limitation. (Fig.6) Dakin, from 0 to 24 h. and the stationary phase start at 20 HD (1924), described that when using the limiting h. (Fig. 5) that observed that malic acid production nitrogen as theory, it is divided into two stages from stationary phase and Meyerozyma caribbica. which the first stage is biomass conversion and the AY 33-1 can synthesize malic acid from glucose second is about converting the remaining glucose and secrete it into the medium. into malic acid.

Fig 5 The time course of malic acid production, cell growth, pH and residual sugar concentration change during the batch fermentation in a shake-flasks at 37°C and 200 rpm. (YPD medium)

Ⓒ Shibaura Institute of Technology, ONLINE ISSN 2435-2993, SEATUC Journal of Science and Engineering, 2019. Volume 1 Fig 6.The time course of malic acid production, cell growth, pH and residual sugar concentration change during the batch fermentation in a shake-flask at 37°C and 200 rpm. (Basal medium)

3.4 Fermentation study in shake-flasks from However, there is limited research on malic acid cassava pulp production from direct fermentation of starch and lignocellulosic biomass employing yeasts because Meyerozyma caribbica AY33-1 grown on solid of the activity of enzyme but in this case, cassava pulp substrate at 37°C, 200 rpm (Fig. 8), Meyerozyma caribbica AY33-1 produced the AY33-1 could utilize cassava pulp for growth at entire cassava pulp degrading enzymes, consisting 37C, and its growth was indicative of cassava pulp of amylase, pullulanase, glucoamylase, cellulase, degradation. It directly produced malic acid (1 g/L) and xylanase .These enzymes are necessary for utilizing 1% cassava pulp and the degradation degrading cassava pulp (Table 2) progressed as malic acid production increased (Fig. 7). Malic acid production was observed after 24 h. Table2. Enzyme activity assay of cultivation, and its products rapidly increased from 72 to 162 h. Specific Action of Substrate activity enzyme (U/mg protein)

Amylase Starch 17.35 Pullulanase Pullulan 4.69 Glucoamylase Maltose 0.46 Xylanase Xylan from 7.89 Birchwood xylan Cellulase Cellulose 5.12

Fig.7 Malic acid production from 1% cassava pulp by AY33-1 for different cultivation times

Figure 8 Appearance of Ay 33-1 grown on solid cassava pulp substrate at 37°C,200 rpm and different cultivation times (0, 24, 72,120 and 168 hours

4.CONCLUSIONS Battat, E., Peleg, Y., Bercovitz, A., Rokem, J.S., Goldberg, I., Optimization of Lmalic acid The present results show current knowledge of production by Aspergillus flavus in a stirred malic acid and enzyme production by newly fermentor, Biotech Bioeng., vol. 37, pp. 1108– isolated yeasts Meyerozyma caribbica AY33-1. 1116, 1991. This is the first report of Meyerozyma caribbica on malic acid production capability using glucose and Bautista-Rosales, P. U., Calderon-Santoyo, M., cassava pulp. The result clearly show that Servín-Villegas, R., Ochoa-Á lvarez, N. A., & optimization on malic acid production from Ragazzo-Sánchez, J. A., Action mechanisms of the Meyerozyma caribbica AY33-1 was enhance by yeast Meyerozyma caribbica for the control of the limit nitrogen media like Basal media. We also phytopathogen Colletotrichum gloeosporioides in observed that Meyerozyma caribbica AY33-1 mangoes, Biol Cont., vol, 65, No. 3, pp. 293–301, produced amylase, pullulanase, glucoamylase, 2013. cellulase and xylanase enzymes that necessary for cassava pulp degrading and malic acid production Chandra R, Sharma P, Yadav S and Tripathi S., when grown on cassava pulp. This is the challenge Biodegradation of Endocrine-Disrupting Chemicals on direct malic acid production using agricultural andResidual Organic Pollutants of Pulp and Paper waste that are rich in starch and lignocellulosic. Mill Effluent by Biostimulation, Front. Microbiol., vol.9.pp.960, 2018.

Chi, Z., Wang, Z.-P., Wang, G.-Y., Khan, I., & ACKNOWLEDGMENTS Chi, Z.-M., Microbial biosynthesis and secretion of l-malic acid and its applications. Crit rev We acknowledge the Enzyme Technology biotechnol., vol. 36, No. 1, pp. 99–107, 2014. Laboratory and Systems Biology and Bioinformatics Laboratory, King Mongkut’s Carrasco, M., Villarreal, P., Barahona, S., Alcaíno, University of Technology Thonburi, Thailand. The J., Cifuentes, V., & Baeza, M., Screening and authors acknowledge the financial support provided characterization of amylase and cellulase activities by King Mongkut’s University of Technology in psychrotolerant yeasts, BMC Microbiol., vol. 16, Thonburi through the “KMUTT 55th Anniversary No. 21, 2016. Commemorative Fund” The authors greatly acknowledge the financial support provided by The National Research Council of Thailand (NRCT) Ding, C., Li, M., & Hu, Y., High-activity under the Graduated research scholarship in the production of xylanase by Pichia stipitis : year 2019, Contract No. 2562RPCS32544 Purification, characterization, kinetic evaluation and xylooligosaccharides production. Int. J. Biol Macromol, vol. 117, pp. 72–77, 2018. REFERENCES Dong, J., Du, Y., Zhou, Y., Yang, S.T., Butanol production from soybean hull and soy molasses by Bai, F. Y., H. Y. Liang, and J. H. Jia., Taxonomic acetone-butanol-ethanol fermentation. In: Robert relationships among the taxa in the Candida Brentin(Ed.), Soy-Based Chemicals and Materials, guilliermondii complex, as revealed by ACS, vol. 1178, Ch 2, pp. 25–41, 2014. comparative electrophoretic karyotyping, Int. J. Syst. Evol. Microbiol., Vol. 50, pp. 417– 422, 2000.

Ⓒ Shibaura Institute of Technology, ONLINE ISSN 2435-2993, SEATUC Journal of Science and Engineering, 2019. Volume 1 Dakin, HD., The formation of L-malic acid as a emerging clinical importance and recent advances product of alcoholic fermentation by yeast, J. Biol. in genetics, Current Genetics, Vol. 59, pp. 73–90, Chem. vol.61.pp.139-145,1924 2013.

Goldberg, I., Rokem JS., Pines, O., Organic acids: Sambrook, J., Fritsch, EF., Maniatis, T., old metabolites, new themes. J. Chem Technol Preparation and analysis of eukaryotic genomic Biot, vol. 81, pp. 1601–1611, 2006. DNA. In: Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor Laboratory Press, Josefa, MCJ., Lyibia, MC.MR., Molecular Beijing., pp. 367–370, 1989. characterization and ecological properties of wine yeasts isolated during spontaneous fermentation of Sriroth, K., Recent developments in cassava six varieties of grape must, Food Microbiol, vol. utilization in Thailand. In: Proceedings of the 21, pp. 149–155, 2004. second international scientific meeting of the cassava biotechnology network. Centro Hu, R., Lin, L., Liu, T., Ouyang, P., He, B., & Liu, Internacional de Agricultura Tropical (CIAT), S., Reducing Sugar Content in Hemicellulose Bogor, pp. 690–701, 1994. Hydrolysate by DNS Method: A Revisit. J Biobased Mater Bio, vol.2 ,No, 156–161,2008 Sriroth, K., Chollakup, R., Chotineeranat, S. , Piyachomkwan, K., Oates, CG., Processing of Knuf, C., Nookaew, I., Brown, S. H., McCulloch, cassava waste for improved biomass utilization. M., Berry, A., & Nielsen, J., Investigation of Malic Biores Technol.vol 71. pp.63–69,2000 Acid Production in Aspergillus oryzae under Nitrogen Starvation Conditions. Appl. Environ. Sugita T, Takashima M, Kodama M, Tsuboi R, Microbiol. Vol.79.pp.6050–6058,2013 Nishikawa, A., Description of a new yeast species, Malassezia japonica, and its detection in patients Lowry, O, H., Rosebrough, N. J., Farr, A, L., and with atopic dermatitis and healthy subjects. Randall, R,J, Biochem,vol. 193, pp. 265-267,1951. JCM.vol.41.pp.4695–4699,2003.

Meek JS., The determination of a mechanism of Taing, O., Taing, K., Production of malic and isomerization of maleic acid to fumaric acid., J. succinic acids by sugar-tolerant yeast Chem Educat., vol. 52 , pp. 541-543, 1975. Zygosaccharomyces rouxii. Eur Food Leaathers, T.D., Kurtzman, C.P., Detroy, R.M., Res,vol.224.pp,343–7,2007. Overproduction and regulation of xylanase in Tanner, F. W., Jr., C. Vojnovich, and J. M. Van Aureobasidium pullulans and Cryptococcus Lanen., Riboflavin production by Candida species. albidus.Biotechnol.Bioeng.Symp.vol14.pp.225- Sci .vol.101.pp.180–181,1945 240,1984. Thongekkaew, J., Ikeda, H., Masaki, K. and Iefuji, Lee, H., To, R.J.B., Latta, R.K., Biely, P., H., An acidic and thermostable carboxymethyl Schneider, H., Some properties of extracellular cellulose from the yeast Cryptococcus sp. S-2: acetylxylan esterase produced by the yeast Purification, characterization and improvement of Rhodotorula muciloginosa. Appl. Environ. its recombinant enzyme production by high cell- Microbiol. vol53. pp.2831-2834,1987. density fermentation of Pichia pastoris. Protein Ouédraogo, N., Savadogo, A., Zongo, C., Somda, Expres Purificat.vol. 60.pp 140-146,2008. K. M. and Traoré, A. S., High performance Wang, J., Lin, M., Xu, M., Yang, S.T., Anaerobic amylolytic yeast strains isolation and identification fermentation for production of carboxylic acids as for valorization of potatoes waste available in bulk chemicals from renewable biomass. Adv Burkina Faso. Int. Food Res. J., Vol. 19, No. 4, pp. Biochem Eng Biotechno,2016. 1463-1469 . 2012. Wang GY, Chi Z, Song B, Wang ZP, Chi ZM., Ouédraogo, N., Savadogo, A., Zongo, C., Somda High level lipid production by a novel inulinase- K., M. A.,Traoré S., High performance amylolytic producing yeast Pichia guilliermondii Pcla22. yeast strains isolation and identification for Biores Technol.vol 124.pp 77–82,2012. valorization of potatoes waste available in Burkina Faso. Int. Food Res. J., Vol. 19, No. 4, pp. 1463- West, TP., Malic acid production from thin stillage 1469, 2012. by Aspergillus species. Biotechnol Lett, vol.33.pp 2463–7, 2011. Papon, N., V. Savini, A. Lanoue, A. J. Simkin, J. Crèche., Candida guilliermondii: biotechnological Vaughan-Martini, A., C. P. Kurtzman, S. A. Meyer, applications, perspectives for biological control, and E. B. O’Neill., Two new species in the Pichia

Ⓒ Shibaura Institute of Technology, ONLINE ISSN 2435-2993, SEATUC Journal of Science and Engineering, 2019. Volume 1 guilliermondii clade: Pichia caribbica sp. nov., the ascosporic state of Candida fermentati, and Candida carpophila comb. FEMS Yeast Res. vol 5.pp 463–469,2005

Zou, Y., Wang, G., Tu, Z., Zan, Wu, X., Adaptation and transcriptome analysisof Aureobasidium pullulans in corncob hydrolysate for increased inhibitortolerance to malic acid production. Plos One.vol.10,2015

Zou, Y. Z., K. Qi, X. Chen, X. L. Miao, and J. J. Zhong., Favorable effect of very low initial k L a value on xylitol production from xylose by a selfisolated strain of Pichia guilliermondii. J Biosci Bioeng. vol.109. pp. 149–152,2010

PHOTOS AND INFORMATION

Thannapat Rattanapatpokin

received the B.Eng. (2017) degree in Bioprocess Engineering from Silpakorn University. She is currently pursuing a master’s degree at School of Bioresources and Technology, King Mongkut's University of Technology Thonburi

Assoc. Prof. Dr. Patthra Pason received the B.Sc. degree (1999) from Khonkaen University, M.Sc. degree (2001) in Biochemistry from King Mongkut’s University of Technology Thonburi, Thailand and Ph.D. degree (2006) in Biochemistry from King Mongkut’s University of Technology Thonburi, Thailand. Her Current interests include bacteria and enzyme technology, biodegradation of plant biomass and Biorefinery.