Newly isolated malic acid fermenting yeast Meyerozyma caribbica AY 33-1 for bioconversion of glucose and cassava pulp Thannapat Rattanapatpokin(1), Chakrit Tachaapikoon (1,2), Rattiya Waeonukul(1,2), Songsak Wattanachaisaereekul (2), Khanok Ratanakhanokchai(1) and Patthra Pason (1,2, *) ( ) 1 School of Bioresources and Technology, King Mongkut’s University of Technology Thonburi, Bangkuntein, Bangkok, 10150, Thailand (2)Pilot Plant Development and Training Institute, King Mongkut’s University of Technology Thonburi, Bangkuntein, Bangkok, 10150, Thailand *Corresponding author: [email protected] ABSTRACT 1. INTRODUCTION This study investigated the yeast species associated Malic acid (2-hydroxybutanedioic acid) is a with fermented foods in Thailand, focusing on dicarboxylic acid and a potential C4 platform identifying those that could combine the chemical. Malic acid was first isolated in 1785 by saccharification and fermentation (SSF) steps of Carl Wilhelm Scheele from unripe apples and an malic acid production from cassava pulp. One hundred nighty six isolated yeast were investigated important intermediate in cellular metabolism and a their ability to produce malic acid from glucose and constituent of the TCA cycle (Meek, JS., 1975). It cassava pulp. The result showed that only one has many applications as an acidulant and flavor isolate, AY33-1, proved to have amylase, xylanase enhancer, which was widely used in the beverage and cellulase activities that crucial for cassava pulp and food industry and used in metal cleaning, saccharification ,which malic acid was identified as fabric dying, water treatment, textile finishing, a key product for the growth on cassava pulp. agriculture and pharmaceuticals (Wang et al., 2016; Sequence analysis of the internal transcribed spacer (ITS) and 26S rDNA region indicated that the Chi , et al.,2014 ) In general, malic acid synthesizes isolated strain was closely related to the species from petroleum-based through either hydration of Meyerozyma caribbica with 99.8% similarity. fumaric or maleic acid under high temperature and Malic acid production from strain AY33-1 on YPD pressure (Goldberg, et al., 2006). In recent years, supplement with 10% glucose was 11.5 g/L and the production of this organic acid from coproducts the productivity was 0.36 g/L/h. Maximum amount of industrial bioprocessing has been investigated. of malic acid production from 10% glucose was Microorganisms have been found to be able to 22.7 g/L and the productivity was 0.53 g/L/h in the basal medium. The yield of malic acid was produce malic acid from a variety of carbon increased with 4.45 folds compared with that of sources, including glucose, fructose, sucrose, Basal medium from YPD. Meyerozyma caribbica maltose and other carbohydrates (Battat, et al., AY33-1 was the multiple enzymatic yeasts 1991). Various microorganisms were reported to containing of 17.35U/mg amylase, 5.12 U/mg produce malic acid from mostly glucose by cellulase, 7.98 U/mg xylanase and also produced fermentation such as Aspergillus species (Battatet, pullulanase when grown on cassava pulp. Our results indicate that the isolated AY33-1 is et al., 1991; West, 2011), Penicillium sp. K034 effective on direct malic acid from cassava pulp (1 (Wang, et al., 2013) and also certain yeasts to g/L of malic acid), suggesting the promising yeast convert glucose into malic acid has been reported for developing high value-added products from (Taing &Taing., 2007) but no report for direct cassava pulp. malic acid from cassava plup before. Yeasts are used by humans for thousands of years with wide Keywords: Malic acid, Yeast, Cassava pulp, applications, both fundamental and industrial, in Meyerozyma caribbic. AY33-1, Direct fermentation science, food, medical and agricultural. Thus, the main objectives of this study were carried out to select yeasts from different sources that can be able to produce high levels of L-malic acid. 62 Ⓒ Shibaura Institute of Technology, ONLINE ISSN 2435-2993, SEATUC Journal of Science and Engineering, 2019. Volume 1 Fermentation process has been studied prior the colony was transferred into YPD broth containing actively transforming glucose to high levels of L- 10% glucose and incubated at 37°C, 200 rpm for malic acid but a few studies have been report about overnight. For medium preparation, the culture malic acid production from lignocellulose biomass. contained 50 ml of YPD into 250 ml shake-flasks. Thailand is the world’s largest cassava starch All medium was sterilized in the autoclave at exporter. Cassava pulp, a by-product of cassava 121°C and 15 psi for 15 min. The flasks were starch industry, is produced in large amounts and aerobically grown at 37°C and 200 rpm for 2 days. mainly contains starch (60%) and cellulose fiber The culture obtained was centrifuged at 8,000×g (20%)(Sriroth, K et al.,1994; Sriroth, K et al.2000). and 4°C for 5 min. Malic acid in the supernatant The transformation of these agro industrial wastes was obtained, and quantitative determination of with high level of starch into malic acid requires malic acid was performed as described below amylolytic, cellulolytoc and xylanolytic strains with strong potential to hydrolyze starch and fiber. 2.3 Analytical methods The challenge of using lignocellulosic biomass is the cost of enzymes (amylase, cellulases and For malic acid analysis, the fermentation broth was xylanases) to degrade the biomass to fermentable centrifuged at 8000 rpm for 10 min, and the sugars (glucose or xylose). Here carbohydrate supernatant was separated by ultrafiltration. The degrading yeast is promising technology for sample was analyzed for malic acid using high consolidate bioprocess of malic acid production performance liquid chromatography (HPLC; RID- from cassava pulp. However, multiple enzyme 10A, Shimadzu, Japan) with an Aminex HPX-87H yeast have not been cited frequently; few of the column (Bio-Rad, Hercules, CA) operated at 50°C notable examples of amylolytic and xylanolytic using 50 mM H2SO4 as the mobile phase at a flow yeast include Candida tropicalis, Pichia stiptis rate of 0.6 mL/min, and a UV detector at 230 nm (Lee, et al., 1987) and Aurobasidium pullulans (Dong, et al., 2014). (Leather, et al., 1984). Also, its ability to produce malic acid from glucose and cassava pulp by the yeast Meyerozyma caribbica in a fermentation 2.4 Morphological analysis and identification of process has not been studied before. AY33-1 Here, the main objectives of this study were to isolate and identify yeast strains and characteristic The yeast strain AY33-1 was inoculated on YPD of Meyerozyma caribbica to produce malic acid agar for microscopic analysis and colony characters. After overnight, it was observed by from glucose and cassava pulp with high cassava microscope for morphological characters. For DNA pulp degrading enzyme activity. extraction, PCR amplification, sequencing, and phylogenetic analysis, total genomic DNA from the 2. EXPERIMENT strain AY33-1 were extracted according to the methods described by Sambrook, et al. (1989),. 2.1 Isolate yeast strain for malic acid To estimate phylogenetic relationships among production. strain AY33-1 and the typical strains reported on internet, amplification and sequencing of ITS (Internal transcribed spacer) from the strain AY33- The yeast strain used in this study was isolated 1 were performed using the primers IT5:5’- from fermented fruit and rice, then purified single TCCGTAGGTGAACCTGCGG -3’ and IT6: 5’- colony using a streak plate technique on YPD agar TCCTCCGCTTATTGATATGC -3’ (Josefa,et al., plates containing 20 g/L glucose, 20 g/L peptone, 2004) and 26S rDNA, NL-1:5’-G CATATCAA 10 g/L yeast extract and 20 g/L agar. The forming TAAGCGGAGGAAAAG-3’ and NL-4:5’-GGT colonies on plates were incubated at 37°C for CCGTGTTTCAAGACGG-3’ (Sugita, et al., 2003). overnight. Then, a single colony was used and 2.5 Effect of the medium for malic acid transferred into YPD agar containing 1 g/L of production bromocresol green after that incubated at 37°C A total of 10% of the cultures was inoculated into 2.2 Screening of yeasts for malic acid production the flask containing 500 ml in YPD medium and limiting nitrogen medium (basal medium) For inoculum preparation, colonies of yeast strains contained glucose (100 g/L), KH PO (0.5 g/L), were sub-cultured on YPD plate and incubated at 2 4 MgSO .7H O (0.5 g/L), yeast extract (1 g/L) and 37°C for an overnight before use. Then, a single 4 2 63 Ⓒ Shibaura Institute of Technology, ONLINE ISSN 2435-2993, SEATUC Journal of Science and Engineering, 2019. Volume 1 CaCO3 (30 g/L) or YPD medium contained glucose 3. RESULTS AND DISCUSSION (100 g/L), peptone (20 g/L),yeast extract (1 g/L ) and CaCO3 (30 g/L). The samples were collected at 3.1 Screening of the yeast strain for their ability a time every 4 h. until 48 h. The sample was to produce high level of malic acid analyzed by HPLC to determine its malic acid content can be followed at step 2.3 and growth was From 196 yeast isolates obtained from fermented determined using a standard plate count (Chandra, fruit and fermented rice, only 98 strains could et al., 2018) and reducing sugar mainly (glucose) directly change the color bromocresol green of were determined by with the 3,5-dinitrosalicylic plate (Fig.1) and morphology was studied to select acid (DNS) colorimetric method (Hu, et al. , 2008) only yeast form. They were then screened to determine their ability to produce malic acid. 2.6 Malic acid production from cassava pulp Among of malic acid production yeast, highest malic acid (8.2 g/L) was produced by the strain Malic acid fermentation by yeast in cassava pulp AY33-1 (Fig. 2). Thus, the strain AY33-1 was substrate was studied.