Randomization of Genes by PCR Mutagenesis

Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press

R. Craig Cadwell and Gerald F. Joyce

Departments of Chemistry and Molecular Biology, The Scripps Research Institute, La Jolla, California 92037

A modified polymerase chain reac- The technology of in vitro mutagene- concentrations of the four dNTPs, in- tion (PCR) was developed to intro- sis allows one to probe structurally and creasing the concentration of Taq poly- duce random point mutations into functionally important regions within merase, and increasing the extension cloned genes. The modifications cloned genes. Random mutagenesis, time. Under the most error-prone condi- were made to decrease the fidelity of coupled with a screening method, is es- tion, the claimed error rate is 2% per po- Taq polymerase during DNA synthesis pecially useful when functionally signif- sition per PCR, with an equal number of without significantly decreasing the icant positions are not well known. Sev- transitions and transversions. (2s) We level of amplification achieved in the eral methods have been utilized to tested the most error-prone condition re- PCR. The resulting PCR products can introduce random mutations into ported by Leung et al. and obtained a be cloned to produce random mu- cloned genes, including chemical mu- mutation rate of 1.37% -+ 0.29% (95% tant libraries or transcribed directly tagenesis, (1-4) incorporation of nucle- C.I.). However, there were approxi- if a T7 promoter is incorporated otide analogues, (s-7) passage through mately three times as many transitions within the appropriate PCR primer. bacteria that contain mutator genes/8) as transversions, with a strong bias to- We used this method to mutagenize incorporation of randomized synthetic ward A ~ G and T ~ C transitions. This the gene that encodes the Tetrahyme- oligonucleotides, ~9-2~ and inaccurate result prompted us to develop a new PCR na ribozyme with a mutation rate of copying by a polymerase. (21-28~ We find mutagenesis protocol that does not have 0.66% -4- 0.13% (95% C.I.) per posi- inaccurate copying by a polymerase to strong mutational bias and provides an tion per PCR, as determined by se- be the most attractive because of its sim- overall error rate of 0.66% +- 0.13% (95% quence analysis. There are no strong plicity and versatility. C.I.). preferences with respect to the type The fidelity of several DNA poly- of base substitution. The number of merases has been measured, including mutations per DNA sequence follows the Klenow fragment of Escherichia coli MATERIALS AND METHODS a Poisson distribution and the muta- DNA polymerase I, (29) T4 DNA poly- Materials tions are randomly distributed merase, (21~ modified T7 DNA polymerase throughout the amplified sequence. (Sequenase)/3~ Taq DNA polymerase/313s) AmpliTaq DNA polymerase was pur- and Thermococcus litoralis (Vent) DNA chased from Cetus; EcoRI, HindlII, and polymerase/s6~ The fidelity of Taq poly- T4 polynucleotide kinase were from New merase is the lowest and, when coupled England Biolabs; and T4 DNA ligase, Mo- to the amplificative power of the MLV reverse transcriptase, and Seque- PCR, (37's8) makes Taq the best candidate nase (version 2.0 kit) were from United for an in vitro mutagenesis procedure. States Biochemical. Buffered solutions The error rate of Taq is 0.001-0.02% per of dNTPs and NTPs were purchased nucleotide per pass of the polymerase, from Pharmacia. PCR primers, 5'-CTG- depending upon reaction conditions/33'34~ CAGAATTCTAATACGACTCACTATAGG- For most purposes, this is insufficient to AGGGAAAAGTTATCAGGC-3' and 5'- mutagenize a gene. Thus, modifications CCAAGCTTGATCTCGAGTACTCCAAAA- of either the reaction conditions or the CTAATC-3', and sequencing primers polymerase itself are needed to achieve a compatible with the pUC 18 plasmid, 5'- substantial reduction of fidelity. GTAAAACGACGGCCAGT-3', and 5'- There is a paper in the literature de- CATGATTACGAATTCTA-3', were pur- scribing a random mutagenesis proce- chased from Operon Technologies and dure based on modification of the purified by polyacrylamide gel electro- PCR/2s~ The fidelity of the PCR was re- phoresis and subsequent Sephadex chro- duced by increasing the concentration matography. [3SS]-(~-thio)-dATP (1000 of MgC12, adding MnCI~ to the reaction Ci/mmole) was from Amersham. E. coli mixture, increasing and unbalancing the strain DH5~-F '~39) was obtained from

28 PCR Methods and Applications 2:28-339 by Cold Spring Harbor Laboratory ISSN 1054-9803/92 $3.00 Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press

BRL. Parent plasmid pT7L-21 (4~ was pro- running a small aliquot of the reaction increased concentration of MgC12; (4) vided by T.R. Cech and cloning plasmid mixture on a 2% agarose gel and visual- addition of 0.5 mM MnC12 to the reaction pUC 18 (AP2/AP5) (41) was provided by izing the ethidium bromide-stained mixture; and (5) increased (1 mM) con- D.J. Decker. T7 RNA polymerase (4z) was products in comparison to known centration of dGTP, dCTP, and dTTP to- prepared according to a modification of amounts of DNA. gether with standard (0.2 mM) concen- a procedure originally developed for SP6 tration of dATP. The last two RNA polymerase. (43) modifications are expected to have the Cloning of PCR Products greatest impact on error rate. To facilitate restriction digestion, 2.5 I~g With the standard PCR, we obtained Preparation of Wild-type cDNA of PCR product DNA was concatenated only I mutation in 3177 nucleotides that Plasmid pT7L-21 was transcribed as pre- in a concerted kination / ligation reac- were sequenced. Thus, based on a one- viously described (41) and the resulting tion, as previously described. (46) The en- tailed t-test, the error rate is <0.14% per RNA was purified by polyacrylamide gel zymes were heat-inactivated, the buffer position (95% C.I.). This error rate re- electrophoresis and subsequent Sepha- was adjusted to 50 mM NaC1, and the flects both mutations that occur during dex chromatography. The purified RNA DNA was digested with EcoRI and the PCR and mutations that occur dur- was used to synthesize cDNA autocata- HindlII. The pUC18 (AP2/AP5) plasmid ing our preparative procedure. It is con- lytically by an isothermal amplification was similarly digested with EcoRI and sistent with published values obtained procedure. (44'4s) The amplification mix- HindlII and purified in 1% low-melting- under similar reaction conditions (34'38) ture contained 50 fmoles of RNA, 100 point agarose gel. This vector contains and establishes a baseline for the present pmoles (each) PCR primers (see Materi- two large deletions in the ribozyme gene study. To obtain a more precise estimate als), 10 mM MgCI2, 80 mM KOAc, 5 mM that were PCR amplified, making it easy of the error rate for the standard PCR, dithiothreitol, 50 mM Tris.HCl (pH 7.5), to distinguish vector religation products one must either sequence a very large 2 mM (each) NTPs, 0.2 mM (each) dNTPs, from vector that has incorporated the number of nucleotides or, as has been 125 units of Mo-MLV reverse tran- PCR fragment. The restriction-digested done in the past, turn to in vivo selec- scriptase, and 500 units of T7 RNA poly- PCR fragment was incorporated into the tion markers to screen a large population merase in a 100-pA volume, which was target vector by ligation within low- of DNA sequences for the presence of a incubated at 37~ for 3 hr. The RNA was melting point agarose. (47) The resulting single mutation. In general, direct se- digested by alkaline hydrolysis and the plasmid DNA was used to transform quencing is impractical unless the muta- cDNA was purified by electrophoresis in competent DH5c~-F' cells, (48) which were tion rate is above 0.2% per position per a 5% polyacrylamide/8 M urea gel and grown on ampicillin-containing plates. PCR. subsequent affinity chromatography on Individual colonies were chosen at ran- We tested a mutagenic PCR based on Du Pont Nensorb. The yield of cDNA was dom and grown overnight in LB media. Leung's conditions and obtained an quantitated spectrophotometrically. DNA was prepared by a boiling lysis overall mutation rate of 1.37% +- 0.29% miniprep protocol (49) and screened for per position per PCR (95% C.I.; n = the presence of insert by restriction di- 6001). This is in reasonable agreement Polymerase Chain Reaction gestion. with the published value of 2%. (zs) How- The standard reaction condition was ever, there was a substantial excess of A compared to four mutagenic reaction --~ G and T --~ C mutations, resulting in DNA Sequencing conditions. All reaction mixtures con- strong GC sequence bias (Table 1). The tained 20 fmoles cDNA, 30 pmoles DNAs were sequenced by the chain-ter- probability of mutation at an A or T po- (each) PCR primers (see Materials), 50 mination method (s~ using reciprocal sition was 2.14% -+ 0.51%, while the mM KCl, 10 mM Tris.HCl (pH 8.3), and primers that flank the cloned insert (see probability of mutation at a G or C po- 0.01% gelatin in a 100-1~1 volume, which Materials). Sequencing reactions utilized sition was only 0.37% -+ 0.24% (95% was cycled in an Ericomp thermal cycler modified T7 DNA polymerase (Seque- C.I.). This bias can be understood in for 30 cycles of 94~ for 1 min, 45~ for nase 2.0, USB) and [3sS]-(a-thio)-dATP terms of the competition between dATP 1 min, and 72~ for 1 min. We did not and were analyzed by electrophoresis in and dGTP for base-pairing at T positions employ a hot start procedure and did not a 6% polyacrylamide/8 M urea sequenc- along a DNA template (see Discussion). carry out a prolonged extension reaction ing gel. The 353 nucleotide positions There may be special circumstances in at the end of the last cycle. In addition to that lie between the two sequencing which it is desirable to apply GC pressure the above components, the standard re- primers were used for statistical analysis. while mutagenizing a gene. However, we action mixture contained 1.5 mM MgC12, sought to address the broader need for a 2.5 units of Taq polymerase, and 0.2 mM mutagenesis technique that does not im- RESULTS (each) dNTPs; the mutagenic reaction pose sequence bias. mixtures contained 7 mM MgCI2, 0.5 mM We first compared the standard PCR to Previous studies concerning the effect MnCI2, 5 units of Taq polymerase, and the mutagenic PCR described by Leung of unbalanced concentrations of the varying concentrations of the four and co-workers. (2s) The Leung protocol four dNTPs on the fidelity of T4 DNA dNTPs. MnC1 z must be added just prior employs several modifications relative polymerase showed that the mutation to enzyme to prevent precipitation. PCR to the standard PCR that might be con- rate could be increased only by increas- products were purified by chloroform/ sidered mutagenic, including: (1) in- ing the dGTP/dATP ratio. (21) Predictably, isoamyl alcohol extraction and ethanol creased concentration of Taq poly- this condition leads to an excess of A--~ precipitation. Yields were estimated by merase; (2) increased extension time; (3) G and T --~ C changes. The same limita-

PCR Methods and Applications 29 Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press

TABLE I Error Rate of the PCR Under Various Mutagenic Reaction Conditionsa is-

[dGTP] [dATP] Nucleotides Mutation rate AT--~GC Transitions mM mM sequenced (95% C.I.) GC---~AT Transversions 10- # of 1.0 0.2 6,001 1.37 +_ 0.29% 10 2.7 clones

0.2 0.2 16,591 0.66 +__ 0.13% 1 0.8 5- 0.2 1.0 1,765 0.85 ___ 0.43% 2 0.4 0.4 0.2 3,177 0.72 + 0.29% 4 3.2

0. i i i i i i aReaction conditions were as described in Materials and Methods, differing only in the concen- 0 1 2 3 4 5 6 tration of dGTP and dATP. Mutation rate refers to the mean number of mutations per base pair per PCR (30 cycles). Frequencies of AT---~GC and GC---~AT mutations are corrected for base com- mutations / clone position of the mutated gene. FIGURE 2 Comparison of observed number of mutations per DNA sequence (O) with expected values based on a Poisson distribution (C)). A G-test for goodness of fit gave G = tion might be expected to apply to other low mutational bias. The PCR was car- 3.26; when compared with the chi-square dis- DNA polymerases. However, Taq poly- ried out in the presence of 0.2 mM dGTP, tribution (6 d.f.) this indicates no significant difference between observed and expected merase, which operates at higher tem- I mM dATP, 1 mM dCTP, and I mM dTTP, values. perature and has lower inherent fidelity under reaction conditions otherwise compared to T4 DNA polymerase, turns identical to those above. This resulted in out to be vulnerable to a variety of alter- an error rate of 0.85% +__ 0.43% per posi- ations in dNTP concentrations. tion per PCR (95% C.I.; n = 1,765) (Table dition using 0.4 mM dGTP, 0.2 mM dATP, Our preferred reaction condition for 1), but with strong bias in favor of A ~ X 1 mM dCTP, and 1 mM dTTP. This re- PCR mutagenesis employs 0.2 mM dGTP, (X # A) and X ~ T changes (X # T). sulted in an error rate of 0.72% + 0.29% 0.2 mM dATP, 1 mM dCTP, and 1 mM Finally, we tested a "compromise" con- per position per PCR (95% C.I.; n = dTTP, but is otherwise identical to our 3,530) (Table 1), but with strong bias in formulation of the Leung condition de- favor of A ~ X changes (X # A). scribed above. The preferred condition A 1.5 Returning to the preferred reaction results in an overall mutation rate of condition, we tested whether there were 0.66% + 0.13% per position per PCR any mutational "hotspots" or clustering

(95% C.I.; n = 16,591) and is free from 1.0, of mutations within the DNA sequence.

GC or AT bias (Table 1). This data reflects frequency The number of mutations per DNA se- the sum of two independent experi- (%) quence (109 mutations; 47 sequences) ments, which were carried out using dif- 0.5- follows a Poisson distribution (Fig. 2). ferent stock solutions and analyzed by The mutations are randomly distributed separate cloning and sequencing proce- throughout the amplified sequence, dures. The two independent mutation 0.0 G-bX A-~X C-~X T~X with no obvious nearest-neighbor effects rates were 0.64% (n = 9884) and 0.69% (Fig. 3). The yield of DNA in the muta- (n = 6707), which do not differ signifi- genic PCR does not differ significantly cantly. Individual rates for various types from the yield in the standard PCR, as of mutations of the form N ~ X and X --~ a 0.6 judged by agarose gel electrophoresis in N (N = G,A,C,T; X ~ N) were tabulated the presence of ethidium bromide. for the two independent samples and, in all cases, found not to differ significantly 0.4- frequency DISCUSSION at even the 90% confidence level. Thus, i%) data from the two independent samples Much has been made of the importance 0.2- was pooled. of maximizing the fidelity of the The preferred reaction condition re- PCR. (3~ Indeed, if the PCR is being sults in no strong mutational bias (Fig. 0.0 used as a preparative procedure prior to 1). There is a modest preference for T --~ X~G X~A X~C X~T subcloning, a low mutation rate is desir- X changes (X ~ T) and X ~ A changes (X FIGURE 1 Frequency of various types of mu- able. However, there are instances in A), both significant at the 99% confi- tations under the preferred reaction condi- which a low-fidelity polymerization re- dence level. All other N ~ X and X ~ N tion for PCR mutagenesis. (A) Mutations of action would be useful, provided that it changes cannot be said to differ at even the form N ~ X; (B), Mutations of the form X does not result in significant mutational N; (N = X # N). Frequencies refer the 90% confidence level. The frequency G,A,C,T; bias. to the mean number of mutations per base of insertions and deletions is <0.03% Recently, a number of in vitro selec- pair per PCR (30 cycles), corrected for base and <0.05%, respectively (one-tailed composition of the mutagenized gene. Error tive amplification techniques have been test, 95% C.I.). bars correspond to 95% confidence interval. developed that depend on generation of Two other reaction conditions were Dashed horizontal line indicates expected an initial population of random vari- tested in an attempt to obtain a higher value based on an overall error rate of 0.66% ants. (sl-64) Normally this is accom- overall mutation rate while maintaining per position per PCR. plished by preparing degenerate oligode-

JO PCR Methods and Applications Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press

`1, `1, `1,`1, `1, l `1, quently modified the PCR mutagenesis The PCR mutagenesis procedure de- 9..CAG GC[ATGCACCTGGTAG CTAGTCTTTAAACCAATAGATT procedure of Leung and co-workers (zs~ to scribed in this study should be sufficient obtain a method for gene randomization for most gene randomization purposes. G CATCG GTTTAAAAG G CAAGACCGTCAAATTG CG G GAAAG G that does not impose strong sequence We encourage others to seek further ,1,, `1, `1, 4,4,,1, `1, `1, `1, `1, ,14, GGTCAACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTG bias. The Leung protocol, which em- modifications of the reaction conditions ploys increased concentrations of dGTP, that would result in a higher error rate +++ +L + + AGATGGCCTTG CAAAGGGTATGGTAATAAGCTGACGGACAT dCTP, and dTTP relative to dATP results without producing significant sequence `1, +4, 4, 114, 4, 14,4, 4,4, in a substantial excess of A ~ G and T ---> bias. The types of manipulations dis- GGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGATCTTC C changes. This is likely due to forma- cussed above would be a reasonable tion of G.T "wobble" pairs between in- place to start. Ultimately, though per- TG]-TGATATGGATGCAGTTCACAGACTAAATGTCGGTCGGG coming dGTPs and T positions along the haps only after the three-dimensional `1,`1, `1, `1, `1,`1,`1, `1, 4,1 DNA template, favored by the increased structure of a thermostable DNA poly- GAAGATGTATTCTTCTCATAAGATATAGTCGGACCTCTCCTT dGTP : dATP ratio. Misincorporation of merase is available, it may be possible to 4, `1,`1, `1, 4,14, ! `1, AATGGGAGCTAGCGGATGAAGTGATGCAACACTGGAGCCG G opposite T accounts for the A ---> G modify the polymerase itself to obtain a changes, and copying of a misincorpo- low-fidelity enzyme. `1, `1,`1, 1`1, `1,`1, `1, CTGG GAACTAATTTGTATGCG AAAGTATATTIGATTA". rated G during the next pass of the poly- FIGURE 3 Distribution of mutations within merase accounts for the T ~ C changes. the gene that was amplified. (Short arrow) One Maintaining relatively low concentra- ACKNOWLEDGMENTS occurrence; (medium-length arrow) two occur- tions of both dATP and dGTP would We are grateful to Steven Reed for help- rences; (long arrow) three occurrences; no po- make such events less favorable. Mass ac- ful suggestions. This work was supported sition was mutated more than three times. tion would then be expected to favor the by NASA grant NAGW-1671 and NIH The DNA strand having the same sense as the four transversion mutations. However, RNA transcript is shown. Boxed regions corre- grant AI30882. we found transitions and transversions spond to primer binding sites. to occur in a ratio of 0.75 : 1, which does not differ significantly from the unbi- REFERENCES ased value of 0.5 : 1 (90% confidence 1. Chu, C.-T., D.S. Parris, R.A.F. Dixon, F.E. oxynucleotides on an automated DNA level). This suggests that there are other Farber, and P.A. Schaffer. 1979. Hydroxyl- synthesizer using nucleoside 3'-phos- mutagenic forces operating in the PCR. amine mutagenesis of HSV DNA and DNA phoramidite solutions that have been Addition of 0.5 mM MnC12 to the re- fragments: Introduction of mutations doped with a small percentage of action mixture is expected to have a sig- into selected regions of the viral genome. each of the three incorrect mono- nificant mutagenic effect. MnC12 is Virology 98: 168-181. mers. (13'16'17'2~ The degenerate oligode- known to be mutagenic for a variety of 2. Shortle, D. and D. Botstein. 1983. Di- oxynucleotides are made double- DNA polymerases (23> and data of Leung rected mutagenesis with sodium bisulfite. stranded and ligated into the target gene. and co-workers suggest that this is the Methods Enzymol. 100: 457-468. This method is time consuming and ex- case for Taq polymerase as well. (2s> We 3. Myers, R.M., L.S. Lerman, and T. Maniatis. 1985. A general method for saturation pensive compared to a mutagenic PCR. have made no attempt to cooptimize the mutagenesis of cloned DNA fragments. Furthermore, it does not allow one to re- concentrations of MnC12 and the four Science 229: 242-247. mutagenize those individuals that have dNTPs to achieve maximal error rate 4. Diaz, J.-J., D.D. Rhoads, and D.J. Roufa. been selected from the initial mutant while maintaining minimal sequence 1991. PCR-mediated chemical mutagene- population. The ability to iterate the mu- bias. An obvious way to increase the sis of cloned duplex DNAs. BioTechniques tation process while carrying out re- overall error rate of the PCR would be to 11: 204-211. peated rounds of selective amplification carry out more reaction cycles, although 5. Flavell, R.A., D.L. Sabo, E.F. Bandle, and C. greatly augments in vitro selection, in ef- this increases the risk of obtaining PCR Weissmann. 1974. Site-directed mutagen- fect converting it to an in vitro evolution artifacts. (66~ Similarly one could carry esis: Generation of an extracistronic mu- procedure. (6s) out two consecutive PCRs, perhaps puri- tation in bacteriophage Q[3 RNA. J. Mol. Biol. 89: 255-272. More generally, PCR mutagenesis can fying the products of the first reaction by 6. Mueller, W., H. Weber, F. Meyer, and C. gel electrophoresis before proceeding be used to randomize any cloned gene Weissmann. 1978. Site-directed mutagen- for the purpose of generating mutant li- with the second reaction. A more subtle esis in DNA: Generation of point muta- braries that can be screened for the ex- way to increase the error rate of the PCR tions in cloned [3-globin complementary pression of some desirable phenotype. If is to increase the concentration of Taq DNA at the positions corresponding to the promoter sequence for T7 RNA poly- polymerase or to increase the extension amino acids 121 to 123. J. MoL Biol. merase is included in the appropriate time within each reaction cycle. These 124: 343-358. PCR primer, then the PCR products can changes are expected to promote chain 7. Mott, J.E., J. van Arsdell, and T. Platt. be transcribed directly to produce a pop- extension beyond positions of base mis- 1984. Targeted mutagenesis in vitro: lac ulation of mutant RNAs. If these RNAs match. (67) Finally, it has been shown repressor mutations generated using AMV reverse transcriptase and dBrUTP. Nucleic contain an AUG start codon and main- that the error rate of the PCR is en- Acids Res. 12: 4139-4152. tain proper codon usage, then they can hanced by increasing the concentration 8. Cox, E.C. 1976. Bacterial mutator genes be translated in vitro to produce a corre- of MgC12, (3~ which presumably stabi- and the control of spontaneous mutation. sponding population of mutant pro- lizes noncomplementary pairs, and by Annu. Rev. Genet. 10: 135-156. teins. increasing the pH, (3~ which may have 9. Matteucci, M.D. and H.L. Heyneker. 1983. In this study, we analyzed and subse- an effect on the polymerase itself. Targeted random mutagenesis: The use of

PCR Methods and Applications 31 Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press

ambiguously synthesized oligonucle- 23. Beckman, R.A., A.S. Mildvan, and L.A. with proofreading activity. Nucleic Acids otides to mutagenize sequences immedi- Loeb. 1985. On the fidelity of DNA repli- Res. 19: 4967-4973. ately 5' of an ATG initiation codon. Nu- cation: Manganese mutagenesis in vitro. 37. Saiki, R.K., S. Scharf, F. Faloona, K.B. Mul- cleic Acids Res. 11: 3113-3121. Biochemistry 24: 5810-5817. lis, G.T. Horn, H.A. Erlich, and N. Arn- 10. Hui, A., J. Hayflick, K. Dinkelspiel, and 24. Lehtovaara, P.M., A.K. Koivula, J. Barn- helm. 1985. Enzymatic amplification of H.A. de Boer. 1984. Mutagenesis of the ford, and J.K.C. Knowles. 1988. A new 13-globin genomic sequences and restric- three bases preceding the start codon of method for random mutagenesis of com- tion site analysis for diagnosis of sickle the f3-galactosidase mRNA and its effect plete genes: Enzymatic generation of mu- cell anemia. Science 230: 1350-1354. on translation in Escherichia coil EMBO J. tant libraries in vitro. Prot. Eng. 2: 63-68. 38. Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. 3: 623-629. 25. Leung, D.W., E. Chen, and D.V. Goeddel. Scharf, R. Higuchi, G.T. Horn, K.B. Mullis, 11. Dreher, T.W., J.J. Bujarski, and T.C. Hall. 1989. A method for random mutagenesis and H.A. Erlich. 1988. Primer-directed en- 1984. Mutant viral RNAs synthesized in of a defined DNA segment using a modi- zymatic amplificiation of DNA with a vitro show altered aminoacylation and fied polymerase chain reaction. Technique thermostable DNA polymerase. Science replicase activities. Nature 311: 171-175. 1: 11-15. 239: 487-491. 12. Wells, J.A., M. Vasser, and D.B. Powers. 26. Holm, L., A.K. Koivula, P.M. Lehtovaara, 39. Hanahan, D. 1983. Studies on transforma- 1985. Cassette mutagenesis: An efficient A. Hemminki, and J.K.C. Knowles. 1990. tion of Escherichia coli with plasmids. J. method for generation of multiple muta- Random mutagenesis used to probe the IdoL Biol. 166: 557-580. tions at defined sites. Gene 34: 315-323. structure and function of Bacillus stearo- 40.Zaug, A.J., C.A. Grosshans, and T.R. Cech. 13. McNeil, J.B. and M. Smith. 1985. Saccha- thermophilus. Prot. Eng. 3: 181-191. 1988. Sequence-specific endoribonu- romyces cerevisiae CYC1 mRNA 5'-end po- 27. Liao, X. and J.A. Wise. 1990. A simple clease activity of the Tetrahymena ri- sitioning: Analysis by in vitro mutagenesis high-efficiency method for random mu- bozyme: Enhanced cleavage of certain using synthetic duplexes with random tagenesis of cloned genes using forced oligonucleotide substrates that form mis- mismatch base pairs. Mol. Cell. Biol. nucleotide misincorporation. Gene matched ribozyme-substrate complexes. 5: 3545-3551. 88: 107-111. Biochemistry 2 7:8924-8931. 14. Oliphant, A.R., A.L. Nussbaum, and K. 28. Zhou, Y., X. Zhang, and R.H. Ebright. 41. Beaudry, A.A. and G.F. Joyce. 1990. Mini- Struhl. 1986. Cloning of random-se- 1991. Random mutagenesis of gene-sized mum secondary structure requirements quence oligodeoxynucleotides. Gene DNA molecules by use of PCR with Taq for catalytic activity of a self-splicing 44: 177-183. DNA polymerase. Nucleic Acids Res. group I intron. Biochemistry 29: 6534- 15. Horwitz, M.S.Z. and L.A. Loeb. 1986. Pro- 19: 6052. 6539. moters selected from random DNA se- 29. Keohavong, P. and W.G. Thilly. 1989. Fi- 42. Studier, F.W. and B.A. Moffatt. 1986. Use quences. Proc. Natl. Acad. Sci. 83: 7405- delity of DNA polymerases in DNA ampli- of bacteriophage T7 RNA polymerase to 7409. fication. Proc. Natl. Acad. Sci. 86: 9253- direct selective high-level expression of 16. Hutchison, C.A., S.K. Nordeen, K. Vogt, 9257. cloned genes. J. MoL Biol. 189: 113-130. and M.H. Edgell. 1986. A complete library 30. Ling, L.L., P. Keohavong, C. Dias, and 43. Butler, E.T. and M.J. Chamberlin. 1982. of point substitution mutations in the W.G. Thilly. 1991. Optimization of the Bacteriophage SP6-specific RNA poly- glucocorticoid response element of polymerase chain reaction with regard to merase. I. Isolation and characterization mouse mammary tumor virus. Proc. Natl. fidelity: Modified T7, Taq, and Vent poly- of the enzyme. J. Biol. Chem. 257: 5772- Acad. Sci. 83: 710-714. merases. PCR Methods Applic. 1: 63-69. 5778. 17. Derbyshire, K.M., J.J. Salvo, and N.D.F. 31. Tindall, K.R. and T.A. Kunkel. 1988. Fidel- 44. Guatelli, J.C., K.M. Whitfield, D.Y. Kwoh, Grindley. 1986. A simple and efficient ity of DNA Synthesis by the Thermus K.J. Barringer, D.D. Richman, and T.R. procedure for saturation mutagenesis us- aquaticus DNA polymerase. Biochemistry Gingeras. 1990. Isothermal, in vitro am- ing mixed oligodeoxynucleotides. Gene 27: 6008-6013. plification of nucleic acids by a multien- 46: 145-152. 32. Ennis, P.D., J. Zemmour, R.D. Salter, and zyme reaction modeled after retroviral 18. Ner, S.S., D.B. Goodin, and M. Smith. P. Parham. 1990. Rapid Cloning of HLA- replication. Proc. Natl. Acad. Sci. 1988. A simple and efficient procedure for A,B cDNA by using the polymerase chain 87: 1874-1878. generating random point mutations and reaction: Frequency and nature of errors 45. Joyce, G.F. 1992. Selective amplification for codon replacements using mixed oli- produced in amplification. Proc. Natl. techniques for optimization of ribozyme gonucleotides. DNA 7: 127-134. Acad. Sci. 87: 2833-2837. function. In Antisense RNA and DNA (ed. 19. Reidhaar-Olson, J.F. and R.T. Sauer. 1988. 33. Eckert, K.A. and T.A. Kunkel. 1990. High J.A.H. Murray), pp. 353-372. Wiley-Liss, Combinatorial cassette mutagenesis as a fidelity DNA synthesis by the Thermus New York. probe of the information content of pro- aquaticus DNA polymerase. Nucleic Acids 46. Kaufman, D.L. and G.A. Evans. 1990. Re- tein sequences. Science 241: 53-57. Res. 18: 3739-3744. striction endonuclease cleavage at the ter- 20. Hermes, J.D., S.M. Parekh, S.C. Blacklow, 34. Eckert, K.A. and T.A. Kunkel. 1991. DNA mini of PCR products. BioTechniques H. K6ster, and J.R. Knowles. 1989. A reli- polymerase fidelity and the polymerase 9: 304-306. able method for random mutagenesis: chain reaction. PCR Methods Applic. 1: 17- 47. Maniatis, T., E.F. Fritsch, andJ. Sambrook. the generation of mutant libraries using 24. 1989. Molecular cloning: A laboratory man- spiked oligodeoxynucleotide primers. 35. Chen, J., A. Sahota, P.J. Stambrook, and ual, pp. 1.72-1.73. Cold Spring Harbor Gene 84: 143-151. J.A. Tischfield. 1991. Polymerase chain re- Press, Cold Spring Harbor, New York. 21. Sinha, N.K. and M.D. Haimes. 1981. Mo- action amplification and sequence analy- 48. Hanahan, D. 1985. Techniques for trans- lecular mechanisms of substitution mu- sis of human mutant adenine phospho- formation of E. coli. In DNA cloning: A tagenesis: an experimental test of the ribosyltransferase genes: The nature and practical approach (ed. D.M. Glover), pp. Watson-Crick and Topal-Fresco models frequency of errors caused by Taq DNA 109-135. IRL Press, Oxford. of base mispairings. L Biol. Chem. polymerase. Mutat. Res. 249: 169-176. 49. Holmes, D.S. and M. Quigley. 1981. A 256: 10671-10683. 36. Mattila, P., J. Korpela, T. Tenkanen, and K. rapid boiling method for the preparation 22. Zakour, R.A. and L.A. Loeb. 1982. Site-spe- PitRnen. 1991. Fidelity of DNA synthesis of bacterial plasmids. Anal Biochem. cific mutagenesis by error-directed DNA by the Thermococcus litoralis DNA poly- 114: 193-197. synthesis. Nature 295: 708-710. merase--an extremely heat stable enzyme 50. Sanger, F., S. Nicklen, and A.R. Coulson.

32 PCR Methods and Applications Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press

1977. DNA sequencing with chain-termi- guide to methods and applications (eds. nating inhibitors. Proc. Natl. Acad. Sci. M.A. Innis, D.H. Gelfand, J.J. Sninsky, and 74: 5463-5467. T.J. White), pp. 3-12. Academic Press, San 51. Joyce, G.F. 1989. Amplification, mutation Diego. and selection of catalytic RNA. Gene 67. Gelfand, D.H. and T.J. White. 1990. Ther- 82: 83-87. mostable DNA polymerases. In PCR proto- 52. Robertson, D.L. and G.F. Joyce. 1990. Se- cols: A guide to methods and applications lection in vitro of an RNA enzyme that (eds. M.A. Innis, D.H. Gelfand, J.J. Snin- specifically cleaves single-stranded DNA. sky, and T.J. White), pp. 129-141. Aca- Nature 344: 467-468. demic Press, San Diego. 53. Scott, J.K. and G.P. Smith. 1990. Search- ing for peptide ligands with an epitope library. Science 249: 386--390. Received April 24, 1992; accepted in 54. Devlin, J.J., L.C. Panganiban, and P.E. revised form June 8, 1992. Devlin. 1990. Random peptide libraries: A source of specific protein binding molecules. Science 249: 404-406. 55. Cwirla, S.E., E.A. Peters, R.W. Barrett, and W.J. Dower. 1990. Peptides on phage: A vast library of peptides for identifying ligands. Proc. Natl. Acad. Sci. 87: 6378- 6382. 56. Tuerk, C. and L. Gold. 1990. Systematic evolution of ligands by exponential en- richment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249: 505- 510. 57. Ellington, A.D. and J.W. Szostak. 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346: 818-822. 58. McCafferty, J., A.D. Griffiths, G. Winter, and D.J. Chiswell. 1990. Phage antibod- ies: Filamentous phage displaying antibody variable domains. Nature 348: 552- 554. 59. Clackson, T., H.R. Hoogenboom, A.D. Griffiths, and G. Winter. 1991. Making antibody fragments using phage display libraries. Nature 352: 624-628. 60. Barbas, C.F., A.S. Kang, R.A. Lerner, and S.J. Benkovic. 1991. Assembly of combinatorial antibody libraries on phage sur- faces: The gene III site. Proc. Natl. Acad. Sci. 88: 7978-7982. 61. Pei, D., H.D. Ulrich, and P.G. Schultz. 1991. A combinatorial approach toward DNA recognition. Science 253: 1408- 1411. 62. Bartel, D.P., M.L. Zapp, M.R. Green, and J.W. Szostak. 1991. HIV-1 Rev regulation involves recognition of non-Watson- Crick base pairs in viral RNA. Cell 67: 529-536. 63. Lowman, H.B., S.H. Bass, N. Simpson, and J.A. Wells. 1991. Selecting high-affinity binding proteins by monovalent phage display. Biochemistry 30: 10832-10838. 64. Bock, L.C., L.C. Griffin, J.A. Latham, E.H. Vermaas, andJ.J. Toole. 1992. Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 355: 564-566. 65. Beaudry, A.A. and G.F. Joyce. 1992. Di- rected evolution of an RNA enzyme. Sci- ence (in press). 66. Innis, M.A. and D.H. Gelfand. 1990. Op- timization of PCRs. In PCR protocols: A

PCR Methods and Applications 33 Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press

Randomization of genes by PCR mutagenesis.

R C Cadwell and G F Joyce

Genome Res. 1992 2: 28-33 Access the most recent version at doi:10.1101/gr.2.1.28

References This article cites 61 articles, 19 of which can be accessed free at: http://genome.cshlp.org/content/2/1/28.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here.

To subscribe to Genome Research go to: https://genome.cshlp.org/subscriptions