DOCSLIB.ORG

Development of Molecular Markers for the Trait of Malvin Formation to Improve Breeding Efforts

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Development of Molecular Markers for the Trait of Malvin Formation to Improve Breeding Efforts Development of molecular markers for the trait of malvin formation to improve breeding efforts L. Hausmann; K. Neumann; R. Eibach; E. Zyprian; R. Töpfer BAZ – Federal Centre for Breeding Research on Cultivated Plants Institute for Grapevine Breeding Geilweilerhof D-76833 Siebeldingen Email: [email protected] Summary Malvidin-3,5-diglycoside, shortly malvin, early gained the interest of viticultural research. It was Ribéreau-Gayon who placed malvin within the focus being considered as indicative for hybrid grapevine varieties (Ribéreau-Gayon 1960). However, simultaneously he indicated that not all hybrids show this coloured compound. Despite this fact, for a long time malvin was used as an analytical marker for hybrid wines which were discriminated for their poor wine quality. Recent success of resistance breeding in grapevine gave clear cut evidence that malvin and wine quality show no correlation of any kind. Up to know the biosynthesis of malvin in the genus Vitis has not been elucidated in great detail. Recently, evidence was gained from the ornamental plant Perilla frutescens pointing to an anthocyanin 5-O-glucosyltransferase (5-GT) as the catalysing enzyme. However, an additional pathway may exist using delphinidin-3-glucoside as a precursor and requiring methyltransferase reactions for modification of the intermediates. First analysis was conducted to identify 5-GT sequences in Vitis in order to develop a specific molecular marker. Thus, five different gene sequences were isolated and their expression pattern was monitored. The expression pattern of one of these genes was found to correlate with malvin formation. Introduction The quality of wine is influenced by numerous compounds in particular sugar, alcohol, acid content, different aroma components (Rapp 1996, 1999; Wüst & Mosandl 2002; Amann 2003), phenols, tannins, etc. and in red wines by anthocyanins (Hesford & Ruffner). Furthermore, colour intensity of red wines depends on (a) the type and (b) the concentration of anthocyanins. For decades grapevine breeders in Germany paid much attention to this characteristic when selecting for new red wine cultivars. Thus, it is self-explanatory that breeding strains and new cultivars like ‘Regent’ have been obtained which behave excellent in colour formation and colour intensity. A comparison of two red wine cultivars, the traditional cultivar ‘Lemberger’ and the new bred ‘Regent’, is given in Fig. 1 showing the difference in anthocyanin profiles as monitored by HPLC analysis. Both cultivars differ in regard of type and concentration of anthocyanins. Most obvious are differences in oenin (malvidin-3- glucoside, red) and malvin (malvidin-3,5-diglucoside, dark red), respectively. Malvin can only be detected in ‘Regent’ while oenin as the presumed precursor of malvin occurs in both genotypes. Compared with oenin, malvin carries an additional glucose residue increasing its solubility, stability and colour intensity. Anthocyanidin-diglucosides in grapevine have been investigated since a long time. Especially malvin was analysed by Ribereau-Gayon and coworkers, because they considered malvin to be typical for hybrid vines (Ribéreau-Gayon 1960). However, Ribéreau-Gayon ascertained simultaneously that not every hybrid contains this colour type (Ribéreau-Gayon 1960). Nevertheless, for a long time malvin had been considered to be an indicator for hybrid wines which were proscribed due to their poor wine quality. Since this correlation was true for just a particular type of vines but not generally, progress in grapevine breeding puts further question marks on it. Recently, newly bred cultivars derived from resistance breeding were classified showing clearly that malvin content and wine quality are not correlated at all. Further evidence is coming from genetic analysis and is presented below. The biosynthesis of malvin in Vitis has not been elucidated completely. Recent tests on an ornamental plant (Perilla frutescens) have shown an UDP-glucose:anthocyanin 5-O- glucosyltransferase (5-GT) being the catalysing enzyme (Fig. 2). Biosynthesis of malvin seems to be also possible via petunidin-3,5-diglucoside catalysed by a methyltransferase (MT) (Fig. 3). In a first approach we initiated experiments in order to identify candidate genes for 5- GT from Vitis in order to develope a specific molecular marker. Lemberger Malvin Oenin Regent Malvin Oenin Fig. 1: Chromatograms of red wines from the cultivars ‘Lemberger’ and ‘Regent’ analysed by HPLC. Major differences are the concentrations of oenin (malvidin-3-glucoside) and malvin (malvidin-3,5-diglucoside), the latter being absent in cv. ‘Lemberger’. Material and methods Analysis of anthocyanins Grape berries were crushed in a mortar and boiled for 2-3 minutes in a microwave. After chilling on ice, berries were pressed and juice was centrifuged at 2150 x g for 10 minutes to remove turbidity. Prior to HPLC analysis for anthocyanins according to O.I.V. recommendations (http://www.oiv.int) the juice was passed through a filter of 0.45 µm pore size. PCR-/3’-RACE Using degenerate primers based on published 5-GT sequences fragments of genomic DNA of various genotypes were PCR-amplified. Primers 04034, ACITTYCCIGCICARGGICAYAT HAAYCC and 04032 TTCCAICCRCARTGIGTIACRAARCAICC were used. RNA for gene expression analysis was extracted from berry skin according to Boss et al. (1996a). 3’-RACE- PCR was performed using the BD Smart RACE cDNA Amplification Kit from Biosciences Clonetech (Heidelberg). The following gene specific primers were used, which were deduced from cloned and sequenced 5GT-candidate genes: gene 5: 04095, GGTCCTAGCTCACAAAGCCG; gene 6: 05026, TCGTGGATTGCTGGACAGTGGCCG; gene 7: 05027, GCTCGCGGGTTGTTAGAAAGCGGAAGAC; gene 8: 05028, GCACGAG GTTTGCTAGATTGTGGCCAGC; gene 9: 05034, GCCTGTGGTCTGCTAAATAGTGAC CGAC; 3-GT: 04121, TTGGAGTTTCAGGCATTCAAGG. Touchdown PCR was performed according to the suppliers recommendations. Mapping and linkage/recombination analysis For linkage analysis the program JoinMap 3.0 (Van Ooijen and Voorrips 2001) was used according to Fischer et al. (2004). Results and discussion Cultivars ‘Lemberger’ and ‘Regent’ show clear-cut differences concerning the anthocyanin profiles (Fig. 1). Both cultivars produce anthocyanines (= 3-glucoside) of delphinidin, cyanidin, petunidin, peonidin and malvidin (see Fig. 1 and Fig. 3) although in different concentrations. Oenin is the most abundant anthocyanin found in ‘Lemberger’, entirely lacking diglucosides. Cultivar ‘Regent’, giving deep coloured red wines, in addition shows high amounts of 3,5-diglucosids particularly malvin. It is interesting to note that significant OH OH + HO O OH OH OCH3 OH OH Delphinidin + HO O OCH3 O-Gluc OCH3 OH Malvidin-3-glucosid OH + HO UDP-glucose: O 5-GT anthocyanin OCH3 5-O-glucosyltransferase O-Gluc Malvidin-3,5-diglucosid O-Gluc Fig. 2: Structure of the anthocyanidin body (delphinidin, blue violet) and a derivative thereof, malvin-3-glucoside (oenin, red). The formation of malvidin-3,5 diglucoside (malvin, dark red) is catalysed by a 5-GT (=UDP-D-glucose:anthocyanin 5-O-β-D-glucosyltransferase). An alternative biosynthesis is presented in Fig. 3. amounts of other anthocyanidin-diglucosides then malvin can not be observed in ‘Regent’. They would be expected if malvin-synthesis would take the route via delphinidin- and petunidin-3,5-diglucoside as indicated in Fig. 3. If this observation is true, at least for ‘Regent’ the major biosynthesis of malvin is catalysed by an UDP-D-glucose:anthocyanin 5- O-β-D-glucosyltransferase (5-GT). Phenylpropanoid Pathway Flavonoid Pathway 3-GT 3-GT Cyanidin-3-G Delphinidin-3-G MT 5-GT Peonidin-3-G MT 5-GT Petunidin-3-G Malvidin-3-G MT 5-GT Cyanidin-3,5-DG 5-GT Delphinidin-3,5-DG 5-GT MT Peonidin-3,5-DG MT Petunidin-3,5-DG Malvidin-3,5-DG MT Fig. 3. Biosynthesis of anthocyanidin-3,5-diglucosides. Precursors are derived from the phenylpropanoid/flavonoid pathway. Malvidin-3,5-diglucoside (malvin, dark red) is being synthesised either by UDP-glucose:anthocyanin 5-O-glucosyltransferase (5-GT) or alternatively via petunidin-3,5-diglucoside and its methylation. Diglucosides are highlighted in grey. 3-GT = UDP-D-glucose:anthocyanidin 3-O-β-D-glucosyltransferase (EC 2.4.1.115); 5-GT = UDP-D-glucose:anthocyanin 5-O-β-D-glucosyltransferase; MT = methyltransferase. Cluster I 5-GT Cluster II 3-GT Cluster III (apparently unrelated sequences) Fig. 4: Cluster analysis of amplified and published GT-gene sequences. The primers used preferentially amplified 5-GT-related sequences. Consequently we looked for 5-GT-genes in Degenerate primers and genomic DNA were used significantly differ from 3-GT-sequences as analysis of the cloned amplification products re Altogether these and the published GT-sequences Cluster I consists of 5-GT-genes, cluster II showing rather unrelated GT-genes (Vogt ‘Regent’ (gene 6, 7, 8, and 9) are closely rela contrast gene 5 is located slig with an UDP-glucose:salicylic acid The sequence information obtained was used to analysis in order to monitor Table 1). Different genotypes incl for candidate gene expression in the skin of ma expression of 3-GT, a prerequisi ‘Regent’ as well as anthocyanin metabolites (Boss et al. 1996b, Ford et described by Yamazaki et al. (1999). Sequence indicative for red cultivars. T for amplification of 5-GT -sequences which htly separated (Fig. 4, arrow). Th ‘Munson’ (Fig. 5) show expression of the 3- vealed five different goups 3-GT-genes and cluster III covers sequences form three major gene-clusters (see Fig. 4). glucosyltransferase& fromJones tobacco. 2000). Four GT-genes obtained from the gene expression of the 5-GT gene family (see Fig. 5 and ted to 5-GT-genes found in other plants. in In other genotypes. uding some found in the pedigree of ‘Regent’ were analysed GT-homologous genes. te for colour formation deduce resulting gene inspecific the first primers coloured for 3’-RACE- hus, it was expected that the re is gene shows higher homology turing berries. Fig. 5 shows as an example the __R e__g e __nt __ __ __ __ __ __ __ __ __ __ __ __ __ Chambourcin al. 1998). Expression of 3-GT in berries is Chancellor GT.
Load more

Recommended publications
  • LC–MS/MS and UPLC–UV Evaluation of Anthocyanins and Anthocyanidins During Rabbiteye Blueberry Juice Processing
    beverages Article LC–MS/MS and UPLC–UV Evaluation of Anthocyanins and Anthocyanidins during Rabbiteye Blueberry Juice Processing Rebecca E. Stein-Chisholm 1, John C. Beaulieu 2,* ID , Casey C. Grimm 2 and Steven W. Lloyd 2 1 Lipotec USA, Inc. 1097 Yates Street, Lewisville, TX 75057, USA; [email protected] 2 United States Department of Agriculture, Agricultural Research Service, Southern Regional Research Center, 1100 Robert E. Lee Blvd., New Orleans, LA 70124, USA; [email protected] (C.C.G.); [email protected] (S.W.L.) * Correspondence: [email protected]; Tel.: +1-504-286-4471 Academic Editor: António Manuel Jordão Received: 11 October 2017; Accepted: 1 November 2017; Published: 25 November 2017 Abstract: Blueberry juice processing includes multiple steps and each one affects the chemical composition of the berries, including thermal degradation of anthocyanins. Not-from-concentrate juice was made by heating and enzyme processing blueberries before pressing, followed by ultrafiltration and pasteurization. Using LC–MS/MS, major and minor anthocyanins were identified and semi-quantified at various steps through the process. Ten anthocyanins were identified, including 5 arabinoside and 5 pyrannoside anthocyanins. Three minor anthocyanins were also identified, which apparently have not been previously reported in rabbiteye blueberries. These were delphinidin-3-(p-coumaroyl-glucoside), cyanidin-3-(p-coumaroyl-glucoside), and petunidin-3-(p- coumaroyl-glucoside). Delphinidin-3-(p-coumaroyl-glucoside) significantly increased 50% after pressing. The five known anthocyanidins—cyanidin, delphinidin, malvidin, peonidin, and petunidin—were also quantitated using UPLC–UV. Raw berries and press cake contained the highest anthocyanidin contents and contribute to the value and interest of press cake for use in other food and non-food products.
    [Show full text]
  • Chemistry and Pharmacology of Kinkéliba (Combretum
    CHEMISTRY AND PHARMACOLOGY OF KINKÉLIBA (COMBRETUM MICRANTHUM), A WEST AFRICAN MEDICINAL PLANT By CARA RENAE WELCH A Dissertation submitted to the Graduate School-New Brunswick Rutgers, The State University of New Jersey in partial fulfillment of the requirements for the degree of Doctor of Philosophy Graduate Program in Medicinal Chemistry written under the direction of Dr. James E. Simon and approved by ______________________________ ______________________________ ______________________________ ______________________________ New Brunswick, New Jersey January, 2010 ABSTRACT OF THE DISSERTATION Chemistry and Pharmacology of Kinkéliba (Combretum micranthum), a West African Medicinal Plant by CARA RENAE WELCH Dissertation Director: James E. Simon Kinkéliba (Combretum micranthum, Fam. Combretaceae) is an undomesticated shrub species of western Africa and is one of the most popular traditional bush teas of Senegal. The herbal beverage is traditionally used for weight loss, digestion, as a diuretic and mild antibiotic, and to relieve pain. The fresh leaves are used to treat malarial fever. Leaf extracts, the most biologically active plant tissue relative to stem, bark and roots, were screened for antioxidant capacity, measuring the removal of a radical by UV/VIS spectrophotometry, anti-inflammatory activity, measuring inducible nitric oxide synthase (iNOS) in RAW 264.7 macrophage cells, and glucose-lowering activity, measuring phosphoenolpyruvate carboxykinase (PEPCK) mRNA expression in an H4IIE rat hepatoma cell line. Radical oxygen scavenging activity, or antioxidant capacity, was utilized for initially directing the fractionation; highlighted subfractions and isolated compounds were subsequently tested for anti-inflammatory and glucose-lowering activities. The ethyl acetate and n-butanol fractions of the crude leaf extract were fractionated leading to the isolation and identification of a number of polyphenolic ii compounds.
    [Show full text]
  • Plant Phenolics: Bioavailability As a Key Determinant of Their Potential Health-Promoting Applications
    antioxidants Review Plant Phenolics: Bioavailability as a Key Determinant of Their Potential Health-Promoting Applications Patricia Cosme , Ana B. Rodríguez, Javier Espino * and María Garrido * Neuroimmunophysiology and Chrononutrition Research Group, Department of Physiology, Faculty of Science, University of Extremadura, 06006 Badajoz, Spain; [email protected] (P.C.); [email protected] (A.B.R.) * Correspondence: [email protected] (J.E.); [email protected] (M.G.); Tel.: +34-92-428-9796 (J.E. & M.G.) Received: 22 October 2020; Accepted: 7 December 2020; Published: 12 December 2020 Abstract: Phenolic compounds are secondary metabolites widely spread throughout the plant kingdom that can be categorized as flavonoids and non-flavonoids. Interest in phenolic compounds has dramatically increased during the last decade due to their biological effects and promising therapeutic applications. In this review, we discuss the importance of phenolic compounds’ bioavailability to accomplish their physiological functions, and highlight main factors affecting such parameter throughout metabolism of phenolics, from absorption to excretion. Besides, we give an updated overview of the health benefits of phenolic compounds, which are mainly linked to both their direct (e.g., free-radical scavenging ability) and indirect (e.g., by stimulating activity of antioxidant enzymes) antioxidant properties. Such antioxidant actions reportedly help them to prevent chronic and oxidative stress-related disorders such as cancer, cardiovascular and neurodegenerative diseases, among others. Last, we comment on development of cutting-edge delivery systems intended to improve bioavailability and enhance stability of phenolic compounds in the human body. Keywords: antioxidant activity; bioavailability; flavonoids; health benefits; phenolic compounds 1. Introduction Phenolic compounds are secondary metabolites widely spread throughout the plant kingdom with around 8000 different phenolic structures [1].
    [Show full text]
  • Christianbrothers00timorich.Pdf
    rafrM^ University of California Berkeley . All uses of this manuscript are covered by a legal agreement between the Regents of the University of California and Brother Timothy, dated 5 March, 1974. The manuscript is thereby made available for research purposes. All literary rights in the manuscript, including the right to publish, are reserved to The Bancroft Library of the University of California at Berkeley. No part of the manuscript may be quoted for publication without the written permission of the Director of The Bancroft Library of the University of California at Berkeley. Requests for permission to quote for publication should be addressed to the Regional Oral History Office, 486 Library, and should include identification of the specific passages to be quoted, anticipated use of the passages, and identification of the user. The legal agreement with Brother Timothy requires that he be notified of the request and allowed thirty days in which to respond. The Bancroft Library University of California/Berkeley Regional Oral History Office California Wine Industry Oral History Project Brother Timothy THE CHRISTIAN BROTHERS AS WINEMAKERS With an Introduction by Maynard A. Amerine An Interview Conducted by Ruth Teiser 1975 by The Regents of the University of California Brother Timothy Being interviewed at Mont La Salle, Photograph by Catherine Harroun. TABLE OF CONTENTS -- Brother Timothy PREFACE i INTRODUCTION by Maynard A. Amerine ill INTERVIEW HISTORY v THE CHRISTIAN BROTHERS 1 THE BEGINNING OF WINE MAKING AT MARTINEZ 4 THE MOVE TO
    [Show full text]
  • Official Journal of the European Communities No L 214/ 1
    16 . 8 . 80 Official Journal of the European Communities No L 214/ 1 I (Acts whose publication is obligatory) COMMISSION REGULATION (EEC) No 2164/80 of 8 August 1980 amending for the seventh time Regulation ( EEC) No 1608/76 laying down detailed rules for the description and presentation of wines and grape musts THE COMMISSION OF THE EUROPEAN on an additional label placed in the same field of COMMUNITIES , vision as the other mandatory information ; Having regard to the Treaty establishing the European Economic Community, Whereas the nominal volume of containers with a volume of not less than 5 ml and not more than 10 1 suitable for putting up wines and grape musts which Having regard to Council Regulation (EEC) No are the subject of intra-Community trade is governed 337/79 of 5 February 1979 on the common organi­ by Council Directive 75/ 106/EEC of 19 December zation of the market in wine ('), as last amended by 1974 on the approximation of the laws of the Regulation (EEC) No 1988 / 80 (2 ), and in particular Member States relating to the making-up by volume Article 54 ( 5) thereof, of certain prepackaged liquids (8 ), as amended by Directive 79/ 1005 /EEC ( 9); whereas it is necessary, Whereas Council Regulation ( EEC) No 355 /79 of first, to adjust Regulation (EEC) No 1608 /76 in line 5 February 1979 laying down general rules for the with the amendments to that Directive and , secondly, description , and presentation of wines and grape in order to enable the wines and grape musts already musts (■'), as amended by Regulation (EEC) No
    [Show full text]
  • Delphinidin and Cyanidin Exhibit Antiproliferative and Apoptotic
    Integrative Cancer Science and Therapeutics Research Article ISSN: 2056-4546 Delphinidin and cyanidin exhibit antiproliferative and apoptotic effects in MCF7 human breast cancer cells Jessica Tang1,2*, Emin Oroudjev1, Leslie Wilson1 and George Ayoub1 1Department of Molecular, Cellular & Developmental Biology, University of California, Santa Barbara, USA 2School of Medicine, Medical Sciences, Indiana University, Bloomington, USA Abstract Fruits high in antioxidants such as berries and pomegranates have been shown to have many biological effects, including anticancer activity. We previously reported that bilberry (European blueberry) extract exhibited cytotoxic effects on MCF7-GFP-Tubulin breast cancer cells. To delve further into the mechanism of action of bilberry extract, we focused on two of the most abundant anthocyanins found in bilberry, delphinidin and cyanidin. In this study, we examined the radical scavenging activity, antiproliferative, and apoptotic effects of delphinidin and cyanidin on MCF7 breast cancer cells in comparison to Trolox, a vitamin E analog. DPPH radical scavenging activity assay showed at 50% antioxidant activity, an IC50 of 80 µM, 63 µM, 1.30 µM for delphinidin, cyanidin, and Trolox, respectively. As determined by SRB assay, delphinidin, cyanidin, and Trolox were shown to inhibit MCF7 cell proliferation at IC50 of 120 µM, 47.18 µM, and 11.25 µM, respectively. Immunofluorescence revealed that delphinidin, cyanidin, and Trolox caused apoptotic features such as rounding up of cell, retraction of pseudopodes, condensation of chromatin, minor modification of cytoplasmic organelles, and plasma membrane blebbing. Together, these results show that delphinidin and cyanidin have significant radical scavenging activity, inhibit cell proliferation, and increase apoptosis of MCF7 breast cancer cells.
    [Show full text]
  • Food Chemistry 218 (2017) 440–446
    Food Chemistry 218 (2017) 440–446 Contents lists available at ScienceDirect Food Chemistry journal homepage: www.elsevier.com/locate/foodchem Antiradical activity of delphinidin, pelargonidin and malvin towards hydroxyl and nitric oxide radicals: The energy requirements calculations as a prediction of the possible antiradical mechanisms ⇑ Jasmina M. Dimitric´ Markovic´ a, , Boris Pejin b, Dejan Milenkovic´ c, Dragan Amic´ d, Nebojša Begovic´ e, Miloš Mojovic´ a, Zoran S. Markovic´ c,f a Faculty of Physical Chemistry, University of Belgrade, Studentski trg 12-16, 11000 Belgrade, Serbia b Department of Life Sciences, Institute for Multidisciplinary Research – IMSI, Kneza Višeslava 1, 11030 Belgrade, Serbia c Bioengineering Research and Development Center, 34000 Kragujevac, Serbia d Faculty of Agriculture, Josip Juraj Strossmayer University of Osijek, Kralja Petra Svacˇic´a 1D, 31000 Osijek, Croatia e Institute of General and Physical Chemistry, Studentski trg 12-16, 11000 Belgrade, Serbia f Department of Chemical-Technological Sciences, State University of Novi Pazar, Vuka Karadzˇic´a bb, 36300 Novi Pazar, Serbia article info abstract Article history: Naturally occurring flavonoids, delphinidin, pelargonidin and malvin, were investigated experimentally Received 24 August 2015 and theoretically for their ability to scavenge hydroxyl and nitric oxide radicals. Electron spin resonance Received in revised form 28 August 2016 (ESR) spectroscopy was used to determine antiradical activity of the selected compounds and M05-2X/6- Accepted 16 September 2016 311+G(d,p) level of theory for the calculation of reaction enthalpies related to three possible mechanisms Available online 17 September 2016 of free radical scavenging activity, namely HAT, SET-PT and SPLET. The results obtained show that the molecules investigated reacted with hydroxyl radical via both HAT and SPLET in the solvents investi- Chemical compounds studied in this article: gated.
    [Show full text]
  • California Grape Acreage 1991
    CALIFORNIA GRAPE ACREAGE 1991 California Agricultural Statistics Service P.O. Box 1258 Sacramento, CA 95812 (916) 654-0799 May 1992 TABLE OF CONTENTS Acknowledgments ........................................................... 1 Foreword ................................................................. 1 Survey Methods ............................................................. 1 Data Limitations .......................................................... 2 Acreage Breakdown .......................................................... 3 Acreage Trends ............................................................. 3 Footnotes ................................................................ 31 TABLE 1. ALL GRAPES: Acreage standing by type, by year planted, California ................ 4 TABLE 2. RAISIN TYPE GRAPES: Acreage standing, by variety, by year planted, California ....... 4 TABLE 3. TABLE TYPE GRAPES: Acreage standing, by variety, by year planted, California ....... 4 TABLE 4. RED WINE TYPE GRAPES: Acreage standing, by variety, by year planted, California ......................................................... 5 TABLE 5. WHITE WINE TYPE GRAPES: Acreage standing, by variety, by year planted, California ......................................................... 5 TABLE 6. RAISIN TYPE GRAPES: Acreage standing, by variety, by year planted, by county, California ................................................. 6 TABLE 7. TABLE TYPE GRAPES: Acreage standing, by variety, by year planted, by county, California ................................................
    [Show full text]
  • Anthocyanins, Vibrant Color Pigments, and Their Role in Skin Cancer Prevention
    biomedicines Review Anthocyanins, Vibrant Color Pigments, and Their Role in Skin Cancer Prevention 1,2, , 2,3, 4,5 3 Zorit, a Diaconeasa * y , Ioana S, tirbu y, Jianbo Xiao , Nicolae Leopold , Zayde Ayvaz 6 , Corina Danciu 7, Huseyin Ayvaz 8 , Andreea Stanilˇ aˇ 1,2,Madˇ alinaˇ Nistor 1,2 and Carmen Socaciu 1,2 1 Faculty of Food Science and Technology, University of Agricultural Sciences and Veterinary Medicine, 400372 Cluj-Napoca, Romania; [email protected] (A.S.); [email protected] (M.N.); [email protected] (C.S.) 2 Institute of Life Sciences, University of Agricultural Sciences and Veterinary Medicine, Calea Mănă¸stur3-5, 400372 Cluj-Napoca, Romania; [email protected] 3 Faculty of Physics, Babes, -Bolyai University, Kogalniceanu 1, 400084 Cluj-Napoca, Romania; [email protected] 4 Institute of Chinese Medical Sciences, State Key Laboratory of Quality Research in Chinese Medicine, University of Macau, Taipa, Macau 999078, China; [email protected] 5 International Research Center for Food Nutrition and Safety, Jiangsu University, Zhenjiang 212013, China 6 Faculty of Marine Science and Technology, Department of Marine Technology Engineering, Canakkale Onsekiz Mart University, 17100 Canakkale, Turkey; [email protected] 7 Victor Babes University of Medicine and Pharmacy, Department of Pharmacognosy, 2 Eftimie Murgu Sq., 300041 Timisoara, Romania; [email protected] 8 Department of Food Engineering, Engineering Faculty, Canakkale Onsekiz Mart University, 17020 Canakkale, Turkey; [email protected] * Correspondence: [email protected]; Tel.: +40-751-033-871 These authors contributed equally to this work. y Received: 31 July 2020; Accepted: 25 August 2020; Published: 9 September 2020 Abstract: Until today, numerous studies evaluated the topic of anthocyanins and various types of cancer, regarding the anthocyanins’ preventative and inhibitory effects, underlying molecular mechanisms, and such.
    [Show full text]
  • Effects of Anthocyanins on the Ahr–CYP1A1 Signaling Pathway in Human
    Toxicology Letters 221 (2013) 1–8 Contents lists available at SciVerse ScienceDirect Toxicology Letters jou rnal homepage: www.elsevier.com/locate/toxlet Effects of anthocyanins on the AhR–CYP1A1 signaling pathway in human hepatocytes and human cancer cell lines a b c d Alzbeta Kamenickova , Eva Anzenbacherova , Petr Pavek , Anatoly A. Soshilov , d e e a,∗ Michael S. Denison , Michaela Zapletalova , Pavel Anzenbacher , Zdenek Dvorak a Department of Cell Biology and Genetics, Faculty of Science, Palacky University, Slechtitelu 11, 783 71 Olomouc, Czech Republic b Institute of Medical Chemistry and Biochemistry, Faculty of Medicine and Dentistry, Palacky University, Hnevotinska 3, 775 15 Olomouc, Czech Republic c Department of Pharmacology and Toxicology, Charles University in Prague, Faculty of Pharmacy in Hradec Kralove, Heyrovskeho 1203, Hradec Kralove 50005, Czech Republic d Department of Environmental Toxicology, University of California, Meyer Hall, One Shields Avenue, Davis, CA 95616-8588, USA e Institute of Pharmacology, Faculty of Medicine and Dentistry, Palacky University, Hnevotinska 3, 775 15 Olomouc, Czech Republic h i g h l i g h t s • Food constituents may interact with drug metabolizing pathways. • AhR–CYP1A1 pathway is involved in drug metabolism and carcinogenesis. • We examined effects of 21 anthocyanins on AhR–CYP1A1 signaling. • Human hepatocytes and cell lines HepG2 and LS174T were used as the models. • Tested anthocyanins possess very low potential for food–drug interactions. a r t i c l e i n f o a b s t r a c t
    [Show full text]
  • NELSON IVAN MENDOZA ALDERETE.Pdf (965.7Kb)
    UNIVERSIDAD AUTONOMA AGRARIA ANTONIO NARRO UNIDAD LAGUNA DIVISIÓN DE CARRERAS AGRONÓMICAS EFECTO DE PORTAINJERTO Y DENSIDAD DE PLANTACIÓN SOBRE LA PRODUCCIÓN DE UVA Y VIGOR DE LA PLANTA EN LA VARIEDAD RUBIRED, BAJO CONDICIONES DE SEQUIA. POR NELSON IVAN MENDOZA ALDERETE TESIS PRESENTADA COMO REQUISITO PARCIAL PARA OBTENER EL TÍTULO DE: INGENIERO AGRÓNOMO EN HORTICULTURA TORREÓN, COAHUILA, MÉXICO Febrero de 2009 Dedicatorias A dios: Por darme la vida para alcanzar esta meta, por la oportunidad que me dio para concluir satisfactoriamente una etapa más de mi vida y por tantas cosas buenas y maravillosas que me ha brindado. A mis padres: Lázaro Mendoza Almaraz Y María Trinidad Alderete Marrufo A mi padre por haberme otorgado siempre su apoyo incondicional, para terminar mi carrera universitaria, así como sus consejos que me ayudaron a forjarme un carácter fuerte de convicciones concretas, y por creer en mí. A mi madre por toda su dulzura, su cariño y comprensión, y por toda la confianza que deposito en mí…. Y a ambos por haberme dado esta herencia tan grande que nunca hubiera logrado sin su apoyo incondicional. A mi novia Jeny que me apoyo en todo momento y estuvo conmigo cuando necesite de ella. A mis hermanos: Juan Carlos Mendoza Alderete y Osbaldo Mendoza Alderete, por todo su apoyo, respeto y cariño que me han brindado. GRACIAS. A mis abuelos, tíos, primos y a toda mi familia que de una u otra manera influyeron en mi carrera y contribuyeron para que lograra alcanzar mi meta … a todos ellos ….GRACIAS… i AGRADECIMIENTOS A dios por darme la oportunidad de vivir este momento tan satisfactorio de mi vida y por ayudarme a ser una persona de bien y mostrarme el camino correcto para alcanzar mis metas.
    [Show full text]
  • A Biochemical Survey of Some Mendelian Factors for Flower Colour
    A BIOCHEMICAL 8UP~VEY OF SOME MENDELIAN FACTOI%S FO].~ FLOWEP~ COLOU~. BY ROSE SCOTT-MONCI~IEFF. (John Inncs Horticultural Institution, London.) (With One Text-figure.) CONTENTS. PAGE P~rb I. Introductory ].17 (a) The plastid 1)igmenl~s ] 21 (b) The a,n~hoxan~hius: i~heir backgromld, co-pigment and interaction effecbs upon flower-colour v~ri~bion 122 (c) The ani~hocyauins ] 25 (c) Col[oidM condition . 131 (f) Anthoey~nins as indic~bors 132 (g) The source of tim ~nl;hoey~nins 133 ]?ar[ II, Experimental 134 A. i~ecen~ investigations: (a) 2Prim,ula si,sensis 134- (b) Pa,l)aver Rhoeas 14.1 (c) Primuln aca.ulis 147 (d) Chc.l)ranth'ss Chci,rl 148 (e) ltosa lmlyanlha . 149 (f) Pelargonium zomdc 149 (g) Lalh,ymts odor~,l,us 150 (h) Vcrbom, hybrids 153 (i) Sl;'e2)loca~'])uG hybrids 15~ (j) T'rol)aeolu,m ,majors ] 55 ]3. B,eviews of published remflts of bhe t~u~horand o~hers.. (a) Dahlia variabilis (Lawreuce and Scol,~-Monerieff) 156 (b) A.nlb'rhinum majors (Wheklalo-Onslow, :Basseb~ a,nd ,~cobb- M.oncrieff ) 157 (c) Pharbilis nil (I-Iagiwam) . 158 (d) J/it& (Sht'itl.er it,lid Anderson) • . 159 (e) Zect d]f.ctys (~&udo, Miiner trod 8borl/lall) 159 Par~, III. The generM beh~wiour of Mendelian £acbors rot' flower colour . 160 Summary . 167 tLefermmes 168 I)AI~T I. II~TI~O])UOTOnY. Slm~C~ Onslow (1914) m~de the first sfudy of biochemica] chal~ges in- volved in flower-eolour va,riadon, our pro'ely chemical knowledge of bhe 118 A Bio&emical Su~'vey oI' Factor's fo~ • Flowe~' Colou~' anthocya.nin pigments has been considerably advanced by the work of Willstgtter, P~obinson, Karrer and their collaborators.
    [Show full text]