Deficiency Γ-Α Genetic Basis of Human Complement C8

Home , Complement deficiency

Genetic Basis of Human Complement C8α-γ Deficiency Takeshi Kojima, Takahiko Horiuchi, Hiroaki Nishizaka, Yasuo Fukumori, Tetsuki Amano, Kohei Nagasawa, This information is current as Yoshiyuki Niho and Kenshi Hayashi of September 24, 2021. J Immunol 1998; 161:3762-3766; ; http://www.jimmunol.org/content/161/7/3762 Downloaded from

References This article cites 46 articles, 20 of which you can access for free at: http://www.jimmunol.org/content/161/7/3762.full#ref-list-1

Why The JI? Submit online. http://www.jimmunol.org/

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on September 24, 2021

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1998 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Genetic Basis of Human Complement C8␣-␥ Deﬁciency1

Takeshi Kojima,* Takahiko Horiuchi,2* Hiroaki Nishizaka,* Yasuo Fukumori,† Tetsuki Amano,‡ Kohei Nagasawa,§ Yoshiyuki Niho,* and Kenshi Hayashi¶

Deficiency of the ␣-␥ subunit of the eighth component of complement (C8␣-␥D) is frequently associated with recurrent neisserial infections, especially meningitis caused by Neisseria meningitidis. We here report the molecular basis of C8␣-␥D in two unrelated Japanese subjects. Screening all 11 exons of the C8␣ gene and all 7 exons of the C8␥ gene and their boundaries by exon-specific PCR/single-strand conformation polymorphism demonstrated aberrant single-stranded DNA fragments in exon 2 of C8␣ gene in case 1 and in exons 2 and 9 of C8␣ gene in case 2. Nucleotide sequencing of the amplified DNA fragments in case 1 revealed a -homozygous single-point mutation at the second exon-intron boundary, inactivating the universally conserved 5؅ splice site con ,sensus sequence of the second intron (IVS2؉1G3T). Case 2 was a compound heterozygote for the splice junction mutation IVS2؉1G3T, and a nonsense mutation at Arg394 (R394X). R394X was caused byaCtoTtransition at nucleotide 1407, the first nucleotide of the codon CGA for Arg394, leading to a stop codon TGA. No mutations were detected in the C8␥ gene by our method. Downloaded from Our results indicate that the pathogenesis of C8␣-␥D might be caused by heterogeneous molecular defects in the C8␣ gene. The Journal of Immunology, 1998, 161: 3762–3766.

he eighth component of complement (C8) plays an im- transmembrane domain (11). The ␤ subunit also has a domain that portant role in the function of membrane attack complex interacts with target membranes and a domain that specifically T (MAC)3 that is generated on target cells upon activation mediates recognition and binding of C8 to C5b-7 (14). The ␥ sub- http://www.jimmunol.org/ of the complement system. MAC is generated by sequential addi- unit is composed of 182 amino acid residues and is disulfide linked tion of C5b, C6, C7, C8, and C9 molecules, which results in the to the ␣ subunit (10, 15). However, the ␥ subunit is not essential transmembrane pore and eventual cell lysis. After binding to C8, for hemolytic activity, as evidenced by the fact that a C8 derivative C5b-7 complex, by itself transiently bound to membrane surface composed of only ␣ and ␤ is functionally equivalent to the normal and nonfunctional, is endowed with the ability to cause membrane protein (12). Individuals with inherited deficiencies of the compo- damage and polymerization of C9 that greatly accelerate MAC nent of MAC frequently suffer from recurrent neisserial infections, activity (1). C8 is a 151-kDa molecule consisting of three non- predominantly meningococcal infections of rare serotypes (16– identical polypeptide chains: ␣ (M ϭ 64 kDa), ␤ (M ϭ 64 kDa), 18). Two functionally distinct C8 deficiency states have been de- r r by guest on September 24, 2021 ␥ ϭ ␣ ␥ ␤ and (Mr 22 kDa) (2). Genetic studies of C8 polymorphisms scribed, depending on which of the C8 subunits ( - or )is established that ␣-␥ and ␤ are encoded at different loci (3–5). The defective. The C8␣-␥ deficiency (C8␣-␥D) is predominantly re- genes for C8␣ and C8␤ are located on chromosome 1p32 (6, 7), ported in Blacks, Hispanics, and Japanese, whereas C8␤D has whereas the gene for C8␥ is located on chromosome 9q (8). The ␣ been reported primarily in Caucasians (19–21). Molecular defects and ␤ subunits of C8 show an overall structural homology to C6, leading to inherited deficiencies of C8␤ as well as the other com- C7, and C9 (9). The ␥ subunit shows structural homology to pro- ponents of MAC such as C5, C6, C7, and C9 have been described tein HC (10). The ␣ subunit is composed of 553 amino acid res- recently (22–29). However, defects causing C8␣-␥D have not been idues (11), has a domain that interacts with ␤ subunit (12), and reported as yet. In the present study, we investigated the genetic comprises the binding site for C9 on C5b-8 (13). The ␣ subunit basis of C8␣-␥D in two unrelated Japanese subjects, using exon- also has several membrane surface-seeking domains and a possible specific PCR/single-strand conformation polymorphism (SSCP) analysis of C8␣ and C8␥ genes (30), followed by direct DNA sequencing anomalously migrating exons to identify mutations. *First Department of Internal Medicine, Faculty of Medicine, Kyushu University, Although there were no mutations detected in the C8␥ gene by this Fukuoka, Japan; †Department of Research, Osaka Red Cross Blood Center, Osaka, Japan; ‡Third Department of Internal Medicine, Faculty of Medicine, Okayama Uni- method in either case, a homozygous (case 1) and a compound versity, Okayama, Japan; §Department of Internal Medicine, Saga Medical School, heterozygous mutation (case 2) were identified in the C8␣ gene. A ¶ Saga, Japan; and Institute of Genetic Information, Kyushu University, Fukuoka, homozygous G to T transversion in the exon 2/intron 2 splice Japan junction (IVS2ϩ1G3T) of the C8␣ gene that would cause splic- Received for publication October 21, 1997. Accepted for publication May 27, 1998. ing error was detected in case 1. In case 2, a heterozygous mutation The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance identical with that of case 1 as well as a heterozygous C to T 394 with 18 U.S.C. Section 1734 solely to indicate this fact. transition in exon 9 at the first nucleotide of CGA codon for Arg 1 This work was supported in part by grants-in-aid from the Ministry of Education, (R394X) of the C8␣ gene were detected. Science, and Culture of Japan (08670522), the Fukuoka Cancer Society, and the Yokoyama Foundation. 2 Address correspondence and reprint requests to Dr. Takahiko Horiuchi, First De- Materials and Methods partment of Internal Medicine, Faculty of Medicine, Kyushu University, Fukuoka ␣ ␥ 812-8582, Japan. E-mail address: [email protected] C8 - D subjects 3 Abbreviations used in this paper: MAC, membrane attack complex; C8␣-␥D, C8␣-␥ Two unrelated individuals were included in this study. Case 1 was a 63- deficiency; SSCP, single-strand conformation polymorphism. yr-old Japanese male who was admitted to Okayama University Hospital 4 Throughout this paper, nucleotide and amino acid residues numbering for C8␣ is (Okayama, Japan) with macrocytic hyperchromic anemia. He had inactive according to Rao et al. (11). pulmonary tuberculosis and ulcerative colitis. Total hemolytic activity

Table I. Primer sequences for the analysis of C8␣ gene

Start 5Ј Oligonucleotide Sequence Start 3Ј Oligonucleotide Sequence Fragment Size Exons (bp)a (5Ј to 3Ј) (bp)b (5Ј to 3Ј) (bp)

1 Ϫ27 GGGTGAGTTTCCAACATCAGA ϩ50 ACCAGGTGATTCCTACGTGC 250 2 Ϫ23 GCATGGATCTTCCCTTTCTT ϩ25 CCCAAACCGGTTGTAAGTGT 142 3 Ϫ68 GCTGCACAAGTCTTGGTTGA ϩ46 TCACTTTTGACAGGCACAGC 259 4 Ϫ28 AGGAGCAGCCACAGTCTCTT ϩ45 GACAAATCATTCCCTGCTCC 221 5 Ϫ48 AAAACCCAGCATCCACTAGC ϩ40 TACACCACAGTGGCCTCAGA 278 6 Ϫ26 CTAATATCTATCCTTT ϩ23 ACACAGACCTTATGT 250 7 Ϫ29 TTGCTTTATTCAATGGCGGT ϩ56 CCATGACCTGGTGTCTGTGT 326 8 Ϫ26 TGTGTTTCTCTGTCTCCCTG ϩ38 ATCCATCACCTTTGCCAGAT 190 9 Ϫ47 GGGCTTTTTGGGAAATGAGT ϩ50 ACTTTCATTCCTCATGGACG 255 10 Ϫ45 TAGATAGAGCCCAGGGAGGG ϩ48 CTTTGAGCTGGGACAGGCT 316 11 Ϫ36 GCTAACCTTCTCCTCCCTGG ϩ129c GGAAGCTGGCAGAACAAAGA 317

a The 5Ј site of the oligonucleotide was defined as N bp upstream (ϪN) from the 5Ј site of the exon. b The 5Ј site of the oligonucleotide was defined as N bp downstream (ϩN) from the 3Ј site of the exon except in the case of exon 11. c The 5Ј site of the oligonucleotide was defined as N bp downstream (ϩN) from the TGA (stop) codon.

␮ Downloaded from (CH50) was undetectable, and a subsequent analysis of complement com- polymerase in a 25- l total reaction volume. Reaction products were pu- ponents revealed that C8 protein was also undetectable in his serum (Ͻ0.5 rified by Microcon 100 (Amicon, Beverly, MA) and directly sequenced mg/dl) by single radial immunodiffusion assay. Total hemolytic activity using the Amplicycle sequencing kit (Perkin-Elmer/Cetus) and radiola- was restored to 75% of the normal range by adding purified C8, but not by beled primers according to the manufacturer’s instructions. Primers were adding serum from a C8␣-␥D patient. Case 2 was a 42-yr-old Japanese labeled using T4 polynucleotide kinase (New England Biolabs, Beverly, female who was found to be C8␣-␥D during a large scale screening for MA) and [␥-32P]ATP (ICN) at 37°C for 20 min. inherited deficiencies of late acting complement components among healthy blood donors in Osaka, Japan (21). The serum C8 concentration in Results http://www.jimmunol.org/ case 2 was below the detectable level either by hemolytic assay for C8 Detection of C8␣ and C8␥ gene mutation by PCR/SSCP activity or by single radial immunodiffusion assay. The C8 hemolytic activity of case 2 was effectively restored by the addition of the purified analysis ␣ ␥ ␣ ␥ C8 - subunit (21). Therefore, these two cases were classified as C8 - D. SSCP analysis of all 11 C8␣ exon-specific PCR fragments resulted They had no history of meningitis or systemic neisserial infections. We were unable to perform family studies in either case. in the detection of aberrant bands in exon 2 of case 1 and in exons 2 and 9 of case 2. As shown in Figure 1a, the exon 2-specific PCR PCR/SSCP analysis fragments of case 1 displayed two bands at 4°C without glycerol The primers for exon-specific PCR for all 11 exons of the C8␣ gene and all migrating differently from those of the C8-sufficient control run in ␥

7 exons of the C8 gene were synthesized on the basis of the flanking parallel. Case 2 displayed the mixed pattern of case 1 and the by guest on September 24, 2021 intronic sequences (31, 32) and are listed in Table I and Table II. Genomic control. Additionally, in case 2 the exon 9-specific PCR fragments DNA was purified from PBMC as previously described (33). Exon-specific displayed three bands at 4°C without glycerol, one of which mi- PCR was conducted using 50 ng of genomic DNA as template, 0.2 ␮Mof each primer, 25 ␮M dNTP including 2 ␮Ci [␣-32P]dCTP (ICN, Irvine, grated differently from those of C8-sufficient controls (Fig. 1b). CA), and 0.125 U Taq polymerase in a 5-␮l total reaction volume. Thirty Analysis of the PCR fragments of the C8 deficiency cases at 25°C cycles consisting of 1 min at 94°C and 2 min at 60°C were conducted using with glycerol did not show any difference compared with those of a thermal cycler PJ2000 (Perkin-Elmer/Cetus, Norwalk, CT). The PCR controls (data not shown). These results suggest that in case 1, a products were subjected to electrophoresis on 5% nondenaturing acryl- homozygous C8␣ gene mutation, resides in exon 2, while in case amide gels at 4°C without glycerol or at 25°C containing 5% glycerol, using 45 mM Tris-borate and 1 mM EDTA buffer, pH 8.3, at 13 V/cm. 2 a compound heterozygous mutation exists in exons 2 and 9. No DNA fragments were visualized by exposing the gels to Fuji RX5 film other aberrant bands were detected in any other exons of the C8␣ (Fuji, Kanagawa, Japan). and C8␥ genes in either of the C8␣-␥D cases.

Genomic DNA sequencing of PCR fragments Determination of the splice junction mutation in intron 2 DNA fragments of interest were excised from PCR/SSCP acrylamide gels, The DNA fragment detected by PCR/SSCP analysis of C8␣ exon puriﬁed on SUPREC-01 columns (Takara Shuzo, Otsu, Japan), and ream- pliﬁed by PCR reagent kit (Perkin-Elmer/Cetus), according to the manu- 2 from case 1 (Fig. 1a, fragment a) as well as the DNA fragment facturer’s instructions, for 20 cycles consisting of 1 min at 95°C and 2 min from a control (Fig. 1a, fragment b) were directly sequenced in its at 60°C by using 2 ␮M of each primer, 200 ␮M dNTP, and 0.625 U Taq entirety. The nucleotide sequence was identical with that reported

Table II. Primer sequences for the analysis of C8␥ gene

Start 5Ј Oligonucleotide Sequence Start 3Ј Oligonucleotide Sequence Fragment Size Exons (bp)a (5Ј to 3Ј) (bp)b (5Ј to 3Ј) (bp)

1 Ϫ46c TGCTACCCTTGGCCTCC ϩ168 CAGACCATGGGAGAACTCG 352 2 Ϫ28 CTCGAGTTCTCCCATGGTCT ϩ111 GAATCCTAGTCCAGGCCACA 276 3 Ϫ67 TGTGGCCTGGACTAGGATTC ϩ75 GCCACAGTAGCCATGTCAGA 213 4 Ϫ52 GGATGACGCAGCCACTGT ϩ96 AGTGTGTCCCCATGGCTC 256 5 Ϫ80 CAGGGGACACACAGACCC ϩ68 AGGGGTCAGGCTGGACAT 250 6, 7 Ϫ46 CACTCTCTGGCTGATGTCCA ϩ103d CCTGATCTGAGGCTGGTTTC 281

a The 5Ј site of the oligonucleotide was defined as N bp upstream (ϪN) from the 5Ј site of the exon except in the case of exon 1. b The 5Ј site of the oligonucleotide was defined as N bp downstream (ϩN) from the 3Ј site of the exon except in the case of exon 6, 7. c The 5Ј site of the oligonucleotide was defined as N bp upstream (ϪN) from the ATG (initiation) codon. d The 5Ј site of the oligonucleotide was defined as N bp downstream (ϩN) from the TGA (stop) codon. 3764 GENETIC BASIS OF HUMAN COMPLEMENT C8␣-␥ DEFICIENCY

FIGURE 3. Definition of the C8␣-exon 9 mutation in case 2. a, Partial nucleotide sequences of the SSCP bands. The sequence of fragment b from Figure 1b is identical with the corresponding sequence of the normal C8␣ gene. Fragment a from Figure 1b displays C to T transition at nucleotide 1407. b, Nucleotide sequence and deduced amino acid sequence (one-letter code) around the mutation. The translated C8␣ protein is truncated at amino acid residue 394 that is different from that of the native protein. Downloaded from FIGURE 1. PCR/SSCP analysis of C8␣-␥D individuals. a, Exon-specific PCR/SSCP for exon 2 using genomic DNA from case 1 (lane 1), case 2(lane 2), and a C8-sufficient control (lane C). b, Exon-specific PCR/SSCP for exon 9 using genomic DNA from case 1 (lane 1), case 2 (lane 2), and C8-sufficient control (lane C). Electrophoresis was performed in 5% poly- quence of fragment a revealed C to T transition at nucleotide 1407 acrylamide gel without glycerol at 4°C. Aberrantly migrating DNA frag- (Fig. 3a). Nucleotide 1407 is the first nucleotide of the codon CGA for Arg394 of the C8␣ gene. The C to T transition generates a

ments (fragment a) as well as those from the normal control (fragment b) http://www.jimmunol.org/ were puriﬁed separately from the gel, ampliﬁed by PCR, and subjected to termination codon, TGA, which would cause the truncation of the nucleotide sequencing. encoded C8␣ protein (Fig. 3b).

Discussion previously (30), except that nucleotide 308ϩ1 was a T instead of We describe here the molecular basis of C8␣-␥D in two unrelated a G (IVS2ϩ1G3T; Fig. 2a). Nucleotide 308ϩ1 is the first nu- Japanese subjects. This is the first description of the molecular cleotide of the C8␣ intron 2. The G to T transversion in intron 2 defects leading to C8␣-␥D. A homozygous splice junction muta- (IVS2ϩ1G3T) would cause the truncation of the C8␣ protein by tion in the first case and a compound heterozygous mutation in the a splicing error (Fig. 2b). Direct sequencing of the C8␣ exon 2 by guest on September 24, 2021 second case consisting of the same splice mutation and a nonsense showed that case 2 was heterozygous for the mutation mutation were shown to be the causes of the deficiency. IVS2ϩ1G3T that was identified in case 1 (data not shown). C8D appears to have an ethnic predominance. The C8␤Dis Determination of the mutation in exon 9 exclusively identified in Caucasians, whereas C8␣-␥D has been found mostly in non-Caucasians (19–21). A review of comple- Two single-stranded DNA fragments detected by PCR/SSCP anal- ment deficiencies published in 1984 described 31 C8D individuals ysis of the C8␣ exon 9 (Fig. 1b, fragments a and b) from case 2 in 22 kindreds (19). Twelve of the 31 C8D subjects had one or were isolated from the gel and sequenced in their entirety. The more episodes of meningococcal disease. Among the 31 C8D nucleotide sequence of fragment b was identical with the corre- subjects, six individuals in five kindreds (four Blacks and one sponding sequence of the normal C8␣ gene. The nucleotide se- Hispanic) were confirmed to be C8␣-␥D. In Japan, four C8␣-␥D individuals, one of whom was case 2 in the present study, were identified among sera from 145,640 healthy blood donors in Osaka (21). To identify the molecular defects causing C8␣-␥D we adapted a two-step procedure with PCR-SSCP analysis as a first step followed by a second step of sequencing the aberrant bands. In the first step, all 11 exons of the C8␣ and the 7 exons of the C8␥ gene were amplified by PCR, and the resulting DNA fragments were analyzed by SSCP. This approach enabled us to detect target exons and avoid sequencing the entire coding region of the C8␣ and C8␥ genes of the deficient individuals. The strategy provides a rapid, sensitive, and simple method to investigate the whole coding region of genes and has been successfully used by our group for the molecular analysis of C6-, C7-, and C9-deficient individuals (24, 25, 29). ␣ FIGURE 2. Definition of C8 -intron 2 mutation in cases 1 and 2. a, We have identified a possible RNA splicing defect in both cases. Partial nucleotide sequences of the SSCP bands. The sequences of frag- The mutation is a single-base G to T transversion destroying the ment b from Figure 1a is identical with the corresponding sequence of the Ј normal C8␣ gene. Fragment a from Figure 1a displays G to T transversion highly conserved sequence at the 5 splice site of intron 2 of the ␣ ϩ in exon 2/intron 2 splicing junction (IVS2ϩ1G3T). b, Nucleotide se- C8 gene. Since the G at position 1 of the splice site sequence quence and deduced amino acid sequence (one-letter code) around the is completely conserved in eukaryotes (34), this mutation undoubt- IVS2ϩ1G3T mutation. This mutation destroys the highly conserved se- edly affects maturation of RNA. A widely accepted model for ver- quence at the 5Ј splice site of intron 2 of C8␣ gene. tebrate pre-mRNA splicing proposed that exons are recognized The Journal of Immunology 3765

4. Raum, D., M. A. Spence, D. Balavitch, S. Tideman, A. D. Merritt, R. T. Taggart, B. H. Petersen, N. K. Day, and C. A. Alper. 1979. Genetic control of the eighth component of complement. J. Clin. Invest. 64:858. 5. Rittner, C., W. Hargesheimer, and E. Mollenhauer. 1984. Population and formal genetics of human C81 (␣-␥) polymorphism. Hum. Genet. 67:166. 6. Theriault, A., E. Boyd, K. Whaley, J. M. Sodetz, and J. M. Connor. 1992. Re- gional chromosomal assignment of genes encoding the ␣ and ␤ subunits of human complement protein C8 to 1p32. Hum. Genet. 88:703. 7. Rogde, S., B. Olaisen, T. Gedde-Dahl, Jr., and P. Teisberg. 1986. The C8A and C8B loci are closely linked on chromosome 1. Annu. Hum. Genet. 50:139. 8. Kaufman, K. M., J. V. Snider, N. K. Spurr, C. E. Schwartz, and J. M. Sodetz. 1989. Chromosomal assignment of genes encoding the ␣, ␤, and ␥ subunits of human complement protein C8: identification of a close physical linkage between the ␣ and the ␤ loci. Genomics 5:475. 9. Hobart, M. J., B. A. Fernie, and R. G. DiScipio. 1995. Structure of the human C7 gene and comparison with the C6, C8A, C8B, and C9 genes. J. Immunol. 154: FIGURE 4. Schematic diagram of the molecular structure of normal 5188. C8␣ (adapted from Ref. 9) and the positions of mutations in cases 1 and 2. 10. Haefliger, J. A., D. Jenne, K. K. Stanley, and J. Tschopp. 1987. Structural ho- ␥ Modules are designated, according to the recommendations of a recent mology of human complement component C8 and plasma protein HC: identity of the cysteine bond pattern. Biochem. Biophys. Res. Commun. 149:750. workshop (53), as follows: T1, thrombospondin, type 1; LA, low density 11. Rao, A. G., O. M. Howard, S. C. Ng, A. S. Whitehead, H. R. Colten, and lipoprotein receptor, type A; EG, epidermal growth factor. J. M. Sodetz. 1987. Complementary DNA and derived amino acid sequence of the ␣ subunit of human complement protein C8: evidence for the existence of a separate ␣ subunit messenger RNA. Biochemistry 26:3556. 12. Brickner, A., and J. M. Sodetz. 1984. Function of subunits within the eighth Downloaded from and defined as units during early assembly by binding of splicing component of human complement: selective removal of the ␥ chain reveals it has factors to the 3Ј end of the preceding intron, followed by a search no direct role in cytolysis. Biochemistry 23:832. for a suitable 5Ј donor site sequence, (C/A)AG:GT(A/G)AGT (the 13. Stewart, J. L., and J. M. Sodetz. 1985. Analysis of the specific association of the eighth and ninth components of human complement: identification of a direct role colon denotes the site of cleavage) (35–37). A point mutation at the for the ␣ subunit of C8. Biochemistry 24:4598. 5Ј splice site at IVS2ϩ1 results in two aberrant splicing patterns. 14. Monahan, J. B., and J. M. Sodetz. 1981. Role of the ␤ subunit in interaction of The first is the activation of cryptic sites either upstream in the the eighth component of human complement with the membrane-bound cytolytic complex. J. Biol. Chem. 256:3258. http://www.jimmunol.org/ exon or downstream in the intron, which are ignored when the 15. Kolb, W. P., and H. J. Mu¨ller-Eberhard. 1976. The membrane attack mechanism authentic splice site is present (38, 39). Such junctional abnormal- of complement: the three polypeptide chain structure of the eighth component ities are reported in many disorders, such as ␤-thalassemia (39), (C8). J. Exp. Med. 143:1131. 16. Fijen, C. A., E. J. Kuijper, A. J. Hannema, A. G. Sjo¨holm, and J. P. van Putten. human cystic fibrosis (40), and muscle phosphofructokinase defi- 1989. Complement deficiencies in patients over ten years old with meningococcal ciency (41). The second pattern is exon skipping. The exon adja- disease due to uncommon serogroups. Lancet ii:585. cent to the mutation is not recognized by the splicing factors in- 17. Tedesco, F., P. Densen, M. A. Villa, B. H. Petersen, and G. Sirchia. 1983. Two types of dysfunctional eighth component of complement (C8) molecules in C8 volved in splice site selection. Exon skipping occurs if no suitable deficiency in man: reconstitution of normal C8 from the mixture of two abnormal new 5Ј donor site can be identified by the spliceosome complex C8 molecules. J. Clin. Invest. 71:183. 18. Di Ninno, V. L., and V. K. Chenier 1981. Activation of complement by neisseria within approximately 300 bp downstream of the 3Ј site (42). An by guest on September 24, 2021 meningitidis. FEMS Microbiol. Lett. 12:55. exon-skipping phenotype has also been demonstrated in many 19. Ross, S. C., and P. Densen. 1984. Complement deficiency states and infection: cases of naturally occurring mutations (43–48). As C8␣ transcripts epidemiology, pathogenesis and consequences of neisserial and other infections were not identified in PBMC from healthy controls or the C8D in an immune deficiency. Medicine 63:243. 20. Tedesco, F. 1986. Component deficiencies. 8. The eighth component. Prog. Al- individuals (our unpublished observation), we were unable to an- lergy 39:295. alyze the aberrant transcripts caused by the mutation, 21. Inai, S., Y. Akagaki, T. Moriyama, Y. Fukumori, K. Yoshimura, S. Ohnoki, and IVS2ϩ1G3T. Another single molecular defect identified in case H. Yamaguchi. 1989. Inherited deficiencies of the late-acting complement components other than C9 found among healthy blood donors. Int. Arch. Allergy 2 was a heterozygous C to T transition at the first nucleotide of the Appl. Immunol. 90:274. 394 codon for Arg in exon 9. The mutation resulted in the genera- 22. Wang, X., D. T. Fleischer, W. T. Whitehead, D. L. Haviland, S. I. Rosenfeld, tion of a termination codon. Nonsense mutations in human disease J. P. Leddy, R. Snyderman, and R. A. Wetsel. 1995. Inherited human complement C5 deficiency: nonsense mutations in exons 1 (Gln1 to stop) and 36 (Arg1458 to genes frequently cause severe reduction in mRNA levels and even stop) and compound heterozygosity in three African-American families. J. Im- when normally transcribed, truncated proteins are quickly de- munol. 154:5464. graded (49–52). Even if translated, the mutant C8␣ gene encodes 23. Wu¨rzner, R., M. J. Hobart, B. A. Fernie, D. Mewar, P. C. Potter, A. Orren, and P. J. Lachmann. 1995. Molecular basis of subtotal complement C6 deficiency: a a polypeptide lacking the carboxyl-terminal 29% of the molecular carboxy-terminally truncated but functionally active C6. J. Clin. Invest. 95:1877. size. As shown in Figure 4, this putative mutant C8␣ polypeptide 24. Nishizaka, H., T. Horiuchi, Z.-B. Zhu, Y. Fukumori, K. Nagasawa, K. Hayashi, in case 2 would be missing the perforin region, the epidermal R. Krumdieck, C. G. Cobbs, M. Higuchi, S. Yasunaga, Y. Niho, and J. E. Volanakis. 1996. Molecular bases for inherited human complement com- growth factor-like region, and the thrombospondin region. In our ponent C6 deficiency in two unrelated individuals. J. Immunol. 156:2309. two cases, no mutations were detected in the C8␥ gene by our 25. Nishizaka, H., T. Horiuchi, Z.-B. Zhu, Y. Fukumori, and J. E. Volanakis. 1996. method. This would be consistent with the report that the ␥ subunit Genetic bases of human complement C7 deficiency. J. Immunol. 157:4239. 26. Kaufmann, T., G. Ha¨nsch, C. Rittner, P. Spa¨th, F. Tedesco, and P. M. Schneider. has no direct role in the hemolytic activity of C8 (12). In conclu- 1993. Genetic basis of human complement C8␤ deficiency. J. Immunol. 150: sion, our result provides evidence that like most other complement 4943. deficiencies, C8␣-␥D is caused by heterogeneous mutational 27. Saucedo, L., L. Ackermann, A. E. Platonov, A. Gewurz, R. M. Rakita, and P. Densen. 1995. Delineation of additional genetic bases for C8␤ deficiency: events. prevalence of null alleles and predominance of C3T transition in their genesis. J. Immunol. 155:5022. 28. Witzel-Schlo¨mp, K., P. J. Spa¨th, M. J. Hobart, B. A. Fernie, C. Rittner, References T. Kaufmann, and P. M. Schneider. 1997. The human complement C9 gene: 1. Mu¨ller-Eberhard, H. J. 1986. The membrane attack complex of complement. identification of two mutations causing deficiency and revision of the gene struc- Annu. Rev. Immunol. 4:503. ture. J. Immunol. 158:5403. 2. Steckel, E. W., R. G. York,, J. B. Monahan, and J. M. Sodetz. 1980. The eighth 29. Horiuchi, T., H. Nishizaka, T. Kojima, T. Sawabe, Y. Niho, P. M. Schneider, component of human complement: purification and physicochemical character- S. Inaba, K. Sakai, K. Hayashi, C. Hashimura, and Y. Fukumori. 1998. A non- ization of its unusual subunit structure. J. Biol. Chem. 255:11997. sense mutation at Arg95 is predominant in complement 9 deficiency in Japanese. 3. Alper, C. A., D. Marcus, D. Raum, B. H. Petersen, and T. J. Spira. 1983. Genetic J. Immunol. 160:1509. polymorphism in C8 ␤-chains: evidence for two unlinked genetic loci for the 30. Hayashi, K. 1991. PCR-SSCP: a simple and sensitive method for detection of eighth component of human complement (C8). J. Clin. Invest. 72:1526. mutations in the genomic DNA. PCR Methods Appl. 1:34. 3766 GENETIC BASIS OF HUMAN COMPLEMENT C8␣-␥ DEFICIENCY

31. Michelotti, G. A., J. V. Snider, and J. M. Sodetz. 1995. Genomic organization of 44. Marvit, J., A. G. DiLella, K. Brayton, F. D. Ledley, K. J. Robson, and S. L. Woo. human complement protein C8␣ and further examination of its linkage to C8␤. 1987. GT to AT transition at a splice donor site causes skipping of the preceding Hum. Genet. 95:513. exon in phenylketonuria. Nucleic Acids Res. 15:5613. 32. Kenneth, M. K., and J. M. Sodetz. 1994. Genomic structure of human comple- 45. Kudo, S., and M. Fukuda. 1989. Structural organization of glycophorin A and B ␥ ment protein C8 : homology to the lipocalin gene family. Biochemistry 33:5162. genes: glycophorin B gene evolved by homologous recombination at Alu repeat 33. Horiuchi, T., K. J. Macon, V. J. Kidd, and J. E. Volanakis. 1989. cDNA cloning sequences. Proc. Natl. Acad. Sci. USA 86:4619. and expression of human complement component C2. J. Immunol. 142:2105. 34. Horowitz, D. S., and A. R. Krainer. 1994. Mechanisms for selecting 5Ј splice sites 46. Urlaub, G., P. J. Mitchell, C. J. Ciudad, and C. J. Chasin. 1989. Nonsense mu- in mammalian pre-mRNA splicing. Trends Genet. 10:100. tations in the dihydrofolate reductase gene affect RNA processing. Mol. Cell. 35. Robertson, B. L., G. J. Cote, and S. M. Berget. 1990. Exon definition may fa- Biol. 9:2868. cilitate splice site selection in RNAs with multiple exons. Mol. Cell. Biol. 10:84. 47. Weil, D., M. Bernard, N. Combates, M. K. Wirtz, D. W. Hollister, B. Steinmann, 36. Penotti, F. E. 1991. Human pre-mRNA splicing signals. J. Theor. Biol. 150:385. and F. Ramirez. 1988. Identification of a mutation that causes exon skipping 37. Iida, Y. 1990. Quantification analysis of 5Ј-splice signal sequences in mRNA during collagen pre-mRNA splicing in an Ehlers-Danlos syndrome variant. precursors: mutations in 5Ј-splice signal sequence of human ␤-globin gene and J. Biol. Chem. 263:8561. ␤ -thalassemia. J. Theor. Biol. 145:523. 48. Raben, N., J. Sherman, F. Miller, H. Mena, and P. Plotz. 1993. A 5Ј splice 38. Padgett, R. A., S. M. Grabowski, M. M. Konarski, S. Seiler, and P. A. Sharp. junction mutation leading to exon deletion in an Ashkenazic Jewish family with 1986. Splicing of messenger RNA precursors. Annu. Rev. Biochem. 55:1119. phosphofructokinase deficiency (Tarui disease). J. Biol. Chem. 268:4963. 39. Kazazian, H. H., Jr. 1990. The thalassemia syndromes: molecular basis and pre- natal diagnosis in 1990. Semin. Hematol. 27:209. 49. Losson, R., and F. Lacroute. 1979. Interference of nonsense mutations with eu- 40. Jones, C. T., I. McIntosh, M. Keston, A. Ferguson, and D. J. Brock. 1992. Three karyotic messenger RNA stability. Proc. Natl. Acad. Sci. USA 76:5134. novel mutations in the cystic fibrosis gene detected by chemical cleavage: anal- 50. Urlaub, G., P. J. Mitchell, C. J. Ciudad, and L. A. Chasin. 1989. Nonsense mu- ysis of variant splicing and a nonsense mutation. Hum. Mol. Genet. 1:11. tation in the dihydrofolate reductase gene affect RNA processing. Mol. Cell. Biol. 41. Nakajima, H., N. Kono, T. Yamasaki, K. Hotta, M. Kawachi, M. Kuwajima, 9:2868. T. Noguchi, T. Tanaka, and S. Tarui. 1990. Genetic defect in muscle phospho- 51. Naeger, L. K., R. V. Schoborg, Q. Zhao, G. E. Tullis, and D. J. Pintel. 1992. fructokinase deficiency: abnormal splicing of the muscle phosphofructokinase Nonsense mutations inhibit splicing of MVM RNA in cis when they interrupt the Downloaded from Ј gene due to a point mutation at the 5 -splice site. J. Biol. Chem. 265:9392. reading frame of either exon of the final spliced product. Genes Dev. 6:1107. 42. Talerico, M., and S. M. Berget. 1990. Effect of 5Ј splice site mutations on splicing of the preceding intron. Mol. Cell. Biol. 10:6299. 52. Helenius, A., T. Marquardt, and I. Braakman. 1992. The endoplasmic reticulum 43. Carstens, R. P., W. A. Fenton, and L. R. Rosenberg. 1991. Identification of RNA as a protein-folding compartment. Trends Cell Biol. 2:227. splicing errors resulting in human ornithine transcarbamylase deficiency. 53. Doolittle, R. F. 1995. The multiplicity of domains in proteins. Annu. Rev. Bio- Am. J. Hum. Genet. 48:1105. chem. 64:287. http://www.jimmunol.org/ by guest on September 24, 2021