Copeia 103, No. 2, 2015, 272–280

Lack of Hybridization between Naturally Sympatric Populations of Red and Blacktail Shiner (Cyprinella lutrensis and C. venusta) in Texas, but Evidence of Introgression among Three Lineages of the C. lutrensis Species Group

Christopher L. Higgins1, Allison Love-Snyder1, Wesley Wiegreffe1, and Russell S. Pfau1

Hybridization is more common in actinopterygian fishes than any other group of vertebrates. This is especially true for members of the family Cyprinidae; for example, Hubbs found 68 different combinations of inter-generic and intra- generic hybridization among cyprinids collected east of the continental divide. Hybridization between two cyprinid species, the red shiner and the blacktail shiner (Cyprinella lutrensis and C. venusta), has been described in detail in Georgia where C. lutrensis is an introduced species. However, hybridization has not been thoroughly assessed where the two species are naturally sympatric. Our specific objectives were to determine the extent of ongoing hybridization between the two species using nuclear markers and morphometrics and to determine the extent of historical introgression using mitochondrial DNA (mtDNA). We collected 100 individuals from four different locations along the Bosque River and an additional 100 individuals from four locations along the Paluxy River. We used amplified fragment length polymorphism (AFLP) to verify species identification and determine hybrid status of each individual. A total of 56 AFLP fragments were scored, with 82.14% (47 fragments) being polymorphic (95% criterion). Based on these nuclear markers, we only identified two hybrids out of the 200 specimens analyzed; one from the Bosque River, Texas and one from the Paluxy River, Texas. There were no instances of introgression of mitochondrial DNA (mtDNA) from one species into the nuclear background of the other species. We did, however, discover the sympatric occurrence of three mtDNA lineages of C. lutrensis within a single nuclear gene pool; there was only one mtDNA lineage of C. venusta. Overall body shape was assessed using a truss network and was found to be statistically different with red shiner having the shorter and deeper body. The minimal amount of hybridization inferred from AFLP data, in combination with the absence of mtDNA introgression and limited morphological overlap, indicates that pre- or postzygotic isolating mechanisms effectively minimize genetic exchange between naturally sympatric populations of C. lutrensis and C. venusta within these two river systems.

RESHWATER ecosystems are some of the most diverse hybrid speciation, introgression, and reinforcement of in the world. They contain over 10,000 fish species, reproductive isolating mechanisms (Osterberg and Rodri- F almost 40% of global fish diversity and 25% of total guez, 2006). The specific outcome may depend on many vertebrate diversity, despite covering less than 1% of factors including whether the parental species are naturally the Earth’s surface (Dudgeon et al., 2006). However, the allopatric, parapatric, or sympatric (Woodruff, 1973). When distributions of many actinopterygians (i.e., ray-finned populations are naturally sympatric, reproductive incom- fishes) in North America are shrinking and their abundances patibility is often strengthened through reinforcement of dwindling. In fact, recent estimates suggest that 39% of all pre- and postzygotic barriers (Noor, 1999). When species are freshwater and diadromous species are imperiled (i.e., naturally allopatric, but come into secondary contact vulnerable, threatened, or endangered) and in need of through the introduction of non-native species, these conservation (Jelks et al., 2008). The declines in distribution reproductive barriers may not be sufficient to prevent and abundance of most North American species are a result hybridization (Rhymer and Simberloff, 1996). For example, of habitat degradation, pollution, flow regulation and water Weigel et al. (2003) reported finding hybridization between extraction, fisheries overexploitation, and the introduction introduced rainbow trout (Oncorhynchus mykiss) and native of non-native species (Strayer and Dudgeon, 2010). Al- cutthroat trout (Oncorhynchus clarkii)in64% of their 80 though each of these anthropogenic activities contribute to sampling localities distributed throughout the Clearwater the decline in fish diversity, the introduction of non-native River Basin, Idaho. In Montana, hybridization between species is considered one of the greatest threats to native introduced O. mykiss and native O. clarkii resulted in a biodiversity (Vitousek et al., 1997; Rahel, 2000). Introduced 50% decrease in reproductive success of native cutthroat species threaten native biodiversity by altering the habitat, trout in only a four-year time span (Muhlfeld et al., 2009). increasing predation pressure, increasing interspecific com- The loss of biodiversity in Cyprinidae, the most speciose petition, and/or hybridizing with native species (Fridley family in North America (Nelson et al., 2004), is of particular et al., 2007). concern because 46% of cyprinids are considered imperiled; Hybridization is more common in actinopterygians than 49 are listed as vulnerable, 20 are listed as threatened, 47 are any other group of vertebrates, largely because of competi- listed as endangered, and 11 are considered extinct (Jelks tion for limited spawning habitat, external fertilization, et al., 2008). Hybridization among cyprinids is widespread and weak behavioral isolating mechanisms, and unequal abun- can be intra-generic (i.e., between different species within a dances of parental species (Hubbs, 1955; Scribner et al., genus) or inter-generic (i.e., between different genera). For 2001). These underlying factors can result in four main example, Hubbs (1955) found 68 different combinations of outcomes, including the formation of hybrid swarms, intra-generic and inter-generic hybridization among cyprinids

1 Department of Biological Sciences, Box T-0100, Tarleton State University, Stephenville, Texas 76402; E-mail: (CLH) [email protected]. Send reprint requests to CLH. Submitted: 17 March 2014. Accepted: 1 December 2014. Associate Editor: T. J. Near. F 2015 by the American Society of Ichthyologists and Herpetologists DOI: 10.1643/CG-14-046 Published online: April 30, 2015 Higgins et al.—Hybridization and introgression in cyprinids 273 collected east of the continental divide. Hybridization within the genus Cyprinella, the second most diverse genera within Cyprinidae comprised of 30 species (Nelson et al., 2004), is particularly common. Interspecific hybridization within the genus Cyprinella is believed to be a threat to diversity in the southeastern United States (Walters et al., 2008). The primary hybridizing species is the introduced red shiner (C. lutrensis). Cyprinella lutrensis is an extremely tolerant species that can aggressively colonize degraded habitats and thrives under harsh environmental conditions (Matthews and Hill, 1977; Marsh-Matthews et al., 2011). The native distribution of C. lutrensis extends throughout much of the Great Plains, including populations in the Mississippi River basin and Gulf Coast drainages to the west (Page and Burr, 2011). However, they have been introduced into at least five drainages in the southeastern United States, successfully establishing popula- tions throughout the region (Fuller et al., 1999) and hybrid- izing with native congeners including the blacktail shiner (C. Fig. 1. Map depicting locations of the eight collecting sites on the venusta Cyprinella venusta ; Walters et al., 2008). has a native Bosque and Paluxy rivers. distribution that extends throughout the southeastern United States, including drainages east and west of the Mississippi Bosque River were located at road crossings, were approxi- River Basin (Page and Burr, 2011). mately equidistant from one another, and represented a Much of what we know about hybridization in Cyprinella gradient of coexistence between C. lutrensis and C. venusta is based on introduced populations of C. lutrensis in Georgia with proportionately more C. lutrensis in downstream (Walters et al., 2008; Blum et al., 2010; Ward et al., 2012), reaches (Linam and Kleinsasser, 1989; Jones, 2000; Stone, but hybrids have been reported elsewhere. Broughton et al. 2012). (2011) identified C. lutrensis 3 C. venusta hybrids in two out of 20 rivers in Texas and Oklahoma: the North Fork of the Guadalupe River in Kerr Co., TX and Sycamore Creek in Sampling method.—All specimens were collected on 15 # Edwards Co., TX. Additionally, Jurgens (1951) and Hubbs August 2011 under permit SPR-0403-284. At each of the 3 et al. (1953) reported hybrid swarms in the San Marcos and eight sampling localities, we used a seine (3 mm 5mm Guadalupe rivers, respectively. The latter two studies mesh) to harvest the first 50 Cyprinella without regard to documented hybrids based on phenotype only. The docu- species identification. Because we wanted to determine mented hybrids in Georgia and Texas suggest that C. whether hybrids were indeed intermediate in phenotype, lutrensis is capable of hybridizing across the extent of the we did not attempt to distinguish among C. lutrensis, C. geographic distribution of C. venusta. However, the Texas venusta, or their putative hybrids a priori. Specimens were studies did not use multilocus genetic techniques necessary immediately stored in 95% ethanol. Upon returning to the to address the degree of hybridization, which may vary lab, individuals were arranged from smallest to largest in depending on whether the parental populations are natu- regard to standard length and numbered 1 through 50. A rally allopatric, parapatric, or sympatric (Woodruff, 1973). random number generator was used to subsample 25 The overall goal of our study was to examine patterns of individuals per site for genetic and morphological analyses. hybridization and introgression in C. lutrensis and C. venusta Each individual selected was given a unique number code from two adjacent tributaries of the Brazos River in Texas, for identification purposes (e.g., B2-01 is the first specimen where the two species are naturally sympatric. Observed from the second sampling site along the Bosque River). levels of hybridization were compared with those from Georgia where C. venusta is native and C. lutrensis is Amplified fragment length polymorphisms (AFLP).—We extract- introduced. Our specific objectives were to determine the ed DNA from pectoral fin tissue using phenol:chloroform: extent of ongoing hybridization between C. lutrensis and C. isoamyl alcohol (25:24:1) and ethanol precipitation. Ampli- venusta using nuclear markers and morphometrics and to fied fragment length polymorphism (AFLP) was used to determine the extent of historical introgression using verify species identification and determine hybrid status of mtDNA as an indicator. each individual. The AFLP protocol was a modified version (Phillips et al., 2007) of the original protocol of Vos et al. (1995). DNA was digested with the restriction enzymes EcoRI MATERIALS AND METHODS and MseI followed by ligations using EcoRI and MseI Study sites.—We surveyed four sites along the Paluxy River adapters. A subset of ligated fragments were then amplified (P1–P4) and four sites along the Bosque River (B1–B4; Fig. 1). by polymerase chain reaction (PCR) using the following pre- The Paluxy River is located in north central Texas and flows selective primer pairs: EcoRI-C (59–ACTGCGTACCAATTCC– 47 km through Erath, Hood, and Somervell counties before 39) and MseI-A (59–GATGAGTCCTGAGTAAA–39). A subset of merging with the Brazos River just east of Glen Rose, Texas. the resulting preselective PCR products was amplified in a The Bosque River is a 185 km river that also originates in second PCR reaction using the following three selective Erath Co. and flows through Hamilton, Bosque, and primer pairs: EcoRI-CAC (59–ACTGCGTACCAATTCCAC–39) McLennen counties before emptying into Lake Waco. paired with MseI-ACC (59–GATGAGTCCTGAGATAACC–39), Because the Paluxy River covers a fraction of the distance MseI-ATT (59–GATGAGTCCTGAGTAAATT–39)andMseI- the Bosque River does, we only sampled sites on the North AGC (59–GATGAGTCCTGAGTAAAGC–39). The EcoRI primer Bosque River. Sampling sites along the Paluxy River and the was fluorescently labeled to allow detection by a Beckman- 274 Copeia 103, No. 2, 2015

Coulter CEQ8000 Genetic Analysis System (Beckman-Coul- Principal Coordinate Analysis (PCoA) was used to visualize ter Inc., Fullerton, CA). The size of fragments was based on patterns of divergence among all 200 specimens using the an internal size standard, and fragments were automatically software GenAlEx 6.4 (Peakall and Smouse, 2006). PCoA placed into bins (one base pair in size) using Beckman- uses a pairwise, similarity matrix, based on Hamming Coulter software. Results of automated scoring was verified distances (Choi et al., 2010), to arrange individuals in visually and corrected when necessary. Only fragments that principal coordinate space so that specimens with similar were unambiguously present or absent across all specimens genetic profiles will be grouped together. Assuming parental were retained. species are distinct and hybrids intermediate in genotype, We conducted admixture analyses of AFLP data using two one would expect to find hybrid individuals between the different Bayesian clustering approaches known to provide clusters of individuals representing parental species. complementary results (Burgarella et al., 2009), NEWHY- BRIDS 1.1 (Anderson and Thompson, 2002) and STRUC- Mitochondrial DNA (mtDNA).—Partial cytochrome b (cyt b) TURE 2.3.4 (Pritchard et al., 2000), along with Principal DNA sequences were obtained using polymerase chain Coordinate Analysis. NEWHYBRIDS uses Markov chain reaction (PCR). Amplifications were carried out in 25 ml Monte Carlo sampling to determine deviation from Hardy- reactions containing 1X Buffer, 1.5 mM MgCl2, 0.8 mM Weinberg equilibrium among multilocus genotypes. Com- deoxynucleotide triphosphates, 2.5 mM of both primers, putations were performed without prior information on 1.25 units Taq DNA polymerase, and 0.5 ml of DNA. Primer population or allele frequencies and with a burn-in of pairs used were LA (59–TGACTTGAAAAACCACCGTTG–39) 100,000 steps and 50,000 iterations with Jeffreys-like priors and HA (59–CAACGATCTCCGGTTTACAAGAC–39; Schmidt for the mixing proportions and allele frequencies. We used et al., 1998). Amplification conditions included an initial the posterior probabilities obtained from NEWHYBRIDS to step of 95uC for 5 minutes, followed by 20 cycles of 95uC for quantify the likelihood that each specimen was categorized 30 s, 56uC(20.5uC per cycle) for 60 s, 72uC for 90 s, and 20 as pure C. lutrensis, pure C. venusta, F1 hybrid, F2 hybrid, C. cycles of 95uC for 30 s, 46uC for 60 s, 72uC for 90 s, then held lutrensis backcross, or C. venusta backcross. Different criteria at 72uC for 10 minutes. PCR products were prepared for sequencing using ExoSAP-IT and sequenced using a Beck- and thresholds can be used to actually classify parental and man-Coulter CEQ8000 Genetic Analysis System. hybrid individuals based on these probabilities (Burgarella et Cyt b sequences were aligned using ClustalX as imple- al., 2009). One criterion requires that the posterior proba- mented in BioEdit along with comparison sequences bility for each separate category must be greater than or selected from Scho¨nhuth and Mayden (2010) and obtained equal to some a priori threshold. Under this conservative from GenBank. They include two from the C. venusta species criterion, it is possible that some of the individuals are not group (GQ275207, CV374; GQ275205, CVFC1) and nine classified at all if the probabilities are fairly low for all from the C. lutrensis species group (GQ275187, CL112434; categories. A second criterion involves setting a threshold GQ275186, CL767; GQ275201, CL0637; GQ275190, 2433; for the purebred categories only (i.e., in order for an GQ275189, CLBC2; DQ324102, CG7891; EU082522, 1499; individual to be classified as a pure species the posterior GQ275176, DSP0633; GQ275177, CL8811). Cyprinella pro- probability must be greater than some set value) and serpina and C. labrosa were used as outgroups (DQ324101, categorizing all other individuals as hybrids. Although this CPR8814; GQ275181, CL38541). Numbers indicate Gen- criterion is liberal at identifying hybrid individuals, it does Bank accessions followed by cyt b designations of Scho¨n- classify each individual as either a parental species or a huth and Mayden (2010). The best-fit model of nucleotide hybrid; this could be important if maintaining sample size is substitution (TN93+I) was identified using MEGA 5.2 an important component of the experimental design. A (Tamura et al., 2011) and used to create a Maximum third criterion involves summing the probabilities from the Likelihood tree in MEGA 5.2. A neighbor-joining tree was four hybrid categories and comparing that total to some also constructed using the TN93 model. threshold. This particular criterion has been shown to perform well with simulated data in regard to power and Morphometrics.—We used a digital camera to photograph accuracy (Burgarella et al., 2009). For our study, we used this the lateral view of all 200 specimens, paying close attention last criterion and classified an individual as being a hybrid if to consistent positioning to obtain unbiased measurements the sum of the posterior probabilities across the four hybrid (Strauss and Bond, 1990). We then digitized 11 anatomic categories was $ 0.5, making the probability that it is a pure landmarks (Fig. 2A) on each image using TPSDIG (http:// species less than 50%. life.bio.sunysb.edu/morph). We used the landmarks to form STRUCTURE uses model-based algorithms for clustering a truss network, which is a systematically arranged set of genetic data assuming Hardy-Weinberg and linkage equilib- distances among a preselected set of anatomical landmarks rium (Pritchard et al., 2000). We used STRUCTURE to (Strauss and Bookstein, 1982), comprised of 20 inter- estimate admixture proportions and assign 90% credibility landmark distances (Fig. 2B); the resulting distances served intervals (Bayesian analogs of confidence intervals) to as a multivariate data set characterizing overall body identify parental and hybrid individuals Simulations were morphology. We used a truss network because trusses carried out with K 5 2 (two distinct genetic entities) under generally ensure complete coverage of the body and allow the admixture model assuming independent allele frequen- measurement error to be partitioned statistically from the cies. A burn-in of 50,000 steps followed by 50,000 iterations variables (Strauss and Bond, 1990). was used. We considered individuals to be hybrids if the Using the species/hybrid identities determined by NEW- 90% credibility interval was completely contained within HYBRIDS as a fixed factor, we conducted a multivariate the range of 0.10 and 0.90, which includes admixture analysis of variance to determine whether species/hybrids proportions expected for F1 and F2 hybrids (0.50) as well as were morphologically different from one another. We backcrosses (0.25, 0.75). performed discriminate function analysis (DFA) on log- Higgins et al.—Hybridization and introgression in cyprinids 275

Fig. 2. Location of anatomical landmarks (closed circles) and corresponding distances (dashed lines) used to quantify overall body morphology (A). Map of morphometric distances used to create truss network obtained from digitized anatomical landmarks (B). Fig. 3. Admixture proportions (qi) from STRUCTURE indicating mem- bership of individual specimens of C. lutrensis and C. venusta from the transformed measurements to ascertain which morpholog- (A) Bosque and (B) Paluxy rivers. Individuals with low q-values are C. ical characters were the most distinguishing features among venusta. Bars indicate 90% credible regions. Individuals with C. species/hybrids and to estimate classification functions to lutrensis cyt b haplotypes are indicated with filled circles whereas those with C. venusta haplotypes are indicated with open circles. predict group membership based on phenotypic variation rather than genotypic differences. DFA provided discrimi- nate scores, which allowed us to visually examine the equal to 0.88; the 90% credibility interval was completely maximum separation between species and produced load- within the 0.10–0.90 admixture range (Fig. 3B). PCoA ings (i.e., vector correlations between morphological vari- revealed two distinct clusters of C. venusta and C. lutrensis ables and discriminate functions) to indicate how well each with the two hybrids being the most centrally located of all variable separated the species. Because all loadings on the 200 individuals (Fig. 4). The positions of hybrids along the first discriminate axis were positive and of similar magni- primary axis, which accounted for 80.3% of the genetic tude, we performed a ‘‘size-free’’ DFA to determine the variation among individuals, were more indicative of degree to which species could be optimally distinguished backcrosses than F1 hybrids. There was no evidence of independent of size variation. This size-free DFA was mitochondrial introgression as all individuals possessed the conducted by finding the pooled within-group principal mtDNA sequence that was expected based on the proportion components, regressing the first principal component from of nuclear DNA that they exhibited. each character independently, and using the regression Both phylogenetic trees placed our specimens and residuals in a canonical discriminate analysis (Strauss, 1995). reference sequences within the same clades, so only the maximum likelihood tree is shown (Fig. 5). Our specimens were closely allied with the reference specimens of Scho¨n- RESULTS huth and Mayden (2010), and species identifications based A total of 56 AFLP fragments were included in the dataset, on mtDNA matched those based on AFLP in all cases. with 83.9% (47 fragments) being polymorphic (95% crite- Additionally, we documented three mtDNA lineages of C. rion) among the 200 individuals. Seven fragments were lutrensis in the Paluxy River and two in the Bosque River fixed in C. lutrensis and absent in C. venusta, and two were (clades A, B, and C in Fig. 5). The most abundant lineage fixed in C. venusta and absent in C. lutrensis. Proportions of (clade A; found in both rivers) is allied with a specimen from polymorphic fragments in pure C. lutrensis and pure C. the Rio Grande River of New Mexico in the phylogeny of venusta were 69.64% and 44.6%, respectively. Overall, C. Scho¨nhuth and Mayden (2010:fig. 6). The second lineage lutrensis was more widely distributed and abundant within (clade B; also found in both rivers, but represented by only the Bosque River than the Paluxy River (Fig. 3). Cyprinella seven specimens) is allied with the specimens from the venusta was found at all four localities in both rivers, but in Mississippi and Rio Grande drainages in the phylogeny of decreasing numbers in the downstream localities, whereas Scho¨nhuth and Mayden (2010:fig. 6). The third lineage C. lutrensis was not observed in upstream localities. (clade C) is represented in our study by only one specimen Of the 200 specimens examined, only two individuals from the Paluxy River and is most closely related to a were identified as being possible hybrids based on results specimen of C. lutrensis from the Pecos River of Texas from both NEWHYBRIDS and STRUCTURE (Fig. 4); one (CL0637) and C. garmani from Durango, Mexico (CG7891, from the Bosque River and one from the Paluxy River. B3–15 1449) in the phylogeny of Scho¨nhuth and Mayden had a 0.99 probability of being a hybrid with the probability (2010:fig. 6). of being classified as an F2 equal to 0.69; the 90% credibility Cyprinella venusta ranged in size from 2.09 cm to 8.23 cm interval was completely within the 0.10–0.90 admixture (mean6std; 4.2561.36), whereas C. lutrensis ranged in size range (Fig. 3A). P4–14 had a 0.99 probability of being a from 1.77 cm to 4.47 cm (mean6std; 3.0560.61). The two hybrid with the probability of being a C. lutrensis backcross species differed in overall body morphology (Wilks’ lambda 276 Copeia 103, No. 2, 2015

AFLP data, in combination with the lack of mtDNA introgression, indicates that pre- or postzygotic isolating mechanisms effectively prevent genetic exchange between C. lutrensis and C. venusta within the Bosque and Paluxy rivers. The finding of minimal hybridization at our study sites is in contrast to those of Walters et al. (2008) and Ward et al. (2012) who reported extensive introgressive hybridization between C. lutrensis and C. venusta in the upper Coosa River, Georgia where C. lutrensis is thought to have been introduced in 1974, and Broughton et al. (2011) who reported hybridization in two drainages in Texas where the two species are likely to be naturally sympatric. Walters et al. (2008), using morphological, microsatellite, and mtDNA data, found that 34% of their total catch was represented by hybrids, with only 1.2% represented by C. lutrensis. Most individuals having hybrid genotypes were phenotypically indistinguishable from C. venusta. Ward et al. (2012), using the same morphological and genetic methodology, found hybrids at all but the uppermost reach of their transect, with some sites consisting of .20% hybrids. The majority of hybrids were later-generation, with C. venusta backcrosses being predominant. Broughton et al. (2011) sampled small numbers of individuals from multiple drainages across Oklahoma and Texas and used coloration Fig. 4. Principal coordinate plot based on AFLPs of C. lutrensis (open along with two mtDNA loci and one nuclear locus to symbols) and C. venusta (closed symbols) from the Bosque (squares) identify hybrids. They reported a mismatch between nuclear and Paluxy (circles) rivers showing distinct genetic differences between and mtDNA sequences in two out of 19 specimens from the species. Individuals identified as hybrids are identified with stars. two rivers in which hybridization was observed: one from Sycamore Creek, a tributary of the Rio Grande, on the county line between Val Verde and Kinney counties, TX 5 0.101, F3,192 5 12.75, P , 0.001), with the first discriminant axis accounting for 87.5% of morphological (erroneously indicated as being from Cooke Co., in their variation among individuals. The key morphological char- table 1 [Broughton, pers. comm.]) and one from the North acters that separated the two species were standard length Fork of the Guadalupe River in Kerr Co., TX, representing a (character 20; Fig. 2B) with C. venusta being the longer hybrid frequency of 11% and 10%, respectively. Most species and measures of body depth (characters 11 and 12; individuals from these two rivers were reported as having Fig. 2B) in which C. lutrensis has the deeper body. Morpho- intermediate or mixed phenotypes, and several individuals logically, individuals classified as hybrids based on results had nuclear or mtDNA sequences that did not match their from NEWHYBRIDS and STRUCTURE were not intermediate morphology (though not all specimens were represented by in reference to parental species. Based on the discriminant both mtDNA and nuclear sequences). No specimens from functions of morphological characters, individuals geneti- other rivers were documented as having mixed or interme- cally identified as C. lutrensis from the Paluxy River were diate morphologies or mismatched DNA sequences; howev- correctly classified 100% of the time whereas those from the er, rivers in their study were represented by only one to six Bosque River were correctly classified 92% of the time. specimens. Individuals genetically identified as C. venusta from the Earlier reports of hybrids in the San Marcos and Guada- Paluxy River were correctly identified based on morphology lupe rivers of Texas were documented by Jurgens (1951) and with 97.4% accuracy; C. venusta from the Bosque River were Hubbs et al. (1953) but were based only on phenotype. classified with 93.6% accuracy. Furthermore, the authors did not state which phenotypic characteristics were relied upon to identify hybrids, thus the validity of their findings cannot be assessed. Field guides, DISCUSSION such as Freshwater Fishes of Texas: A Field Guide (Thomas Cyprinella lutrensis and C. venusta represent two species et al., 2007) and Fishes of Oklahoma (Miller and Robinson, groups consisting of multiple lineages, only some of which 2004), typically indicate that breeding males of C. venusta have been formally recognized taxonomically (Scho¨nhuth have blue dorsal and lateral regions with yellow-white or and Mayden, 2010). Because of current taxonomic uncer- yellow fins, respectively. However, the Peterson’s field guide tainties, we use the names C. venusta and C. lutrensis in a (Page and Burr, 2011) describes C. venusta in Texas as having broad sense to include all lineages not currently described as red-orange fins. Within the Bosque and Paluxy rivers, we unique species by Scho¨nhuth and Mayden (2010). Within routinely observed specimens with the distinct caudal spot this context, the number of individuals classified as hybrids typical of C. venusta in combination with reddish-orange (2 out of 200 specimens) in our study was unexpectedly low fins. We examined 16 of these brightly colored specimens, and appeared to be later generation backcrosses. Further- and they were clearly C. venusta based on AFLP data and more, there were no instances of mtDNA introgression of mtDNA cyt b sequences (data not shown). These results one species into the nuclear background of the other indicate that the bright nuptial coloration typical of male C. species. The minimal amount of hybridization inferred from lutrensis (Dugas and Franssen, 2011) can also occur in C. Higgins et al.—Hybridization and introgression in cyprinids 277

Fig. 5. Maximum likelihood tree of cyt b haplotypes of C. lutrensis and C. venusta from the Bosque and Paluxy rivers along with reference specimens of other species within these species groups. Only individuals representative of unique haplotypes are shown. Bootstrap values for major clades are indicated. Reference specimens are indicated by the first three letters of the specific epithet (ven 5 C. venusta, gar 5 C. garmani, lut 5 C. lutrensis, lep 5 C. lepida, sua 5 C. suavis, pro 5 C. proserpina, lab 5 C. labrosa) followed by the cyt b designations (in brackets) given in Scho¨ nhuth and Mayden (2010). Cyprinella proserpina and C. labrosa are outgroups. 278 Copeia 103, No. 2, 2015 venusta. Given that Jurgens (1951) and Hubbs et al. (1953) not be of the same genetic lineages as those in Texas and, if may have relied on this combination of characteristics to so, they may have accumulated neutral genetic differences identify hybrids, their reports of hybrid swarms should be leading to reproductive isolation. Scho¨nhuth and Mayden viewed with caution. (2010) showed polyphyletic C. venusta and C. lutrensis Although hybridization unquestionably has been docu- mtDNA clades and reported a highly divergent lineage of mented at other locations (Walters et al., 2008; Broughton et C. venusta (basal to other C. venusta, C. spiloptera, and C. al., 2011; Ward et al., 2012), we clearly documented that whipplei) from the Apalachicola and Ochlocknee rivers of hybridization is not an inevitable consequence of the two Georgia and Florida (near the Coosa River). Kristmundsdo´t- species occurring sympatrically. Lower hybridization rates in tir and Gold (1996) previously identified this divergent the Bosque and Paluxy rivers compared to the Coosa River in clade, along with another that included specimens from the Georgia (Walters et al., 2008; Ward et al., 2012) and Coosa River, and suggested that C. venusta could be Sycamore Creek and the Guadalupe River in Texas separated into four different species. Within the Bosque (Broughton et al., 2011) can be explained by several factors, and Paluxy rivers, we identified three mtDNA lineages of C. including differing environmental conditions, population lutrensis and one of C. venusta; however, Walters et al. (2008) structure, and prezygotic isolating mechanisms. Postzygotic did not provide DNA sequences that could be used to barriers seem to be a less likely explanation given the determine the genetic lineage of their specimens relative to evidence of intrinsic hybrid viability reported by Blum et al., ours. Given the likelihood that genetic lineages of one or 2010, unless hybrids have a selective disadvantage in certain both species in Texas are different from those in the Coosa environments. Increased hybridization may occur under River, Georgia, and that these lineages have been evolving certain environmental conditions not currently present in separately for a considerable length of time, geographic the Bosque and Paluxy rivers. River systems can have differences in reproductive compatibility caused by neutral substantial environmental differences, such as stream processes cannot be ruled out as an explanation for discharge and turbidity, which affect reproductive behavior, differences in hybridization rates. altering the ability to discriminate between species. Envi- Another unexpected finding of our study was the ronmental changes are thought to be responsible for sympatric occurrence of divergent mtDNA lineages of C. increased hybridization beyond what historically occurred lutrensis in both the Bosque and Paluxy rivers. These three in naturally sympatric populations of trout (Young et al., lineages occurred within a single, homogenous nuclear 2001; Heath et al., 2010). Alternatively, differences in background, demonstrating that they do not represent three population structure where one species differs greatly in sympatric species. The existence of multiple, divergent abundance may increase hybridization rates (Avise and mtDNA lineages of C. lutrensis and paraphyly of the C. Saunders, 1984; Dowling et al., 1989). Such differences lutrensis species group has been recognized by Broughton certainly occur between our study sites where both species and Gold (2000), Scho¨nhuth and Mayden (2010), and are abundant and spatially segregated and the Coosa River, Broughton et al. (2011); however, these lineages have never Georgia, where the native species, C. venusta, greatly been reported as being sympatric. Broughton et al. (2011) outnumbers the introduced species, C. lutrensis (Walters et examined specimens from throughout Texas and Oklahoma al., 2008; Ward et al., 2012). Additionally, regional differ- and identified four mtDNA clades of C. lutrensis, which ences in hybridization rate could result from differences in appeared to be geographically restricted to the Red River prezygotic isolation between sympatric and allopatric drainaige of Oklahoma and Texas, the Arkansas River populations evolved through selective mechanisms (Albert drainage of Oklahoma, Croton Creek of the Brazos and Schluter, 2004; Crispo et al., 2011), including reinforce- River drainage (represented by one specimen), and rivers ment (Dobzhansky, 1940), adaptation to different niches of southern Texas and Mexico. The latter clade most likely (Kilias et al., 1980), direct selection on mating preferences represents C. suavis of Scho¨nhuth and Mayden (2010), (Servedio, 2001), or through neutral processes (Edmands, which did not occur among our samples suggesting that C. 2002). Differences in premating isolation between allopatric suavis may not occur as far north as hypothesized by and sympatric populations have been observed in other Scho¨nhuth and Mayden (2010:fig. 7). Although the four fishes including sticklebacks (Rundle and Schluter, 1998) clades documented by Broughton et al. (2011) appeared to and trout (Rubidge and Taylor, 2004) and have been occur allopatrically, this may simply be an artifact of limited attributed to reinforcement or spatiotemporal reproductive sampling. The sympatric occurrence of multiple, divergent segregation. Although assortative mating between C. venusta mtDNA lineages in the Bosque and Paluxy rivers may be the and C. lutrensis was documented by Blum et al. (2010), product of recent bait bucket introductions or historical native populations of C. venusta from the Coosa River, (natural) introgression among members of the C. lutrensis which have only encountered introduced populations of red species group. shiner since the 1970s (Fuller et al., 1999), may not possess Our finding of three, highly divergent mtDNA lineages of the same degree of prezygotic incompatibility as popula- C. lutrensis within a single nuclear gene pool emphasizes a tions that have been in sympatry with C. lutrensis for longer major weakness in using mtDNA to delimit and identify periods of time. species (sometimes referred to as DNA taxonomy and DNA Furthermore, differences in reproductive compatibility barcoding, respectively)—namely, the problem of mtDNA among populations may have evolved by neutral as opposed introgression. Although mtDNA studies play a valuable role to selective processes (Demuth and Wade, 2005). As lineages in identifying patterns of genetic diversity, multilocus diverge, changes in mating behaviors or genetic differences techniques such as AFLP (and microsatellites) are better able resulting in epistasis among derived alleles eventually lead to delimit gene pools and species (Creer et al., 2004; to reproductive incompatibility even in the absence of Dasmahapatra et al., 2010). Single-nucleotide polymor- reinforcement or other selective mechanisms. Cyprinella phisms (SNPs) will be increasingly valuable in this regard venusta and C. lutrensis in the Coosa River of Georgia may as the use of massively parallel sequencers (using techniques Higgins et al.—Hybridization and introgression in cyprinids 279 such as RAD-seq) has become cost effective (Peterson et al., Demuth, J. P., and M. J. Wade. 2005. On the theoretical 2012; Rocha et al., 2013). Because of widespread transport of and empirical framework for studying genetic interactions Cyprinella for the baitfish trade (e.g., bait distributors in Texas within and among species. The American Naturalist can obtain C. lutrensis from hatcheries in Missouri) and bait 165:524–536. bucket introductions, it is likely that the historical geographic Dobzhansky, T. 1940. Speciation as a stage in evolutionary range of mtDNA lineages within the C. lutrensis species group divergence. The American Naturalist 74:312–321. will remain largely unknown. Furthermore, if introgression Dowling, T. E., G. R. Smith, and W. M. Brown. 1989. among lineages of the C. lutrensis species group (as reported Reproductive isolation and introgression between Notropis herein) occurs widely, it may be difficult to fully resolve cornutus and Notropis chrysocephalus (family Cyprinidae): longstanding taxonomic issues within this group. comparison of morphology, allozymes, and mitochondri- al DNA. Evolution 43:620–634. ACKNOWLEDGMENTS Dudgeon, D., A. H. Arthington, M. O. Gessner, Z. Kawabata, D. J. Knowler, C. Levenque, R. J. Naiman, A. Prieur- We thank J. Munz for assistance in the field, and acknowl- Rishard, D. Soto, M. L. J. Stiassny, and C. A. Sullivan. edge the Office of Student Research & Creative Activities at 2006. Freshwater biodiversity: importance, threats, status Tarleton State University for monetary support. Specimens and conservation challenges. Biology Reviews 81:163–182. were harvested under CLH’s scientific collecting permit SPR- Dugas, M. B., and N. R. Franssen. 2011. Nuptial coloration 0403-284 with the Texas Parks and Wildlife Department. of red shiners (Cyprinella lutrensis) is more intense in turbid waters. Naturwissenschaften 98:247–251. LITERATURE CITED Edmands, S. 2002. Does parental divergence predict Albert, A. Y. K., and D. Schluter. 2004. Reproductive reproductive compatibility? Trends in Ecology & Evolu- character displacement of male stickleback mate prefer- tion 17:520–527. ence: reinforcement or direct selection? Evolution 58: Fridley, J. D., J. J. Stachowicz, S. Naeem, D. F. Sax, E. W. 1099–1107. Seabloom, M. D. Smith, T. J. Stohlgren, D. Tilman, and Anderson, E. C., and E. A. Thompson. 2002. A model-based B. Von Holle. 2007. The invasion paradox: reconciling method for identifying species hybrids using multilocus pattern and process in species invasions. Ecology 88:3–17. genetic data. Genetics 160:1217–1229. Fuller, P. L., L. G. Nico, and J. D. Wiliams. 1999. Avise, J. C., and N. C. Saunders. 1984. Hybridization and Nonindigenous fishes introduced into inland waters of introgression among species of sunfish (Lepomis): analysis the United States. American Fisheries Society Special by mitochondrial DNA and allozyme markers. Genetics Publication 27, Bethesda, Maryland. 108:237–255. Heath, D., C. M. Bettles, and D. Roff. 2010. Environmental Blum, M. J., D. M. Walters, N. M. Burkhead, B. J. Freeman, factors associated with reproductive barrier breakdown in and B. A. Porter. 2010. Reproductive isolation and sympatric trout populations on Vancouver Island. Evolu- the expansion of an invasive hybrid swarm. Biological tionary Applications 3:77–90. Invasions 12:2825–2836. Hubbs, C. L. 1955. Hybridization between fish species in Broughton, R. E., and J. R. Gold. 2000. Phylogenetic nature. Systematic Zoology 4:1–20. relationships in the North American cyprinid genus Hubbs, C. L., A. Kuehne, and J. C. Ball. 1953. The fishes of Cyprinella (Actinopterygii: Cyprinidae) based on mito- the upper Guadalupe River, Texas. Texas Journal of chondrial ND2 and ND4L gene sequences. Copeia Science 5:216–244. 2000:1–10. Jelks, H. L., S. J. Walsh, N. M. Burkhead, S. Contreras- Broughton, R. E., K. C. Vedala, T. M. Crowl, and L. L. Balderas, E. Diaz-Pardo, D. A. Hendrickson, J. Lyons, Ritterhouse. 2011. Current and historical hybridization N. E. Mandrak, F. McCormick, J. S. Nelson, S. P. with differential introgression among three species of Platania, B. A. Portes, C. B. Renaud, J. J. Schmitter- cyprinid fishes (genus Cyprinella). Genetica 139:699–707. Soto, E. B. Taylor, and M. L. Warren, Jr. 2008. Burgarella, C., Z. Lorenzo, R. Jabbour-Zahab, R. Lumaret, Conservation status of imperiled North American fresh- E. Guichoux, R. J. Petit, A. Soto, and L. Gil. 2009. water and diadromous fishes. Fisheries 33:372–407. Detection of hybrids in nature: application to oaks Jones, T. 2000. Fisheries survey of the Bosque River (Quercus suber and Q. ilex). Heredity 102:442–452. watershed above Lake Waco. Texas Institute for Applied Choi, S. S., S. H. Cha, and C. Tappert. 2010. A survey Environmental Research, Stephenville, Texas. of binary similarity and distance measures. Journal of Jurgens, K. C. 1951. The distribution and ecology of the Systematics, Cybernetics, and Informatics 8:43–48. fishes in the San Marcos River. Unpubl. M.S. thesis, Creer, S., R. S. Thorpe, A. Malhotra, W. H. Chou, and A. G. Unviversity of Texas, Austin, Texas. Stenson. 2004. The utility of AFLPs for supporting Kilias, G., S. N. Alahiotis, and M. Pelecanos. 1980. A mitochondrial DNA phylogeographical analyses in the multifactorial genetic investigation of speciation theory Taiwanese bamboo viper, Trimeresurus stejnegeri. Journal of using Drosophila melanogaster. Evolution 34:730–737. Evolutionary Biology 17:100–107. Kristmundsdo´ttir, A. Y., and J. R. Gold. 1996. Systematics Crispo, E., J. S. Moore, J. A. Lee-Yaw, S. M. Gray, and B. C. of the blacktail shiner (Cyprinella venusta) inferred from Haller. 2011. Broken barriers: human-induced changes analysis of mitochondrial DNA. Copeia 1996:773–783. to gene flow and introgression in animals. Bioessays Linam, G. W., and L. J. Kleinsasser. 1989. Fisheries use 33:508–518. attainability study for the Bosque River. Resource Protec- Dasmahapatra, K. K., M. Elias, R. I. Hill, J. I. Hoffman, and tion Division, Texas Parks and Wildlife Department, J. Mallet. 2010. Mitochondrial DNA barcoding detects Austin, Texas. some species that are real, and some that are not. Marsh-Matthews, E., W. J. Matthews, and N. R. Franssen. Molecular Ecology Resources 10:264–273. 2011. Can a highly invasive species re-invade its native 280 Copeia 103, No. 2, 2015

community? The paradox of the red shiner. Biological Scho¨nhuth, S., and R. L. Mayden. 2010. Phylogenetic Invasions 13:2911–2924. relationships in the genus Cyprinella (Actinopterygii: Cypri- Matthews, W. J., and L. G. Hill. 1977. Tolerance of the red nidae) based on mitochondrial and nuclear gene sequences. shiner, Notropis lutrensis (Cyprinidae) to environmental Molecular Phylogenetics and Evolution 55:77–98. parameters. The Southwestern Naturalist 22:89–99. Scribner, K. T., K. S. Page, and M. L. Barton. 2001. Miller, R. J., and H. W. Robison. 2004. Fishes of Oklahoma. Hybridization in freshwater fishes: a review of case studies University of Oklahoma Press, Norman, Oklahoma. and cytonuclear methods of biological inference. Reviews Muhlfeld, C. C., S. T. Kalinowski, T. E. McMahon, M. L. in Fish Biology and Fisheries 10:293–323. Taper, S. Painter, R. F. Leary, and F. W. Allendorf. 2009. Servedio, M. R. 2001. Beyond reinforcement: the evolution Hybridization rapidly reduces fitness of a native trout in of premating isolation by direct selection on preferences the wild. Biology Letters 5:328–331. and postmating, prezygotic incompatibilities. Evolution Nelson, J. S., E. J. Crossman, H. Espinoza-Perez, L. T. 55:1909–1920. Findley, C. R. Gilbert, R. N. Lea, and J. D. Williams. Stone, K. 2012. Spatial and temporal variation in fish 2004. Common and Scientific Names of Fishes from the assemblage structure along the Paluxy River, Texas. United States, Canada, and Mexico. American Fisheries Unpubl. M.S. thesis, Tarleton State University, Stephen- Society special publication 29, Bethesda, Maryland. ville, Texas. Noor, M. A. F. 1999. Reinforcement and other consequences Strauss, R. E. 1995. Metamorphic growth-gradient changes of sympatry. Heredity 83:503–508. in South American loricariid catfishes Loricariichthys Osterberg, C. O., and R. J. Rodriguez. 2006. Hybridization maculatus and Pseudohemiodon laticeps. Studies on Neo- and cytonuclear associations among native westslope tropical Fauna and Environment 30:177–191. cutthroat trout, introduced rainbow trout, and theu Strauss, R. E., and C. E. Bond. 1990. Taxonomic methods: hybrids with the Stehekin River drainage, North Cascades morphology, p. 109–140. In: Methods for Fish Biology. P. National Park. Transactions of the American Fisheries Moyle and C. Schreck (eds.). American Fisheries Society, Society 135:924–942. Bethesda, Maryland. Page, L. M., and B. M. Burr. 2011. Peterson’s Field Guide to Strauss, R. E., and F. L. Bookstein. 1982. The truss: body Freshwater Fishes of North America North of Mexico. form reconstruction in morphometrics. Systematic Zool- Houghton Mifflin Harcourt, Boston. ogy 31:113–135. Peakall, R., and P. E. Smouse. 2006. GenAlEx 6: genetic Strayer, D. L., and D. Dudgeon. 2010. Freshwater biodiver- analysis in Excel. Population genetic software for teaching sity conservation: recent progress and future challenges. and research. Molecular Ecology Resources 6:288–295. Journal of the North Americal Benthological Society Peterson, B. K., J. N. Weber, E. H. Kay, H. S. Fisher, and 29:344–358. H. E. Hoekstra. 2012. Double digest RADseq: an inexpen- Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, sive method for de novo SNP discovery and genotyping and S. Kumar. 2011. MEGA5: Molecular Evolutionary in model and non-model species. PLoS ONE 7:e37135. Genetics Analysis using maximum likelihood, evolution- doi:10.1371/journal.pone.0037135 ary distance, and maximum parsimony methods. Molec- Phillips, C. D., C. A. Henard, and R. S. Pfau. 2007. ular Biology and Evolution 28:2731–2739. Amplified fragment length polymorphism and mitochon- Thomas, C., T. H. Bonner, and B. G. Whiteside. 2007. drial DNA analyses reveal patterns of divergence and Freshwater Fishes of Texas: A Field Guide. Texas A&M hybridization in the hispid cotton rat (Sigmodon hispidus). University Press, College Station, Texas. Journal of Mammalogy 88:351–359. Vitousek, P. M., H. A. Mooney, J. Lubchenco, and J. M. Pritchard, J. K., M. Stephens, and P. Donnelly. 2000. Melillo. 1997. Human domination of Earth’s ecosystems. Inference of population structure using multilocus geno- Science 277:494–499. type data. Genetics 155:945–959. Vos, P., R. Hogers, M. Bleeker, M. Reijans, T. van de Lee, Rahel, F. J. 2000. Homogenization of fish faunas across the M. Hornes, A. Frijters, J. Pot, J. Peleman, M. Kuiper, and United States. Science 288:854–856. M. Zabeau. 1995. AFLP: a new technique for DNA Rhymer, J. M., and D. Simberloff. 1996. Extinction by fingerprinting. Nucleic Acids Research 23:4407–4414. hybridization and introgression. Annual Review of Ecol- Walters, D. M., M. J. Blum, B. Rashleigh, B. J. Freeman, B. A. ogy and Systematics 27:83–109. Porter, and N. M. Burkhead. 2008. Red shiner invasion Rocha, L., M. Bernal, M. R. Gaither, and M. E. Alfaro. and hybridization with blacktail shiner in the upper Coosa 2013. Massively parallel DNA sequencing: the new River, USA. Biological Invasions 10:1229–1242. frontier in biogeography. Frontiers of Biogeography Ward, J. L., M. J. Blum, D. M. Walters, B. A. Porter, N. 5:67–77. Burkhead, and B. Freeman. 2012. Discordant introgres- Rubidge, E. M., and E. B. Taylor. 2004. Hybrid zone sion in a rapidly expanding hybrid swarm. Evolutionary structure and the potential role of selection in hybridizing Applications 5:380–392. populations of native westslope cutthroat trout (Onco- Weigel, D. E., J. T. Peterson, and P. Spruell. 2003. Introgres- rhynchus clarki lewisi) and introduced rainbow trout (O. sive hybridization between native cutthroat trout and mykiss). Molecular Ecology 13:3735–3749. introduced rainbow trout. Ecological Applications 13:38–50. Rundle, H. D., and D. Schluter. 1998. Reinforcement of Woodruff, D. S. 1973. Natural hybridization and hybrid stickleback mate preferences: sympatry breeds contempt. zones. Systematic Zoology 22:213–218. Evolution 52:200–208. Young, W. P., C. O. Ostberg, P. Keim, and G. H. Schmidt, T. R., J. P. Bielawski, and J. R. Gold. 1998. Thorgaard. 2001. Genetic characterization of hybridiza- Molecular phylogenetics and evolution of the cytochrome tion and introgression between anadromous rainbow b gene in the cyprinid genus Lythrurus (Actinopterygii: trout (Oncorhynchus mykiss irideus) and coastal cutthroat Cypriniformes). Copeia 1998:14–22. trout (O. clarkii clarki). Molecular Ecology 10:921–930.