And Cytosolic Proteases Endoplasmic Reticulum Aminopeptidase 1

Home , Endoplasmic reticulum

Processing of a Class I-Restricted Epitope from Tyrosinase Requires Peptide N -Glycanase and the Cooperative Action of Endoplasmic Reticulum Aminopeptidase 1 This information is current as and Cytosolic Proteases of September 28, 2021. Michelle L. Altrich-VanLith, Marina Ostankovitch, Joy M. Polefrone, Claudio A. Mosse, Jeffrey Shabanowitz, Donald F. Hunt and Victor H. Engelhard

J Immunol 2006; 177:5440-5450; ; Downloaded from doi: 10.4049/jimmunol.177.8.5440 http://www.jimmunol.org/content/177/8/5440 http://www.jimmunol.org/ References This article cites 45 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/177/8/5440.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

by guest on September 28, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Processing of a Class I-Restricted Epitope from Tyrosinase Requires Peptide N-Glycanase and the Cooperative Action of Endoplasmic Reticulum Aminopeptidase 1 and Cytosolic Proteases1

Michelle L. Altrich-VanLith,2* Marina Ostankovitch,* Joy M. Polefrone,† Claudio A. Mosse,3* Jeffrey Shabanowitz,† Donald F. Hunt,†‡ and Victor H. Engelhard4*

Although multiple components of the class I MHC processing pathway have been elucidated, the participation of nonproteasomal cytosolic enzymes has been largely unexplored. In this study, we provide evidence for multiple cytosolic mechanisms in the

generation of an HLA-A*0201-associated epitope from tyrosinase. This epitope is presented in two isoforms containing either Asn Downloaded from or Asp, depending on the structure of the tyrosinase precursor. We show that deamidation of Asn to Asp is dependent on glycosylation in the endoplasmic reticulum (ER), and subsequent deglycosylation by peptide-N-glycanase in the cytosol. Epitope precursors with N-terminal extensions undergo a similar process. This is linked to an inability of ER aminopeptidase 1 to efﬁciently remove N-terminal residues, necessitating processing by nonproteasomal peptidases in the cytosol. Our work demonstrates that processing of this tyrosinase epitope involves recycling between the ER and cytosol, and an obligatory interplay between enzymes

involved in proteolysis and glycosylation/deglycosylation located in both compartments. The Journal of Immunology, 2006, 177: http://www.jimmunol.org/ 5440–5450.

ultiple posttranslational modifications have been de- cells developed against cells expressing the endogenous sequences scribed that alter the repertoire of MHC class I pep- preferentially recognize synthetic peptides containing Asp in place M tides displayed by cells. One of these modifications of Asn. In addition, both Asn- and Asp-containing forms of an involves the deamidation of Asn to Asp (1). The first epitope de- epitope derived from lymphocytic choriomeningitis virus (LCMV) scribed to undergo this process encompassed residues 369–377 GP1 are presented on cells infected with LCMV (6). In all four 5 from tyrosinase (Tyr369), a melanocyte differentiation protein that epitopes, the Asn residues in the original sequences are part of is also a target for melanoma-reactive T cells. In melanoma cells Asn-linked glycosylation sites, and it has been suggested that de- by guest on September 28, 2021 expressing full-length tyrosinase, the deamidated (Asp-containing) amidated epitopes would arise following glycosylation in the en- form of this epitope is presented at high copy number by HLA- doplasmic reticulum (ER) and subsequent deglycosylation. A cy- A*0201, whereas the Asn-containing form encoded directly by the tosolic enzyme, peptide-N-glycanase (PNGase), was recently gene is not detectable by either T cells or mass spectrometry (2, 3). shown to remove N-linked sugars from proteins or peptides during Later, two additional epitopes from HIV-1 env (4) and hepatitis C protein degradation (7–9). An obligatory step in this enzymatic E1 (5) proteins have been suggested to be deamidated, because T reaction is hydrolysis, which converts Asn to Asp (10). Despite suggestive evidence (3, 5), there has not yet been a direct demon-

*Carter Immunology Center and Department of Microbiology, †Department of Chem- stration that a deamidated epitope is produced as a result of protein istry, and ‡Department of Pathology, University of Virginia, Charlottesville, VA glycosylation and deglycosylation, nor has the involvement of PN- 22908 Gase in such a process been evaluated. Received for publication April 24, 2006. Accepted for publication July 31, 2006. Because glycosylation occurs during translation of tyrosinase in The costs of publication of this article were defrayed in part by the payment of page the ER, the necessity of this process for deamidation of Tyr369 was charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. examined by altering the site of protein expression. Consistent 1 This work was supported by U.S. Public Health Service Grants AI20963 (to V.H.E.) with the involvement of glycosylation in deamidation, we previ- and AI33993 (to D.F.H.). M.L.A.-V. was supported by American Cancer Society ously established that the minimal 9-mer peptide representing Grant PF-03-128-01-LIB. Tyr369 did not undergo deamidation when translated in the cytosol 2 Current address: IBT Reference Laboratory, 11274 Renner Boulevard, Lenexa, KS (3). However, cytosolic translation of a fragment encoding resi- 66219. dues 144–378 of tyrosinase resulted in presentation of both the 3 Current address: Department of Pathology, Vanderbilt University, Nashville, TN 37212. Asp (Tyr369(D)) and Asn (Tyr369(N)) forms of the epitope. We 4 Address correspondence and reprint requests to Dr. Victor H. Engelhard, Carter hypothesized that this large fragment was processed in the cytosol Immunology Center, University of Virginia, Box 801386, Charlottesville, VA 22908- to give both minimal epitope and extended precursor peptides, 1386. E-mail address: [email protected] both of which were transported by TAP. We further hypothesized 5 Abbreviations used in this paper: Tyr369, tyrosinase 369–377; LCMV, lymphocytic that the additional length in the extended precursors prevented im- choriomeningitis virus; ER, endoplasmic reticulum; PNGase, peptide-N-glycanase; TPPII, tripeptidyl peptidase II; ERAP, ER aminopeptidase; LAP, leucine aminopep- mediate binding to HLA-A*0201 after TAP transport, enabling the tidase; PSA, puromycin-sensitive aminopeptidase; BH, bleomycin hydrolase; TOP, peptide to become glycosylated and to exit the ER into the cytosol thimet oligopeptidase; EGFP, enhanced GFP; ICS, intracellular cytokine staining; BFA, brefeldin A; siRNA, small interfering RNA; FTMS, Fourier transform mass for both deglycosylation and processing to the mature epitope. In spectrometer. the present paper, we have investigated these hypotheses directly.

In considering the hypothesis outlined above, it became of in- T cell activity terest to understand which proteases were involved in the process- Tyr369(D)- and Tyr369(N)-specific T cells were generated as described pre- ing of Tyr369 epitope precursors. The proteasome has been shown viously (3) and restimulated weekly with peptide-pulsed splenocytes in to be responsible for proteolytic cleavage to generate the final C RPMI 1640 supplemented with 10% FBS, 1ϫ essential and nonessential terminus of many epitopes (11–13), whereas tripeptidyl peptidase amino acids, 10 U/ml IL-2, 15 mM HEPES, and 50 ␮M 2-ME (T cell medium). Presentation of Tyr (N) and Tyr (D) was evaluated either by II (TPPII) has been shown to play a more limited role (14). How- 369 369 intracellular cytokine staining (ICS) or ELISA. For ICS, T cells and stim- ever, the peptides that are generated by these proteases frequently ulator cells were incubated at various ratios for4hinTcell medium contain one or more N-terminal residues beyond that of the mature containing 50 U/ml IL-2 and 10 ␮g/ml brefeldin A (BFA) (Sigma-Aldrich). epitope (11–13, 15, 16). Several aminopeptidases in the cytosol Cells were stained with anti-CD8-PE (eBioscience), fixed and permeabil- and the ER have been implicated in the removal of these N-ter- ized with Cytofix/Cytoperm (BD Pharmingen), and stained with anti-IFN- ␥-allophycocyanin (eBioscience). Background IFN-␥ production was sub- minal extensions. One aminopeptidase localized in the ER, ER tracted out using unstimulated parallel cultures. In some ICS assays, aminopeptidase 1 (ERAP1), trims precursors to their final anti- deamidation was quantified by as the ratio of the percentage of IFN-␥ϩ ␥ϩ genic form in vitro, and exerts a strong influence on epitope gen- Tyr369(D) T cells over the sum of the percentage of IFN- Tyr369(D) and eration in vivo (17–21). A second ER-localized aminopeptidase, Tyr369(N) T cells. In these experiments, a T cell stimulator ratio was cho- sen such that the response was in the linear range. For ELISA, T cells and ERAP2, is required for removal of some basic residues from some stimulator cells were incubated at various ratios for 18–24 h in T cell peptides (20, 21). Leucine aminopeptidase (LAP), a cytosolic ami- medium. IFN-␥ was measured following manufacturer’s protocol nopeptidase, can generate epitopes from precursors in vitro (13, (eBiosciences). 22), but knockout of LAP does not impact the level of SIINFEKL/ H-2Kb complexes formed from a number of precursor peptides or Inhibition of epitope expression using chemical inhibitors Downloaded from full-length OVA (23). Bleomycin hydrolase (BH) and puromycin- DM331 cells were incubated for 30 min in medium containing 10 ␮g/ml sensitive aminopeptidase (PSA), which are also located in the cy- BFA, 50 ␮M Z-VAD FMK (Promega or R&D Systems), 50 ␮M Q-VD- ␮ tosol, have also been shown to generate epitopes from precursors OPh (R&D Systems), or 2.5 l/ml DMSO (Sigma-Aldrich) and treated with acidic buffer to remove cell surface class I MHC molecules (30, 31). in in vitro degradation assays (24). However, no cytosolic amino- Cells were resuspended in medium containing the same inhibitors and in- peptidase has been shown to be directly involved in the production cubated at 37°C for5htoallow re-expression of MHC molecules. Cells

of class I MHC-associated peptides in vivo. Furthermore, overex- were fixed with 0.1% glutaraldehyde, and used as stimulators in an ELISA. http://www.jimmunol.org/ pression of TPPII, thimet oligopeptidase (TOP), LAP, BH, or PSA Inhibition of protease expression by small interfering RNA does not alter the presentation of two influenza nucleoprotein (siRNA) knockdown epitopes (25); thus, it is also consequently unclear whether cytosolic and ER-localized aminopeptidases cooperate in epitope gen- DM331 cells expressing full-length tyrosinase or minigenes were trans- eration. In the present paper, we have directly examined the pro- fected twice 4 h apart using Oligofectamine (Invitrogen Life Technologies) and siRNA oligonucleotides targeting human ERAP1 (AACGTAGTGAT teolytic processes responsible for trimming of the Tyr369 epitope. GGGACACCAT), TOP (AAAAGGUCACCCUCAAGUACC), TPPII (AAGUGGCGAUGUGAAUACUGC) (all from Dharmacon); LAP (CCCAGTCTTCTTGGAAATTCA and AAAGCTTAATTTGCCCAT by guest on September 28, 2021 Materials and Methods TAA), PSA (CTGGGAATGGTTAAACACAAA and CAGACCAAT GGGTGAAGTTAA), or BH (CCAATGGGATATGCTTGTTAA and AT Plasmids GCTTGTTAATATTGTTGAA) (all from Qiagen), or control nontargeting ICP47 (gift from N. Shastri, University of California, Berkeley, CA) was siRNA (Dharmacon). For experiments combining ERAP1 knockdown and subcloned into pcDNA3.1/zeocin using the HindIII and EcoRI sites. Plas- TAP inhibition, Tyr369-encoding minigenes and siRNA were cotransfected mids encoding cytosolic minigenes were generated by ligating overlapping by Nucleofection (Amaxa) using buffer V and program U-20. Blasticidin oligonucleotides into pEGFP/Ub (gift from F. Levy, Ludwig Institute for and zeocin were added after 24 h. All transfectants were used as stimulators Cancer Research, University of Lausanne, Epalinges, Switzerland) after in ELISA 3 or 4 days following transfection. digestion with BamHI and SacII. This plasmid links minigenes to an enhanced GFP (EGFP)-ubiquitin conjugate, and directs cleavage by an ubiq- Real-time RT-PCR uitin-specific protease and releases the minigene in the cytosol without RNA was extracted using TRIzol with glycogen pull-down (Invitrogen necessitating the removal of an initiator methionine (26). Plasmids encod- Life Technologies) from cells that had been transfected with siRNA oli- ing minigenes targeted to the ER via the tyrosinase signal sequence were gonucleotides 3 days previously. Various concentrations of RNA were generated by ligating overlapping oligonucleotides into pEF6 (Invitrogen used in a real-time RT-PCR using the QuantiTect SYBR Green RT-PCR Life Technologies) after digestion with BamHI and KpnI. Full-length ty- kit (Qiagen) and QuantiTect Primer Assays (Qiagen) for all five proteases rosinase with a flag-tag at the C terminus, in p3XCMV (gift from R. Hala- and the housekeeping gene, GAPDH, on an ABI Prism 7000, following the ban, Yale University, New Haven, CT) has been previously described (27), manufacturer’s protocol. A ratio of GAPDH to protease mRNA was cal- and was used to generate a glycosylation-mutant tyrosinase, T373V (28). culated by the formula 1/2DCt, where DCt is the difference in cycle count All plasmids were confirmed by sequencing. between GAPDH and the specific protease.

Immunoblotting Cell lines and transfectants For tyrosinase immunoblotting, DM331 cells expressing flag-tagged full- The human melanoma line DM331, which expresses HLA-A*0201 but not length tyrosinase were incubated for4hinmedium containing 1 ␮g/ml tyrosinase (29), was grown in RPMI 1640 supplemented with L-glutamine, cycloheximide and either 50 ␮M Z-VAD FMK (Promega), 2 ␮M epoxomi- HEPES, and 5% FBS/SerExtend (Irvine Scientific). DM331 was trans- cin (Calbiochem), or both. For ERAP1 immunoblotting, DM331 cells fected with the above plasmid constructs using Fugene (Roche), and se- transfected with siRNA oligonucleotides 4 days prior were used. Cells lected in medium containing 250 ␮g/ml zeocin (Invitrogen Life Technol- were lysed by repeated freeze-thaw in buffer containing protease inhibitors ogies) (ICP47), 600 ␮g/ml G418 (Invitrogen Life Technologies) (cytosolic and centrifuged at 100,000 ϫ g for1hat4°C. For tyrosinase immuno- constructs, flag-tagged full-length tyrosinase, and T373V tyrosinase), or 10 blotting, half of each supernatant was digested with 1000 U of PNGase ␮g/ml blasticidin (Invitrogen Life Technologies) (ER constructs and full- (New England Biolabs) according to the manufacturer’s recommendations. length tyrosinase). Clones expressing ICP47 were identified based on Boiled samples were separated on 10% SDS-PAGE gels, transferred to down-regulation of HLA-B and -C molecules detected with the B123.2 Ab. Immobilon-P membrane, and blocked in 5% nonfat milk in PBS with For some experiments, cells were transiently transfected. One day post- 0.05% Tween 20. Blots were probed overnight with Abs against flag transfection, cells were trypsinized and evaluated for transfection efficiency (Sigma-Aldrich), ERAP1 (a gift from Dr. M. Tsujimoto, RIKEN, Wako, by measuring the percentage of cells positive for EGFP and used as stim- Japan), or calnexin (StressGen), washed, probed with HRP-conjugated sec- ulators for T cells. ondary Abs, and developed according to the Amersham ECL protocol. 5442 ER AND CYTOSOL ACTIVITIES FORM TYROSINASE EPITOPE

FIGURE 1. T cells distinguish between Asn- and

Asp-containing Tyr369 epitopes. DM331 cells were either pulsed with peptides (A) or transfected with either full-length tyrosinase or the cytosolic-targeted minimal epitope Tyr369(N) (B), and used as stimulators in an ICS assay with Tyr369(N)- (left panel)orTyr369(D)- (right panel) speciﬁc T cells. Downloaded from http://www.jimmunol.org/

In vitro digestion with ERAP1 Tyr369(N) epitope presented only Tyr369(N) and not Tyr369(D). Thus, The 6ϩ9N peptide HNALHIYMNGTMSQV (150 ␮M) and 3.5 ␮g/ml the location and structure of the precursor of the Tyr369 epitope de- ERAP1 (gift from K. Rock and L. Stern, University of Massachusetts Med- termines whether it undergoes deamidation. ical School, Worcester, MA) were incubated in 50 mM Tris-HCl (pH 7.8) under argon to minimize oxidation. The reaction was terminated by adding 0.6% trifluoroacetic acid. Aliquots from each time point were loaded onto a reverse-phase C18 microcapillary HPLC column and gradient eluted at a flow rate of ϳ60 nl/min through a 2-␮m diameter laser pulled electrospray orifice directly into a hybrid linear quadrupole ion trap Fourier transform mass spectrometer (FTMS) (Thermo Electron Corporation) adapted as in by guest on September 28, 2021 Ref. 32. Collisional activated dissociation spectra ms were acquired in a data-dependent mode. First, a full-scan mass spectrum was obtained with the FTMS, followed by 10 ms spectra acquired in the linear trap of the top 10 most abundant mass spectrometry ions from the FTMS full scan spectrum (one microscan per spectra; precursor m/z, Ϯ1.5 Da; 30% collision energy; 30-ms ion activation; no dynamic exclusion; repeat count of two). SEQUEST, version 27 (revision 11) (33), was used for automated peptide identification, searched through the BioWorks, version 3.2, interface. A simple peptide database corresponding to the sequence of the 15-mer was searched without enzyme restriction, with a differential modification of 16 Da for methionine oxidation. Peak areas and heights were calculated (2.5- ppm mass tolerance; 10,000 ion count minimum threshold; no smoothing) within the Bioworks 3.2 software, for manually validated peptides. Peak height values of oxidized and unoxidized forms of a peptide were summed and used to determine relative abundance in the sample set, because the relative values for height and area were equivalent under these analysis conditions. Results

Deamidation of Tyr369 is dependent on glycosylation and deglycosylation by PNGase We previously established that two HLA-A*0201-restricted FIGURE 2. Accumulation of deglycosylated degradation intermediates epitopes derived from the Tyr369 sequence were produced in vivo is blocked by Z-VAD-FMK. A, DM331 melanoma cells expressing flag- (2, 3). One of these, based on the genetically encoded sequence tagged full-length tyrosinase were incubated in medium containing and containing an Asn at the third position, is designated Z-VAD-FMK, the proteasome inhibitor epoxomicin, or both. After 4 h, cells were lysed, and one-half of the supernatant was digested with PNGase Tyr369(N). The other contains an Asp at this position, and is designated Tyr (D). The presentation of these epitopes on melanoma in vitro. Samples were analyzed by SDS-PAGE and immunoblotted with 369 anti-flag Ab. The broad bands centered at ϳ78 kDa represent glycosylated cells and tyrosinase transfectants was initially shown using mass spec- forms of tyrosinase. The bands at ϳ61 kDa represent proteasome-sensitive trometry, and later using T cells specific for each epitope, analogous deglycosylated tyrosinase. B, Expression of 61-kDa bands representing to those shown in Fig. 1A. As previously shown, cells expressing deglycosylated tyrosinase, normalized to that of tubulin, determined after full-length tyrosinase presented substantial amounts of Tyr369(D), but stripping and rehybridizing with anti-tubulin Ab. Values are obtained by no significant amount of Tyr369(N) (Fig. 1B). Conversely, cells trans- scanning densitometry of the bands in lanes 1 (medium), 3 (epoxo), 5 fected with a minigene encoding a cytosol-targeted minimal (z-vad-fmk ϩepoxo), and 7 (z-vad-fmk) of the blot shown in A. The Journal of Immunology 5443

We previously hypothesized that the conversion of Asn to Asp alone, to allow re-expression of class I molecules, or in medium 371 in the Tyr369 epitope was due to glycosylation at Asn during containing Z-VAD FMK; Q-VD-OPh, an unrelated caspase inhib- biosynthesis, and subsequent deglycosylation by PNGase during itor that does not block PNGase (35); or BFA, which blocks egress protein degradation. This hydrolytic process results in deamidation of newly formed class I molecules to the cell surface. These cells of Asn to Asp (10). To directly examine the involvement of were then evaluated for presentation of the deamidated and non-

PNGase, we treated cells with Z-VAD FMK. This compound is a deamidated epitopes to specific T cells. Presentation of Tyr369(D) well-known inhibitor of caspases (34), but has recently been by cells expressing full-length tyrosinase was substantially inhib- shown to block the activity of PNGase (35). We first established ited by incubation with Z-VAD FMK, whereas incubation with that Z-VAD FMK did block the deglycosylation of misfolded ty- Q-VD-OPh had no effect (Fig. 3A, left panel). Thus, this inhibition rosinase that accumulated in the cytosol after inhibition of protea- was not due to the anti-caspase activity of Z-VAD FMK. However, some activity with epoxomicin. Deglycosylation of 78-kDa full- Z-VAD FMK did not inhibit the presentation of Tyr369(N) in cells length glycosylated tyrosinase by PNGase in vitro produces a band expressing the minigene encoding this epitope in the cytosol (Fig. of 61 kDa (Fig. 2A), and a band at the same molecular mass was 3A, right panel), demonstrating that it did not interfere with other observed in cells treated with epoxomycin. Treatment of cells with elements of the MHC class I processing and presentation pathway. 371 Z-VAD-FMK and epoxomicin reduced the amount of this 61-kDa These results indicate that deglycosylation of Asn in the Tyr369 band by Ͼ80% (Fig. 2B). Treatment with Z-VAD FMK did not epitope that originates from full-length tyrosinase is responsible cause accumulation of either the 61-kDa tyrosinase species (Fig. 2) for its deamidation to Asp. or other degradation intermediates (data not shown). This is con- To further confirm that glycosylation was a prerequisite to de- sistent with what has been observed for other proteins (35), and amidation, we mutated the glycosylation consensus sequence of Downloaded from demonstrates that glycosylated proteins are still degraded by the Asn371 by replacing Thr373 with a Val (T373V) (36). Synthetic proteasome in treated cells. peptides representing these Val-substituted epitopes bind to HLA- To evaluate the requirement for PNGase in the expression of A*0201 with similar affinity compared with their Thr-containing

Tyr369(D), DM331 melanoma cells expressing full-length tyrosi- counterparts (our unpublished data). Tyr369(D)-speciﬁc T cells rec- nase were brieﬂy exposed to acidic buffer to denature cell surface ognized DM331 cells pulsed with the YMDGVMSQV peptide class I MHC molecules and then incubated for5hinmedium comparably to cells pulsed with the parental Tyr369(D) epitope, http://www.jimmunol.org/ by guest on September 28, 2021

FIGURE 3. Deamidation of Tyr369 occurs through glycosylation-dependent and -independent pathways. A, DM331 cells expressing full-length tyrosinase (left panel)or the cytosolic-targeted minimal epitope

Tyr369(N) (right panel) were exposed to acidic buffer to denature cell surface class I MHC molecules, and then incubated in medium containing Z-VAD-MK, Q-VD-OPh, DMSO, or BFA. These cells were evaluated for epitope expression by incubation with Ⅺ f Tyr369(N)- ( )orTyr369(D)- ( ) specific T cells, and quantitation of IFN-␥ release by ELISA. B, DM331 cells transfected with either full-length tyrosinase or T373V tyrosinase were evaluated for epitope expression by incubation with Tyr369(N)- (left panel)or Tyr369(D)- (right panel) specific T cells, and quantitation of IFN-␥ϩ cells by ICS. C, Sim- ilar to A except cells were transfected with T373V tyrosinase and evaluated for expression of Tyr369(D). nd, Not detected. 5444 ER AND CYTOSOL ACTIVITIES FORM TYROSINASE EPITOPE and showed no discernable reactivity on either peptide containing 371 Asn (Fig. 1A). Likewise, Tyr369(N)-specific T cells specifically recognized DM331 cells pulsed with the YMNGVMSQV peptide, although slightly less well than they recognized cells pulsed with

Tyr369(N). DM331 cells expressing T373V tyrosinase efficiently stimulated Tyr369(N)-specific T cells (Fig. 3B, right panel), demonstrating that the absence of glycosylation of Asn371 enabled presentation of an unmodified Tyr369 epitope from full-length tyrosinase. Surprisingly however, T373V transfectants also stimulated

Tyr369(D)-speciﬁc T cells (Fig. 3B, left panel). This presentation was insensitive to inhibition of PNGase with Z-VAD FMK (Fig. 3C), demonstrating that it was not a result of residual glycosylation. Using mass spectrometry, we have also directly established that cells transfected with T373V tyrosinase express both YMNGVMSQV and YMDGVMSQV peptides (data not shown). Collectively, these results suggest the existence of a second pathway for deamidation of this Asn371 that is independent of glycosylation. Downloaded from

N-terminal extended Tyr369 epitope precursors in the cytosol undergo deglycosylation-dependent deamidation We previously demonstrated that cells expressing a fragment com- prising residues 144–378 of tyrosinase in the cytosol presented FIGURE 4. N-terminal extended precursors synthesized in the cytosol enable deamidation through a PNGase-dependent pathway. A, DM331 both Tyr (D) and Tyr (N) epitopes (3), suggesting that longer 369 369 cells transfected to express cytosolic-targeted epitopes or epitope precur- epitope precursors enabled deamidation to occur. To gain insight sors were evaluated for epitope expression by incubation with Tyr (N)- http://www.jimmunol.org/ into the mechanism responsible, we generated minigenes encoding 369 (left panel)orTyr369(D)- (right panel) specific T cells, and quantitation of ϩ Tyr369 epitope precursors linked to the C-terminal end of an IFN-␥ cells by ICS. B, DM331 cells expressing the 5ϩ9N epitope pre- EGFP-ubiquitin fusion protein. These fusion proteins are rapidly cursor were exposed to acidic buffer to denature cell surface class I MHC and quantitatively cleaved following the ubiquitin residue by a molecules, and then incubated in medium containing Z-VAD-MK, Q-VD- ubiquitin-specific protease, releasing the epitope precursors into OPh, DMSO, or BFA. These cells were then evaluated for epitope expres- Ⅺ f the cytosol (26). Constructs were generated that encoded precur- sion by incubation with Tyr369(N)- ( )orTyr369(D)- ( ) specific T cells, sors with extensions of either three or five N-terminal residues and quantitation of IFN-␥ release by ELISA. C, Deamidation was quanti- (3ϩ9N and 5ϩ9N), three or five C-terminal residues (9Nϩ3 and fied as described in Materials and Methods. nd, Not detected. 9Nϩ5), or five residues on both ends of the mature epitope by guest on September 28, 2021 (5ϩ9Nϩ5). All extensions were taken from the tyrosinase se- whereas recognition of cells expressing 9N construct was minimal. quence flanking the epitope (Table I). Expression plasmids encod- This demonstrates that deamidation of Tyr369 derived from pre- ing the fusion proteins were transfected into DM331, and cells cursors synthesized in the cytosol is dependent on extending their expressing equivalent levels of EGFP were evaluated for epitope N-terminal ends relative to that of the mature epitope. presentation with Tyr369(D)- and Tyr369(N)-specific T cells. Rel- Because of the glycosylation dependent and independent path- ative to cells expressing the minimal 9-mer construct (9N), cells ways defined above, it was important to determine which pathway expressing precursors with C-terminal extensions (9Nϩ3, 9Nϩ5, was responsible for deamidation of these small epitope precursors. ϩ ϩ and 5 9N 5) presented Tyr369(N) very poorly, and did not Z-VAD FMK, but not the general caspase inhibitor Q-VD-OPh, ϩ present Tyr369(D) at any detectable level (Fig. 4A). These low blocked presentation of Tyr369(D) by cells transfected with 5 9N levels of presentation may be due either to an inability of these (Fig. 4B, f). However, Z-VAD FMK did not block presentation of Ⅺ short substrates to be processed by the proteasome or, alterna- Tyr369(N) in the same cells (Fig. 4B, ). This indicates deamida- tively, to inappropriate proteasomal cleavage resulting in epitope tion of Tyr369 from this cytosolic precursor is dependent on deg- destruction. In contrast, cells expressing precursors with N-termi- lycosylation by PNGase, similar to that seen with wild-type full- ϩ ϩ nal extensions (3 9N and 5 9N) presented Tyr369(N) similarly to length tyrosinase. This in turn suggests that these precursors enter cells expressing the minimal 9N construct (Fig. 4A). Most impor- the ER to become glycosylated, are then retrotranslocated into the tantly, cells expressing either the 3ϩ9N or 5ϩ9N constructs were cytosol for deglycosylation, and are transported into the ER a sec- recognized at a significant level by Tyr369(D)-specific T cells, ond time for binding to HLA-A*0201. We evaluated the relative efficiency of deamidation of different

epitope forms by calculating the ratio of Tyr369(D)-specific T cell reactivity to the sum of Tyr (D)-specific and Tyr (N)-specific Table I. Sequences of epitopes and epitope precursors 369 369 T cell reactivities. This measurement can be affected by variation in T cell activity and transfection efficiency in different experi- Construct Sequence ments, and its relationship to the number of relevant peptide-MHC 9D YMDGTMSQV complexes is more likely to be logarithmic than linear. Nonethe- 9N YMNGTMSQV less, it provides a semiquantitative determination of the extent of ϩ LHI YMNGTMSQV 3 9N deamidation, and consistent results were obtained in four indepen- 5 ϩ 9N NALHI YMNGTMSQV 6 ϩ 9N HNALHI YMNGTMSQV dent experiments. These data showed that the relative efficiency of 9N ϩ 3 YMNGTMSQV QGS deamidation was similar for the 3ϩ9N and 5ϩ9N constructs (Fig. 9N ϩ 5 YMNGTMSQV QGSAN 4C). However, the efficiency of deamidation of either construct ϩ ϩ 5 9N 5 NALHI YMNGTMSQV QGSAN was substantially less than that of full-length tyrosinase. The Journal of Immunology 5445

FIGURE 5. N-terminal extended epitope precursors synthesized in the ER enable deamidation through a PNGase-dependent pathway. A, DM331 cells expressing ER-targeted epitopes or epitope precursors were evaluated for epitope expression by incubation with

Tyr369(N)- (left panel)orTyr369(D)- (right panel) spe- ciﬁc T cells, and quantitation of IFN-␥ϩ cells by ICS. B, DM331 cells expressing the ER6ϩ9N epitope precursor were exposed to acidic buffer to denature cell surface class I MHC molecules, and then incubated in medium containing Z-VAD-MK, Q-VD-OPh, DMSO, or BFA. These cells were then evaluated for epitope expression Ⅺ f by incubation with Tyr369(N)- ( )orTyr369(D)- ( ) speciﬁc T cells, and quantitation of IFN-␥ release by

ELISA. C, Deamidation was quantiﬁed as described in Downloaded from Materials and Methods. nd, Not detected. http://www.jimmunol.org/

The efficiency of Tyr369 deamidation is independent of the site of However, the recent identification of ERAP1 and ERAP2 as im- translation portant mediators of N-terminal trimming in the ER cast doubt on this model. In addition, it is generally believed that glycosylated The inefficiency of deamidation of cytosolic Tyr369 precursors relative to full-length tyrosinase in the ER suggested that deamidation peptides exit the ER poorly, a fact that has been used in the design was linked to the site of translation. Therefore, we generated mini- of assays for TAP transport. To gain further insight into these genes encoding either the minimal epitope (ER9N) or N-terminal issues, we examined the ability of Tyr369 epitope precursors to be extended precursors (ER1ϩ9N, ER2ϩ9N, ER6ϩ9N) linked to the processed in the ER alone. Minigenes encoding cytosol- or ER- by guest on September 28, 2021 signal sequence of tyrosinase, allowing for translation into the lu- targeted epitopes or precursors were transfected into DM331 cells men of the ER and release of the precursor by signal peptidase. that had been stably transfected to express ICP47, a herpes simplex Cells expressing all of these constructs were recognized by viral protein that blocks TAP transport into the ER and the cells were evaluated for epitope presentation with Tyr369(N)-specific T Tyr369(N)-specific T cells comparably to one another and to cells transfected with the cytosol-directed 5ϩ9N construct (Fig. 5A). As cells. As expected, epitope presentation from the cytosol-localized ϩ was seen above with the cytosolic constructs, cells expressing N- 5 9N precursor was strongly inhibited by cotransfection of terminal extended constructs in the ER were recognized at an el- ICP47, reflecting TAP-dependent transport (Fig. 6A), whereas Tyr (N) presentation in cells transfected to express the minimal evated level by Tyr369(D)-specific T cells, indicating that a fraction 369 of these molecules had undergone deamidation. In addition, Z- 9N construct in the ER was insensitive to ICP47 (Fig. 6B). Pre- sentation of Tyr (D) from ER-targeted precursors with N-termi- VAD FMK treatment blocked presentation of Tyr369(D) in cells 369 expressing the ER6ϩ9N construct (Fig. 5B). This indicates deami- nal extensions was inhibited by ICP47 regardless of the length of the extension (Fig. 6B), consistent with the idea that generation of dation of Tyr369 from ER-targeted precursors is dependent on deglycosylation by PNGase. However, the relative efficiency of this deamidated epitope depends on translocation from ER to cy- deamidation of ER-targeted precursors was similar to that seen for tosol for PNGase-mediated deamidation. Interestingly, however, the N-terminal extended cytosolic precursors, and still substan- the effect of ICP47 on presentation of the nondeamidated tially less than that seen for full-length tyrosinase (Fig. 5C). Thus, Tyr369(N) epitope from ER-targeted precursors was length depen- translation in the ER per se is not sufficient to improve the effi- dent (Fig. 6A). ICP47 had little impact on epitope presentation ciency of deamidation, suggesting that structural differences be- from a precursor with a single residue N-terminal extension. How- tween these small epitope precursors and full-length tyrosinase ever, TAP inhibition by ICP47 significantly diminished the pre- exert a strong influence. sentation of Tyr369(N) from precursors with two and six residue extensions. This indicates that aminopeptidases in the ER are suf- Proteases in both ER and cytosol are differentially involved in ficient to trim short Tyr369 precursors to their final length. How- the generation of Tyr369(N) ever, efficient presentation from longer precursors depends, at least in part, on proteases localized in the cytosol. Although the results above established that extended Tyr369 epitope precursors underwent glycosylation-dependent deamidation, they did not directly address how the N-terminal extensions enabled this process. We originally suggested that this additional The ER aminopeptidase ERAP1 is involved in the generation of Tyr epitopes length prevented immediate binding to HLA-A*0201 after TAP 369 transport, enabling the peptide to exit the ER into the cytosol for The ER aminopeptidase, ERAP1, has been shown to influence the both deglycosylation and processing to the mature epitope (3). presentation of a large fraction of class I MHC-associated peptide 5446 ER AND CYTOSOL ACTIVITIES FORM TYROSINASE EPITOPE

FIGURE 6. Expression of Tyr369(N) and Tyr369(D) from ER-targeted precursors with two or more N-terminal residues requires cytosolic processing. DM331 cells were transfected with minigenes encoding cytosolic- or

ER-targeted Tyr369 epitopes or epitope precursors alone or in combination with the gene encoding ICP47. Trans- fectants were evaluated for epitope expression by incubation with Tyr369(N)-specific T cells (A, left panel)or Tyr369(D)-specific T cells (B), and quantitation of IFN-␥ϩ cells by ICS (A, right panel). The percentage of inhibition was quantified as follows: 1 Ϫ ((% T cells activated by ICP47-expressing stimulators/% T cells activated by stimulators not expressing ICP47) ϫ 100). Downloaded from http://www.jimmunol.org/ epitopes (17). To evaluate the importance of ERAP1 in the pro- the presentation of Tyr369(N) in cells transfected to express the duction of Tyr369(N), DM331 cells expressing cytosolic- or ER- cytosolic-targeted minimal construct (9N) (Fig. 7, B and C). This targeted constructs were transfected with siRNA oligonucleotides is consistent with the demonstration that ERAP1 degrades for either ERAP1 or a nontargeting control, and cells were ana- Tyr369(N) in vitro (17). Conversely, ERAP1 knockdown decreased lyzed for presentation of Tyr369(N) 3–4 days later. Knockdown of the presentation of Tyr369(N) from the cytosolic- and ER-targeted ERAP1, which was confirmed by Western blot (Fig. 7A), increased precursors containing five or six N-terminal amino acids (Fig. 7, B by guest on September 28, 2021

FIGURE 7. ERAP1 destroys or generates Tyr369 from epitopes or epitope precursors depending on subcellular localization and precursor length. A, DM331 cells were transfected with control or ERAP1 siRNA oligonucleotides, and analyzed for expression of ERAP1 and calnexin 3 days later. Cell extracts were fractionated by SDS-PAGE and immunoblotted with anti-ERAP1 Ab. The blot was then stripped and rehybridized with anti-calnexin Ab. The numbers below each lane are the magnitude of the ERAP1 band expressed as a percentage of the Calnexin band, as determined by scanning densitometry. B, DM331 cells expressing tyrosinase, cytosolic- or ER-targeted epitopes, or epitope precursors were transfected with either ERAP1 (f) or control (Ⅺ) siRNAs. Transfectants were analyzed for expression of Tyr369(N) (epitope and epitope precursors) or Tyr369(D) (tyrosinase) by incubation with appropriate T cells and measurement of IFN-␥ release by ELISA. DM331 (C and D) or DM331.ICP47 (D) cells expressing cytosolic- or ER-targeted epitopes or epitope Ⅺ f precursors and ERAP1 siRNA or control siRNA were analyzed for expression of Tyr369(N) ( )orTyr369(D) ( ). Epitope expression in cells transfected with ERAP1 siRNA was compared with that in cells expressing control siRNA and percentage change was calculated as follows: % change ϭ ((ERAP1 siRNA Ϫ control siRNA)/control siRNA) ϫ 100. Values shown are the means of data obtained in four to eight independent experiments. The Journal of Immunology 5447

simultaneously. DM331 cells stably expressing ICP47 were cotransfected with siRNA (ERAP1 or control) and minigenes encod- ϩ ϩ ing ER1 9N or ER2 9N, and Tyr369(N) presentation was evaluated 3 and 4 days later. Although presentation of this epitope was insensitive to ERAP1 blockade in cells with normal TAP activity, it was strongly inhibited by ERAP1 blockade in cells with dimin-

ished TAP activity (Fig. 7D). This indicates that when Tyr369 epitope precursors with one and two residue extensions are con- ﬁned to the ER, ERAP1 plays a central role in their processing. However, when ERAP1 activity is blocked, these precursors are efﬁciently processed in the cytosol.

The observation that epitope presentation from Tyr369 precur- FIGURE 8. In vitro degradation of 6ϩ9N peptide by ERAP1 results in sors with two and six residue extensions was TAP dependent sug- differential accumulation of the 2ϩ9N precursor, but does generates gested that cytosolic proteases were compensating for a deﬁciency Tyr (N). HNALYMNGTMSQV and ERAP1 were incubated for various 369 in the trimming of these longer peptides by ERAP1. To evaluate times and the degradation products were identiﬁed and quantitated by mass this hypothesis, recombinant human ERAP1 was incubated in vitro spectrometry. with a 15-mer synthetic peptide corresponding to the ER6ϩ9N precursor, and the degradation products were analyzed by mass and C). Additionally, ERAP1 knockdown inhibited presentation of spectrometry. Under the conditions used, ERAP1 degraded ϳ90% Downloaded from

Tyr369(D) in cells expressing full-length tyrosinase. These results, of this 15-mer within a period of 10 min (Fig. 8). The 14-mer, taken with the ICP47 blockade data of Fig. 6, suggest that both 13-mer, and 12-mer degradation products became evident as the cytosolic proteases and ERAP1 are involved in the generation of 15-mer was degraded, but were always detected at relatively low

Tyr369 epitopes from precursors containing ﬁve to six residue ex- levels. In contrast, the 11-mer accumulated substantially within 5 tensions, and that such precursors are produced from full-length min and remained present at signiﬁcant levels for at least 30 min.

tyrosinase. The 10-mer also accumulated to a signiﬁcant extent early, but then http://www.jimmunol.org/ In contrast to these longer precursors, the presentation of declined coincident with the appearance of the mature 9-mer

Tyr369(N) from ER-target precursors with shorter N-terminal ex- epitope. These results suggest a model in which epitope production tensions (ER1ϩ9N and ER2ϩ9N) was relatively insensitive to is limited by inefﬁcient trimming of the 11-mer peptide by ERAP1, ERAP1 knockdown (Fig. 7, B and C). This suggested that trim- which is compensated for by retrotranslocation and trimming in ming of these precursors was mediated either by another ER-res- the cytosol. ident protease, such as ERAP2, or a protease in the cytosol. To Multiple cytosolic proteases (PSA, BH, TOP, LAP, and TPPII) determine whether another ER-resident protease was responsible have been implicated in the generation of MHC epitopes in vitro for trimming of these precursors, ERAP1 and TAP were blocked (37). To evaluate the in vivo relevance of their activity to the by guest on September 28, 2021

ϩ FIGURE 9. Nonproteasomal cytosolic proteases destroy Tyr369 from ER6 9N and full-length tyrosinase. A, Cells were transfected with either TPPII, TOP, BH, LAP, PSA (f), or control (Ⅺ) siRNA oligonucleotides, and expression of the indicated protease mRNAs was quantitated as described in Materials and Methods. y-axis values represent the level of expression of the indicated protease mRNA normalized to the level of GAPDH mRNA in the same sample. B, DM331 cells expressing ER6ϩ9N were transfected with siRNA oligonucleotides targeting TPPII, TOP, BH, LAP, PSA, or control siRNA Ϯ were analyzed for expression of Tyr369(N) by ICS. Data points represent the mean of three experiments SEM. C, DM331 cells expressing full-length tyrosinase were transfected with siRNA oligonucleotides targeting TPPII, TOP, BH, LAP, PSA, or control siRNA were analyzed for expression of Ϯ Tyr369(D) by ICS. Data points represent the mean of three experiments SEM. 5448 ER AND CYTOSOL ACTIVITIES FORM TYROSINASE EPITOPE

ϩ generation of Tyr369(N), cells expressing the ER6 9N precursor sylation or spontaneous deamidation. Conversely, it is also impor- or full-length tyrosinase were transfected with siRNA oligonucle- tant to reiterate that, based on the absence of Tyr369(N), the re- otides for either TOP, TPPII, LAP, PSA, BH, or a nontargeting quirement for PNGase, and the obligatory conversion of Asn to control, and cells were analyzed for presentation of Tyr369(N) or Asp during PNGase mediated deglycosylation, our evidence does Tyr369(D) 4 days later. Knockdown of mRNA was confirmed with not support a role for spontaneous deamidation in the generation of real-time RT-PCR (Fig. 9A). Knockdown of TOP, TPPI, or BH did Tyr369(D) from normally glycosylated tyrosinase. not affect the presentation of Tyr369(N) compared with control Our work has also established that PNGase-dependent deglyco- siRNA (Fig. 9B), indicating that these proteases are not involved in sylation to generate Tyr369(D) occurs on short epitope precursors ϩ the generation of Tyr369(N) form ER6 9N. In contrast, knock- that contain N-terminal extensions, but not on the minimal 9-mer down of either PSA or LAP increased the presentation of epitope. Furthermore, the extent of deamidation is not enhanced by ϩ Tyr369(N) from ER6 9N. This suggests that, rather than generate longer N-terminal extensions. The exact mechanism by which N- Tyr369(N), these proteases actually destroy the epitope. Knock- terminal extensions enable deamidation is not certain. Such pre- down of LAP and PSA also leads to an increase in Tyr369(D) from cursors have a greatly diminished ability to bind to the HLA- full-length tyrosinase (Fig. 9C). However, in contrast to what was A*0201, and will be susceptible to trimming in either ER or seen with ER6ϩ9N, knockdown of TOP and TPPII also led to an cytosol, glycosylation, and retrotranslocation. However, we have increase in presentation of Tyr369(D) from full-length tyrosinase shown that the efficiency of trimming in the ER is clearly depen- (Fig. 9C). These results demonstrate these proteases in the cytosol dent on the length of the precursor, suggesting that this does not destroy Tyr369 epitopes or epitope precursors before they are trans- determine the extent of deamidation. Interestingly, glycosylation ported by TAP for HLA-A*0201 binding. Thus, the cytosolic pro- has been shown to interfere with the processing of influenza NP Downloaded from ϩ tease necessary for the production of Tyr369(N) from ER6 9N epitope precursors in the ER (41). Therefore, an attractive model remains unidentified. for the processing of tyrosinase is one in which epitope precursors of different lengths are glycosylated to a similar extent, preventing Discussion their trimming and rendering the differences in their length irrel- In this paper, we have explored the requirements for generation of evant. This in turn renders them susceptible to retro-translocation a deamidated form of the Tyr369 epitope presented by HLA- into the cytosol for deamidation. In the context of this model, it has http://www.jimmunol.org/ A*0201. Previous data from our lab led to the hypothesis that this previously been shown that glycosylated Tyr369(N) binds to HLA- epitope was dependent on glycosylation of Asn371, retrotransloca- A*0201 in vivo (42). Thus, the failure of the minimal 9-mer tion of full-length tyrosinase into the cytosol for proteolysis and epitope to undergo deamidation is a consequence of its immediate deglycosylation, and finally TAP-dependent reentry into the ER binding to HLA-A*0201, independent of its glycosylation state, for MHC binding (2, 3). Subsequent studies have suggested the which prevents retrotranslocation and subsequent deglycosylation existence of deamidated epitopes from other proteins and proposed by PNGase. similar pathways (4, 5, 38). However, direct evidence of either Whereas cells expressing full-length tyrosinase present only deamidation or a responsible mechanism has been sparse (5, 6). Tyr369(D) (2, 3), cells expressing minigenes encoding epitope pre- Here, we provide the first direct demonstration that deamidation of cursors in either the ER or cytosol presented substantial and sim- by guest on September 28, 2021 371 Tyr369 is a result of deglycosylation of Asn in the cytosol by ilar levels of Tyr369(N). This suggests that glycosylation, albeit PNGase. PNGase has been established to mediate the deglycosy- inefficient, occurs primarily on small peptides located in the lumen lation of several misfolded membrane proteins in concert with of the ER after release from the translation apparatus or after TAP their degradation by the proteasome after retrotranslocation into transport. This may be due to the short length of the peptides such the cytosol. Our results further link this pathway of glycoprotein that they are cleaved from the signal sequence before the glyco- degradation to epitope generation. sylation machinery recognizes the glycosylation consensus motif. Given the above mechanism, a surprising result was that elim- The inefficient deamidation of these short precursors compared ination of the glycosylation consensus sequence in the Tyr369 with full-length proteins is a significant result to consider in the epitope did not completely eliminate deamidation. This suggests design of vaccines based on epitopes with the potential to undergo that a second pathway exists for deamidation. No enzymatic path- glycosylation and/or deamidation. In a similar vein, glycosylation- way for the deamidation of unglycosylated Asn has been described dependent deamidation of short precursors after TAP transport in mammals. However, spontaneous deamidation of Asn residues may alter the repertoire of epitopes generated from cytosolic pro- in aged or damaged proteins is common (39). It has also been teins that contain cryptic glycosylation consensus sequences. demonstrated that spontaneous deamidation is influenced by prox- In this paper, we have also examined the involvement of pro- imal residues, and a Gly residue to the C-terminal side of the target teases localized in the ER and the cytosol in the generation of

Asn promotes this process (40). Thus, we propose that the deami- Tyr369 epitopes. The ER-localized aminopeptidase ERAP1 has dated Tyr369 epitope that arises independent of glycosylation is been established to play an important role in N-terminal trimming due to a spontaneous deamidation process. A corollary of this hy- of precursors for multiple epitopes (17–19). This has led to a gen- pothesis is that spontaneously deamidated Asn residues should be eral model of class I MHC peptide processing that involves gen- represented in class I MHC-associated epitopes derived from a eration of the C terminus by the proteasome in the cytosol, fol- variety of proteins. Although such epitopes have not yet been de- lowed by TAP-mediated entry into the ER and ERAP1-mediated scribed in the literature, a more systematic investigation of this trimming (43). Here, we show that generation of Tyr369(N) and hypothesis is clearly warranted. Because spontaneous deamidation Tyr369(D) from small precursors or full-length tyrosinase is is not expected to be complete, it has the potential to yield greater ERAP1 dependent. However, ERAP1 also diminished presentation epitope diversity through the generation of both Asn- and Asp- of Tyr369(N) in cells expressing a minigene encoding the mature containing forms of the same peptide. In this context, cells infected epitope, demonstrating that it can also destroy this epitope in vivo. with LCMV present both deamidated and Asn-containing forms of Finally, we have demonstrated that the action of ERAP1 is depen- a GP1-derived epitope (6). Although the presence of the Asn form dent on the structure of the Tyr369 precursor, and the enzyme in- indicates that the full-length protein is not efficiently glycosylated, efficiently removes the His at the Ϫ2 position. It is possible that it is not clear whether the deamidated form arises from deglyco- this is due to the weakly basic nature of His, because it has been The Journal of Immunology 5449 shown that ERAP1 inefficiently removes some other basic residues 5. Selby, M., A. Erickson, C. Dong, S. Cooper, P. Parham, M. Houghton, and (21). C. M. Walker. 1999. Hepatitis C virus envelope glycoprotein E1 originates in the endoplasmic reticulum and requires cytoplasmic processing for presentation by In keeping with this inefficient action of ERAP1, our results also class I MHC molecules. J. Immunol. 162: 669–676. 6. Hudrisier, D., J. Riond, H. Mazarguil, M. B. Oldstone, and J. E. Gairin. 1999. establish that presentation of Tyr369(N) from ER-targeted precur- Genetically encoded and post-translationally modified forms of a major histo- sors containing two or six N-terminal residues requires processing compatibility complex class I-restricted antigen bearing a glycosylation motif are in the cytosol. Previous studies have suggested that several distinct independently processed and co-presented to cytotoxic T lymphocytes. J. Biol. cytosolically localized peptidases mediate N-terminal trimming of Chem. 274: 36274–36280. 7. Hirsch, C., D. Blom, and H. L. Ploegh. 2003. A role for N-glycanase in the precursors to generate epitopes in vitro (13, 22, 24), although the cytosolic turnover of glycoproteins. EMBO J. 22: 1036–1046. in vivo relevance of cytosolic peptidases in the N-terminal trim- 8. Joshi, S., S. Katiyar, and W. J. Lennarz. 2005. Misfolding of glycoproteins is a ming of epitope precursors has not previously been established. prerequisite for peptide: N-glycanase mediated deglycosylation. FEBS Lett. 579: 823–826. Here, we have shown that none of these previously identified pro- 9. Park, H., T. Suzuki, and W. J. Lennarz. 2001. Identification of proteins that teases are involved in the generation of Tyr369 from ER-targeted interact with mammalian peptide:N-glycanase and implicate this hydrolase in the precursors containing six N-terminal residues or from full-length proteasome-dependent pathway for protein degradation. Proc. Natl. Acad. Sci. USA 98: 11163–11168. tyrosinase. This is in agreement with the recent observation that 10. Suzuki, T., A. Seko, K. Kitajima, Y. Inoue, and S. Inoue. 1993. Identification of knockout mice lacking leucine aminopeptidase do not show any peptide:N-glycanase activity in mammalian-derived cultured cells. Biochem. Bio- significant alteration in the MHC class I processing pathway (23). phys. Res. Commun. 194: 1124–1130. 11. Craiu, A., T. Akopian, A. Goldberg, and K. L. Rock. 1997. Two distinct proteo- Thus, the cytosolic peptidase responsible for the N-terminal trim- lytic processes in the generation of a major histocompatibility complex class ming of these Tyr369(N) epitope precursors remains unclear. I-presented peptide. Proc. Natl. Acad. Sci. USA 94: 10850–10855.

Collectively, these data lead to a model in which precursors 12. Stoltze, L., T. P. Dick, M. Deeg, B. Pommerl, H. G. Rammensee, and H. Schild. Downloaded from 1998. Generation of the vesicular stomatitis virus nucleoprotein cytotoxic T lym- longer than 10 residues and localized in the ER are trimmed by phocyte epitope requires proteasome-dependent and -independent proteolytic ac- ERAP1, and then retrotranslocated to the cytosol for removal of tivities. Eur. J. Immunol. 28: 4029–4036. the His at the Ϫ2 position, and retransported back into the ER by 13. Mo, X. Y., P. Cascio, K. Lemerise, A. L. Goldberg, and K. L. Rock. 1999. Distinct proteolytic processes generate the C and N termini of MHC class I-bind- TAP. It has been shown elsewhere that TAP transports the 10-mer ing peptides. J. Immunol. 163: 5851–5859. precursor of Tyr369 much more efficiently than the mature 9-mer 14. Seifert, U., C. Maranon, A. Shmueli, J. F. Desoutter, L. Wesoloski, K. Janek, P. Henklein, S. Diescher, M. Andrieu, H. de la Salle, et al. 2003. An essential role epitope (44). Thus, ERAP1 may act a second time on the products http://www.jimmunol.org/ for tripeptidyl peptidase in the generation of an MHC class I epitope. Nat. Im- of cytosolic trimming. In the context of a cell expressing full- munol. 4: 375–379. length tyrosinase, this model would also apply for any precursors 15. Cascio, P., C. Hilton, A. F. Kisselev, K. L. Rock, and A. L. Goldberg. 2001. 26S longer than 10 residues that are transported by TAP after genera- proteasomes and immunoproteasomes produce mainly N-extended versions of an antigenic peptide. EMBO J. 20: 2357–2366. tion by the proteasome in the cytosol. This model is in keeping 16. Lucchiari-Hartz, M., P. M. van Endert, G. Lauvau, R. Maier, A. Meyerhans, with a previous demonstration of the recycling of longer peptides D. Mann, K. Eichmann, and G. Niedermann. 2000. Cytotoxic T lymphocyte epitopes of HIV-1 Nef: generation of multiple definitive major histocompatibility from ER to cytosol (45), but differs in that recycling is necessary complex class I ligands by proteasomes. J. Exp. Med. 191: 239–252. for epitope generation. It also differs from another model in which 17. York, I. A., S. C. Chang, T. Saric, J. A. Keys, J. M. Favreau, A. L. Goldberg, and a deficiency in ERAP1 activity was compensated by the activity of K. L. Rock. 2002. The ER aminopeptidase ERAP1 enhances or limits antigen

presentation by trimming epitopes to 8–9 residues. Nat. Immunol. 3: 1177–1184. by guest on September 28, 2021 ERAP2 (21). Whether this is due to a deficiency in ERAP2 ex- 18. Serwold, T., F. Gonzalez, J. Kim, R. Jacob, and N. Shastri. 2002. ERAAP cus- pression by DM331 cells, or an inactivity of ERAP2 toward this tomizes peptides for MHC class I molecules in the endoplasmic reticulum. Na- precursor, is currently unclear. ture 419: 480–483. 19. Saric, T., S. C. Chang, A. Hattori, I. A. York, S. Markant, K. L. Rock, In sum, we have provided new insights into mechanisms that M. Tsujimoto, and A. L. Goldberg. 2002. An IFN-␥-induced aminopeptidase in generate the HLA-A*0201-associated epitope Tyr369, and that are the ER, ERAP1, trims precursors to MHC class I-presented peptides. Nat. Im- likely to apply to a broad range of epitopes. These mechanisms munol. 3: 1169–1176. 20. Tanioka, T., A. Hattori, S. Masuda, Y. Nomura, H. Nakayama, S. Mizutani, and involve enzymatic activities in the cytosol that provide essential M. Tsujimoto. 2003. Human leukocyte-derived arginine aminopeptidase: the roles in the generation of class I MHC-associated epitopes. As third member of the oxytocinase subfamily of aminopeptidases. J. Biol. Chem. such, they should be properly considered elements of the class I 278: 32275–32283. 21. Saveanu, L., O. Carroll, V. Lindo, V. M. Del, D. Lopez, Y. Lepelletier, F. Greer, MHC processing and presentation pathway. L. Schomburg, D. Fruci, G. Niedermann, and P. M. van Endert. 2005. Concerted peptide trimming by human ERAP1 and ERAP2 aminopeptidase complexes in the endoplasmic reticulum. Nat. Immunol. 6: 689–697. Acknowledgments 22. Beninga, J., K. L. Rock, and A. L. Goldberg. 1998. Interferon-␥ can stimulate We thank Dr. Kenneth Rock for his generous gift of purified ERAP1. post-proteasomal trimming of the N terminus of an antigenic peptide by inducing leucine aminopeptidase. J. Biol. Chem. 273: 18734–18742. 23. Towne, C. F., I. A. York, J. Neijssen, M. L. Karow, A. J. Murphy, Disclosures D. M. Valenzuela, G. D. Yancopoulos, J. J. Neefjes, and K. L. Rock. 2005. The authors have no financial conflict of interest. Leucine aminopeptidase is not essential for trimming peptides in the cytosol or generating epitopes for MHC class I antigen presentation. J. Immunol. 175: 6605–6614. References 24. Stoltze, L., M. Schirle, G. Schwarz, C. Schroter, M. W. Thompson, L. B. Hersh, 1. Engelhard, V. H., A. G. Brickner, and A. L. Zarling. 2002. Insights into antigen H. Kalbacher, S. Stevanovic, H. G. Rammensee, and H. Schild. 2000. Two new processing gained by direct analysis of the naturally processed class I MHC proteases in the MHC class I processing pathway. Nat. Immunol. 1: 413–418. associated peptide repertoire. Mol. Immunol. 39: 127–137. 25. Wherry, E. J., T. N. Golovina, S. E. Morrison, G. Sinnathamby, 2. Skipper, J. C. A., R. C. Hendrickson, P. H. Gulden, V. Brichard, A. Van Pel, M. J. McElhaugh, D. C. Shockey, and L. C. Eisenlohr. 2006. Re-evaluating the Y. Chen, J. Shabanowitz, T. Wolfel, C. L. Slingluff, T. Boon, et al. 1996. An generation of a “proteasome-independent” MHC class I-restricted CD8 T cell HLA-A2 restricted tyrosinase antigen on melanoma cells results from post-trans- epitope. J. Immunol. 176: 2249–2261. lational modification and suggests a novel processing pathway for membrane 26. Valmori, D., U. Gileadi, C. Servis, P. R. Dunbar, J. C. Cerottini, P. Romero, proteins. J. Exp. Med. 183: 527–534. V. Cerundolo, and F. Levy. 1999. Modulation of proteasomal activity required 3. Mosse, C. A., L. Meadows, C. J. Luckey, D. J. Kittlesen, E. L. Huczko, for the generation of a cytotoxic T lymphocyte-defined peptide derived from the C. L. Slingluff, Jr., J. Shabanowitz, D. F. Hunt, and V. H. Engelhard. 1998. The tumor antigen MAGE-3. J. Exp. Med. 189: 895–906. class I antigen processing pathway for the membrane protein tyrosinase involves 27. Halaban, R., E. Cheng, and D. N. Hebert. 2002. Coexpression of wild-type ty- translation in the endoplasmic reticulum and processing in the cytosol. J. Exp. rosinase enhances maturation of temperature-sensitive tyrosinase mutants. J. In- Med. 187: 37–48. vest. Dermatol. 119: 481–488. 4. Ferris, R. L., C. Hall, N. V. Sipsas, J. T. Safrit, A. Trocha, R. A. Koup, 28. Ostankovitch, M., V. Robila, and V. H. Engelhard. 2005. Regulated folding of R. P. Johnson, and R. F. Siliciano. 1999. Processing of HIV-1 envelope glyco- tyrosinase in the endoplasmic reticulum demonstrates that misfolded full-length protein for class I-restricted recognition: dependence on TAP1/2 and mechanisms proteins are efficient substrates for class I processing and presentation. J. Immu- for cytosolic localization. J. Immunol. 162: 1324–1332. nol. 174: 2544–2551. 5450 ER AND CYTOSOL ACTIVITIES FORM TYROSINASE EPITOPE

29. Slingluff, C. L., T. A. Colella, L. Thompson, D. D. Graham, J. C. A. Skipper, 37. Saveanu, L., D. Fruci, and P. Van Endert. 2002. Beyond the proteasome: trim- J. A. Caldwell, L. Brinkerhoff, D. J. Kittlesen, D. H. Deacon, C. Oei, et al. 2000. ming, degradation and generation of MHC class I ligands by auxiliary proteases. Melanomas with concordant loss of multiple melanocytic differentiation proteins: Mol. Immunol. 39: 203–215. immune escape that may be overcome by targeting unique or undefined antigens. 38. Bacik, I., H. L. Snyder, L. C. Anton, G. Russ, W. Chen, J. R. Bennink, L. Urge, Cancer Immunol. Immunother. 48: 661–672. L. Otvos, B. Dudkowska, L. Eisenlohr, and J. W. Yewdell. 1997. Introduction of 30. Wang, W., S. Man, P. H. Gulden, D. F. Hunt, and V. H. Engelhard. 1998. Class a glycosylation site into a secreted protein provides evidence for an alternative I-restricted alloreactive cytotoxic T lymphocytes recognize a complex array of antigen processing pathway: transport of precursors of major histocompatability specific MHC-associated peptides. J. Immunol. 160: 1091–1097. complex class I-restricted peptides from the endoplasmic reticulum to the cytosol. J. Exp. Med. 186: 479–487. 31. Luckey, C. J., J. A. Marto, M. Partridge, E. Hall, F. M. White, J. D. Lippolis, 39. Weintraub, S. J., and S. R. Manson. 2004. Asparagine deamidation: a regulatory J. Shabanowitz, D. F. Hunt, and V. H. Engelhard. 2001. Differences in the ex- hourglass. Mech. Ageing Dev. 125: 255–257. pression of human class I MHC alleles and their associated peptides in the pres- 40. Tyler-Cross, R., and V. Schirch. 1991. Effects of amino acid sequence, buffers, ence of proteasome inhibitors. J. Immunol. 167: 1212–1221. and ionic strength on the rate and mechanism of deamidation of asparagine res- 32. Syka, J. E., J. A. Marto, D. L. Bai, S. Horning, M. W. Senko, J. C. Schwartz, idues in small peptides. J. Biol. Chem. 266: 22549–22556. B. Ueberheide, B. Garcia, S. Busby, T. Muratore, et al. 2004. Novel linear quad- 41. Wood, P., and T. Elliott. 1998. Glycan-regulated antigen processing of a protein rupole ion trap/FT mass spectrometer: performance characterization and use in in the endoplasmic reticulum can uncover cryptic cytotoxic T cell epitopes. the comparative analysis of histone H3 post-translational modifications. J. Exp. Med. 188: 773–778. J. Proteome Res. 3: 621–626. 42. Androlewicz, M. J. 1996. An N-glycosylated tyrosinase epitope associates with 33. Eng, J. K., A. L. McCormack, and J. R. Yates. 1994. An approach to correlate newly synthesized MHC class I molecules in melanoma cells. Hum. Immunol. 51: tandem mass spectral data of peptides with amino acid sequences in a protein 81–88. database. J. Am. Soc. Mass Spectrom. 5: 976–989. 43. Rock, K. L., I. A. York, and A. L. Goldberg. 2004. Post-proteasomal antigen processing for major histocompatibility complex class I presentation. Nat. Im- 34. Garcia-Calvo, M., E. P. Peterson, B. Leiting, R. Ruel, D. W. Nicholson, and munol. 5: 670–677. N. A. Thornberry. 1998. Inhibition of human caspases by peptide-based and 44. Wang, Y., D. S. Guttoh, and M. J. Androlewicz. 1998. TAP prefers to transport macromolecular inhibitors. J. Biol. Chem. 273: 32608–32613. melanoma antigenic peptides which are longer than the optimal T-cell epitope: 35. Misaghi, S., M. E. Pacold, D. Blom, H. L. Ploegh, and G. A. Korbel. 2004. Using evidence for further processing in the endoplasmic reticulum. Melonoma Res. 8: Downloaded from a small molecule inhibitor of peptide: N-glycanase to probe its role in glycopro- 345–353. tein turnover. Chem. Biol. 11: 1677–1687. 45. Roelse, J., M. Gromme, F. Momburg, G. Hammerling, and J. Neefjes. 1994. 36. Bause, E. 1984. Model studies on N-glycosylation of proteins. Biochem. Soc. Trimming of TAP-translocated peptides in the endoplasmic reticulum and in the Trans. 12: 514–517. cytosol during recycling. J. Exp. Med. 180: 1591–1597. http://www.jimmunol.org/ by guest on September 28, 2021