Antonie van Leeuwenhoek (2016) 109:273–285 DOI 10.1007/s10482-015-0630-0 ORIGINAL PAPER Tenacibaculum finnmarkense sp. nov., a fish pathogenic bacterium of the family Flavobacteriaceae isolated from Atlantic salmon Sverre Bang Sma˚ge . Øyvind Jakobsen Brevik . Henrik Duesund . Karl Fredrik Ottem . Kuninori Watanabe . Are Nylund Received: 24 August 2015 / Accepted: 1 December 2015 / Published online: 11 December 2015 Ó The Author(s) 2015. This article is published with open access at Springerlink.com Abstract A novel Gram-stain negative, aerobic, non- performed with the phylogenetically closely related type flagellated, rod-shaped gliding bacterial strain, desig- strains, T. dicentrarchi NCIMB 14598T and Tenacibac- nated HFJT, was isolated from a skin lesion of a diseased ulum ovolyticum NCIMB 13127T. These data, as well as Atlantic salmon (Salmo salar L.) in Finnmark, Norway. phylogenetic analyses, suggest that strain HFJT should be Colonies were observed to be yellow pigmented with classified as a representative of a novel species in the entire and/or undulating margins and did not adhere to genus Tenacibaculum, for which the name Tenacibac- the agar. The 16S rRNA gene sequence showed that the ulum finnmarkense sp. nov. is proposed; the type strain is strain belongs to the genus Tenacibaculum (family HFJ T = (DSM 28541T = NCIMB 42386T). Flavobacteriaceae, phylum ‘Bacteroidetes’). Strain HFJT exhibits high 16S rRNA gene sequence similarity Keywords Norway Á Polyphasic taxonomy Á Salmon values to Tenacibaculum dicentrarchi NCIMB 14598T farming Á Skin lesions Á Ulcerative disease Á Winter (97.2%).Thestrainwasfoundtogrowat2–20°Cand ulcers only in the presence of sea salts. The respiratory quinone was identified as menaquinone 6 and the major fatty acids were identified as summed feature 3 (comprising C16:1 x7c and/or iso-C15:0 2-OH), iso-C15:0,anteiso-C15:0, iso- Introduction C15:1 and iso-C15:0 3-OH. The DNA G?C content was determined to be 34.1 mol%. DNA–DNA hybridization During an outbreak of an ulcerative disease in Atlantic and comparative phenotypic and genetic tests were salmon at a seawater site in Finnmark, Norway, long rod shaped bacteria were found to predominate in the skin lesions. One strain of these isolates designated T S. B. Sma˚ge (&) Á K. Watanabe Á A. Nylund HFJ is described in the present study. The 16S rRNA Fish Disease Research Group, Department of Biology, gene sequence showed that it belongs to the genus University of Bergen, Thormøhlensgt 55, Bergen 5020, Tenacibaculum (family Flavobacteriaceae,phylum Norway ‘Bacteroidetes’) described by Suzuki et al. (2001). To e-mail: [email protected] date the genus comprises 21 species derived from a S. B. Sma˚ge Á Ø. J. Brevik Á H. Duesund variety of marine environments and marine organisms Cermaq Group AS, Dronning Eufemias Gate 16, (Kim et al. 2013; LPSN 2015). Several of the type Oslo 0191, Norway strains in genus Tenacibaculum have been reported as K. F. Ottem pathogenic for fish or associated with disease in Cermaq Norway, Gjerbakknes, Nordfold 8286, Norway cultured marine fish (Wakabayashi et al. 1986; Hansen 123 274 Antonie van Leeuwenhoek (2016) 109:273–285 et al. 1992;Pin˜eiro-Vidal et al. 2008a, b;Lo´pez et al. diseased Atlantic salmon at a seawater site in Finn- 2010;Pin˜eiro-Vidal et al. 2012). Tenacibaculum mar- mark, Norway. Tenacibaculum sp. strains Tsp. 2–7 itimum, the causative agent of marine tenacibaculosis, were collected from skin or gill of Atlantic salmon and is the best known and most extensively studied fish cod in Norway. The type strains Tenacibaculum pathogenic bacterium in the genus (Wakabayashi et al. dicentrarchi NCIMB 14598T, Tenacibaculum ovoly- 1986;Suzukietal.2001). The disease has been reported ticum NCIMB 13127T, Tenacibaculum soleae from Europe, Japan, North America and Australia and NCIMB 14368T and T. maritimum NCIMB 2154T affects both wild and cultured fish, including Rainbow were obtained from The National Collection of trout and Atlantic salmon (Toranzo et al. 2005; Industrial, Marine and Food Bacteria (NCIMB). Avendan˜o-Herrera et al. 2006; Bruno et al. 2013). T. Subcultivation was performed on Marine agar (MA) maritimum has never been isolated in cases of ulcer- (Difco 2216) plates at 16 °C for 48 h. The strains were ative disease in Norway (Olsen et al. 2011). preserved in CryoTubeTM vials (Thermo scientific) at There has been a growing attention regarding the -80 °C. potential role of Norwegian Tenacibaculum spp. in Draft genome sequencing of strain HFJT was causing ulcerative disease in sea-reared Atlantic carried out by BaseClear B.V (Leiden, The Nether- salmon, as they are commonly identified from skin lands.) using Illumina next generation sequencing on a lesion in mixed cultures with the bacterium Moritella HiSeq 2500TM platform. Extraction of the required viscosa or as the apparent sole agent (Olsen et al. 2011; concentration ([100 ng/ll) of genomic DNA was Bornø and Lie 2015). The aim of the present study was performed using an E.Z.N.A. tissue DNA kitTM to determine the taxonomic position of the fish (Omega Bio-Tek) following the cultured cells proto- pathogenic Tenacibaculum strain HFJT using genetic, col. The draft genome sequence obtained for strain phenotypic and chemotaxonomic characterisations, a HFJT was used for the PCR primer design using detailed phylogenetic investigation based on 16S rRNA primer-BLAST (Ye et al. 2012) and to verify obtained gene sequences and concatenated housekeeping (HK) sequences for strain HFJT. gene sequences, and DNA–DNA hybridization (DDH). Genomic DNA from all Tenacibaculum sp. strains listed in Table 1 was extracted using an E.Z.N.A. tissue DNA kitTM (Omega Bio-Tek) following the Materials and methods cultured cells protocol. PCR was performed using the 16S rRNA primers 27F and 1518R (Giovannoni et al. A total of 11 isolates from genus Tenacibaculum were 1996) and specific primers for five HK genes (atpD, included in the present study (Table 1). Strain HFJT fusA, pgk, rpoB, and tuf) (Table 2). Amplification was was isolated in spring 2013 from a skin lesion of a based on a standard reaction mixture containing 2.5 ll Table 1 List of Tenacibaculum strains included in the present study Bacterial species Strain Origin Host Tissue Year Tenacibaculum sp. HFJT Norway Atlantic salmon Skin 2013 Tenacibaculum sp. Tsp.2 Norway Atlantic salmon Skin 2013 Tenacibaculum sp. Tsp.3 Norway Atlantic salmon Gill 2014 Tenacibaculum sp. Tsp.4 Norway Atlantic salmon Skin 2013 Tenacibaculum sp. Tsp.5 Norway Atlantic salmon Skin 2014 Tenacibaculum sp. Tsp.6 Norway Atlantic salmon Skin 2009 Tenacibaculum sp. Tsp.7 Norway Farmed Atlantic cod Skin 2009 Tenacibaculum maritimum NCIMB 2154T Japan Red sea bream fingerling Kidney 1977 Tenacibaculum soleae NCIMB 14368T Spain Senegalese sole Unknown 2007 Tenacibaculum ovolyticum NCIMB 13127T Norway Atlantic halibut eggs Eggs 1989 Tenacibaculum dicentrarchi NCIMB 14598T Spain European sea bass Skin 2009 The Tenacibaculum sp. strains were collected from Norwegian field cases, whereas the type strains were obtained from NCIMB 123 Antonie van Leeuwenhoek (2016) 109:273–285 275 Table 2 List of PCR Target gene Name Sequence (50–30) Source primers used in present study 16S rRNA B27F AGAGTTTGATCMTGGCTCAG Giovannoni et al. (1996) 16S rRNA A1518R AAGGAGGTGATCCANCCRCA Giovannoni et al. (1996) tuf Tb_tuf F1 ACCTCCTTCACGGATAGC Present study tuf Tb_tuf R1 TTACGATCGTTCGAAGCCCC Present study rpoB Tb_rpoB F1 ATYTCTCCAAAACGCTGACC Present study rpoB Tb_rpoB R1 AAAACGAATCAAGGWACGAAYA Present study rpoB Tb_rpoB F2 ACCCTTTCCAAGGCATAAAGG Present study rpoB Tb_rpoB R2 GAGCCATYGGTTTTGAAAGAGA Present study rpoB Tb_rpoB F3 CTCTTGCTGTCTCCTCATCTG Present study rpoB Tb_rpoB R3 ATCCACCAAGATATAGCATCCA Present study pgk Tb_pgk F1 GCTCCWCCACCWGTAGAAAC Present study pgk Tb_pgk R1 TYCGTGTAGATTTTAATGTGCCT Present study atpD Tb_atpD F1 TGGYCCAGTWATCGATGTTGA Present study atpD Tb_atpD R1 AATACGYTCTTGCATTGCTC Present study fusA Tb_fusA F1 ATGGTAACTCACCCATTCCAGA Present study fusA Tb_fusA R1 TGGCATGATGCAACACAAGG Present study Extra buffer, 1.25 mM deoxyribonucleotide triphos- was used to assemble and align the obtained phates, 0.75 units (0.15 lL) Taq DNA polymerase sequences. (BioLabs, New England), 5 lM(1lL) of forward and Three alignments were constructed for phyloge- reverse primers; DNase-RNase free water was added netic analysis. The first, 16S rRNA gene sequence to a final volume of 25 lL (16.85 lLH2O). Ampli- alignment, consisted of 1341 positions and included fication was performed in a GeneAmp PCR system sequences of HFJT and the 21 published type strains in 2700 (Applied Biosystems) at 95 °C for 5 min; 35 the genus Tenacibaculum. In this alignment, all cycles of 95 °C for 30 s, 58 °C for 30 s, 72 °C for sequences were obtained from GenBank with the 60-100 s, followed by 72 °C for 10 min. The PCR exception of strain HFJT, T. dicentrarchi NCIMB product was confirmed by gel electrophoresis and 14598T, T. ovolyticum NCIMB 13127T, T. soleae enzymatically purified using ExoStar 1-Step Ò (GE NCIMB 14368T and T. maritimum NCIMB 2154T. Healthcare Bio-Sciences Corp) in an Artik Thermal The second 16S rRNA gene sequence alignment of Cycler (Thermo Scientific) at 37 °C for 15 min and at 1349 positions contained sequences from all strains 80 °C for 15 min. The sequencing reaction was listed in Table 1. A third alignment, of 6750 positions, performed using a BigDyeÒ version 3.1 reaction in was constructed using concatenated sequences of the an Arktik Thermal Cycler, at 96 °C for 5 min; 30 five HK genes of the strains listed in Table 1; atpD at cycles of 96 °C for 10 s, 58 °C for 5 s and 60 °C for position 1-807, fusA at position 808–1575, pgk at 4 min. The reaction was composed of a mixture of position 1576–2511, rpoB at position 2512–5778 and 5.5 lL deionized water, 1 lL BigDyeÒ Terminator tuf at position 5779–6750. All sequences obtained in 3.1 version sequencing buffer, 1 lL BigDye Termi- the present study are available in GenBank with nator 3.1 version Ready Reaction Premix (2.5X) accession numbers presented in Table 3.