DOCSLIB.ORG

Tenacibaculum Finnmarkense Sp. Nov., a Fish Pathogenic Bacterium Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Tenacibaculum Finnmarkense Sp. Nov., a Fish Pathogenic Bacterium Of Antonie van Leeuwenhoek (2016) 109:273–285 DOI 10.1007/s10482-015-0630-0 ORIGINAL PAPER Tenacibaculum finnmarkense sp. nov., a fish pathogenic bacterium of the family Flavobacteriaceae isolated from Atlantic salmon Sverre Bang Sma˚ge . Øyvind Jakobsen Brevik . Henrik Duesund . Karl Fredrik Ottem . Kuninori Watanabe . Are Nylund Received: 24 August 2015 / Accepted: 1 December 2015 / Published online: 11 December 2015 Ó The Author(s) 2015. This article is published with open access at Springerlink.com Abstract A novel Gram-stain negative, aerobic, non- performed with the phylogenetically closely related type flagellated, rod-shaped gliding bacterial strain, desig- strains, T. dicentrarchi NCIMB 14598T and Tenacibac- nated HFJT, was isolated from a skin lesion of a diseased ulum ovolyticum NCIMB 13127T. These data, as well as Atlantic salmon (Salmo salar L.) in Finnmark, Norway. phylogenetic analyses, suggest that strain HFJT should be Colonies were observed to be yellow pigmented with classified as a representative of a novel species in the entire and/or undulating margins and did not adhere to genus Tenacibaculum, for which the name Tenacibac- the agar. The 16S rRNA gene sequence showed that the ulum finnmarkense sp. nov. is proposed; the type strain is strain belongs to the genus Tenacibaculum (family HFJ T = (DSM 28541T = NCIMB 42386T). Flavobacteriaceae, phylum ‘Bacteroidetes’). Strain HFJT exhibits high 16S rRNA gene sequence similarity Keywords Norway Á Polyphasic taxonomy Á Salmon values to Tenacibaculum dicentrarchi NCIMB 14598T farming Á Skin lesions Á Ulcerative disease Á Winter (97.2%).Thestrainwasfoundtogrowat2–20°Cand ulcers only in the presence of sea salts. The respiratory quinone was identified as menaquinone 6 and the major fatty acids were identified as summed feature 3 (comprising C16:1 x7c and/or iso-C15:0 2-OH), iso-C15:0,anteiso-C15:0, iso- Introduction C15:1 and iso-C15:0 3-OH. The DNA G?C content was determined to be 34.1 mol%. DNA–DNA hybridization During an outbreak of an ulcerative disease in Atlantic and comparative phenotypic and genetic tests were salmon at a seawater site in Finnmark, Norway, long rod shaped bacteria were found to predominate in the skin lesions. One strain of these isolates designated T S. B. Sma˚ge (&) Á K. Watanabe Á A. Nylund HFJ is described in the present study. The 16S rRNA Fish Disease Research Group, Department of Biology, gene sequence showed that it belongs to the genus University of Bergen, Thormøhlensgt 55, Bergen 5020, Tenacibaculum (family Flavobacteriaceae,phylum Norway ‘Bacteroidetes’) described by Suzuki et al. (2001). To e-mail: [email protected] date the genus comprises 21 species derived from a S. B. Sma˚ge Á Ø. J. Brevik Á H. Duesund variety of marine environments and marine organisms Cermaq Group AS, Dronning Eufemias Gate 16, (Kim et al. 2013; LPSN 2015). Several of the type Oslo 0191, Norway strains in genus Tenacibaculum have been reported as K. F. Ottem pathogenic for fish or associated with disease in Cermaq Norway, Gjerbakknes, Nordfold 8286, Norway cultured marine fish (Wakabayashi et al. 1986; Hansen 123 274 Antonie van Leeuwenhoek (2016) 109:273–285 et al. 1992;Pin˜eiro-Vidal et al. 2008a, b;Lo´pez et al. diseased Atlantic salmon at a seawater site in Finn- 2010;Pin˜eiro-Vidal et al. 2012). Tenacibaculum mar- mark, Norway. Tenacibaculum sp. strains Tsp. 2–7 itimum, the causative agent of marine tenacibaculosis, were collected from skin or gill of Atlantic salmon and is the best known and most extensively studied fish cod in Norway. The type strains Tenacibaculum pathogenic bacterium in the genus (Wakabayashi et al. dicentrarchi NCIMB 14598T, Tenacibaculum ovoly- 1986;Suzukietal.2001). The disease has been reported ticum NCIMB 13127T, Tenacibaculum soleae from Europe, Japan, North America and Australia and NCIMB 14368T and T. maritimum NCIMB 2154T affects both wild and cultured fish, including Rainbow were obtained from The National Collection of trout and Atlantic salmon (Toranzo et al. 2005; Industrial, Marine and Food Bacteria (NCIMB). Avendan˜o-Herrera et al. 2006; Bruno et al. 2013). T. Subcultivation was performed on Marine agar (MA) maritimum has never been isolated in cases of ulcer- (Difco 2216) plates at 16 °C for 48 h. The strains were ative disease in Norway (Olsen et al. 2011). preserved in CryoTubeTM vials (Thermo scientific) at There has been a growing attention regarding the -80 °C. potential role of Norwegian Tenacibaculum spp. in Draft genome sequencing of strain HFJT was causing ulcerative disease in sea-reared Atlantic carried out by BaseClear B.V (Leiden, The Nether- salmon, as they are commonly identified from skin lands.) using Illumina next generation sequencing on a lesion in mixed cultures with the bacterium Moritella HiSeq 2500TM platform. Extraction of the required viscosa or as the apparent sole agent (Olsen et al. 2011; concentration ([100 ng/ll) of genomic DNA was Bornø and Lie 2015). The aim of the present study was performed using an E.Z.N.A. tissue DNA kitTM to determine the taxonomic position of the fish (Omega Bio-Tek) following the cultured cells proto- pathogenic Tenacibaculum strain HFJT using genetic, col. The draft genome sequence obtained for strain phenotypic and chemotaxonomic characterisations, a HFJT was used for the PCR primer design using detailed phylogenetic investigation based on 16S rRNA primer-BLAST (Ye et al. 2012) and to verify obtained gene sequences and concatenated housekeeping (HK) sequences for strain HFJT. gene sequences, and DNA–DNA hybridization (DDH). Genomic DNA from all Tenacibaculum sp. strains listed in Table 1 was extracted using an E.Z.N.A. tissue DNA kitTM (Omega Bio-Tek) following the Materials and methods cultured cells protocol. PCR was performed using the 16S rRNA primers 27F and 1518R (Giovannoni et al. A total of 11 isolates from genus Tenacibaculum were 1996) and specific primers for five HK genes (atpD, included in the present study (Table 1). Strain HFJT fusA, pgk, rpoB, and tuf) (Table 2). Amplification was was isolated in spring 2013 from a skin lesion of a based on a standard reaction mixture containing 2.5 ll Table 1 List of Tenacibaculum strains included in the present study Bacterial species Strain Origin Host Tissue Year Tenacibaculum sp. HFJT Norway Atlantic salmon Skin 2013 Tenacibaculum sp. Tsp.2 Norway Atlantic salmon Skin 2013 Tenacibaculum sp. Tsp.3 Norway Atlantic salmon Gill 2014 Tenacibaculum sp. Tsp.4 Norway Atlantic salmon Skin 2013 Tenacibaculum sp. Tsp.5 Norway Atlantic salmon Skin 2014 Tenacibaculum sp. Tsp.6 Norway Atlantic salmon Skin 2009 Tenacibaculum sp. Tsp.7 Norway Farmed Atlantic cod Skin 2009 Tenacibaculum maritimum NCIMB 2154T Japan Red sea bream fingerling Kidney 1977 Tenacibaculum soleae NCIMB 14368T Spain Senegalese sole Unknown 2007 Tenacibaculum ovolyticum NCIMB 13127T Norway Atlantic halibut eggs Eggs 1989 Tenacibaculum dicentrarchi NCIMB 14598T Spain European sea bass Skin 2009 The Tenacibaculum sp. strains were collected from Norwegian field cases, whereas the type strains were obtained from NCIMB 123 Antonie van Leeuwenhoek (2016) 109:273–285 275 Table 2 List of PCR Target gene Name Sequence (50–30) Source primers used in present study 16S rRNA B27F AGAGTTTGATCMTGGCTCAG Giovannoni et al. (1996) 16S rRNA A1518R AAGGAGGTGATCCANCCRCA Giovannoni et al. (1996) tuf Tb_tuf F1 ACCTCCTTCACGGATAGC Present study tuf Tb_tuf R1 TTACGATCGTTCGAAGCCCC Present study rpoB Tb_rpoB F1 ATYTCTCCAAAACGCTGACC Present study rpoB Tb_rpoB R1 AAAACGAATCAAGGWACGAAYA Present study rpoB Tb_rpoB F2 ACCCTTTCCAAGGCATAAAGG Present study rpoB Tb_rpoB R2 GAGCCATYGGTTTTGAAAGAGA Present study rpoB Tb_rpoB F3 CTCTTGCTGTCTCCTCATCTG Present study rpoB Tb_rpoB R3 ATCCACCAAGATATAGCATCCA Present study pgk Tb_pgk F1 GCTCCWCCACCWGTAGAAAC Present study pgk Tb_pgk R1 TYCGTGTAGATTTTAATGTGCCT Present study atpD Tb_atpD F1 TGGYCCAGTWATCGATGTTGA Present study atpD Tb_atpD R1 AATACGYTCTTGCATTGCTC Present study fusA Tb_fusA F1 ATGGTAACTCACCCATTCCAGA Present study fusA Tb_fusA R1 TGGCATGATGCAACACAAGG Present study Extra buffer, 1.25 mM deoxyribonucleotide triphos- was used to assemble and align the obtained phates, 0.75 units (0.15 lL) Taq DNA polymerase sequences. (BioLabs, New England), 5 lM(1lL) of forward and Three alignments were constructed for phyloge- reverse primers; DNase-RNase free water was added netic analysis. The first, 16S rRNA gene sequence to a final volume of 25 lL (16.85 lLH2O). Ampli- alignment, consisted of 1341 positions and included fication was performed in a GeneAmp PCR system sequences of HFJT and the 21 published type strains in 2700 (Applied Biosystems) at 95 °C for 5 min; 35 the genus Tenacibaculum. In this alignment, all cycles of 95 °C for 30 s, 58 °C for 30 s, 72 °C for sequences were obtained from GenBank with the 60-100 s, followed by 72 °C for 10 min. The PCR exception of strain HFJT, T. dicentrarchi NCIMB product was confirmed by gel electrophoresis and 14598T, T. ovolyticum NCIMB 13127T, T. soleae enzymatically purified using ExoStar 1-Step Ò (GE NCIMB 14368T and T. maritimum NCIMB 2154T. Healthcare Bio-Sciences Corp) in an Artik Thermal The second 16S rRNA gene sequence alignment of Cycler (Thermo Scientific) at 37 °C for 15 min and at 1349 positions contained sequences from all strains 80 °C for 15 min. The sequencing reaction was listed in Table 1. A third alignment, of 6750 positions, performed using a BigDyeÒ version 3.1 reaction in was constructed using concatenated sequences of the an Arktik Thermal Cycler, at 96 °C for 5 min; 30 five HK genes of the strains listed in Table 1; atpD at cycles of 96 °C for 10 s, 58 °C for 5 s and 60 °C for position 1-807, fusA at position 808–1575, pgk at 4 min. The reaction was composed of a mixture of position 1576–2511, rpoB at position 2512–5778 and 5.5 lL deionized water, 1 lL BigDyeÒ Terminator tuf at position 5779–6750. All sequences obtained in 3.1 version sequencing buffer, 1 lL BigDye Termi- the present study are available in GenBank with nator 3.1 version Ready Reaction Premix (2.5X) accession numbers presented in Table 3.
Load more

Recommended publications
  • Eelgrass Sediment Microbiome As a Nitrous Oxide Sink in Brackish Lake Akkeshi, Japan
    Microbes Environ. Vol. 34, No. 1, 13-22, 2019 https://www.jstage.jst.go.jp/browse/jsme2 doi:10.1264/jsme2.ME18103 Eelgrass Sediment Microbiome as a Nitrous Oxide Sink in Brackish Lake Akkeshi, Japan TATSUNORI NAKAGAWA1*, YUKI TSUCHIYA1, SHINGO UEDA1, MANABU FUKUI2, and REIJI TAKAHASHI1 1College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa, 252–0880, Japan; and 2Institute of Low Temperature Science, Hokkaido University, Kita-19, Nishi-8, Kita-ku, Sapporo, 060–0819, Japan (Received July 16, 2018—Accepted October 22, 2018—Published online December 1, 2018) Nitrous oxide (N2O) is a powerful greenhouse gas; however, limited information is currently available on the microbiomes involved in its sink and source in seagrass meadow sediments. Using laboratory incubations, a quantitative PCR (qPCR) analysis of N2O reductase (nosZ) and ammonia monooxygenase subunit A (amoA) genes, and a metagenome analysis based on the nosZ gene, we investigated the abundance of N2O-reducing microorganisms and ammonia-oxidizing prokaryotes as well as the community compositions of N2O-reducing microorganisms in in situ and cultivated sediments in the non-eelgrass and eelgrass zones of Lake Akkeshi, Japan. Laboratory incubations showed that N2O was reduced by eelgrass sediments and emitted by non-eelgrass sediments. qPCR analyses revealed that the abundance of nosZ gene clade II in both sediments before and after the incubation as higher in the eelgrass zone than in the non-eelgrass zone. In contrast, the abundance of ammonia-oxidizing archaeal amoA genes increased after incubations in the non-eelgrass zone only. Metagenome analyses of nosZ genes revealed that the lineages Dechloromonas-Magnetospirillum-Thiocapsa and Bacteroidetes (Flavobacteriia) within nosZ gene clade II were the main populations in the N2O-reducing microbiome in the in situ sediments of eelgrass zones.
    [Show full text]
  • Host-Parasite Interaction of Atlantic Salmon (Salmo Salar) and the Ectoparasite Neoparamoeba Perurans in Amoebic Gill Disease
    ORIGINAL RESEARCH published: 31 May 2021 doi: 10.3389/fimmu.2021.672700 Host-Parasite Interaction of Atlantic salmon (Salmo salar) and the Ectoparasite Neoparamoeba perurans in Amoebic Gill Disease † Natasha A. Botwright 1*, Amin R. Mohamed 1 , Joel Slinger 2, Paula C. Lima 1 and James W. Wynne 3 1 Livestock and Aquaculture, CSIRO Agriculture and Food, St Lucia, QLD, Australia, 2 Livestock and Aquaculture, CSIRO Agriculture and Food, Woorim, QLD, Australia, 3 Livestock and Aquaculture, CSIRO Agriculture and Food, Hobart, TAS, Australia Marine farmed Atlantic salmon (Salmo salar) are susceptible to recurrent amoebic gill disease Edited by: (AGD) caused by the ectoparasite Neoparamoeba perurans over the growout production Samuel A. M. Martin, University of Aberdeen, cycle. The parasite elicits a highly localized response within the gill epithelium resulting in United Kingdom multifocal mucoid patches at the site of parasite attachment. This host-parasite response Reviewed by: drives a complex immune reaction, which remains poorly understood. To generate a model Diego Robledo, for host-parasite interaction during pathogenesis of AGD in Atlantic salmon the local (gill) and University of Edinburgh, United Kingdom systemic transcriptomic response in the host, and the parasite during AGD pathogenesis was Maria K. Dahle, explored. A dual RNA-seq approach together with differential gene expression and system- Norwegian Veterinary Institute (NVI), Norway wide statistical analyses of gene and transcription factor networks was employed. A multi- *Correspondence: tissue transcriptomic data set was generated from the gill (including both lesioned and non- Natasha A. Botwright lesioned tissue), head kidney and spleen tissues naïve and AGD-affected Atlantic salmon [email protected] sourced from an in vivo AGD challenge trial.
    [Show full text]
  • Technical Report: an Overview of Emerging Diseases in the Salmonid
    TECHNICAL REPORT An overview of emerging diseases in the salmonid farming industry Disclaimer: This report is provided for information purposes only. Readers/users should consult with qualified veterinary professionals/ fish health specialists to review, assess and adopt practices that are appropriate in their own operations, practices and location. Cover Photo: Ole Bendik Dale. 32 Foreword Dear reader, as well as internationally by rapidly spreading through trans- Although we are still early in any domestication process, boundary trade and other activities. salmon is a relatively easy species to hold and grow in tanks and cages. Intense research to develop breeding programs, In this report we highlight and discuss six important diseases feed formulae and techniques, and technology to handle large or health challenges affecting farmed salmon. We have animal populations efficiently and cost-effectively, are all parts identified them as emerging as there is new knowledge on of making Atlantic salmon farming likely the most industrialized agent dynamics, they re-occur or they are well described in one of all aquaculture productions today. Consequently, salmon region and may well become a threat to other regions with the farming is an important primary sector of the economy in same type of production. producing countries; according to Kontali Analyse¹, global production of Atlantic salmon exceeded 2.3 million tons in 2017 Knowledge sharing on salmonid production, fish health and and today salmon is a highly asked-for seafood commodity emerging diseases has become a key prime awareness with worldwide. dedicated resource and focus from the farming industry through groups such as the Global Salmon Initiative (GSI).
    [Show full text]
  • Tenacibaculum Maritimum, Causal Agent of Tenacibaculosis in Marine Fish
    # 70 JANUARY 2019 Tenacibaculum maritimum, causal agent of tenacibaculosis in marine fish ICES IDENTIFICATION LEAFLETS FOR DISEASES AND PARASITES IN FISH AND SHELLFISH ICES INTERNATIONAL COUNCIL FOR THE EXPLORATION OF THE SEA CIEM CONSEIL INTERNATIONAL POUR L’EXPLORATION DE LA MER ICES IDENTIFICATION LEAFLETS FOR DISEASES AND PARASITES OF FISH AND SHELLFISH NO. 70 JANUARY 2019 Tenacibaculum maritimum, causal agent of tenacibaculosis in marine fish Original by Y. Santos, F. Pazos and J. L. Barja (No. 55) Revised by Simon R. M. Jones and Lone Madsen International Council for the Exploration of the Sea Conseil International pour l’Exploration de la Mer H. C. Andersens Boulevard 44–46 DK-1553 Copenhagen V Denmark Telephone (+45) 33 38 67 00 Telefax (+45) 33 93 42 15 www.ices.dk [email protected] Recommended format for purposes of citation: ICES 2019. Tenacibaculum maritimum, causal agent of tenacibaculosis in marine fish. Orig- inal by Santos Y., F. Pazos and J. L. Barja (No. 55), Revised by Simon R. M. Jones and Lone Madsen. ICES Identification Leaflets for Diseases and Parasites of Fish and Shell- fish. No. 70. 5 pp. http://doi.org/10.17895/ices.pub.4681 Series Editor: Neil Ruane. Prepared under the auspices of the ICES Working Group on Pathology and Diseases of Marine Organisms. The material in this report may be reused for non-commercial purposes using the rec- ommended citation. ICES may only grant usage rights of information, data, images, graphs, etc. of which it has ownership. For other third-party material cited in this re- port, you must contact the original copyright holder for permission.
    [Show full text]
  • First Isolation of Virulent Tenacibaculum Maritimum Strains
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.15.435441; this version posted March 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 First isolation of virulent Tenacibaculum maritimum 2 strains from diseased orbicular batfish (Platax orbicularis) 3 farmed in Tahiti Island 4 Pierre Lopez 1¶, Denis Saulnier 1¶*, Shital Swarup-Gaucher 2, Rarahu David 2, Christophe Lau 2, 5 Revahere Taputuarai 2, Corinne Belliard 1, Caline Basset 1, Victor Labrune 1, Arnaud Marie 3, Jean 6 François Bernardet 4, Eric Duchaud 4 7 8 9 1 Ifremer, IRD, Institut Louis‐Malardé, Univ Polynésie française, EIO, Labex Corail, F‐98719 10 Taravao, Tahiti, Polynésie française, France 11 2 DRM, Direction des ressources marines, Fare Ute Immeuble Le caill, BP 20 – 98713 Papeete, Tahiti, 12 Polynésie française 13 3 Labofarm Finalab Veterinary Laboratory Group, 4 rue Théodore Botrel, 22600 Loudéac, France 14 4 Unité VIM, INRAE, Université Paris-Saclay, 78350 Jouy-en-Josas, France 15 * Corresponding author 16 E-mail: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.15.435441; this version posted March 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 17 Abstract 18 The orbicular batfish (Platax orbicularis), also called 'Paraha peue' in Tahitian, is the most important 19 marine fish species reared in French Polynesia.
    [Show full text]
  • Full Article in Pdf Format
    DISEASES OF AQUATIC ORGANISMS Vol. 58: 1–8, 2004 Published January 28 Dis Aquat Org Phenotyphic characterization and description of two major O-serotypes in Tenacibaculum maritimum strains from marine fishes Ruben Avendaño-Herrera, Beatriz Magariños, Sonia López-Romalde, Jesús L. Romalde, Alicia E. Toranzo* Departamento de Microbiología y Parasitología, Facultad de Biología, Universidad de Santiago, 15782 Santiago de Compostela, Spain ABSTRACT: Tenacibaculum maritimum is the etiological agent of marine flexibacteriosis disease, with the potential to cause severe mortalities in various cultured marine fishes. The development of effective preventive measures (i.e. vaccination) requires biochemical, serological and genetic knowl- edge of the pathogen. With this aim, the biochemical and antigenic characteristics of T. maritimum strains isolated from sole, turbot and gilthead sea bream were analysed. Rabbit antisera were pre- pared against sole and turbot strains to examine the antigenic relationships between the 29 isolates and 3 reference strains. The results of the slide agglutination test, dot-blot assay and immunoblotting of lipopolysaccharides (LPS) and membrane proteins were evaluated. All bacteria studied were biochemically identical to the T. maritimum reference strains. The slide agglutination assays using O-antigens revealed cross-reaction for all strains regardless of the host species and serum employed. However, when the dot-blot assays were performed, the existence of antigenic heterogeneity was demonstrated. This heterogeneity was supported by immunoblot analysis of the LPS, which clearly revealed 2 major serological groups that were distinguishable without the use of absorbed antiserum: Serotypes O1 and O2. These 2 serotypes seem to be host-specfic. In addition, 2 sole isolates and the Japanese reference strains displayed cross-reaction with both sera in all serological assays, and are considered to constitute a minor serotype, O1/O2.
    [Show full text]
  • Penaeus Monodon
    www.nature.com/scientificreports OPEN Bacterial analysis in the early developmental stages of the black tiger shrimp (Penaeus monodon) Pacharaporn Angthong1,3, Tanaporn Uengwetwanit1,3, Sopacha Arayamethakorn1, Panomkorn Chaitongsakul2, Nitsara Karoonuthaisiri1 & Wanilada Rungrassamee1* Microbial colonization is an essential process in the early life of animal hosts—a crucial phase that could help infuence and determine their health status at the later stages. The establishment of bacterial community in a host has been comprehensively studied in many animal models; however, knowledge on bacterial community associated with the early life stages of Penaeus monodon (the black tiger shrimp) is still limited. Here, we examined the bacterial community structures in four life stages (nauplius, zoea, mysis and postlarva) of two black tiger shrimp families using 16S rRNA amplicon sequencing by a next-generation sequencing. Although the bacterial profles exhibited diferent patterns in each developmental stage, Bacteroidetes, Proteobacteria, Actinobacteria and Planctomycetes were identifed as common bacterial phyla associated with shrimp. Interestingly, the bacterial diversity became relatively stable once shrimp developed to postlarvae (5-day-old and 15-day- old postlarval stages), suggesting an establishment of the bacterial community in matured shrimp. To our knowledge, this is the frst report on bacteria establishment and assembly in early developmental stages of P. monodon. Our fndings showed that the bacterial compositions could be shaped by diferent host developmental stages where the interplay of various host-associated factors, such as physiology, immune status and required diets, could have a strong infuence. Te shrimp aquaculture industry is one of the key sectors to supply food source to the world’s growing pop- ulation.
    [Show full text]
  • Thogens in European Seabass and Gilthead Seabream Aquaculture
    Diagnostic Manual for the main pa- thogens in European seabass and Gilthead seabream aquaculture ^ Edited^ by: Snjezana Zrncic´ méditerranéennes OPTIONS OPTIONS méditerranéennes SERIES B: Studies and Research 2020 - Number 75 CIHEAM Centre International de Hautes Etudes Agronomiques Méditerranéennes International Centre for Advanced Mediterranean Agronomic Studies Président / President: Mohammed SADIKI Secretariat General / General Secretariat: Plácido PLAZA 11, rue Newton 75116 Paris, France Tél.: +33 (0) 1 53 23 91 00 - Fax: +33 (0) 1 53 23 91 01 et 02 [email protected] www.ciheam.org Le Centre International de Hautes Etudes Agronomiques Founded in 1962 at the joint initiative of the OECD and the Méditerranéennes (CIHEAM) a été créé, à l'initiative conjointe de Council of Europe, the International Centre for Advanced l'OCDE et du Conseil de l'Europe, le 21 mai 1962. C'est une Mediterranean Agronomic Studies (CIHEAM) is an organisation intergouvernementale qui réunit aujourd'hui treize intergovernmental organisation comprising thirteen member Etats membres du bassin méditerranéen (Albanie, Algérie, Egypte, countries from the Mediterranean Basin (Albania, Algeria, Egypt, Espagne, France, Grèce, Italie, Liban, Malte, Maroc, Portugal, Spain, France, Greece, Italy, Lebanon, Malta, Morocco, Portugal, Tunisie et Turquie). Tunisia and Turkey). Le CIHEAM se structure autour d'un Secrétariat général situé à CIHEAM is made up of a General Secretariat based in Paris and Paris et de quatre Instituts Agronomiques Méditerranéens (IAM), four Mediterranean
    [Show full text]
  • Tenacibaculum Adriaticum Sp. Nov., from a Bryozoan in the Adriatic Sea
    International Journal of Systematic and Evolutionary Microbiology (2008), 58, 542–547 DOI 10.1099/ijs.0.65383-0 Tenacibaculum adriaticum sp. nov., from a bryozoan in the Adriatic Sea Herwig Heindl, Jutta Wiese and Johannes F. Imhoff Correspondence Kieler Wirkstoff-Zentrum (KiWiZ) at the Leibniz-Institute for Marine Sciences, Am Kiel-Kanal 44, Johannes F. Imhoff D-24106 Kiel, Germany [email protected] A rod-shaped, translucent yellow-pigmented, Gram-negative bacterium, strain B390T, was isolated from the bryozoan Schizobrachiella sanguinea collected in the Adriatic Sea, near Rovinj, Croatia. 16S rRNA gene sequence analysis indicated affiliation to the genus Tenacibaculum, with sequence similarity levels of 94.8–97.3 % to type strains of species with validly published names. It grew at 5–34 6C, with optimal growth at 18–26 6C, and only in the presence of NaCl or sea salts. In contrast to other type strains of the genus, strain B390T was able to hydrolyse aesculin. The predominant menaquinone was MK-6 and major fatty acids were iso-C15 : 0, iso-C15 : 0 3-OH and iso-C15 : 1. The DNA G+C content was 31.6 mol%. DNA–DNA hybridization and comparative physiological tests were performed with type strains Tenacibaculum aestuarii JCM 13491T and Tenacibaculum lutimaris DSM 16505T, since they exhibit 16S rRNA gene sequence similarities above 97 %. These data, as well as phylogenetic analyses, suggest that strain B390T (5DSM 18961T 5JCM 14633T) should be classified as the type strain of a novel species within the genus Tenacibaculum, for which the name Tenacibaculum adriaticum sp. nov. is proposed.
    [Show full text]
  • Tail and Fin Rot Bacteria in Icelandic Aquaculture
    Tail and fin rot bacteria in Icelandic aquaculture Diversity and genetic analysis Guðbjörg Guttormsdóttir Thesis for the degree of Master of Science University of Iceland Faculty of Medicine School of Health Sciences Sporð- og uggarots bakteríur í íslensku fiskeldi Fjölbreytileiki og erfðatæknileg greining Guðbjörg Guttormsdóttir Ritgerð til meistaragráðu í líf- og læknavísindum Umsjónarkennarar: Árni Kristmundsson Leiðbeinandi: Þorbjörg Einarsdóttir Meistaranámsnefnd: Gunnsteinn Ægir Haraldsson Læknadeild Heilbrigðisvísindasvið Háskóla Íslands Febrúar 2017 Tail and fin rot in Icelandic aquaculture Diversity and genetic analysis Guðbjörg Guttormsdóttir Thesis for the degree of Master of Science Supervisor: Árni Kristmundsson Advisor: Þorbjörg Einarsdóttir Masters committee: Gunnsteinn Ægir Haraldsson Faculty of Medicine School of Health Sciences February 2017 Ritgerð þessi er til meistaragráðu í Líf- og læknavísindum og er óheimilt að afrita ritgerðina á nokkurn hátt nema með leyfi rétthafa. © Guðbjörg Guttormsdóttir 2017 Prentun: Háskólaprent Reykjavík, Ísland 2017 Ágrip Sporð- og uggarot hefur greinst í auknum mæli í fiskeldisstöðvum á Íslandi. Einkenni sjúkdómsins eru einna helst opin sár, vefjaskemmdir og rot á sporði og uggum en einkennin geta verið mis alvarleg allt frá litabreytingum á roði yfir í kerfisbundnar sýkingar. Orsök sjúkdómsins eru sýkingar af völdum Flavobacterium og Tenacibaculum bakteríutegunda og í ritgerðinni eru fimm slíkar tegundir teknar til skoðunar; Flavobacterium psychrophilum, Flavobacterium columnare, Flavobacterium branchiophilum, Tenacibaculum maritimum og Tenacibaculum soleae. Bakteríurnar flokkast sem Gram neikvæðir stafir og mynda föl-gular og gular þyrpingar á Flexibacter maritimus medium (FMM) agarskálum. Erfiðlega hefur reynst að staðfesta sýkingar með ræktun vegna þess að bakteríurnar eru hægvaxta, og því geta hraðvaxta umhverfisbakteríur vaxið yfir hina eiginlegu sjúkdómsvalda. Til þess að bæta greiningu á þessum bakteríum voru tegundasértækir polymerase chain reaction (PCR) vísar og DNA raðgreining notuð.
    [Show full text]
  • Host-Microbe Symbiosis in the Marine Sponge Halichondria Panicea
    Host-microbe symbiosis in the marine sponge Halichondria panicea Stephen Knobloch Faculty of Life and Environmental Sciences University of Iceland 2019 Host-microbe symbiosis in the marine sponge Halichondria panicea Stephen Knobloch Dissertation submitted in partial fulfilment of a Philosophiae Doctor degree in Biology PhD Committee Viggó Þór Marteinsson Ragnar Jóhannsson Eva Benediktsdóttir Opponents Detmer Sipkema Ólafur Sigmar Andrésson Faculty of Life and Environmental Sciences School of Engineering and Natural Sciences University of Iceland Reykjavik, May 2019 Host-microbe symbiosis in the marine sponge Halichondria panicea Bacterial symbiosis in H. panicea Dissertation submitted in partial fulfilment of a Philosophiae Doctor degree in Biology Copyright © 2019 Stephen Knobloch All rights reserved Faculty of Life and Environmental Sciences School of Engineering and Natural Sciences University of Iceland Askja, Sturlugata 7 101, Reykjavik Iceland Telephone: +354 525 4000 Bibliographic information: Stephen Knobloch, 2019, Host-microbe symbiosis in the marine sponge Halichondria panicea, PhD dissertation, Faculty of Life and Environmental Sciences, University of Iceland, 204 pp. ISBN: 978-9935-9438-8-0 Author ORCID: 0000-0002-0930-8592 Printing: Háskólaprent Reykjavik, Iceland, May 2019 Abstract Sponges (phylum Porifera) are considered one of the oldest extant lineages of the animal kingdom. Their close association with microorganism makes them suitable for studying early animal-microbe symbiosis and expanding our understanding of host-microbe interactions through conserved mechanisms. Moreover, many sponges and sponge- associated microorganisms produce bioactive compounds, making them highly relevant for the biotechnology and pharmaceutical industry. So far, however, it has not been possible to grow biotechnologically relevant sponge species or isolate their obligate microbial symbionts for these purposes.
    [Show full text]
  • Tenacibaculosis Infection in Marine Fish Caused by Tenacibaculum Maritimum: a Review
    DISEASES OF AQUATIC ORGANISMS Vol. 71: 255–266, 2006 Published August 30 Dis Aquat Org REVIEW Tenacibaculosis infection in marine fish caused by Tenacibaculum maritimum: a review Ruben Avendaño-Herrera, Alicia E. Toranzo, Beatriz Magariños* Departamento de Microbiología y Parasitología, Facultad de Biología e Instituto de Acuicultura, Universidad de Santiago, 15782 Santiago de Compostela, Spain ABSTRACT: Tenacibaculum maritimum is the aetiological agent of an ulcerative disease known as tenacibaculosis, which affects a large number of marine fish species in the world and is of consider- able economic significance to aquaculture producers. Problems associated with epizootics include high mortality rates, increased susceptibility to other pathogens, high labour costs of treatment and enormous expenditures on chemotherapy. In the present article we review current knowledge on this bacterial pathogen, focusing on important aspects such as the phenotypic, serologic and genetic characterization of the bacterium, its geographical distribution and the host species affected. The epi- zootiology of the disease, the routes of transmission and the putative reservoirs of T. maritimum are also discussed. We include a summary of molecular diagnostic procedures, the current status of pre- vention and control strategies, the main virulence mechanisms of the pathogen, and we attempt to highlight fruitful areas for continued research. KEY WORDS: Tenacibaculum maritimum · Tenacibaculosis · Review · Pathogenicity · Diagnosis · Control Resale or republication not permitted without written consent of the publisher INTRODUCTION disease, gliding bacterial disease of sea fish, bacterial stomatitis, eroded mouth syndrome and black patch Tenacibaculum maritimum, a Gram-negative and necrosis have all been used. To avoid confusion with filamentous bacterium, has been described as the eti- other fish diseases, this review will use the name ological agent of tenacibaculosis in marine fish.
    [Show full text]