sign in sign up
<<
Home , Actenoides, African dwarf kingfisher, African pygmy kingfisher, Alcedo, Amazon kingfisher, Azure kingfisher

The Auk 123(2):487–499, 2006 © The American Ornithologists’ Union, 2006. Printed in USA.

A MOLECULAR PHYLOGENY OF (ALCEDINIDAE) WITH INSIGHTS INTO EARLY BIOGEOGRAPHIC HISTORY R G. M1 Department of Ornithology, American Museum of Natural History, Central Park West at 79th Street, New York, New York 10024, USA

A.—The phylogeny of kingfi shers was reconstructed by comparing mitochondrial and nuclear DNA sequences representing 38 ingroup . Analysis of the combined data and the nuclear data alone recovered the Alcedininae as the lineage in the family. This basal arrangement, and support for many relationships within the three subfamilies, allows discussion of biogeographic issues. The Australian region and Pacifi c islands display the highest diversity of kingfi shers, but this diversity is not a refl ection of a long history in the region. Rather, high diversity and endemism in the Australian region is inferred to result from relatively recent radiations from southern . The most parsimonious explanation for the origin of taxa is two dispersal events from the Old World. Within the large radiation, the phylogeny is well resolved and allows evaluation of generic assignments. The phylogeny supports spli ing from Halcyon. Todiramphus and are sister taxa, as are Halcyon and . Thus, merging or retaining those genera is a more subjective decision. Although not fully resolved, relationships within the alcedinines indicate that and , as currently delimited, are not natural groups. Received 9 December 2004, accepted 15 August 2005.

Key words: Alcedinidae, biogeography, kingfi sher, systematics.

Phylogénie Moléculaire des Alcedinidae avec un Aperçu de l’Histoire Biogéographique Ancienne

R.—La phylogénie des Alcedinidae a été reconstruite en comparant des séquences d’ADN mitochondriales et nucléaires de 38 espèces de la famille. L’analyse des données combinées et des données nucléaires seules rétablit les Alcedinidae comme la lignée de base dans la famille. Cet arrangement de base, et le support pour de nombreuses relations à l’intérieur des trois sous-familles, conduisent à une discussion sur les questions de biogéographie. La région australienne et les îles du Pacifi que affi chent la plus grande diversité en Alcedinidae. Néanmoins, ce e diversité n’est pas un refl et d’une longue histoire dans la région. La grande diversité et l’endémisme de la région australienne résulteraient des radiations relativement récentes de l’Asie du sud. L’explication la plus parcimonieuse pour l’origine des taxons du Nouveau Monde réside dans deux évènements de dispersion de l’Ancien Monde. À l’intérieur de la grande radiation Halcyon, la phylogénie est bien résolue et permet une évaluation des a ributions génériques. La phylogénie supporte la séparation de Todiramphus avec Halcyon. Todiramphus et Syma sont des taxons frères, tout comme Halcyon et Pelargopsis. Par conséquent, rassembler ou maintenir ces genres est une décision plus subjective. Bien qu’elles ne soient pas complètement résolues, les relations entre les alcedinines indiquent que Ceyx and Alcedo, telles que défi nies actuellement, ne sont pas des groupes naturels.

1E-mail: [email protected]

487 488 R G. M [Auk, Vol. 123

Knslknm (Ainsni) a family of ~90 Modern phylogenetic hypotheses for king- species that range in size from the 9-g African fi shers are few, and all are the byproduct of Dwarf Kingfi sher (Ceyx lecontei) to the ~500-g higher-level studies not specifi cally intended Laughing (Dacelo novaeguineae) to examine relationships among kingfi sh- (Woodall 2001). Despite their name, kingfi shers ers. Morphological comparisons (Maurer and are not all piscivorous. In fact, many species are Raikow 1981) indicated that Daceloninae was found far from water and prey on a variety of the basal subfamily, in agreement with a gen- terrestrial and small vertebrates. eral consensus that this large and diverse group Although a few species have adapted to tem- represented the ancestral morphotype, behav- perate regions, kingfi shers are a largely tropical ior, and geographic origin (Malesia). Sibley group. Compared with some other widespread and Ahlquist’s (1990) DNA–DNA hybridization tropical groups, however, their diversity studies recovered the Alcedininae as the basal pa ern is unusual. Kingfi shers are most diverse clade, but these results have been questioned in the Australian region, whereas some other because of speculation that increased rates of speciose pantropical groups (e.g. barbets and molecular evolution in these small-bodied trogons) do not occur east of Wallace’s line. adversely aff ected the hybridization compari- Many kingfi sher species are not restricted to sons (Fry et al. 1992). A study based on DNA forest habitats and, as evidenced by their migra- sequences of piciform and galbuliform birds tory behavior and presence on numerous Pacifi c (Johansson and Ericson 2003) included repre- islands, kingfi shers seem to have substantial sentatives of the three kingfi sher subfamilies dispersal ability. and found the Cerylinae basal. Thus, three Distribution, behavior, and life-history char- studies using three diff erent types of data have acteristics make kingfi shers a ractive subjects recovered each of the three potential basal rela- for comparative evolutionary analyses. They tionships among kingfi shers. have been the focus of studies on community Here, I a empt to clarify higher-level relation- ecology (Remsen 1991), cooperative breeding ships among the kingfi shers. I compare DNA (Reyer 1980, 1984), retinal morphology (Moroney sequences of a mitochondrial and nuclear gene and Pe igrew 1987), skull morphology (Burton from 38 ingroup species and address three main 1978), biogeography (Fry 1980a, b), and mor- questions. First, what are the historical rela- phometry (Woodall 1991), yet none of these tionships between major clades of kingfi shers? studies had the benefi t of an explicit phyloge- Second, to the extent that taxon sampling allows, netic hypothesis for the family. Consequently, do current generic and subfamilial designations natural groups, primitive character states, describe natural groups? Third, what are the bio- ancestral areas, and convergent evolution have geographic implications of the inferred higher- been inferred from taxonomic groupings, which level relationships among kingfi shers? rely heavily on or behavioral charac- ters. For example, one subfamily (Alcedininae) Mmi is divided into genera largely on the basis of feeding strategy (Delacour 1951, Fry et al. 1992, T}s Sunsl Woodall 2001), with terrestrial feeders assigned to Ceyx and aquatic feeders assigned to Alcedo. Ingroup sampling (Table 1) included at Unfortunately, terrestrial and aquatic species are least one species of all recently recognized not clearly delimited. Thus, some authors have genera of kingfi shers except Halcyon fulgi- added other genera (e.g. ) for species dus, a species from the that display both feeding behaviors, and Ceyx sometimes placed in its own Carridonax. lepidus, which has varying degrees of piscivory Outgroup sampling included three families of on diff erent islands, has been included in both coraciiforms: ( caudatus), Ceyx (Dickinson 2003) and Alcedo (Schodde Momotidae (Momotus momotus), and Todidae 1977, Fry et al. 1992). Other taxonomic group- ( angustirostris). Previous molecular stud- ings are similarly contentious, including a large ies (Sibley and Ahlquist 1990, Harshman 1994, Old World radiation of terrestrial sit-and-wait Johansson and Ericson 2003) indicated that mot- predators variously lumped into a single genus mots and are the closest living relatives (Halcyon) or divided into as many as fi ve genera. of kingfi shers. April 2006] Kingfi sher Phylogeny 489

T 1. Taxa included in the present study.

Voucher identifi cation Species a Common name number Source b Locality c Ingroup: Daceloninae lindsayi Spo ed Wood Kingfi sher 433013 FMNH A. concretus Rufous-collared Kingfi sher B36383 LSUMNS Tanysiptera galatea Common Paradise Kingfi sher AM1008 KUNHM Ci ura cyanotis Lilac Kingfi sher 115589 ZMUC Melidora macrorrhina Hook-billed Kingfi sher 96077 KUNHM New Guinea Clytoceyx rex Shovel-billed Kingfi sher 5103 KUNHM New Guinea Lacedo pulchella Banded Kingfi sher DOT10817 AMNH Dacelo gaudichaud Rufous-bellied Kookaburra 67921 UWBM New Guinea D. leachii Blue-winged Kookaburra 60802 UWBM D. novaeguineae DOT2409 AMNH Australia Pelargopsis (Halcyon) capensis Stork-billed Kingfi sher 4-1H MNHN Halcyon badia Chocolate-backed Kingfi sher DOT12426 AMNH Liberia H. malimbica Blue-breasted Kingfi sher DOT12517 AMNH CAR H. senegalensis Woodland Kingfi sher DOT12481 AMNH CAR Todiramphus (Halcyon) leucopygius Ultramarine Kingfi sher DOT6654 AMNH Solomon Is. T. (H.) chloris Kingfi sher DOT6704 AMNH Solomon Is. T. (H.) sanctus Sacred Kingfi sher DOT12594 AMNH Sulawesi T. (H.) tutus Pacifi c Kingfi sher 42503 UWBM Cook Is. T. (H.) rufi collaris Mangaia Island Kingfi sher 42791 UWBM Cook Is. Syma (Halcyon) torotoro Lesser Yellow-billed Kingfi sher AM1036 KUNHM New Guinea Ingroup: Alcedininae Ceyx (, Myioceyx) lecontei African Dwarf Kingfi sher DOT10589 AMNH CAR C. (Ispidina) pictus African Pygmy Kingfi sher DOT10701 AMNH CAR C. erithaca Oriental Dwarf Kingfi sher DOT9655 AMNH C. (Ispidina, Corythornis, Ceycoides) madagascariensis Madagascar Pygmy Kingfi sher 393192 FMNH Madagascar C. (Alcedo) lepidus Variable Dwarf Kingfi sher DOT6641 AMNH Solomon Is. Alcedo (Corythornis) leucogaster White-bellied Kingfi sher DOT10682 AMNH CAR A. (C.) cristata Malachite Kingfi sher B39303 LSUMNS Ghana A. quadribrachys Shining-blue Kingfi sher DOT6738 AMNH Liberia A. (Alcyone, Ceyx) azurea Azure Kingfi sher 96095 KUNHM New Guinea A. a his Common Kingfi sher DOT12586 AMNH Sulawesi Ingroup: Cerylinae Chloroceryle aenea American Pygmy Kingfi sher DOT11970 AMNH Venezuela C. inda Green-and-rufous Kingfi sher DOT6182 AMNH Bolivia C. americana Green Kingfi sher DOT6181 AMNH Bolivia C. amazona Amazon Kingfi sher DOT2317 AMNH Bolivia (Ceryle) maxima Giant Kingfi sher 396319 FMNH Gabon M. (C.) torquata Ringed Kingfi sher DOT8781 AMNH Venezuela M. (C.) alcyon Belted Kingfi sher DOT10476 AMNH California Ceryle rudis Pied Kingfi sher B39362 LSUMNS Ghana Outgroup Coracias caudata Lilac-breasted Roller Genbank C. garrulus Genbank Momotus momota Blue-crowned RWD17160 AMNH Todus angustirostris Narrow-billed NKK1014 AMNH a follows Woodall (2001). Alternative generic assignments are included in parentheses. b Institution abbreviations are: AMNH, American Museum of Natural History; LSUMNS, Louisiana State University Museum of Natural Science; FMNH, Field Museum of Natural History; KUNHM, University of Kansas Natural History Museum; UWBM, Burke Museum of Natural History, University of Washington; MNHN, Muséum National d’Histoire Naturelle, Paris; ZMUC, Zoological Museum University of Copenhagen. c CAR = Central African Republic. 490 R G. M [Auk, Vol. 123

Svsnsl using a chi-square analysis of base frequencies across taxa. To visualize the degree of diver- Genomic DNA was extracted from muscle gence between ingroup and outgroup taxa, the tissue using proteinase K digestion following extent of saturation, and relative substitution the manufacturer’s protocol (DNeasy Tissue rates between RAG-1 and ND2, I plo ed the Kit; Qiagen, Valencia, California). The prim- uncorrected distance (P-distance) and maxi- ers L5215 (Hacke 1996) and H6313 (Johnson mum-likelihood-transformed distance of ND2 and Sorenson 1998) were used to amplify versus that of RAG-1 for all pairwise compari- the entire NADH dehydrogenase-2 gene sons of taxa. (ND2) via polymerase chain reaction (PCR). Maximum-likelihood (ML) and maximum- Amplifi cation of smaller fragments from the parsimony (MP) analyses were performed for initial PCR products or whole genomic DNA each gene as well as the combined data using was performed with the internal primers PAUP*. Heuristic searches employed tree bisec- L5758 (Johnson and Sorenson 1998), ND2Hal tion and reconnection (TBR) branch-swapping (5’–GTTAGTAGGGTRAGTTTDGGG–3’), and and 100 random-taxon-addition sequences. For ND2Alc (5’–AGGTAGAAGGTTATTAGGGTTAG– each likelihood analysis, I used MODELTEST, 3’). An exon from the recombination activating version 3.5 (Posada and Crandall 1998), to gene (RAG-1) was amplifi ed using primers from determine the model of evolution and param- Groth and Barrowclough (1999). These genes eter estimates. Support for nodes in the ML have provided good resolution across vary- tree was assessed by nonparametric bootstrap- ing taxonomic levels in birds (e.g. Groth and ping (Felsenstein 1985) and re-analysis of the Barrowclough 1999, Barker et al. 2004, Moyle data (100 replicates). MRBAYES, version 3.0 2005). The nuclear exon evolves slowly and (Huelsenbeck and Ronquist 2001), was used to generally provides more phylogenetic signal estimate model parameters from the data and than mitochondrial markers at deeper nodes in to evaluate support for specifi c relationships a phylogeny. The mitochondrial marker evolves in the phylogeny. For the combined data set, more quickly and is useful for resolving more a mixed-model approach was implemented closely related taxa. to account for the potential diff erence in evo- I purifi ed PCR products with Perfectprep lutionary model parameters between data PCR cleanup kits (Eppendorf, Westbury, New partitions (genes in this case). A general time- York). Sequencing of purifi ed PCR products reversible (Yang 1994a) model framework, with was performed with BigDye Terminator Cycle γ-distributed rates among sites (Yang 1994b) Sequencing reagents (Applied Biosystems, and invariant sites, was used for both partitions Foster City, California). Primers used for PCR (from MODELTEST). All parameters (except were also used for cycle sequencing reactions, topology) were unlinked between partitions. I resulting in bidirectional sequence for all taxa. ran four Markov chains for 25 million genera- Cycle sequencing products were run on an ABI tions, as well as two 2-million-generation runs. Prism 3100 automated DNA sequencer (Applied The shorter runs were used to help evaluate sta- Biosystems). The program SEQUENCHER 4.1 tionarity, the condition in which parameter esti- (Genecodes, Ann Arbor, Michigan) was used mates (and likelihood scores) have converged to reconcile chromatograms of complimentary on a value and the Markov chain is sampling in fragments and to align sequences across taxa. the vicinity of the ML parameter and tree space. All samples prior to reaching stationarity were D Asn discarded. Markov chains were sampled every 1,000 generations, yielding 25,000 parameter Congruence between phylogenetic signal in point estimates. These subsamples, minus the the two genes was tested with the incongru- burn-in generations, were used to create 50% ence length diff erence test (Farris et al. 1994, majority-rule consensus trees. 1995), implemented in PAUP*, version 4.0b10 (i.e. partition homogeneity test; Swoff ord 2002). R The test excluded constant characters and ran for 1,000 bootstrap repetitions. PAUP* was also The fi nal data matrix included 38 ingroup used to test the base composition of each gene species and 3,916 characters (1,044 ND2 and April 2006] Kingfi sher Phylogeny 491

2,872 RAG-1; Genbank numbers DQ111789– the slope noticeably decreased above ND2 DQ111867). The ND2 sequence was three bases divergences of ~15%. ND2 values remained longer than usually reported, because of a one- between 20% and 25% for more than half the codon insertion near the 3’ end of the Alcedo span of RAG-1 p-distance (~4.5% to 9.5%). cristata sequence. The matrix included 930 Maximum-likelihood corrections produced a parsimony-informative characters (414 RAG- more linear relationship between pairwise dis- 1, 516 ND2), and both genes had skewed base tances for the two genes. composition (i.e. excess adenine in both genes and an excess of cytosine in the ND2 data), Hnlm-{ Rnsmnu which was, however, homogeneous across taxa and typical of these genes in other birds (e.g. Parsimony, likelihood, and Bayesian meth- Groth and Barrowclough 1999, Kirchman et al. ods produced congruent results. Topological 2001). Aligned ND2 sequences appeared to be diff erences occurred, but no confl icts received genuine mitochondrial sequence, rather than high support from bootstrapping or Bayesian nuclear copies. Sequences contained no stop analysis. Monophyly of the three traditional codons, overlapping fragments contained no subfamilies of kingfi shers (Alcedininae, confl icts, base composition was homogeneous Cerylinae, and Daceloninae) was strongly sup- across taxa, codon positions contained expected ported in all analyses (Figs. 2 and 3). The rela- relative divergences (3>1>2), and highly suspect tionship among these three clades (Alcedininae relationships were not evident. The partition basal to Cerylinae and Daceloninae) was the homogeneity test results were not signifi cant same across all combined analyses but did not (P > 0.05). A plot of pairwise divergences (Fig. always receive strong support. For example, 1) between the two genes showed evidence of posterior probability for the basal position of saturation in the ND2 partition. For p-distance, the Alcedininae from Bayesian analysis of the

Fnl. 1. Plot of pairwise values for uncorrected p-distance and ML-corrected distance. Maximum- likelihood model and parameter estimates from MODELTEST (see text). 492 R G. M [Auk, Vol. 123

Fnl. 2. Bayesian consensus tree of combined ND2 and RAG-1 data from mixed-model analysis. Numbers at nodes indicate Bayesian posterior-probability or maximum-likelihood bootstrap sup- port. General distribution of each species is indicated to the right. combined data (0.92) fell just shy of signifi cance, DNA sequence data. Analysis of the RAG-1 data and bootstrap support was <50%, but parsi- alone (Fig. 3A) produced the same result as the mony bootstrap analysis of RAG-1 alone was combined analysis, but analysis of ND2 alone more persuasive (85%). It is apparent that reso- (Fig. 3B) produced an alternate basal topology lution of this node relies heavily on the nuclear (Daceloninae basal) with low branch support. April 2006] Kingfi sher Phylogeny 493 ate subfamilies: Fnl. 3. Bayesian consensus trees of the RAG-1 (A) and ND2 (B) data analyzed separately. Numbers above nodes indicate Bayesian nodes indicate Bayesian Numbers above consensus trees of the RAG-1 (A) and ND2 (B) data analyzed separately. Fnl. 3. Bayesian posterior-probability or parsimony-bootstrap proportions. Bootstrap proportions <50% are indicated with an asterisk. Bars indic posterior-probability Alcedininae, black; Cerylinae, gray; Daceloninae, open. 494 R G. M [Auk, Vol. 123

Ainsns and the Stork-billed Kingfi sher (Pelargopsis capensis). The second lineage included only the Basal relationships within the Alcedininae monotypic Lacedo pulchella. Bayesian analysis of were not resolved with the current data. Bayesian the RAG-1 partition (Fig. 2A) yielded a signifi - analysis of the combined data (Fig. 2) essentially cant posterior probability (0.96) placing Lacedo yielded a trichotomy at the end of a long stem lin- sister to the Pelargopsis–Halcyon clade, but sup- eage. The basal split, albeit with no support from port from combined analyses was far lower any type of analysis, separated Ceyx lecontei and (0.66). This discrepancy may be due to the phy- C. picta (both included in Ispidina at times) from logenetic signal from the ND2 data (Fig. 2B), the rest of the taxa. One of the two remaining which reconstructed Lacedo as the basal branch groups, with high support at both nodes, placed in the Daceloninae, albeit with low support. the Madagascar Pygmy Kingfi sher (C. madagas- When combined, the two genes cannot place cariensis) sister to a pair of African Alcedo species Lacedo with any certainty. (A. leucogaster and A. cristata). The fi nal clade of The third lineage in the Daceloninae was a alcedinines sampled in the study included fi ve diverse assemblage of mostly Australasian and species from , Asia, and the Australian Pacifi c taxa. Within this clade, relationships region, as well as the Common Kingfi sher (A. among some genera were strongly supported, a his), one of the few kingfi sher species that but uncertainty existed at the base of the radia- ranges far outside the tropics. tion. All analyses supported sister relationships between Ci ura and Tanysiptera, Syma and Cns Halcyon (the subset included in Todiramphus), Dacelo and Clytoceyx, and Melidora with (Dacelo, Although the most depauperate of the three Clytoceyx). Bayesian analysis of the ND2 data subfamilies, the Cerylinae arguably have the yielded signifi cant support for a sister relation- widest geographic distribution, occurring ship between Actenoides and Syma–Todiramphus, throughout the tropics of Africa, Asia, and the but this relationship lacked signifi cant support New World, as well as temperate regions of from the RAG-1 partition or the combined North America and Asia. Relationships within analyses. The data did not produce signifi cant the Cerylinae were well resolved and divide the support for other relationships among the main subfamily into two clades, both containing New lineages in this clade. and Old World taxa. One clade included the two New World species of Megaceryle sister to the Dnns one Old World Megaceryle species sampled. The second clade contained Ceryle rudis sister to the Hnlm-{ Rnsmnu four species of Chloroceryle. Within Chloroceryle, plumage does not segregate species pairs as tra- Phylogenetic analysis of nuclear and ditionally assumed (Fry 1980b, Fry et al. 1992, mitochondrial DNA sequences produced a Woodall 2001). The two rufous-bellied species robust hypothesis of kingfi sher relationships. (C. aenea and C. inda) were not sister taxa, nor Combined analysis supported the Alcedininae were the two white-bellied species (C. amazona as the basal branch in the kingfi sher phylogeny, and C. americana). Instead, C. americana and C. in agreement with Sibley and Ahlquist’s (1990) inda were sisters, and C. aenea and C. amazona DNA–DNA hybridization results. Fry et al. branched off successively deeper in the clade. (1992) and Woodall (2001) speculated that the hybridization results may have been biased Dsns by a presumed faster rate of evolution among the small-bodied alcedinines. Visual inspec- The Daceloninae are the most speciose and tion of the phylogeny (Fig. 2) confi rms that the phylogenetically uncertain subfamily of king- alcedinines sit farther from the base of the tree fi shers. All analyses supported monophyly of than the other subfamilies. This is not expected the Daceloninae, but uncertainty existed about to greatly infl uence the present results because, relationships within the subfamily. Three well- unlike DNA–DNA hybridization methods, the defi ned lineages diverged at the base of the current data and analytical methods are more clade. The fi rst was a sister grouping of Halcyon adept at handling rate discrepancies. April 2006] Kingfi sher Phylogeny 495

Support for the basal node in the phylogeny Bnllumn Hn derived exclusively from the RAG-1 partition. The ND2 data supported the Daceloninae as the Incomplete taxon sampling and uncertainty basal lineage in the family (Fig. 3B), but there is at the base of the alcedinine and dacelonine reason to discount this result in relation to the radiations preclude formal analysis of global RAG-1 and combined analyses. Kingfi shers are kingfi sher biogeography. Nevertheless, the an old family, arising in the or earlier current phylogenetic hypothesis and outgroup according to the record (Grande 1980, comparisons allow re-evaluation of the con- Houde and Olson 1988, Mourer-Chauviré ventional wisdom on kingfi sher biogeography 1995). In analysis of such a group, mitochon- and informed discussion about the family’s drial DNA, by virtue of its faster rate of evolu- origins. Kingfi sher diversity reaches its maxi- tion and among-site rate heterogeneity, is more mum in the Australian region, which contains likely to suff er from saturation eff ects (multiple more species, endemic species, and endemic superimposed substitutions) than nuclear DNA genera than any other region (Fry et al. 1992). sequences. Saturation causes a decrease in phy- The other tropical regions, in order of decreas- logenetic signal at deeper nodes, and a concom- ing kingfi sher diversity, are Asia, Africa, and itant increase in spurious signal. ND2 begins to South–Central America. This diversity pa ern, show evidence of saturation by 15% uncorrected along with the supposition that terrestrial sit- divergence (Fig. 1) and plateaus just above 20% and-wait predators in tropical are divergence. Distance transformation using the likely to represent ancestral types, contributed ML model and parameter estimates established to the idea that kingfi shers arose in Malesia (Fry a more linear relationship between the two et al. 1992, Woodall 2001). The problem with genes, but increased the variance (sca er) as this conclusion is that Malesia, a broad region well. A character- and model-based tree evalu- stretching from the to New ation method (like ML) can emphasize phyloge- Guinea, comprises two distinct faunal regions netic signal from less-saturated characters, but and is divided by Wallace’s line. Although no transformation can reconstruct informative it is possible that early kingfi sher evolution character changes erased by homoplasy. Unlike straddled Wallace’s line, the importance of mitochondrial DNA, the RAG-1 gene evolves this barrier in the biogeographic history of so at a much slower rate and has proved useful many other groups indicates that Malesia may in deciphering distant relationships in several not be a cohesive biogeographic region in king- bird groups (e.g. Groth and Barrowclough fi sher evolution. Furthermore, the extensive 1999; Barker et al. 2002, 2004). The diff erence archipelago between the Asian and Australian in phylogenetic signal provided by the two continental plates that constitutes much of genes is refl ected in the combined and sepa- Malesia did not exist until the early Miocene rate analyses. Although the Daceloninae were (Hall 1996), long aV er kingfi shers fi rst appeared basal in the ND2 analysis, this was based on in the Eocene fossil record of and North relatively li le informative phylogenetic signal. America (Grande 1980, Houde and Olson 1988, Nonparametric bootstrap resampling (<50%) Mourer-Chauviré 1995). Thus, lumping por- and Bayesian posterior probability (0.75) pro- tions of the Asian and Australian tropics into a vided li le support for this conformation. By single region may obscure early biogeographic contrast, the basal node in the RAG-1 analysis pa erns of kingfi shers. received high-parsimony bootstrap support Todies and , the of king- (85%) and a Bayesian posterior probability fi shers, live in Neotropical forests. Considering (0.93) just shy of signifi cance. Mixed-model that maximum kingfi sher diversity occurs in the Bayesian analysis of the combined data yielded Australian region, this might indicate a south- virtually the same posterior probability as the ern origin for these taxa. A close look at their RAG-1 analysis, indicating that the nuclear current distribution and the fossil record indi- sequence data is providing most of the phyloge- cates otherwise. Todies are currently restricted netic signal at that deep node. In the combined to islands, and motmot diversity is data analysis, trivial posterior probabilities centered in Central America; neither family is supported other basal arrangements (Cerylinae predominantly South American. Furthermore, basal 0.01, Daceloninae basal 0.06). the fossil record of both families is restricted to 496 R G. M [Auk, Vol. 123

Europe and North America (Olson 1976, Becker Divergence dates have not been estimated for 1986, Mourer-Chauviré 1995). Consequently, it the kingfi sher phylogeny, owing to a lack of cal- is likely that todies and motmots are of north- ibration points from the fossil record. However, ern origin, that they have become extinct in the branch-length comparisons and raw sequence- Old World, and that their current distribution is divergence between New and Old World clades relictual (Chapman 1923, Feduccia 1977). Thus, of the Cerylinae are quite high (ND2: 10–17% the sister group of kingfi shers is most likely P-distance, 14–40% ML distance) for an origin Laurasian, rather than Neotropical. within the past 5 million years. Diversity pa erns within the kingfi shers are also deceptive. Although the Australian Iunns k T}s si Knslknm region supports the highest kingfi sher diversity, E{ns Australian taxa are not basal in the phylogeny. The basal subfamily in the kingfi sher radia- Even with the limitations imposed by incom- tion is the Alcedininae, and the few Australian plete taxon sampling, the current data clearly alcedinines (represented in this study by support or refute several proposed generic Alcedo azurea and Ceyx lepidus) are embedded allocations. Inclusion of the New World species among African and Asian taxa. Almost all the alcyon and torquatus within Megaceryle (Woodall species endemic to the Australian region and 2001, Dickinson 2003), rather than Ceryle Pacifi c islands are dacelonine, but within that (Forshaw 1983), is strongly supported. Ceryle subfamily two of the three basal lineages are rudis has no close living relatives, but is closest entirely Asian and African. The third lineage to Chloroceryle rather than Megaceryle. The only contains all the diverse Australian and Pacifi c missing species, M. lugubris, is assumed to group island taxa; yet, even here, major radiations are with the other Megaceryle species; its similarities sister to Asian clades (e.g. Actenoides sister to in plumage and morphology to M. alcyon, M. tor- Syma–Todiramphus). Consequently, the incred- quata, and M. maxima led Fry (1980a) to consider ible kingfi sher diversity east of Wallace’s line them all part of a superspecies. is likely the result of a few relatively recent Within the Daceloninae, the data clearly radiations from southern Asia. Fry (1980b) may demonstrate that Halcyon (sensu Forshaw 1983, be correct in surmising that the diversity of the Fry et al. 1992) is not a natural group. At least dacelonine radiation was caused by the com- two genera are necessary to accommodate the plex geography of Malesia in the Miocene, but traditional Halcyon species. The decision to split the phylogeny indicates that crown-clade king- Syma off from Todiramphus and Pelargopsis off fi shers had a substantial biogeographic history from Halcyon (Woodall 2001, Dickinson 2003) is before that time. not mandated by the phylogenetic results, but Taxon sampling within the Cerylinae is could be maintained to account for the degree relatively complete, lacking only Crested of diff erence between the proposed genera. Bell Kingfi sher (Megaceryle lugubris) of Asia. It has (1981) and Fry (1980a) suggested that Melidora been suggested that this subfamily arose as an might have affi nities to Tanysiptera, but the data off shoot of the Alcedininae as recently as the support a more recent common ancestor with Miocene or Pliocene (Fry et al. 1992, Woodall Dacelo and Clytoceyx. It is apparent that Lacedo 2001). In that scenario, an ancestor invaded pulchella has no close living relatives, and the the New World from Asia and subsequently data do not support a close connection to Dacelo, split into the Megaceryle and Chloroceryle lin- as proposed by Fry (1980a), or to Tanysiptera, as eages. Extant Old World taxa are the result of proposed by Forshaw (1983). One data parti- re-invasions by the two lineages in the Pliocene tion (ND2) places Lacedo with Pelargopsis and or Pleistocene. Although this hypothesis cor- Halcyon, but that result is contradicted by the rectly identifi es the early split into Megaceryle RAG-1 results, which place Lacedo as the basal and Ceryle–Chloroceryle lineages, the timing and branch in the subfamily. direction of invasions is doubtful. In light of Ceyx and Alcedo, as delimited in most modern the phylogeny, initial diversifi cation within the taxonomic treatments, are not natural groups. Old World and subsequent invasion of the New Members of both genera are interspersed in World is more parsimonious, requiring only multiple well-supported clades. Thus, feeding two New World–Old World dispersal events. strategy, bill shape, and plumage characters April 2006] Kingfi sher Phylogeny 497 are phylogenetically misleading. For example, the Ambrose Monell Molecular Laboratory and the Madagascar Pygmy Kingfi sher (C. madagas- is a contribution of the Lewis B. and Dorothy cariensis) resembles Asian Ceyx species in plum- Cullman Program for Molecular Systematic age (rufous back), diet (mostly ), and bill Studies, a joint initiative of the New York shape (dorsoventrally fl a ened), yet it is sister Botanical Gardens and the American Museum to two fi sh-eating Alcedo species from Africa, a of Natural History. relationship suggested by Traylor (1960). If the traditional taxonomic characters are mislead- Ln Cni ing, what then are the common threads, aside from shared nucleotides, that unite clades? To Bp, F. K., G. F. B|lm, si some extent, the alcedinines are more cohe- J. G. Gm. 2002. A phylogenetic hypoth- sive geographically than previously believed. esis for passerine birds: Taxonomic and Traditional taxonomy indicated close relation- biogeographic implications of an analysis ships among species from diff erent regions, of nuclear DNA sequence data. Proceedings but the phylogeny places many of those spe- of the Royal Society of London, Series B 269: cies into geographic groupings. For example, 295–308. Azure Kingfi sher (A. azurea) of Australasia is Bp, F. K., A. Cnn, P. Smnp, J. Fnsns, sister to Asian (C. erithaca) and Australasian (C. si J. Ck. 2004. Phylogeny and lepidus) species, rather than to other Alcedo taxa. diversifi cation of the largest avian radiation. Likewise, the Madagascar Pygmy Kingfi sher Proceedings of the National Academy of (C. madagascariensis) is actually related to an Sciences USA 101:11040–11045. African Alcedo clade, rather than the Asian Ceyx Bp, J. J. 1986. A fossil motmot (Aves: with which it had been grouped. Further evalu- Momotidae) from the late Miocene of ation of taxonomy, biogeography, and evolution Florida. Condor 88:478–482. in this subfamily awaits a phylogenetic hypoth- B, H. L. 1981. Information on New Guinea esis with complete taxon sampling (R. G. Moyle kingfi shers, Alcedinidae. Ibis 123:51–61. et al. unpubl. data). Bs, P. 1978. The basisphenoid notch of king- fi shers. Bulletin of the British Ornithologists’ Aps|ils Club 98:68–74. Cmus, F. M. 1923. The distribution of the Tissue samples were kindly provided by motmots of the genus Momotus. Bulletin of Louisiana State University Museum of Natural the American Museum of Natural History Science (R. Brumfi eld and D. Di mann), 48:27–59. University of Kansas Natural History Museum D, J. 1951. The signifi cance of the num- (A. T. Peterson, M. Robbins, and A. Mack), Burke ber of toes in some and king- Museum of Natural History at the University of fi shers. Auk 68:49–51. Washington (S. Birks), Field Museum of Natural Dnpnss, E. C., Ei. 2003. The Howard and History (J. Bates, S. Hacke , and D. Willard), Moore Complete Checklist of the Birds Muséum National d’Histoire Naturelle, Paris (E. of the World. Princeton University Press, Pasquet), and Zoological Museum University of Princeton, New Jersey. Copenhagen (J. Fjeldså). I also thank the fi eld Fn, J. S., M. Kƒo¾, A. G. Kl, si C. collectors at these institutions for all their eff orts B. 1994. Testing signifi cance of incongru- and generosity. For collecting permits and fi eld ence. Cladistics 10:315–319. assistance, I thank the Malaysian Economic Fn, J. S., M. Kƒo¾, A. G. Kl, si C. Planning Unit, Sabah Museum (J. Majuakim B. 1995. Constructing a signifi cance test and A. Lo), Sabah Parks (D. Lamri Ali, J. Nais, for incongruence. Systematic Biology 44: and M. Lakim), Sabah Wildlife Department 570–572. (D. Mahedi Andau), and the Ghana Wildlife Fin, A. 1977. A model for the evolution Department (J. Amponsah and J. Braimah). This of perching birds. Systematic Zoology 26: work was supported in part by National Science 19–31. Foundation “Assembling the Tree of Life” Fsns, J. 1985. Confi dence limits on phy- Grant EAR-0228693 and the F.M. Chapman logenies: An approach using the bootstrap. Memorial Fund. The research was conducted in Evolution 39:783–791. 498 R G. M [Auk, Vol. 123

Fm|, J. M. 1983. Alcedinidae Ceryle to si J. M. B. 2001. Phylogeny and system- Ci ura. Lansdowne Editions, . atics of ground rollers (Brachypteraciidae) F, C. H. 1980a. The evolutionary biology of of Madagascar. Auk 118:849–863. kingfi shers (Alcedinidae). Living Bird 19: M, D., si R. J. Rnp|. 1981. 113–160. Appendicular myology, phylogeny, and clas- F, C. H. 1980b. The origin of Afrotropical sifi cation of the avian order kingfi shers. Ibis 122:57–74. (including Trogoniformes). Annals of the F, C. H., K. F, si A. Hn. 1992. Carnegie Museum of Natural History 50: Kingfi shers, Bee-eaters, and Rollers. 417–434. Christopher Helm, London. Ms, M. K., si J. D. Pnl|. 1987. Gsi, L. 1980. Paleontology of the Green Some observations on the visual optics River Formation, with a review of the fi sh of Kingfi shers (Aves, Coraciformes, fauna. Geological Survey of Wyoming Alcedinidae). Journal of Comparative Bulletin, no. 63. Physiology A 160:137–149. Gm, J. G., si G. F. B|lm. 1999. M-Cm{n, C. 1995. Dynamics of the Basal divergences in birds and the phylo- avifauna during the Paleogene and the genetic utility of the nuclear RAG-1 gene. Early Neogene of France. Se ling of the and Evolution 12: recent fauna. Acta Zoologica Cracoviensia 115–123. 38:325–342. Hp, S. J. 1996. Molecular phylogenet- M, R. G. 2005. Phylogeny and biogeograph- ics and biogeography of tanagers in the ical history of Trogoniformes, a pantropical genus Ramphocelus (Aves). Molecular bird order. Biological Journal of the Linnean Phylogenetics and Evolution 5:368–382. Society 84:725–738. H, R. 1996. Reconstructing Cenozoic SE Os, S. L. 1976. Oligocene bearing on Asia. Pages 153–184 in Tectonic Evolution the origins of the Todidae and Momotidae of (R. Hall and D. Blundell, (Aves: Coraciiformes). Smithsonian Eds.). Geological Society Publications, no. Contributions to Paleobiology 27:111–119. 106. Pi, D., si K. A. Csi. 1998. Hms, J. 1994. Reweaving the tapestry: MODELTEST: testing the model of DNA What can we learn from Sibley and Ahlquist substitution. Bioinformatics 14:817–818. (1990)? Auk 111:377–388. Rs, J. V., J. 1991. Community ecology Hi, P., si S. L. Os. 1988. Small arboral of Neotropical kingfi shers. University of nonpasserine birds from the early Tertiary California Publications in Zoology, no. 124. of western North America. Pages 2030–2036 R, H. U. 1980. Flexible helper structure as an in Acta XIX Congressus Internationalis ecological adaptation in the Pied Kingfi sher Ornithologici (H. Ouellet, Ed.). National (Ceryle rudis rudis L.). Behavioral Ecology Museum of Natural Sciences, University of and Sociobiology 6:219–227. O awa Press, O awa. R, H. U. 1984. Investment and relatedness: Hsp, J. P., si F. Rsvn. 2001. A cost/benefi t analysis of breeding and MRBAYES: Bayesian inference of phyloge- helping in the Pied Kingfi sher (Ceryle rudis). netic trees. Bioinformatics 17:754–755. Behaviour 32:1163–1178. Jmss, U. S., si P. G. P. Ens. 2003. Smii, R. 1977. Contributions to Papuan orni- Molecular support for a sister group thology. 6. Survey of the birds of southern relationship between Pici and Galbulae Bouganville Island, Papua New Guinea. (Piciformes sensu Wetmore 1960). Journal of CSIRO Division of Wildlife Resources Avian Biology 34:185–197. Technical Papers, no. 34. Jmss, K. P., si M. D. Sss. 1998. Sn, C. G., si J. E. Amvn. 1990. Phylogeny Comparing molecular evolution in two and Classifi cation of Birds. Yale University, mitochondrial protein coding genes (cyto- New Haven, Connecticut. chrome b and ND2) in the dabbling ducks S|kki, D. L. 2002. PAUP*: Phylonetic (Tribe: Anatini). Molecular Phylogenetics Analysis Using Parsimony (*and other and Evolution 10:82–94. methods), version 4. Sinauer Associates, Knms, J. J., S. J. Hp, S. M. Gis, Sunderland, Massachuse s. April 2006] Kingfi sher Phylogeny 499

T, M. A. 1960. Genera Corythornis, Ysl, Z. 1994a. Estimating the pa ern of nucle- Ispidina, Myioceyx. Bulletin of the British otide substitution. Journal of Molecular Ornithologists’ Club 80:144–146. Evolution 39:105–111. Wi, P. F. 1991. Morphometry, diet and hab- Ysl, Z. 1994b. Maximum likelihood phylo- itat in the kingfi shers (Aves, Alcedinidae). genetic estimation from DNA-sequences Journal of Zoology (London) 223:79–90. with variable rates over sites: Approximate Wi, P. F. 2001. Family Alcedinidae methods. Journal of Molecular Evolution 39: (Kingfi shers). Pages 130–249 in Handbook 306–314. of the Birds of the World: to (J. del Hoyo, A. Ellio , and J. Sargatal, Eds.). Lynx Edicions, Barcelona. Associate Editor: K. P. Johnson