Characterizing the Bcl-2 Associated Athanogene 5 Interactome in the Context of Parkinson’S Disease
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Whole Brain and Brain Regional Coexpression Network Interactions Associated with Predisposition to Alcohol Consumption Lauren A
Virginia Commonwealth University VCU Scholars Compass Study of Biological Complexity Publications Center for the Study of Biological Complexity 2013 Whole Brain and Brain Regional Coexpression Network Interactions Associated with Predisposition to Alcohol Consumption Lauren A. Vanderlinden University of Colorado at Aurora Laura M. Saba University of Colorado at Aurora Katerina Kechris University of Colorado at Aurora See next page for additional authors Follow this and additional works at: http://scholarscompass.vcu.edu/csbc_pubs Part of the Life Sciences Commons © 2013 Vanderlinden et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Downloaded from http://scholarscompass.vcu.edu/csbc_pubs/24 This Article is brought to you for free and open access by the Center for the Study of Biological Complexity at VCU Scholars Compass. It has been accepted for inclusion in Study of Biological Complexity Publications by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Authors Lauren A. Vanderlinden, Laura M. Saba, Katerina Kechris, Michael F. Miles, Paula L. Hoffman, and Boris Tabakoff This article is available at VCU Scholars Compass: http://scholarscompass.vcu.edu/csbc_pubs/24 Whole Brain and Brain Regional Coexpression Network Interactions Associated with Predisposition to Alcohol Consumption Lauren -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Analysis of Trans Esnps Infers Regulatory Network Architecture
Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation. -
RT² Profiler PCR Array (384-Well Format) Human Apoptosis 384HT
RT² Profiler PCR Array (384-Well Format) Human Apoptosis 384HT Cat. no. 330231 PAHS-3012ZE For pathway expression analysis Format For use with the following real-time cyclers RT² Profiler PCR Array, Applied Biosystems® models 7900HT (384-well block), Format E ViiA™ 7 (384-well block); Bio-Rad CFX384™ RT² Profiler PCR Array, Roche® LightCycler® 480 (384-well block) Format G Description The Human Apoptosis RT² Profiler PCR Array profiles the expression of 370 key genes involved in apoptosis, or programmed cell death. The array includes the TNF ligands and their receptors; members of the bcl-2 family, BIR (baculoviral IAP repeat) domain proteins, CARD domain (caspase recruitment domain) proteins, death domain proteins, TRAF (TNF receptor-associated factor) domain proteins and caspases. These 370 genes are also grouped by their functional contribution to apoptosis, either anti-apoptosis or induction of apoptosis. Using real-time PCR, you can easily and reliably analyze expression of a focused panel of genes related to apoptosis with this array. For further details, consult the RT² Profiler PCR Array Handbook. Sample & Assay Technologies Shipping and storage RT² Profiler PCR Arrays in formats E and G are shipped at ambient temperature, on dry ice, or blue ice packs depending on destination and accompanying products. For long term storage, keep plates at –20°C. Note: Ensure that you have the correct RT² Profiler PCR Array format for your real-time cycler (see table above). Note: Open the package and store the products appropriately immediately -
Proteomic Analysis of the Venom of Jellyfishes Rhopilema Esculentum and Sanderia Malayensis
marine drugs Article Proteomic Analysis of the Venom of Jellyfishes Rhopilema esculentum and Sanderia malayensis 1, 2, 2 2, Thomas C. N. Leung y , Zhe Qu y , Wenyan Nong , Jerome H. L. Hui * and Sai Ming Ngai 1,* 1 State Key Laboratory of Agrobiotechnology, School of Life Sciences, The Chinese University of Hong Kong, Hong Kong, China; [email protected] 2 Simon F.S. Li Marine Science Laboratory, State Key Laboratory of Agrobiotechnology, School of Life Sciences, The Chinese University of Hong Kong, Hong Kong, China; [email protected] (Z.Q.); [email protected] (W.N.) * Correspondence: [email protected] (J.H.L.H.); [email protected] (S.M.N.) Contributed equally. y Received: 27 November 2020; Accepted: 17 December 2020; Published: 18 December 2020 Abstract: Venomics, the study of biological venoms, could potentially provide a new source of therapeutic compounds, yet information on the venoms from marine organisms, including cnidarians (sea anemones, corals, and jellyfish), is limited. This study identified the putative toxins of two species of jellyfish—edible jellyfish Rhopilema esculentum Kishinouye, 1891, also known as flame jellyfish, and Amuska jellyfish Sanderia malayensis Goette, 1886. Utilizing nano-flow liquid chromatography tandem mass spectrometry (nLC–MS/MS), 3000 proteins were identified from the nematocysts in each of the above two jellyfish species. Forty and fifty-one putative toxins were identified in R. esculentum and S. malayensis, respectively, which were further classified into eight toxin families according to their predicted functions. Amongst the identified putative toxins, hemostasis-impairing toxins and proteases were found to be the most dominant members (>60%). -
Regulation of Cdc42 and Its Effectors in Epithelial Morphogenesis Franck Pichaud1,2,*, Rhian F
© 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs217869. doi:10.1242/jcs.217869 REVIEW SUBJECT COLLECTION: ADHESION Regulation of Cdc42 and its effectors in epithelial morphogenesis Franck Pichaud1,2,*, Rhian F. Walther1 and Francisca Nunes de Almeida1 ABSTRACT An overview of Cdc42 Cdc42 – a member of the small Rho GTPase family – regulates cell Cdc42 was discovered in yeast and belongs to a large family of small – polarity across organisms from yeast to humans. It is an essential (20 30 kDa) GTP-binding proteins (Adams et al., 1990; Johnson regulator of polarized morphogenesis in epithelial cells, through and Pringle, 1990). It is part of the Ras-homologous Rho subfamily coordination of apical membrane morphogenesis, lumen formation and of GTPases, of which there are 20 members in humans, including junction maturation. In parallel, work in yeast and Caenorhabditis elegans the RhoA and Rac GTPases, (Hall, 2012). Rho, Rac and Cdc42 has provided important clues as to how this molecular switch can homologues are found in all eukaryotes, except for plants, which do generate and regulate polarity through localized activation or inhibition, not have a clear homologue for Cdc42. Together, the function of and cytoskeleton regulation. Recent studies have revealed how Rho GTPases influences most, if not all, cellular processes. important and complex these regulations can be during epithelial In the early 1990s, seminal work from Alan Hall and his morphogenesis. This complexity is mirrored by the fact that Cdc42 can collaborators identified Rho, Rac and Cdc42 as main regulators of exert its function through many effector proteins. -
Comparative Mapping of Growth Habit, Plant Height, and Flowering Qtls in Two Interspecific Families of Leymus
Published online November 21, 2006 Comparative Mapping of Growth Habit, Plant Height, and Flowering QTLs in Two Interspecific Families of Leymus Steven R. Larson,* Xiaolei Wu, Thomas A. Jones, Kevin B. Jensen, N. Jerry Chatterton, Blair L. Waldron, Joseph G. Robins, B. Shaun Bushman, and Antonio J. Palazzo ABSTRACT Aggressive rhizomes and adaptation to poorly drained Leymus cinereus (Scribn. & Merr.) A´ .Lo¨ve and L. triticoides alkaline sites, primarily within the western USA, charac- (Buckley) Pilg. are tall caespitose and short rhizomatous perennial terize sod-forming L. triticoides (0.3–0.7 m). Conversely, Triticeae grasses, respectively. Circumference of rhizome spreading, L. cinereus is a tall (up to 2 m) conspicuous bunchgrass proportion of bolting culms, anthesis date, and plant height were eval- adapted to deep well-drained soils from Saskatchewan to uated in two mapping families derived from two interspecific hybrids of British Columbia, south to California, northern Arizona, L. cinereus Acc:636 and L. triticoides Acc:641 accessions, backcrossed and New Mexico, and east to South Dakota and Minne- to one L. triticoides tester. Two circumference, two bolting, and two sota. Most populations of L. cinereus and L. triticoides are height QTLs were homologous between families. Two circumference, allotetraploids; however, octoploid forms of L. cinereus seven bolting, all five anthesis date, and five height QTLs were family are typical in the Pacific Northwest. Basin wildrye, and specific. Thus, substantial QTL variation was apparent within and be- octoploid giant wildrye [L. condensatus (J. Presl) A´ . tween natural source populations of these species. Two of the four circumference QTLs were detected in homoeologous regions of linkage Lo¨ve], are the largest cool-season bunch grasses native to groups 3a and 3b in both families, indicating that one gene may control western North America. -
UNIVERSITY of CALIFORNIA, SAN DIEGO Functional Analysis of Sall4
UNIVERSITY OF CALIFORNIA, SAN DIEGO Functional analysis of Sall4 in modulating embryonic stem cell fate A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Molecular Pathology by Pei Jen A. Lee Committee in charge: Professor Steven Briggs, Chair Professor Geoff Rosenfeld, Co-Chair Professor Alexander Hoffmann Professor Randall Johnson Professor Mark Mercola 2009 Copyright Pei Jen A. Lee, 2009 All rights reserved. The dissertation of Pei Jen A. Lee is approved, and it is acceptable in quality and form for publication on microfilm and electronically: ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ Co-Chair ______________________________________________________________ Chair University of California, San Diego 2009 iii Dedicated to my parents, my brother ,and my husband for their love and support iv Table of Contents Signature Page……………………………………………………………………….…iii Dedication…...…………………………………………………………………………..iv Table of Contents……………………………………………………………………….v List of Figures…………………………………………………………………………...vi List of Tables………………………………………………….………………………...ix Curriculum vitae…………………………………………………………………………x Acknowledgement………………………………………………….……….……..…...xi Abstract………………………………………………………………..…………….....xiii Chapter 1 Introduction ..…………………………………………………………………………….1 Chapter 2 Materials and Methods……………………………………………………………..…12 -
The N-Cadherin Interactome in Primary Cardiomyocytes As Defined Using Quantitative Proximity Proteomics Yang Li1,*, Chelsea D
© 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs221606. doi:10.1242/jcs.221606 TOOLS AND RESOURCES The N-cadherin interactome in primary cardiomyocytes as defined using quantitative proximity proteomics Yang Li1,*, Chelsea D. Merkel1,*, Xuemei Zeng2, Jonathon A. Heier1, Pamela S. Cantrell2, Mai Sun2, Donna B. Stolz1, Simon C. Watkins1, Nathan A. Yates1,2,3 and Adam V. Kwiatkowski1,‡ ABSTRACT requires multiple adhesion, cytoskeletal and signaling proteins, The junctional complexes that couple cardiomyocytes must transmit and mutations in these proteins can cause cardiomyopathies (Ehler, the mechanical forces of contraction while maintaining adhesive 2018). However, the molecular composition of ICD junctional homeostasis. The adherens junction (AJ) connects the actomyosin complexes remains poorly defined. – networks of neighboring cardiomyocytes and is required for proper The core of the AJ is the cadherin catenin complex (Halbleib and heart function. Yet little is known about the molecular composition of the Nelson, 2006; Ratheesh and Yap, 2012). Classical cadherins are cardiomyocyte AJ or how it is organized to function under mechanical single-pass transmembrane proteins with an extracellular domain that load. Here, we define the architecture, dynamics and proteome of mediates calcium-dependent homotypic interactions. The adhesive the cardiomyocyte AJ. Mouse neonatal cardiomyocytes assemble properties of classical cadherins are driven by the recruitment of stable AJs along intercellular contacts with organizational and cytosolic catenin proteins to the cadherin tail, with p120-catenin β structural hallmarks similar to mature contacts. We combine (CTNND1) binding to the juxta-membrane domain and -catenin β quantitative mass spectrometry with proximity labeling to identify the (CTNNB1) binding to the distal part of the tail. -
Transcriptional Signature of Accessory Cells in the Lateral Line, Using the Tnk1bp1:EGFP Transgenic Zebrafish Line Behra Et Al
Transcriptional signature of accessory cells in the lateral line, using the Tnk1bp1:EGFP transgenic zebrafish line Behra et al. Behra et al. BMC Developmental Biology 2012, 12:6 http://www.biomedcentral.com/1471-213X/12/6 (24 January 2012) Behra et al. BMC Developmental Biology 2012, 12:6 http://www.biomedcentral.com/1471-213X/12/6 RESEARCHARTICLE Open Access Transcriptional signature of accessory cells in the lateral line, using the Tnk1bp1:EGFP transgenic zebrafish line Martine Behra1,3*, Viviana E Gallardo1, John Bradsher3, Aranza Torrado3, Abdel Elkahloun1, Jennifer Idol1, Jessica Sheehy1, Seth Zonies1, Lisha Xu1, Kenna M Shaw2,5, Chie Satou4, Shin-ichi Higashijima4, Brant M Weinstein2 and Shawn M Burgess1 Abstract Background: Because of the structural and molecular similarities between the two systems, the lateral line, a fish and amphibian specific sensory organ, has been widely used in zebrafish as a model to study the development/ biology of neuroepithelia of the inner ear. Both organs have hair cells, which are the mechanoreceptor cells, and supporting cells providing other functions to the epithelium. In most vertebrates (excluding mammals), supporting cells comprise a pool of progenitors that replace damaged or dead hair cells. However, the lack of regenerative capacity in mammals is the single leading cause for acquired hearing disorders in humans. Results: In an effort to understand the regenerative process of hair cells in fish, we characterized and cloned an egfp transgenic stable fish line that trapped tnks1bp1, a highly conserved gene that has been implicated in the maintenance of telomeres’ length. We then used this Tg(tnks1bp1:EGFP) line in a FACsorting strategy combined with microarrays to identify new molecular markers for supporting cells. -
Coordinate Regulation of Long Non-Coding Rnas and Protein-Coding Genes in Germ- Free Mice Joseph Dempsey, Angela Zhang and Julia Yue Cui*
Dempsey et al. BMC Genomics (2018) 19:834 https://doi.org/10.1186/s12864-018-5235-3 RESEARCHARTICLE Open Access Coordinate regulation of long non-coding RNAs and protein-coding genes in germ- free mice Joseph Dempsey, Angela Zhang and Julia Yue Cui* Abstract Background: Long non-coding RNAs (lncRNAs) are increasingly recognized as regulators of tissue-specific cellular functions and have been shown to regulate transcriptional and translational processes, acting as signals, decoys, guides, and scaffolds. It has been suggested that some lncRNAs act in cis to regulate the expression of neighboring protein-coding genes (PCGs) in a mechanism that fine-tunes gene expression. Gut microbiome is increasingly recognized as a regulator of development, inflammation, host metabolic processes, and xenobiotic metabolism. However, there is little known regarding whether the gut microbiome modulates lncRNA gene expression in various host metabolic organs. The goals of this study were to 1) characterize the tissue-specific expression of lncRNAs and 2) identify and annotate lncRNAs differentially regulated in the absence of gut microbiome. Results: Total RNA was isolated from various tissues (liver, duodenum, jejunum, ileum, colon, brown adipose tissue, white adipose tissue, and skeletal muscle) from adult male conventional and germ-free mice (n = 3 per group). RNA-Seq was conducted and reads were mapped to the mouse reference genome (mm10) using HISAT. Transcript abundance and differential expression was determined with Cufflinks using the reference databases NONCODE 2016 for lncRNAs and UCSC mm10 for PCGs. Although the constitutive expression of lncRNAs was ubiquitous within the enterohepatic (liver and intestine) and the peripheral metabolic tissues (fat and muscle) in conventional mice, differential expression of lncRNAs by lack of gut microbiota was highly tissue specific. -
(12) United States Patent (10) Patent No.: US 8,603,824 B2 Ramseier Et Al
USOO8603824B2 (12) United States Patent (10) Patent No.: US 8,603,824 B2 Ramseier et al. (45) Date of Patent: Dec. 10, 2013 (54) PROCESS FOR IMPROVED PROTEIN 5,399,684 A 3, 1995 Davie et al. EXPRESSION BY STRAIN ENGINEERING 5,418, 155 A 5/1995 Cormier et al. 5,441,934 A 8/1995 Krapcho et al. (75) Inventors: Thomas M. Ramseier, Poway, CA 5,508,192 A * 4/1996 Georgiou et al. .......... 435/252.3 (US); Hongfan Jin, San Diego, CA 5,527,883 A 6/1996 Thompson et al. (US); Charles H. Squires, Poway, CA 5,558,862 A 9, 1996 Corbinet al. 5,559,015 A 9/1996 Capage et al. (US) 5,571,694 A 11/1996 Makoff et al. (73) Assignee: Pfenex, Inc., San Diego, CA (US) 5,595,898 A 1/1997 Robinson et al. 5,610,044 A 3, 1997 Lam et al. (*) Notice: Subject to any disclaimer, the term of this 5,621,074 A 4/1997 Bjorn et al. patent is extended or adjusted under 35 5,622,846 A 4/1997 Kiener et al. 5,641,671 A 6/1997 Bos et al. U.S.C. 154(b) by 471 days. 5,641,870 A 6/1997 Rinderknecht et al. 5,643,774 A 7/1997 Ligon et al. (21) Appl. No.: 11/189,375 5,662,898 A 9/1997 Ligon et al. (22) Filed: Jul. 26, 2005 5,677,127 A 10/1997 Hogan et al. 5,683,888 A 1 1/1997 Campbell (65) Prior Publication Data 5,686,282 A 11/1997 Lam et al.