Comparative Mapping of Growth Habit, Plant Height, and Flowering Qtls in Two Interspecific Families of Leymus

Published online November 21, 2006

Comparative Mapping of Growth Habit, Plant Height, and Flowering QTLs in Two Interspecific Families of Leymus

Steven R. Larson,* Xiaolei Wu, Thomas A. Jones, Kevin B. Jensen, N. Jerry Chatterton, Blair L. Waldron, Joseph G. Robins, B. Shaun Bushman, and Antonio J. Palazzo

ABSTRACT Aggressive rhizomes and adaptation to poorly drained Leymus cinereus (Scribn. & Merr.) A´ .Lo¨ve and L. triticoides alkaline sites, primarily within the western USA, charac- (Buckley) Pilg. are tall caespitose and short rhizomatous perennial terize sod-forming L. triticoides (0.3–0.7 m). Conversely, Triticeae grasses, respectively. Circumference of rhizome spreading, L. cinereus is a tall (up to 2 m) conspicuous bunchgrass proportion of bolting culms, anthesis date, and plant height were eval- adapted to deep well-drained soils from Saskatchewan to uated in two mapping families derived from two interspecific hybrids of British Columbia, south to California, northern Arizona, L. cinereus Acc:636 and L. triticoides Acc:641 accessions, backcrossed and New Mexico, and east to South Dakota and Minne- to one L. triticoides tester. Two circumference, two bolting, and two sota. Most populations of L. cinereus and L. triticoides are height QTLs were homologous between families. Two circumference, allotetraploids; however, octoploid forms of L. cinereus seven bolting, all five anthesis date, and five height QTLs were family are typical in the Pacific Northwest. Basin wildrye, and specific. Thus, substantial QTL variation was apparent within and be- octoploid giant wildrye [L. condensatus (J. Presl) A´ . tween natural source populations of these species. Two of the four circumference QTLs were detected in homoeologous regions of linkage Lo¨ve], are the largest cool-season bunch grasses native to groups 3a and 3b in both families, indicating that one gene may control western North America. Artificial hybrids of L. cinereus, much of the dramatic difference in growth habit between these species. L. triticoides, and other North American Leymus wildryes A major height QTL detected in both families may correspond with display regular meiosis and stainable pollen (Stebbins dwarfing mutations on barley 2H and wheat 2A. The L. cinereus parent and Walters, 1949; Dewey, 1972; Hole et al., 1999). Both contributed negative alleles for all four circumference QTLs, five of L. cinereus and L. triticoides are highly self-sterile (Jensen nine bolting QTLs, two of five anthesis date QTLs, and one of seven et al., 1990) and hybridize with each other in nature. height QTLs. Coupling of synergistic QTL allele effects within parental These species are naturally important forage and hay species was consistent with the divergent growth habit and plant height grasses in the Great Basin and other regions of western of L. cinereus and L. triticoides. Conversely, antagonistic QTL alleles North America. evidently caused transgressive segregation in reproductive bolting and flowering time. Growth habit is a highly variable and ecologically important trait in perennial grasses. Aggressive rhizomes characterize quackgrass [Elymus repens (L.) Desv. EYMUS wildryes are long-lived Triticeae grasses, ex Nevski] and johnsongrass [Sorghum bicolor (L.) Lclosely related to wheat (Triticum spp.) and barley Moench], which rank among the world’s worst perennial (Hordeum vulgare L.). The genus Leymus includes grass weeds (Holm et al., 1977). In general, caespitose about 30 species distributed throughout temperate re- (i.e., growing in bunches or tufts) and rhizomatous grasses gions of Europe, Asia, and the Americas (Dewey, 1984). dominate semiarid and mesic grasslands, respectively More than half of all Leymus species are allotetraploids (Sims et al., 1978). Nutrient islands beneath caespitose (2n 5 4x 5 28), but octoploid (2n 5 8x 5 56) and do- grasses may also contribute to clone fitness in this growth decaploid (2n 5 12x 5 84) variants may arise from inter- form in both mesic and semiarid communities, whereas specific hybrids (Anamthawat-Jo´ nsson and Bo¨dvarsdo´ ttir, the distribution of rhizomatous grasses may be restricted 2001) or autoduplication within species. These cool- to microsites characterized by higher soil organic carbon season grasses display remarkable variation in growth and nitrogen concentrations (Derner and Briske, 2001). habit and stature with unusual adaptation to harsh We have observed L. cinereus and L. triticoides growing in polar, desert, saline, and erosion-prone environments. close proximity in mixed stands, at several disturbed sites, Leymus triticoides (creeping or beardless wildrye) and with no apparent difference in microhabitat. Conversely, L. cinereus (basin wildrye) are closely related but mor- we have observed L. triticoides in riparian or wet zones phologically divergent North American range grasses. and L. cinereus inhabiting dry adjacent uplands, restricted to seemingly different natural microhabitats. In any case, L. cinereus and L. triticoides display profound differences S.R. Larson, T.A. Jones, K.B. Jensen, N.J. Chatterton, B.L. Waldron, in growth habit. Lateral branches of L. cinereus grow J.G. Robins, and B.S. Bushman, USDA-ARS, Forage and Range Research Lab., Utah State Univ., Logan, UT 84322-6300; X. Wu, strictly upward, often within the lower leaf sheaths as Univ. of Missouri-Columbia, Columbia, MO 65211; A.J. Palazzo, U.S. tillers, whereas the lateral branches of L. triticoides fre- Reproduced from Crop Science. Published by CropArmy Science Society of America. All copyrights reserved. Corps of Engineers, Engineering Research and Development quently grow horizontally or downward under the soil Center-Cold Regions Research and Engineering Lab., Hanover, NH surface as rhizomes. In addition to obvious morphological 03755-1290. Received 13 Dec. 2005. *Corresponding author (stlarson@ cc.usu.edu). Abbreviations: AFLP, amplified fragment length polymorphism; Published in Crop Sci. 46:2526–2539 (2006). ANTH, anthesis date; BOLT, reproductive bolting; CIRC, plant circum- Genomics, Molecular Genetics & Biotechnology ference; HGHT, plant height; IM, interval mapping; MQM, multiple- doi:10.2135/cropsci2005.12.0472 QTL model; QTL, quantitative trail locus (i); RFLP,restriction fragment ª Crop Science Society of America length polymorphism; rMQM, restricted MQM mapping; STS, sequence- 677 S. Segoe Rd., Madison, WI 53711 USA tagged site; SSR, simple-sequence repeat. 2526 LARSON ET AL.: LEYMUS WILDRYES 2527

differences in growth habit and stature, L. cinereus and L. between the Leymus TTC1 and TTC2 families and compari- triticoides display differences in salt tolerance, seed dor- sons of homoeology with other species, we showed all anchor mancy, seed color, seed shattering, mineral content, til- makers but only those AFLP markers that were detected (ho- lering, texture, and other characteristics. mologous) in both TTC1 and TTC2 families (Fig. 1). The F1 hybrids of L. cinereus and L. triticoides are robust and vigorous plants with relatively large biomass Field Evaluations potential compared to other range grasses of western North America. Wu et al. (2003) recently constructed Ramets from each of the two mapping families (TTC1 and TTC2) were space planted in a randomized complete block high-density molecular genetic linkage maps for two (RCB) design with two replicates (blocks) per family at the full-sib families, TTC1 and TTC2. The 164-sib TTC1 and Utah Agriculture Experiment Station Richmond Farm (Cache 170-sib TTC2 families were derived from two different Co., UT). Each block contained one entry of each of the 164 L. triticoides 3 L. cinereus F1 hybrids, TC1 and TC2, TTC1 siblings or one clone from each of the 170 TTC2 siblings crossed to different clones of the same L. triticoides plus the parental clones (i.e., TC1, TC2 and T) and single-plant tester genotype (T–tester). The TC1 and TC2 F1 hybrids representatives of the heterogeneous L. cinereus Acc:636 and were derived from naturally heterogeneous L. triticoides L. triticoides Acc:641 accessions. Individual ramets were and L. cinereus seed accessions from Oregon and Al- transplanted from soil containers (4-cm diameter) in the berta, respectively. Together, the TTC1 and TTC2 fam- spring of 2001 to field plots with 2-meter row spacing and 2- ilies capture a snippet of the divergence among and meter spacing within rows (2-m centers). Plants were aligned among rows such that each plant had four equidistant (2 m) heterogeneity within the L. triticoides and L. cinereus neighboring plants. Each row contained 34 centers (one plant source populations. These two experimental populations per center), thus blocks were restricted to six or seven rows. provide unique system for gene discovery research and The TTC1 rep1, TTC2 rep1, TTC1 rep2, and TTC2 rep2 development of breeding markers in perennial grasses. blocks were arranged lengthwise, respectively, along the 66-m A close relative of quackgrass, Leymus also provides a rows to form one continuous array comprised of 24 3 34 useful system to study weedy traits such as rhizomes. centers (46 3 66 m). Quantitative traits, described below, were Our primary objective here was to identify, character- measured in 2002, 2003, and 2004. ize, and compare QTLs controlling growth habit, plant Rhizome proliferation was measured as plant circumference height, and flowering traits. Another major objective (CIRC) in late spring or early summer. For caespitose plants, was to compare the location of these Leymus QTLs with this could be simply measured by stretching a tape ruler around the tussock at the soil surface. The circumference of genomic regions controlling related traits in other cereal irregular sods, characteristic of the more rhizomatous plants, and grass species. was approximated as the perimeter of a polygon where the corners represent the outermost rhizome branches (i.e., the shortest distance around the outermost rhizomes) at the soil MATERIALS AND METHODS surface. Anthesis date (ANTH) was measured as the number Plant Materials and Genetic Maps of days from 1 January until the first day of anther extrusion, which is most apparent on warm dry mornings, beginning mid- The full-sib TTC1 and TTC2 molecular genetic maps and June. In practice, the first day of anther extrusion was in- pedigrees were described by Wu et al. (2003). The 164-sib terpolated between two or three observations per week. A TTC1 map included 1069 AFLP markers and 38 anchor loci in priori, one unexpected phenomenon in the TTC1 and TTC2 14 linkage groups spanning 2001 cM. The 170-sib TTC2 map families was variation in reproductive bolting (BOLT), where contained 1002 AFLP markers and 36 anchor loci in 14 linkage some genotypes flowered and some did not, first observed in groups spanning 2066 cM. Some 488 homologous AFLP loci 2002. Individual clones were retrospectively rated as 0 (not and 24 anchor markers, detected in both families, showed sim- flowered) or one (flowered), after seed harvest and mowing, ilar map order among 14 homologous linkage groups of the based on ANTH notes take in 2002. We subsequently rated TTC1 and TTC2 families (Fig. 1). The 14 homologous linkage individual plants for the proportion of bolting culms from 0 (no groups of the allotetraploid TTC1 and TTC2 families were spikes produced) to 1 (virtually all major culms bolting), be- tentatively numbered according to the seven homoeolgous fore seed harvests and mowing, in 2003 and 2004. Plant height groups of the Triticeae grasses on the basis of synteny of two (HGHT)as measured after anthesis using a 2-m ruler. Plant or more anchor markers from each of the seven homoeologous groups of wheat and barley. Moreover, genome-specific STS height (i.e., actual culm length from soil surface to the spike markers were used to distinguish the Ns and Xm marker se- terminal) was not measured on plants that did not flower. quences for homoeologous groups four and five on the basis of similarity to Psathyrostachys juncea (Fisch.) Nevski (genome Data Analysis designation Ns), which is one of the diploid ancestors of al- Reproduced from Crop Science. Published by Crop Sciencelotetraploid Society of America. All copyrights reserved. Leymus (Wu et al., 2003). Otherwise, homoeo- QTL analyses were based on trait means from two logous chromosomes of allotetraploid Leymus were arbitrarily replicants for each of the 164 TTC1 and 170 TTC2 segregates distinguished by the letters “a” or “b.” For example, LG3a is in 2002, 2003, and 2004. QTL analyses were also performed on allegedly homoeologous with LG3b (Fig. 1), an assertion sup- averages over all 3 yr, using output from the LSMEANS pro- ported by synteny among 10 of the 11 anchor markers mapped cedure of SAS (Statistical Analysis Systems Institute Inc., to these linkage groups (Wu et al., 2003). Additional SSR and Cary, NC). Coefficients of skewness and kurtosis, g1, and g2 STS anchor markers described in the results below were were calculated as described by Snedecor and Cochran (1980). analyzed by methods described by Wu et al. (2003). Detailed Departures from normality were deemed significant if they genetic maps containing all 1583 AFLP markers mapped in exceeded two standard errors of skewness (SES) and kurto- the TTC1 and/or TTC2 families are shown in Supplementary sis (SEK) estimated by (6/N)22 and (24/N)22, respectively (Ta- Data files online. For essential comparisons of homology bachnick and Fidell, 1996). Histograms of phenotypic values 2528 CROP SCIENCE, VOL. 46, NOVEMBER–DECEMBER 2006

(clonal averages) from 2002, 2003, and 2004 were also prepared used in a multiple-QTL model (MQM) (Jansen, 1993; Jansen, for CIRC, BOLT, ANTH, and HGHT (Supplementary Data). 1994; Jansen and Stam, 1994). Markers with the highest log- Broad-sense heritabilities within years were obtained us- likelihood ratios (i.e., LOD test statistics) for each QTL (no ing a SAS program for estimating heritability from lines more than one per chromosome) were selected as the initial evaluated in an RCB design in a single environment (Holland set of possible MQM cofactors. A backward elimination pro- et al., 2003). Likewise, heritabilities among years were ob- cedure was applied to this initial set of cofactors using a tained using another SAS program for estimating heritability conservative significance level of 0.001 to ensure the indepen- from lines evaluated in RCB designs in multiple environments dence of each cofactor. A reiterative process of restricted (Holland et al., 2003), modified to account for repeated mea- MQM (rMQM) mapping, which excludes any syntenous co- surements on perennial plants. All class variables (i.e., rep, factors (i.e., cofactors located on the same linkage group that clone, year) were treated as random effects. Genotypic and is being scanned), was used to refine the location of rMQM phenotypic correlations between traits evaluated using a SAS cofactors (QTLs) and identify new rMQM cofactors (QTLs). program for estimating correlations from RCB designs in Moreover conventional MQM mapping was used to detect (or multiple environments (Holland et al., 2003), also modified to exclude) syntenous QTLs, where that possibility was apparent. account for repeated measurements. The original SAS Finally, all putative QTLs were also evaluated using the non- programs for estimating heritabilities, genotypic correlations, parametric Kruskal–Wallis rank sum test, equivalent to the and phenotypic correlations (Holland et al., 2003) are two-sided Wilcoxon rank sum test for two genotype classes available at http://www4.ncsu.edu/|jholland/homepage_files/ (this study), which means that no assumptions are being made Page571.htm (verified 24 July 2006). for the probability distributions of the quantitative traits A sequential and reiterative procedure of QTL detection (Lehmann, 1975). was performed using the MAPQTL five package (Van Ooijen, A threshold of 3.3 LOD was used throughout these QTL, 2004). Genome-wide interval mapping (IM) (Lander and MQM, and rMQM detection procedures as a close approxi- Botstein, 1989; Van Ooijen, 1992) was performed in 1-cM in- mation for a genome-wide 5% significance level as determined crements to identify putative QTLs and possible cofactors from simulation tables based on genome size and family type Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved.

Fig. 1. Continued on next page. LARSON ET AL.: LEYMUS WILDRYES 2529 Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved.

Fig. 1. Continued on next page. 2530 CROP SCIENCE, VOL. 46, NOVEMBER–DECEMBER 2006 Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved.

Fig. 1. Continued on next page. LARSON ET AL.: LEYMUS WILDRYES 2531 Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved.

Fig. 1. Summary and comparison of plant height, growth habit, and flowering QTLs detected in the full-sib Leymus triticoides 3 (L. triticoides 3 L. cinereus) TTC1 and TTC2 families based on 2002, 2003, 2004, and average measurements. The approximate location of QTLeffects (LOD 3.3), corresponding to a genome-wide P # 0.05 signficance level, detected using a restricted multiple QTL model (rMQM) are indicated by black or white bars for each trait 3 year. The updated molecular genetic linkage maps include 488 homologous AFLP markers and mapped in both TTC1 and TTC2 families (Wu et al., 2003), 50 anchor markers (larger bold marker text) mapped in TTC1 and/or TTC2 families (Wu et al., 2003), and 17 additional anchor markers (larger bold italic marker text) mapped in the TTC1 and/or TTC2 families. Annotation next to each anchor marker indicate homoeologous groups of barley (H), wheat (ABD), cereal rye (R), and in parentheses oat chromosome designations. 2532 CROP SCIENCE, VOL. 46, NOVEMBER–DECEMBER 2006

(Van Ooijen, 1999) and empirical thresholds based on permu- Of special interest with regard to flowering traits, the tation analyses with 1000 replications (Churchill and Doerge, VRN1 and VRN2 genes are the two most potent genes 1994) specific to each trait. Both methods (Van Ooijen, 1999; controlling differences in vernalization requirement be- Churchill and Doerge, 1994) produced remarkably similar re- tween winter annual and spring annual barley, wheat, sults for all four traits evaluated in this study. and rye (Dubcovsky et al., 1998), and both of these genes Genome-wide IM and rMQM LOD scans based on 2002, 2003, 2004, and average phenotypic values were performed for have been cloned (Yan et al., 2003, 2004). The VRN2 CIRC, BOLT, ANTH, and HGHTusing MapChart version 2.1 gene is present on homoeologous regions of 4H in winter (Voorrips, 2002) and the updated Leymus TTC1 and TTC2 barleys (evidently absent in most spring barleys) and a genetic maps as described in the results section below. Detailed 4A/5A translocation region of Triticum monococcum 5A graphs of each genome-wide LOD scan using the complete (Dubcovsky et al., 1998; Yan et al., 2004). Primers high-density linkage maps are provided in the Supplementary designed from the wheat VRN2 gene amplified mixed Data Online. sequences from Leymus that were very similar in size (supplemental data) and sequence (DQ486013) to the RESULTS wheat VRN2 gene. These putative Leymus VRN2 sequences map to a locus on the distal long arm of Leymus Molecular Map Update 5Ns (Fig. 1), which evidently corresponds to the VRN2 A subset of 48 CSU or KSU wheat SSR primer pairs locus on Triticum monococcum 5A. Although we have described by Yu et al. (2004), the HVCABG SSR not yet mapped the Leymus VRN1 sequences, this gene primers described by Becker and Heun (1995), and the is closely associated with the CDO504 marker in other HVM068 SSR primers described by Liu et al. (1996) Triticeae species and also maps to Leymus LG5Ns and were tested for amplification and polymorphism among LG5Xm (Fig. 1) (Wu et al., 2003). the parental genotypes. Seven of these SSR primer pairs In summary, seven SSR primer pairs and seven STS (CNL45, KSU154, CNL39, HVCABG, HVN068, primer pairs (supplemental data) detected 15 additional KSU149, and KSU171) detected 11 loci in the Leymus anchor loci in the TTC1 family and nine additional TTC1 and/or TTC2 families (Fig. 1). Likewise, another anchor loci in the TTC2 family, not previously described subset of 48 published STS primer pair sequences (Mano by Wu et al. (2003). The updated TTC1 map includes et al., 1999; Taylor et al., 2001; Lem and Lallemand, 1069 AFLP markers and 53 anchor loci in 14 linkage 2003), three sets of STS primers designed from the wheat groups spanning 2001 cM. The updated TTC2 map con- VRN2 (Yan et al., 2004), and one set of STS primers tained 1002 AFLP markers and 45 anchor loci in 14 designed from the BCD1117 barley cDNA clone (Heun linkage groups spanning 2066 cM. Some 488 homolo- et al., 1991) were also tested for amplification and poly- gous AFLP loci and 31 anchor markers have been morphism among the parental genotypes. Seven of these mapped in both families, showing similar map order. STS primer pairs (TRX1, TRX2, BCD1117, MWG2230, Thus, 1583 AFLP markers and 67 different anchor loci VRN2, MWG2264, and ADP) detected 13 loci in the have been mapped into 14 linkage groups, which evi- Leymus TTC1 and/or TTC2 families (Fig. 1). dently correspond to the 14 chromosome pairs of allo- The thioredoxin h RFLP marker, Xbm2,mapsnearthe tetraploid Leymus (2n 5 4x 5 28). The map locations self-incompatibility gene locus, S, on homeologous group of the 17 new anchor loci (24 total including seven 1R of Secale (Korzun et al., 2001), and thioredoxin h STS homologous pairs) (Fig. 1) were largely consistent with markers have been utilized in perennial ryegrass (Taylor the other anchor loci previously mapped in Leymus (Wu et al., 2001) and Kentucky bluegrass (Patterson et al., et al., 2003). 2005). The thioredoxin h STS primers used by Patterson et al. (2005) amplified two distinct sets of sequences, designated TRX1 (AY943821 and AY943822 from L. ci- Growth Habit nereus Acc:636; AY943823 and AY943824 from L. triti- The L. cinereus Acc:636 and L. triticoides Acc:641 coides Acc:641) and TRX2 (AY943825-AY943827 from progenitor accessions displayed very different levels L. cinereus Acc:636; AY943828-AY943830 from L. triti- of rhizomatous spreading, which became more pro- coides Acc:641). We designed TRX1 and TRX2 primers nounced each year (Table 1). Although CIRC measure- that would amplify corresponding sequences from L. cine- ments of the TC1 and TC2 F1 hybrids were significantly reus but not L. triticoides—thus providing informative poly- greater than L. cinereus Acc:636, these means were well- morphisms for mapping in the TTC1 and TTC2 backcross below the midparent, TTC1, and TTC2 averages es- families. The TRX2 amplicons mapped to homologous po- pecially in 2004 (Table 1). Reproduced from Crop Science. Published by Cropsitions Science Society of America. All copyrights reserved. of the LG6b linkage group, evident by the colin- Circumference of plant (rhizome) spreading showed iearity with homologous TTC1 and TTC2 AFLP markers relatively strong broad-sense heritabilities in the TTC1 (Fig. 1). The TRX1 primers amplified 289 bp sequences family and moderate heritabilities in the more rhizoma- that mapped to LG1a in TTC1 and LG2b in TTC2 (Fig. 1). tous TTC2 family (Table 2). The CIRC trait also showed The TRX1 locus on LG1a is presumably homeologous to especially strong heritabilities over years, in both TTC1 the Xbm2 locus on Secale 1R. The role of thioredoxin and TTC2 families; however, this is expected because h genes in seed germination, self-incompatibility, grain plant spreading is a cumulative trait. Not surprisingly, quality, and characteristics has been evaluated in cereals, the ratio of genotype 3 year to phenotypic variance was grasses, and other plants (Juttner et al., 2000; Langridge negligible (0.02) for the CIRC trait. The CIRC trait was et al., 1999; Li et al., 1994, 1997; Sahrawy et al., 1996). weakly correlated with the BOLT and ANTH flowering LARSON ET AL.: LEYMUS WILDRYES 2533

Table 1. Trait means 6 SD for circumference of plant spreading (CIRC), proportion of bolting culms (BOLT), anthesis date (ANTH), and plantheight (HGHT) for Leymus cinereus Acc:636, L. triticoides Acc:641, L. triticoides T parental genotype, interspecific TC1 and TC2 parental hybrids, and full-sib L. triticoides 3 (L. triticoides 3 L. cinereus) TTC1 and TTC2 mapping families. Trait Year Acc:636 (n 5 18)† Acc:641 (n 5 15)† t tester (n 5 13)‡ TC1 (n 5 14)‡ TC2 (n 5 14)‡ TTC1 (n 5 164)§ TTC2 (n 5 168)§ CIRC 2002 23 6 10 354 6 186 487 6 61 96 6 35 125 6 37 180 6 91 299 6 116 2003 51 6 26 594 6 326 853 6 120 200 6 32 231 6 38 288 6 122 449 6 154 2004 76 6 21 816 6 416 1263 6 177 256 6 39 282 6 53 362 6 137 548 6 170 Avg. 57 6 23 702 6 208 653 6 112 183 6 28 212 6 40 273 6 112 430 6 144 BOLT 2002 0.28 6 0.46 0.67 6 0.48 1.00 6 0.00 0.79 6 0.43 1.00 6 0.00 0.57 6 0.43 0.73 6 0.38 2003 0.63 6 0.43 0.56 6 0.32 0.98 6 0.06 0.88 6 0.19 0.77 6 0.21 0.33 6 0.24 0.36 6 0.25 2004 0.85 6 0.33 0.78 6 0.35 1.00 6 0.00 0.84 6 0.19 0.81 6 0.23 0.55 6 0.26 0.67 6 0.27 Avg. 0.60 6 0.58 0.74 6 0.24 0.99 6 0.03 0.83 6 0.14 0.85 6 0.09 0.49 6 0.26 0.59 6 0.26 ANTH 2002 176.8 6 2.1 173.3 6 2.6 172.0 6 0.0 173.6 6 2.1 173.1 6 1.5 173.5 6 1.9 173.8 6 4.8 2003 171.1 6 5.1 169.3 6 1.4 169.0 6 0.0 169.0 6 0.0 169.0 6 0.0 172.1 6 5.7 171.3 6 4.9 2004 178.3 6 3.9 172.6 6 1.6 173.0 6 0.0 175.9 6 4.0 175.9 6 4.0 175.7 6 4.6 174.1 6 3.7 Avg. 175.9 6 2.4 172.2 6 1.1 171.3 6 0.0 172.8 6 1.3 172.6 6 1.5 174.5 6 3.5 173.4 6 4.0 HGHT 2002 99.0 6 39.8 94.5 6 12.6 100.8 6 5.7 145.8 6 15.9 141.8 6 10.6 103.9 6 13.8 109.7 6 13.0 2003 135.6 6 23.0 98.5 6 8.5 100.9 6 5.9 155.1 6 12.6 138.4 6 13.3 108.3 6 12.9 106.1 6 12.4 2004 182.9 6 18.5 123.3 6 12.7 125.7 6 3.4 184.7 6 12.3 164.6 6 8.7 134.8 6 13.8 137.8 6 11.8 Avg. 142.2 6 26.0 107.3 6 8.7 109.2 6 2.4 161.8 6 11.2 148.3 6 8.3 116.1 6 12.5 117.9 6 10.7 Measurements expressed in cm (CIRC and HGHT), proportion (BOLT), and days from January one (ANTH). † Sample size based on individual plants. ‡ Sample size based on individual clones of each parental genotype. § Sample size based on means of two clones for each genotype (n).

traits, in the TTC1 and/or TTC2 families, but virtually highly significant (P , 0.0001) on the basis of the non- independent from plant height in both TTC1 and TTC2 parametric Kruskal–Wallis rank sum test. families (Table 3). At least three significant CIRC QTLs were detected Flowering Traits in each family; however, not more than two QTLs were significant in any one year and population (Table 4, The BOLT and ANTH traits showed relatively strong Fig. 1). The strongest, most consistent CIRC QTLs in negative genotypic correlations in both TTC1 and TTC2 both TTC1 and TTC2 families were located in homolo- families (Table 3), evidently controlled by several common gous regions of LG3a (Table 4, Fig. 1). Likewise, homolo- (probably pleiotropic) QTLs (Fig. 1). Thus, data from gous CIRC QTLs were also detected on LG3b in both these two traits are presented together in one section. TTC1 and TTC2 families (Fig. 1). The LG3a and LG3b The L. cinereus Acc:636 and L. triticoides Acc:641 pro- CIRC QTLs, detected in both TTC1 and TTC2 families, genitor accessions; F1 interspecific hybrids (TC1 and are all located near homoeologous copies of VP1 gene TC2); and TTC1 and TTC2 families displayed similar markers (Fig. 1). The transcription factor Viviparous-1 BOLT and ANTH phenotypic means (Table 1), except (encoded by the Vp1 gene) induces and maintains seed for the fact that L. cinereus showed relatively weak bolt- dormancy (McCarty et al., 1991) and has been mapped ing in the first establishment year. Leymus cinereus has a to orthologous loci in wheat, maize, and rice (Bailey et al., relatively large stature, requiring several years to reach 1999).Inadditiontothehomologousandpossiblyhomoeo- reproductive maturity. Yet, the TTC1 and TTC2 families logous QTLs detected on LG3a and LG3b, in both TTC1 displayed transgressive BOLT and ANTH segregation and TTC2 families, a TTC1-specific CIRC QTL was de- that persisted through 2002, 2003, and 2004 (see trait tected on LG6a and a TTC2-specific CIRC QTL was de- distributions in Supplemental Data). Unlike the F1 hy- tected on LG5Xm (Fig. 1). Thus, two CIRC QTLs were brids or parental source populations, some transgressive common to both TTC1 and TTC2 families and two were progeny failed to flower in 2002, 2003, 2004, and 2005. unique to only one family.The L. cinereus alleles had nega- The BOLT and ANTH traits both showed relatively tive effects at all four (LG3a, LG3b, LG5Xm, and LG6a) weak plot-mean heritabilities over years (Table 2). The CIRC QTLs (Table 4, Fig. 1) consistent with divergent ratio of genotype 3 year interaction to phenotypic var- phenotypes of the parental species. iance was substantially greater for ANTH (0.18) and Although significant skewness was detected in several BOLT (0.21) compared with CIRC (0.02) or HGHT evaluations, all four CIRC QTLs (Table 4, Fig. 1) were (0.13), which explains the low plot-mean heritabilities

Table 2. Estimates of broad-sense heritability (H 2) 6 SE based on a plot basis and, in parentheses, genotypic mean basis for circumference Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. of plant spreading (CIRC), proportion of bolting culms (BOLT), anthesis date (ANTH), and plant height (HGHT) in the full-sib Leymus triticoides 3 (L. triticoides 3 L. cinereus) TTC1 and TTC2 mapping families. Trait Family 2002 2003 2004 Over years CIRC TTC1 0.72 6 0.04 (0.84 6 0.03) 0.77 6 0.03 (0.87 6 0.02) 0.73 6 0.04 (0.85 6 0.02) 0.64 6 0.04 (0.91 6 0.01) TTC2 0.54 6 0.06 (0.70 6 0.05) 0.55 6 0.06 (0.71 6 0.05) 0.57 6 0.05 (0.73 6 0.04) 0.50 6 0.05 (0.86 6 0.03) BOLT TTC1 0.44 6 0.06 (0.61 6 0.06) 0.63 6 0.05 (0.77 6 0.04) 0.64 6 0.05 (0.77 6 0.04) 0.38 6 0.04 (0.76 6 0.04) TTC2 0.43 6 0.06 (0.61 6 0.06) 0.64 6 0.05 (0.78 6 0.04) 0.69 6 0.04 (0.81 6 0.03) 0.41 6 0.04 (0.78 6 0.03) ANTH TTC1 0.50 6 0.07 (0.67 6 0.07) 0.42 6 0.08 (0.59 6 0.08) 0.51 6 0.06 (0.67 6 0.06) 0.31 6 0.05 (0.71 6 0.05) TTC2 0.73 6 0.04 (0.84 6 0.03) 0.43 6 0.08 (0.60 6 0.07) 0.46 6 0.07 (0.63 6 0.06) 0.41 6 0.04 (0.78 6 0.03) HGHT TTC1 0.69 6 0.05 (0.81 6 0.03) 0.51 6 0.07 (0.68 6 0.06) 0.73 6 0.04 (0.84 6 0.03) 0.54 6 0.04 (0.86 6 0.02) TTC2 0.66 6 0.05 (0.79 6 0.03) 0.53 6 0.06 (0.69 6 0.06) 0.59 6 0.05 (0.75 6 0.04) 0.48 6 0.04 (0.82 6 0.03) 2534 CROP SCIENCE, VOL. 46, NOVEMBER–DECEMBER 2006

Table 3. Genotypic and in parentheses phenotypic trait correlations 6 SE for circumference of plant spreading (CIRC), proportion of bolting culms (BOLT), anthesis date (ANTH), and plant height (HGHT) in the full-sib Leymus triticoides (L. triticoides 3 L. cinereus) TTC1 (below diagonal) and TTC2 (above diagonal) families. CIRC BOLT ANTH HGHT CIRC — 0.24 6 0.09 (0.13 6 0.05) 20.22 6 0.09 (20.10 6 0.05) 0.12 6 0.09 (0.02 6 0.05) BOLT 0.22 6 0.08 (0.15 6 0.05) — 20.83 6 0.04 (20.56 6 0.03) 0.32 6 0.09 (0.36 6 0.04) ANTH 20.33 6 0.09 (20.22 6 0.05) 20.81 6 0.06 (20.48 6 0.03) — 20.26 6 0.09 (20.32 6 0.04) HGHT 0.01 6 0.09 (0.04 6 0.06) 0.32 6 0.09 (0.40 6 0.04) 0.07 6 0.11 (20.19 6 0.05) —

over years for the ANTH and BOLT flowering traits. there is insufficient separation of the TTC1 and TTC2 Although, BOLT and ANTH traits show significant ge- BOLT QTLs on LG6a to declare these as different (Fig. 1). notype 3 year interaction and the significance of QTLs Thus, L. cinereus contributed five negative TTC1 and/or vary by year (Tables 4), several QTLs were detectable TTC2 BOLT QTL alleles and four positive TTC1 and/or over years (Fig. 1). One notable exception was a highly TTC2 BOLT QTL alleles (Table 4, Fig. 1). Two of these significant TTC2 ANTH QTL on LG6a in 2002, which nine BOLT QTLs were significant in both TTC1 and was virtually nonexistent in subsequent years. Bolting TTC2 families (i.e., homologous), whereas seven QTLs deficiencies were strongly correlated with late flowering were unique to TTC1 or TTC2. Four QTLs explained up and weakly correlated with short caespitose character- to 43.9% of the BOLT variation in the 2003 TTC2 data istics (Table 3). set, which was the most explanatory QTL model in this A total of nine BOLT QTLs were detected in the study (Table 4). TTC1 and/or TTC2 families (Table 4, Fig. 1). The TTC1 A total of five significant ANTH QTLs were detected and TTC2 BOLT QTL peaks on the upper portion of in the TTC1 or TTC2 families (Table 4, Fig. 1). All five LG4Xm overlap well enough (Fig. 1) that we counted significant ANTH QTLs were unique to TTC1 or TTC2 these as one homologous QTL. Likewise, we believe that (Table 4 and Fig. 1). However, the TTC1 family displayed

Table 4. Summary of QTL effects detected using multiple QTL model (MQM) scans of circumference of plant spreading (CIRC), proportion of bolting culms (BOLT), anthesis date (ANTH), and plant height (HGHT) in the full-sib Leymus triticoides 3 (L. cinereus 3 L. triticoides) TTC1 and TTC2 backcross mapping families. Trait Family Position (interval†) 2002 LOD (R2, effect‡) 2003 LOD (R2, effect‡) 2004 LOD (R2, effect‡) Average LOD (R2, effect‡) CIRC TTC1 3a (125–137) NS 3.88 (10.7%, 279)§ 3.16 (9.3%, 283)§ 3.41 (10.0%, 269)¶ 3b (111–112) NS 3.47 (8.5%, 273)¶ NS NS 6a (107–144) NS NS 4.08 (9.9%, 287)§ 3.33 (8.2%, 64.4)§ Overall R2 NS 16.9% 18.4% 16.4% TTC2 3a (111–161) 4.36 (10.2%, 275)§ 5.15 (12.0%, 2107)§ 3.9 (9.0%, 2102)§ 5.44 (12.8%, 2104)§ 3b (111–144) 3.56 (8.4%, 268)§ NS NS NS 5Xm (25–66) NS 3.84 (8.7%, 294)§ 4.76 (12.1%, 2121)§ 4.49 (10.4%, 296)§ Overall R2 19.7% 21.0% 20.3% 20.4% BOLT TTC1 3a (27–80) NS NS 6.12 (13.3%, 10.19)§ 4.00 (7.6%, 10.14)¶ 4Xm (11–42) 3.17 (7.4%, 20.24)§ 4.12 (10.9%, 20.16)§ 5.12 (11.4%, 20.18)§ 6.33 (13.6%, 20.19)§ 6a (61–88) 3.57 (8.4%, 10.25)§ NS NS 4.01 (8.1%, 10.15)§ 6b (95–117) NS NS 3.47 (9.3%, 20.16)¶ 4.11 (10.0%, 20.16)§ 7b (11–15) 3.20 (7.0%, 10.24)§ NS NS NS Overall R2 25.7% 10.9% 28.9% 35.9% TTC2 1b (47–85) NS 5.38 (8.9%, 20.15)§ NS NS 4Ns (0–24) 3.78 (8.7%, 20.25)§ NS NS NS 4Ns (95–142) 4.36 (10.8%, 10.26)§ 4.53 (9.0%, 10.16)§ 5.65 (15.3%, 10.21)§ 5.64 (11.3%, 10.18)§ 4Xm (23–41) NS 4.05 (7.2%, 20.13)§ NS 4.37 (9.2%, 20.16)§ 4Xm (68–109) NS 4.61 (8.1%, 20.14)¶ NS NS 6a (80–125) NS 7.33 (15.4%, 10.20)§ NS 4.89 (12.4%, 10.18)§ Overall R2 19.9% 43.9% 15.3% 32.6% ANTH TTC1 2a (121–139) NS NS NS 4.59 (11.4%, 12.5)§ 6b (108–127) NS NS NS 4.00 (9.9%, 12.2)¶ Overall R2 NS NS NS 19.2% TTC2 4Ns (87–124) 3.54 (7.6%, 22.7)§ 5.21 (15.9%, 24.5)§ NS 5.42 (14.7%, 23.12)§ 4Xm (32–34) 3.70 (7.5%, 12.7)§ NS NS NS 6a (108–127) 5.85 (15.6%, 23.9)§ NS NS NS Overall R2 30.9% 13.7% NS 14.7% HGHT TTC1 2a (30–105) 7.66 (23.5%, 113.3)§ 6.74 (15.2%, 110.1)§ 10.8 (24.5%, 113.6)§ 10.36 (21.2%, 111.6)§ 2b (130–164) NS NS 5.16 (10.7%, 19.0)§ 5.07 (9.6%, 17.8)§ 5Ns (42–44) NS 3.44 (7.4%, 17.0)¶ NS NS e Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. 5Xm (0–11) NS NS NS 3.77 (7.0%, 26.8) 6b (0–24) NS 3.86 (11.7% 19.1)§ NS NS Overall R2 20.6% 31.4% 33.8% 38.8% TTC2 2a (37–103) 8.56 (17.5%, 111.1)§ 4.20 (9.3%, 17.6)§ 3.50 (8.8%, 17.0)§ 6.40 (14.2%, 18.1)§ 3a (20–34) 4.10 (8.7%, 17.74)¶ 4.15 (9.2%, 17.5)¶ NS 3.98 (7.9%, 16.0)§ 3a (77–89) NS 3.42 (7.2%, 16.7)§ 4.96 (13.2%, 18.6)§ NS 5Xm (6–82) 5.64 (11.1%, 28.8)§ NS NS 4.65 (9.1%, 26.9)§ Overall R2 34.1% 28.8% 20.3% 34.5% † Approximate positions (cM) where LOD scan exceeded 3.3 threshold as shown in Fig. 1. ‡ Mean of heterozygous genotype (L. cinereus and L. triticoides alleles)– mean of homozygous genotypes (two L. triticoides alleles) expressed in centimeters (CIRC and HGHT), proportions (BOLT), or days (ANTH). § Cofactors selected by interval mapping (LOD . 3.3) and backward elimination (significant at the 0.001 level). ¶ Additional cofactors identified by restricted multiple QTL model mapping (LOD . 3.3) and backward elimination. LARSON ET AL.: LEYMUS WILDRYES 2535

ANTH LOD values that were nearly significant on a (Table 4, Fig. 1). The single largest HGHT QTL was chromosome region homologous to the TTC2 ANTH located in homologous regions of LG2a in both TTC1 QTL on LG4Xm (see ANTH LOD scan in Supple- and TTC2 families. Likewise, overlapping TTC1 and mental Data). Similarly, both TTC1 and TTC2 displayed TTC2 HGHT QTLs on LG5Xm were too close to sepa- nearly significant ANTH LOD values on homologous rate (Fig. 1), which we count as one homologous QTL. regions of LG3b. In any case, L. cinereus contributed Moreover, LG5Xm was the only chromosome that con- three positive and two negative ANTH QTL alleles at tributed negative HGHT QTL alleles from the taller L. the five significant QTLs (Table 4, Fig. 1). cinereus species, which also seems to support our inter- The genome-wide LOD scans were similar but not pretation that these are homologous QTLs in the TTC1 identical for the BOLTand ANTH flowering traits (Fig. 1 and TTC2 families. Thus, L. cinereus contributed six and Supplemental Data). The TTC1 BOLT QTL on positive and one negative HGHT QTL alleles in the LG3a had no apparent effects on ANTH. The TTC2 TTC1 and/or TTC2 families, which is consistent with di- BOLT QTLs on LG4Ns were associated with significant vergent phenotypes of the parental species. or nearly significant ANTH QTLs. Likewise, the BOLT QTLs on LG4Xm were associated with significant or nearly significant ANTH QTLs in the TTC1 and TTC2 DISCUSSION families. The TTC1 ANTH QTL on LG 5Ns was as- Leymus Molecular Genetic Maps sociated with elevated BOLT LOD, albeit less than the 3.3 LOD threshold (Supplemental Data). Interestingly, Seventeen additional anchor markers described in this the TTC1 and TTC2 BOLT QTLs on LG6a were as- study support previous linkage group identifications, ten- sociated with significant ANTH QTLs only in the TTC2 tatively numbered according to the seven homoeologous family. The TTC1 BOLT QTL on LG6a was not as- groups of the wheat, barley, and rye Triticeae cereals sociated with elevated ANTH LOD values. The latter (Wu et al., 2003). Among the well-characterized Triticeae genomes, researchers have detected one rearrangement observation raises some doubt about the putative ho- I mology of the TTC1 and TTC2 BOLT QTLs on LG6a in Aegilops longissima Schweinf. & Muschl. (S ge- (Fig. 1). Finally the TTC1 BOLT QTLs on LG6b and nome), 11 in Ae. umbellulata Zhuk. (U genome), 0 in LG7b were closely associated with a significant or nearly Ae. speltoides Tausch (S genome), seven in Secale cereale significant ANTH QTLs, respectively. L. cultivated ryes (R genome), and two paracentric Significant skewness and kurtosis was detected for inversions in H. vulgare cultivated barleys (H genome) BOLT and ANTH; however, all QTLs (Table 4, Fig. 1) relative to Ae. tauschii Coss., the donor of the hexaploid were highly significant (P , 0.0001) on the basis of the wheat D genome (Devos and Gale, 2000). The A, B, and nonparametric Kruskal–Wallis rank sum test. D genomes of allohexaploid wheat are evidently colinear except for several large reciprocal translocations involving chromosome arms 2BS and 6BS and chromosomes Plant Height 4A, 5A, and 7B (Devos and Gale, 2000). One of these The L. cinereus Acc:636 plants were substantially rearrangements involves a reciprocal translocation be- taller than the L. triticoides Acc:641 plants in 2003 and tween 4AL and 5AL, which includes the VRN2 gene in 2004 (Table 1). However, the L. cinereus plants require T. monococcum L. (Dubcovsky et al., 1998; Yan et al., several years to reach full-size; thus, interspecific dif- 2004). Interestingly, the location of the VRN2 gene on ferences in plant height were not apparent in 2002. Leymus LG5Ns evidently corresponds with the location Interestingly, the TC1 and TC2 F1 hybrid genotypes of VRN2 in T. monococcum (Devos et al., 1995; Dub- displayed greater plant height than the L. cinereus Acc: covsky et al., 1996). Thus, the LeymusNsandT. mono- 636 or L. triticoides Acc:641 reference individuals, espe- coccum genomes evidently share the same 4AL/5AL cially in 2002 and 2003 (Table 1). The 2004 HGHT means translocation arrangement. Although we detected seven were substantially greater in 2004, which may be attrib- instances of marker synteny in Leymus that were not utable to better rainfall (i.e., 2002 and 2003 were severe syntenous in other Triticeae species, we have no firm drought years) and/or longer plant establishment. evidence of rearrangements other than the putative 4Ns/ Heritabilities over years (Table 2) for HGHT were 5Ns translocation that has already been documented in intermediate between CIRC and the two flowering traits wheat. Incongruent RFLP marker locations can often (ANTH and BOLT). Likewise, the ratio of genotype 3 be attributed to paralogous duplications or, in the case year interaction to phenotypic variance for HGHT (0.13) of PCR, priming annealing at nonhomologous loci. Al- Reproduced from Crop Science. Published by Crop Sciencewas Society of America. All copyrights reserved. intermediate between CIRC (0.02) and the flow- though there is substantial evidence of colinearity between ering traits, ANTH (0.18) and BOLT (0.21). Weak posi- the Leymus Ns, Leymus Xm, wheat A, wheat B, wheat D, tive genotypic correlations between HGHT and BOLT and barley H genomes, we cannot exclude the possibility of were detected in TTC1 and TTC2 families, but no a few yet undetected rearrangements in Leymus. other trait correlations with HGHT were detected in These are the first QTL analyses conducted using the both families. high-density linkage maps published by Wu et al. (2003). We detected a total of seven HGHT QTLs in the Throughout much of the linkage map, relatively small TTC1 and/or TTC2 families (Table 4, Fig. 1). The TTC2 irregularities in the LOD scans (Supplemental Data) re- HGHT QTL on LG3a was split into two QTLs using a sulted from imperfect genotyping, missing data, and am- combination of rMQM and unrestricted MQM mapping biguous marker orders. Nevertheless, these QTL maps 2536 CROP SCIENCE, VOL. 46, NOVEMBER–DECEMBER 2006

provide a useful starting point for high-resolution QTL BCD1130, BCD1707, and PSR128 loci. The PSR128 mapping experiments using six advanced backcross marker also maps in the centromere region of maize populations that are currently being genotyped and evalu- chromosome 4 near the recessive lazy1 (la1) gene (Law- ated in clonally replicated field trials. rence et al., 2004). Lazy maize mutants, allelic to la1, actively grow downward (prostrate) under light (Firn Comparison of TTC1 and TTC2 QTLs et al., 2000). We found BCD1707 and BCD1130 sequences on rice chromosome 11, using a TBLASTX Two circumference, two bolting, and two height QTLs search (Ware et al., 2002) of the rice genome (Interna- were evidently homologous in both TTC1 and TTC2 tional Rice Genome Project, 2005), near another lazy (la) families. Conversely, two circumference, seven bolting, gene (Miura et al., 2003). The centromere and short arm all five anthesis date, and five height QTLs were unique regions of Triticeae group 5 are homoeologous to rice to TTC1 or TTC2 families. Differences between the chromosomes 9 and 12, respectively (Van Deynze et al., TTC1 and TTC2 families can be attributed to differences 1995; La Rota and Sorrells 2004). Rice chromosome 9 between the TC1 and TC2 hybrids, which in turn can only contains a major QTL (Ta) for tiller angle (Li et al., 1999). be attributed to genetic variation within the L. cinereus The TTC1 CIRC QTL peak on LG6a is located ap- Acc:636 and L. triticoides Acc:641 natural germplasm proximately (minus) 40 cM from the MWG2264 locus. sources. Thus, functionally important QTL variation was Interestingly, the uniculm (cul2) mutation and MWG2264 apparent within and between natural source populations loci are both located (minus) 8.8 and 3 cM relative to the of these experimental families and species. cMWG679 locus on barley 6H (Babb and Muehlbauer, 2003; Graner et al., 1991; Graner, 2004). Compared with Growth Habit other barley mutants, uniculm2 (cul2) is unique in that it The coincidence of QTL effects near the VP1 loci on inhibits formation of axillary meristems and does not LG3a and LG3b, in both TTC1 and TTC2, suggest that produce tillers (Babb and Muehlbauer, 2003). these QTLs may be controlled by homoeologous copies We were not able to identify rhizome QTLs in Ley- of the one gene. If so, this gene evidently controls much mus that were homeologous to rhizome QTLs of Sor- of the dramatic difference in growth habit between L. ghum and Oryza. Paterson et al. (1995) detected about cinereus, L. triticoides, and perhaps other grasses. The 12 rhizome QTLs including a conspicuous cluster of only other CIRC QTLs, on LG5Xm and LG6a, were QTLs affecting rhizome number, rhizome distance, and unique to the TTC1 and TTC2 families, respectively. A seedling tillers on Sorghum linkage group C, which preponderance of mapped barley mutations (four of six corresponds to wheat group 4 (Draye et al., 2001). The loci) that affect vegetative axillary development have latter Sorghum QTL also corresponds with sucker and been localized to chromosome 3HL (minus arm), in- stalk number QTL in Saccharum (Jordan et al., 2004), in cluding absent lower laterals (als), low number of tillers1 addition to the Rhz2 gene and 11 other QTLs con- (int1), and semi brachytic (usu), which produce fewer trolling rhizome proliferation differences between O. tillers, in addition to granum-a (gra-a), which produces sativa L. and O. longistaminata A. Chev. & Roehr. (Hu significantly more tillers (Babb and Muehlbauer, 2003; et al., 2003). We did not detect any plant circumference Franckowiak, 1996). A recessive gravitropic lazy dwarf QTLs on Leymus LG 4Ns or LG4Xm, which include the gene (lzd) was also mapped to the short arm of barley PRC140 rhizome QTL marker (Draye et al., 2001) chromosome 3 (Franckowiak, 1996; Takahashi et al., derived from a Sorghum LG C and sequences ortholo- 1975), but this mutation seems to be more proximal to the gous to the maize teosinte branched one gene (Doebley centromere than the Leymus LG3a and LG3b growth et al., 1997). The Rhz3 gene and rhizome QTL on Oryza habit QTLs. Chromosome 3 is highly conserved within chromosome 4 correspond to rhizome QTLs on Sor- the Triticeae (Devos and Gale, 2000). Colinear from end ghum LG D (Hu et al., 2003) and Saccharum (Jordan to end with rice chromosome 1, Triticeae group three is et al., 2004). This region of Oryza chromosome 4 and also the most conserved of all chromosome groups when Sorghum LG D evidently corresponds to Triticeae group compared with rice (La Rota and Sorrells, 2004). Rice 2 (Paterson et al., 1995; Van Deynze et al., 1995). We did chromosome 1 contains putative transmembrane auxin not detect any significant rhizome QTL effects on Triti- efflux carrier and DNAJ-like genes (International Rice ceae group 2. Genome Sequencing Project, 2005), near the Vp1 locus, originally identified in Arabidopsis pin-forming (Ga¨lweiler et al., 1998) and arg1 (altered response to gravity) Bolting and Anthesis Date Reproduced from Crop Science. Published by Crop(Sedbrook Science Society of America. All copyrights reserved. et al., 1999) mutants, respectively. However, The genetic control of flowering time is complex, pin1-andarg1-like sequences are also present in other involving three major groups of genes on all seven regions the rice genome. Rhizome (Hu et al., 2003) and Triticeae chromosome groups (Snape et al., 2001). Two tiller angle (Li et al., 1999) QTLs also map to rice chro- of these groups interact with the environment, namely mosome 1, but these rice loci were not located near the those controlling vernalization (Vrn) and photoperiod rice Vp1 gene. (Ppd). The third set of genes controls developmental rate The TTC2 CIRC rMQM QTL on LG5Xm mapped independent of vernalization and photoperiod, so-called near the TCP-like sequence (TCP2) amplified from L. “earliness per se” (Eps) genes. A relatively large number triticoides rhizome cDNA using primers designed from of Eps genes have been mapped to all seven homoeologous the teosinte branched one gene (Doebley et al., 1997), groups of wheat and/or barley (Laurie et al., 1995; Snape LARSON ET AL.: LEYMUS WILDRYES 2537

et al., 2001), several of which may correspond to BOLT LG2b interval also includes the cWMG763 locus (Fig. 1), and/or ANTH QTLs detected in Leymus. which was mapped to the short (plus) arm of barley 2H The Vrn genes map to Triticeae groups 1, 4, 5, and 7 about 36 cm distal from the MWG2287 marker in the (Dubcovsky et al., 1998; Snape et al., 2001). Moreover, barley IGRI 3 FRANKA population (Graner et al., the two most potent genes, on groups 4 and 5, have been 1991; Graner, 2004). The MWG2287 locus is closely cloned and characterized (Yan et al., 2003; Yan et al., linked to the barley gai mutation in the centromeric re- 2004). Surprisingly, no significant bolting or anthesis gion of barley chromosome 2H (Bo¨ rner et al., 1999). We date QTLs were associated with the Leymus CDO504 speculate that the gai (sdw3) locus, described by Bo¨rner markers on LG5Ns and LG5Xm, which are presumably et al. (1999) and Gottwald et al. (2004), may correspond closely linked with genes that are orthologous to VRN1. with a major plant height QTL associated with the clus- We have amplified VRN1 sequences from Leymus but ter of DNA markers near the CNL045 locus of LG2a. have not yet found polymorphisms needed for mapping. The CNL045 loci are associated with high-density clus- Likewise, no significant bolting or anthesis date QTLs ters of markers on Leymus LG2a and LG2b linkage were associated with the VRN2 gene on LG5Ns. A sec- groups, probably caused by reduced recombination near ond yet undetected VRN2 gene may or may not be pres- the centromere. Yang et al. (1995) also described a parent on the Xm genome. The most conspicuous wheat and tially dominant GA-ins dwarfing gene on the short arm barley Ppd genes are located on homoeologous regions of chromosome 2A of wheat (Rht21), which could be of the 2A, 2B, 2D, and 2H short (plus) chromosome arms. homeologous to the gai mutation mapped by Bo¨rner Other Ppd genes have also been reported on barley 1H et al. (1999). In any case, the barley, wheat, and Leymus (Laurie et al., 1995) and 6H (Strake and Bo¨rner, 1998). plant height genes on homeologous group two are evi- We did not detect ANTH or BOLT QTLs on short (mi- dently different from the so-called “green revolution” nus) arm of Leymus group two chromosomes. GA-ins dwarfing genes of wheat, barley, and rice encode The TTC1 and TTC2 families displayed substantial gibberellin response modulators that map to Triticeae genetic variation for anthesis date and bolting, including group four (Peng et al., 1999). genotypes that have not flowered in the field, which was not apparent among the parental species accessions. This transgressive segregation can be explained by a ACKNOWLEDGMENTS mixture of antagonistic (i.e., positive and negative) QTL This work was supported by joint contributions of the USDA alleles from each parental species. Leymus cinereus con- Agriculture Research Service, Utah Agriculture Experiment tributed five positive and four negative BOLT QTLs Station, Department of Defense Strategic Environmental and three positive and two negative ANTH QTLs. Thus, Research and Development Program CS1103 project, and US correspondence of bolting and anthesis date QTLs (and Army BT25-EC-B09 project (Genetic Characterization of Native Plants in Cold Regions). Trade names are included for relatively strong negative genotypic correlations) sug- the benefit of the reader, and imply no endorsement or pref- gest that outbreeding depression (i.e., transgressive ge- erential treatment of the products listed by the USDA. The au- notypes that to flower) was associated with flowering thors gratefully acknowledge the technical assistance of Mauro (i.e., lateness) genes under balancing selection. Although Cardona, Linnea Johnson, Neil Rasmussen, and Ron Reed. population means and standard deviations may not demonstrate significant bolting depression, the fact that REFERENCES a substantial number of progeny failed to flower year after year indicates that some outbreeding depression Anamthawat-Jo´ nsson, K., and S. Bo¨ dvarsdo´ ttir. 2001. Genomic and genetic relationships among species of Leymus (Poaceae: Triticeae) is occurring. We have not observed this phenomenon inferred from 18S–26S ribosomal genes. Am. J. Bot. 88:553–559. within the L. cinereus Acc:636 or L. triticoides Acc:641 Babb, S., and G.J. Muehlbauer. 2003. Genetic and morphological natural source populations. characterization of the barley uniculm2 (cul2) mutant. Theor. Appl. Genet. 106:846–857. Bailey, P.C., R.S. McKibbin, J.R. Lenton, M.J. Holdsworth, J.E. Flint- Plant Height ham, and M.D. Gale. 1999. Genetic map locations for orthologous Vp1 genes in wheat and rice. Theor. Appl. Genet. 98:281–284. The HGHT QTLs on LG2a displayed remarkably Becker, J., and M. Heun. 1995. Barley microsatellites: Allele variation strong effects and similar map locations in both TTC1 and mapping. Plant Mol. Biol. 27:835–845. and TTC2 families, suggesting that these QTLs are ho- Bo¨ rner, A., V. Korzun, S. Malyshev, V. Ivandic, and A. Graner. 1999. Molecular mapping of two dwarfing genes differing in their GA mologous. The LG2a HGHT QTL was the only major response on chromosome 2H of barley. Theor. Appl. Genet. 99: positive HGHT effect associated with chromatin of the 670–675. Reproduced from Crop Science. Published by Crop Sciencemuch Society of America. All copyrights reserved. taller L. cinereus species and detected in both Churchill, G.A., and R.W. Doerge. 1994. Empirical threshold values TTC1 and TTC2 families. We interpret these results to for quantitative trait mapping. Genetics 138:963–971. mean that this is one of the key QTLs controlling rela- Devos, K.M., J. Dubcovsky, J. Dvorˇa´k, C.N. Chinoy, and M.D. Gale. 1995. Structural evolution of wheat chromosome 4A, 5A, and 7B tively large differences in plant height between L. and its impact on recombination. Theor. Appl. Genet. 91:282–288. cinereus and L. triticoides. Bo¨ rner et al. (1999) mapped Devos, K.M., and M.D. Gale. 2000. Genome relationships: The grass gibberellin-sensitive gal (GA-less) and gibberellin- model in current research. Plant Cell 12:637–646. insensitive gai (GA-ins) mutations about 55 cM apart Dubcovsky, J., D. Lijavetzky, L. Appendina, and G. Tranquilli. 1998. Comparative RFLP mapping of Triticum monococcum genes con- on barley 2H. The Leymus LG2a HGHT QTL spans a trolling vernalization requirement. Theor. Appl. Genet. 97:968–975. 40 cM interval from the XANTHA locus down below Dubcovsky, J., M.C. Luo, G.Y. Zhong, R. Bransteitter, A. Desai, A. the CNL045 locus (Fig. 1). The XANTHA–CNL045 Kilian, A. Kleinhofs, and J. Dvorˇa´k. 1996. Genetic map of diploid 2538 CROP SCIENCE, VOL. 46, NOVEMBER–DECEMBER 2006

wheat, Triticum monococcum L., and its comparison with maps of Korzun, V., S. Malyshev, A.V. Voylokov, and A. Bo¨rner. 2001. A genetic Hordeum vulgare L. Genetics 143:983–999. map of rye (Secale cereale L.) combining RFLP, isozyme, protein, Derner, J.D., and D.D. Briske. 2001. Below-ground carbon and nitro- microsatellite and gene loci. Theor. Appl. Genet. 102:709–717. gen accumulation in perennial grasses: A comparison of caespi- Lander, E.S., and D. Botstein. 1989. Mapping Mendelian factors un- tose and rhizomatous growth forms. Plant Soil 237:117–127. derlying quantitative traits using RFLP linkage maps. Genetics 121: Dewey, D.R. 1972. Cytogenetics of tetraploid Elymus cinereus, E. 185–199. triticoides, E. multicaulis, E. karatviensis, and their F1 hybrids. Bot. Langridge, P., U. Baumann, and J. Juttner. 1999. Revisiting and re- Gaz. 133:51–57. vising the self-incompatibility genetics of Phalaris coerulescens. Dewey, D.R. 1984. The genomic system of classification as a guide to Plant Cell 10:1826–1827. intergeneric hybridization with the perennial Triticeae. p. 209–279. La Rota, M., and M.E. Sorrells. 2004. Comparative DNA sequence In J.P. Gustafson (ed.) Proc. of the 16th Stadler Genetics Sym- analysis of mapped wheat ESTs reveals the complexity of ge- posium. Plenum, New York. nome relationships between rice and wheat. Funct. Integr. Genom. Draye, X., Y.R. Lin, X.Y. Qian, J.E. Bowers, G.B. Burrow, P.L. 4:34–46. Morrell, D.G. Peterson, G.G. Presting, S.X. Ren, R.W. Wing, and Laurie, D.A., N. Pratchett, J.H. Bezant, and J.W. Snape. 1995. RFLP A.H. Paterson. 2001. Toward integration of comparative genetic, mapping of five major genes and eight quantitative trait loci con- physical, diversity, and cytomolecular maps for grasses and grains, trolling flowering time in a winter 3 spring barley (Hordeum vul- using the sorghum genome as a foundation. Plant Physiol. 125: gare) cross. Genome 38:575–585. 1325–1341. Lawrence, C.J., Q. Dong, M.L. Polacco, T.E. Seigfried, and V. Brendel. Doebley, J., A. Stec, and L. Hubbard. 1997. The evolution of apical 2004. MaizeGDB, the community database for maize genetics and dominance in maize. Nature 386:485–488. genomics. Nucleic Acids Res. 32:D393–D397. Firn, R.D., C. Wagstaff, and J. Digby. 2000. The use of mutants to probe Lehmann, E.L. 1975 Nonparamentrics. McGraw-Hill, New York. models of gravitropism. J. Exp. Bot. 51:1323–1340. Lem, P., and J. Lallemand. 2003. Grass consensus STS markers: An Franckowiak, J.D. 1996. Revised linkage maps for morphological efficient approach for detecting polymorphism in Lolium. Theor. markers in barley, Hordeum vulgare. Barley Genet. Newsl. 26:9–22. Appl. Genet. 107:1113–1122. Ga¨lweiler, L., C. Guan, A. Mu¨ ller, E. Wisman, K. Mendgen, A. Ye- Li, X., N. Paech, J. Nield, D. Haman, and P. Langridge. 1997. Self- phremov, and K. Palme. 1998. Regulation of polar auxin transport incompatibility in the grasses: Evolutionary relationships of the S by AtPIN1 in Arabidopsis vascular tissue. Science 282:2226–2230. gene from Phalaris coerulescens to homologous sequences in other Graner, A. 2004. GrainGenes map data report: Barley, I3F. In Grain- grasses. Plant Mol. Biol. 34:223–232. genes: A database for Triticeae and Avena. http://wheat.pw.usda. Li, X., J. Nield, D. Hayman, and P. Langridge. 1994. Cloning a putative gov/cgi-bin/graingenes/report.cgi?class=mapdata&name=Barley% self-incompatibility gene from the pollen of the grass Phalaris 2C%20IxF (verified 24 July 2006). coerulescens. Plant Cell 6:1923–1932. Graner, A., A. Jahoor, J. Schondelmaier, H. Siedler, K. Pillen, G. Li, Z., A.H. Paterson, S.R.M. Pinson, and J.W. Stansel. 1999. RFLP Fischbeck, G. Wenzel, and R.G. Herrmann. 1991. Construction of facilitated analysis of tiller and leaf angles in rice (Oryza sativa L.). an RFLP map of barley. Theor. Appl. Genet. 83:250–256. Euphytica 109:79–84. Gottwald, S., N. Stein, A. Bo¨ rner, T. Sasaki, and A. Graner. 2004. The Liu, Z.W., R.M. Biyashev, and M.A. Saghai Maroof. 1996. Develop- gibberellic-acid insensitive dwarfing gene sdw3 of barley is located ment of simple sequence repeat DNA markers and their integration on chromosome 2HS in a region that show high colinearity with rice into a barley linkage map. Theor. Appl. Genet. 93:869–876. chromosome 7L. Mol. Gen. Genom. 271:426–436. McCarty, D.R., T. Hattori, C.B. Carson, V. Vasil, M. Lazar, and I.K. Heun, M., A.E. Kennedy, J.A. Anderson, N.L.V. Lapitan, M.E. Sor- Vasil. 1991. The Viviparous–1 developmental gene of maize en- rells, and S.D. Tanksley. 1991. Construction of a restriction frag- codes a novel transcriptional activator. Cell 66:895–905. ment length polymorphism map for barley (Hordeum vulgare). Mano, Y., B.E. Sayed-Tabatabaei, A. Graner, T. Blake, F. Takaiwa, S. Genome 34:437–447. Oka, and T. Kobatsuda. 1999. Map construction of sequence-tagged Hole, D.J., K.B. Jensen, R.R.C. Wang, and S.M. Clawson. 1999. Mo- sites (STSs) in barley (Hordeum vulgare L.). Theor. Appl. Genet. lecular marker analysis of Leymus flavescens and chromosome 98:937–946. pairing in Leymus flavescens hybrids (Poaceae: Triticeae). Int. J. Miura, K., M. Ashikari, M. Matsuoka, and Y.I.C. Hsing. 2003. Map- Plant Sci. 160:371–376. ping of the lazy gene, la. Rice Genet. Newsl. 20:29–30. Holland, J.B., W.E. Nyquist, and C.T. Cervantes-Marinez. 2003. Es- Paterson, A.H., K.F. Schertz, Y.R. Lin, S.C. Liu, and Y.L. Chang. 1995. timating and interpreting heritability for plant breeding: An update. The weediness of wild plants: Molecular analysis of genes in- Plant Breed. Rev. 22:9–111. fluencing dispersal and persistence of johnsongrass, Sorghum hale- Holm, L.G., D.L. Plucknett, J.V. Pancho, and J.P. Herberger. 1977. The pense (L.). Pers. Proc. Natl. Acad. Sci. USA 92:6127–6131. world’s worst weeds: distribution and biology. Univ. Press of Ha- Patterson, J.T., S.R. Larson, and P.G. Johnson. 2005. Genome rela- waii, Honolulu. tionships in polyploid Poa pratensis and other Poa species inferred Hu, F.Y., D.Y. Tao, E. Sacks, B.Y. Fu, P. Xu, J. Li, Y. Yang, K. McNally, from phylogentic analysis of nuclear and chloroplast DNA se- G.S. Khush, A.H. Paterson, and Z.K. Li. 2003. Convergent evo- quences. Genome 48:76–87. lution of perenniality in rice and sorghum. Proc. Natl. Acad. Sci. Peng, J., D.E. Richards, N.M. Hartley, G.P. Murphy, K.M. Devos, J.E. USA 100:4050–4054. Flintham, J. Beales, L.J. Fish, A.J. Worland, F. Pelica, D. Sudhakar, International Rice Genome Sequencing Project. 2005. The map-based P. Christou, J.W. Snape, M.D. Gale, and N.P. Harberd. 1999. ‘Green sequence of the rice genome. Nature 436:793–800. revolution’ genes encode mutant gibberellin response modulators. Jansen, R.C. 1993. Interval mapping of multiple quantitative trait loci. Nature 400:256–261. Genetics 135:205–211. Sahrawy, M., V. Hecht, J. Lopez-Jarmillo, A. Chueca, Y. Chartier, and Jansen, R.C. 1994. Controlling the type I and type II errors in mapping Y. Meyer. 1996. Intron position as an evolutionary marker of thio- quantitative trait loci. Genetics 138:871–881. redoxins and thioredoxin domains. J. Mol. Evol. 42:422–431.

Reproduced from Crop Science. Published by CropJansen, Science Society of America. All copyrights reserved. R.C., and P. Stam. 1994. High resolution of quantitative traits Sedbrook, J.C., R. Chen, and P.H. Masson. 1999. ARG1 (Altered Re- into multiple loci via interval mapping. Genetics 136:1447–1455. sponse to Gravity) encodes a DNAJ-like protein that potentially Jensen, K.B., Y.F. Zhang, and D.R. Dewey. 1990. Mode of pollination interacts with the cytoskeleton. Proc. Natl. Acad. Sci. USA 96: of perennial species of the Triticeae in relation to genomically 1140–1145. defined genera. Can. J. Plant Sci. 70:215–225. Sims, P.L., J.S. Singh, and W.K. Lauenroth. 1978. The structure and Jordan, D.R., R.E. Casu, P. Besse, B.C. Carroll, N. Berding, and C.L. function of ten western North American grasslands. I. Abiotic and McIntyre. 2004. Markers associated with stalk number and suck- vegetation characteristics. J. Ecol. 66:251–281. ering in sugarcane colocate with tillering and rhizomatousness Snape, J.W., K. Butterworth, E. Whitechuch, and A.J. Worland. 2001. QTLs in sorghum. Genome 47:988–993. Waiting for fine times: Genetics of flowering time in wheat. Juttner, J., D. Olde, P. Langridge, and U. Baumann. 2000. Cloning and Euphytica 119:185–190. expression of a distinct subclass of plant thioredoxins. Eur. J. Bio- Snedecor, G.W., and W.G. Cochran. 1980. Statistical methods, Seventh chem. 267:7109–7117. ed. Iowa State Univ. Press, Ames, IA. LARSON ET AL.: LEYMUS WILDRYES 2539

Stebbins, G.L., and M.S. Walters. 1949. Artificial and natural hybrids Voorrips, R.E. 2002. MapChart: Software for the graphical presenta- in the Gramineae, tribe Hordeae. III. Hybrids involving Elymus tion of linkage maps and QTLs. Heredity 93:77–78. condensatus and E. triticoides. Am. J. Bot. 36:291–301. Ware, D., P. Jaiswal, J. Ni, X. Pan, K. Chang, K. Clark, L. Teytelman, S. Strake, S., and A. Bo¨ rner. 1998. Molecular mapping of the photope- Schmidt, W. Zhao, S. Cartinhour, S. McCouch, and L. Stein. 2002. riod response gene ea7 in barley. Theor. Appl. Genet. 97:797–800. Gramene: A resource for comparative grass genomics. Nucleic Tabachnick, B.G., and L.S. Fidell. 1996. Using multivariate statistics Acids. Res. 30:103–105. (3rd ed.). New York: Harper Collins. Wu, X.L., S.R. Larson, Z.M. Hu, A.J. Palazzo, T.A. Jones, R.R.C. Wang, Takahashi, R., J. Hayashi, T. Konishi, and I. Moriya. 1975. Linkage K.B. Jensen, and N.J. Chatterton. 2003. Molecular genetic linkage analysis of barley mutants. Barley Genet. Newsl. 5:56–60. maps for allotetraploid Leymus (Triticeae). Genome 46:627–646. Taylor, C., K. Madsen, S. Borg, M.G. Møller, B. Boelt, and P.B. Holm. Yan, L.L., A. Loukoianov, A. Blechl, G. Tranquilli, W. Ramakrishna, P. 2001. The development of sequence-tagged sites (STSs) in Lolium SanMiguel, J.L. Bennetzen, V. Echenique, and J. Dubcovsky. 2004. perenne L.: The application of primer sets derived from other The wheat VRN2 gene is a flowering repressor down-regulated by genera. Theor. Appl. Genet. 103:648–658. vernalization. Science 303:1640–1644. Van Deynze, A.E., J.C. Nelson, E.S. Yglesias, S.E. Harrington, D.P. Yan, L., A. Loukoianov, G. Tranquilli, M. Helguera, T. Fahima, and J. Braga, S.R. McCouch, and M.E. Sorrells. 1995. Comparative map- Dubcovsky. 2003. Positional cloning of the wheat vernalization ping in grasses. Wheat relationships. Mol. Gen. Genet. 248:744–754. gene VRN1. Proc. Natl. Acad. Sci. USA 100:6263–6268. Van Ooijen, J.W. 1992. Accuracy of mapping quantitative trait loci in Yang, T.Z., X.K. Zhang, H.W. Liu, and Z.H. Wang. 1995. Chromosomal autogamous species. Theor. Appl. Genet. 84:803–811. arm location of a dominant dwarfing gene Rht21 in XN0004 of com- VanOoijen, J.W. 1999. LOD significance thresholds for QTL analysis in mon wheat. p. 839–842. In Z.S. Li and Z.Y. Xin (ed.) Proc. 8th Int. experimental populations of diploid species. Heredity 83:613–624. Wheat Genet. Symp. China Agricultural Scientech Press, Beijing. Van Ooijen, J.W. 2004. MapQTL W 5, Software for the mapping of Yu, J.K., T.M. Dake, S. Singh, D. Benscher, W. Li, B. Gill, and M.E. quantitative trait loci in experimental populations. Kyazma B.V., Sorrells. 2004. Development and mapping of EST-derived simple Wageningen, the Netherlands. sequence repeat markers for hexaploid wheat. Genome 47:805–818. Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. Genome-wide QTL interval mapping (IM) and restricted multiple QTL model (rMQM) mapping in the full-sib Leymus TTC1 and TTC2 families based on log of the odds (LOD) for circumference of plant spreading (CIRC), proportion of bolting culms (BOLT), anthesis date (ANTH), and plant height (HGHT) based averages over 2002, 2003, and 2004. A threshold value of 3.3 LOD is shown for reference.

LG1a--TTC1 LG1a--TTC2 LG1b--TTC1 LG1b--TTC2 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 E36M61.254 0 P33M47.258 E36M61.336 P33M47.280b E38M49.066 E41M59.098 P33M47.280b P33M50.162 E37M61.306 E36M59.167 P33M50.162 P33M62.220 E36M59.062 5 P35M59.213 E38M60.202 E38M47.185 P33M47.258 E36M61.336 P33M60.360 P42M61.072 E36M61.377 E36M48.168 10 P33M47.161 P33M60.290 P42M62.187 E38M49.066 P42M61.166 E36M49.306 E36M50.397 P42M62.181 E36M59.250 E36M61.291 E38M60.182 E38M60.177 15 P33M60.147 E41M49.278 E37M61.306 E36M48.225 E41M59.335 E37M62.244 E41M49.052 E36M48.069 E41M61.367 E36M61.292 E41M49.278 P33M60.360 P33M60.290 E41M48.162b E41M59.271 20 P35M61.361 P44M62.137 E38M47.222a E36M48.257b P33M47.161 P33M62.346 E41M48.322 E37M62.270 E38M60.181 E36M50.222 P44M62.164a E36M59.167 E41M47.119 E41M47.300 E37M47.270 25 E36M61.231 E38M47.253 E38M47.222a 1R TRX1 E41M61.271 E38M49.319 P42M62.293b P33M61.331 E36M62.363 P35M50.142 30 E41M48.110 E36M48.061 E41M48.388 E41M47.130 P35M60.248a E38M49.396 P44M49.228a P44M62.266 E37M61.173 E41M59.090 E36M49.287 35 P35M62.353 P33M50.305 E38M47.293 E41M47.129 P33M59.251 E41M60.094 E37M49.146 E37M61.167 E41M59.124 E38M59.215 E41M59.197 E36M61.191 40 E38M49.396 E38M47.293 P33M62.346 E36M61.286 P44M62.331b E38M47.394 E41M59.193 E36M49.321 E41M61.226 E36M48.163 E36M48.271 P42M62.062 45 E41M47.113 E37M62.278 E38M49.283b E41M60.123a E36M61.191 E41M48.389 P35M62.350 E41M49.217 E38M49.283b E36M62.240 E37M60.097 E38M49.266 1AD WMC336.388 P44M62.293 E36M61.240 50 E37M49.361 P35M62.350 E41M60.123a E36M62.140 E37M49.321 E41M61.265 E41M49.217 E37M60.103 E37M60.153 E37M47.126 E41M61.321 E37M47.319 E38M60.074 E36M62.140 E37M62.388b 55 E38M59.330 E37M60.103 P35M61.396 E41M59.082 P44M62.378 E41M62.173 E41M49.072 P35M61.394 E38M60.213 E37M60.146 P44M49.200 60 E37M49.321 P33M61.367 E36M62.346 P35M49.334 E36M61.323 P35M49.311 E41M61.385 P33M61.198 E41M48.245 65 E41M49.220 P42M62.153 P33M47.328 P33M61.198 E41M49.072 P35M49.139 E37M62.232 P35M50.213a P42M61.117 E41M48.131 E37M61.182 E36M61.323 P35M59.154 70 E41M48.245 P44M62.105 P33M61.367 E38M49.140 E38M60.213 E41M60.361 E36M62.346 P42M61.117 E36M50.254 E41M62.189 P33M62.319 75 E41M61.385 E38M47.229 E37M49.051 E41M47.355 P33M50.281 E37M47.319 P33M50.154 P33M59.158 E36M59.217 E37M47.320 E38M59.317 80 E41M47.355 E37M61.095 E41M60.360 P33M47.255 E37M49.079 E37M62.201b E41M47.148 E37M61.073 E37M61.290 85 E38M60.107a E36M59.317 E37M47.151 P44M49.388 E41M61.141 E37M47.150 E38M59.101 E38M49.269 E41M61.252 E38M49.146 E37M60.097 E37M49.092 90 E41M59.163 E41M47.148 E37M61.095 E36M61.192 E41M49.171 E38M60.159 E38M60.162 E38M59.204 P42M61.114 E41M60.336a E36M61.267 E37M61.344 BCD1150 1B(A) E41M47.237 95 1H HVA.094 E37M49.092 E41M48.053 E41M61.122 E38M60.107a E36M61.267 E37M60.284 E37M47.196 E36M59.239 P44M62.209 P42M61.218 P35M59.211 P33M50.246b 100 P33M62.354 E41M59.163 E38M49.214 P33M59.118a E41M61.398 P44M62.164b P33M62.271 P35M59.188 HVA.094 1H P35M62.180 P44M62.351 105 E38M59.101 E41M59.310 BCD1562 1BD(A) P33M50.246b P33M61.137 E41M47.110 E38M60.108 P33M62.354 110 P35M61.177 P42M61.218 E38M49.241 E38M49.399 E37M47.196 E38M59.153 E36M62.150 P33M61.233 E38M60.291 E38M49.386 P33M47.234 E41M61.398 E36M62.057 115 P44M62.119 E36M59.296 E41M48.147 P44M62.368 E41M60.195 P44M49.133 E37M47.327 P35M61.177 P35M61.141 P33M50.180b E41M49.134 GDM126.146 1D E36M62.192 120 P35M61.174 E38M60.108 E41M47.078 E38M60.311 E41M47.163 P44M49.250 E38M60.294 P44M62.368 E37M60.259 P33M47.273 P33M47.234 E38M49.241 125 P44M62.124 E38M49.256 P33M62.138 E41M49.134 P35M60.119 P44M49.133

Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. E37M47.327 P42M62.312 130 E38M60.294 P42M61.157 E38M60.311 E36M62.192 E41M62.184 E41M47.078 P35M50.127 E41M62.337 135 E38M49.063a

CIRC_IM BOLT_IM ANTH_IM HGHT_IM

CIRC_rMQM BOLT_rMQM ANTH_rMQM HGHT_rMQM LG2a--TTC1 10 LG2a--TTC2 LG2b--TTC1 LG2b--TTC2 P33M62.285 0 1 2 3 4 5 6 7 8 9 P33M61.175 0 1 2 3 4 5 6 0 1 2 3 4 5 0 1 2 3 4 E41M48.255 E38M47.364 E36M61.248 E41M49.131 0 P33M48.139 E36M48.172 E36M61.248 P33M61.175 E37M61.246 P33M61.312 E41M48.255 E36M59.293 P33M47.078 E38M60.263 E41M47.204 E38M60.153 5 P35M62.187 E37M61.155 E36M50.311 P35M49.202 P33M61.312 P44M49.095b P33M61.213 P42M61.145 P33M50.227 P35M61.225 P33M48.139 E41M48.241a P33M50.152 10 E36M48.172 P35M49.202 E36M59.293 P35M62.194 E38M60.263 P33M61.212 E41M49.131 P35M62.163 E37M61.155 P33M59.256 E36M49.311 E41M62.160 E41M59.077 E38M59.217 E36M59.392 E37M49.270 15 E38M47.364 P44M62.223 E38M47.072 P44M49.258 E36M61.138 P35M62.178 P35M62.194 E37M61.102 E41M59.345 P44M49.246 P33M60.125 P44M62.223 E41M59.184 P33M50.152 20 E36M61.175 E36M61.221 P33M48.328 P35M50.208 P44M49.246 E38M60.056 P35M50.208 P33M48.392 P33M59.256 P33M62.364 P33M48.394 E36M50.247 P35M49.297 P44M62.299 25 P35M62.365 E36M48.305 P44M62.176 30 E38M60.056 E38M60.153 P44M62.228 35 E41M59.094 P33M62.117 P35M62.365 E36M59.221 E37M62.072 E37M60.172b 40 P42M62.303 P42M62.298 E41M61.111a E38M59.282 45 P44M62.228 2H XANTHA.395 E36M50.224 E41M61.352 E36M61.152a P33M47.345 P35M60.227 P35M60.227 50 2H XANTHA.270 P33M48.212 E37M60.257 E37M60.192 P42M61.142 E36M61.157 E36M50.224 E41M60.139 E37M62.272 E38M47.180 E41M48.070 P33M59.241 55 P33M48.212 E36M61.361 E37M60.188 P33M50.249 2H MWG763.277 E36M61.297 P35M60.248b E37M60.192 E41M61.188 E41M59.257 E41M47.249 E41M61.254 E37M60.188 P33M61.285 60 E36M59.234 E41M62.194 P35M62.320 P33M60.130 E36M61.361 E41M48.085a E37M61.110 E41M48.251 P42M61.367 E37M60.342 P33M60.130 TRX1 1R E36M49.271 E37M62.228 E37M62.131 E37M62.183 65 E37M60.342 E38M60.087 E37M60.297 P35M61.364 E41M62.194 E38M60.069 E41M50.159 P33M48.079 E37M47.145 E41M49.092 E37M62.272 P35M59.253 E41M61.188 P42M61.367 E37M60.257 P33M60.250 70 E37M62.228 E41M62.319 E38M60.280 E37M62.260 E36M61.297 P33M61.216 E41M60.172 E36M59.171 E41M49.092 P33M60.143 E41M49.215 E37M62.212 E36M61.253 E37M49.304 E36M62.145 75 P33M61.216 P35M59.253 E41M49.247 2A CNL045.154 E41M48.062a P33M48.079 E41M61.350 E37M62.182 P33M60.249 E37M61.281 E36M48.098 P35M61.364 E37M61.141 80 P35M50.385 P33M61.285 E37M49.147 P33M48.215 E37M62.183 E36M62.097 E36M59.171 P33M60.180 P33M61.203 P33M48.154 E41M48.226 85 E37M47.143b E41M62.152 E38M60.234 E36M49.179 E41M50.202 E37M62.261 P33M59.278 E38M59.329 E38M60.130 E37M61.232 E37M62.136 90 E37M62.252 E37M62.252 E38M47.105 E36M48.248 E36M49.313 P33M59.241 P35M60.280 P33M48.224 P42M62.115 95 E41M60.123b E41M60.238 E37M61.141 P44M49.223 E41M61.119 P35M50.279 E36M61.157 E37M49.102 E37M49.147 100 P33M50.180c 2A CNL045.172 E36M48.202 P35M50.279 P33M60.180 E41M60.293a E36M59.222 E37M49.102 E37M47.370 105 E37M60.294 E41M61.099 P33M59.278 P33M59.172 E41M47.139 E36M49.130 110 E36M48.356 E36M59.222 E37M62.269 E41M61.119 P33M59.242 P33M59.172 115 E41M59.318 E41M61.359 P33M59.318 E41M61.099 P33M50.180a E38M49.074 P33M50.180a P42M62.067 120 E36M49.266 P33M62.231 E36M48.356 P35M60.272 E41M47.359 P33M50.246a E41M59.323 E38M47.076a E36M61.091 125 P35M60.272 E41M59.154 E37M49.165 P35M62.377 E38M47.076a E37M49.165 P33M62.231 130 E41M47.356 E41M60.088 P42M61.185 P33M48.348 E36M62.339 E37M62.269 E36M49.339 E41M47.357 P35M59.372 E37M47.198 P42M61.122 P33M47.243 P33M60.268 135 P42M61.196 P44M49.149 P33M48.126 P33M48.350 P33M62.296 E37M60.186 P35M50.307 E41M48.060 2ABD GWM382.095 P33M62.333 P33M61.071b 140 P33M62.291 P33M48.126 E41M61.156 P42M61.081 E38M49.152 P35M49.242 P35M62.111 E37M49.160 P42M61.081 E38M59.220 P35M49.140 GWM382.095 2ABD E38M59.220 E36M49.109 P44M62.088a 145 P35M62.399 E36M49.092 E37M47.056 E36M49.348 P35M60.144 P35M61.243 P35M61.243 E36M48.075 P33M62.291 P33M60.217 P44M49.286 E36M49.366 P35M49.090 E36M49.366 P33M60.217 150 E38M49.067 2ABD GWM382.126 Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. E41M47.132 E41M47.155 E41M48.112 P33M62.394 E41M48.112 E38M59.095 E36M59.182 E41M47.131 E41M47.155 E41M60.144 E41M47.285 P44M49.369 E38M59.095 E37M47.356 155 E38M59.074 P42M62.146 E41M60.144 E38M59.179 E41M47.214 E37M47.356 P33M50.245 P44M49.323 E38M59.179 E41M59.126a P33M48.397 P42M61.140 GWM382.126 2ABD 160 CIRC_IM E41M59.126a P33M48.067 E38M47.278 P35M50.258 E38M47.278 CIRC_rMQM E41M48.188 P33M48.067 165 BOLT_IM ANTH_IM HGHT_IM P42M61.140 BOLT_rMQM ANTH_rMQM HGHT_rMQM LG3a--TTC1 LG3a--TTC2 LG3b--TTC1 LG3b--TTC2 0 1 2 3 4 0 1 2 3 4 5 0 1 2 3 4 0 1 2 3 4 E36M59.261 0 P33M50.250 E41M48.390 P35M49.082 P33M62.343 P33M47.310 E38M47.228 P33M47.228 P33M47.179 E41M59.148 P33M47.280a 5 E38M49.363 E41M60.156 E38M47.228 E36M61.339a P33M62.393 P33M47.131 P42M62.177 CDO460 3ABR(C) P33M48.194 E41M61.394 E36M49.206 10 P35M59.195 P33M62.393 E36M61.092 P33M60.104 P33M47.179 E41M48.085b P42M61.294 P33M47.279 E41M61.313a P42M62.178 P44M62.334 P35M49.082 15 E38M59.298a P35M61.158 P44M49.331 P35M62.385 P35M62.385 E37M62.274 E41M61.234a 20 P44M62.197a P35M61.082 E41M61.235 E41M60.080b E41M61.095 E36M62.130 P33M60.305 P44M49.253 E41M62.354 25 E37M62.257 E38M49.084 E41M49.135 E37M47.128 E41M62.350 P35M50.120 E41M47.167 E41M59.268 P42M61.197 30 E37M47.305 E41M49.135 P33M62.144 E38M49.084 E41M47.167 P35M50.120 E37M62.096 BCD1532 3AB(C) SIP1.413 3H P33M60.308 P42M61.197 E41M60.111 E41M62.154 35 E38M47.214 P33M62.144 3H SIP1.413 E38M49.057 E36M48.164 P42M61.232 E41M60.166 P35M50.314 SIP1.291 3H E41M60.343 40 P35M62.225 E36M62.338 3H SIP1.324 E41M62.223 E38M49.057 E36M48.164 3A GWM005.080 45 P42M61.232 P33M47.072 E41M49.122b E36M61.311 GWM005.080 3A E36M62.338 P33M47.072 P35M62.225 E41M60.166 P33M47.073 E41M62.223 50 E36M62.302 P33M47.073 P33M47.167 P35M50.154 E37M47.386 E38M60.359 E41M49.122b P44M49.110 E37M47.386 E36M48.101 E38M47.374 E41M47.071 P44M49.110 E37M47.226 E37M61.199 55 E41M49.090 P35M60.074b E38M60.359 E37M60.339 E36M61.330 E38M47.374 E41M47.071 P33M62.190 E38M47.076b E37M49.329 E36M59.287 E37M49.329 E41M47.225 P33M47.167 60 E36M61.330 P33M61.153 P33M62.190 E36M62.173 E36M62.173 P33M50.116 E41M48.133 E41M47.225 E37M61.199 E36M49.351 E37M60.339 65 P33M50.328 E36M59.253 P33M61.149a E38M47.076b E36M61.263 E36M61.097 E41M61.290 P35M62.199 P33M61.153 E36M61.141 E37M49.132 E37M47.302 E36M59.253 E37M60.203 P44M49.329 70 P33M50.328 P44M49.329 P35M59.284 P33M61.149a E36M61.097 E37M60.200b E41M61.290 E37M62.082 E37M62.082 E36M61.303 E37M60.203 E36M61.263 E36M61.141 75 P42M61.316 E41M61.127 E41M61.131 E37M61.350 E41M48.133 E37M49.303 E37M49.303 E37M60.356a E41M61.131 E36M61.234 P35M59.284 E36M49.351 E38M47.140 E36M50.351 80 E38M60.242 E38M47.165 E38M60.242 E37M47.242 E41M59.113 E36M48.066 E41M48.102 P35M49.242 E36M61.206 E36M61.234 85 P33M47.097 E38M60.316 E38M60.316 E37M61.349 E37M47.124 P33M60.192 E38M47.140 E41M49.163 90 E38M60.305 E38M47.192 E41M61.220 P44M62.204 E36M61.243 95 E38M49.064 3ABD VP1i5.406 E37M49.349 P35M50.264 E37M60.083 P35M60.135 P33M47.097 E37M60.082 100 E38M47.172 E36M62.203 P33M60.207 E41M48.102 E41M49.302 E41M60.286 P44M62.360 P33M60.192 105 E37M47.225 P33M60.207 E41M47.134 E36M59.219 P35M62.242 E41M49.304 E41M59.365 E38M60.278 E36M62.227 P33M60.227 110 E41M60.296 P44M49.324 E41M61.077 VP1i5.406 3ABD P33M48.378 P33M50.345 P33M50.149 E41M61.220 E37M62.162 P33M48.119 E37M60.083 E36M62.227 P33M47.099 115 P33M50.285 P44M62.204 3ABD VP1i2.394 E37M62.162 P44M49.324 P44M49.197 E37M47.326 E37M47.326 E36M49.248 E38M59.249 120 E36M48.284 P44M62.360 E36M48.204 E37M47.263 E37M47.225 E41M59.206 E41M62.204 E36M59.219 E41M62.204 125 P35M49.270 P33M50.146 P42M62.249 P33M47.111 E36M62.090 P33M48.155 E41M62.260 P35M61.089 E38M47.185 E36M59.262 P35M62.147 E37M49.141 E41M47.173 P42M62.249 130 E38M47.359 E36M48.167 P33M59.245 E37M61.191 E37M49.179 E36M50.170 P33M61.174 E41M48.248 E36M48.308 E41M59.325b E41M59.222 135 E37M49.118 P44M62.093 E37M49.358 P33M61.129 P35M49.224 E41M62.341 4B(F) CDO1401 E36M50.237a E37M49.201 E41M49.285 E37M47.224 E41M59.210 140 E41M61.063 E37M49.358 P35M61.089 E38M59.065 E41M62.069 P35M62.147 P33M60.393 E37M62.235 E37M60.303 P33M62.090 145 P44M49.139 E41M49.232 E37M62.075 P33M61.129 P44M62.093 E37M60.302

Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. 150 P44M49.139 CIRC_IM E37M47.224 ANTH_IM P33M59.118b 155 E37M49.355 E41M62.069 CIRC_rMQM ANTH_rMQM

160 BOLT_IM HGHT_IM

P35M59.174 165 BOLT_rMQM P35M60.074a HGHT_rMQM

170 P33M59.118b E41M61.107 LG4Ns--TTC1 LG4Ns--TTC2 LG4Xm--TTC1 LG4Xm--TTC2 0 1 2 3 4 0 1 2 3 4 5 6 0 1 2 3 4 5 6 0 1 2 3 4 P33M62.351 E38M59.239 E41M47.169 E36M50.064 0 E36M50.064 E37M49.207 P33M62.351 P33M59.260 E37M49.206 P33M59.134 P33M59.134 E41M61.186 5 P35M62.140 E41M61.172 4BH GWM006.170 E41M49.198b E41M49.283 P33M59.260 P33M48.399 P33M48.399 E41M49.223 E41M49.194 E41M60.326 E38M59.239 E36M48.109 10 E36M62.349 P42M61.073 P33M61.316 E37M62.129 P44M49.095a E37M62.128 E41M49.277 E36M61.368 P35M61.153 4H MLOH1A.352 P35M50.371 15 E37M47.143a E38M47.398 E41M49.223 P35M59.230 P35M50.372 E41M49.283 P35M60.392 E41M61.172 E37M47.304 E38M60.325 20 P35M62.140 P35M60.392 E38M60.090 P42M61.073 E41M62.235 P35M50.371 E41M62.082 E41M49.277 P35M50.372 P44M62.317 E36M59.152 P35M49.187 P42M61.285 E41M62.239 25 P44M62.331a P42M62.263 E37M62.368 P33M48.359 E38M60.091 E41M62.219b E41M62.082 4H MipsA.284 E41M62.233 4B KSU154.137 P44M62.317 P44M49.141 30 E41M62.396 P33M48.359 4B KSU154.137 E38M60.090 E41M62.200 E36M61.378 E36M62.210 P42M62.362 E41M61.381 E37M49.360 35 E36M61.289b E41M47.150 P42M62.164 E41M47.301 E38M59.346 E41M61.381 P35M61.277 E41M61.373 E36M62.087 E36M62.087 40 E41M60.069 E41M60.069 E41M47.150 P33M59.133 4ABD GWM165.172 P35M59.112 P35M50.262 E38M59.346 E41M47.301 P35M61.277 E41M62.091 E41M62.246 45 E41M47.205b E41M49.343 E36M61.332 4ABD GWM165.202 E41M60.233 E41M62.246 P35M61.370 E36M48.272 E41M61.317 GWM165.202 4ABD (F) BCD250 P35M62.123 50 E38M59.387 E36M61.332 P33M47.142 P33M60.110 E41M62.393 4H PRC140.409 E38M60.146 E41M62.393 P42M61.182 E36M61.306 55 E38M47.063 E36M49.187 P33M60.110 E38M47.284 E37M49.316 E38M60.146 E41M59.230 E41M60.132a P33M59.091 E41M50.330 E36M59.113 E36M61.342 E37M49.313 E36M61.306 E36M49.238 60 E41M49.143 E41M59.152 E38M47.284 E41M61.340 E41M49.142 P33M47.094 E38M47.363 PRC140.409 4H E41M50.282 E41M49.143 E41M61.317 KSU149.243 4D E36M49.353 E37M61.186 E41M59.230 E37M47.108 65 E38M47.103 E41M61.109 E36M59.113 E38M49.291 E36M61.287 E41M48.067 E36M49.238 E36M48.118 E41M61.084b E38M60.259 E37M60.135 E36M48.277 E41M60.196 E37M60.262 E38M47.068 E41M47.171 E41M60.243 E36M61.287 70 E37M49.273 P33M61.340 E38M60.259 E38M47.103 4D KSU149.240 E41M59.342 E36M62.319 E38M49.170 E41M62.335 E41M62.336 E38M49.291 75 E36M62.319 E36M49.376 E37M47.108 E41M47.172 3A CNL039.229 P33M50.264 E36M50.171 E38M60.201 E36M50.376 E41M61.084b E36M62.341 KNOX.239 4H E41M61.109 E36M50.376 E36M48.118 80 P42M61.317 E41M60.247 E36M61.099 E36M62.249 E38M60.122 E41M62.369 E38M59.100a E36M59.374 E37M49.174 E41M47.060 E41M48.185a E36M50.353 E38M60.396 85 E41M60.196 E37M60.325 4H TCP1Xm.459 TCP1Xm.459 4H P33M59.302 E36M49.353 P35M62.370 E38M60.196 90 P33M62.070 4H KNOX.239 P33M62.070 E36M62.249 E41M61.269 E41M59.342 E38M59.100a E36M49.076 E37M60.183 E41M47.060 95 E37M61.332 P33M62.206 E37M62.286 E41M61.269 E38M47.198 E36M49.076 E37M60.190 E41M48.093 100 E37M60.090 P35M49.201 P44M49.326 P33M61.273 P35M49.205 P35M60.313 105 P35M62.276 P33M47.125 P35M62.276 P35M62.274 P33M47.126 P35M62.274 110 E36M62.211

115 P33M61.096 E41M60.301 P35M62.127 E36M49.279 120 TCP1Ns.430 4H E38M49.390 E38M60.223 125 E37M60.252 E36M62.211 E41M61.380 E41M47.384 E36M59.247 130 4H TCP1Ns.430 CIRC_IM BOLT_IM E37M60.375 P35M62.127 135 CIRC_rMQM BOLT_rMQM

140 E41M48.195 E41M61.272 ANTH_IM HGHT_IM

E38M49.390 145 E36M59.247 ANTH_rMQM HGHT_rMQM

E41M61.212 Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. LG5Ns--TTC1 LG5Ns--TTC2 LG5Xm--TTC1 LG5Xm--TTC2 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 E41M59.333 0 P33M62.133 P33M62.175 5B GDM101.196 E36M49.272 E41M48.077 E38M59.137 E41M48.244a E37M62.172 E41M59.333 E36M59.308 TCP2Ns.117 5H E41M48.244a P33M61.089 5 E36M59.308 E37M61.269 P35M50.281 P33M60.202 P42M61.162 E36M61.218 P33M62.133 P42M62.081 P33M61.123 E37M49.073 P35M62.390 P35M62.389 P33M59.169 E41M47.364 10 5H TCP2Ns.117 E36M48.290 E41M49.094 E37M60.156 E41M49.094 P33M62.093 P42M62.381 E37M60.156 P33M62.097 E41M61.224 P35M61.131 E36M59.169 E37M49.251 E41M59.260 15 E37M62.172 E41M49.120 E41M49.120 E41M59.114a P33M59.200 E38M49.136 GWM205.142 5AD P33M50.274 E36M50.284 E37M49.250 20 E38M60.248 E41M48.336 P33M59.169 E37M60.228 E41M47.258 GDM101.197 5B E37M62.163 E38M47.147 P33M59.170 E38M60.094 P35M50.363 P35M61.102 25 E36M49.284 TCP2Xm.252 5H E38M60.204 E41M49.333 E37M61.149 E38M47.313 E38M60.204 E41M60.357 E41M60.205 E38M47.124 30 E38M60.094 E36M61.082 E38M47.147 E37M47.133 E37M60.172a E38M49.245 E38M60.327 E38M49.245 E38M47.313 E41M61.091b E41M60.164 E41M60.205 35 E36M61.339b 5ABD GDM068.114 E37M60.172a E36M48.180 E36M59.133 E37M61.149 P33M61.250 E36M59.225 E37M61.291 BCD1130 5ABD(F) P33M60.366 E41M60.285 E38M49.191 BCD1707 (F) 40 E37M60.287 E36M50.284 E41M61.136a P44M49.085 E36M61.383 P33M50.244 KSU220.308 7B E36M62.311 E37M47.341 E36M62.330 E38M59.268 E37M47.133 E41M60.276 E36M49.284 45 E37M61.204 E41M60.293b E38M59.139 E41M48.059 E37M60.398 E36M61.383 E41M49.191 P35M50.363 E41M60.163 5B KSU171.279 E41M61.091b E38M60.178 P33M50.158 E36M48.180 P42M61.100 P33M61.250 50 E41M48.280 E38M49.222 P33M48.298 E38M59.139 E37M47.378 E37M62.136 E36M61.352 P44M49.085 E38M60.107b E38M49.369 E41M48.062b P42M61.257 E37M47.307 E41M47.281 E37M47.378 P35M49.199 55 P33M60.366 P33M50.197 E36M62.325 E36M62.340 P33M50.244 KSU171.279 5B 5ABDHR PSR128.412 P33M62.259 P33M50.340 E38M49.191 P35M62.264 E41M49.192 P33M50.158 60 E38M59.268 GDM068.116 5ABD E41M60.267 E36M59.111 E41M49.140 E36M61.173 E37M62.273 E41M48.173 P33M48.298 E38M49.207b E36M62.311 E41M48.103 65 E36M48.254 E38M60.107b E36M48.088 P33M50.232 E41M47.281 E36M48.296 E41M59.130 E37M60.307 E38M60.169 70 P33M50.233 E38M59.199 E36M62.189 E36M48.308 E36M62.189 E41M48.119a E36M48.254 E37M61.327 75 E37M60.092 E41M62.107 E41M62.107 E41M59.267 E41M48.103 E37M60.105 E41M61.201 E41M61.201 E41M61.256 5ABDHR CDO504Xm.167 80 E41M61.256 E37M47.096 E36M61.139 E37M47.136 E37M47.322 E37M47.324 E38M59.199 85 E37M60.105 E36M62.180 E37M49.183 E36M49.188 E41M59.199 P33M59.264 90 P42M62.191 E38M49.230 E36M50.333 E41M47.149 E36M62.180 P33M47.211 P33M59.264 95 E38M47.338 E37M61.190 CDO504Xm.167 5ABDHR E36M59.291 E36M62.220 P33M59.104 E36M59.312 E37M62.120 100 5H MWG2230.285 P35M59.376 E36M48.200 E41M60.229 P33M48.340 P35M59.137 E37M49.077 P35M59.102 105 P35M49.251 P44M62.088b E41M49.213 E36M62.159 P44M62.089 P35M61.295 P35M60.240 E36M50.333 P33M62.323 110 E37M61.215 E36M49.333 E41M61.194 E41M62.122 E37M61.190 E38M47.084 P33M59.262 E41M59.303 E41M60.244 E41M60.147 P35M62.167 115 P35M60.100 E38M59.248 P33M48.361 P33M47.216 E41M50.064 E36M62.252 120 P33M62.172 E36M61.125 E37M49.100 P35M59.137 P35M60.115 E37M47.063 P33M62.178 E37M49.063 E41M60.140 E41M49.213 E41M62.122 125 E41M59.311 E36M62.334a E41M59.312 P44M62.088b E36M59.140 E41M60.058 P44M62.089 E41M60.099 P33M48.153 P35M60.240 130 E36M59.265 P35M60.239 E37M47.153 CDO504Ns.086 5ABDHR E41M48.056b P35M62.167 E38M47.084 E37M47.244 P42M62.112 E37M60.200a 135 P44M62.296 E37M60.235 E36M49.138 P35M60.100 P33M60.077 P33M47.216 P42M61.143 E41M60.244 E41M48.075 P33M48.283 E41M60.079 140 E37M62.155 P33M48.258 E37M49.100 P35M49.344 E38M59.248 P35M49.065b 4H-5A VRN2.199 P33M62.172 P33M62.335 145 P33M50.292 E36M59.265 E36M49.319 P35M60.115 E36M50.319 E37M49.352 E36M48.158 E36M48.207 E41M48.056a

Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. 150 E41M61.279 E38M59.149 E41M48.056b P42M62.112 CIRC_IM 155 ANTH_IM E37M47.244 P33M62.208 P33M60.077 CIRC_rMQM ANTH_rMQM 160 P42M61.139 E37M60.235 BOLT_IM HGHT_IM P35M49.344 165 P33M50.292 VRN2.193 4H-5A BOLT_rMQM HGHT_rMQM P44M49.296 LG6a--TTC1 LG6a--TTC2 LG6b--TTC1 LG6b--TTC2 0 1 2 3 4 0 1 2 3 4 5 6 0 1 2 3 4 0 1 2 3 4

0 P35M62.193 P35M62.193 P35M50.213b P35M50.213b P33M50.323

5 P33M60.214 E37M49.135 E36M48.257a P44M49.065 P44M49.121 P33M50.323 10 E38M49.197 P42M62.205 E38M49.103 MWG652.264 6H E38M47.183 E41M49.122a P33M62.219 P44M49.205 P33M48.087 15 GIRi7.394 6B P35M61.198 P35M62.066 P33M48.087 P33M60.154 P35M59.091 P44M62.219 P35M61.198 P33M61.168 P44M49.121 E37M61.063 P44M62.219 E37M60.089 E37M47.093 P33M62.219 P33M61.168 20 E41M62.334 E41M61.134 P33M47.398 E41M61.134 P42M62.206 E41M49.246 E41M48.235 E37M47.093 E37M49.233 E37M61.063 E41M62.279 E37M60.158 6H MWG652.264 P33M60.203 P33M61.280 25 E36M62.114 E36M62.114 P35M49.196 E37M62.189 E41M59.185 E38M59.319 P35M49.194 E38M59.321 P33M48.296 6B GIRi5.351 P35M49.269 E36M62.374 P44M62.200 30 P44M62.200 E36M59.260 E41M47.397 E41M47.350 P44M49.151 P33M60.356 35 E41M60.122 P33M48.131 P33M61.149b P44M49.345 P35M60.093 E41M60.287 40 P33M48.131 E41M61.276 E38M60.144 P35M60.093 E36M61.112 E41M47.350 P35M60.106 P35M62.312 45 E36M48.329 E36M61.344 P35M49.164 P35M62.313 P35M62.344 50 E37M47.083 E37M61.282 E36M48.329 E41M48.079a E41M62.150 P44M62.196 E41M48.205 P35M62.205 55 P33M47.170 E41M47.385 P33M47.206 P35M62.344

P33M47.133 E37M47.346 60 P35M62.183 E36M62.178a P35M62.209 E36M62.292 E38M49.336 P35M62.251 MWG2264.403 6H 65 E36M62.177 E36M49.310 P33M47.206 E41M47.385 E41M62.113 P33M47.132 P42M62.269 E41M62.076 E41M62.076 E41M60.098b E41M47.058 E38M47.252 70 E38M49.336 P35M62.183 E38M59.161 E36M49.310 E36M62.292 E38M59.160 P33M48.386 75 E36M61.255 P42M62.163 P35M62.209 E36M48.196a P42M62.293a P42M61.099 E41M60.098a E41M61.098 P42M61.099 P33M50.278 E41M61.399 E41M62.313 80 E38M59.291 E36M48.327 E36M59.245 E36M61.170 E38M47.157 E37M62.190 E38M59.264 E38M59.291 E41M61.259 E41M61.105 P33M60.310 85 E36M61.170 P33M60.252 E36M61.252 E38M47.157 E38M49.315 P35M50.389 E41M60.098a E41M60.363 E36M61.255 E38M60.205 E37M49.363 90 E41M47.205a 1R TRX2 E41M61.259 E36M62.118 E41M59.353 E41M62.157 E37M62.190 P33M60.252 E36M49.274 P35M60.149 95 P35M60.149 E36M61.252 E41M60.363 E37M49.363 TRX2 1R 100 E38M49.315 E37M61.133 P35M62.223 E41M47.099 105 7D GDM150.365 P35M62.224 E41M60.232 E37M61.133 P33M50.258 E41M47.099 P42M62.284 110 P35M61.164 P35M50.236 P42M62.284 E37M60.290 P33M50.258 P33M62.217 E41M61.192 GDM150.365 7D P33M60.390 E41M60.232 115 P35M60.169 P44M49.312 E41M62.185 P35M50.236 P44M62.284 E36M49.295 E41M59.348 P35M61.301 E41M61.192 P33M62.213 E37M47.366 P35M49.378 120 E41M62.185 P35M59.243 E37M62.268 P42M61.319 E41M59.368b P35M59.243 E41M59.349 P35M49.381 P35M49.381 E37M62.371 P44M62.103 P35M49.378 E37M47.366 125 E38M49.278 P33M62.108 E37M60.356b E38M47.353 E41M59.252 E41M59.291 P44M62.103 E37M62.268 E41M59.313 E38M59.286 E36M48.196b E37M60.328 P44M62.284 130 E38M49.278 E36M62.219 P33M59.273 P44M49.070 E41M59.367 P33M62.313 P35M59.214 P35M62.100 P33M59.267 E38M60.334 P35M59.214 135 E36M62.219 P35M50.093 P35M50.093 P35M61.205 P35M61.205 P35M59.093 E41M60.071 140 E38M47.329 E41M60.071 E36M48.152 E37M47.102 E36M61.367

145 P35M60.286 Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. CIRC_IM BOLT_IM ANTH_IM HGHT_IM

CIRC_rMQM BOLT_rMQM ANTH_rMQM HGHT_rMQM LG7a--TTC1 LG7a--TTC2 LG7b--TTC1 LG7b--TTC2

E36M49.124 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 P33M50.361 E41M59.215 E41M59.215 0 E38M49.207a P44M62.094 E36M59.095 E41M60.235 E38M60.308 P33M47.119 E36M49.090 6-SFT.579 7H P33M59.082 E41M61.084a E36M59.100 P44M62.094 6-SFT.101 7H E37M62.291 E36M62.261 5 7H 6-SFT.101 E37M62.071 E36M61.316 P33M50.267 P33M61.387 E37M62.291 E36M62.193 P33M50.143 7H 6-SFT.579 E41M61.084a E41M48.215 P33M48.159 E41M59.072 E38M59.323 10 E41M48.152 E41M48.215 P44M49.179 P44M49.228b 7H MWG703.194 E37M49.340 P33M50.284 P33M50.284 P35M49.204 E41M48.153 P35M59.166 E37M61.205 E41M49.204 MWG703.194 7H P33M48.135 E41M59.072 15 E36M61.095 E36M62.088 P35M61.154 P35M62.184 E36M49.061 E36M48.336 E38M47.385 P35M59.165 P33M61.386 P44M62.397 P33M62.071 P33M62.071 E41M62.212 E41M60.130 E38M47.385 20 E41M49.259 P33M62.352 E41M60.130 E41M48.162a E38M47.222b P44M62.117 P35M50.101 E36M48.130 25 P44M62.197b E37M61.193 E41M62.212 E37M49.382 E37M61.193 E37M47.078 P35M50.219 E41M48.254 E41M61.091a E41M47.266 E38M60.148 P33M48.240 P35M60.246 30 E38M49.375 E36M59.371 E36M61.152b E41M61.090b E38M59.304 E37M49.198 E37M49.142 E41M61.091a P35M60.247 E37M49.143 E41M49.193 P35M60.247 LIMDEX.227 7H 35 P33M61.326 E38M60.140 E36M59.134 P35M59.116 P42M62.386 E41M59.278 E38M59.304 E41M59.234 P33M50.349 E41M60.070 P35M60.189 E38M59.298b 40 P33M48.384 P44M62.197b P35M59.116 E41M62.103 E37M62.180 E37M62.180 P42M62.326 E38M59.259 E36M49.190 E38M60.140 E38M47.096 45 P44M49.261 E37M62.297 E41M47.066 E41M60.190 E41M61.313b E38M47.096 E41M47.162 P35M62.109 50 E38M59.342 P33M62.325 E36M61.067 E41M47.170 E36M59.263 P33M62.325 E41M49.357 E41M60.336b P35M62.254 55 E41M49.170 MWG741.287 7H P33M48.319a E41M47.162 E38M49.136 E36M61.093 E36M62.306 E36M61.122A E38M59.082 E37M47.222 7H MWG741.287 E36M62.225 E41M48.321 60 E41M62.351 E37M62.323 E41M48.111 7H(D) BCD421 E41M61.111b E36M61.289a E41M47.134 E36M62.225 E41M62.116 E36M49.327 E37M62.323 P44M62.226 E38M60.165 65 6ABDHR MWG669.492 E38M49.297 E38M47.171 E37M60.144 5A,5B,5D ADP.350 E41M60.239 E37M60.148 E37M47.082 P42M62.289 E38M60.092 E38M59.082 5A,5B,5D ADP.190 E41M61.267 P33M61.368 70 E38M49.297 E41M48.294 P33M62.327 E41M48.294 E41M61.112 P44M62.290 E41M48.111 E36M59.391 E37M61.340 E41M59.095 E36M62.298 E41M47.220 75 E36M49.380 E36M49.380 E37M49.380 E37M60.144 E38M60.092 E41M60.338 E37M62.157 E41M59.203 E41M48.355 E41M61.112 E41M59.114b E41M59.203 E41M50.267 P44M62.288b E36M62.334b 80 P33M62.126 MWG669.492 6ABDHR P35M49.347 P44M62.290 P33M47.242 E37M47.259 P35M49.347 E36M59.279 E41M60.378 P35M61.311 E41M60.338 P44M62.063 85 E37M61.340 P44M49.129b E36M61.320 E38M47.384 E36M50.314 E38M59.300 E41M48.338 P33M48.319b 90 P42M61.322 P35M61.382 E41M62.342 7A WMC488.105 P44M49.130 P33M62.122 E36M50.202 E36M61.122 WMC488.105 7A 95 E41M48.240 E41M59.273 E37M60.106 E37M61.225 100 E37M60.092 E37M61.283 E38M59.327 E41M59.220 P35M50.209 P33M48.122 P33M47.230 E41M60.378 P35M62.166 P35M61.311 105 E37M61.374 E41M62.229 P44M49.129b E36M62.300 P33M60.378 E37M60.246 P33M50.332 E41M62.287 P35M61.183 E36M62.172 110 E36M49.368 E36M49.258 E41M59.252 E37M49.356 E37M47.294 E37M60.323 P33M48.122 E36M50.202 P33M60.318 E41M47.399 P44M62.156 115 P33M48.174 E38M59.151 E41M61.090a E36M62.383 E41M62.362 E36M49.269 E36M50.325 E41M62.229 P44M49.130 P35M62.280 E36M62.172 120 P33M48.178 P33M62.181 E41M47.257 E36M48.313 E41M49.313 P35M50.285 E41M60.185 P35M61.381 125 E36M62.325 E41M47.313 E37M49.108 E41M48.377 E36M59.237 E38M47.261 P35M59.237 E37M60.107 E41M49.065 P33M59.186 E36M49.101 E41M47.310 E37M62.230 E38M49.305 E36M50.398 130 E36M61.142 E36M50.212 E37M49.113 P33M47.108 E37M61.374 E41M47.255 E41M61.262 P33M48.294 P33M60.378 P33M50.156 E41M61.240 135 P33M50.142 E36M48.293 P35M62.166 E36M50.269 E37M47.169 E36M50.325 E36M49.270 140 E38M47.230 P35M62.095 P33M48.174 E41M48.384 P35M62.280 P33M60.318 P33M61.074 145 P33M48.178 E38M49.305 E41M47.257 E36M48.313 P35M61.143 E41M60.185 P35M61.381

Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. 150 P33M60.225

155

P33M61.074

CIRC_IM BOLT_IM ANTH_IM HGHT_IM

CIRC_rMQM BOLT_rMQM ANTH_rMQM HGHT_rMQM Histograms for circumference (cm) of plant spreading in the full-sib Leymus TTC1 (n=164) and TTC2 (n=170) mapping families, based on means of two clones, compared to the heterogeneous L. cinereus Acc:636 (Lc) and L. triticoides Acc:641 (Lt) progenitors, interspecific hybrid parents (TC1 and TC2), and recurrent parent (T). 60 55 2002 ID AV (SD) Lc 23 (10) 50 Lt 354 (186) 45 T 487 (61) TC1 96 (35) 40 TC2 125 (37) 35 TTC1 180 (91) TTC1 30 TTC2 299 (116) TTC2 25 20 15 10 5 0 70 140 210 280 350 420 490 560 630 700 770 840 910 980 1050 More

Lc TC1 TC2 TTC1 TTC2 Lt T 50 ID AV (SD) 45 2003 Lc 51 (26) 40 Lt 594 (326) T 853 (120) 35 TC1 200 (32) TC2 231 (38) 30 TTC1 288 (122) TTC1 25 TTC2 449 (154) TTC2 20 15 10 5 0 70 140 210 280 350 420 490 560 630 700 770 840 910 980 1050 More

Lc TC1TC2 TTC1 TTC2 Lt T 40 2004 ID AV (SD) 35 Lc 76 (21) Lt 816 (416) 30 T 1263 (177) TC1 256 (39) 25 TC2 282 (53) TTC1 362 (137) TTC2 548 (170) TTC1 20 TTC2 15 Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. 10

0 70 140 210 280 350 420 490 560 630 700 770 840 910 980 1050 More

Lc TC1TC2 TTC1 TTC2 Lt T Histograms for proportion of bolting culms in the full-sib Leymus TTC1 (n=164) and TTC2 (n=170) mapping populations, based on means of two clones, compared to the heterogeneous L. cinereus Acc:636 (Lc) and L. triticoides Acc:641 (Lt) progenitors, interspecific hybrid parents (TC1 and TC2), and recurrent parent (T).

110 ID AV (SD) 100 2002 Lc 0.28 (0.46) 90 Lt 0.67 (0.48) T 1.00 (0.00) 80 TC1 0.79 (0.43) 70 TC2 1.00 (0.00) TTC1 0.57 (0.43) 60 TTC2 0.72 (0.39) TTC1 50 TTC2 40 30 20 10 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1

T Lc TTC1 Lt TTC2 TC1 TC2 40 2003 ID AV (SD) 35 Lc 0.63 (0.43) Lt 0.56 (0.32) 30 T 0.98 (0.06) TC1 0.88 (0.19) 25 TC2 0.77 (0.21) TTC1 0.33 (0.24) TTC1 20 TTC2 0.55 (0.26) TTC2 15

0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1

TTC1 TTC2 Lt Lc TC2 TC1 T 40 2004 ID AV (SD) 35 Lc 0.85 (0.33) Lt 0.78 (0.35) 30 T 1.00 (0.00) TC1 0.84 (0.19) 25 TC2 0.81 (0.23) TTC1 0.55 (0.26) TTC1 20 TTC2 0.67 (0.27) TTC2 15

Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. 10

0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1

TTC1 TTC2 Lt TC2 TC1 Lc T Histograms for anthesis date (days from January 1) in the full-sib Leymus TTC1 (n=164) and TTC2 (n=170) mapping populations, based on means of two clones, compared to the heterogeneous L. cinereus Acc:636 (Lc) and L. triticoides Acc:641 (Lt) progenitors, interspecific hybrid parents (TC1 and TC2), and recurrent parent (T). 100 90 2002 ID AV (SD) 80 Lc 176.8 (2.1) Lt 173.3 (2.6) 70 T 172.0 (0.0) 60 TC1 173.6 (2.1) TC2 173.1 (1.5) TTC1 50 TTC1 174.8 (1.9) TTC2 173.8 (4.9) TTC2 40 30 20 10 0 166 169 172 175 178 181 184 187 190 193

T-tester Lt TTC2 Lc TC2 TC1 TTC1 55 ID AV (SD) 50 2003 Lc 171.1 (5.1) 45 Lt 169.3 (1.4) T 169.0 (0.0) 40 TC1 169.0 (0.0) 35 TC2 169.0 (0.0) TTC1 172.1 (5.7) 30 TTC2 172.1 (5.5) TTC1 25 TTC2 20 15 10 5 0 166 169 172 175 178 181 184 187 190 193 T-tester Lt Lc TTC1 TC1 TC2 TTC2 70 65 2004 ID AV (SD) 60 Lc 178.3 (3.9) Lt 172.6 (1.6) 55 T 173.0 (0.0) 50 TC1 175.9 (4.0) 45 TC2 175.9 (4.0) 40 TTC1 175.7 (4.6) TTC1 35 TTC2 174.2 (4.0) 30 TTC2 25 Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved. 20 15 10 5 0 166 169 172 175 178 181 184 187 190 193

Lt TTC2 TC1 Lc T-tester TC2 Histograms for plant height (cm) in the full-sib Leymus TTC1 (n=164) and TTC2 (n=170) mapping populations, based on means of two clones, compared to the heterogeneous Leymus cinereus Acc:636 (Lc) and L. triticoides Acc:641 (Lt) progenitors, interspecific hybrid parents (TC1 and TC2), and recurrent parent (T). 50 2002 ID AV (SD) Lc 99.0 (39.8) 40 Lt 94.5 (12.6) T 100.8 (5.7) TC1 145.8 (15.9) TC2 141.8 (10.6) 30 TTC1 103.9 (13.8) TTC2 109.7 (13.0) TTC1 TTC2 20

0 60 70 80 90 100 110 120 130 140 150 160 170 180

Lt Lc T TTC1 TTC2 TC2 TC1 70 2003 ID AV (SD) Lc 135.6 (23.0) 60 Lt 98.5 (8.5) T 100.9 (5.9) 50 TC1 155.1 (12.6) TC2 138.4 (13.3) 40 TTC1 108.3 (12.9) TTC2 109.7 (13.0) TTC1 30 TTC2

0 60 70 80 90 100 110 120 130 140 150 160 170 180

Lt T TTC1 TTC2 Lc TC2 TC1 60 2004 ID AV (SD) Lc 182.9 (18.5) 50 Lt 123.3 (12.7) T 125.7 (3.4) TC1 184.7 (12.3) 40 TC2 164.6 (8.7) TTC1 134.8 (13.8) TTC2 137.8 (11.8) TTC1 30 TTC2

20 Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved.

0 60 70 80 90 100 110 120 130 140 150 160 170 180

Lt T TTC1 TTC2 TC2 Lc TC1 Description of additional SSR (CNL and KSU) and STS markers added to the Leymus TTC1 and TTC2 maps originally published by WU et al. (2003) Expected Mapped Loci(groups) Primers Gene or motif Anchor loci amplicon amplicons§ TRX1 (LG1a, LG2b) GGATAACATGACCCTAAAAACT† AY204511 thioredoxin, Xbm2, 1R 287‡ Leymus 289 GTTGTGCATCACAGGGTTATA TRX2 (LG6B) GGATAACATGACCCTAAAAAG† AY204511 thioredoxin, Xbm2 1R 287‡ Leymus 288 TTGTTCATCACAGGGTTATC CNL45 GAGAGAGCTTCGTCCCACTC (ga)9, putative RNA binding protein 2A 167‡ wheat 154, 161, 170, 172 (LG2A, LG2B) CACCACTCGTTTCTTTCACTTT

KSU154 (LG4Ns) GGAGACTCTGGTCATCTCGC (cac)7 4B 146‡ wheat 137 ATACTGGAGTGAAGGCACGG CNL39 (LG4Ns) TACCTGTGCGGCGATGAAT AF251264 (atgc)5 rubisco activase B 3A 220‡ wheat 229 CAGGAGCAGGAGAACGTGAA BCD1117 TCAGTTCTCAATAGAAGTGCTGTG BCD117 barley cDNA clone 4HD 209 152, 211 (LG4Ns, LG4Xm) TCCTGAATAAGGTCTTCATACCAA

HVCABG (LG4Ns) ACACCTTCCCAGGACAATCC Rubisco (AT)29 4H 182 barley 152 CAGAGCACCGAAAAAGTCTGTA HVM068 (LG4Xm) AGGACCGGATGTTCATAACG (GA)22 4H 204 barley 199 CAAATCTTCCAGCGAGGCT KSU149 (LG4Xm) GAGCCACCAGAGCAGAAATC (acc)9 4D 228‡ wheat 240, 243 CGAGCTCCCCTTCTTCTTCT KSU171 (LG5Ns) TCTTGCTTGCATTGTAACCG (agt)7 5B 243‡ wheat 279 TCATGTCTGGGAGCATGGTA MWG2230 (LG5Ns) AATGATGTTGCTTTCCTGTTTGCTC MWG2230 barley genomic DNA 5H 320 barley 285 ACAGATGATGATGGCGTGCAGCTTT VRN2 (LG5Ns) AGTACCAGTTCTTCRCCCAAGG Wheat vrn2 (AY485644) 4H, 4A/5A 203 wheat 193,199 CTGCASYAGGTGAGCCAT MWG2264 (LG6a) AGGTAGAAGTCAAACTGTGTGGGAT MWG2264 barley genomic DNA 6H 400-450 403 GTATTACTTTACGAGTTAGATGCTA ADP (LG7a) CCTCCGTGAACAATTTCCTG M31616 ADP glucose phosphorylase 5ABD 1003‡ rice 350 TaqI TCCAATACGAGCATTCTTGT 190 TaqI † FAM 5’ labeled primer. ‡ Amplicon size based on sequence data. § Amplicon size based on comparisons with internal size standards in capillary electrophoresis. Reproduced from Crop Science. Published by Crop Science Society of America. All copyrights reserved.