USOO6331289B1 (12) United States Patent (10) Patent No.: US 6,331,289 B1 Klaveness et al. (45) Date of Patent: Dec. 18, 2001

(54) TARGETED DIAGNOSTIC/THERAPEUTIC 5,716,594 2/1998 Elmaleh et al...... 424/1.41 AGENTS HAVING MORE THAN ONE 5,733,572 3/1998 Unger et al...... 424/450 DIFFERENT VECTORS 5,780,010 7/1998 Lanza et al. . ... 424/9.32 5,846,517 12/1998 Unger ...... 424/9.52 (75) Inventors: Jo Klaveness; Pál Rongved; Anders 5,849,727 12/1998 Porter et al...... 514/156 Høgset; Helge Tolleshaug, Alan 5,910,300 6/1999 Tournier et al...... 424/9.34 Cuthbertson; Lars Hoff, Klaus Bryn; 6.245,318 6/2001 Klibanov et al...... 424/9.52 Halldis Hellebust; Magne Solbakken, FOREIGN PATENT DOCUMENTS all of Olso (NO) 2 145 SOS 4/1994 (CA). 19 626 530 7/1996 (DE). (73) Assignee: Nycomed Imaging AS, Oslo (NO) O 727 225 8/1996 (EP). WO 93/20802 10/1993 (WO). * Y NotOtice: Subjubject to anyy disclaimer,disclai theh term off thisthi WO 94/07539 4/1994 (WO). patent is extended or adjusted under 35 WO 94/28873 12/1994 (WO). U.S.C. 154(b) by 0 days. WO 94/28874 12/1994 (WO). WO95/03356 2/1995 (WO). WO95/03357 2/1995 (WO). (21) Appl. No.: 08/959,206 WO95/07072 3/1995 (WO). (22) Filed: Oct. 28, 1997 WO95/15118 6/1995 (WO). WO 96/39149 12/1996 (WO). Related U.S. Application Data WO 96/40277 12/1996 (WO). (60) Provisional application No. 60/049.263, filed on Jun. 7, WO 96/40285 12/1996 (WO). 1997, provisional application No. 60/049.264, filed on Jun. WO 96/41647 12/1996 (WO). 6, 1997, and provisional application No. 60/049.266, filed WO 97/23855 7/1997 (WO). on Jun. 7, 1997. WO 97/33474 9/1997 (WO). WO 97/41898 11/1997 (WO). (30) Foreign Application Priority Data WO 98/OO172 1/1998 (WO). Oct. 28, 1996 (GB) ...... 9622366 WO 98/04293 2/1998 (WO). Oct. 28, 1996 (GB) ...... 9622369 WO 98/19705 5/1998 (WO). Feb. 4, 1997 (GB) ...... 97.02195 WO 98/20856 5/1998 (WO). Apr. 24, 1997 (GB) ...... 9708265 WO 98/42384 10/1998 (WO). Jun. 6, 1997 (GB) ...... 9711837 OTHER PUBLICATIONS Jun. 6, 1997 (GB) ...... 9711839 Worthington Enzyme Manual, Worthington Biochemical (51) Int. Cl...... A61B 8/00; A61K 51/00; Corporation, 1972. A61K 9/127 U.S. application No. 08/640,464, Unger, filed May 1, 1996. (52) U.S. Cl...... 424/9.52; 424/1.21; 424/9.4; U.S. application No. 08/660,032, Unger, filed Jun. 6, 1996. 424/9.6; 424/450 U.S. application No. 08/712,173, Unger, filed Sep. 11, 1996. (58) Field of Search ...... 424/9.52, 9.51, Medline database extract No. XP-002063692, 1997. 424/9.5, 450, 489, 498, 499, 502, 1.21, Biosis database extract No. XP-002063693, Nov. 1997. 9.4, 9.6, 9.1; 530/300, 324, 326, 327: 514/14 Medline database extract No. KP-002064110, 1997. Muzykantov et al., J. Nuclear Medicine, 35(8): 1358–1365 (56) References Cited (1994). U.S. PATENT DOCUMENTS Klibanov et al., Acta Radiologica, 38(Supp. 412): 113-120 (1997). 4,927,916 5/1990 Matsueda ...... 530/387 5,013,556 5/1991 Woodle et al...... 424/450 * cited by examiner 5,154,924 10/1992 Friden ...... 424/85.91 5,198.424 3/1993 McEver ...... 514/13 Primary Examiner Michael G. Hartley 5,356,633 10/1994 Woodle et al. ... 424/450 (74) Attorney, Agent, or Firm-Bacon & Thomas 5,362.478 11/1994 Desai et al...... 424/9 (57) ABSTRACT 5,498,421 3/1996 Grinstaff et al...... 424/450 5,505,932 4/1996 Grinstaff et al...... 424/9.3 Targetable diagnostic and/or therapeutically active agents, 5,534.241 7/1996 Torchillin et al. ... 424/9.321 e.g. ultrasound contrast agents, comprising a Suspension in 5,612,057 3/1997 Lanza et al...... 424/450 an aqueous carrier liquid of a reporter comprising gas 5,632,986 5/1997 Tait et al...... 424/94.64 5,643,553 7/1997 Schneider et al. . ... 424/9.52 containing or gas-generating material, Said agent being 5,650,156 7/1997 Grinstaff et al...... 424/400 capable of forming at least two types of binding pairs with 5,656.211 8/1997 Unger et al...... 264/4.1 a target. 5,665,383 9/1997 Grinstaff et al. ... 424/450 5,690,907 11/1997 Lanza et al...... 424/9.5 22 Claims, 1 Drawing Sheet U.S. Patent Dec. 18, 2001 US 6,331,289 B1

256 Gm: 15.62 CW. 34.39 144-1023) 18430 (92.2/)

FITClog F. G. 1. US 6,331,289 B1 1 2 TARGETED DIAGNOSTIC/THERAPEUTIC Surfactant material but rather that this is incorporated in AGENTS HAVING MORE THAN ONE liquid-filled liposomes which stabilise the microbubbles. It DIFFERENT VECTORS will be appreciated that lamellar or laminar Surfactant mate rial Such as phospholipids present in Such liposomes will This application claims benefit of the filing dates under 5 inevitably be present in the form of one or more lipid 35 USC 119(e) of U.S. provisional applications 60/049.263 bilayers with the lipophilic tails “back-to-back” and the and 049,264 filed on Jun. 6, 1997 and 60/049,266 filed on hydrophilic heads both inside and outside (see e.g. Jun. 7, 1997. Schneider, M. on "Liposomes as drug carriers: 10 years of It is well known that ultraSonic imaging comprises a research” in Drug targeting, Nyon, Switzerland, 3-5 Octo potentially valuable diagnostic tool, for example in Studies ber 1984, Buri, P. and Gumma, A. (Ed), Elsevier, Amsterdam of the vascular System, particularly in cardiography, and of 1984). tissue microvasculature. A variety of contrast agents has EP-A-0727225 describes targeted ultrasound contrast been proposed to enhance the acoustic images So obtained, agents in which the reporter comprises a chemical having a including Suspensions of Solid particles, emulsified liquid Sufficient vapour pressure Such that a proportion of it is a gas droplets, gas bubbles and encapsulated gases or liquids. It is 15 at the body temperature of the subject. This chemical is generally accepted that low density contrast agents which asSociated with a Surfactant or albumin carrier which are easily compressible are particularly efficient in terms of includes a protein-, peptide- or carbohydrate-based cell the acoustic backScatter they generate, and considerable adhesion molecule ligand as vector. The receptor moieties in interest has therefore been shown in the preparation of Such contrast agents correspond to the phase shift colloid gas-containing and gas-generating Systems. systems described in WO-A-9416739; it is now recognised Gas-containing contrast media are also known to be that administration of Such phase shift colloids may lead to effective in magnetic resonance (MR) imaging, e.g. as generation of microbubbles which grow uncontrollably, susceptibility contrast agents which will act to reduce MR possibly to the extent where they cause potentially danger Signal intensity. Oxygen-containing contrast media also rep ouS embolisation of, for example, the myocardial vascula resent potentially useful paramagnetic MR contrast agents. 25 ture and brain (see e.g. Schwarz, Advances in Echo-Contrast Furthermore, in the field of X-ray imaging it has been 1994(3)], pp. 48–49). observed that gases Such as carbon dioxide may be used as WO-A-9320802 proposes that tissue-specific ultrasonic negative oral contrast agents or intravascular contrast image enhancement may be achieved using acoustically agents. reflective oligolamellar liposomes conjugated to tissue The use of radioactive gases, e.g. radioactive isotopes of Specific ligands Such as antibodies, peptides, lectins etc. The inert gases Such as Xenon, has also been proposed in liposomes are deliberately chosen to be devoid of gas and So Scintigraphy, for example for blood pool imaging. will not have the advantageous echogenic properties of Targeted ultrasound contrast agents may be regarded as gas-based ultrasound contrast agents. Further references to comprising (i) a reporter moiety capable of interacting with this technology, e.g. in targeting to fibrin, thrombi and ultrasound irradiation to generate a detectable signal; (ii) one 35 atherosclerotic areas are found in publications by or more vectors having affinity for particular target Sites Alkanonyuksel, H. et al. in J. Pharm. Sci. (1996) 85(5), and/or structures within the body, e.g. for Specific cells or 486-490, J. Am. Coll. Cardiol. (1996)27(2) Suppl A, 298A; areas of pathology; and (iii) one or more linkers connecting and Circulation, 68 Sci. Sessions, Anaheim 13-16 Novem said reporter and vector(s), in the event that these are not ber 1995. directly joined. 40 There is also a number of publications concerning ultra The molecules and/or structure to which the contrast Sound contrast agents which refer in passing to possible use agent is intended to bind will hereinafter be referred to as the of monoclonal antibodies as vectors without giving Signifi target. In order to obtain specific imaging of a Selected cant practical detail and/or to reporters comprising materials region/structure in the body the target must be present and which may be taken up by the reticuloendothelial System available in this region/structure. Ideally it will be expressed 45 and thereby permit image enhancement of organs Such as the only in the region of interest, but usually will also be present liver-see, for example WO-A-9300933, WO-A-94.01140, at other locations in the body, creating possible background WO-A-9408.627, WO-A-9428874, U.S. Pat. No. 5,088,499, problems. The target may either be a defined molecular U.S. Pat. No. 5,348,016 and U.S. Pat. No. 5,469,854. In Species (i.e. a target molecule) or an unknown molecule or general these prior art targeted contrast agents are intended more complex structure (i.e. a target structure) which is 50 to enhance contrast at Specific Sites in the body, for example present in the area to be imaged, and is able to bind tumour cells, by using one vector to bind Strongly to one Specifically or Selectively to a given vector molecule. target, in order to achieve concentration at the target cells. In The vector is attached to the reporter moiety in order to contrast to this principle of using one vector to bind with bind these moieties to the region/structure to be imaged. The high affinity to one target, the present invention is based in vector may bind Specifically to a chosen target, or it may 55 part on the finding that diagnostic and/or therapeutically bind only selectively, having affinty also for a limited active agents with more favourable properties may be number of other molecules/structures, again creating poS obtained by use of multiple kinds of vector-target interac Sible background problems. tions (e.g. involving agents associated with a plurality of There is a limited body of prior art relating to targeted different vectors and/or with one or more vectors having ultrasound contrast agents. Thus, for example, US-A- 60 affinity for different targets on the same or different cell 5531980 is directed to systems in which the reporter com types). In this way, binding of gas-containing and gas prises an aqueous Suspension of air or gas microbubbles generating diagnostic and/or therapeutic agents may, for Stabilised by one or more film-forming Surfactants present at example, be obtained by forming multiple binding pairs least partially in lamellar or laminar form, said Surfactant(s) between one vector with Specificity for more than one being bound to one or more vectors comprising “bioactive 65 receptor or between more than one vector with affinity for Species designed for Specific targeting purposes'. It is Stated one or more types of target, with either low or high affinities. that the microbubbles are not directly encapsulated by Such multiple binding of the vector-conjugated agent to one US 6,331,289 B1 3 4 or more target molecules/structures may result in advanta described by Lanza et al. (Circulation, (1996) 94 (12), pp geous targeting properties, for example by enhancing target 3334), annexin V atherosclerotic plaque binding peptides Specificity and/or by distinguishing interactions at a desired such as YRALVDTLK, or any other vector known to target area from background interactions with lower levels asSociate with fibrin clots, in combination with a drug or of molecules/structures Similar to target expressed elsewhere enzyme with fibrinolytic activity Such as Streptokinase, in the body. plasminogen activator (tPA), urokinase (uPA) or prouroki It is well known to use one vector binding with high nase (scuPA) resulting in a localised therapeutic antithrom affinity to one target. The present invention, however, is botic effect. This invention is also extended to include based on the finding that the desired binding of gas vectors with increased specificity for tumour cells in com containing and gas-generating diagnostic and/or therapeutic bination with vectors or drug molecules functioning as agents may be obtained by forming multiple binding pairs chemotherapeutic agents capable of inhibiting tumour with low affinity between one type of vector and one type of growth. target, or by forming multiple binding pairs between one or It is well known that many, if not all, target molecules are more types of vectors and one or more types of target, with not expressed exclusively at target Sites, a common situation either low or high affinities. Thus multiple binding of the 15 is that Such molecules are over-expressed by target cells or vector conjugated agent to one or more target molecules/ at a target Structure but are also expressed at lower levels Structures may have advantageous targeting properties, for elsewhere in the body. The use of reporters carrying a example in enhancing target Specificity and/or in distin multiplicity of vectors with relatively low affinity for the guishing interactions at a desired target area from back target may be advantageous in this situation, Since the ground interactions with lower levels of molecules/ reporter will then tend to concentrate in regions of high Structures Similar to target expressed elsewhere in the body. target density which permit multiple (and therefore strong) Thus according to one aspect of the present invention binding to the reporter (e.g. a gas-containing agent incor there is provided a targetable diagnostic and/or therapeuti porating the Vectors folic acid and glutathione for multiple cally active agent, e.g. an ultrasound contrast agent, com Specific binding to folic acid receptors and glutathione-S- prising a Suspension in an aqueous carrier liquid, e.g. an 25 trasferase receptorS respectively which are over-expressed injectable carrier liquid, of a reporter comprising gas as tumour cells). Areas of low target density, on the other containing or gas-generating material characterised in that hand, will not provide sufficient interaction with such low Said agent is capable of forming at least two types of binding affinity vectors to bind the target. In such embodiments of pairs, e.g. being conjugated to at least two vectors or to one the invention, low affinity vectors may be regarded as having vector capable of binding to at least two binding Sites. an association constant K, for interaction with a target mol One advantageous embodiment of the invention is based ecule or structure of less than 10 M', e.g. less than 107 on the additional finding that limited adhesion to targets is M, preferably less than 10 M. A further embodiment of a highly useful property of diagnostic and/or therapeutically this invention is thus based on the finding that the desired active agents, which property may be achieved using vectors binding of gas-containing and gas-generating diagnostic giving temporary retention rather than fixed adhesion to a 35 and/or therapeutic agents may be obtained by forming target. Thus Such agents, rather than being fixedly retained binding pairs with low affinity between more than one type at Specific Sites, may for example effectively exhibit a form of vector and one or more type of target. Multiple vectors of retarded flow along the vascular endothelium by virtue of may therfore be used to increase Specificity, So that the their transient interactions with endothelial cells. Such reporter will bind only to target cells or Structures expressing agents may thus become concentrated on the walls of blood 40 a particular combination of target molecules. vessels, in the case of ultrasound contrast agents providing It may also be useful to select a plurality of vectors which enhanced echogenicity thereof relative to the bulk of the bind to different parts, e.g. epitopes, of a target Structure in bloodstream, which is devoid of anatomical features. They order to give increased binding Strength. This may be therefore may permit enhanced imaging of the capillary particularly advantageous when the target density is low. System, including the microvasculature, and So may facili 45 Products comprising two or more vectors with different tate distinction between normal and inadequately perfused Specificities, i.e. which bind to different target molecules on tissue, e.g. in the heart, and may also be useful in Visualising different cells, may advantageously be used as "general Structures Such as Kupffer cells, thrombi and atherosclerotic purpose' agents for detection of a range of diseases, e.g. lesions or for visualising neo-vascularized and inflamed different forms of cancer. Thus, for example, the use of Such tissue areas. The present invention is well Suited to imaging 50 agents may enable detection of metastases, which are often changes occurring in normal blood vessels which are situ heterogeneous with respect to expression of target molecules ated in areas of tissue necrosis. (i.e. antigens). It will be appreciated that binding affinities are dependent Within the context of the present invention, the reporter on numbers of interactions as well as their Strength. The unit will usually remain attached to the vectors. In another density of vector molecules at the Surface of the reporter 55 type of targeting procedure, Sometimes called pre-targeting, units may therefore be selected So as appropriately to adjust the vector (often, a monoclonal antibody) is administered the degree of interactions between particular agents and alone; Subsequently, the reporter is administered, coupled to targets. a moiety which is capable of Specifically binding the Vector The term multiple-specificity is also used to describe an molecule (when the vector is an antibody, the reporter may injectable carrier liquid, of gas-containing or gas-generating 60 be coupled to an immunoglobulin-binding molecule, Such as material composed of one or more vectors with a specificity protein A or an anti-immunoglobulin antibody). An advan for one or more cellular Surface receptors while at the same tage of this protocol is that time may be allowed for time comprising a Second element with Specificity for a elimination of the vector molecules that do not bind their Substrate or receptor System binding to which induces a targets, Substantially reducing the background problems that therapeutic response. Thus included within the Scope of the 65 are connected with the presence of an excess of reporter present invention are multiple-specific imaging agents com vector conjugate. Within the context of the present prising a targeting vector, Such as the anti-fibrin antibody invention, pre-targeting with one Specific vector might be US 6,331,289 B1 S 6 envisaged, followed by reporter units that are coupled to a polyoxyethylene-polyoxypropylene block copolymer Sur another vector and a moiety which binds the first vector. factant Such as a Pluronic, a polymer Surfactant as described Within the context of the present invention, in Some cases in WO-A-9506518, or a film-forming surfactant such as a and in particular for the assessment of blood perfusion rates phospholipid, e.g. as described in WO-A-9211873, WO-A- in defined areas, for example in myocardium, it is of interest 921.7212, WO-A-9222247, WO-A-9428780 or WO-A- to measure the rate at which ultrasound contrast agents 9503835). bound to the target are displaced or released from the target. Other useful gas-containing contrast agent formulations This can be achieved in a controlled fashion by Subsequent include gas-containing Solid Systems, for example micro administration of a vector or other agent able to displace or particles (especially aggregates of microparticles) having release the contrast agent from the target. gas contained therewithin or otherwise associated therewith (for example being adsorbed on the Surface thereof and/or BRIEF DESCRIPTION OF THE DRAWINGS contained within Voids, cavities or pores therein, e.g. as FIG. 1 Flow cytometric comparison of negative control described in EP-A-0122624, EP-A-0123235, EP-A- microbubbles of DSPS (left curve) with bubbles conjugated 0365467, WO-A-92.21382, WO-A-9300930, WO-A- with CD71 FITC-labelled anti-transferrin antibody (filled 15 9313802, WO-A-9313808 or WO-A-9313809). It will be curve, right) showing that 92% of the population fluoresce. appreciated that the echogenicity of Such microparticulate Vectors useful in accordance with the invention include contrast agents may derive directly from the contained/ ligands for cell adhesion proteins, as well as cell adhesion associated gas and/or from gas (e.g. microbubbles) liberated proteins themselves where these have corresponding ligands from the Solid material (e.g. upon dissolution of the micro on endothelial cell Surfaces. Examples of cell adhesion particulate structure). proteins include integrins, most of which bind the Arg-Gly The disclosures of all of the above-described documents Asp (RGD) amino acid sequence. If desired, the vector may relating to gas-containing contrast agent formulations are be targeted to Specific cell adhesion proteins expressed incorporated herein by reference. mainly on activated endothelial cells Such as are found at or 25 Gas microbubbles and other gas-containing materials close to Sites of inflammation or other pathological Such as microparticles preferably have an initial average size responses. Other vectors which may be used include pro not exceeding 10 um (e.g. of 7 um or less) in order to permit teins and peptides that bind to cell-Surface proteoglycans, their free passage through the pulmonary System following which are complexes of proteins and Sulphated polysaccar administration, e.g. by intravenous injection. ides found on most cells, including endothelial cells. Such Where phospholipid-containing compositions are proteoglycans contribute to the negative Surface charge of employed in accordance with the invention, e.g. in the form all nucleated cells from vertebrate animals; this charge may of phospholipid-Stabilised gas microbubbles, representative also be exploited in accordance with the invention by using examples of useful phospholipids include lecithins (i.e. positively charged vectors, e.g. comprising cationic lipids, phosphatidylcholines), for example natural lecithins Such as which will interact electrostatically with the endothelial 35 egg yolk lecithin or Soya bean lecithin and Synthetic or Surface. Se miSynthetic le cithins Such S A further aspect of the present invention is for example dimyristoylphosphatidylcholine, dipalmitoylphosphatidyl where a vector or vectorS is attached to the reporter or choline or distearoylphosphatidylcholine; phosphatidic included non-covalently into the reporter in a manner where acids, phosphatidylethanolamines, phosphatidylserines, the Said vector or vectors is not readily exposed to the targets 40 phosphatidylglycerols, phosphatidylinositols, cardiolipins, or receptors. Increased tissue Specificity may therefore be Sphingomyelins, fluorinated analogues of any of the fore achieved by applying an additional process to expose the going, mixtures of any of the foregoing and mixtures with vectors, e.g. the agent is exposed after administration to other lipids Such as cholesterol. The use of phospholipids external ultrasound to change the diffusibility of the moieties predominantly (e.g. at least 75%) comprising molecules containing the vectors. 45 individually bearing net Overall charge, e.g. negative charge, The reporter may be in any convenient form, for example for example as in naturally occurring (e.g. Soya bean or egg being any appropriate gas-containing or gas-generating yolk derived), semisynthetic (e.g. partially or fully ultrasound contrast agent formulation. Representative hydrogenated) and Synthetic phosphatidylserines, examples of Such formulations include microbubbles of gas phosphatidylglycerols, phosphatidylinositols, phosphatidic Stabilised (e.g. at least partially encapsulated) by a 50 acids and/or cardiolipins, may be particularly advantageous. coalescence-resistant Surface membrane (for example Other exemplary lipids which may be used to prepare gelatin, e.g. as described in WO-A-8002365), a filmogenic gas-containing contrast agents include fatty acids, Stearic protein (for example an albumin Such as human serum acid, palmitic acid, 2-n-hexadecylstearic acid, oleic acid and albumin, e.g. as described in U.S. Pat. No. 4,718,433, U.S. other acid containing lipid structures. These lipid structures Pat. No. 4,774,958, U.S. Pat. No. 4,844,882, EP-A-0359246, 55 are considered particularly interesting when coupled by WO-A-9112823, WO-A-9205806, WO-A-9217213, WO-A- amide bond formation to amino acids containing one or 9406477 or WO-A-950.1187), a polymer material (for more amino groups. The resulting lipid modified amino example a Synthetic biodegradable polymer as described in acids (e.g. dipal mitoylly Sine, dis tearoyl-2,3- EP-A-0398935, an elastic interfacial synthetic polymer diaminopropionic acid) are considered useful precursors for membrane as described in EP-A-0458745, a microparticu 60 the attachment of functionalised Spacer elements featuring late biodegradable polyaldehyde as described in EP-A- coupling Sites for conjugation of one or more vector mol 0441468, a microparticulate N-dicarboxylic acid derivative ecules. of a polyamino acid-polycyclic imide as described in A further eXtension of this invention relates to the Syn EP-A-0458079, or a biodegradable polymer as described in thesis of lipopeptide Structures comprising a lipid reporter WO-A-9317718 or WO-A-9607434), a non-polymeric and 65 attached to a linker portion (e.g. PEG, polyamino acid, non-polymerisable wall-forming material (for example as alkylhalide etc) the said linker being Suitably functionalised described in WO-A-9521631), or a surfactant (for example for coupling to one or more vector molecules. A particular US 6,331,289 B1 7 8 preference is the inclusion of a positively charged linker Such as ethylene, propene, propadiene or a butene, or an element (e.g. two or more lysine residues) for anchoring of alkyne Such as acetylene or propyne, an ether Such as the reporter element in the microbubble through electrostatic dimethyl ether, a ketone; an ester; a halogenated low interaction with the negatively charged membrane. molecular weight hydrocarbon (e.g. containing up to 7 Multiple-Specific targeting is achievable by mixing and carbon atoms); or a mixture of any of the foregoing. Advan doping of phospholipid gas-containing Structures with one tageously at least Some of the halogen atoms in halogenated or more targeted lipopeptide Sequences. Multiple-specificity gases are fluorine atoms; thus biocompatible halogenated can also be achieved by assembling more than one vector on hydrocarbon gases may, for example, be Selected from a branched lysine core structure Such as those described by bromochlorodifluoromethane, chlorodifluoromethane, Tam et al. (Proc. Natl. Acad. Sci. USA, 1989, 86,9084) or dichlorodifluoromethane, bromotrifluoromethane, by incorporating multiple vectors in a linear Sequence. chlorotrifluorome thane, chlorope intafluoroethane, Multiple-Specificity can also be achieved using lipopeptides dichlorote trafluoroethane, chlorotrifluoroethylene, fluoroethylene, ethylfluoride, 1,1-difluoroethane and or phospholipids comprising combinatorial libraries Synthe perfluorocarbons, e.g. perfluoroalkane S Such as Sised by chemical Synthesis as described by Lowe perfluoromethane, perfluoroethane, perfluoropropanes, per (Combinatorial Chemistry, Chemical Society Reviews, 15 fluorobutanes (e.g. perfluoro-n-butane, optionally in admix 1995, 309-317). ture with other isomerS Such as perfluoro-iso-butane), Also within the Scope of this invention are functionalised perfluoropentanes, perfluorohexanes and perfluoroheptanes, microbubbles carrying one or more reactive groups for perfluoroalkenes Such as perfluoropropene, perfluorobutenes non-specific reaction with receptor molecules located on cell (e.g. perfluorobut-2-ene) and perfluorobutadiene; perfluoro Surfaces. Microbubbles comprising a thiol moiety, for alkynes Such as perfluorobut-2-yne, and perfluorocycloal example, can bind to cell Surface receptorS via disulphide kane S Such S perfluoro cyclobutane, eXchange reactions. The reversible nature of this covalent perfluoro methylcyclobutane, bond means that bubble flow can be controlled by altering perfluorodimethylcyclobutanes, perfluorotrimethyl the redox environment. Similarly activated microbubbles cyclobutanes, perfluorocyclopentane, perfluoromethyl of membranes comprising active esterS Such as 25 cyclope ntane, perfluorodimethylcyclope ntane S, N-hydroxySuccinimide esters can be used to modify amino perfluorocyclohexane, perfluoromethylcyclohexane and per groups found on a multiplicity of cell Surface molecules. fluorocycloheptane. Other halogenated gases include methyl Representative examples of gas-containing microparticu chloride, fluorinated (e.g. perfluorinated) ketones Such as late materials which may be useful in accordance with the perfluoroacetone and fluorinated (e.g. perfluorinated) ethers invention include carbohydrates (for example hexoses Such such as perfluorodiethyl ether. The use of perfluorinated as glucose, fructose or galactose; disaccharides Such as gases, for example Sulphur hexafluoride and perfluorocar Sucrose, lactose or maltose; pentoses Such as arabinose, bons Such as perfluoropropane, perfluorobutanes and xylose or ribose, C.-, B- and Y-cyclodextrins; polysaccharides perfluoropentanes, may be particularly advantageous in Such as Starch, hydroxyethyl Starch, amylose, amylopectin, view of the recognised high stability in the bloodstream of glycogen, inulin, pulullan, dextran, carboxymethyl dextran, 35 microbubbles containing Such gases. dextran phosphate, ketodeXtran, aminoethylde Xtran, The reporter may be made by any convenient process, for alginates, chitin, chitosan, hyaluronic acid or heparin; and example by making gas-containing or gas-generating for Sugar alcohols, including alditols Such as mannitol or mulations. Representative examples include the preparation Sorbitol), inorganic Salts (e.g. Sodium chloride), organic Salts of a Suspension of gas microbubbles by contacting a Sur (e.g. Sodium citrate, Sodium acetate or Sodium tartrate), 40 factant with gas and mixing them in the presence of an X-ray contrast agents (e.g. any of the commercially avail acqueous carrier, as described in WO 911524.4; or by atom able carboxylic acid and non-ionic amide contrast agents ising a Solution or dispersion of a wall-forming material in typically containing at least one 2,4,6-triiodophenyl group the presence of a gas in order to obtain hollow having Substituents Such as carboxyl, carbamoyl, microcapsules, as described in EP 512693A1; preparation of N-alkylcarbamoyl, N-hydroxyalkylcarbamoyl, acylamino, 45 Solid microSpheres by a double emulsion process, as N-alkylacylamino or acylaminomethyl at the 3- and/or described in U.S. Pat. No. 5,648,095; or a process for 5-positions, as in metrizoic acid, diatrizoic acid, iothalamic forming hollow microcapsules by Spray-drying as described acid, ioxaglic acid, iohexol, iopentol, iopamidol, iodixanol, in EP 68.1843A2; or preparing gas-filled liposomes by iopromide, metrizamide, iodip amide, meglumine Shaking an aqueous Solution comprising a lipid in the iodipamide, meglumine acetrizoate and meglumine 50 presence of a gas as described in U.S. Pat. No. 5,469,854. diatrizoate), and polypeptides and proteins (e.g. gelatin or A Suitable proceSS for attachment of the desired vector to albumin Such as human Serum albumin). the reporter comprises a Surface modification of the pre Any biocompatible gas may be present in the reporter of formed reporter with a Suitable linker employing reactive contrast agents according to the invention, the term "gas' as groups on the Surface of both the reporter and vector. It may used herein including any Substances (including mixtures) 55 be particularly advantageous physically to mix the reporter Substantially or completely in gaseous (including vapour) material with the vector-containing Substance at any Step of form at the normal human body temperature of 37 C. The the process. Such a proceSS will result in incorporation or an gas may thus, for example, comprise air, nitrogen; oxygen; attachment of the vector to the reporter. An optional process carbon dioxide, hydrogen; an inert gas Such as helium, Step may remove the excess of Vector not bound to the argon, Xenon or krypton; a Sulphur fluoride Such as Sulphur 60 reporter by Washing the gas-containing particles following hexafluoride, disulphur decafluoride or trifluoromethylsul Separation, by for example, floatation. A preferred aspect is phur pentafluoride, Selenium hexafluoride; an optionally the use of lipopeptide Structures incorporating functional halogenated Silane Such as methylsilane or dimethylsilane; a groupS Such as thiol, maleimide biotin etc. which can be low molecular weight hydrocarbon (e.g. containing up to 7 premixed if desired with other reporter molecules before carbon atoms), for example an alkane Such as methane, 65 formation of gas-containing agents. The attachment of Vec ethane, a propane, a butane or a pentane, a cycloalkane Such tor molecules may be carried out using the linker reagents as cyclopropane, cyclobutane or cyclopentane, an alkene listed below. US 6,331,289 B1 10 Linking of a reporter unit to the desired vectors may be viii) aziridines based on S-triazine compounds detailed achieved by covalent or non-covalent means, usually involv above, e.g. as described by Ross, W. C. J. in Adv. ing interaction with one or more functional groups located Cancer Res. (1954) 2, 1, which react with nucleophiles on the reporter and/or vectors. Examples of chemically Such as amino groups by ring opening; reactive functional groups which may be employed for this purpose include amino, hydroxyl, Sulfhydryl, carboxyl, and ix) Squaric acid diethyl esters as described by Tietze, L. F. carbonyl groups, as well as carbohydrate groups, vicinal in Chem. Ber. (1991) 124, 1215; and diols, thioethers, 2-aminoalcohols, 2-aminothiols, X) C.-haloalkyl ethers, which are more reactive alkylating guanidinyl, imidazolyl and phenolic groups. agents than normal alkyl halides because of the acti Covalent coupling of reporter and vectors may therefore Vation caused by the ether oxygen atom, e.g. as be effected using linking agents containing reactive moieties described by Benneche, T. et al. in Eur. J. Med. Chem. capable of reaction with Such functional groups. Examples (1993) 28, 463. of reactive moieties capable of reaction with sulfhydryl Representative amino-reactive acylating agents include: groups include C.-haloacetyl compounds of the type i) isocyanates and isothiocyanates, particularly aromatic X-CHCO-(where X=Br, Clor I), which show particular derivatives, Which form stable urea and thiourea reactivity for sulfhydryl groups but which can also be used 15 derivatives respectively and have been used for protein to modify imidazolyl, thioether, phenol and amino groups as crosslinking as described by Schick, A. F. et al. in J. described by Gurd, F. R. N. in Methods Enzymol. (1967) 11, 532. N-Maleimide derivatives are also considered selective Biol. Chem. (1961) 236, 2477; towards Sulfhydryl groups, but may additionally be useful in ii) sulfonyl chlorides, which have been described by coupling to amino groups under certain conditions. Herzig, D. J. et al. in Biopolymers (1964) 2, 349 and N-maleimides may be incorporated into linking Systems for which may be useful for the introduction of a fluores reporter-vector conjugation as described by Kitagawa, T. et cent reporter group into the linker; al. in Chem. Pharm. Bull. (1981) 29, 1130 or used as iii) Acid halides; polymer crosslinkers for bubble stabilisation as described by iv) Active esters such as nitrophenylesters or Kovacic, P. et al. in J. Am. Chem. Soc. (1959) 81, 1887. 25 N-hydroxysuccinimidyl esters; Reagents Such as 2-iminothiolane, e.g. as described by V) acid anhydrides Such as mixed, symmetrical or Traut, R. et al. in Biochemistry (1973) 12, 3266, which N-carboxyanhydrides; introduce a thiol group through conversion of an amino Vi) other useful reagents for amide bond formation as group, may be considered as Sulfhydryl reagents if linking described by Bodansky, M. et al. in Principles of occurs through the formation of disulphide bridges. Thus Peptide Synthesis (1984) Springer-Verlag, reagents which introduce reactive disulphide bonds into either the reporter or the vectors may be useful, Since linking Vii) acylazides, e.g. wherein the azide group is generated may be brought about by disulphide exchange between the from a preformed hydrazide derivative using Sodium vector and reporter; examples of Such reagents include nitrite, e.g. as described by Wetz, K. et al. in Anal. Ellman's reagent (DTNB), 4,4'-dithiodipyridine, methyl-3- 35 Biochem. (1974) 58, 347; nitro-2-pyridyl disulphide and methyl-2-pyridyl disulphide viii) azlactones attached to polymerS Such as bis (described by Kimura, T. et al. in Analyt. Biochem. (1982) acrylamide, e.g. as described by Rasmussen, J. K. in 122, 271). Reactive Polymers (1991) 16, 199; and Examples of reactive moieties capable of reaction with iX) Imidoesters, which form stable amidines on reaction amino groups include alkylating and acylating agents. Rep 40 with amino groups, e.g. as described by Hunter, M. J. resentative alkylating agents include: and Ludwig, M. L. in J. Am. Chem. Soc. (1962) 84, i) C-haloacetyl compounds, which show specificity 3491. towards amino groups in the absence of reactive thiol Carbonyl groups Such as aldehyde functions may be groups and are of the type X-CHCO-(where X=Cl, reacted with weak protein bases at a pH Such that nucleo Br or I), e.g. as described by Wong, Y-H.H. in Bio 45 philic protein Side-chain functions are protonated. Weak chemistry (1979) 24, 5337; bases include 1,2-aminothiols Such as those found in ii) N-maleimide derivatives, which may react with amino N-terminal cysteine residues, which selectively form stable groups either through a Michael type reaction or 5-membered thiazolidine rings with aldehyde groups, e.g. as through acylation by addition to the ring carbonyl described by Ratner, S. et al. in J. Am. Chem. Soc. (1937) 59, group as described by Smyth, D. G. et al. in J. Am. 50 200. Other weak bases such as phenyl hydrazones may be Chem. Soc. (1960) 82,4600 and Biochem.J. (1964) 91, used, e.g. as described by Heitzman, H. et al. in Proc. Natl. 589; Acad. Sci. USA (1974) 71, 3537. iii) aryl halides Such as reactive nitrohaloaromatic com Aldehydes and ketones may also be reacted with amines pounds, to form Schiff's bases, which may advantageously be Sta 55 bilised through reductive amination. Alkoxylamino moieties iv) alkyl halides as described by McKenzie, J. A. et al. in readily react with ketones and aldehydes to produce Stable J. Protein Chem. (1988) 7, 581; alkoxamines, e.g. as described by Webb, R. et al. in Bio v) aldehydes and ketones capable of Schiff's base forma conjugate Chem. (1990) 1, 96. tion with amino groups, the adducts formed usually Examples of reactive moieties capable of reaction with being Stabilised through reduction to give a Stable 60 carboxyl groups include diazo compounds Such as diaZoac amine; etate esters and diazoacetamides, which react with high Vi) epoxide derivatives Such as epichlorohydrin and Specificity to generate ester groups, e.g. as described by bisoxiranes,which may react with amino, Sulfhydryl or Herriot R. M. in Adv. Protein Chem. (1947) 3, 169. Car phenolic hydroxyl groups, boxylic acid modifying reagents Such as carbodiimides, vii) chlorine-containing derivatives of S-triazines, which 65 which react through O-acylurea formation followed by are very reactive towards nucleophiles Such as amino, amide bond formation, may also usefully be employed; Sufhydryl and hydroxy groups, linking may be facilitated through addition of an amine or US 6,331,289 B1 11 12 may result in direct vector-receptor coupling. Useful water Raynal, P. and H. B. Pollard. Annexins: the problem of soluble carbodiimides include 1-cyclohexyl-3-(2- assessing the biological role for a gene family of multifunc morpholinyl-4-ethyl)carbodiimide (CMC) and 1-ethyl-3-(3- tional calcium- and phospholipid-binding proteins. Bio dimethylaminopropyl)carbodiimide (EDC), e.g. as chim. Biophys. Acta 1197: 63-93). A conjugate of a vector described by Zot, H. G. and Puett, D. in J. Biol. Chem. 5 with Such a phosphatidylserine-binding protein may there (1989) 264, 15552. Other useful carboxylic acid modifying fore be used to attach the vector to phosphatidylserine reagents include isoxazolium derivatives Such as Wood encapsulated microbubbles. When the amino acid Sequence wards reagent K, chloro for mate S. Such as of a binding protein is known, the phospholipid-binding p-nitrophenylchloroformate; carbonyldiimidazoles Such as portion may be Synthesised or isolated and used for conju 1, 1'- carbonyl diimidazole; and gation with a vector, thus avoiding the biological activity N-carb alko Xy dihydro quino line S Such as which may be located elsewhere in the molecule. N-(ethoxycarbonyl)-2-ethoxy-1,2-dihydroquinoline. It is also possible to obtain molecules that bind Specifi Other potentially useful reactive moieties include vicinal cally to the surface (or in the “membrane”) of microspheres diones Such as p-phenylenediglyoxal, which may be used to by direct Screening of molecular libraries for microSphere react with guanidinyl groups, e.g. as described by Wagner et 15 binding molecules. For example, phage libraries displaying al. in Nucleic acid Res. (1978) 5,4065; and diazonium salts, Small peptides could be used for Such Selection. The Selec which may undergo electrophilic Substitution reactions, e.g. tion may be made by Simply mixing the microSpheres and as described by Ishizaka, K. and Ishizaka T. in J. Immunol. the phage display library and eluting the phages binding to (1960) 85, 163. Bis-diazonium compounds are readily pre the floating microSpheres. If desired, the Selection can be pared by treatment of aryl diamines with Sodium nitrite in done under “physiological conditions” (e.g. in blood) to acidic Solutions. It will be appreciated that functional groups eliminate peptides which croSS-react with blood compo in the reporter and/or vector may if desired be converted to nents. An advantage of this type of Selection procedure is other functional groups prior to reaction, e.g. to confer that only binding molecules that do not destabilize the additional reactivity or Selectivity. Examples of methods microSpheres should be Selected, Since only binding mol useful for this purpose include conversion of amines to 25 ecules attached to intact floating microSpheres will rise to carboxylic acids using reagents Such as dicarboxylic anhy the top. It may also be possible to introduce Some kind of drides, conversion of amines to thiols using reagents Such as “stress” during the Selection procedure (e.g. pressure) to N-acetylhomoc y Steine thiolac tone, ensure that destabilizing binding moieties are not Selected. S-acetylmercaptoSuccinic anhydride, 2-iminothiolane or Furthermore the Selection could be done under Shear con thiol-containing Succinimidyl derivatives, conversion of thi ditions e.g. by first letting the phages react with the micro ols to carboxylic acids using reagents Such as a-haloacetates, Spheres and then letting the microSpheres pass through a conversion of thiols to amines using reagents Such as Surface coated with anti-phage antibodies under flow con ethylenimine or 2-bromoethylamine; conversion of carboxy ditions. In this way it may be possible to select binders lic acids to amines using reagents Such as carbodiimides which may resist shear conditions present in Vivo. Binding followed by diamines; and conversion of alcohols to thiols 35 moieties identified in this way may be coupled (chemically using reagents Such as tosyl chloride followed by transes via peptide Synthesis, or at the DNA-level using recombi terification with thioacetate and hydrolysis to the thiol with nant vectors) to a vector molecule, constituting a general Sodium acetate. tool for attaching any vector molecule to the microSpheres. Vector-receptor coupling may also be effected using A vector which comprises or is coupled to a peptide or enzymes as Zero-length crosslinking agents; thus, for 40 lipopeptide linker which contains a element capable of example, transglutaminase, peroxidase and Xanthine oxidase mediating membrane insertion may also be useful. One have been used to produce crosslinked products. Reverse example is described by Leenhouts, J. M. et al. in Febs proteolysis may also be used for crosslinking through amide Letters (1995) 370(3), 189-192. Non-bioactive molecules bond formation. consisting of known membrane insertion anchor/signal Non-covalent vector-receptor coupling may, for example, 45 groups may also be used as Vectors for certain applications, be effected by electroStatic charge interactions e.g. between an example being the H1 hydrophobic Segment from the Na, a polylysinyl-functionalised reporter and a polyglutamyl K-ATPase O-subunit described by Xie, Y. and Morimoto, T. functionalised vector, through chelation in the form of Stable in J. Biol. Chem. (1995) 270(20), 11985–11991. The anchor metal complexes or through high affinity binding interaction group may also be fatty acid(s) or cholesterol. Such as avidin/biotin binding. Polylysine, coated non 50 Coupling may also be effected using avidin or covalently to the negatively charged membrane Surface can streptavidin, which have four high affinity binding sites for also increase non-specifically the affinity of a microbubble biotin. Avidin may therefore be used to conjugate vector to for a cell through charge interactions. reporter if both vector and reporter are biotinylated. Alternatively, vectors may be coupled to a protein or Examples are described by Bayer, E. A. and Wilchek, M. in peptide Sequence known to bind phospholipids. In many 55 Methods Biochem. Anal. (1980) 26, 1. instances, a single molecule of phospholipid may attach to This method may also be extended to include linking of a protein Such as a translocase, while other proteins may reporter to reporter, a process which may encourage bubble attach to Surfaces consisting mainly of phospholipid head asSociation and consequent potentially increased echogenic groupS and So may be used to attach vectors to phospholipid ity. microSpheres; one example of Such a protein is 60 Non-covalent coupling may also utilise the bifunctional f32-glycoprotein I (Chonn, A., Semple, S. C. and Cullis, P. nature of bispecific immunoglobulins. These molecules can R., Journal of Biological Chemistry (1995) 270, Specifically bind two antigens, thus linking them. For 25845-25849). Phosphatidylserine-binding proteins have example, either bispecific IgG or chemically engineered been described, e.g. by Igarashi, K. et al. in Journal of bispecific F(ab)2 fragments may be used as linking agents. Biological Chemistry 270(49), 29075-29078. Annexins are 65 Heterobifunctional bispecific antibodies have also been a class of phospholipid-binding proteins, many of which reported for linking two different antigens, e.g. as described bind particularly avidly to phosphatidyl-Serine (reviewed in by Bode, C. et al. in J. Biol. Chem. (1989) 264,944 and by US 6,331,289 B1 13 14 Staerz, U. D. et al. in Proc. Natl. Acad. Sci. USA (1986) 83, The major mechanism for uptake of particles by the cells 1453. Similarly, any reporter and/or vector containing two or of the reticuloendothelial system (RES) is opsonisation by more antigenic determinants (e.g. as described by Chen, Aa plasma proteins in blood; these mark foreign particles which et al. in Am. J. Pathol. (1988) 130, 216) may crosslink are then taken up by the RES. The biological properties of antibody molecules and lead to formation of multi-bubble PEG spacer elements used in accordance with the invention croSS-linked assemblies of potentially increased echogenic may serve to increase contrast agent circulation time in a ity. similar manner to that observed for PEGylated liposomes So-called Zero-length linking agents, which induce direct (see e.g. Klibanov, A. L. et al. in FEBS Letters (1990) 268, covalent joining of two reactive chemical groups without 235-237 and Blume, G. and Cevc, G. in Biochim. BiophyS. introducing additional linking material (e.g. as in amide Acta (1990) 1029, 91–97). bond formation induced using carbodiimides or Other potentially useful protein modifications which can enzymatically) may, if desired, be used, as may agents Such be made to vectors include partial or complete deglycosi as biotin/avidin Systems which induce non-covalent dation by neuraminidase, endoglycosydases or periodate, reporter-vector linking and agents which induce hydropho Since deglycosidation often results in leSS uptake by liver, bic or electrostatic interactions. 15 Spleen, macrophages etc., whereas neo-glycosylation of Most commonly, however, the linking agent will com proteins often results in increased uptake by the liver and prise two or more reactive moieties, e.g. as described above, macrophages); preparation of truncated forms by proteolytic connected by a Spacer element. The presence of Such a cleavage, leading to reduced size and shorter half life in Spacer permits bifunctional linkers to react with Specific circulation; and cationisation, e.g. as described by Kumagi functional groups within a molecule or between two differ et al. in J. Biol. Chem. (1987) 262, 15214-15219; Triguero ent molecules, resulting in a bond between these two com et al. in Proc. Natl. Acad. Sci. USA (1989) 86, 4761-4765; ponents and introducing extrinsic linker-derived material Pardridge et al. in J. Pharmacol. Exp. Therap. (1989) 251, into the reporter-vector conjugate. The reactive moieties in 821-826 and Pardridge and Boado, Febs Lett. (1991) 288, a linking agent may be the same (homobifunctional agents) 30-32. or different (heterobifunctional agents or, where several 25 Increased coupling efficiency to areas of interest may also dissimilar reactive moieties are present, heteromultifunc be achieved using antibodies bound to the termini of PEG tional agents), providing a diversity of potential reagents Spacers (see e.g. Maruyama, K. et al. in Biochim. BiophyS. that may bring about covalent bonding between any chemi Acta (1995) 1234, 74–80 and Hansen, C. B. et al. in cal Species, either intramolecularly or intermolecularly. Biochim. Biophys. Acta (1995) 1239, 133–144). The nature of extrinsic material introduced by the linking In Some instances it is considered advantageous to include agent may have a critical bearing on the targeting ability and a PEG component as a Stabiliser in conjunction with a vector general Stability of the ultimate product. Thus it may be or vectors or directly to the reporter in the same molecule desirable to introduce labile linkages, e.g. containing Spacer where the PEG does not serve as a spacer. arms which are biodegradable or chemically Sensitive or Other representative Spacer elements include Structural which incorporate enzymatic cleavage Sites. Alternatively 35 type polysaccharides Such as polygalacturonic acid, the Spacer may include polymeric components, e.g. to act as glycosaminoglycans, heparinoids, cellulose and marine Surfactants and enhance bubble Stability. The Spacer may polysaccharides Such as alginates, chitosans and carrageen also contain reactive moieties, e.g. as described above to ans, Storage-type polysaccharides Such as Starch, glycogen, enhance Surface crosslinking, or it may contain a tracer dextran and aminodeXtrans, polyamino acids and methyl and element Such as a fluorescent probe, Spin label or radioactive 40 ethyl esters thereof, as in homo-and co-polymers of lysine, material. glutamic acid and aspartic acid; and polypeptides, oligo Spacer elements may typically consist of aliphatic chains nucleotides and oligosaccharides, which may or may not which effectively separate the reactive moieties of the linker contain enzyme cleavage Sites. by distances of between 5 and 30 A. They may also comprise In general, Spacer elements may contain cleavable groups macromolecular structures Such as poly(ethylene glycols). 45 Such as vicinal glycol, azo, Sulfone, ester, thioester or Such polymeric structures, hereinafter referred to as PEGs, disulphide groups. Spacers containing biodegradable meth are simple, neutral polyethers which have been given much ylene diester or diamide groups of formula attention in biotechnical and biomedical applications (see e.g. Milton Harris, J. (ed) "Poly(ethylene glycol) chemistry, biotechnical and biomedical applications” Plenum Press, 50 where X and Z are selected from -O-, -S-, and New York, 1992). PEGs are soluble in most solvents, -NR-(where R is hydrogen or an organic group); each Y including water, and are highly hydrated in aqueous is a carbonyl, thiocarbonyl, Sulphonyl, phosphoryl or similar environments, with two or three water molecules bound to acid-forming group: m and n are each Zero or 1; and R' and each ethylene glycol Segment; this has the effect of prevent Rare each hydrogen, an organic group or a group —X.Y. ing adsorption either of other polymers or of proteins onto 55 (Z)m-, or together form a divalent organic group may PEG-modified Surfaces. PEGs are known to be nontoxic and also be useful; as discussed in, for example, WO-A-9217436 not to harm active proteins or cells, whilst covalently linked Such groups are readily biodegraded in the presence of PEGs are known to be non-immunogenic and non-antigenic. esterases, e.g. in Vivo, but are stable in the absence of Such Furthermore, PEGs may readily be modified and bound to enzymes. They may therefore advantageously be linked to other molecules with only little effect on their chemistry. 60 therapeutic agents to permit Slow release thereof. Their advantageous Solubility and biological properties are PolyIN-(2-hydroxyethyl)methacrylamides are poten apparent from the many possible uses of PEGS and copoly tially useful Spacer materials by virtue of their low degree of mers thereof, including block copolymerS Such as PEG interaction with cells and tissues (see e.g. Volfová, I., polyurethanes and PEG-polypropylenes. Rihová, B. and V. R. and Vetvicka, P. in J. Bioact. Comp. Appropriate molecular weights for PEG Spacers used in 65 Polymers (1992) 7, 175-190). Work on a similar polymer accordance with the invention may, for example, be between consisting mainly of the closely related 2-hydroxypropyl 120 Daltons and 20 kDaltons. derivative showed that it was endocytosed by the mono US 6,331,289 B1 15 16 nuclear phagocyte System only to a rather low extent (see xi) poly(1,4-dioxan-2-ones), which may be regarded as Goddard, P., Williamson, I., Bron, J., Hutchkinson, L. E., biodegradable esters in view of their hydrolysable ester Nicholls, J. and Petrak, K. in J. Bioct. Compat. Polym. linkages (see e.g. Song, C. X., Cui, X. M. and (1991) 6, 4–24). Schindler, A. in Med. Biol. Eng. Comput. (1993) 31, Other potentially useful poymeric Spacer materials S147-150), and which may include glycolide units to include: improve their absorbability (see Bezwada, R. S., Shalaby, S. W. and Newman, H. D. J. in Agricultural i) copolymers of methyl methacrylate with methacrylic and Synthetic polymers. Biodegradability and utiliza acid; these may be erodible (see Lee, P. I. in Pharm. tion (1990) (ed Glass, J. E. and Swift, G.), 167–174 Res. (1993) 10, 980) and the carboxylate substituents ACS symposium Series, #433, Washington D.C., may cause a higher degree of Swelling than with neutral 1O U.S.A.-American Chemical Society); polymers, xii) polyanhydrides Such as copolymers of Sebacic acid ii) block copolymers of polymethacrylates with biode (octanedioic acid) with bis(4-carboxy-phenoxy) gradable polyesters (see e.g. San Roman, J. and propane, which have been shown in rabbit studies (see Guillen-Garcia, P. in Biomaterials (1991) 12, Brem, H., Kader, A., Epstein, J. I., Tamargo, R. J., 236-241); 15 Domb, A., Langer, R. and Leong, K.W. in Sel. Cancer iii) cyanoacrylates, i.e. polymers of esters of Ther. (1989) 5,55–65) and rat studies (see Tamargo, R. 2-cyanoacrylic acid-these are biodegradable and have J., Epstein, J. I., Reinhard, C. S., Chasin, M. and Brem, H. in J. Biomed. Mater. Res. (1989) 23, 253–266) to be been used in the form of nanoparticles for Selective useful for controlled release of drugs in the brain drug delivery (see Forestier, F., Gerrier, P., Chaumard, without evident toxic effects; C., Quero, A. M., Couvreur, P. and Labarre, C. in J. xiii) biodegradable polymers containing ortho-ester Antimicrob. Chemoter. (1992) 30, 173–179); groups, which have been employed for controlled iv) polyvinyl alcohols, which are water-soluble and gen release in vivo (see Maa, Y. F. and Heller, J. in J. erally regarded as biocompatible (see e.g. Langer, R. in Control. Release (1990) 14, 21–28); and J. Control. Release (1991) 16, 53–60); 25 xiv) polyphosphaZenes, which are inorganic polymers v) copolymers of vinyl methyl ether with maleic consisting of alternate phosphorus and nitrogen atoms anhydride, which have been stated to be bioerodible (see Crommen, J. H., Vandorpe, J. and Schacht, E. H. (see Finne, U., Hannus, M. and Urtti, A. in Int. J. in J. Control. Release (1993) 24, 167–180). Pharm. (1992) 78. 237–241); The following tables list linking agents and agents for Vi) polyvinylpyrrolidones, e.g. with molecular weight less protein modification which may be useful in preparing than about 25,000, which are rapidly filtered by the targetable contrast agents in accordance with the invention. kidneys (see Hespe, W., Meier, A. M. and Blankwater, Y. M. in Arzeim.-Forsch/Drug Res. (1977) 27, 1158–1162); vii) polymers and copolymers of Short-chain aliphatic 35 Heterobifunctional linking agents hydroxyacids Such as glycolic, lactic, butyric, Valeric Linking agent Reactivity 1 Reactivity 2 Comments and caproic acids (see e.g. Carli, F. in Chim. Ind. ABH carbohydrate photoreactive (Milan) (1993) 75, 494-9), including copolymers ANB-NOS -NH photoreactive which incorporate aromatic hydroxyacids in order to APDP (1) -SH photoreactive iodinable disulphide increase their degradation rate (see Imasaki, K., 40 linker Yoshida, M., Fukuzaki, H., Asano, M., Kumakura, M., APG -NH. photoreactive reacts selectively with Arg at pH 7–8 Mashimo, T., Yamanaka, H. and Nagai. T. in Int. J. ASIB (1) -SH photoreactive iodinable Pharm. (1992) 81, 31–38); ASBA (1) -COOH photoreactive iodinable viii) polyesters consisting of alternating units of ethylene EDC -NH. -COOH Zero-length linker 45 GMBS -NH -SH glycol and terephthalic acid, e.g. Dacron', which are Sulfo-GMBS -NH. -SH water-soluble non-degradable but highly biocompatible; HSAB -NH. photoreactive iX) block copolymers comprising biodegradable segments Sulfo-HSAB -NH. photoreactive water-soluble MBS -NH -SH of aliphatic hydroxyacid polymers (see e.g. Younes, H., Sulfo-MBS -NH. -SH water-soluble Nataf, P. R., Cohn, D., Appelbaum, Y. J., Pizov, G. and 50 MCH carbohydrate -SH Uretzky, G. in Biomater. Artif Cells Artif. Organs MPBH carbohydrate -SH NHS-ASA (1) -NH photoreactive iodinable (1988) 16, 705–719), for instance in conjunction with Sulfo-NHS- -NH. photoreactive water-soluble, polyurethanes (see Kobayashi, H., Hyon, S. H. and ASA (1) iodinable Ikada, Y. in “Water-curable and biodegradable sulfo-NHS-LC- -NH. photoreactive water-soluble, prepolymers' J. Biomed. Mater. Res. (1991) 25, 55 ASA (1) iodinable PDPH carbohydrate -SH disulphide linker 1481–1494); PNP-DTP -NH. photoreactive X) polyurethanes, which are known to be well-tolerated in SADP -NH photoreactive disulphide linker implants, and which may be combined with flexible Sulfo-SADP -NH. photoreactive water-soluble “Soft” segments, e.g. comprising poly(tetra methylene disulphide linker SAED -NH. photoreactive disulphide linker glycol), poly(propylene glycol) or poly(ethylene 60 SAND -NH photoreactive water-soluble glycol)) and aromatic "hard” segments, e.g. comprising disulphide linker 4,4'-methylenebis(phenylene isocyanate) (see e.g. SANPAH -NH. photoreactive sulfo-SANPAH -NH photoreactive water-soluble Ratner, B. D., Johnston, A. B. and Lenk, T. J. in J. SASD (1) -NH photoreactive water-soluble Biomed. Mater. Res: Applied Biomaterials (1987) 21, iodinable disulphide 59–90; Sa Da Costa, V. et al. in J. Coll. Interface Sci. 65 linker (1981) 80, 445-452 and Affrossman, S. et al. in Clini SAB -NH. -SH cal Materials (1991) 8, 25–31); US 6,331,289 B1 17 18

-continued Heterobifunctional linking agents Agents for protein modification

Linking agent Reactivity 1 Reactivity 2 Comments Agent Reactivity Function Ellman's reagent -SH quantifies/detects/protects sulfo-SIAB -NH. -SH water-soluble DTT -S.S.- reduction SMCC -NH. -SH 2-mercaptoethanol -S.S.- reduction Sulfo-SMCC -NH. -SH water-soluble 2-mercaptylamine -S.S.- reduction SMPB -NH. -SH Traut's reagent -NH. introduces -SH Sulfo-SMPB -NH -SH water-soluble SATA -NH. introduces protected -SH SMPT -NH. -SH AMCA-NHS -NH fluorescent labelling -SH water-soluble AMCA-hydrazide carbohydrate fluorescent labelling sulfo-LC-SMPT -NH AMCA-HPDP -S.S.- fluorescent labelling SPDP -NH. -SH SBF-chloride -S.S.- fluorescent detection of -SH Sulfo-SPDP -NH. -SH water-soluble 15 N-ethylmaleimide -S.S.- blocks -SH sulfo-LC-SPDP -NH, -SH water-soluble NHS-acetate -NH. blocks and acetylates -NH. sulfo-SAMCA (2) -NH. photoreactive citraconic anhydride -NH. reversibly blocks and Sulfo-SAPB -NH photoreactive water-soluble introduces negative charges DTPA -NH. introduces chelator Notes: BNPS-skatole tryptophan cleaves tryptophan residue (1) = iodinable; Bolton-Hunter -NH. introduces iodinable group (2) = fluorescent Linking agents used in accordance with the invention will in general bring about linking of vector to reporter or reporter to reporter with Some degree of Specificity, and may Homobifunctional linking agents 25 also be used to attach one or more therapeutically active agents. Linking agent Reactivity Comments Ultrasound imaging modalities which may be used in O -NH. accordance with the invention include two- and three BMH -SH dimensional imaging techniques Such as B-mode imaging BASED (1) photoreactive iodinable disulphide linker (for example using the time-varying amplitude of the signal BSCOES -NH Sulfo-BSCOES -NH. water-soluble envelope generated from the fundamental frequency of the DFDNB -NH. emitted ultrasound pulse, from Sub-harmonics or higher DMA -NH. harmonics thereof or from Sum or difference frequencies DMP -NH DMS derived from the emitted pulse and Such harmonics, images -NH. 35 DPDPB -SH disulphide linker generated from the fundamental frequency or the Second DSG -NH. harmonic thereof being preferred), colour Doppler imaging DSP -NH disulphide linker and Doppler amplitude imaging, and combinations of the DSS -NH. two latter with any of the modalities (techniques) above. DST -NH. Sulfo-DST -NH. water-soluble Surprisingly, the Second harmonic Signals from the targeted DTBP -NH. disulphide linker 40 monolayer microSpheres were found to be excellent when DTSSP -NH. disulphide linker used in accordance with the present invention. To reduce the EGS -NH. effects of movement, Successive images of tissueS Such as Sulfo-EGS -NH water-soluble the heart or kidney may be collected with the aid of suitable SPBP -NH. Synchronisation techniques (e.g. gating to the ECG or res 45 piratory movement of the Subject). Measurement of changes in resonance frequency or frequency absorption which accompany arrested or retarded microbubbles may also usefully be made to detect the contrast agent. Biotinylation agents The present invention provides a tool for therapeutic drug Agent Reactivity Comments 50 delivery in combination with vector-mediated direction of the product to the desired site. By “therapeutic' or “drug” is biotin-BMCC -SH biotin-DPPE* preparation of meant an agent having a beneficial effect on a specific biotinylated liposomes disease in a living human or non-human animal. Whilst biotin-LC-DPPE* preparation of combinations of drugs and ultrasound contrast agents have biotinylated liposomes 55 been proposed in, for example, WO-A-9428873 and WO-A- biotin-HPDP -SH disulphide linker biotin-hydrazide carbohydrate 9507072, these products lack vectors having affinity for biotin-LC-hydrazide carbohydrate particular Sites and thereby show comparitively poor Specific iodoacetyl-LC-biotin retention at desired SiteS prior to or during drug release. NHS-iminobiotin -NH. reduced affinity for Therapeutic compounds used in accordance with the avidin NHS-SS-biotin -NH disulphide linker 60 present invention may be encapsulated in the interior of the photoactivatable biotin nucleic acids microbubbles or attached to or incorporated in the encap Sulfo-NHS-biotin -NH. water-soluble Sulating walls. Thus, the therapeutic compound may be Sulfo-NHS-LC-biotin -NH. linked to a part of the wall, for example through covalent or Notes: ionic bonds, or may be physically mixed into the encapsu DPPE = dipalmitoylphosphatidylethanolamine; 65 lating material, particularly if the drug has similar polarity or LC = long chain Solubility to the membrane material, So as to prevent it from leaking out of the product before it is intended to act in the US 6,331,289 B1 19 20 body. The release of the drug may be initiated merely by (L-asparaginase), etoposide, interferon a-2a and 2b, wetting contact with blood following administration or as a blood products Such as hematoporphyrins or deriva consequence of other internal or external influences, e.g. tives of the foregoing, biological response modifiers dissolution processes catalyzed by enzymes or the use of of Such as muramylpeptides, antifungal agents Such as ultrasound. The destruction of gas-containing microparticles ketoconazole, nyStatin, griseofulvin, flucytosine, using external ultrasound is a well known phenomenon in miconazole or amphotericin B; hormones or hormone respect of ultrasound contrast agents, e.g. as described in analogues Such as growth hormone, melanocyte Stimu WO-A-9325241; the rate of release may be varied depend lating hormone, estradiol, be clomethaSone ing on the type of therapeutic application, using a specific dipropionate, betame thaSone, cortisone acetate, amount of ultrasound energy from the transducer. de Xame thaSone, flunisolide, hydrocortisone, The therapeutic agent may be covalently linked to the methylprednisolone, parame thaSone acetate, encapsulating membrane Surface using a Suitable linking prednisolone, prednisone, triamcinolone or fludrocor agent, e.g. as described herein. Thus, for example, one may tisone acetate; Vitamins Such as cyanocobalamin or initially prepare a phospholipid or lipopeptide derivative to retinoids, enzymes Such as alkaline phosphatase or which the drug is bonded through a biodegradable or Selec 15 manganese Superoxide dismutase, antiallergic agents tively cleavable linker followed by incorporation of the Such as amelexanox, inhibitors of tissue factor Such as material into the microbubble. Alternatively lipidated drug monoclonal antibodies and Fab fragments thereof, Syn molecules which do not require processing to liberate an thetic peptides, nonpeptides and compounds down active drug are incorporated directly into the membrane. The regulating tissue factor expression; inhibitors of plate active lipidated-drug can be released by increasing the lets such as, GPIa, GPIb and GPIIb-IIIa, ADP Strength of the ultrasound beam. receptors, thrombin receptors, von Willebrand factor, Exemplary drug delivery Systems Suitable for use in the prostaglandins, aspirin, ticlopidin, clopigogrel and present compositions include any known therapeutic drugs reopro, inhibitors of coagulation protein targets Such or active analogues thereof containing thiol groups which as: FIIa FVa, FVIIa, FVIIIA, FIXa, tissue factor, are coupled to thiol containing microbubbles under oxida 25 hepatins, hirudin, hirulog, argatroban, DEGR-rFVIIa tive conditions yielding disulphide bridgeS. In combination and annexin V; inhibitors of fibrin formation and pro with a vector or vectors the drug/vector modified moters of fibrionolysis such as t-PA, urokinase, Plamin, microbubbles are allowed to accumulate in the target tissue. Streptokinase, rt-Plasminogen Activator and rStaphy Administration of a reducing agent Such as reduced glu lokinase; antiangiogenic factorS Such as tathione then liberates the drug molecule from the targeted medroxyprogesteron, pentosan poly Sulphate, Suramin, microbubble in the vicinity of the target cell increasing the taxol, thalidomide, angiostatin, interferon-alpha, met local concentration of the drug and enhancing therapeutic alloproteinase inhibitors, plate let factor 4, effect. The product may also be prepared without the thera Somatostatin, thromobospondin; circulatory drugs Such peutic if desired. The drug may then be coupled to or coated as propranolol, metabolic potentiatorS Such as glu on the microbubbles prior to use. Thus, for example, a 35 tathione, antitubercularS Such as p-aminoSalicylic acid, therapeutic could be added to a Suspension of microbubbles isoniaZid, capreomycin Sulfate, cyclose Xine, in aqueous media and Shaken in order to attach or adhere the ethambutol, ethionamide, pyrazinamide, rifampin or therapeutic to the microbubbles. Streptomycin Sulphate, antivirals Such as acyclovir, Other drug delivery systems include vector modified amantadine, azidothymidine, ribavirin or Vidarabine; phospholipid membranes doped with lipopeptide Structures 40 blood vessel dilating agents Such as diltiazem, comprising a poly-L-lysine or poly-D-lysine chain in com nifedipine, Verapamil, erythritol tetranitrate, isosorbide bination with a targeting vector. Applied to gene therapy/ dinitrate, nitroglycerin or pentaerythritol tetranitrate; antisense technologies with particular emphasis on receptor antibiotics Such as dapsone, chloramphenicol, mediated drug delivery the microbubble carrier is condensed neomycin, cefaclor, cefadroxil, cephalexin, cephradine, with DNA or RNA via elecrostatic interaction with the 45 erythromycin, clindamycin, lincomycin, amoxicillin, polycation. This method has the advantage that the vector or ampicillin, bacampicillin, carbenicillin, dicloxacillin, vectors used for targeted delivery are not directly attached to cyclacillin, picloxacillin, he tacillin, methicillin, the polysine carrier moiety. The polylysine chain is also nafcillin, penicillin, polymyxin or tetracycline; antiin anchored more tightly in the microbubble membrane due to flammatories Such as diflunisal, ibuprofen, the presence of the lipid chains. The use of ultrasound to 50 indomethacin, meclefenamate, mefenamic acid, increase the effectiveness of delivery is also considered naproxen, phenylbutaZone, piroXicam, tolmetin, aspirin useful. or Salicylates, antiprotozoans Such as chloroquine, Alternatively free polylysine chains are firstly modified metronidazole, quinine or meglumine antimonate, anti with drug or vector molecules then condensed onto the rheumatics Such as penicillamine; narcotics Such as negative Surface of targeted microbubbles. 55 paregoric, opiates Such as codeine, morphine or opium; Representative and non-limiting examples of drugs useful cardiac glycosides Such as deslaneside, digitoxin, in accordance with the invention include digoxin, digitalin or digitalis; neuromuscular blockers antineoplastic agents Such as Vincristine, vinblastine, Such as atracurium meSylate, gallamine triethiodide, Vindesline, buSulfan, chlorambucil, Spiroplatin, hexafluorenium bromide, metocurine iodide, pancuro cisplatin, carboplatin, methotrexate, adriamycin, 60 nium bromide, Succinylcholine chloride, tubocurarine mitomycin, bleomycin, cytosine arabinoside, arabino chloride or vecuronium bromide, Sedatives Such as Syl adenine, mercaptopurine, mitotane, procarbazine, amobarbital, amobarbital Sodium, apropbarbital, but dactinomycin (antinomycin D), daunorubicin, doxoru abarbital sodium, chloral hydrate, ethchlorvynol, bic in hydrochloride, tax ol, plicamycin, ethinamate, flurazepam hydrochloride, glutethimide, aminoglute thimide, e Stramu Stine, flutamide, 65 methotrimeprazine hydrochloride, methyprylon, mida leuprolide, megestrol acetate, tamoxifen, testolactone, Zolam hydrochloride, paraldehyde, pentobarbital, Seco triloStane, amsacrine (m-AMSA), asparaginase barbital Sodium, talbutal, temazepam or triazolam, US 6,331,289 B1 21 22 local anaesthetics Such as bupivacaine, chloroprocaine, themselves, and finally to Synthetise a basement membrane etidocaine, lidocaine, mepivacaine, procaine or tetra around the new vessels. caine; general anaesthetics Such as droperidol, Tumors must initiate angiogenesis when they reach mil etomidate, fentanyl citrate with droperidol, ketamine limeter size in order to keep up their rate of growth. AS hydrochloride, methohexital Sodium or thiopental and angiogenesis is accompanied by characteristic changes in pharmaceutically acceptable salts (e.g. acid addition the endothelial cells and their environment, this process is a salts such as the hydrochloride or hydrobromide or base promising target for therapeutic intervention. The transfor Salts. Such as Sodium, calcium or magnesium salts) or mations accompanying angiogenesis are also very promis derivatives (e.g. acetates) thereof. Other examples of ing for diagnosis, a preferred example being malignant therapeutics include genetic material Such as nucleic 1O disease, but the concept also shows great promise in inflam acids, RNA, and DNA of natural or synthetic origin, mation and a variety of inflammation-related diseases. These including recombinant RNA and DNA. DNA encoding factors are also involved in re-vascularisation of infarcted certain proteins may be used in the treatment of many parts of the myocardium, which occurs if a Stenosis is different types of diseases. For example, tumor necrosis released within a short time. factor or interleukin-2 genes may be provided to treat 15 A number of known receptorS/targets associated with advanced cancers, thymidine kinase genes may be angiogenesis are given in Subsequent tables. Using the provided to treat ovarian cancer or brain tumors, targeting principles described in the present disclosure, interleukin-2 genes may be provided to treat angiogenesis mav be detected by the majority of the imaging neuroblastoma, malignant melanoma or kidney cancer, modalities in use in medicine. Contrast-enhanced ultrasound and interleukin-4 genes may be provided to treat can may possess additional advantages, the contrast medium CC. being microSpheres which are restricted to the interior of Lipophilic derivatives of drugs linked to the microbubble blood vessels. Even if the target antigens are found on many wall through hydrophobic interactions may exhibit thera cell types, the microSpheres will attach exclusively to endot peutic effects as part of the microbubble or after release from helial cells. the microbubble, e.g. by use of ultrasound. If the drug does 25 So-called prodrugs may also be used in agents according not possess the desired physical properties, a lipophilic to the invention. Thus drugs may be derivatised to alter their group may be introduced for anchoring the drug to the physicochemical properties and to adapt them for inclusion membrane. Preferably the lipophilic group should be intro into the reporter, Such derivatised drugs may be regarded as duced in a way that does not influence the in Vivo potency prodrugs and are usually inactive until cleavage of the of the molecule, or the lipophilic group may be cleaved derivatising group regenerates the active form of the drug. releasing the active drug. Lipophilic groups may be intro By targeting a gas-filled microbubble containing a duced by various chemical means depending on functional prodrug-activating enzyme to areas of pathology one may groups available in the drug molecule. Covalent coupling image targeting of the enzyme, making it possible to visua may be effected using functional groups in the drug mol lise when the micobubbles are targeted properly to the area ecule capable of reacting with appropriately functionalised 35 of pathology and at the same time have disappeared from lipophilic compounds. Examples of lipophilic moieties non-target areas. In this way one can determine the optimal include branched and unbranched alkyl chains, cyclic time for injection of prodrug into individual patients. compounds, aromatic residues and fused aromatic and non Another alternative is to incorporate the prodrug, the aromatic cyclic Systems. In Some instances the lipophilic prodrug-activating enzyme and the vector in the same moiety will consist of a Suitably functionalised Steroid, like 40 microbubble in a system where the prodrug will only be cholesterol and related compounds. Examples of functional activated after Some external Stimulus. Such a Stimulus may, groups particularly Suitable for derivatisation include for example, be a tumour-specific protease as described nucleophilic groups like amino, hydroxy and Sulfhydryl above, or bursting of the bubbles by external ultrasound after groupS. Suitable processes for lipophilic derivatisation of the desired targeting has been achieved. any drug containing a Sulfhydryl group, like captopril, may 45 Therapeutics may easily be delivered in accordance with include direct alkylation, e.g. reaction with an alkyl halide the invention to diseased or necrotic areas including the under basic conditions and thiol ester formation by reaction heart and vasculature in general, and to the liver, Spleen and with an activated carboxylic acid. Representative examples kidneys and other regions Such as the lymph System, body of derivatisation of any drug having carboxylic functions, cavities or gastrointestinal System. like atenolol and chlorambucil, include amide and ester 50 Products according to the present invention may be used formation by coupling of amines and alcohols, respectively, for targeted therapeutic delivery either in vivo or in vitro. In possesing requested physical properties. A preferred aspect the latter context the products may be useful in in Vitro is attachment of cholesterol to a therapeutic compound by Systems. Such as kits for diagnosis of different diseases or forming a degradable ester bond. characterisation of different components in blood or tissue A preferred application of the present invention relates to 55 Samples. Similar techniques to those used to attach certain angiogenesis, which is the formation of new blood vessels blood components or cells to polymer particles(e.g. mono by branching from existing vessels. The primary Stimulus disperse magnetic particles) in vitro to separate them from a for this proceSS may be inadequate Supply of nutrients and Sample may be used in the present invention, using the low oxygen (hypoxia) to cells in a tissue. The cells may respond density of the reporter units in agents of the present inven by Secreting angiogenetic factors, of which there are many; 60 tion to effect Separation of the gas-containing material by one example is vascular endothelial growth factor. These floatation and repeated Washing. factors initiate the Secretion of proteolytic enzymes which Vectors which may be usefully employed in generating break down the proteins of the basement membrane, as well multiple-specific targetable contrast agents according to the as inhibitors which limit the action of these potentially invention include the following: harmful enzymes. The combined effect of loss of attachment 65 i) Antibodies, which can be used as vectors for a very and Signals from the receptors for angiogenetic factors is to wide range of targets, and which have advantageous cause the endothelial cells to move, multiply, and rearrange properties Such as very high specificity, high affinity (if US 6,331,289 B1 23 24 desired), the possiblity of modifying affinity according cells. Combinatorial libraries may be used to select to need etc. Whether or not antibodies will be bioactive oligonucleotides which bind Specifically to possible will depend on the Specific vector/target combination. target molecules (from proteins to caffeine) and which Both conventional and genetically engineered antibod therefore may be employed as Vectors for targeting. ies may be employed, the latter permitting engineering v) DNA-binding drugs may behave similarly to of antibodies to particular needs, e.g. as regards affinity oligonuclotides, but may exhibit biological acitvity and Specificity. The use of human antibodies may be and/or toxic effects if taken up by cells. preferred to avoid possible immune reactions against Vi) Various Small molecules, including bioactive com the vector molecule. A further useful class of antibodies pounds known to bind to biological receptors of various comprises So-called bispecific antibodies, i.e. antibod kinds. Such vectors or their targets may be used to ies having specificity for two different target molecules generate non-bioactive compounds binding to the same in one antibody molecule. Such antibodies may, for targets. example, be useful in promoting formation of bubble vii) Vector molecules may be selected from combinatorial clusters and may also be used for various therapeutic libraries without necessarily knowing the exact purposes, e.g. for carrying toxic moieties to the target. 15 molecular target, by functionally Selecting (in vitro, ex Various aspects of bispecific antibodies are described Vivo or in vivo) for molecules binding to the region/ by McGuinness, B. T. et al. in Nat. Biotechnol. (1996) Structure to be imaged. 14, 1149-1154; by George, A. J. et al. in J. Immunol. viii) Various Small molecules, including bioactive com (1994) 152, 1802–1811; by Bonardi et al. in Cancer pounds known to bind to biological receptors of various Res. (1993) 53,3015–3021; and by French, R. R. et al. kinds. Such vectors or their targets may be used for in Cancer Res. (1991) 51,2353-2361. generate non-bioactive compounds binding to the same ii) Cell adhesion molecules, their receptors, cytokines, targets. growth factors, peptide hormones and pieces thereof. ix) Proteins or peptides which bind to glucosaminoglycan Such vectors rely on normal biological protein-protein Side chains e.g. haparan Sulphate, including interactions with target molecule receptors, and So in 25 glucoso aminoglycan-binding portions of larger many cases will generate a biological response on molecules, Since binding to Such glucosoaminoglycans binding with the targets and thus be bioactive; this may Side chains does not result in a biological response. be a relatively insignificant concern with vectors which Proteoglycans are not found on red blood cells, thus target proteoglycans. eliminating undesirable adsorption to these cells. iii) Non-peptide agonists/antagonists or non-bioactive Other peptide vectors and lipopeptides thereof of particu binders of receptorS for cell adhesion molecules, lar interest for targeted ultrasound imaging are listed below: cytokines, growth factors and peptide hormones. This Atherosclerotic plaque binding peptide S Such as category may include non-bioactive vectors which will YRALVDTLK (SEQ ID NO: 22), YAKFRE be neither agonists nor antagonist but which may TLEDTRDRMY (SEQ ID NO:23) and nonetheless exhibit valuable targeting ability. 35 RALVDTEFKVKQEAGAK (SEQ ID NO:24); Thrombus iv) Oligonucleotides and modified oligonucleotides which binding peptides such as NDGDFEEIPEEYLQ (SEQ ID bind DNA or RNA through Watson-Crick or other types NO:25) and GPRG (SEQ ID NO:26); Platelet binding of base-pairing. DNA is usually only present in extra peptides such as PLYKKIIKKLLES (SEQ ID NO:27); and cellular space as a consequence of cell damage, So that cholecystokinin, C.-melanocyte-stimulating hormone, heat Such oligonucleotides, which will usually be non 40 Stable enterotoxin 1, vasoactive intestinal peptide, Synthetic bioactive, may be useful in, for example, targeting of alpha-M2 peptide from the third heavy chain necrotic regions, which are associated with many dif complementarity-determining region and analogues thereof ferent pathological conditions. Oligonucleotides may for tumor targeting. also be designed to bind to specific DNA- or RNA The following tables identify various receptors which binding proteins, for example transcription factors 45 may be targeted by particular types of vectors and conse which are very often highly overexpressed or activated quent areas of use for targetable ultrasound contrast agents in tumour cells or in activated immune or endothelial according to the invention which contain Such vectors.

Protein and peptide vectors - antibodies Vector type Receptor Comments/areas of use Ref antibodies (general) CD34 vascular diseases in general, normal vessel wall (e.g myocardium), activated endothelium, immune cells ICAM-1 vascular diseases in general, normal vessel wall (e.g myocardium), activated endothelium, immune cells ICAM-2 vascular diseases in general, normal vessel wall (e.g myocardium), activated endothelium, immune cells ICAM-3 vascular diseases in general, normal vessel wall (e.g US 6,331,289 B1 25 26

-continued Protein and peptide vectors - antibodies Vector type Receptor Comments/areas of use Ref myocardium), activated endothelium, immune cells E-selectin vascular diseases in general, normal vessel wall (e.g myocardium), activated endothelium, immune cells P-selectin vascular diseases in general, normal vessel wall (e.g myocardium), activated endothelium, immune cells PECAM vascular diseases in general, normal vessel wall (e.g myocardium), activated endothelium, immune cells Integrins, vascular diseases in general, e.g. VLA-1, normal vessel wall (e.g VLA-2, VLA-3 myocardium), activated VLA-4, VLA-5, endothelium, immune cells VLA-6,

B1Clv. LFA-1, Mac-1, CD41a, etc. GlyCAM Vessel wall in lymph nodes (quite specific for lymph nodes) MadCam 1 Vessel wall in lymph nodes (quite specific for lymph nodes) fibrin Thrombi Tissue Activated endothelium, Factor tumours Myosin Necrosis, myocardial infaction CEA Tumours (carcinoembryonal antigen) Mucins Tumours Multiple drug Tumours resistance protein Prostate Prostate cancer specific antigen Cathepsin B Tumours (proteases of various kinds are often more or less specifically overexpressed in a variety of tumours - Cathepsin B is such a protease) Transferrin Tumors, receptor vessel wall MOAb 9.2.27 Tumours Antigen upregulated on cell growth VAP-1 Adhesion molecule Band 3 Upregulated during phagocytic protein activity CD44 tumor cells B2 general microglobulin MHC class I general antibody integrin tumors, angiogenisis Civ3 antibodies CD44 tumour cells antibodies B2 general microglobulin antibodies MHC class I general

60 a. ) Heider, K. H., M. Sproll, S. Susani, E. Patzelt, P. b). I. Roitt, J. Brostoff, and D. Male. 1985. Immunology, Beaumier, E. Ostermann, H. Ahorn, and G. R. Adolf. London: Gower Medical Publishing, p. 4.7 1996. “Characterization of a high-affinity monoclonal antibody specific for CD44v6 as candidate for immu c.) Stromblad, S., and D. A. Cheresh. 1996. “Integrins, notherapy of Squamous cell carcinomas'. Cancer 65 angiogenesis and vascular cell Survival’. Chemistry & Immunology Immunotherapy 43: 245-253. Biology 3: 881-885. US 6,331,289 B1 27 28

-continued Protein and peptide vectors - cell adhesion molecules etc. Vectors comprising cytokines/growth factors/peptide hormones and fragments thereof Vector type Receptor Comments/areas of use Ref L-selectin CD34 vascular diseases in Vector type Receptor Comments fareas of use Ref MadCAM1 general, normal vessel wall GlyCam 1 (e.g. myocardium), activated GM-CSF, M-CSF, proteoglycans endothelium, Lymph nodes IL-3) Other selectins carbohydrate vascular diseases in Insulin like IGF-I receptor Tumours, ligands general, normal vessel wall growth factor I other growing tissues (sialyl Lewis X) (e.g. myocardium), Atrial ANF-receptors Kidney, heparan sulfate activated endothelium Natriuretic vessel wall RGD-peptides integrins angiogenisis Factor PECAM PECAM, Endothelium, Vasopressin Vasopressin Kidney, and other Cells in immune system 15 Integrins, Laminin, Endothelium, receptor vessel wall e.g. VLA-1, collagen, Vessel wall VEGF VEGF-receptor Endothelium, VLA-2, VLA-3, fibronectin, etc. regions of angiogenesis VLA-4, VLA-5, VCAM-1, Fibroblast FGF-receptors, Endothelium VLA-6, thrombo growth factors Proteoglycans Angiogenesis spondin, Schwann cell proteoglycans vitronectin growth factor specific B1Clv, etc. LFA-1, Mac-1, receptors CD41a, etc. Integrin Integrins, Cells in immune system receptors, e.g. VLA-1, vessel wall e.g. Laminin, VLA-2, VLA-3, etc. 25 collagen, VLA-4, VLA-5, fibronectin, VLA-6, Miscellaneous protein and peptide Vectors VCAM-1, thrombospondin, Vector type Receptor Comments fareas of use Ref vitronectin BCtv. etc. LFA-1, Mac-1, Streptavidin Kidney Kidney diseases Bacterial Fibronectin Vessel wall CD41a, etc. fibronectin Nerve cell proteoglycans binding proteins adhesion N-CAM Fc-part of Fc-receptors Monocytes molecule (N- (homophilic) antibodies macrophages CAM) 35 liver RGD-peptides integrins angiogenesis C Transferrin transferrin- Tumours receptor vessel walls Streptokinase? thrombi thrombi tissue plasminogen activator Vectors comprising cytokines/growth factors/peptide 40 Plasminogen, Fibrin Thrombi, hormones and fragments thereof plasmin tumours Mast cell proteoglycans Vector type Receptor Comments/areas of use Ref proteinases Elastase proteoglycans Epidermal growth EGF-receptor or Tumours Lipoprotein proteoglycans factor related 45 lipase receptors Coagulation proteoglycans Nerve growth NGF-receptor Tumours enzymes factor Extracellular proteoglycans Somatostatin ST-receptor Tumours Superoxide Endothelin Endothelin Vessel wall dismutase receptor 50 Heparin cofactor proteoglycans Interleukin-1 IL-1-receptor Inflammation, activated II cells of different kinds Retinal survival proteoglycans Interleukin-2 IL-2-receptor Inflammation, activated factor specific cells of different kinds receptors Chemokines (ca. Chemokine Inflammation Heparin-binding proteoglycans 20 different receptors, 55 brain mitogen specific cytokines partly proteoglycans receptors sharing Apollipoprotein, proteoglycans receptors) C.S. specific Tumour necrosis TNF-receptors Inflammation apolipoprotein B receptors factor (e.g., LDL Parathyroid PTH-receptors Bone diseases receptor) hormone Kidney diseases 60 Apollipoprotein E LDL receptor Bone BMP-receptors Bone Diseases proteoglycans Morphogenetic Adhesion- proteoglycans Protein promoting Calcitonin CT-receptors Bone diseases proteins, Colony Corresponding Endothelium e.g. Purpurin stimulating specific 65 Viral coat proteoglycans factors (G-CSF, receptors, proteins, US 6,331,289 B1 29 30

-continued Vectors comprising angiogenic factors Miscellaneous protein and peptide vectors Comments/areas Vector type Targe of use Ref Vector type Receptor Comments fareas of use Ref acidic fibroblast growth ECO OS actor e.g. HIV. Herpes adenosine ECO OS Microbial "Antigen 85” fibronectin, collagen, Angiogenin ECO OS Angiotensin II ECO OS adhesins complex of fibrinogen, vitronectin, basement membrane tumors e.g., tenascin, mycobacteria heparan sulfate components collagen IV basic fibroblast growth ECO OS B-amyloid proteoglycans f-amyloid accumulates in actor ECO OS precursor Alzheimer's disease 15 Bradykinin Calcitonin gene-related ECO OS Tenascin, heparan sulfate, peptide epidermal growth factor ECO OS e.g. tenascin C integrins Fibrin tumors Fibrinogen tumors Heparin ECO OS histamine ECO OS hyaluronic acid or fragments ECO OS hereof Vectors comprising non-peptide agonists/antagonists of Interleukin-1C. ECO OS aminin, laminin fragments ECO OS cytokines? growth factors/peptide hormones/cell adhesion nicotinamide ECO OS molecules 25 platelet activating factor ECO OS platelet-derived endothelial ECO OS Vector type Receptor Comments/areas of use Ref growth factor prostaglandins E1, E2 ECO OS Endothelin Endothelin Vessel wall spermine ECO OS antagonist receptor spermine ECO OS Desmopressin Vasopressin Kidney Substance P ECO OS (vasopressin receptor Vessel wall ransforming growth factor-C. ECO OS analogue) ransforming growth factor-f ECO OS Demoxytocin Oxytocin Reproductive organs, Tumor necrosis factor-B ECO OS (Oxytocin Receptor Mammary glands, vascular endothelial growth ECO OS actor/vascular permeability analogue) Brain 35 Angiotensin II Angiotensin II Vessel wall actor receptor receptors brain vitronectin A. antagonists adrenal gland CV-11974, TCV-116 non-peptide RGD- integrins Cells in immune system analogues vessel wall etc. 40 Vector molecules other than recognized angiogenetic factors with known affinity for receptors associated with angiogenesis Vector type Target Comments fareas of use Ref Vectors comprising anti-angiogenic factors 45 angiopoietin umors, Vector type Target Comments/areas of use Ref inflammation C2-antiplasmin umors, Angiostatin EC of tumors plasminogen fragment K inflammation cartilage-derived EC of tumors J combinatorial umors, for instance: compounds inhibitor 50 libraries, compounds inflammation that bind to basement B-Cyclodextrin tumors, C from membrane after degradation tetradecasulfate inflammation endoglin umors, fumagillin and analogs tumors, E inflammation inflammation endosialin umors, Interferon-C. EC of tumors K inflammation Interferon-Y EC of tumors E 55 endostatin collagen umors, interleukin-12 EC of tumors E fragment inflammation linomide tumors, A. Factor VII related umors, inflammation antigen inflammation medroxyprogesterone EC of tumors K fibrinopeptides umors, metalloproteinase EC of tumors K inflammation inhibitors fibroblast growth umors, pentosan polysulfate EC of tumors K 60 factor, basic inflammation platelet factor 4 EC of tumors M hepatocyte growth umors, Somatostatin EC of tumors K factor inflammation Suramin EC of tumors K insulin-like growth umors, Taxol EC of tumors K factor inflammation thalidomide EC of tumors K interleukins umors, e.g.: IL-8 Thrombospondin EC of tumors K 65 inflammation leukemia inhibitory umors, US 6,331,289 B1 31 32

-continued -continued Vector molecules other than recognized angiogenetic Receptors/targets associated with angiogenesis factors with known affinity for receptors associated with angiogenesis Vector type Target Comments fareas of use Ref Vector type Target Comments/areas of use Ref endothelin receptors tumors, G inflammation factor inflammation fibronectin tumors P metalloproteinase tumors, e.g., batimastat E FIk-1/KDR, Flt-4 tumors, VEGF receptor D inhibitors inflammation inflammation Monoclonal antibodies tumors, for instance: to FLT1 (fms-like tumors, VEGF-A receptor O inflammation angiogenetic factors or tyrosine kinase) inflammation their receptors, or to heparan sulfate tumors, P components of the inflammation fibrinolytic system hepatocyte growth tumors, I peptides, for instance tumors, B, Q 15 factor receptor (c-met) inflammation cyclic RGDFV inflammation insulin-like growth tumors, R placental growth factor tumors, J factorfmannose-6- inflammation inflammation phosphate receptor placental umors, E integrins: Tumors, D, proliferin-related inflammation fs and fs, inflammation P protein integrin Clvfs, plasminogen umors, M integrin Croft, laminin receptor inflammation integrins C6, plasminogen activators tumors, D integrins 31, inflammation integrin C.2?1, plasminogen activator tumors, U, V integrin Clvfs, inhibitors inflammation integrin Cls subunit of the fibronectin platelet activating umors, inhibitors of angiogenesis A 25 receptor actor antagonists inflammation integrin Clvfs, platelet-derived growth tumors, E fibrin receptors. actor inflammation Intercellular adhesion umors, P pleiotropin umors, ZA molecule-1 and -2 inflammation inflammation Jagged gene product umors, T proliferin umors, E inflammation inflammation Ly-6 umors, a lymphocyte activation N proliferin related umors, E inflammation protein matrix umors, D protein inflammation metalloproteinases inflammation selectins umors, e.g., E-selectin D MHC class II umors, inflammation 35 inflammation SPARC OS M Notch gene product umors, T inflammation inflammation snake venoms umors, O Osteopontin OS Z. (RGD-containing) inflammation PECAM umors, alias CD31 P Tissue inhibitor of umors, eg, TIMP-2 U inflammation metalloproteinases inflammation 40 plasminogen activator umors, ZC thrombin umors, H receptor inflammation inflammation platelet-derived growth tumors, E thrombin-receptor- umors, H factor receptors inflammation activating tetra- inflammation Selectins: E-, P- umors, D decapeptide inflammation Sialyl Lewis-X umors, blood group antigen M thymidine umors, D 45 inflammation phosphorylase inflammation stress proteins: umors, molecular chaperones tumor growth factor umors, ZA glucose regulated, inflammation inflammation heat shock families and others syndecan umors, T 50 inflammation hrombospondin umors, M inflammation Receptors/targets associated with angiogenesis TIE receptors umors, tyrosine kinases with Ig- E inflammation and EGF-Iike domains Vector type Target Comments/areas of use Ref issue factor umors, Z. 55 inflammation biglycan tumors, dermatan sulfate X issue inhibitor of umors, e.g., TIMP-2 U inflammation proteoglycan metalloproteinases inflammation CD34 tumors, L ransforming growth umors, E inflammation actor receptor inflammation CD44 tumors, F urokinase-type umors, D inflammation plasminogen activator inflammation collagen type I, IV, tumors, A. 60 receptor VI, VIII inflammation Vascular cellular umors, D decorin tumors, dermatan sulfate Y adhesion molecule inflammation inflammation proteoglycan (VCAM) dermatan sulfate tumors, X Vascular endothelial umors, proteoglycans inflammation growth factor related inflammation endothelin tumors, G 65 protein inflammation Vascular endothelial umors, K US 6,331,289 B1 33 34

-continued -continued Receptors/targets associated with angiogenesis Modified oligonucleotide vectors Vector type Target Comments/areas of use Ref Vector type Receptor Comments fareas of use Ref growth factor-A inflammation DNA-binding As for unmodified Increased binding affinity receptor drugs conjugated oligos as compared to pure oligos von Willebrand factor- tumors, L to oligos (for related antigen inflammation examples, see below) Peptide Nucleic As for unmodified Increased binding affinity Acids (PNAs, oligos and stability compared to oligonucleotidss standard oligos. with a peptide backbone) Oligonucleotide vectors 15 Vector type Receptor Comments/areas of use Ref Oligonucleotides DNA made Tumours complementary to available by Myocardial infection repeated necrosis All other diseases that Nucleoside and nucleotide vectors Sequences, e.g. involves necrosis genes for Vector type Receptor Comments fareas of use Ref ribosomal RNA, Adenosine or Adenosine Vessel wall Alu-sequences analogues receptors Heart Oligonucleotides DNA made Tumours ADP, UDP, UTP Various Many tissues e.g. brain, complementary to available by and others nucleotide spinal cord, kidney, spleen disease-specific necrosis in a 25 mutations (e.g. region of the receptors mutated relevant disease oncogenes) Oligonucleotides DNA of infective Viral or bacterial complementary to agent infections DNA of infecting agent. Receptors comprising DNA-binding drugs Triple or As in above As in above examples quadruple-helix examples Vector type Receptor Comments fareas of use Ref forming oligonucleotides acridine DNA made Tumours, Oligonucleotides DNA-binding Tumours derivatives available by Myocardial infarction and with recognition protein, e.g. Activated endothelium 35 distamycin necrosis all other diseases involving sequence for transcription Activated immune cells netropsin necrosis or other processes DNA-or RNA- factors (often actinomycin D liberating DNA from cells binding proteins overexpressed/ echinomycin activated in bleomycin etc. tumours Or activated 40 endotheliumf immune cells Receptors comprising protease Substrates 45 Vector type Receptor Comments fareas of use Ref Peptidic or non- Cathepsin B Tumours, a variety of which Modified oligonucleotide vectors peptidic may more or less specifically Substrates overexpress proteases of Vector type Receptor Comments/areas of use Ref various kinds, e.g. Phosphorothioate. As for As for unmodified oligos 50 Cathepsin B oligos unmodified oligos 2'-O-methyl As for As for unmodified oligos substituted unmodified oligos oligos circular oligos As for unmodified As for unmodified oligos 55 Receptors comprising protease inhibitors oligos oligos As for unmodified As for unmodified oligos Vector type Receptor Comments fareas of use Ref containing oligos hairpin Peptidic or non- Cathepsin B Tumours, a variety of which Structure to peptidic may more or less specifically decrease inhibitors overexpress proteases of degradation 60 e.g. N-acetyl- various kinds, e.g. oligos with As for unmodified As for unmodified oligos Leu-Leu- Cathepsin B terminal oligos norleucinal phosphorothioate bestatin Amino- Tumours, 2'-fluoro oligos As for unmodified As for unmodified oligos ((2S,3R)-3- peptidases e.g. on cell surfaces oligos Amino-2- 2'-amino oligos As for unmodified As for unmodified oligos 65 hydroxy oligos 4-phenyl US 6,331,289 B1 35 36

-continued -continued

Receptors comprising protease inhibitors Vectors from combinatorial libraries

Vector type Receptor Comments fareas of use Ref Vector type Receptor Comments fareas of use Ref butanoyl-L- leucine process vector binding hydrochloride) to chosen Pefabloc (4-(2- Serine Tumours, diseased aminoethyl)- proteases vessel wall Structure benzenesulfonyl etc. fluoride hydrochloride) Commercially Angiotensin Endothelial cells available converting inhibitors enzyme 15 e.g. kaptopril Carbohydrate vectors enalapril ricionopril Vector type Receptor Comments fareas of use Ref Low specificity Coagulation Vessel wall injury, CO- macrophages general activation? non-peptidic factors tumours, glycoproteins inflammation compounds etc. oligosaccharides Asialo- liver Protease nexins proteoglycans with terminal glycoprotein (extracellular galactose receptor protease Hyaluronan aggrecan (a inhibitors) proteoglycan) Antithrombin proteoglycans, “link proteins Coagulation 25 cell-surface factors receptors: CD44 Mannose Blood brain barrier, Brain tumours and other diseases causing changes in BBB Bacterial Blood brain barrier, glycopeptides Brain tumours and other Vectors from combinatorial libraries diseases causing changes in BBB Vector type Receptor Comments/areas of use Ref Antibodies with Any of above Any diseased or normal Structure argets - or may structure of interest, e.g. 35 determined be unknown when thrombi, tumors or walls of during make functional myocardial vessels generation selection of Lipid vectors process vector binding O chosen Vector type Receptor Comments fareas of use Ref diseased 40 Structure LDL-like lipids LDL-receptor Atherosclerosis Peptides with Any of above Any diseased or normal sequence argets - or may structure of interest, e.g. determined be unknown when thrombi, tumours or walls of during make functional myocardial vessels generation selection of process vector binding 45 Small molecule vectors O chosen diseased Vector type Receptor Comments fareas of use Ref Structure Oligonucleotides Any of above Any diseased or normal Adrenalin Corresponding with sequence argets - or may structure of interest, e.g. receptors determined be unknown when thrombi, tumours or walls of 50 Betablockers Adrenergic beta- Myocardium for beta-1 during make functional myocardial vessels receptors blockers generation selection of Alpha-blockers Adrenergic Vessel wall process vector binding alpha-receptors O chosen benzodiazepines diseased serotonin- Serotonin Structure 55 analogues receptors Modifications of Any of above Any diseased or normal anti-histamines Histamine- Vessel wall oligos obtained argets - or may structure of interest, e.g. receptors as above be unknown when thrombi, tumours or walls of Acetyl-choline ACh-receptors make functional myocardial vessels receptor selection of antagonists vector binding Verapamil Cat-channel Heart muscle O chosen 60 blocker diseased nifedipin Ca'-channel Heart muscle Structure blocker Other chemicals Any of above Any diseased or normal Amiloride Na"/H'-exchanger Blocks this exchanges in with structure argets - or may structure of interest, e.g. kidney and is generally determined be unknown when thrombi, tumours or walls of upregulated in cells during make functional myocardial vessels 65 stimulated by growth generation selection of factors. US 6,331,289 B1 37 38 Y. Sato, and M. Kuwano. 1996. "Angiogenesis as a new -continued target for cancer treatment”. Cancer Chemoter. Phar macol. 38 (Suppl.): S78–S82. Small molecule vectors K. Passe, T.J., D. A. Bluemke, and S. S. Siegelman. June 1997. “Tumor angiogenesis: Tutorial on implications Vector type Receptor Comments/areas of use Ref for imaging". Radiology 203 (3): 593-600. Digitalis Na'/K'-ATP-ases myocardium L. Saclarides, T. J. February 1997. “Angiogenesis in glycosides peripheral vasculature, central nervous system colorectal cancer'. Surgical Clinics of North America Thromboxaef Thromboxanef Vessel wall, 77 (1): 253. Prostaglandin prostaglandin Endothelium M. Sage, E. H. May 1997. “Pieces of eight: Bioactive receptor receptors fragments of extracellular proteins as regulators of antagonists or agonists angiogenesis”. Trends in Cell Biology 7 (5): 182-186. Glutathione Glutathione- Lung, N. Sagi-Assif, O., A. Traister, B. Z. Katz, R. Anavi, M. receptors Brain Eskenazy, and I. P. Witz. 1996. “TNFC. and anti-Fas Leukotriene 15 receptors antibodies regulate Ly-6E.1 expression by tumor cells: Biotin biotin transport A possible link between angiogenesis and Ly-6E.1'. protein on cell Immunology Letters 54: 207-213. surface O. Strawn, L. M., G. McMahon, H. App, R. Schreck, W. Folate folate transport Tumours protein on cell R. Kuchler, M. P. Longhi, T. H. Hui, C. Tang, A. surface Levitzki, A. Gazit, I. Chen, G. Keri, L. Orfi, W. Risau, Riboflavin riboflavin I. Flamme, A. Ullirch, K. P. Hirth, and L. K. Shawyer. transport 1996. “Flk-1 as a Target for Tumor Growth Inhibition”. protein on cell Cancer ReS. 56: 3340-3545. surface Methotrexate folate transport P. Stromblad, S., and D. A. Cheresh. December 1996. protein on cell 25 “Cell adhesion and angiogenesis”. Trends in Cell Biol surface chlorambucil general ogy 6 (12): 462-468. transport Q. Stromblad, S., and D. A. Cheresh. November 1996. mechanisms “Integrins, angiogenesis and Vascular cell Survival'. Chemistry & Biology 3 (11): 881-885. References to the preceding tables R. Volpert, O., D. Jackson, N. Bouck, and D. I. H. Linzer. A. Auerbach, W., and R. Auerbach. 1994. "Angiogenesis September 1996. “The insulin-like growth factor inhibition: a review’. Pharmac. Ther. 63: 265–311. II/mannose 6-phosphate receptor is required for B. Barinaga, M. 1997. “Designing Therapies That Target proliferin-induced angiogenesis. Endocrinology 137 Tumor Blood Vessels”. Science 275 (Jan. 24): 482–484. 35 (9): 3871-3876. C. Folkman, J., P. B. Weisz, M. M. Joullie, W. W. Li, and S. Yoshida, O. M., T. Shono, H. Izumi, T. Ishibashi, H. W. R. Ewing. 1989. “Control of Angiogenesis With Suzuki, and M. Kuwano. 1997. “Involvement of Synthetic Heparin Substitutes”. Science 243: Interleukin-8, Vascular Endothelial Growth Factor, and 1490-1493. Basic Fibroblast Growth Factor in Tumor Necrosis D. Fox, S. B., and A. L. Harris. 1997. “Markers of tumor Factor Alpha-Dependent Angiogenesis'. Mol. Cell. angiogenesis: Clinical applications in prognosis and 40 Biol. 17: 4015-4023. anti-angiogenic therapy'. Investigational New Drugs T. Zimrin, A. B., M. S. Pepper, G. A. McMahon, F. 15 (1): 15–28. Nguyen, R. Montesano, and T. Maciag. 1996. “An E. Gastl, G., T. Hermann, M. Steurer, J. Zmija, E. AntiSense Oligonucleotide to the Notch Ligand Jagged Gunsilius, C. Unger, and A. Kraft. May 1997. “Angio Enhances Fibroblast Growth Factor-induced genesis as a target for tumor treatment'. Oncology 54 45 Angiogenesis.Statin, altan Serin, altapiZone, factor. Nature Medicine 2, 167-8 alteconazole, althiazide, altrenogest, altretamine, alu ZA. Relf, M., S. LeJeune, PA. Scott, S. Fox, K. Smith, R. minium acetate, aluminium clofibrate, aluminium Leek, A. Moghaddam, R. Whitehouse, R. Bicknell and Subacetate, alverine, amadinone acetate, amafolone, A:L. Harris. 1997. “Expression of the angiogenic fac 5 amano Zine, amantadine, amantanium bromide, tors vascular endothelial cell growth factor, acidic and amantocillin, ambasilide, ambazone, ambenonium basic fibroblast growth factor, tumor growth factor chloride, ambe no Xan, ambroXol, am bruticin, beta-1, platelet-derived endothelial cell growth factor, ambucaine, ambucetamide, ambuphylline, ambuSide, placenta growth factor and pleiotrophin in human pri ambutonium bromide, amcinafal, amcinafide, mary breast cancer and its relation to angiogenesis'. amcinonide, amdinocillin, amdinocillin pivoxil, Cancer Res. 57, 963–9. amebucort, amedalin, ametantrone, ameZepine, ameZ ZB. Carmeliet, P., L. Moons, M. Dewerchin, N. inium me tilSulfate, amfenac, amfe pentorex, Mackman, T. Luther, G. Breier, V. Ploplis, M. Miller, amfetaminil, amflutizole, amfonelic acid, amicarbalide, A. Nagy, E. Plow, R. Gerard, T. Edgington, W. Risau, amicibone, amicloral, amicycline, amidantel, 15 amidapSone, amidephrine, amiflamine, amifloverine, D. Collen. 1997. Ann, N.Y. Acad. Sci. 811, 191-206. amifloxacin, amifostine, amikacin, amikhelline, ZC. Van Hinsbergh, P. Koolwijk, R. Haanemaijer. 1997. amiloride, aminacrine, amindocate, amineptine, ami “Role of fibrin and plasminogen activators in repair nobenzoic acid, aminocaproic acid, aminoethyl nitrate, asSociated angiogenesis: in vitro Studies with human a mino glute thimide, a minohippuric acid, endothelial cells' EXS 79,391–411. aminometradine, aminopentamide, aminophylline, Passe, T. J., D. A. Bluemke and S. S. Siegelman. 1997. aminop romazine, aminopterin, aminopyrine, Radiology 203: 593-600. aminoquinol, aminoquinuride, aminorex, aminoSalicy Representative examples of drugs useful in accordance clic acid, aminothiadiazole, aminothiazole, with the invention include: amiodarone, amiperone, amipheaZole, amipizone, abamectin, abundiazole, acapra Zine, acabrose, 25 amiprilose, amiquinsin, amisometradine, amisulpride, acebrochol, aceburic acid, acebutolol, acecainide, amite rol, amithioZone, amitraz, amitriptyline, acecarbromal, aceclidine, aceclofenac, acedapSone, amitriptylinoxide, amiXetrine, amlexanoX, amlodipine, acediasulfone, acedoben, acefluranol, acefurtiamine, amobarbital, amodiacquine, amogastrin, amolanone, acefylline clofibrol, acefylline piperazine, aceglatone, amonofide, amoproXan, amopyroquin, amorolfine, aceglutamide, aceglutamide aluminium, acemetacin, amocanate, amoSulalol, amotriphene, amoxapine, ace no couma rol, ace perone, ace prom a Zine, amoxecaine, amoxicillin, amoxydramine camsilate, ace pro meta Zine, ace quinoline, ace Sulfame, amperozide, amphecloral, amphenidone, amphetamine, acetaminophen, acetamino Salol, acetanilide, ampho tallide, amp hote ricin B, amplicillin, acetarSone, acetazolamide, acetergamine, acetiamine, ampiroXicam, amprolium, ampyrimine, ampy Zine, acetiromate, acetohexamide, acetohydroxamic acid, 35 amduinate, amrinone, amsacrine, amygdalin, amylene, ace to me roctol, acetophena Zine, ace torphine, amylmetacresol, amyl nitrite, anagestone acetate, acetosulfone, acetriozate, acetryptine, acetylcholine anagrelide, anaXirone, anazocine, anaZOlene, ancarolol, chloride, acetylcolchinol, acetylcy Steine, ancitabine, androstanediol, androstanol propionate, acetyldigitoxin, acetylleucine, acetylsalicyclic acid, androstenetrione, androStenonol propionate, anethole, ace Valtrate, aceXamic acid, acifran, acipimox, 40 anguidine, anidoxime, anilamate, anilleridine, aniline, acitemate, acitretin, acivicin, aclantate, aclarubicin, anilopam, anipamil, aniracetam, anirolac, anisacril, aclatonium napadisilate, acodazole, aconiazide, anisindione, anisopirol, anisoylbromacrylic acid, aconitine, acoxatrine, acridorex, acrihelin, acrisorcin, anitraZafen, anpirtoline, ansoxetine, antafenite, acrivastine, acrocinide, acronine, actinoquinol, antazoline, antaZonite, anthelmycin, anthiolimine, acto digin, acyclovir, adafe noXate, adame Xine, 45 anthralin, anthramycin, antienite, antimony potassium ade metionine, adenosine phosphate, adibendan, tart rate, antimony thioglycollate, antipyrine, adicillin, adimolol, adinazolam, adiphenine, aditeren, an trafe nine, apalcillin, apa Zone, apicycline, aditoprim, adrafinil, adrenalone, afloqualone, afurolol, apomorphine, apo Vincamine, a praclonidine, aganodine, ajmaline, aklomide, alacepril, alafosfalin, apramycin, aprindine, aprobarbital, aprofene, alanine mustard, alanosine, alaproclate, alazanine 50 aptazapine, aptocaine, arabinosylmercaptopurine, triclofenate, albendazole, albendazole oxide, albuterol, ara notin, arbaproStil, arbekacin, arclofenin, albutoin, alclofenac, alcometasone dipropionate, arfendazam, arginine, arginine glutamat, arildone, alcloxa, alcuronium chloride, aldioxa, aldosterone, arnolol, aronixil, arotinolol, arpinocid, arpromidine, alepride, aletamine, alexidine, alfacalcidol, alfadex, arSanilic acid, arSthinol, artemisinin, articaine, asaley, alfadolone, alfaprostol, alfaxalone, alfentanil, 55 ascorbic acid, ascorbyl palmitate, asocainol, aspartame, alfuZosin, algestone acetonide, algestone acetophenide, aspartic acid, asperlin, aspoxicillin, astemizole, alibendol, aliconazole, allifedrine, alliflurane, alimadol, atameStane, atenolol, atipameZole, atiproSin, atolide, alinidine, alipamide, alitame, alizapride, allantoin, atracurium besilate, atromepine, atropine, atropine alletorphine, allobarbital, alloclamide, allocupreide, Oxide, auranofin, aurothoiglucose, aurothioglycanide, allomethadione, allopurinol, ally lestrenol, allyl 60 avillamycin-A, avridine, a Xamo Zide, a Zabon, isothicyanate, allylprodine, allylthiourea, almadrate aZabuperone, azacitodine, azaclorzine, azaconazole, Sulfate, alma Silate, almecillin, alme Strone, aZacosterol, azacyclonol, aZaftozine, azaguanidine, alminoprofen, almitrine, almoxatone, alonacic, aZaloxan, azamethonium bromide, azamulin, azanator, alonimid, alo XiStatin, alo Zafone, alpertine, a Zanidazole, a Zape rone, a Zapicy 1, a Zap rocin, alphacetylmethadol, alphameprodine, alphamethadol, 65 aZaquinzole, azaribine, azarole, azaserine, azaspirium alphaprodine, alpha-Vinyla Ziridinoethyl acetate, chloride, a Zastene, a Zastrptonigrin, a Zatodine, alpidem, alpiropride, alprazolam, alprenolol, aZathioprine, a Zauridine, a Zelastine, a Zepexole, US 6,331,289 B1 41 42 aZepindole, azetepa, azidamfenicol, azidocillin, brequinar, bretylium tosylate, brindoxime, brivundine, azimeXon, azintamide, azipramine, azithromycin, brobactam, broclepride, brocresine, brocrinat, aZlocillin, a Zolimine, a ZoSemide, azotomycin, brodimoprim, brofaromine, brofezil, brofoxine, aztreonam, aZumolene, bacampicillin, baclofen, brolaconazole, brolamfetamine, bromacrylide, bacmecillinam, balsalazide, bamaluzole, bambuterol, brom a do line, brom amid, brom a Zep a m, bamethan, bamifylline, bamipine, bamnidazole, bromchlorenone, bromebric acid, bromerguride, baduiloprim, barbexaclone, barbital, barucainide, brometenamine, bromfenac, bromheXine, bromindione, batilol, baZina prine, becanthone, beclamide, bromiso Valum, bromocicle n, bromocriptine, be clobrate, be clomethas one diprop ionate, bromodiphenhydramine, bromofenofos, bromopride, beclotiamine, befipe ride, befunolol, befuraline, bromoXandide, bromperidol, bromperidol decanoate, bekanamycin, belarizine, beloxamide, bemarinone, bromphe niramine, bronopol, brop are Strol, be megride, be metizide, bemitradine, benactyzine, broperamole, bropirimine, broquinaldol, broSotamide, benafentrine, benanSerin, benapry Zine, benaxibine, broSuximide, brotianide, brotizolam, brovanexine, benazepril, bencianol, bencisteine, benclonidine, brovincamine, broXaldine, broXaterol, broXitalamic bencyclane, bendamustine, bendaZac, bendaZol, 15 acid, broXuridine, broxyquinoline, bruceantin, brucine, benderizine, bendroflumethiazide, benethamide bucainide, bucetin, buciclovir, bucillamine, bucindolol, penicillin, be nexate, benflore X, benfosformin, bucladesine, buclizine, buclosamide, bucloxic acid, benfotiamine, benfurodil hemisuccinate, benhepaZone, bucolome, bucricaine, bucromarone, bucrylate, benidipine, benmoxin, benolizime, be norilate, bucumolol, bude Sonide, budi pine, budotitane, benorterone, benoxafos, benoxaprofen, benoximate, budralazine, bufenadrine, bufeniode, bufetolol, benperidol, ben properine, benrixate, benSalan, bufeXamac, bufe Zolac, buflomedil, bufogenin, be nSera Zide, benSulda Zic acid, bentazepam, buformin, bufrolin, bufuralol, bumadizone, bumecaine, bentemazole, bentiamine, bentipimine, bentiromide, bumepidil, bumetanide, bumetrizole, bunaftine, benurestat, benzaldehyde, benzalkonium chloride, bunamidine, bunamiodyl, bunaprolast, bunaZosin, be nZaprinoxide, ben Zarone, ben Zbromarone, 25 bunitrolol, bunolol, buparvaquone, bupicomide, benzestrol, benzethidine, benzethonium chloride, bupivacaine, bupranolol, buprenorphine, bupropion, benzetimide, benzilonium bromide, benzindopyrine, buquineran, buquinolate, buquiterine, buramate, be nZiodarone, ben Zmale cene, ben Znidazole, burodiline, buspirone, busulfan, butabarbital, be n Zob arbital, benzocaine, benzo clidine, butacaine, butacetin, butaclamol, butadiaZamide, benzoctamide, benzodepa, benzododecinium chloride, butafosfan, but alamine, but albital, but amben, benzoic acid, benzoin, benzonatate, benzopyrronium butamirate, butamisole, butamoxane, butanediol cyclic bromide, benzoquinium chloride, benzotript, Sulfite, butanilicaine, butanixin, butanserin, butantrone, benzo Xiquine, benzoxonium chloride, benzoyl butaperazine, butaprost, butaverine, butedronate, peroxide, benzoylpas, benzphetamine, benzpiperylon, buterizine, bute tamate, butethamine, buthiazide, benzpyrinium bromide, benzauercin, benzcuinamide, 35 butibulfen, but idrine, butikacin, but ilfenin, ben Zthia Zide, ben Ztropine, ben Zy damine, butinazocine, butinoline, butirosin, butiXirate, benzylpenicillin, benzylsulfamide, beperidium iodide, butobendine, butoconazole, butocrolol, butoctamide, bephenium naphtoate, bepiastine, bepridil, beraprost, butofilolol, butonate, butopamine, butopiprine, berberine Sulfate, bermastine, bermoprofen, butoprozine, butopyrammonium iodide, butorphanol, berythromycin, beSulpamide, beslunide, beta caroteine, 40 butoxamine, butoxylate, butriptyline, butropium be tacetylmethadol, be tahistine, be taine, bromide, butylated hydroxyanisole, butylated be tameprodine, betamethadol, betame thaSone, hydroxytoluene, butylparaben, butynamine, buZepide betamethasone acetate, betamethasone acibutate, metiodide, cabastine, cabergoline, cadralazine, betamethasone benzoate, betamethasone dipropionate, cafaminol, cafedrine, caffeine, calcifediol, calcitrol, betamethasone phosphate, betamethasone Valerate, 45 calcium citrate, calcium dobe Silate, calcium betamicin, beta prodine, be taxolol, betazole, glubionate, calcium gluceptate, calcium gluconate, cal be thane chol chloride, bethanidine, betiatide, cium glycerophosphate, calcium hypophosphite, cal betoxycaine, bevantolol, bevonium metilsulfate, cium lactate, calcium lactobionate, calcium levulinate, beZafibrate, bezitramide, bialamicol, bibenzonium calcium mandelate, calcium pantothenate, calcium bromide, bibrocathol, bicifadine, biclodil, biclofibrate, 50 phosphate dibasic, calcium phophate tribasic, calcium biclotymol, bico Zamycin, bidima Zium iodine, Saccharate, calcium Stearate, calusterone, camazepam, bietamiverine, bietaserpine, bifemelane, bifepramide, cambendazole, camiverine, camoStast, camphotamide, bifluranol, bifonazole, binedaline, binfloxacin, camptothecin, camylofin, canbisol, cannabinol, can binfibrate, bioallethrin, biores methrin, biotin, renoic acid, canrenone, cantharidine, capobenic acid, bipenamol, biperiden, biphenamine, biriperone, 55 capreomycin, caproxamine, capsaicine, captamine, bisacodyl, bisantrene, bis(aziridinyl) butanediol, captodiame, captopril, cap uride, carace mide, bisbendazole, bisbentiamine, bisfenaZone, bisfentidine, caramiphen, carazolol, carbachol, carbadox, bismuth betanaphthol, bismuth-triglycollamate, bis carbaldrate, carbamazepine, carbamide peroxide, carb muth Subgallate, bismuth Subsalicylate, bisorbin, antel lauryl Sulfate, carbaril, carbarSone, carbaspirin bisoprolol, bisorcic, bioxatin acetate, bispyrithione 60 calcium, carbaZeran, carbazochrome, carbazachrome magSulfeX, bithionol, bithionoloxide, bitipaZone, Salicylate, carbazachrome Sulfonate, carbazocine, bitoterol, bitoscantate, bleomycin, bluenSomycin, carbeniciltin, carbenicillinindanyl, carbencillin phenyl, bofumustine, bolandiol dipropionate, bolasterone, carbenoXolone, carbenzide, carbestrol, carbetapentane, bolazine, bolde none undecyle nate, bolenol, carbidopa, carbimazole, carbinoxamine, carbiphene, bolmantalate, bometolol, bopindolol, bornaprine, 65 carbocloral, carbocysteine, carbofenotion, carbol bornaprolol, borne lone, botiacrine, boxidine, fuSchin, carbomycin, carboplatin, carboprost, carbo brallobarbital, braZergoline, brefonalol, bremazocine, prost methyl, carboquone, carbromal, carbubarb, US 6,331,289 B1 43 44 carburazepam, carbutamide, carbuterol, carcainium cinfeno ac, cinflumide, cingestol, cinitapride, chloride, carebastine, carfentanil, carfimate, cinmetacin, cinnamaverine, cinnamedrine, cinnarizine, carisoprodol, carmantadine, carmetizide, carmofur, cinnarizine clofibrate, cinnofuradione, cincotramide, car mustine, carnidazole, carnitine, carocainide, cinodine, cinolazepam, cinoquidox, cinoaxin, cinoXate, caroverine, caroXaZone, carpe ridine, caperone, cinoXolone, cinooxopazide, cinperene, cinprazole, carphenazine, carpindolol, carpiramine, carprofen, car cinpropazide, cinromide, cintaZone, cintriamide, cinperone, ciprafamide, ciprafaZone, ciprefadol, pronium chloride, carSalam, cartaZolate, carteolol, ciprocinonide, ciprofibrate, ciprofloxacin, cipropride, carubicin, carumo nam, carvedilol, car Zenide, ciprocquaZone, ciprostene, ciramadol, cirazoline, carzolamide, cathine, cathinone, cefaclor, cefadroxil, cisapride, cisconazole, cismadinone, cisplatin, cefalonium, cefaloram, cefamandole, cefamandole cistine Xine, citalopram, citate pine, cite namide, naftate, cefaparole, cefatrizine, cefazaflur, cefazedone, citenaZone, citicoline, citiolone, clamidoxic acid, cefazolin, cefbuperaZone, cefcanel, cefcanel daloxate, clamoxyquin, clanfenur, clanobutin, clantifen, ce fedrolor, ce fempidone, cefepime, ce fetamet, clarithromycin, clavulanic acid, claZolam, clazolimine, cefetrizole, cefvitril, cefixime, cefimenoXime, cefime claZuril, clebopride, clefamide, clemastine, clemeprol, pidium chloride, cefimetazole, cefminox, cefodizime, 15 cle mizole, clenbute rol, clenpirin, cle to quine, cefonizid, cefoperaZone, ceforanide, cefotaxime, clibucaine, clidafidine, clidanac, clidinum bromide, cefotetan, cefotiam, cefoxazole, cefoXitin, cefpimizole, climaZolam, climbazole, climiqualine, clindamycin, cefpiramide, cefpirome, cefpodoxime, cefpodoxime clindamycin palmitate, clindamycin phosphate, proxetil, cefauinome, cefrotil, cefroXadine, cefSulodin, clinofibrate, clinolamide, cliquinol, clioxanide, cefSumide, ceftazidime, cefteram, cefteZole, ceftiofur, clipoxamine, cliprofen, clobaZam, clobenoside, ceftiolene, ceftioxide, ceftizoxime, ceftriaxone, clobenzepam, clobenzorex, clobenztropine, clobetasol ceful race time, cefuroxime, cefuraxime axe til, propionate, clobetaSone butyrate, clobutinol, cefurZonam, celiprolol, cephacetrile, cephalexin, clobu Zarit, clocanfamide, clocapramine, clociguanil, cephaloglycin, cephaloridine, cephalothin, cephapirin, clocinizine, clocortolone acetate, clocortolone pivalate, cephradine, cetaben, cetamolol, cetheXonium chloride, 25 clocoumarol, clodacaine, clodanolene, clodiazon, ce tiedil, cetirizine, cetocycline, cetohexazine, clodoxopone, clodronic acid, clofazimine, clofenamic acid, clofenamide, clofenciclan, clofenetamine, cetophe nicol, cetotiamine, cetoxime, cetraXate, clofenoxyde, clofenVinfoS, clofeverine, clofeXamide, chaulmosulfone, chendiol, chiniofon, chlophedianol, clofeZone, clofibrate, clofibric acid, clofibride, clofi chloracy Zine, chloral be taine, chloral hydrate, lium phosphate, cloflucarban, clofoctol, cloforex, chlor alo Se, chlor ambucil, chlora mine, clofurac, clogestone acetate, cloguanamil, clomacran, chloramphenicol, chloramphenicol palmitate, chloram clomegestone acetate, clometacin, clometherone, phenicol Succinate, chlorazanil, chlorbenzoxamine, clomethiazole, clometocillin, clomife noxide, chlorbetamide, chlorcyclizine, chloridantoin, clominorex, clomiphene, clomipramine, clomocycline, chlordiazepoxide, chlordimorine, chlorhexadol, clomoxir, clonazepam, clonazoline, clonidine, chlorhexidine, chlorhexidine phosphanilate, 35 clonitaZene, clonitrate, clonixeril, clonixin, clopamide, chlorindanol, chlorisondamine chloride, chlormadi clopenthiXol, cloperastine, cloperidone, clopidogrel, none acetate, chlormerodrin, chlorime Zanone, clopidol, clopimozide, clopipazan, clopirac, cloponone, chlormidazole, chloronaphazine, chloroa Zodin, cloprednol, cloproStenol, cloprothiazole, cloquinate, chlorobutanol, chloro cre Sol, cloquinozine, cloracetadol, cloranolol, cloraZepate, chlorodihydroxyandrostenone, chloroethyl meSylate, 40 clore thate, clorexolone, clorgiline, cloricromen, 5-chloro-3'-fluoro-2'3-dideoxyuridine, chloroguanide, cloridarol, clorindanic acid, clorindione, clormecaine, chlorophe nothane, chloroprednisone acetate, cloroperone, clorophene, cloroqualone, clorotepine, chloroprocaine, chloropyramine, chloroquine, clorprenaline, clorSulon, clortermine, closantel, chloro Serpidine, chlorothen, chlorothiazide, closiramine, clostebol, clothiapine, clothixamide, chlorotrian Sene, chloroXine, chloroxylenol, 45 clotiazepam, cloticaSone propionate, clotioxone, chloro Zotocin, chlorphenesin, chlorphene Sin clotrimazole, clovoxamine, cloxacepride, cloxacillin, carbamate, chlorpheniramine, chlorphe noctium cloxacillin benzathine, cloxazolam, cloxestradiol, amsonate, chlorphenoxamine, chlorphen termine, cloximate, cloXotestosterone, cloxypendyl, cloxyquin, chlorproethazine, chlorproguanil, chlorpromazine, clozapine, cobamide, cocaine, cocarboxylase, codeine, codoxime, cofisatin, coga Zocine, colchicine, chlorpropamide, chlorprothixene, chlorquinaldol, 50 colestolone, colfenamate, colforsin, colterol, conessine, chlortetracycline, chlorthalidone, chlorthenoxazine, Conorphone, copper gluconate, cormethasone acetate, chlorZoaXaZone, chloecalciferol, cholic acid, choline corticosterone, cortisone acetate, cortisu Zol, cortivaZol, chloride, choline glycerophosphate, chromocarb, cortodoxone, cotarnine chloride, cotinine, cotriptyline, chromonar, ciadox, ciameXOn, cianergoline, cianidol, coumaphos, coumaZoline, coumermycin, coumetarol, cianopramine, ciapilome, cicaprost, cicarperOne, 55 creatinolfosfate, crisinatol, croconazole, cromakalim, ciclactate, ciclafrine, cicla Zindol, cicletanine, cromitrile, cromolyn, cropropamide, croSpoVidone, ciclomenol, ciclonicate, ciclonium bromide, ciclopirox, crotamiton, crotetamide, crotoniazide, crufomate, ciclopramine, cicloprofen, cicloprolol, ciclosidomine, cuprimyxin, cuproXoline, cyacetacide, cyamemazine, ciclotizolam, ciclotropium bromide, cicloxilic acid, cyanocobalamine, cyclacillin, cyclande late, cicloxolone, cicortonide, cicrotic acid, cidoxepin, 60 cyclarbamate, cyclazocine, cyclazodone, cyclexanone, cifenline, cifostodine, ciglita Zone, ciheptolane, cyclindole, cycliramine, cyclizine, cyclobarbital, cil adopa, cila Statine, cila Zapril, cila Zaprilat, cyclobendazole, cyclobenzaprine, cyclobutoic acid, cilobamine, cillofungin, ciloStamide, ciloStaZol, cyclobutyrol, cyclofenil, cycloguanil, cloheximide, ciltoprazine, cimaterol, cimemoxin, cimepanol, cycloleucine, cyclomenol, cyclomethicone, cimetidine, cimetropium bromide, cimoxatone, 65 cyclomethycaine, cyclopentamine, cyclopenthiazide, cinchonine, cinchophen, cinecromen, cinepaXadil, cyclopentolate, cyclopenazine, cyclophosphamide, cinepaZet, cinepazic acid, cinepazide, cinfenine, cyclopregnol, cyclopyrronium bromide, cycloSerine, US 6,331,289 B1 45 46 cyclosporine, cyclothiazide, cyclovalone, cycotiamine, dienogest, diethadione, diethazine, diethylpropion, cycrimine, cyheptamide, cyheptropine, cynarine, diethylstilbestrol, diethylstilbestrol diphosphate, dieth cypenamine, cypothrin, cyprazepam, cyprenophine, ylstilbe Strol dipropionate, diethylthiambute ne, cyprodenate, cyproheptadine, cyprolidol, cyproduinate, diethyltoluamide, dietifen, difebarbamate, difemerine, cyproterone acetate, cyproximide, cystine, cytarabine, dife me tore X, dife namizole, difencloxazine, dacarbazine, dacemazine, dacisteine, dacinomycin, difenoXimide, difenoXin, difetarSone, difeterol, diflo dacuronium bromide, dagapamil, dalbraminol, rasone diacetate, difloxacin, difluanine, diflucortolone, daledalin, daltroban, dametralast, damotepine, danazol, diflurcortolone pivalate, diflumidone, diflunisal, danitracen, danosteine, danthron, dant rolene, difluprednate, diftalone, digalloyl trioleate, digitoxin, dapiprazole, dapsone, daptomycin, darenzepine, digo Xin, dihe Xy verine, dihydra la Zine, darodipine, datelliptium chloride, dunorubicin, dihydro a Za cytidine, dihydro ergot a mine, daZadrol, dazepinil, daZidamine, daZmegrel, dihydrole in per one, dihydro Stre p to mycin, dazolicine, dazopride, dazoquinast, dacoxiben, deanol dihydrotachysterol, dihydroxyfluoroprogestrone, aceglumate, deanol acetaminobenzoate, deaZauridine, diisopromine, diisopropanolamine, dilaZep, dilevalol, deboxamet, debrisoquin, decamethonium bromide, 15 dilimefone, diloxanide, diltiazem, dimabefylline, decimenide, decitropine, declaben, declenperone, dimecamine, dimecolonium iodide, dimecrotic acid, decloxizine, decominol, decoquinate, deditonium dimefadane, dimefline, dimelazine, dimemorfan, bromide, deferoxamine, deflazacort, defosfamide, dimenhydrinate, dimenoxadol, dime heptanol, dehydroacetic acid, dehydroemetine, dehydro-7- dimepranol, dimepregnen, dimeproZan, dimercaprol, methyltestosterone, delanterone, delapril, delergotrile, dimeSna, dimeSone, dimetacrine, dimetamfetamine, del fantrine, delmadinone acetate, delmetacin, dimethadione, dimethamino Styrylcquinoline, delmopinol, delorazepam, deloxone, delprostenate, dime tha Zan, dime thin de ne, dimethiodal, dembrexine, demecarium bromide, demeclocycline, dime thisoquin, dime thisterone, dimetholizine, demecolcine, demecycline, demegestone, demelverine, dimethoXanate, dimethylhydroxy testosterone, de me Xiptiline, democonazole, demo Xepam, 25 dimethylnorandrostadienone, dimethylnortestosterone, denaverine, denbufylline, denipride, denopamine, dimethylstilbestrol, dimethyl, dimethylthiambutene, denpidaZone, denZimol, deoxyspergualin, depramine, dimethyl tubocurarinium chloride, dime tipirium deprodone, deprostil, deptropine, derpanicate, desace bromide, dimetofrine, dimetridazole, diminaZene, tylcolchicine tartrate, desaspidin, desiclovir, descino dimoxamine, dimoxaprost, dimoxyline, dimpylate, lone acetonide, deserpidine, desipramine, deslanoside, dinaline, dinaZafone, diniprofylline, dinitolmide, deSmethylcolchicine, de Smethyl misonidazole, dinoprost, dinoprostone, dinsed, dioSmin, dioxadillol, deSmethylmoramide, de Socriptine, desogeStrel, dioxadrol, dioxamate, dioxaphetyl butyrate, deSomorphine, desonide, desoximetaSone, desoxycor dioxethedrin, dioxifedrine, dioxybenzone, dipenine ticosterone acetate, desoxycorticosterone pivalate, bromide, diperodon, diphemanil methylsulfate, desoxypyridoxine, detajmium bitartrate, detanosal, 35 diphenadione, diphenan, diphenhydramine, diphendiol, deterenol, detomidine, detorubicin, detrothronine, diphenoxylate, diphenylpraline, diphoXaZide, devapamil, dexamethasone, dexamethasone acefurate, dipipanone, dipipoverine, dipliverin, diprafenone, dexamethasone acetate, dexamethasone dipropionate, diprenorphine, diprobutine, diprofene, diprogulic acid, de Xame tha S one phosphate, de Xami Sole, diproleandomycin, diprocqualone, diproteverine, de Xbr omphe niramine, de X chlorphe niramine, 40 diprotriozate, diproXadol, dipyridamole, dipyrithione, deXclamol, deXetimide, deXetoZoline, dexfenfluramine, dipyrocetyl, dipyrone, dirithromycin, disobutamide, deximafen, deXindoprofen, dexivacaine, dexlofexidine, disofenin, disogluside, disopyramide, disoxaril, distig de Ximede to midine, deXOXadrol, deXpan the nol, mine bromide, disulergine, disulfamide, disulfiram, deXpropranolol, deXproxibute ne, deXecoverine, disuprazole, ditazole, ditercalinium chloride, dithiaza dextilidine, dextroamphetamine, dextrofemine, 45 nine iodide, ditiocarb, ditiomustine, ditolamide, dextromethorphan, dextromoramide, dextrorphan, ditophal, divabuterol, dixanthogen, dizatrifone, dextrothyroXine, deZaguanine, dezocine, diacerein, dizocilpine, dobupride, dobutamine, docarpamine, diacetamate, diace to lol, diacetylmorphine, doconazole, docusate, doliracetam, domaZoline, diamfenetide, diaminomethylphenazinium chloride, domio dol, domiphen bromide, domipi Zone, diamo caine, diam promide, diamtha Zole, 50 domoprednate, domo Xin, dom peridone, don, dianhydrogalactitol, diapamide, diarbarone, donetidine, dopamantine, dopamine, dopexamine, diathy mosulfone, diatrizoic acid, diave ridine, dopropidil, docqua last, dorastine, do reptide, diazepam, diaziquone, diazoacetylglycine hydrazide, doSergoside, dotarizine, dote fonium bromide, dia Zouracil, diaZoxide, dibekacin, dibe methine, dothiepin, doxacurium chloride, doxaminol, doxapram, dibe namine, diben Zepin, dibrom propamidine, 55 doxaprost, doxazosin, doxefazepam, doxenitoin, dibromsalan, dibroSpidium chloride, dibucaine, doxepin, doxibetasol, doxifluridine, doxofylline, dibuprol, dibupyrone, dibuSadol, dicarbine, dicarfen, doxorubicin, doxpicomine, doxycycline, doxylamine, dichlorallyl laws one, dichlorisone acetate, dramedilol, draquinolol, deaZidox, dribendazole, dichlor me Za none, dichloroflu or me thane, drindene, drobuline, drocinonide, droclidinium dichlorome thotre Xate, dichlorophe n, 60 bromide, drocode, drofe nine, droloxifene, dichlorophe narSine, dichlorote trafluoroethane, drometrizole, dromoStanolone, dromoStanolone dichloroxylenol, dichlorphe namide, dichlorvos, propionate, dronabinol, dropempine, droperidol, diciferron, dicire none, dicla Zuril, diclofenac, droprenilamine, dropropizine, drotaverine, drotebanol, diclofensine, diclofurime, diclometide, diclonixin, droxacin, droxicainide, droxicam, droxidopa, dicloxacillin, dicobalt edetate, dicolinium iodide, 65 droxypropine, dulofibrate, duloZafone, duometacin, dicre Sulene, dicumarol, dicyclomine, didemnin, duoperone, dup racetam, durapatite, dyclonine, dideoxycytidine, didrovaltrate, dieldrin, dienestrol, dydrogesterone, dymanthine, dyphylline, ebastine, US 6,331,289 B1 47 48 e brotidine, ebSelen, ecastolol, echinomycin, e topoSide, etop rindole, etoprine, e torphine, echothiophate iodide, ecipramidil, eclanamine, eto Salamide, etoxadrol, etoxe ridine, e to Zolin, eclaZolast, econazole, ectylurea, edelfosine, edetic etrabamine, etretinate, etryptamine, etymemazine, acid, edetol, edifolone, edogestrone, edoxudine, edro eucalyptol, euca tropine, eugenol, eup rocin, phonicum chloride, efaroXan, efetozole, eflornithine, evandamine, Evans blue, exalamide, exametazine, efloxate, efrotomycin, elantrine, elanzepine, elder exaprolol, exepanol, exifone, exiproben, fallintolol, field's pyrimidine mustard, elfazepam, elagic acid, falipamil, famiraprinium chloride, famotidine, elliptinium acetate, elmustine, elnadipine, eltenac, famotine, famiprofaZone, fanetizole, fantridone, faza eltopra Zine, elucaine, el Ziverine, embramine, dinium bromide, faZaribine, febantel, febarbamate, embu tramide, eme pronium bromide, emetine, februpol, febuverine, feclemine, feclobu Zone, fedrilate, emiglitate, emilium tosylate, emopanil, emorfaZone, felbamate, felbinac, felipyrine, felodipine, femoxetine, emylcamate, enalapril, enalaprilat, enbucrilate, fenabutene, fenacetinol, fenaclon, fenadiazole, fenaptic encainide, enciprazine, enclomiphene, encyprate, acid, fenalamide, fenalcomine, fenamifuril, penamole, endomide, endralazine, endry Sone, enefeXine, fenaperone, fenbendazole, fenbencillin, fenbufen, eneStebol, enfenamic acid, enflurane, eniclobrate, 15 fenbutraZate, fencamfamine, fencibutirol, fencleXo enilconazole, eniloSpirone, enisoprost, enocitabine, nium metilsulfate, fenclofenac, fenclonine, fenclorac, enolicam, enoxacin, enoxa mast, enoXimone, fenlozic acid, fendiline, fendosal, feneritrol, feneStrel, enoXolone, eniprazole, eniproline, enpraZepine, fenethazine, fenethylline, fenetradil, fenflumizole, enprofylline, enpromate, enproStil, enrofloxacin, entSu fenfluramine, fenfluthrin, fengabine, fenharmane, fon Sodium, enviomycin, enviradene, epalretat, fenimide, feniodium chloride, fenipentol, fenirofibrate, epanolol, eperisone, ephedrine, epicainide, epicillin, fenisorex, fenmetoZole, fenmetramide, fenobam, epicriptine, epieStriol, epime Strol, epinastine, fenocinol, fenoctimine, fenofibrate, fenoldopam, epinephrine, epinephrylborate, epipropidine, epirizole, fenoprofen, fenoterol, fenoverine, fenoxazoline, epiroprim, epirubicin, epithiazide, epitioStanol, fe noXedil, feno Zolone, fenpentadiol, femperate, epoprostenol, epoStane, eprazinone, eproVafen, 25 fenipalone, fenipramide, feniprane, fenpiverinium eproXindine, eproZinol, epsiprantel, eptaloprost, bromide, fenprinast, fenproporex, fenprostalene, eptazocine, equilin, erdosteine, ergocalciferol, ergoloid fenduizone, fenretinide, fenspiride, fentanyl, fentiazac, meSylates, ergonoVine, ergosterol, ergotamine, ericolol, fenticlor, fenticonazole, fentonium bromide, fenyripol, erizepine, erocainide, erythrity1 tetranitrate, fepentolic acid, fepitrizol, fepradinol, feprazone, erythromycin, erythromycin acistrate, erythromycin fe promide, fe proSid nine, ferric late calcium, ethylSuccinate, erythromycin propionate, erythrosine, ferrotrenine, ferrous fumarate, ferrous gluconate, esaprazole, esculamine, eSeridine, esflurbiprofen, fe to Xylate, feXicaine, feXinidazole, fe Zatione, eSmolol, eSorubicin, esprocquin, estaZolam, estradiol, fezolamine, fiacitabine, fibracillin, filenadol, filipin, estradiol benzoate, estradiol cypionate, estradiol fifexide, flamenol, flavamine, flavodic acid, flavodil, dipropionate, estradiol enanthate, estradiol undecylate, 35 flavoneactic acid, flavoxate, flazalone, flecainide, estradiol Valerate, estramustine, estramustine fle robute rol, fleroxacin, flesino Xan, fle Stolol, phosphate, estrapronicate, estraZinol, estriol, fletazepam, floctafenine, flomoxef, flopropione, estrofurate, estrone, estrone hydrogen Sulfate, florantyrone, flordipine, floredil, florfenicol, estropipate, eSuprone, etaben Zarone, etacepride, florife nine, floSequinan, flotre nizine, floverine, etafe drine, etafe none, et ame Strol, eta miline, 40 floxacillin, floxacrine, floXuridine, flu acizine, etamiphyllin, etamocycline, etanidazole, etanterol, fluialamide, flulanisone, fluaZacort, flubanilate, etacqualone, etasuline, etazepine, etazolate, etebenecid, flu bendazole, flu be pride, fluca bril, fluce torex, eterobarb, etersalate, ethacridine, ethacrynic acid, flucindole, fluciprazine, flucloronide, fluconazole, ethambutol, ethamivan, ethamsylate, ethanolamine flucrylate, flucytosine, fludalanine, fludarabine oleate, ethaverine, ethchlorVynol, ethenZamide, 45 phosphate, fluda Zonium chloride, flu diazepam, ethazide, ethidium chloride, ethinamate, ethinyl fluidorex, fluidoxopone, fludrocortisone acetate, flufe e Stradiol, ethiofoS, ethionamide, eth Sterone, namic acid, flufenisal, flufosal, flufylline, fluindarol, ethoheptazine, ethomoxane, ethonam, ethopropazine, fluindione, flumazenil, flumecinol, flumedroXone-17 ethoSuximide, ethotoin, ethoxazene, ethoxazorutoside, acetate, flumequine, flumeridone, flumethasone, flu e thoX Zolamide, ethyly be nZ tropine, ethyl 50 methasone pivalate, flumethiazide, flumetramide, biscoumacetate, ethyl carfluZepate, ethyl cartrizoate, flumeXadol, flumeZapine, fluminorex, flumizole, ethyl dibunate, ethyl dirazepate, ethylene diamine, flumoxonide, flunamine, flunarizine, flunidazole, ethylestrenol, ethylhydrocupreine, ethyl loflazepate, flunisolide, flunisolide acetate, flunitrazepan, flunixin, ethylmethylthiambutene, ethylmorphine, 9-ethyl-6- flunoprost, flunoxaprofen, fluocinolone acetonide, mercaptopurine, ethyl nitrite, ethylnorepinephrine, 55 fluocinonide, flourcortin butyrate, fluocortolone, fluo ethylparaben, ethylphenacemide, ethylstibamine, cortolone caproate, fluorescein, fluore Sone, ethynerone, ethynodiol diacetate, ethy picone, fluoroadenosine, 3-fluoroandrostanol, fluorodopane, etibendazole, eticlopride, eticyclidine, etidocaine, fluorohydroxyandrosterone, fluorometholone, fluo etidronic acid, etifelmine, etifenin, etifoxine, rometholone acetate, fluorosalan, 6-fluorotestosterone etilamfetamine, etillefrine, etillefrine pivalate, etintidine, 60 propionate, fluorouracil, 9-fluoroXotestenololactone, etiochlanolone, e tipirium iodide, etiproston, 9-fluoroXotestololace tone, fluotracen, fluoxetine, e tiracetam, etiro Xate, etisazole, etisomicin, fluoxymesterone, fluparoxan, flupentiXol, fluperamide, etisulergine, etizolam, etocarlide, etocrylene, etodolac, fluperlapine, fluperolone acetate, flu phenazine, etodroXZine, etofamide, etofenamate, etofen proX, flu phenazine enanthate, flupimazine, flupirtine, etofibrate, etoformin, etofuradine, etofylline, etoglucid, 65 flupranone, fluprazine, fluprednidene, fluprednisolone, etolore X, etolotifen, etoloxamine, etomidate, fluprednisolone Valerate, flu profen, flu profylline, etomidoline, etomoxir, etonitaZene, etoperidone, flu.proquaZone, fluprostenol, fluguaZone, fluradoline, US 6,331,289 B1 49 SO flurandrenoline, flurantel, flurazepam, flurbiprofen, hexachlorophene, hexacyclonate, hexacy prone, fluretofen, flurithromycin, flurocitabine, flurofamide, hexadiline, hexadimethrine bromide, hexafluorenium flurogestone acetate, flurothyl, fluroxene, flusoxolol, bromide, hexamethonium bromide, hexamidine, fluspiperone, fluspirilene, flutamide, flutazolam, hexapradol, hexaprofen, hexapropymate, heXasonium flutemazepam, flutia Zin, fluticaSone propionate, iodide, heXacarbacholine bromide, hexedine, hexestrol, flutizenol, flutonidine, flutoprazepam, flutroline, heXetidine, heXobarbital, heXobendine, hexocyclium flutropium bromide, fluvoxamine, flu Zinamide, methylsulfate, hexoprenaline, heXopyrronium bromide, flu Zoperine, folescu tol, folic acid, fomidacillin, hexylcaine, he Xylene glycol, he Xylresorcinol, fominoben, fomocaine, fona Zine, fopiirtoline, histamine, his tapyrro dine, homarylamine, forfenimex, formebolone, formetorex, formintrazole, homatropine, homatropine methylbromide, homidium formocortal, formoterol, fosarilate, foSazepam, bromide, homochlorcyclizine, homofena Zine, foScarnet, foscolic acid, foSenazide, fosfocreatine, homoharringtonine, homopipramol, homosalate, fosfomycin, foSfonet, fosfosal, foSinapril, foSmenic homotestosterone propionate, homprenorphine, hopan acid, foSmidomycin, forpirate, fostedil, fostriecin, tenic acid, hoquizil, hycanthone, hydracarbazine, fotemustine, fotreamine, frabuprofen, frentizole, 15 hydrala Zine, hydrarga phen, hydrobentizide, fronepidil, froxiprost, ftaxilide, ftivazide, ftorafur, hydrochlorthiazide, hydrocodone, hydrocortamate, ftormetazine, ftorpropazine, fubrogonium iodide, hydrocortisone, hydrocortisone aceponate, hydrocorti fuchsin, fumagillin, fumoxcillin, fuprazole, furacrinic Sone acetate, hydrocortisone butyrate, hydrocortisone acid, furafylline, furalazine, furaltadone, furaprofen, cypionate, hydrocortisone-phosphate, hydrocortisone fura Zabol, furazolidone, furazolium chloride, Succinate, hydrocort is one Vale rate, furbucillin, furcloprofen, furegrelate, furethidine, hydroflumethiazide, hydromadinone, hydromorphinol, furfenorex, furidarone, furmethoxadone, furobufen, hydromorphone, hydroquinone, hydroxindaSate, furodazole, furofenac, furomazine, furosemide, hydroxindasol, hydroxyoxocobalamin, hydroxy furostilbestrol, furSalan, furSultiamine, furterene, ampheta mine, hydro Xy chloro quine, furtrethonium iodide, fusidic acid, fuZlocillin, 25 hydroxydime thandro Stadie none, hydroxydione gabapentin, gabeXate, gabOXadol, galantamine, gal Succinate, hydroxy methyl and rosta none, lamine triethodide, gallopamil, galosemide, galtifenin, 10-hydroxy no rehisterone, hydroxype thidine, gampexine, gamolenic acid, ganciclovir, ganglefene, hydroxyphen a mate, hydroxy procaine, gapicomine, gapromidine, gefarnate, gemazocine, hydroxyprogeSerone, hydroxyprogesterone caproate, gemcadiol, gemeprost, gemfibrozil, gentamicin, gen hydroxypyridine tart rate, hydroxyStilbamidine, tian Violet, gepefrine, gepirone, geroquinol, gestaclone, 7-hydroxyteStololace tone, hydroxy testosterone ge Stadienol, gestodene, geston.orone caproate, propionate, hydroxytetracaine, hydroxytoluic acid, geStrinone, giparmen, gitaloxin, gitoformate, glafenine, hydroxyu rea, hydroxy Zine, hyme cro mone, glaziovine, gliamilide, glibornuride, glibutimine, hyoscyamine, hypericin, ibacitabine, ibafloxacin, glicaramide, glicetanile, geroquinol, gestaclone, 35 ibazocine, ibopamine, ibrotamide, ibudilast, ibufenac, ge Stadienol, gestodene, geston.orone caproate, ibuprofen, ibuprofen piconol, ibuproxam, ibuterol, gestrinone, giparmen, gitaloxin, gitoformate, glafenine, ibuverine, icaZepam, icosipiramide, icotidine, glaziovine, gliamilide, glibornuride, glibutimine, idarubicin, idaverine, idaZOXan, idebenone, idenast, glicaramide, glicetanile, gliclazide, glicondamide, idoxuridine, idralfidine, idrocilamide, idropranolol, glidaZamide, gliflumide, glimepiride, glipentide, 40 ifenprodil, ifosfamide, ifoxetine, ilmofoSine, iloprost, glipizide, gliquidone, glisamuride, glisindamide, imafen, imanixil, imaZodan, imcarbofoS, imeXon, glisolamide, glisoxepide, gloxazone, gloximonam, imiclopazine, imidazole Salicylate, imidazopyrazole, glu came tacin, glucosamine, glucosulfamide, imidecyl iodine, imidocarb, imidoline, imidu rea, glucosulfone, glucurolactone, glucuronamide, imiloxan, iminophendimide, imipenem, imipramine, glunicate, glutamic acid, glutaral, glutarimide, 45 imipraminoxide, imirestat, imolamine, imoxiterol, glutaurine, glutethimide, glyburide, glybuthiazol, impacarzine, impromidine, improSulfan, imuracetam, gly buzole, glyceryl monoSite a rate, glycidyl inaperisone, indacrinone, indalpine, indanazoline, methacrylate, glycine, glyclopyramide, glybiar.Sol, indanidine, indanorex, indapamide, indatraline, gly copyrrolate, glycyclamide, gly he Xamide, indacainide, indeloxazine, indenolol, indicine-N-oxide, glymidine, glyoctamide, glypinamide, glyprothiazol, 50 indigotindisulfonic acid, indobufen, indocate, indocya glySobuzole, gold thiomalate, gold Sodium thiosulfate, nine green, indolapril, indolidan, indomethacin, granisetron, griseofulvin, guabenXan, guacetisal, indopanolol, indopine, indoprofen, indoramin, guafecainol, guaiactamine, guaiapate, guaietolin, indorenate, indoxole, indriline, inicarone, inocoterone, guaifenesin, guaimeSal, guaisteine, guaithylline, inosine, inoSine dialdehyde, inositol niacinate, guamecycline, guanabenz, guanacline, guanadrel, 55 inproduone, intrazole, intriptyline, iobenzamic acid, guana Zodine, guanazole, guanclofine, guancydine, iobutic acid, iocarmic acid, iocetamic acid, iodamide, guanethidine, guanfacine, guanisoquin, guanoclor, iodecimol, iodetryl, iodipamide, iodixanol, iodoal guanoctine, guanoXabenz, guanoxan, guanoxyfen, phionic acid, iodol, iodophthalein, iodoquinol, had acidin, halazepam, hala Zone, halcinonide, iodothiouracil, iodoxamic acid, ioglicic acid, ioglucol, halethazole, halocortolone, halofantrine, halofenate, 60 ioglucomide, ioglunide, ioglycamic acid, iogulamide, halofuginone, halometasone, halonamine, halopemide, iohexol, iodlidonic acid, iolixanic acid, iomeglamic halopenium chloride, haloperidol, haloperidol acid, iomeprol, iomorinic acid, iopamidol, iopanoic decanoate, haloperidone acetate, haloprogesterone, acid, iopentol, iophendylate, iophenoxic acid, ioproce haloprogin, halothane, haloxazolam, haloxon, mic acid, iopromide, iopronic acid, iopydol, iopydone, halquinols, he daquinium chloride, he pronicate, 65 iosarcol, iosefamic acid, ioSeric acid, ioSimide, heptabarbital, heptaminol, heptaverine, heptolamide, ioSulamide, iOSumetic acid, iotasul, iotetric acid, iotha hepzidine, hetacillin, hetaflur, heteronium bromide, lamic acid, iotranic acid, iotrizoic acid, iotrolan, US 6,331,289 B1 S1 52 iotroXic acid, iOverSol, ioxabrolic acid, iOXaglic acid, lotucaine, lovastatin, loxanast, loxapine, loxiglumide, ioxitalamic acid, ioxotrizoic acid, ioZomic acid, loxoprofen, loXtidine, lo Zilurea, lucanthone, ipexidine, ipodic acid, ipragratine, ipramidil, ipratro lucartamide, lucimycin, lufuradom, lupitidine, pium bromide, iprazochrome, ipriflavone, iprindole, lu prostiol, luxabendazole, ly apolate Sodium, iprocinodine, iproclozide, iprocrolol, iprofenin, lycetamine, lydimycin, lymecycline, lynestrenol, iproheptine, iproniazid, iproidazole, iproplatin, ly Sergide, lysine, mabuterol, maduramicin, mafenide, iprotiaZem, iproxamine, iprozilamine, ipsalazide, mafoprazine, mafosfamide, magnesium citrate, magne ipsapirone, iquindamine, irindalone, irloxacin, sium gluconate, magnesium Salicylate, malathion, irolapride, irsogladine, isamfaZone, isamoltan, malethamer, malic acid, malotilate, manidipine, man isamoxole, isaxonine, isbogrel, isepamicin, isoaminile, ganese gluconate, mannitol, mannitol heXanitrate, iSobromindione, isobucaine, isobutam ben, mannomustine, mannoSulfan, manoZodil, maprotiline, isocarboxazid, isoconazole, isocromil, isoetharine, maridomycin, mariptiline, maroxepin, maytansine, isofe Zolac, isoflupredone acetate, isoflurane, maZaticol, maZindol, maZipredone, mebanazine, isoflurophate, isoleucine, isomazole, isomerol, mebendazole, mebenoside, mebeverine, mebeZonium isometamidium, isomethadone, isometheptene, 15 iodide, mebhydrolin, mebiquine, mebolazine, isomy lamine, isoniazid, isoniXin, isopra Zone, mebrofenin, mebutamate, mebutizide, mecamylamine, isoprednidene, isoprofen, isoprofamide iodide, me carbinate, me c e tronium ethylsulfate, isopropicillin, isopropyl myristate, isopropyl palmitate, mechlorethamine, meciadanol, mecinarone, meclizine, isoproterenol, isosorbide, isosorbide dinitrate, isosor meclocycline, meclocycline Sulfosalicylate, meclofe bide mononitrate, isoSpalglumic acid, isosulfan blue, namic acid, meclofenoxate, meclonazepam, isosulpride, isothipendyl, isotic, isotiquimide, mecloqualone, mecloralurea, meclorisone dibutyrate, isotretinoin, isoxaprolol, isoxe pac, isoxicam, mecloxamine, mecobalamin, mecrylate, mecysteine, iSOX Suprine, is radipine, it anoXone, it a Zigrel, medazepam, medazomide, medetomidine, medibazine, itraconazole, itrocainide, ivermectin bib, ivoqualine, me difoX amine, me dorinone, me dorubicin, josamycin, kalinic acid, kalafungin, kanamycin, 25 me droge Stone, medronic acid, medro Xalol, kebu Zone, keracyanin, ketamine, ketan Serin, medroxyprogestrone, medroxyprogestrone acetate, ketazocine, ketazolam, kethoxal, ketipramine, medrylamine, medrySone, mefeclorazine, mefenamic ketobemidone, ketocaine, ketocainol, ketoconazole, acid, mefenidil, mefenidramium me tilSulfate, ketoprofen, ketorfanol, ketorolac, ketotifen, mefenorex, mefeserpine, mefeXamide, mefloquine, ketotrexate, khellin, khelloSide, kitasamycin, labetalol, me fruside, megalomicin, mege Strol acetate, lacidipine, lactalfate, lactose, lactulose, lamotrigine, meglitinide, megucycline, meglumine, meglutol, lamtidine, lanatoside, lapachol, lapinone, lapyrium meladrazine, melarSonyl, melarSoprol, melengestrol chloride, lasalocid, laudexium methyl Sulfate, lauralko acetate, mele timide, melinamide, melitrace n, nium chloride, laureth, laurixamine, laurocapram, melizame, meloxicam, melperone, melphalan, lauro guadine, laurolinium acetate, lauryl 35 memantine, memotine, menabitan, menadiol, menadiol isoquinolinium, lefetamine, leflunomide, leiopyrrole, diphosphate, menadiol disulfate, menadione, menadi lemidosul, lenampicillin, lenicquinsin, lenperone, one Sodium bisulfite, menate trenone, menbutone, leptacline, lergotrile, letimide, letosteine, leucine, menfegol, menglytate, menitrazepam, menoctone, leucinocaine, leucocianidol, leucovorin,levacecarnine, menogaril, menthol, meobentine, meparfynol, le vall orphan, le Vamfe tamine, le Vami Sole, 40 mepazine, me pen Zolate bromide, me peridine, levdropropiZine, levisoprenaline, levlofexidine, mephene Sin, mephenoxalone, mephen termine, levobunolol, levocabastine, levocarnitine, levodopa, mephenyton, mephobarbital, mepindolol, mepiprazole, levofacetoperane, leVofenfluramine, levofuraltadone, mepiroXol, mepitioStane, mepivacaine, mepixanox, le Voglutamide, le Vomenol, le Vome thadone, me pramidil, me prednisone, me proba mate, le V o meth a dyl acetate, le V o meth orphan, 45 meproscillarin, meproxitol, meprylcaine, meptaZinol, levometiomeprazine, levomopranol, levomoramide, me quido X, meguinol, meguita Zine, me ralein, levonian tradiol, levonor deprin, levonorge Strel, meralluride, merbarone, merbromin, mercaptamine, le vophe nacyl morphan, le Vopropoxyphene, mercaptomerin, mercaptopurine, mercuderamide, mer levopropylcillin, levopropylhexedrine, levoprotiline, cufenol chloride, mercumatilin, mercurobu tol, levorin, levorphanol, levothyroXine, levoxadrol, 50 mergocriptine, merophan, merSalyl, mesabolone, leXofenac, libecillide, liben Zapril, lid amidine, meSalamine, meSeclaZone, meSna, mesocarb.meso lidocaine, lidofenin, lidoflazine, lifibrate, lilopristone, hexestrol, mesoridazine, mesipire none,meStanolone, lima prost, lincomycin, lindane, linsidomine, mesterolone, meStranol,meSudipine, meSulergine, liothyronine, liroldine, lisinopril, lisuride, lithium meSulfamide, meSulfen, meSuprine, metabromsalan, carbonate, lithium citrate, litracen, lividomycin, 55 metacetamol, me taclazepam, metaglycodol, liXaZinone, lobe line, lobendazole, loben Zarit, metaheXamide, metamelfalan, metamfa Zone, lobu profen, locic ort one, lo da X a prine, metamfe pramone, metampicillin, metaniXin, lodace/arlodinixil, lodiperone, lodoxamide, lodoxam metapramine, metaproterenol, metaraminol, metaterol, ide ethyl, lofemizole, lofenda Zam, lofentanil, metaxalone, metaZamide, metazide, metazocine, lofepramine, lofexidine, loflucarban, lombazole, 60 metbufen, meteneprost, metergoline, metergotamine, lomefloxacin, lometraline, lomevactone, lomifylline, metescufylline, metescule tol, metethoheptazine, lomofungin, lomustine, lonapalene, lonaprofen, metformin, methacholine chloride, methacycline, lonazolac, lonidamine, loperamide, loperamide oxide, methadone, methadyl acetate, methallenestril, lopiraZepam, loprazolam, loprodiol, lorajmine, methallibure, methalthiazide, methamphetamine, lorapride, loratadine, lorazepam, lorbamate, lorcainide, 65 methandriol, methandrostenolone, methaniazide, meth lorcinadol, lorglumide, lormetazepam, lortalamine, antheline bromide, methaphenilene, methapyrilene, lorZafone, losindole, loSulazine, lotifazole, lotrifen, methaqualone, metharbital, metha Styridone, US 6,331,289 B1 S3 S4 methazolamide, methdilazine, methenamine, meth monobenzone, monoethanolamine, monometacrine, enolone acetate, methenolone enanthate, metheptazine, monophosphothiamine, monothioglycerol, methestrol, methetoin, methicillin, methimazole, monoxerutin, montirelin, moperone, mopidamol, methiodal Sodium, methioguanine, methiomeprazine, mopidralazine, moprolol, moquizone, morantel, methionine, methisaZone, methitural, methixene, mora Zone, morclofone, morfore X, moricizine, methocarbamol, methohexital, methopholine, morinamide, morniflumate, morocromen, morOXydine, methoserpidine, methotrexate, methotrimeprazine, morpheridine, morphine, morSuximide, motapizone, methoxamine, methoXSalen, methoxyflurane, motrazepam, motretinide, moveltipril, moxadolen, methoxyphe drine, methoxyphen a mine, moxalactam, moxaprindine, moXastine, moxaverine, methoxypromazine, methScopolamine bromide, moxazocine, moxestrol, moxicoumone, moxipraduine, methSuximide, methylclothiazide, N-methyladrealone moxisylyte, moxnidazole, moxonidine, mupirocin, hcl, methyl alcohol, methylatropine nitrate, methylben murabutide, murocainide, muZolimine, mycophenolic acty Zium bromide, methylben Zethonium, acid, my fadol, myralact, myrophine, myrtecaine, methyl chro mone, methyl de S orphine, nabazenil, nabilone, nabitan, naboctate, nabumetone, methyldihydromorphine, methyldopa, methyldopate, 15 nadide, nadolol, nadoxolol, naepaine, nafamoStat, methylene blue, methylphedrine, methylergonovine, nafazatrom, nafcaproic acid, nafcillin, nafenodone, methylformamide, methyl nicotinate, 2-methyl-19 nafenopin, nafetolol, nafimidone, nafiverine, naflocort, nortestosterone, 2-methyl-11-oxoprogestrone, methyl nafomine,nafoxadol, nafoxidine, nafronyl, naftalofoS, palmoxirate, methylparaben, methylphendiate, nafta Zone, naftifine, naftopidil, nafto Xate, methylprednisolone, methylprednisolone aceponate, naftypramide, nalbuphine, nalidixic acid, nalmefene, methylprednisolone acetate, methylprednisolone nalmexone, nalorphine, naltrexone, naminterol, hemisuccinate, methylprednisolone phosphate, methyl namoxyrate, nanaprocin, nandrolone cyclotate, nan prednisolone Suleptanate, methyl Salicylate, methyl drolone decanoate, nandrolone phen propionate, predniSolne S a methyl testo Sterone, nanofin, nant radol, napacitadine, napame Zole, 7-methyl testosterone, 17-methyl testosterone, 25 naphazoline, naphthonone, naprodoxime, naproxen, 7-methylteSosterone propionate, methylthionosine, naproXol, naranol, narasin, natamycin, naxagolide, 16-methylthioprogestone, methylthiouracil, methyno naxaprostene, nealbarbital, nebidrazine, nebivolol, diol diacetate, methyprylon, methySergide, metiamide, nebracetam, nedocromil, nefazodone, neflumozide, metiapine, metiaZinic acid, metibride, meticrane, ne fop a m, n e le Zap rine, n e o ar Sphen a mine, metildigoxin, metindizate, metioprim, metioXate, neocinchophen, neomycin, neostigmine bromide, metipiroX, metipranolol, metiprenaline, metitepine, nequinate, neraminol, nerbacadol, neSapidil, metizoline, metkephamid, metochalcone, metocinium nesosteine, netilmicin, netobimin, neutramycin, iodide, metoclopramide, me to curine iodide, neXeridine, niacin, niacinamide, nialamide, niaprazine, metofenazate, metogest, metolaZone, metomidate, nibroxane, nicafenine, nicainoprol, nicametate, metopimazine, metopon, metoprine, metoprolol, 35 nicarbazin, nicarpidine, nicergoline, niceritrol, metoquizine, metoSerpate, metoStilenol, metoxepin, nice verine, niclofolan, niclosamide, nicoboxil, me trafa Zoline, metralindole, me tra Zifone, nicoclonate, nicocodine, nicocortonide, nicodicodine, metrenperone, metribolone, metrifonate, metrifudil, nicofibrate, nicofuranose, nicofurate, nicogrelate, metrizamide, metrizoic acid, metronidazole, nicomol, nicomorphine, nicopholine, nicorandil, meturedepa, mety rapone, metyridine, metyrosine, 40 nicothiazone, nicotinyl alcohol, nicOXamat, nictiazem, mevastatin, meXafylline, mexazolam, meXenone, nictindole, nodroxy Zone, nifedipine, nife nalol, mexiletine, mexiprostil, mexoprofen, meXrenoate, nifenaZone, niflumic acid, nifluridide, nifuradene, meZacopride, meZepine, meZilamine, meZlocillin, nifuraldeZone, nifuralide, nifuratel, nifuratrone, mianserin, mibolerone, micinicate, miconazole, nifurdazil, nifurethaZone, nifurfoline, nifurimide, micronomicin, midaflur, midaglizole, midalcipran, 45 nifurizone, nifurmazole, nifurmerone, nifuroquine, midamaline, midazogrel, midazolam, midecamycin, nifuroxazide, nifuroxime, nifurpipone, nifurpirinol, midodrine, mifentidine, mifepristone, mifobate, nifurprazine, nifurcquinazole, nifursemizone, nifurSol, miglitol, mikamycin, millacemide, milenperone, nifurthiazole, nifurtimox, nifurtoinol, nifurVidine, millipertine, miloxacin, milrinone, milverine, mimbane, nifurzide, niguldipine, nihydraZone, nikethamide, minaprine, minaXolone, mindolilol, mindoperone, 50 nile prost, nilprazole, nilu dipline, nilutamide, minepentate, minocromil, minocycline, minoxidil, nilvadipine, nimaZone, nimeSulide, nimetazepam, mioflazine, mipimazole, mirincamycin, miristalkonium nimidane, nimodipine, nimorazole, nimustine, chloride, miroprofen, mirosamicin, misonidazole, niometacin, niperotidine, nipradillol, niprofaZone, misoprostol, mitindomide, mitobronitol, mitoclomine, niridazole, nisbuterol, nisobamate, nisoldipine, mitoguaZone, mitolactol, mitomycin, mitonafide, 55 nisoxetine, nisterime acetate, nitarSone, nitaZOXanide, mitopodozide, mitoquidone, mitotane, mitotenamine, nithiamide, nitracrine, nitrafudam, nitralamine, mitoxantrone, mitoZolomide, mivacurium chloride, nitramisole, nitraduaZone, nitrazepam, nitrefazole, mixidine, misoprostol, mitindomide, mitobronitol, nitrendipine, nitricholine, nitrochlofene, nitrocycline, mitoclomine, mitoguaZone, mitolactol, mitomycin, nitrodan, nitrofurantoin, nitrofuraZone, nitroglycerin, mitonafide, mitopodozide, mitoquidone, mitotane, 60 nitromerSol, nitromide, nitromifene, nitroScanate, mitotenamine, mitoxantrone, mitozolomide, mivacu nitroSulfathiazole, nitroXinil, nitroxoline, nivaZol, rium chloride, mixidine, mizoribine, mobe carb, nivimeldone, nixylic acid, nizatidine, nizofenone, moben Zoxamine, mocimycin, mo cipra Zine, noberastine, nocloprost, nocodazole, nofecainide, moclobemide, moctamide, modafinil, modaline, nogalamycin, nolinium bromide, nome gestrol, mofebutaZone, mofloverine, mofoXime, molfarnate, 65 nomelidine, nomifensine, nonabine, nonaperone, molinaZone, molindone, molracetam, molsidomine, nonapyrimine, nono Xynol-4, nono Xynol-9, mometasone furoate, monalazone disodium, monensin, no racy methadol, norbolethone, norbu drine, US 6,331,289 B1 SS S6 norcloStebol, norcodeine, nordazepam, norde frin, parSalmide, partricin, parvaquone, pasiniaZid, nordinone, norepinephrine, nore thandrolone, paulomycin, paxamate, paZelliptine, paZOxide, pcnu, norethindrone, norethindrone acetate, norethynodrel, pecilocin, pecocycline, pefloxacin, pelanSerin, pelretin, noreximide, norfenefrine, norfloxacin, norfloxacin pelrinone, pemedolac, pemerid, pemoline, pempidine, Succinil, norflurane, norgesterone, norgestimate, penamecillin, penbutolol, pendecamaine, penfluridol, norgestomet, norgestrel, norgestrienone, norletimol, penflutizide, pengitoxin, penicillamine, penicillin norlevorphanol, normethadone, normethandrone, procaine, penicillin, penimepicycline, penimocycline, normorphine, norpipanone, nortestosterone propionate, penirolol, penmesterol, penoctonium bromide, nortetrazepam, nortriptyline, norvinisterone, noSantine, penprostene, pentabamate, pentacynium chloride, pen noscapine, noSiheptide, novobiocin, noxiptiline, taerythritol tetranitrate, pentafluranol, pentagastrin, noXytiolin, nuclomedone, nuclotixine, nulfenoXole, pentagestrone, pentalamide, pentamethonium bromide, nuVenzepine, nylestriol, nylidrin, nyStatin, obidoxime, pentamethylmelamine, pentamidine, pentamoxane, ocilitide, ocrylate, octabenzone, octacaine, octafonium pent amu Stine, pentapipe ride, pentapipe rium chloride, octamoxin, octamylamine, octanoic acid, methylsulfate, pentaquine, pentazocine, pentetate cal octapinol, octastine, octaverine, octaZamide, 15 cium triSodium, pentetic acid, penthienate bromide, octenidine, octenidine Saccharin, Octicizer, Octimibate, penthrichloral, pentiapine maleate, pentifylline, octorylene, octodrine, octopamine, octotiamine, pentigetide, pentisomicin, pentisomide, pentizidone, Octoxynol-9, octriptyline, octriZole, ofloxacin, pentobarbital, pentolinium tartrate, pentomone, ofornine, oftasceine, Olaflur, olaquindox, oleanomycin, pentopril, pentorex, pentosan polysulfate Sodium, oletimol, oleyl alcohol, olivomycin a, Olmidine, pen to Statin, pentoxifylline, p entrinitrol, olpimedone, olSalazine, oltipraz, olvanil, omeprazole, pentylenetrazole, peplomycin, pepstatin, peraclopone, omidoline, omoconazole, omonasteine, onapristone, peradoxime, perafensine, peralopride, peraquinsin, Ondansetron, on tianil, opiniazide, opipramol, perastine, peratizole, perbufylline, perfluamine, ora Zamide, orbutopril, orconazole, orestrate, perflunafene, pergolide, perhexilene, periciazine, ormetoprim, ornidazole, ornipressin, ornithine, 25 perimetazine, perindopril,perindoprilat, perisoxal, ornoprostil, orotic acid, orotirelin, orpanoxin, perlapine, permethrin, perphenazine, persilic acid, orphenadrine, Ortetamine, OSalmid, OSmadizone, otilo petrichloral, peXantel, phanquone, phenacaine, nium bromide, otimerate Sodium, Ouabain, OXabolone phenacemide, phenacetin, phenact tropinium chloride, cipionate, OXabre Xine, oxace prol, oxacillin, phenadoxone, phenaglycodol, phe nama Zoline, oXadimedine, Oxaflozane, Oxaflumazine, OXagrelate, phenampromide, phenarSone Sulfoxylate, phenazocine, oxalinast, oxaliplatin, oXamarin, oxametacin, phenaZopyridine, phencarbamide, phencyclidine, oxamisole, oxamniquine, Oxanamide, Oxandrolone, phendimetrazine, phenelZine, pheneridine, phenesterin, OXantel, Oxapadol, Oxapium iodide, Oxapropanium pe nethicillin, phenformin, phen glutarimide, iodide, Oxaprotiline, Oxaprozin, oxarbazole, Oxatomide, phenicarbazide, phenindamine, phenindione, OXa Zafone, oxazepam, OXaZidione, oxazolam, 35 phe nipra Zine, pheniramine, pheniso none, oxazorone, Oxcarbazepine, oxdralazine, OXeladin, phen metrazine, phenobarbital, phenobutiodil, Oxendolone, OXepinac, oxetacillin, oxethazaine, phenolph tale in, phenol Sulfon phthale in, OXetorone, Oxfendazole, Oxfenicine, OXibendazole, phenomorphan, phenoperidine, phenothiazine, OXibetaine, oxiconazole, oxidopamine, oxidronic acid, phenothrin, phenoxybenzamine, phenoxypropazine, oxifentorex, oxifungin, OXilorphan, oximonam, 40 phenprobamate, phenprocoumon, phenpromethamine, OXindanac, OXiniacic acid, OXiperomide, OXiracetam, phen Su Ximide, phen termine, phen to lamine, oxiramide, oxisopred, OXisuran, OXitefonium bromide, phenylala nine, phenyl a mino Salicy late, oxitriptan, oxitriptyline, OXitropium bromide, phenylbutaZone, phenylrphrine, phenylethyl alcohol, OXmetidine, Oxodipine, Oxogestone phenpropionate, phenylmercuric acetate, phenylmercuric borate, phe OXolamine, OXolinic acid, oxomemazine, OXonazine, 45 nylmercuric chloride, phenylmercuric nitrate, phenyl OXOphenarsine, Oxoprostol, oxpheneridine, Oxprenoate methylbarbituric acid, phenylpropanolamine, potassium, Oxprenolol, OXtriphylline, oxybenzone, phenylthilone, phenyltoloxamine, phenyramidol, oxybutynin, oxychlorosene, oxycin chophen, phenytoin, phetharbital, pholcodine, pholedrine, phos Oxyclozanide, oxycodone, Oxydipentonium chloride, phoramide mustard, phoXim, phthalofyne, oxy fedrine, oxy me Sterone, oxy metazoline, 50 phthaly Sulfacetamide, phthalylsulfame thizole, oxymetholone, Oxymorphone, oxypendyl, oxypertine, phthalylsulfathiazole, phySoStigmine, phytic acid, phy oxyphen but a Zone, oxyphenonium bromide, to nadiol diphosphate, phytonadione, pibe carb, Oxypurinol, oxypyrronium bromide, oxyquinoline, piben Zimol, pibe carb, piben Zimol, piberaline, oxyridazine, oxy Sonium iodide, oxytetracycline, picafibrate, picartamide, pice nadol, picilorex, Oxytiocin, OZagrel, Ozolinone, pacrinolol, pactamycin, 55 piclonidine, piclopastine, picloxydine, picobenzide, padimate, pafenolol, palatrigine, paldimycin, picodralazine, picolamine, piconol, picoperine, palmidrol, palmoxiric acid, pamabrom, pamaquine, picoprazole, picotamide, picotrin diolamine, picumast, pamatolol, pamidronic acid, pancuronium bromide, pidolic acid, pifarnine, pilfenate, pifeXole, piflutiXole, panidazole, panomifene, patenicate, panthenol, pan pifoXime, piketoprofen, pildralazine, pilocarpine, tothenic acid, panuramine, papaverine, papaveroline, 60 pimoclone, pimefylline, pimelautde, pimetacin, parachlorophenol, paraflutizide, paraldehyde, pimethixene, pimetine, pimetremide, piminodine, paramethadione, paramethasone acetate, paranyline, pimobendan, pimondiazole, pimozide, pinacidil, parapenzolate bromide, parapropamol, pararosaniline, pinadoline, pinafide, pinaverium bromide, pinazepam, pararosaniline embonate, paraXaZone, parbendazole, pincainide, pindolol, pin olcaine, pino Xepin, parconazole, pareptide, parethoxycaine, pargeverine, 65 pioglitaZone, pipacycline, pipamazine, pipaperone, pargolol, pargy line, paridocaine, parodilol, pipazethate, pipebuZone, pipecuronium bromide, pipe paro momycin, paroxetine, paroxypropione, midic acid, pipenZolate bromide, pipequaline, US 6,331,289 B1 57 58 piperacetazine, piperacillin, piperamide, piperazine, pyromazine bromide, produaZone, produinolate, pro piperazinedione, piperidolate, piperilate, piperocaine, renoate potassium, proroXan, proscillaridin, pros piperoxan, piperylone, pipobroman, pipoctanone, pidium chloride, prostalene, proSulpride, pipofeZine, pipo Sulfan, pipotia Zine palmiate, proSultiamine, proterguride, pro the obromine, pipOXizine, pipoxolan, pipradimadol, pipradol, prothipendyl, prothixene, protiofate, protionamide, pipramadol, pipratecol, piprinhydrinate, piprocurarium protirelin, protizinic acid, protokylol, protoveratine, iodide, piprofurol, piprozolin, piquindone, piquizil, protriptyline, proxazole, proxibarbal, proxibutene, piracetam, pirandamine, pirarubicin, piraxelate, proXicromil, proxifeZone, proXorphan, proxyphylline, piraZmonam, piraZolac, pirbenicillin, pirbuterol, pirdo prozapine, pseudoephedrine, psilocybine, pumiteba, nium bromide, pirenoXine, piremperone, pirenzepine, puromycin, pyrabrom, pyran copolymer, pyrantel, pirepolol, piretanide, pirfenidone, piribedil, piridicillin, pyrathiazine, pyrazinamide, pyrazofurin, pyricarbate, piridocaine, piridoxilate, piridironic acid, pirifibrate, pyridarone, pyridofylline, pyridostigmine bromide, pirindazole, piriniXic acid, piriniXil, piriprost, pyridoxine, pyrilamine, pyrimethamine, pyrimitate, piriqualone, piriSudanol, piritramide, piritrexim, pyrinoline, pyrithione Zinc, pyrithyldione, pyritidium pirlimycin, pirlindole, pirmagrel, pirmenol, pirnabine, 15 bromide, pyritinol, pyronine, pyrophenindane, piroctone, pirogliride, piroheptine, pirolate, pyrovalerone, pyroxamine, pyrrobutamine, pyrrocaine, pirolaZamide, piromidic acid, piro Xantrone hcl, pyrroliphene, pyrrolnitrin, pyrvinium chloride, piroXicam, piroXicam cinnamate, piroXicillin, pytamine, quadazocine, quadrosilan, quatacaine, piroXimone, pirozadil, pirprofen, pirquinozol, pirralko quaZepam, quaZinone, quaZodine, quaZolast, nium bromide, pirtenidine, pitenodil, pitofenone, quifenadine, quillifoline, quinacainol, quinacillin, pituxate, pivampicillin, piv enfrine, pivopril, quinacrine, quinaldine blue, quinapril, quinaprilat, pivoxazepam, pizotyline, plafibride, plaunotol, quinaZosin, quinbolone, quincarbate, quindecamine, pleuromulin, plicamycin, podilfen, podophylloxoxin, quindonium bromide, quindoXin, quineStradol, poldine methylsulfate, polidocanol, ploymyxin, quinestrol, quinethaZone, quinetolate, quineZamide, polythiazide, ponalrestat, ponfibrate, porfiromycin, 25 quinfamide, quingestanol acetate, quingestrone, poskine, potassium guaiacolsulfonate, potassium quindine, quinine, quinocide, quinpirole, quinterenol, nitrazepate, potassium Sodium tartrate, potassium quintiofoS, quinuclium bromide, quinupramine, Sorbate, potassium thiocyanate, practolol, prajmalium, quipazine, quisultazine, race femine, racemethionine, pralidoxime chloride, pramipexole, pramiracetam, race methorphan, race me tiro Sine, raclopride, pramiverine, pramoXime, prampine, pranolium ractopamine, rafoxanide, ralitoline, raloxifene, chloride, prano profen, prano Sal, prasterone, ramciclane, ramefenaZone, ramipril, ramiprilat, pravastatin, praXadine, praZepam, praZepine, ramixotidine, ramnodignin, ranimustine, ranimycin, praZiquantel, praZitone, praZOcillin, praZoSin, ranitidine, ranola Zine, rathyronine, raZinodil, preclamol, prednazate, prednazoline, prednicarbate, raZoba Zam, raZoxane, reboxetine, recainam, prednimustine, prednisolamate, prednisolone, pred 35 reclazepam, relomycin, remoxipride, renanolone, nisolone acetate, prednisolone hemisuccinate, pred rentiapril, repirinast, repromicin, reproterol, recimetol, nisolone phosphate, prednisolone Steaglate, predniso rescinnamine, reserpine, resorantel, resorcinol, resorci lone tebutate, prednisone, prednival, prednylidene, nol monoacetate, retelliptine, retinol, revenast, prefenamate, pregnenolone, pregnenolone Succinate, ribavirin, riboflavin, riboflavin 5'-phosphate, riboprine, premazepam, prenalterol, prenisteine, prenoverine, 40 ribostamycin, ridazolol, ridiflone, rifabutin, rifamide, prenoXdiazine, prenylamine, pretamazium iodide, rifampin, rifamycin, rifapentine, rifaximin, rilapine, pretiadil, pribecaine, pridefine, prideperone, pridinol, rilma Zafone, rillmenidine, rilopiroX, rilo Zarone, prifelone, pri?inium bromide, prifuroline, prilocaine, rimantadine, rimaZolium metilsulfate, rimcazole, primaperone, primaquine, primidolol, primidone, rimeXolone, rimiterol, rimoprogin, riodipine, rioprostil, primycin, prinomide, pristinamycin, prizidilol, 45 ripazepam, risocaine, risperidone, ristianol, ristocetin, proadifen, probarbital, probenecid, probicromil, ritanserin, ritiometan, ritodrine, ritropirronium probucol, procainamide, procaine, procarbazine, bromide, ritroSulfan, robenidine, rocastine, rociverine, procaterol, prochlorperazine, procinolol, procinonide, rodocaine, rodorubicin, rofelodine, roflurante, proclonol, procodazole, procyclidine, procymate, pro rokitamycin, roletamide, rolgamidine, rolicyclidine, deconium bromide, prodilidine, prodipine, prodolic 50 rolicyprine, rollipram, rollitetracycline, rolodine, acid, profadol, profeXalone, proflavine, proflazepam, rolziracetam, romifenone, romifidine, ronactolol, progabide, progesterone, proglumetacin, proglumide, ronidazole, ronifibrate, ronipamil, ronnel, ropitoin, proheptazine, proligestone, proline, prolintane, prolo ropivacaine, ropiZine, roquinime X, rosaprostol, nium iodide, promazine, promegestone, promestriene, rosaramicin, rosaramicin butyrate, rosaramicin promethazine, promolate, promoxolane, pronetalol, 55 propionate, roSoxacin, rosterolone, rotamicillin, propacetamol, propafenone, propamidine, propanidid, rotoxamine, rotraxate, roXarSone, roXatidine acetate, propanocaine, propantheline bromide, proparacaine, roxibolone, roXindole, roXithromycin, roXolonium propatyl nitrate, propazolamide, propendiazole, metilsulfate, roXoperone, rufloxacin, rutamycin, rutin, prope into fylline, propen Zolate, prope ridine, ruvaZone, Sabeluzole, Saccharin, Salacetamide, propetamide, propetandrol, propicillin, propikacin, 60 Salafibrate, Salantel, Salazodine, SalazOSSulfadimedine, propine tidine, propiolactone, propioma Zine, SalazoSulfamide, SalazoSulfathiazole, Salethamide, propipocaine, propiram, propisergide, propiverine, Salfluverine, Salicin, Salicyl alcohol, Salicylamide, propizepine, propofol, propoxate, propoxycaine, Salicylanilide, Salicylic acid, Salinazid, Salinomycin, propoxyphene, propranolol, propyl docetrizoate, pro Salmefanol, Salmeterol, Salmisteine, SalprotoSide, pylene glycol, propylene glycol monoStearate, propyl 65 Salsalate, Salverine, Sancy cline, Sangivamycin, gallate, propylhexedrine, propyliodone, propylparaben, Saperconazole, Sarcolysin, Sarmazenil, Sarmoxicillin, propylthiouracil, propyperone, propyphenaZone, pro Sarpicillin, Saterinone, Satranidazole, Savoxepin, Scarlet US 6,331,289 B1 59 60 red, Scopafungin, Scopolamine, SeclaZone, Secnidazole, Sulisatin, Sulisoben Zone, Sulmarin, Sulmazole, Secobarbital, Secoverine, Securinine, Sedecamycin, Sulmepride, Sulinidazole, Sulocarbilate, Suloctidil, Seganserin, Seglitide, Selegiline, Selenium Sulfide, Sulosemide, Sulotroban, Suloxifen, Sulpiride, Sulprosal, Selprazine, Sematilide, Semustine, SepaZonium Sulprostone, Sultamicillin, Sulthiame, Sultopride, Sulto chloride, Sepe ridol, Sequifenadine, Serfibrate, Silic acid, Sultroponium, Sulverapride, Sumacetamol, Sergole Xole, Serine, Serme tacin, Serotonin, Sumatriptan, Sumetizide, Sunagrel, Suncillin, Sertaconazole, Sertraline, Setastine, SetaZindol, Supidimide, Suproclone, Suprofen, Suramin, Suricainide, Setiptiline, Setoperone, Sevitropium me Silate, Suriclone, Suxe merid, Suxe thonium chloride, sevoflurane, Sevopramide, Siagoside, Sibu tramine, SuXibu Zone, Symclosene, Syme tine, Synephrine, Siccanin, Silandrone, Silibinin, Silicristin, Silidianin, Sil Syrisingopine, taclamine, tacrine, taglutimide, ver Sulfadiazine, Simetride, Simfibrate, SimtraZene, talampicillin, tallastine, talbutal, taleranol, talinolol, Simvastatin, Sine fungin, Sintropium bromide, talipexole, tallisomycin, talmetacin, talmetoprim, Sisomicin, Sitalidone, Sitofibrate, SitogluSide, Sodium talniflumate, tallopram, talo Salate, taloXimine, benzoate, Sodium dibunate, Sodium ethasulfate, Sodium talSupram, taltrimide, tameridone, tameticillin, formaldehyde Sulfoxylate, Sodium gentisate, Sodium 15 tametraline, tamitinol, tamoxipen, tampramine, gualenate, Sodium nitrite, Sodium nitroprusSide, tandamine, taprostene, tartaric acid, tasuldine, tauro Sodium oxybate, Sodium phenylacetate, Sodium cholic acid, taurolidine, tauromustine, tauroSelcholic picofoSfate, Sodium picOSulfate, Sodium propionate, acid, taurultam, taxol, taZadolene, taZanolast, Sodium Stibocaptate, Sodium Stibogluconate, Sodium tazaburate, taZeprofen, tazifylline, taZiprinone, tazolol, tetradecyl Sulfate, Sodium thiosulfate, Sofalcone, tebatizole, tebuduine, teclothiazide, teclozan, tedisamil, Solasulfone, Solpecainol, Solypertine, Somantadine, tefazoline, tefenperate, tefludazine, teflurane, teflutiXol, Sopitazine, Sopromidine, Soquinolol, Sorbic acid, tegafur, telen Zepine, te mafloxacin, temaroteine, Sorbinicate, Sorbinil, Sorbitan monolaurate, Sorbitan temazepam, temefoS, temelastine, temocillin, temodox, monooleate, Sorbitan monopalmitate, Sorbitan temozolomide, temurtide, tenamfetamine, tenilapine, monoStearate, Sorbitan trioleate, Sorbitan tristearate, 25 teniloxazine, tenilsetam, teniposide, tenocyclidine, Sorbitol, Sorndipine, Sotalol, Soterenol, Spaglumic acid, tenonitrozole, tenoxicam, tenylidone, teopranitol, Sparfosic acid, SparSomycin, Sparteine, Spectinomycin, teoprolol, tepirindole, tepoxalin, teraZosin, terbinafine, Spiclamine, Spiclomazine, Spiperone, Spiradoline, terbucromil, terbufibrol, terbuficin, terbuprol, Spiramide, Spiramycin, Spirapril, Spiraprilat, terbutaline, terciprazine, terconazole, terfenadine, Spirendolol, Spirgetine, Spirilene, Spirofylline, terfluranol, terguride, terizidone, ternidazole, Spirogermanium, Spiromustine, Spironolactone, terodiline, terofenamate, teroxalene, teroxirone, terpin Spiroplatin, Spirorenone, Spirotriazine, SpiroXasone, hydrate, tertatolol, teSicam, tesimide, testolactone, SpiroXatrine, SpiroXepin, Spizofurone, Stallimycin, testosterone, testosterone cypionate, testosterone Stanolone, Stanzolol, Stearic acid, Stearyl alcohol, enanthate, testosterone ketolaurate, testosterone Stearylsulfamide, Steffimycin, Stenbolone acetate, 35 phenylacetate, testosterone propionate, tetrabarbital, Stepronin, Stercuronium iodide, Stevaladil, Stibamine tetrabenazine, tetracaine, tetrachloroethylene, glucoside, Stibophen, Stilbamidine, Stilbazium iodide, tetracycline, tetradonium bromide, tetraethylammo Stilonium iodide, Stirimazole, Stiripentol, Stirocainide, nium chloride, tetrahydro Zoline, tetramethrin, Stirifos, Streptomycin, StreptonicOZid, Streptonigrin, tetramisole, tetrandrine, tetrantoin, tetrazepam, Streptovarycin, Streptozocin, Strinoline, Strychnine, 40 tetriprofen, tetronasin 5930, tetroquinone, tetroXoprim, Styramate, Subathizone, Subendazole, Succimer, Succi tetrydamine, texacromil, thalicarpine, thalidomide, nylcholine chloride, Succinylsulfathiazole, thebacon, thebaine, thenalidine, thenium closylate, Succisulfone, Suclofenide, Sucralfate, Sucrose the nyldia mine, the obromine, the Odrenaline, octaacetate, Sude Xanox, Sudoxicam, Sufentanil, the ofibrate, the ophylline, thia benda Zole, Sufosfamide, Sufotidine, Sulazepam, Sulbactam, Sulbac 45 thiacetarSamide, thialbarbital, thiambutosine, thiamine, tam pivoxil, Sulbenicillin, Sulbenox, Sulbentine, thiamiprine, thiamphenicol, thiamylal, thiaZeSim, thi Sulbutiamine, Sulclamide, Sulconazole, Sulfabenz, aZinamium chloride, thiazolsulfone, thiethyperazine, Sulfaben Zamide, Sulfacarbamide, Sulface cole, thihexinol methylbromide, thimerfonate, thimerosal, Sulfacetamide, Sulfachlorpyridazine, Sulfachrysoidine, thiocarbanidin, thiocarzolamide, thiocolchioside, Sulfaclomide, Sulfaclorazole, Sulfaclozine, Sulfacytine, 50 thiofuradene, thioguanine, thioguanine alpha Sulfadiazine, Sulfadicramide, Sulfadimethoxine, deoxyriboside, thioguanine beta-deoxyriboside, Sulfado Xine, Sulfaethidole, Sulfaguandide, thioguanosine, thiohexamide, thioinosine, thiopental, Sulfaguanole, Sulfalene.Sulfaloxic acid, SulfamaZone, thiopropazate, thioproperazine, thioridazine, thiosalan, Sulfamera Zine, Sulfameter, Sulfame thaZine, thiotepa, thiotetrabarbital, thiothixene, thiouracil, Sulf a methi Zole, Sulf a methoxazole, 55 thiphenamil, thiphencillin, thiram, thonzonium Sulfamethoxypyridazine, Sulfamethoxypyridazine bromide, thon Zylamine, thoZalinone, threonine, acetyl, Sulfame to midine, Sulfame t role, thymidine, thymol, thymol iodide, thymopentin, Sulfamonomethoxine, Sulfamoxole, Sulfanil amide, thyromedan, thyropropic acid, tiacrilast, tiadenol, Sulfanitran, Sulfaperin,Sulfaphenazole, Sulfaproxyline, tiafibrate, tiamenidine, tiametonium iodide, tiamulin, Sulfapyridine, Sulfaquinoxaline, SulfarSphenamine, 60 tianafac, tianeptine, tiapamil, tiapirinol, tiapride, SulfaSalazine, SulfaSomizole, SulfaSuccinamide, tiaprofenic acid, tiaprost, tiaramide, tiazofurin, tiaZuril, Sulfasy mazine, Sulfathiazole, Sulfathiou rea, tibalosin, tibenalast Sodium, tibenzate, tibeZonium Sulfatolamide, Sulfatroxazole, Sulfatrozole, Sulfazamet, iodide, tibolone, tibric acid, tibrofan, tic-mustard, tica Sulfinalol, Sulfinpyrazone, Sulfiram, SulfiSomidine, besone propionate, ticarbodine, ticarcillin, ticarcillin Sulfisoxazole, Sulfisoxazole, Sulfobromophthalein, 65 creSyl, ticlatone, ticlopidine, ticrynafen, tidiacic, Sulfonethylmethane, Sulfonmethane, Sulfonterol, tie moium iodide, tie nocarbine, tienopramine, Sulforidazine, Sulfoxone Sodium, Sullicrinat, Sulindac, tienoXolol, tifemoxone, tiflamizole, tiflorex, tifluadom, US 6,331,289 B1 61 62 tiflucarbine, tiformin, tifurac, tigemonam, tigestol, trimoxamine, trioxifene, trioxSalen, tripamide, tigloidine, tilbroquinol, tiletamine, tilidine, tiliquinol, trip a ranol, trip elen namine, trip otassium tilisolol, tilmicosin, tilomisole, tillorone, tilozepine, dicitratobismuthate, trip rollidine, tritio Zine, tilSuprost, timefurone, timegadine, timelotem, time tritoqualine, trityl cysteine, trixolane, trizoxime, pidium bromide, timiperone, timobesone acetate, trocimine, troclosene potassium, trofosfamide, timofibrate, timolol, timonacic, timoprazole, tinabinol, trole and omycin, trol nitrate, tromanta dine, tinazoline, tinidazole, tinisulpride, tinofedrine, tromethamine, tropabazate, tropanserin, tropapride, tinoridine, tio carlide, tio clomarol, tioconazole, tropatepine, tropenZiline bromide, tropicamide, tioctilate, tiodaZosin, tiodonium chloride, tiomergine, tropigline, tropiprine, tropodifene, trospectomycin, tro tiomesterone, tioperidone, tiopinac, tiopronin, Spium chloride, troXerutin, troXipide, troXolamide, tiopropamine, tioSpirone, tiotidine, tioxacin, tioXamast, troxonium tosilate, troxypyrrolium tosilate, troxypyr tioxaprofen, tioxidazole, tioXolone, tipentosin, rolium tosilate, truXicurium iodide, truXipicurium tipepidine, tipetropium bromide, tipindole, tipredane, iodide, tryparsamide, tryptophan, tryptophane mustard, tiprenolol, tiprinast, tipropidil, tiproStanide, tiprotimod, tuaminoheptane, tubercidine, tubocurarine chloride, tiquinamide, tiquizium bromide, tiratricol, tiropramide, 15 tubulo Zole, tu clazepam, tulobutrol, tu Vatidine, tisocromide, tisopurine, tisoquone, tivandizole, tiXadil, tybamate, tylocrebin, tylosin, tyramine, tyropanic acid, tiXanox, tiXocortol pivalate, tiZabrin, tianidine, tyrosine, ubenimex, ubide care none, ubisindine, tizolemide, tizoprolic acid, tobramycin, tobuterol, ufenamate, ufiprazole, uldazepam, ulobetasol, unde tocainide, tocamphyl, tocofenoxate, to cofibrate, coylium chloride, undecyclenic acid, uracil mustard, tocopherSolan, todralazine, tofenacin, tofetridine, urapidil, urea, uredepa, uredofoS, urefibrate, urethane, tofisoline, tofisopam, tolamolol, tolaZamide, tolazoline, uridine, urSodeoxycholic acid, urSucholic acid, tolboxane, tolbutamide, tolciclate, toldimfos, Vadocaine, Valconazole, Valdetamide, Valdipromide, tolfamide, tolfenamic acid, tolgabide, tolimidone, Valine, Valnoctamide, Valofane, Valperinol, Valproate tolindate, toliodium chloride, toliprolol, tolmeSoxide, pivoxil, Valproic acid, Valpromide, Valtrate, Vancomy tolmetin, tolnaftate, tolnapersine, tolnidamine, toloco 25 c in h cl, Vane prim, Vanillin, Vanitolide, nium metilsulfate, tolonidine, tolonium chloride, Vanyldisulfamide, Vapi.prost, Vecuronium bromide, Vel toloxatone, toloxychlorinol, tolpadol, tolpentamide, nacrine maleate, Venlafaxine, Veradoline, Veralipride, tolperisone, toliprazole, tolpronine, tolpropamine, Verapamil, Vera Zide, Verilopam, Verofylline, tolpyrramide, tolduin Zole, tolrestat, toltraZuril, Vesnarinone, Vetrabutine, Vidarabine, Vidarabine tolu fazepam, tolycaine, tomelukast, tomoglumide, phophate, vigabatrin, Viloxazine, Viminol, Vinbarbital, tomoxetine, tomoxiprole, tonazocine, topiramate, Vinblastine, Vinburnine, Vincamine, Vincanol, toprilidine, tonazocine, topiramate, toprilidine, Vincan tril, VincofoS, Vinconate, Vincristine, topterone, to quizine, tora Semide, toeb afylline, vindrburnol, Vindesine, Vindepidine, Vinformide, toremifene, toSifen, toSufloxacin, toSulur, toyocamycin, Vinglycinate, Vinorelbine, Vinpocetine, Vinpoline, toyomycin, trabo Xepine, traca Zolate, tralonide, 35 Vinrosidine, Vintiamol, Vintriptol, Vinylbital, Vinylether, tramadol, tramaZoline, trandolapril, tranexamic acid, Vinzolidine, Viomycin, Viprostol, Viqualine, Vicquidil, tranilast, transcainide, trantellinium bromide, Virginiamycin factors, ViroXime, Visnadine, tranylcypromine, trapencaine, trapidil, traXanox, Visnafylline, Vitamin e, volazocine, warfarin, trazilitine, traZium esilate, traZOdone, traZolopride, Xamoterol, Xanoxic acid, Xanthinol niacinate, Xanthiol, treben Zomine, trecadrine, treloxinate, trenbolone 40 Xantifibrate, Xantocillin, Xenalipin, Xenazoic acid, acetate, trengestone, trenizine, troSulfan, trepibutone, Xenbucin, Xenipentone, Xenthiorate, Xenygloxal, Xeny trepipam, trepirium iodide, treptilamine, trequensin, heXenic acid, Xeny tropium bromide, Xibenolol, trestolone acetate, trethinium tosilate, trethocanoic Xibornol, Xilobam, Ximoprofen, Xinidamine, acid, tretinoin, tretoquinol, triacetin, triafungin, Xino miline, Xipamide, Xipranolol, Xorphanol, triamcinolone, triamcinolone acetonide, triamcinolone 45 Xylamidine, Xylazine, Xylocoumarol, Xylometazoline, acetonide-phosphate, triamcinolone benetonide, triam Xyloxemine, yohimbic acid, Zabicipril, Zacopride, cinolone diacetate, triamcinolone furetonide, triamci Zafuleptine, Zaltidine, Zapizolam, Zaprinast, no lone hexacetonide, triampy Zine, triamterene, Zardaverine, Zenazocine meSylate, Zepastine, Zeranol, tria Zinate, triaziquone, triazolam, tribendilol, Zetidoline, Zidapamide, Zidometacin, Zidovudine, tribenoside, tribromoethanol, tribromsalan, tribuZone, 50 Zilantel, Zimeldine, Zimidoben, Zinc acetate, Zinc triacetamide, trichlormethiazide, trichlormethine, phenolsulfonate, Zinc undecyle nate, Zindotrine, trichloroacetic acid, trichloroethylene, tricribine Zindoxifene, Zinoconazole, Zinterol, ZinviroXime, phosphate, triclabendazole, triclacetamol, triclazate, Zipe prol, Zocainone, Zofenopril, Zoficonazole, triclobisonicum chloride, triclocarban, triclodaZol, Zola mine, Zola Zepam, Zolen Zepine, Zollertine, triclofenol, piperazine, triclofoS, triclofylline, 55 Zolimidine, Zoli profen, Zoloperone, Zolpidem, triclonide, triclosan, tricyclamol chloride, tridiheXethyl ZomebaZam, Zomepirac, Zometapine, Zonisamide, chloride, trientine, trie thylene me la mine, Zopiclone, Zorubicin, Zotepine, Zoxazolamine, triethylenephosphoramide, trifen agrel, trife Zolac, Zuclomiphene, Zuclophenthixol, Zylofuramine. triflocin, triflubazam, triflumidate, trifluomeprazine, The following non-limitative examples Serve to illustrate trifluopera Zine, triflu peridol, triflu promazine, 60 the concept of multiple receptor Specificity. Other combina trifluridine, triflusal, trige Volol, trihexyphenidyl, tions of vectors, Spacers and reporters and conjugation triletide, triloStane, trimaZosin, trimebutine, trimecaine, technologies leading to multiple vector incorporation are trimedoxime bromide, trimeperidine, trimeprazine, also considered relevant to this invention. Confirmation of trimetaZidine, trimethadione, trimethamide, tri the microparticulate nature of products is performed using methaphan camsylate, trimethidinium methoSulfate, 65 microscopy as described in WO-A-9607434. Ultrasonic trimethoben Zamide, trimethoprim, trime to Zine, transmission measurements may be made using a broadband trimetrexate, trimeXiline, trimipramine, trimoprostil, transducer to indicate Suspensions of products giving an US 6,331,289 B1 63 64 increased Sound beam attenuation compared to a Standard. The Simultaneous removal of peptide from the resin and Flow cytometric analysis of products can be used to confirm Side-chain protecting groups was carried out in TFA con attachment of antibodies thereto. The ability of targeted taining 5% phenol, 5% EDT, 5% anisole and 5% HO for agents to bind Specifically to cells expressing a target may be 2 hours giving a crude product yield of 150 mg. Purification Studied by microScopy and/or using a flow chamber con by preparative HPLC (Vydac 218TP1022 column) of a 40 taining immobilised cells, for example employing a popu mg aliquot of crude material was carried out using a gradient lation of cells expressing the target Structure and a further of 70 to 100% B over 40 min (A=0.1% TFA/water and population of cells not expressing the target. Radioactive, B=MeOH) at a flow rate of 9 mL/min. After lyophilization fluorescent or enzyme-labelled Streptavidin/avidin may be 16 mg of pure material was obtained (Analytical HPLC; Gradient, 70–100% B where B=MeOH, A=0.01% TFA/ used to analyse biotin attachment. 1O water: column-Vydac 218TP54: Detection-UV 260 and fluorescence, Exso, Ems-product retention time=19.44 EXAMPLE 1. min). Further product characterization was carried out using Preparation and Biological Evaluation of Multiple MALDI mass spectrometry; expected, M+H at 2198, found, at 2199 specific Gas-containing Microbubbles of DSPS 15 b) Preparation of Gas-containing Microbubbles of DSPS Doped with a Lipopeptide Consisting of a Doped with a Multiple-specific Lipopeptide Consisting of Heparin Sulphate Binding Peptide (KRKR) (SEQ a Heparin Sulphate Binding Peptide (KRKR) (SEQ ID ID NO:1) and a Fibronectin Peptide (WOPPRARI) NO:1) and Fibronectin Peptide (WOPPRARI) (SEQ ID (SEQ ID NO. 2). NO:2). This example is directed at the preparation of targeted DSPS (Avanti, 4.5 mg) and lipopeptide from a) (0.5 mg) microbubbles comprising multiple peptidic vectors arranged were weighed into each of 2 vials and 0.8 mL of a solution in a linear Sequence. of 1.4% propylene glycol/2.4% glycerol was added to each a) Synthesis of a Lipopeptide Consisting of a Heparin vial. The mixture was warmed to 80°C. for 5 minutes (vials Sulphate Binding Peptide (KRKR) (SEQ ID NO:1) and Shaken during warming). The samples were cooled to room Fibronectin Peptide (WOPPRARI) (SEQ ID NO:2). temperature and the head Space flushed with perfluorobutane

SEOID NO:3

O N NH2 N NH2 NH NH

O O

N N N N H H H O O O

HN NH2 HN NH2

The lipopeptide was synthesised on a ABI 433A auto gas. The Vials were Shaken in a cap mixer for 45 S and the matic peptide Synthesiser Starting with Fmoc-Ile-Wang resin microbubbles rolled overnight. Bubbles were washed sev (Novabiochem) on a 0.1 mmol Scale using 1 mmol amino 65 eral times with deionised water and analysed by Coulter acid cartridges. All amino acids and palmitic acid were counter (Size: 1-3 micron (87%), 3-5 micron (11.5%)) and preactivated using HBTU before coupling. acoustic attenuation (frequency max att.: 3.5 MHz). The US 6,331,289 B1 65 66 microbubbles were stable at 120 mm Hg. MALDI mass position resulted in re-appearance of contrast effects, mov Spectral analysis was used to confirm incorporation into ing the Slice back to the initial position again resulted in a DSPS microbubbles as follows; ca. 0.05-0.1 mL of tissue brightness again close to baseline. microbubble Suspension was transferred to a clean vial and Case 2) comparative 0.05-0.1 mL methanol added. The suspension was Sonicated A net volume of 2 mL microbubbles prepared in an for 30s and the solution analysed by MALDI MS. Positive identical manner to b) above with the exception that no mode gave M+H at 2200, expected for lipopeptide, 2198. lipopeptide was included in the preparation was injected, c) In Vitro Study of Gas-containing Microbubbles of DSPS using the same imaging procedure as above. The myocardial Doped with a Multiple-specific Lipopeptide Consisting of echo enhancement was far less intense and of Shorter a Heparin Sulphate Binding Peptide (KRKR) (SEQ ID duration than observed in case 1. At the completion of the NO:1) and Fibronectin Peptide (WOPPRARI) (SEQ ID left Ventricular attenuation phase, there was also almost NO:2): Binding to Endothelial Cells Under Flow Conditions complete loSS of myocardial contrast effects, and a myocar The human endothelial cell line ECV 304, derived from a dial echo increases in the posterior part of the left ventricle normal umbilical cord (ATCC CRL-1998) was cultured in as in case 1 was not observed. 260 mL Nunc culture flasks (chutney 153732) in RPMI 1640 15 EXAMPLE 2 medium (Bio Whittaker) to which L-Glutamine 200 mM, Penicillin/ Streptomycin (10.000 U/mL and 10.000 mcg/ Multiple-specific Gas-containing Microbubbles of mL) and 10% Fetal Bovine Serum (Hyclone Lot no. AFE DSPS Doped with RGDC-(SEQ ID NO:4)-Mal 5183) were added. PEGooo-DSPE and a Lipopeptide Consisting of a The cells were subcultured with a split ratio of 1:5 to 1:7 Heparin Sulphate Binding Peptide (KRKR) (SEQ when reaching confluence. Cover-glasses, 22 mm in diam ID NO:1, and Fibronectin Peptide (WOPPRARI) eter (BDH, Cat no. 406/0189/40) were sterilised and placed (SEQ ID NO:2) on the bottom of 12 well culture plates (Costar) before cells in 0.5 mL complete medium with Serum was added on top. This example is directed at the preparation of targeted When the cells reached confluence the coverslips were microbubbles comprising multiple peptidic vectors. placed in a custom made flow-chamber. The chamber con 25 a) Synthesis of 3-Maleimidopropionylamido-PEGooo-acyl Sists of a groove carved into a glass plate upon which the Distearoyl Phosphatidylethanolamine (PE-PEG-MAL) cover Slip with cells was placed with the cells facing the A mixture of distearoyl phosphatidyl ethanolamine groove forming a flow channel. (DSPE), (37.40 mg, 0.005 mmol), N-hydroxysuccinimido Ultrasound microbubbles from section b) were passed PEGooo-maleimide, NHS-PEG-MAL, (100 mg, 0.25 from a reservoir held at 37 degree Celsius through the flow mmol) and triethylamine (35ul, 0.25 mmol) in a solution of chamber and back to the reservoir using a peristaltic pump. chloroform/methanol (3:1) was stirred at room temperature The flow rate was adjusted to Simulate physiological rel for 24 hours. After evaporation of the solvents under reduced evant shear rates. The flow chamber was placed under a preSSure, the residue was purified by flash chromatography microScope and the interaction between the microSpheres (chloroform/methanol, 8:2). The product was obtained as a and cells viewed directly. A camera mounted on the micro white wax,92 mg (66%) and structure was verified by NMR Scope was connected to a colour Video printer and a monitor. 35 and maldi-MS. A gradual accumulation of the microbubbles on the cells b) Synthesis of RGDC (SEQ ID NO:4) took place which was dependant on the flow rate. By The RGDC (SEQ ID NO:4) peptide was synthesised on a increasing the flow rate the cells Started to become detached ABI 433A automated peptide synthesiser (0.25 mmol scale, from the coverslip, the microbubbles were still bound to the Fmoc-Cys(Trt)-Wang resin, (Novabiochem). All amino cells. Control bubbles not carrying the vector did not adhere 40 acids were activated using HBTU. The crude peptide was to the endothelial cells and disappeared from the cells under removed from the resin and Simultaneously deprotected in minimal flow conditions. TFA containing 5% EDT, 5% phenol and 5% water. Fol d) In Vivo Experiment in Dog lowing evaporation of the excess cleavage Solution the Case 1) peptide was precipitated and triturated Several times with A 22 kg mongrel dog was anaesthetized with pentobar 45 diethyl ether before air drying. The crude peptide was bital and mechanically ventilated. The chest was opened by purified by preparative hplc and fractions containing pure a midline Sternotomy, the anterior pericardium was product combined and freeze dried. Final characterisation removed, and a 30 mm gelled Silicone rubber spacer was was performed using analytical hplc and MALDI MS. inserted between the heart and a P5-3 transducer of an ATL c) Preparation of Multiple-specific Gas-filled Microbubbles HDI-3000 ultrasound Scanner. The scanner was set for 50 Encapsulated by Phosphatidylserine and Doped with intermittent Short axis imaging once in each end-Systole by RGDC-(SEQ ID NO:4)-Mal-PEGo-DSPE and a Lipopep delayed EGC triggering. tide Comprising a Heparin Sulphate Binding Peptide A net volume of 2 mL of microbubbles from b) were (KRKR) (SEQ ID NO: 1) and Fibronectin Peptide injected as a rapid intravenous bolus. 3 Seconds later, the (WOPPRARI) (SEQ ID NO:2). imaged right ventricle was seen to contain contrast material, 55 DSPS (Avanti, 5.0 mg), lipopeptide (0.5 mg) from another 3 seconds later, the left ventricle was also filled, and example 1a)and PE-PEG-MAL (0.5 mg) from section a) was a transient attenuation Shadow that obscured the view of the weighed into a clean vial and 1.0 mL of a solution of 1.4% posterior parts of the left Ventricle was observed. A Substan propylene glycol? 2.4% glycerol added. The mixture was tial increase in brightness of the myocardium was seen, also Sonicated for 3-5 mins, warmed to 80 C. for 5 minutes then in the portions of the heart distal to the left ventricle when filtered through a 4.5 micron filter. The mixture was cooled the attenuation Shadow Subsided. 60 to room temperature and the head Space flushed with per After passage of the inital bolus, the ultrasound Scanner fluorobutane gas. The Vials were Shaken in a cap mixer for was Set to continuous, high frame rate high output power 45s and the microbubbles centrifuged at 1000 rpm for 3 imaging, a procedure known to cause destruction of utra minutes. The infranatant was exchanged with 1 mL of PBS Sound contrast agent bubbles in the imaged tissue regions. containing 1 mg of the peptide RGDC (SEQ ID NO:4) and After a few Seconds, the Scanner was adjusted back to its 65 the pH adjusted to 8. The conjugation reaction was allowed initial Setting. The myocardium was then darker, and closer to proceed for 2 h. The bubbles were washed in PBS then to the baseline value. Moving the imaged slice to a new with water until all unreacted RGDC (SEQ ID NO:4) had US 6,331,289 B1 67 68 been removed from the infranatant as observed by MALDI (Novabiochem) on a 0.1 mmol scale using 1 mmol amino MS. The microbubbles were further analysed by Coulter acid cartridges. All amino acids were preactivated using counter (98% between 1 and 7 micron). HBTU before coupling. d) In Vitro Binding Assay. The Simultaneous removal of peptide from the resin and The binding of microbubbles to endothelial cells was Side-chain protecting groups was carried out in TFA con carried out under flow conditions using the in Vitro assay taining 5% phenol, 5% EDT and 5% HO for 2 hours giving described in example 1. c). A gradual accumulation of the a crude product yield of 302 mg. Purification by preparative microbubbles on the cells took place which was dependant HPLC (Vydac 218TP1022 column) of a 25 mg aliquot of on the flow rate. Control bubbles not carrying the vectors did crude material was carried out using a gradient of 20 to 40% B over 40 min (A=0.1% TFA/water and B=0.1% TFA/ not adhere to the endothelial cells detaching from the cells acetonitrile) at a flow rate of 9 mL/min. After lyophilization under minimal flow conditions. 10 mg of pure material was obtained (Analytical HPLC; EXAMPLE 3 Gradient, 20 to 50% B where B=0.1% TFA/acetonitrile, A=0.01% TFA/water: column-vydac 218TP54:Detection Preparation of Multiple-Specific Gas-containing UV 214 and 260 nm-product retention time=12.4 min). 15 Further product characterization was carried out using Microbubbles encapsulated with DSPS and MALDI mass spectrometry; expected, M+H at 2856, found, Thiolated anti-CD62-Mal-PEG-PE and at 2866. Thiolated-anti-ICAM-1-Mal-PEGooo-PE b) Preparation of Microbubbles of DSPS Coated Non This example is directed at the preparation of covalently with Polylysine and the PS Binding/Fibronectin microbubbles comprising multiple antibody vectors for tar Fragment Fusion Peptide geted ultrasound. NHF.N.F.R.L.K.A.G.O.K.I.R.F.G.G.G.G.W.O.P.P.R.A.I. a) Preparation of Gas-containing Microbubbles Encapsu OH. (SEQ ID NO:5) lated with DSPS and PE-PEG-MAL DSPS (5 mg, Avanti) was weighed into a clean vial along DSPS (Avanti, 4.5 mg) and PE-PEGo-Maleimide from with poly-L-lysine (Sigma, 0.2 mg) and peptide from a) 25 above (0.2 mg). To the vial was added 1.0 mL of a solution example 2a)(0.5 mg) were weighed into a clean vial and 1 of 1.4% propylene glycol/ 2.4% glycerol. The mixture was mL of a solution of 1.4% propylene glycol/2.4% glycerol warmed to 80 C. for 5 minutes. The sample was cooled to added. The mixture was warmed to 80 C. for 5 minutes then room temperature and the head Space flushed with perfluo filtered through a 4.5 micron filter. The sample was cooled robutane gas. The Vials were Shaken in a cap mixer for 45 S to room temperature and the head Space flushed with per and the microbubbles centrifuged at 1000 rpm for 3 minutes. fluorobutane gas. The Vials were Shaken in a cap mixer for Following extensive washing with water, PBS and water 45s and the microbubbles washed three times with distilled the final Solution was examined for polylysine and peptide Water. content using MALDI MS. No polypeptide material was b) Thiolation of Anti-CD62 and Anti-ICAM-1 Antibodies observed in the final wash solution. To 0.3 mg each of anti-CD62 and anti-ICAM-1 antibodies Acetonitrile (0.5 mL) was then added and the dissolved in PBS buffer (pH 7, 0.5 mL) was added Traut’s 35 microbubbles destroyed by Sonication. Analysis of the reagent and the Solutions Stirred at room temperature . for 1 resulting solution for polylysine and PS-binding/fibronectin h. ExceSS reagent was separated from the modified protein fusion peptide was then carried out using MALDI MS. The on a NAP-5 column (Pharmacia). results were as follows: c) Conjugation of Thiolated Anti-CD62 and Anti-ICAM-1 Antibodies to Gas-containing Microbubbles Encapsulated 40 with DSPS and DSPE-PEG-MAL 0.5 mL of the mixed thiolated antibody preparation from MALDI expected MALDI found b) was added to an aliquot of microbubbles from a) and the Poly-L-lysine 786,914, 1042, 1170 790,919, conjugation reaction allowed to proceed for 30 min on a 1048, 1177 roller table. Following centrifugation at 2000 rpm for 5 min 45 DSPS-binding peptide 2856 2866 the infranatant was removed. The microbubbles were washed a further three times with water. The spacer element contained within the PS binding/ The PEG spacer length may also be varied to include Fibronectin fusion peptide (-GGG-) can also be replaced longer e.g. PEGoo and PEG sooo or shorter e.g. PEGoo or with other spacers Such as PEGooo or polyalanine (-AAA-). PEGs chains. Addition of a third antibody Such as 50 It is also envisaged that a form of pre-targeting may be thiolated-anti-CD34 is also envisaged. employed, whereby the DSPS binding/Fibronectin fragment fusion peptide is firstly allowed to associate with cells via EXAMPLE 4 the fibronectin peptide binding. This is followed by admin istration of PS microbubbles which then bind to the PS Targeted Multiple-specific Gas-containing 55 binding peptide. Microbubbles of DSPS Coated Non-covalently with EXAMPLE 5 Polylysine and a Fusion Peptide Comprising a PS Binding Component and a Fibronectin Peptide Multiple-specific Gas-containing Microbubbles Sequence Encapsulated with Phosphatidylserine and Biotin 60 PEGoo-alanyl-cholesterol and Functionalised with OH. (SEQ ID NO:5) Streptavidin/biotinyl-endothelin-1 Peptide (biotin a) Synthesis of PS Binding/Fibronectin Fragment Fusion D-Trp-Leu-Asp-Ile-Ile-Trp.OH) (SEQ ID NO:6) Peptide and Biotinyl-fibrin-anti-polymerant Peptide (biotin NHF.N.F.R.L.K.A.G.O.K.I.R.F.G.G.G.G.W.O.P.P.R.A.I. GPRPPERHOS.NH) (SEQ ID NO:7) OH. (SEQ ID NO:5) 65 This example is directed at the preparation of targeted The peptide was synthesised on an ABI 433A automatic ultrasound microbubbles whereby streptavidin is used as a peptide Synthesiser Starting with Fmoc-Ile-Wang resin linker between biotinylated reporter(s) and vector(s). US 6,331,289 B1 69 70 a) Synthesis of Biotin-PEGoo-B-Alanine Cholesterol EXAMPLE 6 To a solution of cholesteryl-B-alanine hydrochloride (15 mg, 0.03 mmol) in 3 mL chloroform/wet methanol (2.6:1), was added triethylamine (42 mL, 0.30 mmol). The mixture Multiple-specific Gas-filled Microbubbles was Stired for 10 minutes at room temperature and a Solution Encapsulated with Phosphatidylserine and a of biotin-PEG-NHS (100 mg, 0.03 mmol) in 1,4-dioxan Biotinylated Lipopeptide used to Prepare a (1 mL) was added dropwise. After stirring at room tempera Streptavidin Sandwich with a Mixture of Biotinyl ture for 3 h, the mixture was evaporated to dryneSS and the endothelin-1 Peptide (biotin-D-Trp-Leu-Asp-Ile-Ile residue purified by flash chromatography to give white Trp.OH) (SEQ ID NO:6) and Biotinyl-fibrin-anti crystals, yield; 102 mg (89%). The structure was verified by polymerant peptide (biotin-GPRPPERHOS.NH) MALDI-MS and NMR. (SEQ ID NO:7) b) Synthesis of Biotinylated Endothelin-1 Peptide (biotin D-Trp-Leu-Asp-Ile-Ile-Trp.OH) (SEQ ID NO:6) a) Synthesis of Lipopeptide Dipalmitoyl-lysinyl The peptide was synthesised on a ABI 433A automatic 15 tryptophanyl-lysinyl-lysinyl-lysinyl(biotinyl)-glycine (SEQ peptide synthesiser starting with Fmoc-Trp.(Boc)-Wang ID NO:8) resin (Novabiochem) on a 0.1 mmol scale using 1 mmol The lipopeptide was synthesised on a ABI 433A auto amino acid cartridges. All amino acids were preactivated matic peptide Synthesiser Starting with Fmoc-Gly-Wang using HBTU before coupling. resin (Novabiochem) on a 0.1 mmol scale using 1 mmol The Simultaneous removal of peptide from the resin and amino acid cartridges. All amino acids and palmitic acid Side-chain protecting groups was carried out in TFA con were preactivated using HBTU before coupling. taining 5% anisole and 5% HO for 2 hours giving a crude product yield of 75 mg. Purification by preparative HPLC The Simultaneous removal of peptide from the resin and (Vydac 218TP1022 column) of a 20 mg aliquot of crude 25 Side-chain protecting groups was carried out in TFA con material was carried out using a gradient of 30 to 80% B taining 5% phenol, 5% EDT, 5% anisole and 5% HO for over 40 min (A=0.1% TFA/water and B=0.1% TFA/ 2 hours giving a crude product yield of 150 mg. Purification acetonitrile) and a flow rate of 9 mL/min. After lyophiliza by preparative HPLC (Vydac 218TP1022 column) of a 40 tion of the pure fractions 2 mg of pure material was obtained mg aliquot of crude material was carred out using a gradient (Analytical HPLC; Gradient, 30-80% B where B=0.1% TFA/acetonitrile, A=0.01% TFA/water: column-vydac of 70 to 100% B over 40 min (A=0.1% TFA/water and 218TP54: Detection-UV 214 nm-product retention time= B=MeOH) at a flow rate of 9 mL/min. After lyophilization 12.6 min). Further product characterization was carried out 14 mg of pure material (Analytical HPLC; Gradient, using MALDI mass spectrometry; expected, M+H at 1077, 70–100% B where B=MeOH, A=0.01% TFA/water: column-vydac 218TP54: Detection-UV 260 and found, 1077. 35 c) Synthesis of Biotinyl-fibrin-anti-polymerantPBeptide fluorescence, Ex280, Em350-product retention time=22 (Biotin-GPRPPERHOS.NH) (SEQ ID NO:7) min). Further product characterization was carried out using This peptide was Synthesised and purified using similar MALDI mass spectrometry; expected, M+H at 1478, found, protocols to those described in section b) above. The pure 1471. product was characterised by hplc and MALDI MS. 40 b) Preparation of Gas-containing Microbubbles of DSPS d) Preparation of Multiple-specific Gas-filled Microbubbles Doped with the Biotinylated Lipopeptide Sequence from Encapsulated with Phosphatidylserine and Biotin-PEGoo Section a) B-Alanine Cholesterol DSPS (Avanti, 4.5 mg) and biotin-PEG-B-Alanine DSPS (Avanti, 4.5 mg) and lipopeptide from a) (0.5 mg) cholesterol from Section a) (0.5 mg) were weighed into a vial 45 were weighed into each of 2 vials and 0.8 mL of a solution and 0.8 mL of a solution of 1.4% propylene glycol/ 2.4% of 1.4% propylene glycol/2.4% glycerol was added to each glycerol added. The mixture was warmed to 80° C. for 5 vial. The mixture was warmed to 80°C. for 5 minutes (vials minutes (vials shaken during warming). The sample was Shaken during warming). The samples were cooled to room cooled to room temperature and the head Space flushed with 50 temperature and the head Space flushed with perfluorobutane perfluorobutane gas. The Vial was shaken in a cap mixer for gas. The Vials were Shaken in a cap mixer for 45 S and the 45 S and the microbubbles rolled overnight. The microbubbles formed rolled overnight. The microbubbles microbubble suspension was washed several times with were washed Several times with deionised water and analy deionised water and analysed by Coulter counter and acous sed by Coulter counter and acoustic attenuation. MALDI tic attenuation. 55 mass spectral analysis was used to confirm incorporation e) Conjugation with Fluorescein Labelled Streptavidin and into DSPS microbubbles as described in example 1b). Biotinylated Peptides from Section b) and c). To the microbubble preparation from d) was added fluo c) Preparation of Multiple-specific Gas-filled Microbubbles rescein conjugated streptavidin (0.2 mg) dissolved in PBS (1 Encapsulated with Phosphatidylserine and a Biotinylated mL). The bubbles were placed on a roller table for 3 hat 60 Lipopeptide and Functionalised with Streptavidin/biotinyl room temperature. Following extensive Washing with water endothelin-1 Peptide (biotin-D-Trp-Leu-Asp-Ile-Ile and analysis by fluorescence microScopy the microbubbles Trp.OH) (SEQ ID NO:6)/Biotinyl-Fibrin-Anti-Polymerant were incubated in 1 mL of PBS containing biotinyl Peptide (biotin-GPRPPERHOSNH) (SEQ ID NO:7) Endothelin-1 peptide (0.5 mg) and biotinyl-Fibrin-anti polymerant peptide (0.5 mg) from Sections b) and c) respec 65 The microbubble preparation from b) above was treated in tively for 2 h. Extensive washing of the microbubbles was an analogous manner to that described in example 5 Section performed to remove unconjugated peptide. e). US 6,331,289 B1 71 72 EXAMPLE 7 Succ-PEGo-DSPE Non-covalently Functionalised with Biotinylated Human Transferrin and Human Endothelium Multiple-specific Gas-filled Microbubbles IgG Antibody Encapsulated with Phosphatidylserine and Biotin Microbubbles from section c) are incubated in a solution DPPE used to Prepare a Streptavidin Sandwich containing human transferrin and human endothelium IgG with a Mixture of Biotinyl-endothelin-1 Peptide antibody biotinylated using the method described by Bayer (biotin-D-Trp-Leu-Asp-Ile-Ile-Trp.OH) (SEQ ID et al., Meth. Enzymol., 62, 308. The vector-coated NO:6) and Biotinyl-fibrin-anti-polymerant Peptide microbubbles are washed as described above. (biotin-GPRPPERHOS.NH) (SEQ ID NO:7) a) Preparation of Biotin Containing Microbubbles. EXAMPLE 9 To a mixture of phosphatidylserine (5 mg, Avanti) and biotin-DPPE (0.6 mg, Pierce) in a clean vial was added 5% Multiple-specific Gas-filled Microbubbles propyleneglycol-glycerol in water (1 mL). The dispersion Encapsulated with Phosphatidylserine/streptavidin was heated to 80 C. for 5 minutes and then cooled to Succ-PEG-DSPE and the Oligonucleotides Biotin ambient temperature. The head Space was then flushed with 15 GAAAGGTAGTGGGGTCGTGTGCCGG (SEQ ID perfluorobutane and the vial Shaken in a cap-mixer for 45 NO:9) and Biotin Seconds. After centrifugation the infranatant was removed GGCGCTGATGATGTTGTTGATTCTT (SEQ ID and the microbubbles formed washed extensively with NO:10) Water. a) Synthesis of Succ-PEGo-DSPE b) Conjuaation of Gas-filled Microbubbles Encapsulated Described in example 8 a) with Phosphatidylserine and Biotin-DPPE with Streptavidin b) Preparation of Gas-filled Microbubbles Encapsulated and a Mixture of Biotinyl-Endothelin-1 (biotin-D-Trp-Leu with Phosphatidylserine and Succ-PEGo-DSPE Asp-Ile-Ile-Trp.OH) (SEQ ID NO:6) and Biotinyl-Fibrin Described in example 8b). anti-polymerant Peptide (biotin-GPRPPERHOS.NH) (SEQ c) Coupling of Streptavidin to Gas-filled Microbubbles ID NO:7) Encapsulated with Phosphatidylserine and Succ-PEGoo The procedure detailed in example 5 Section e) was 25 DSPE followed. Described in example 8 c). d) Preparation of Gas-filled Microbubbles Encapsulated EXAMPLE 8 with Phosphatidylserine/streptavidin-Succ-PEG-DSPE and Multiple-specific Gas-filled Microbubbles the Oligonucleotide S Bio tin Encapsulated with Phosphatidylserine, Streptavidin GAAAGGTAGTGGGGTCGTGTGCCGG (SEQ ID NO:9) and Biotin-GGCGCTGATGATGTTGTTGATTCTT (SEQ Succ-PEG-DSPE and a Mixture of Biotinylated ID NO:10) Human Endothelium IaG Antibody and Microbubbles from section c) are incubated in a solution Biotinylated Transferrin containing mixture of biotin a) Synthesis of Succ-PEGo-DSPE 35 GAAAGGTAGTGGGGTCGTGTGCCGG (SEQ ID NO:9) NH-PEGo-DSPE is carboxylated using succinic and biotin-GGCGCTGATGATGTTGTTGATTCTT (SEQ anhydride, e.g. by a similar method to that described by ID NO:10). The oligonucleotide-coated microbubbles are Nayar, R. and Schroit, A. J. in Biochemistry (1985) 24, washed as described above. Binding of the oligonucleotide 5967. T1. to the bubbles is detected e.g. by using fluorescent-labeled b) Preparation of Gas-filled Microbubbles Encapsulated 40 oligonucleotides for attachment to the bubbles, or by hybri with Phosphatidylserine and Succ-PEGo-DSPE dising the attached oligonucleotide to a labeled To a mixture (5 mg) of phosphatidylserine (90-99.9 mol (fluorescence or radioactivity) complementary oligonucle %) and Succ-PEGo-DSPE (10–0.1 mol%) is added 5% otide. The functionality of the oligonucleotide-carrying propyleneglycol-glycerol in water (1 mL). The dispersion is microbubbles is analysed, e.g. by hybridising the bubbles heated to not more than 80 C. for 5 minutes and then cooled 45 with immobilized DNA-containing Sequences complemen to ambient temperature. The dispersion (0.8 mL) is trans tary to the attached oligonucleotide. ferred to a vial (1 mL) and the head space is flushed with Other useful examples include an oligonucleotide perfluorobutane. The vial is shaken in a cap-mixer for 45 complementary to ribosomal DNA (of which there are many Seconds, whereafter the Sample is put on a roller table. After copies per haploid genome) and an oligonucleotide comple centrifugation the infranatant is exchanged with water and 50 the Washing is repeated. mentary to an oncogene (e.g. ras of which there is one copy c) Coupling of Streptavidin to Gas-filled Microbubbles per haploid genome) are used. Encapsulated with Phosphatidylserine and Succ-PEGoo EXAMPLE 10 DSPE Streptavidin is covalently bound to Succ-PEGoo-DSPE 55 Multiple-specific Gas-filled Microbubbles in the membrane by Standard coupling methods using a Encapsulated with Phosphatidylserine and water-Soluble carbodiimide. The Sample is placed on a roller Phosphatidylethanolamine Covalently table during the reaction. After centrifugation the infranatant Functionalised with the Fibronectin and Transferrin is exchanged with water and the Washing is repeated. The Proteins functionality of the attached Streptavidin is analysed by 60 a) Microbubbles Preparation. binding, e.g. to fluorescently labeled biotin, biotinylated DSPS (Avanti, 4.5 mg) and DSPE (Avanti, 1.0 mg) were antibodies (detected with a fluorescently labeled secondary weighed into a clean vial and 1 mL of a solution of 1.4% antibody) or biotinylated and fluorescence- or radioactively propylene glycol/2.4% glycerol added. The mixture was labeled oligonucleotides. Analysis is performed by fluores warmed to 80 C. for 5 minutes then filtered through a 4.5 cence microscopy or Scintillation counting. 65 micron filter. The Sample was cooled to room temperature d) Preparation of Multiple-specific Gas-filled Microbubbles and the head Space flushed with perfluorobutane gas. The Encapsulated with Phosphatidylserine and Streptavidin vial was shaken in a cap mixer for 45s and the microbubbles US 6,331,289 B1 73 74 washed two times with distilled water then resuspended in ID NO:10) and 0.2 mg of biotin-D-Trp-Leu-Asp-Ile-Ile-Trp. 0.1 M sodium borate buffer pH 9. OH (SEQ ID NO:6) from b) above. After incubation for 24 b) Modification of Fibronectin/Transferrin. h the particles were washed extensively with PBS and water. Fibronectin (0.5 mg) and transferrin (1.3 mg) were mixed in PBS and a solution containing NHS-fluorescin in DMSO EXAMPLE 12 added. The mixture was Stirred at room temperature for 1 Functionalisation of Gas-filled Albumin hour then the protein purified on a Superdex 200 column. Microspheres (GAM) with Biotin for Multiple The fluorescein-labelled protein mixture in phosphate buffer Specific Targeting pH 7.5 was freeze dried. a) Preparation of Biotinylated Albumin Microspheres c) Microbubble Modification. 1O A homogeneous suspension of GAM (6x10 particles/ The freeze-dried product from b) was re-dissolved in 0.5 mL) in 5 mg/mL albumin was used, with all manipulations mL water and to the fluorescein labelled fibronectin/ being carried out at room temperature. Two 10 mL aliquots transferrin mixture was added 0.1 mmol of the crosslinker were centrifuged (170xg, 5 minutes) to promote floatation of SDBP (Pierce). The solution was incubated on ice for 2 15 the microSpheres and 8 mL of the underlying infranatant was hours, charged on a NAP-5 column and eluted with PBS. To removed by careful Suction and replaced by an equal volume this was added 1 mL of the microbubble suspension from a) of air-Saturated phosphate buffered Saline, the preparations and incubation allowed to proceed for 2 hat room tempera being rotated for 15-20 minutes to resuspend the micro ture on a roller table. Unreacted material was removed by Spheres. This procedure was repeated twice, whereafter only allowing the microbubbles to float then replacing the buffer negligible amounts of free non-microSphere-associated with water, this process was repeated 3 times. albumin were assumed to remain. 50 ul of NHS-biotin (10 mM in dimethylsulphoxide) was added to one of the aliquots EXAMPLE 11 (final concentration 50 uM); the other (control) aliquot Preparation of Multiple-specific Hollow Polymer 25 received 50 ul of dimethylsulphoxide. The tubes containing Particles Incorporating Avidin in the Polymer Wall the samples were rotated for 1 hour whereafter 20 ul portions Conjugated with the Oligonucleotide Biotin of 50% aqueous glutaraldehyde were added to each tube to GGCGCTGATGATGTTGTTGATTCTT (SEQ ID crosslink the microSpheres. After rotation for another hour NO:10) and the Endothelin-1 Peptide Biotin-D-Trp the tubes were positioned vertically overnight to allow Leu-Asp-Ile-Ile-Trp.OH (SEQ ID NO:6) floatation of the microSpheres. The next day, the Suspensions This example is directed at the preparation of polymeric were washed twice with phosphate buffered Saline contain ultrasound contrast agents comprising multiple vectors ing 1 mg/mL human serum albumin (PBS/HSA) and were attached to non-Surfactant for targeting/therapeutic applica resuspended in PBS/HSA after the last centrifugation. tions. In order to determine the presence of microSphere a) Preparation of Polymer Particles Incorporating Avidin in 35 asSociated biotin, Streptavidin conjugated to horseradish the Polymer Wall peroxidase (strep-HRP) was added to both suspensions and Hollow polymer particles of P73 (as described in patent the tubes were rotated for 1 hour to allow for reaction. The WO96/07434) containing avidin were prepared by a process microSpheres were then washed three times, resuspended in involving the freeze-drying of an oil-in-water emulsion 40 100 mM citrate-phosphate buffer (pH 5) containing 0.1 using the following procedure: An oil Solution was prepared mg/mL phenylenediamine dihydrochloride and 0.01% by dissolving 0.25 g of the biodegradable polymer P73 hydrogen peroxide, and rotated for 10 minutes. Develop poly(ethylidene bis(16-hydroxyhexadecanoate) co (adipic ment of a yellow-green colour was indicative of the presence acid) in 5 mL of camphene at 60° C. To 0.2 mL of the oil of enzyme. The following results were obtained: Solution was added 2 mg avidin. An aqueous Solution was 45 then prepared by dissolving 0.4 g of the polymer, a-(16 he X a de canoyloxy he X a de canoyl)- w - methoxypolyoxyethylene ester, in 20 mL of water at 60° C. Sample Colour development The oil solution (0.2 mL) was then mixed with of the 50 Biotinylated spheres + strp-HRP 2+ Control spheres + strp-HRP -- aqueous solution (0.8 mL) in a vibromixer (Capmix) for 15 This confirms that GAM were biotinylated. S to form the oil-in-water emulsion. The emulsion was frozen in dry ice and methanol then dried at a pressure of 200 mTorr for 24 h to remove excess solvent. The powder was b) Multiple-specific Gas-containing Microparticles reconstituted as a Suspension of hollow particles by addition 55 The biotinylated microSpheres are then used to prepare of 1.0 mL water. The resulting ultrasound contrast agent was multiple-specific targeting products in an analogous manner confirmed by microscopy observation, Coulter Size to those exemplified in examples 5), 6) and 7). distribution, acoustic attenuation and resistance to external EXAMPLE 13 preSSure. 60 Multiple-specific Gas-containing Microbubbles of b) Synthesis of Biotin-D-Trp-Leu-Asp-Ile-Ile-Trp.OH (SEQ DSPS Functionalised with Heparin Sulphate ID NO:6) Binding Peptide/Fibronectin Peptide/RGD Peptide Described in example 5b). and Fluorescein. c) Conjuaation of Polymer Particles Incorporating Avidin. a) Synthesis of a Lipopeptide Containing the RGD Sequence The particles from a) were centrifuged and the Superna 65 and a Fluorescein Reporter Group: Dipalmitoyl-Lys-Lys tant replaced with 1 mL of PBS buffer pH 7.5 containing 0.2 Lys-Lys Acetyl-Ara-Gly-Asp-Lys (Fluorescein) Gly.OH mg of biotin-GGCGCTGATGATGTTGTTGATTCTT (SEQ (SEQ ID NO:11) US 6,331,289 B1

HN NH2 N O NH2 NH HO HO

HN O O O O O O O H H H N N N N N H H E H H E H O O O

NH2

N~~~~

The lipopeptide was Synthesised as described in example 40 and the head Space flushed with perfluorobutane gas. The 1) using commercially available amino acids and polymers. Vials were Shaken in a cap mixer for 45 S and the The lipopeptide was cleaved from the resin in TFA contain microbubbles formed rolled overnight. The microbubbles ing 5% water, 5% phenol, 5% EDT for 2 h. Following evaporation in vacuo the crude product was were washed Several times with deionised water and analy precipitated and triturated with diethyl ether. Purification by sed by MALDI mass spectrometry as described in example preparative HPLC (Vydac 218TP1022 column) of a 40 mg 45 1b). The microbubbles following analysis by microscopy aliquot of crude material was carried out using a gradient of were Seen to consist of a range of sizes between 1 and 5 60 to 100% B over 40 min (A=0.1%TFA/water and B=0.1% micron. Furthermore the microbubbles were fluorescent. TFA/acetonitrile) at a flow rate of 9 mL/min. After lyo philization 10 mg of pure material (Analytical HPLC; EXAMPLE 1.4 Gradient, 60–100% B where B=0.1% TFA/acetonitrile), 50 A=0.01% TFA/water: column-vydac 218TP54:Detection UV 260-product retention time=20–22 min). Further prod Multiple-specific Gas Containing Microbubbles of uct characterization was carried out using MALDI maSS DSPS Covalently Modified with CD71 FITC spectrometry; expected, M+H at 1922, found, at 1920. labelled Anti-transferrin Receptor Antibody and b) Synthesis of a Lipopeptide Containing a Heparin Sulphate 55 Doped with a Lipopeptide with Affinity for Binding Sequence and a Fibronectin Peptide Endothelial Cells. Synthesis and purification described in example 1 a). c) Preparation of Multiple-specific Gas-containing This example is directed at the preparation of multiple Microbubbles of DSPS Functionalised with a Heparin Sul vector targeted ultrasound agents. phate Binding Peptide a Fibronectin Peptide Acetyl-RGD 60 a) Synthesis of an Endothelial Cell Binding Lipopeptide: Peptide and Fluorescein. 2-n-hexadecylstearyl-Lys-Leu-Ala-Leu-Lys-Leu-Ala-Leu DSPS (Avanti, 4 mg) and lipopeptide from a) (0.5 mg, 0.2 Lys-Ala-Leu-Lys-Ala-Ala-Leu-Lys-Leu-Ala-NH. (SEQ ID mmol) and lipopeptide from b) (0.5 mg) were weighed into NO;12) each of 2 vials and 0.8 mL of a solution of 1.4% propylene The lipopeptide shown below was synthesised on a ABI glycol/2.4% glycerol was added to each vial. The mixture 65 433A automatic peptide Synthesiser Starting with a Rink was warmed to 80° C. for 5 minutes (vials shaken during amide resin on a 0.1 mmol Scale using 1 mmol amino acid warming). The samples were cooled to room temperature cartridges. US 6,331,289 B1 77 78

H n 1 H N

Q H \ O NCH O H E O NCE O l E F. N, H-N 1. rs 1. 1. N1 O H O Yi O H O H O H

H1 N NH 1N Ha-H Ha-H

O H O H H E O H O N 11 NY1. N 1. O H O H O H

All amino acids and 2-m-hexadecylstearic acid were pre d) Conjugation of Thiolated FITC-labelled Anti-transferrin activated using HBTU before coupling. The simultaneous Receptor Antibody to Gas-containing Microbubbles of removal of peptide from the resin and Side-chain protecting DSPS Doped with an Endothelial Cell Binding Lipopep groups was carried out in TFA containing 5% EDT, and 5% tide and DSPE-PEG-MAL HO for 2 hours giving a crude product yield of 150 mg. 35 Purification by preparative HPLC (Vydac 218TP1022 A 0.5 mL aliquot of the protein fraction (2 mL in total) column) of a 40 mg aliquot of crude material was carried out from c) above was added to the microbubbles from b) and using a gradient of 90 to 100% B over 50 min (A=0.1% the conjugation reaction allowed to proceed for 10 min on a TFA/water and B=MeOH) at a flow rate of 9 mL/min. After 40 roller table. Following centrifugation at 1000 rpm for 3 min lyophilization 10 mg of pure material was obtained the protein Solution was removed and the conjugation (Analytical HPLC; Gradient, 90–100% B where B=MeOH, repeated a further two times with 1 mL and 0.5 mL aliquots A=0.01% TFA/water: column-vydac 218TP54: Detection of protein solution respectively. The bubbles were then UV 214 nm-product retention time=23 min). Further prod washed four times in distilled water and a Sample analysed uct characterization was carried out using MALDI maSS 45 for the presence of antibody by flow cytometry and micros spectrometry; expected, M+H at 2369, found, at 2373. copy. A fluorescent population of>92% was observed. (See b) Preparation of Gas-containing Microbubbles of DSPS Doped with a Endothelial Cell Binding Lipopeptide and FIG. 1). PE-PEGooo-MAL 50 Incorporation into the microbubbles of lipopeptide was DSPS (Avanti, 4.5 mg) and lipopeptide from a) (0.5 mg) confirmed by MALDI mass spectrometry as described in along with PE-PEGooo-Maleimide from example 2 (0.5 Example 1b). mg) were weighed into a clean vial and 1 mL of a Solution of 1.4% propylene glycol/2.4% glycerol added. The mixture EXAMPLE 1.5 was warmed to 80° C. for 5 minutes then filtered through a 55 4.5 micron filter. The Sample was cooled to room tempera ture and the head Space flushed with perfluorobutane gas. Preparation of Multiple-sepecific Transferrin/Avidin The vials were shaken in a cap mixer for 45 s and the Coated gas-filled Microbubbles for Targeted microbubbles washed three times with distilled water. Ultrasound Imaging. c) Thiolation of FITC-labelled Anti-transferrin Receptor 60 Antibody. This example is directed to the preparation of FITC labelled CD71 anti-transferrin receptor Ab (100 mg/ microbubbles containing multiple protein vectors for tar mL, Becton Dickinson), 0.7 mL, in PBS was modified with geted ultrasound/therapy. Traut's reagent (0.9 mg, Pierce) at room temperature for 1 65 h. ExceSS reagent was separated from modified protein on a a) Synthesis of a Thiol Functionalised Lipid Molecule: NAP-5 column (Pharmacia). Dipalmitoyl-Lys-Lys-Lys-Aca-CyS.OH (SEQ ID NO:13) US 6,331,289 B1 79 80

(SEQ ID NO: 13)

NH2

SH O O H H N N OH N N i H H O O O

NH2

The lipid structure shown above was synthesised on a ABI d) Microbubble Conjugation with Modified Transferrin/ 433A automatic peptide Synthesiser Starting with Fmoc-CyS Avidin. (Trt)-Wang resin (Novabiochem) on a 0.25 mmol scale using To the thiol containing microbubbles from b) was added 1 mmolamino acid cartridges. All amino acids and palmitic 25 1 mL of the modified transferrin/avidin protein solution c). acid were preactivated using HBTU coupling chemistry. After adjusting the pH of the Solution to 9 the conjugation The Simultaneous removal of peptide from the resin and reaction was allowed to proceed for 2 hat room temperature. deprotection of Side-chain protecting groups was carried out Following extensive Washing with deionised water the in TFA containing 5% EDT, and 5% HO for 2 hours giving microbubbles were analysed by Coulter counter (81% a crude product yield of 250 mg. Purification by preparative between 1 and 7 micron) and fluorescence microscopy HPLC (Vydac 218TP1022 column) of a 40 mg aliquot of (highly fluorescent microbubbles were observed). crude material was carried out using a gradient of 90 to 100% Bover 50 min (A=0.1%TFA/water and B-MeOH) at EXAMPLE 16 a flow rate of 9 mL/min. After lyophilization 24 mg of pure Preparation of Functionalised Gas-filled Microbubbles for material was obtained (Analytical HPLC; Gradient, 35 Taraeted Ultrasound Imaging. 70–100% B where B=0.1% TFA? acetonitrile, A=0.01% This example is directed to the preparation of TFA/water: column-vydac 218TP54: Detection-UV 214 microbubbles having a reactive group on the Surface for nim-product retention time=23 min). Further product char non-specific targeting, principally utilising disulphide acterization was carried out using MALDI mass spectrom 40 eXchange reactions to effect binding to a multiplicity of etry; expected, M+H at 1096, found, at 1099. cellular targets. b) Preparation of Gas-containing Microbubbles of DSPS DSPS (Avanti, 5.0 mg) and the thiol containing lipid Doped with a Thiol Containing Lipid Structure: Structure from example 15a)(1.0 mg) were weighed into a DSPS (Avanti, 4.5 mg) and the lipid structure from a) clean vial and 0.8 mL of a Solution containing 1.4% propy above (0.5 mg) were weighed into a clean vial and 0.8 mL 45 lene glycol? 2.4% glycerol in water added. The mixture was of a Solution containing 1.4% propylene glycol? 2.4% glyc warmed to 80° C. for 5 minutes (vials shaken during erol in water added. The mixture was warmed to 80 C. for warming) and filtered while still hot through a 40 micron 5 minutes (vials Shaken during warming) and filtered while filter. The Samples were cooled to room temperature and the still hot through a 40 micron filter. The samples were cooled 50 head Space flushed with perfluorobutane gas. The Vials were to room temperature and the head Space flushed with per Shaken in a cap mixer for 45 S and the microbubbles placed fluorobutane gas. The Vials were Shaken in a cap mixer for on roller table overnight. Bubbles were washed several 45s and the microbubbles placed on roller table overnight. times with deionised water and analysed for thiol group Bubbles were washed several times with deionised water incorporation using Ellmans Reagent. and analysed for thiol group incorporation using Ellmans 55 Reagent. EXAMPLE 1.7 c) Modification of Transferrin and Avidin with Fluorescein NHS and Sulpho-SMPB. Multiple-specific Gas-containing Microbubbles of To a mixture of 2 mg of transferrin (Holo, human, Alpha DSPS Comprising a Lipopeptide for Endothelial Therapeutic Corp) and 2 mg of avidin (Sigma) in PBS (1 60 Cell Targeting and a Captopril Containing mL) was added 0.5 mL DMSO solution containing 1 mg Molecule. Sulpho-SMPB (Pierce) and 0.5 mg Fluorescein-NHS (Pierce). The mixture was stirred for 45 minutes at room This example is directed to the preparation of ultrasound temperature then passed through a SephadeX 200 column 65 agents for combined targeting and therapeutic applications. using PBS as eluent. The protein fraction was collected and a) Synthesis of a Lipopeptide Functionalised with Captopril: stored at 4 C. prior to use. (SEQ ID NO:14) US 6,331,289 B1 81 82

(SEQ ID NO: 14)

NH2

O O H N N NH2 O

O On 10H NH2 HN --- ^ S E N

The Structure shown above was Synthesised using a was purified by preparative liquid chromatography (Vydac manual nitrogen bubbler apparatus Starting with Fmoc pro 218TP1022 column) using a gradient of 70 to 100% B over tected Rink Amide MBHA resin (Novabiochem) on a 0.125 25 60 min (A=0.1% TFA/water and B=0.1% TFA/acetonitrile) mmol Scale. All amino acids were purchased from Nova at a flow rate of 10 mL/min. After lyophilization a yield of biochem and palmitic acid from Fluka. Coupling was carried out using standard TBTU/HOBt/DIEA protocols. Bro 2 mg of pure material was obtained (analytical HPLC: moacetic acid was coupled through the Side-chain of Lys as gradient 70–100% B over 20 min, A=0.1% TFA/water and a Symmetrical anhydride using DIC preactivation. Captopril B=0.1% TFA/acetonitrile; flow rate 1 mL/min, column (Sigma) dissolved in DMF was introduced on the solid Vydac 218TP54; detection UV 214 nm; retention time 26 phase using DBU as base. min). Further characterisation was carried out using MALDI Simultaneous removal of the peptide from the resin and mass Spectrometry, giving M--H at 1265 as expected. deprotection of Side-chain protecting groups was carried out b) Synthesis of a Lipopeptide with Affinity for Endothelial in TFA containing 5% EDT, 5% water and 5% ethyl methyl Cells: Dipalmitoyl-Lys-Lys-Lys-Aca-Ile-Ara-Arg-Val-Ala sulphide for 2 h. An aliquot of 10 mg of the crude material Ara-Pro-Pro-Leu-NH. (SEQ ID NO:15)

Null N---> US 6,331,289 B1 83 84 -continued "N. NH NH

O O H H N N H H O

NH

HN 1s NH

The lipopeptide was synthesised on a ABI 433A auto EXAMPLE 1.8 matic peptide Synthesiser Starting with Rink amide resin Preparation of Multiple-Specific Gas-containing (Novabiochem) on a 0.1 mmol Scale using 1 mmol amino Microbubbles of DSPS loaded with a Lipopeptide acid cartridges. All amino acids and palmitic acid were Comprising a Helical Peptide with Affinity for Cell preactivated using HBTU before coupling. The simulta 25 neous removal of peptide from the resin and Side-chain Membranes and the Peptide Antibiotic Polymixin B protecting groups was carried out in TFA containing 5% Sulphate. phenol, 5% EDT and 5% HO for 2 hours giving a crude This example is directed at the preparation of targeted product yield of 160 mg. Purification by preparative HPLC microbubbles comprising multiple peptidic vectors having a (Vydac 218TP1022 column) of a 35 mg aliquot of crude combined targeting and a therapeutic application. material was carried out using a gradient of 70 to 100% B a) Synthesis of a Lipopeptide Comprising a Helical Peptide over 40 min (A=0.1% TFA/water and B=MeOH) at a flow with Affinity for Cell Membranes: hexadecylstearyl-Lys rate of 9 mL/min. After lyophilization 20 mg of pure Leu-Ala-Leu-Lys-Leu-Ala-Leu-Lys-Ala-Leu-Lys-Ala-Ala material was obtained (Analytical HPLC; Gradient, Leu-Lys-Leu-Ala-NH. (SEQ ID NO:12). 70-100% B where B=MeOH, A=0.01% TFA/water: Described in example 14a). column-vydac 218TP54: Detection-UV 214 and 260 35 b)-Preparation of Multiple-specific Gas-containing nim-product retention time=16 min). Further product char Microbubbles. acterization was carried out using MALDI mass spectrom DSPS (Avanti, 5.0 mg), lipopeptide from a)(0.3 mg)and etry; expected, M+H at 2050, found, at 2055. polymixin B Sulphate (Sigma,0.5 mg) were weighed into a c) Preparation of Gas-containing Microbubbles of DSPS clean vial and 1.0 mL of a solution of 1.4% propylene Comprising a Lipopeptide for Endothelial Cell Targeting 40 glycol? 2.4% glycerol added. The mixture was Sonicated for and a Captopril Containing Molecule for Drug Delivery 3-5 mins, warmed to 80 C. for 5 minutes then filtered DSPS (Avanti, 4.5 mg), product from a) (0.5 mg) and through a 4.5 micron filter. The mixture was cooled to room product from b) (0.5 mg) were weighed into a vial and 1.0 temperature and the head Space flushed with perfluorobutane mL of a solution of 1.4% propylene glycol/ 2.4% glycerol gas. The Vial was Shaken in a cap mixer for 45 S and the was added to each vial. The mixture was warmed to 80 C. microbubbles centrifuged at 1000 rpm for 3 minutes. The for 5 minutes (vials shaken during warming). The samples 45 microbubbles were washed in water until no polymixin B were cooled to room temperature and the head Space flushed Sulphate or lipopeptide could be detected in the infranatant with perfluorobutane gas. The Vials were firstly Shaken in a by MALDI-MS. Microscopy showed that the size distribu cap mixer for 45s then rolled for 1 h followed by extensive tion of the bubble population was between 1-8 micron as washing with deionised water. No detectable levels of start desired. To the washed bubbles (ca. 0.2 mL) was added ing material were found in the final wash Solution as 50 methanol (0.5 mL) and the mixture placed in a sonic bath for evidenced by MALDI MS. MALDI mass spectral analysis 2 min. The resulting clear Solution, following analysis by was used to confirm incorporation of the products from MALDI-MS, was found to contain both lipopeptide and section a) and b) into the microbubbles as described in polymixin B Sulphate (expected 1203, found 1207). example 1b). EXAMPLE 1.9 d) In Vitro Study of Gas-containing Microbubbles of DSPS 55 Comprising a Lipopepitcle for Endothelial Cell Targeting Preparation of Multiple-Specific Gas-containing and a Captopril Containing Molecule for Therapeutic Appli Microbubbles of DSPS Doped with a Lipopeptide Com cations. prising a IL-1 Receptor Binding Sequence and Modified The in vitro assay described in example 1c) was used to with a Branched Structure Containing the Drug Methotrex examine cell binding under flow conditions. A gradual 60 ate. accumulation of the microbubbles on the cells took place This example is directed at the preparation of targeted which was dependant on the flow rate. By increasing the microbubbles comprising multiple vectors for targeted/ flow rate the cells started to become detached from the therapeutic /drug release applications. coverslip, the microbubbles were still bound to the cells. Synthesis of a Lipopeptide Comprising an Interleukin-1 Control bubbles not carrying the vector did not adhere to the 65 Receptor Binding Peptide: Dipalmitoyl-Lys-Gly-Asp-Trp endothelial cells and disappeared from the cells under mini Asp-Gln-Phe-Gly-Leu-Trp-Ara-Gly-Ala-Ala.OH (SEQ ID mal flow conditions. NO:16) US 6,331,289 B1 85 86

H Y H O1 O O

O O | O | O | --~~~~ Nulls N Null N Nn1 S s H O H O H O a N D. ti- O H

| H-N YN-H NH

O | O | O | O | O

us N Nulls N Nulls N Null N Nulls O s E H O H O H O H O H

The lipopeptide was synthesised on a ABI 433A auto- 100% B over 40 min (A=0.1%TFA/water and B=MeOH) at matic peptide Synthesiser Starting with Fmoc-Ala-Wang a flow rate of 9 mL/min. After lyophilization 4 mg of pure resin (Novabiochem) on a 0.1 mmol Scale using 1 mmol 45 material was obtained (Analytical HPLC; Gradient, amino acid cartridges. All amino acids and palmitic acid 90-100% B Over 20 min where B-MeOH, A=0.01% TFA/ were preactivated using HBTU before coupling. The simul- water: column-vydac 218TP54: Detection-UV 214 nm, taneous removal of lipopeptide from the resin and Side-chain s protecting groups was carried out in TFA containing 5% product retention time 23 min). Further product character H0, 5% anisole, 5% phenol and 5% EDT for 2 hours giving 50 ization was carried out using MALDI mass spectrometry; a crude product yield of 150 mg. Purification by preparative expected, M+H at 2083, found, at 2088. HPLC (Vydac 218TP1022 column) of a 30 mg aliquot of b) Synthesis of a Branched Methotrexate Core Structure crude material was carried out using a gradient of 90 to Containing a Thiol Moiety. US 6,331,289 B1 87 88

HN N N YS COOH NN 4. N O H H H NH2 Null N H N-- O O HN N N COOH COOH O rS H N HN COOH H CCulNH2 N O N r H O SH O

COOH

The methotrexate structure was synthesised on a ABI EXAMPLE 2.0 433A automatic peptide Synthesiser Starting with Fmoc-CyS 25 Preparation of Microbubbles Coated with Poly-L- (Trt) Tentagel resin on a 0.1 mmol Scale. The simultaneous lysine Complexed to Fluorescein Labeled DNA removal of product from the resin and deprotection of Fragments from Plasmid pBR322 protecting groups was carried out in TFA containing 5% This example is directed to the preparation of EDT and 5% HO for 2 hours giving a crude product yield microbubbles for gene therapy/anti-Sense applications. It is of 160 mg. Purification by preparative HPLC (Vydac envisaged that Specific targeting may be achieved by further 218TP1022 column) of a 30 mg aliquot of crude material doping of microbubble membranes with vector modified was carried out using a gradient of 10 to 30% B over 40 mm lipid structures as described in example 1. (A 0.1% TeA/water and B=0.1% TCA/acetonitrile) and a a) Preparation of DSPS Gas-containing Microbubbles flow rate of 9 mL/min. After lyophilization of the pure DSPS (Avanti, 4.5 mg) was weighed into a clean vial. 1.0 fractions 9 mg of pure material was obtained (Analytical 35 mL of a solution of 1.4% propylene glycol/ 2.4% glycerol HPLC; Gradient, 5–50% B where B=0.1% TFA/acetonitrile, was added and the mixture Sonicated for 2 min then warmed A=0.01% TFA/water: column-vydac 218TP54: Detection to 80° C. for 5 minutes. Immediately following warming the UV 214 nm-product retention time=9.5 min). Further prod solution was filtered through a 4 micron filter. The sample uct characterization was carried out using MALDI maSS was cooled to room temperature and the head Space flushed spectrometry; expected, M+H at 1523, found, 1523. with perfluorobutane gas. The vial was shaken in a cap mixer c)-Preparation of Multiple-specific Gas-containing 40 for 45 S. Bubbles were then washed once with deionised Microbubbles. water and the infranatant discarded. The microbubbles were then resuspended in 0.5 mL water. DSPS (Avanti, 4.5 mg) and thiol containing lipopeptide b) Preparation of Poly-L-lysine/DNA Complex and Loading from example 15a) (0.5 mg) and lipopeptide from a) (0.2 of DSPS Microbubbles mg) above were weighed into a clean vial and 1.0 mL of a 45 To 1 mg of poly-L-lysine (70-150 kD) in a clean vial was Solution of 1.4% propylene glycol? 2.4% glycerol added. added 0.1 mL of a fluorescein labeled digest of plasmid The mixture was Sonicated for 3-5 mins, warmed to 80 C. pBR322 (Biorad) dissolved in TE buffer (10 mM tris-HCl, for 5 minutes then filtered through a 4.5 micron filter. The pH 8). The solution was made up to a total of 0.6 mL by mixture was cooled to room temperature and the head Space addition of water and the pH adjusted to 8. Complexation flushed with perfluorobutane gas. The vials were shaken in 50 was allowed to proceed for 1 h then 0.05 mL of the a cap mixer for 45 S and the microbubbles centrifuged at polylysine-DNA solution was added to the microbubble 1000 rpm for 3 minutes following which the infranatant was Suspension from a) above. After 1 h microscopy was used to discarded. show that the bubbles were fluorescent confirming the d) Conjugation of Methotrexate Branched Structure to Thi presence of DNA. olated Microbubbles. 55 The methotrexate structure from b) above (0.5 mg) was EXAMPLE 21 dissolved in PBS pH 8.0. The solution was then added to the Preparation of Multiple-specific Gas-filled thiol containing bubbles from c) and disulphide bond for Microbubbles Containing a Branched Core Peptide mation allowed to proceed for 16 h. Following extensive Comprising a Dabsylated-atherosclerotic Plaque washing with PBS and water the bubbles were analysed by 60 Binding Sequence and RGDS (SEQ ID NO:21). microscopy and MALDI MS. This example is directed to the preparation of It is also considered relevant that the disulphide bond microbubbles having a thiol group on the Surface for modi linking the methotrexate Structure to the microbubble may fication with thiol containing vectors for targeting/drug be reduced in vivo liberating the free drug molecule. This in delivery and drug release. combination with a tumour Specific vector is a drug delivery 65 a) Synthesis of the Branched Peptide Dabsyl-Tyr-Arg-Ala System. A physiologically relevant reducing agent Such as Leu-Val-Asp-Thr-leu-Lys-Lys(NH2-Ara-Gly-Asp-Ser)- glutathione may be used to bring about drug release. Gly-Cys.OH (SEQ ID NO:17) US 6,331,289 B1 89 90

OH O O O

N N N N2letN O O H O H O YCOOHH O NN / -NH NH2

O O O

1N N irr OH X. l Nshi

NH HO

COOH

The peptide was synthesised on a ABI 433A automatic The infranatant from the microbubbles from b) above was peptide Synthesiser Starting with Fmoc-Cys(Trt)-Tentagel discarded and replaced with a Solution of dabsyl-peptide resin on a 0.1 mmol Scale using 1 mmol amino acid cartridges. All amino acids were preactivated using HBTU from a) (1 mg) in 0.7 mL dil. ammonia solution (pH 8). To before coupling. The Simultaneous removal of peptide from this was added 0.2 mL of a Stock Solution containing 6 mg the resin and Side-chain protecting groups was carried out in of potassiumferricyanate dissolved in 2 mL of water. The TFA containing 5% phenol, 5% EDT and 5% HO for 2 vial was placed on a roller table and thiol oxidation allowed hours giving a crude product yield of 160 mg. Purification to proceed for 2 h. The bubbles were then washed exten by preparative HPLC (Vydac 218TP1022 column) of a 30 sively with water until the infranatant was free of the mg aliquot of crude material was carried out using a gradient 55 of 10 to 60% B over 40 min (where A=0.1%TFA/water and dabsyl-peptide as evidenced by hplc and MALDI MS. B=acetonitrile) at a flow rate of 9 mL/min. After lyophiliza tion 2.5 mg of pure material was obtained (Analytical HPLC; Gradient, 10–50% B over 20 min where B=0.1% Detection of microbubble bound peptide was carried out TFA/acetonitrile and A=0.01% TFA/water: column-Vydac by reduction of the disulphide bond using the water souble 218TP54: Detection-UV 214 and 435 nm-product retention reducing agent tris-(2-carboxyethyl)-phosphine. Following time=21 min). Further product characterization was carried reduction the infranatant was found to contain free dabsyl out using MALDI mass spectrometry; expected, M+H at peptide as evidenced by hplc and MALDI MS. 2070, found, at 2073. b) Preparation of Thiol Containing Gas-filled Microbubbles. As described in example 15a) and b). 65 Other physiological relevant reducing agents Such as c) Oxidative Coupling of Thiolated Microbubbles with reduced glutathione are also considered useful for initiating Multiple-specific Peptide via Disulphide Bond Formation. release. US 6,331,289 B1 91 92 EXAMPLE 22 GAAAGGTAGTGGGGTCGTGTGCCGG (SEQ ID NO:9) Gas-containing Microparticles Comprising Polymer and Biotinylated Fibrin-anti-polymerant Peptide (Biotin from Ethylidene Bis(16-hydroxyhexadecanoate) and GPRPPERHOS.NH) (SEQ ID NO:7). Adipoyl Chloride and Biotin-amidocaproate-Ala a) Synthesis of Biotin-PEG-acyl-phosphatidyl Ethano Covalently attached to the Polymer lamine a) Synthesis of Z-Ala-polymer (3-O-(carbobenzyloxy-L- alanyl)-polymer) A mixture of dipalmitoyl phosphatidyl ethanolamine, The polymer is prepared from ethylidene bis(16 (21.00 mg, 0.03 mmol), biotin-PEG-CO-NHS, (100 mg, hydroxyhexadecanoate) and adipoyl chloride as described in 0.03 mmol) and triethylamine (42 ul, 0.30 mmol) in a WO-A-9607434, and a polymer fraction with molecular solution of chloroform/methanol (3:1) was stirred at room weight 10000 is purified using gel permeation chromatog temperature for 2 hours. After evaporation of the Solvents raphy (GPC). 10 g of the material (corresponding to 1 mmol under reduced pressure, the residue was flash chromato OH groups), Z-alanine (5 mmol) and dimethylaminopyri graphed (methylene chloride/methanol/water, 40:8:1). The dine (4 mmol) are dissolved in dry dimethylformamide/ 15 product was obtained as a yellow gum, 112 mg (94%) and tetrahydrofuran and dicyclohexylcarbodiimide is then structure verified by NMR and MALDI-MS. added. The reaction mixture is stirred at ambient tempera ture overnight. Dicyclohexylurea is filtered off and the b) Binding of Fluorescein-conjugated Streptavidin to Gas Solvent is removed using rotary evaporation. The product is Filled Microbubbles purified by chromatography, fractions containing the title Gas-containing microbubbles were prepared by mixing compound are combined and the Solvent is removed using DSPS and biotin-PEG-acyl-phosphatidyl ethanolamine rotary evaporation. The Structure of the product is confirmed as described in example 5a). by NMR. b) Synthesis of Ala-polymer (3-O-(L-alanyl)-polymer) The microbubble Suspension was divided into 0.2 mL Z-Ala-polymer (0.1 mmol) is stirred in toluene/ aliquots and fluorescein conjugated Streptavidin added as tetrahydrofuran and glacial acetic acid (15% of the total 25 shown in the table below. The samples were incubated on a Volume) and hydrogenated in the presence of 5% palladium roller table for 15 or 30 minutes at ambient temperature on charcoal for 2 hours. The reaction mixture is filtered and before removal of excess protein by washing in PBS. concentrated in vacuo. c) Synthesis of Biotinamidocaproate-Ala-polymer A Solution of biotinamidocaproate N-hydroxySuccinimide ester in tetrahydrofuran is added to HN-Ala-polymer dis Results: solved in a mixture of tetrahydrofuran and dimethylforma Added Particle mide and 0.1 M Sodium phosphate buffer having a pH of 7.5. Streptavidin Incubation median The reaction mixture is heated to 30° C. and stirred vigor Aliquot (ug/200:1 time % Fluorescent diameter ously; the reaction is followed by TLC to completion. The 35 O. sample) (amb. temp.) particles (microns) Solvent is evaporated and the crude product is used without 1. O 2.0 further purification. 2 O 12 (foam) 3 O.2 30 min 7.8 3.9 d) Gas-containing Particles Comprising Biotin (3 x 10 mmol) amidocaproate-Ala-polymer and PEG 10000 Methyl Ether 4 2 30 min 26.2 4.2 16-hexadecanoyloxyhexadecanoate 40 (3 x 10 mmol) 10 mL of a 5% w/w solution of biotin-amidocaproate 5 1O 15 min 30.5 la (1.5 x 107 mmol) Ala-polymer in (-)-camphene maintained at 60° C. is added 6 2O 30 min 97.9 5.2 to 30 mL of an 1% w/w aqueous solution of PEG 10000 (3 x 107 mmol) methyl ether 16-hexadecanoyloxyhexadecanoate (prepared 7 40 15 min 96.7 5.1 as described in WO-A-9607434) at the same temperature. 45 (6 x 107 mmol) The mixture is emulsified using a rotor stator mixer (Ultra 8 DSPS 2O 15 min O.6 3.7 Turax(R) T25) at a slow speed for several minutes, and control (3 x 107 mmol) thereafter is frozen in a dry ice/methanol bath and lyo philized for 48 hours, giving the title product as a white 50 The samples were analysed by flow cytometry and Coulter powder. Counter. The results are Summarized in the table above. e) Acoustic Characterisation and Microscopy of the Product Confirmation of the microparticulate nature of the product c) Conjugation of Streptavin Coated Microbubbles with the is performed using light microscopy as described in WO-A- Oligo nucleotide Bio tin 9607434. Ultrasonic transmission measurements using a 3.5 GAAAGGTAGTGGGGTCGTGTGCCGG (SEQ ID NO:9) MHZ broadband transducer indicate that a particle Suspen 55 and Biotinylated Fibrin-anti-polymerant Peptide Biotin Sion of <2 mg/mL gives a Sound beam attenuation of at least GPRPPERHOS (SEQ ID NO:7) 5 dB/cm. The particles from aliquot no. 6 above were centrifuged f) Multiple-specific Microparticles and the Supernatant replaced with 1 mL of PBS buffer pH 7.5 The biotinylated microSpheres are then used to prepare containing O2 mg of biotin multiple-specific targeting products similar to those exem 60 GAAAGGTAGTGGGGTCGTGTGCCGG (SEQ ID NO:9) plified in examples 5), 6) and 7). and 0.2 mg of biotin-GPRPPERHQS (SEQ ID NO:7) EXAMPLE 23 (Example 5c). After incubation for 24 h the particles were Preparation of Multiple-Specific Gas-containing washed extensively with PBS and water. Microbubbles Encapsulated with DSPS and Biotin 65 It is envisaged that other biotinylated vectors or thera PEGoo-acyl-phosphatidylethanolamine and Functiona peutic agents may be conjugated to Streptavidin or avidin lised with Streptavidin, Oligonucleotide Biotin coated microbubbles using this procedure. US 6,331,289 B1 93 94 EXAMPLE 24 min then purification carried out on a SuperdeX 200 column. The product was eluted in PBS and the modified protein Preparation of Microbubbles Encapsulated with fraction collected. DSPS and Functionalised with a Thrombi-taraeting c) Preparation of Microbubbles Encapsulated with DSPS/ Lipopeptide and the Thrombolytic Enzyme Tissue 5 thrombi-binding Lipopeptide and Thiol Containing Lipoep Plasminogen Activator. This example is directed at tide and Conjugation to Modified Tissue Plasminogen Acti the preparation of thrombus targeted US agents VatOr. comprising a therapeutic thromolytic agent. a) DSPS (Avanti, 5.0 mg) was weighed into a clean vial Synthesis of a lipopeptide with affinity for thrombi along with 0.5 mg of the lipopeptide from a) and 0.5 mg of (Dipalmitoyl-Lys-Asn-Asp-Gly-Asp-Phe-Glu-Glu- 10 the thiol containing lipopeptide from example 15a). Ile-Pro-Glu-Glu-Tyr-Leu-Gln-NH) (SEO ID To this was added 1.0 mL of a solution of 1.4% propylene NO:18) glycol? 2.4% glycerol and the mixture Sonicated for 2 min

(SEQ ID NO: 18)

O

COOH

OH

The lipopeptide was synthesised on a ABI 433 A auto- then warmed to 80 C. for 5 minutes. Immediately following matic peptide Synthesiser Starting with Rink amide resin warming the Solution was filtered through a 4 micron filter. (Novabiochem) on a 0.1 mmol Scale using 1 mmol amino 50 The sample was cooled to room temperature and the head acid cartridges. All amino acids and palmitic acid were Space flushed with perfluorobutane gas. The Vials were preactivated using HBTU before coupling. The simulta- shaken in a cap mixer for 45s and the microbubbles washed neous removal of peptide from the resin and Side-chain 2 times with deionised water. The infranatant was discarded protecting groups was carried out in TFA containing 5% and replaced with a 1 mLaliquot of the protein Solution from phenol, 5% EDT, 5% anisole and 5% HO for 2 h giving a 55 b) above. The conjugation reaction was allowed to proceed crude product yield of 80 mg. Purification by preparative for 1 h. The bubbles were centrifuged and infranatant HPLC (Vydac 218TP1022 column) of a 20 mg aliquot of the exchanged with a further 1 mL of protein solution. The crude material was carried out. After lyophilization 6 mg of incubation Step was repeated until all protein Solution was pure material was obtained. The product was characterized used up. The microbubbles were then washed extensively by MALDI mass spectrometry and analytical HPLC. 60 with water and analysed by Coulter counter. The b) Modification of Issue Plasminogen Activator with microbubbles were tested in the flow chamber assay Sulpho-SMPB. described in Example 1c). Microbubbles modified with A Solution of 0.1 mL of ammonium carbonate buffer protein were found to bind in higher numbers than those containing 0.1 mg of t-PA (Sigma) was made up to 0.2 mL comprising either lipopeptide/DSPS or DSPS alone. by the addition of water. To this Solution was added 0.4 mg 65 It is envisaged that the targeting/therapeutic/ultrasound of Sulpho-SMPB (Pierce) dissolved in 0.05 mL DMSO. The activities of these microbubbles be evaluated in models of in protein Solution was left Standing at room temperature for 45 Vitro and in Vivo thrombogenisis. US 6,331,289 B1 95 96 EXAMPLE 25 iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methylethyl) Multiple-specific PFB Gas-filled Microbubbles amino-propoxyphenylacetic acid Encapsulated with DSPS and a Lipopeptide A solution of the 4-2-hydroxy-3-(1-methylethyl) Comprising a Heparin Sulphate Binding peptide amino-propoxyphenylacetic acid hydrochloride (2.0 (KRKR) (SEq ID NO:1) and a Fibronectin Peptide mmol) in water (2 ml) was added to a Solution of Sodium (WOPPRARI) (SEQ ID NO:2) for Targeting and a Lipopeptide Containing Atenolol for Therapeutic bicarbonate (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 Applications ml). A solution of di-tert-butyl dicarbonate (0.48 g, 2.2 a) Synthesis of a Lipopeptide Consisting of a Heparin mmol) in dioxane (5 ml) was added. Progress of the reaction Sulphate Binding Peptide (KRKR) (SEQ ID NO:1) and a was monitored by TLC analysis (silica, CHCl/MeOH/ Fibronectin Peptide (WOPPRARI) (SEQ ID NO:2). AcOH 85:10:5), and portions of di-tert-butyl dicarbonate Synthesis and purification described in example 1a). were added until conversion was complete. The reaction b) Synthesis of a Protected Atenolol Derivative Suitable for mixture was poured onto water Saturated with potassium Solid Phase Coupling hydrogenSulphate and organic material was extracted into i) Synthesis of methyl 4-(2,3-epoxy)propoxy 15 ethyl acetate. The organic phase was washed with water and phenylacetate brine, dried (Na2SO) and filtered to give 0.6 g of crude A mixture of methyl 4-hydroxyphenylacetate (4.98 g, material. The product was purified by chromatography 0.03 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyridine (silica, CHCl/MeOH/AcOH 85:10:5). The solution was (121 ul, 1.5 mmol) was stirred at 85°C. for 2 h. The reaction concentrated and the residue was taken up in glacial acetic mixture was cooled, and exceSS epichlorohydrin was dis acid and lyophilised. Yield 415 mg (56%), white solid. The tilled off (rotavapor). The residue was taken up in ethyl structure was confirmed by H and 'C NMR analysis. acetate, washed with brine and dried (Na2SO.) The solution c) Synthesis of a Lipopeptide Functionalised with Atenolol was filtered and concentrated. The dark residue was chro (SEQ ID NO:19)

(SEQ ID NO:19)

O

O O O H N --~~~~ N Null N H H O O

H s H O--OH matographed (silica, hexane/ethyl acetate 7:3) to give 2.25g The Structure shown above was Synthesised on a manual (34%) of a colourless oil. "H (300 MHz) and CNMR (75 nitrogen bubbler starting with Fmoc protected Rink Amide MHz) spectra were in accordance with the structure. MBHA resin (Novabiochem) on a 0.125 mmol scale, using ii) Synthesis of methyl 4-2-hydroxy-3-(1-methylethyl) amino acids from Novabiochem, palmitic acid from Fluka amino-propoxyphenylacetate 50 and the compound from a). Coupling was carried out using A mixture of methyl 4-(2,3-epoxy) propoxy standard TBTU/HOBt/DIEA protocols. phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, Simultaneous removal of the peptide from the resin and 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at deprotection of Side-chain protecting groups was carried out room temperature overnight. The reaction mixture was con in TFA containing 5% EDT and 5% water for 2h. Crude centrated (rotavapor) and the oily residue was dissolved in 55 material was precipitated from ether and purified by pre chloroform and dried (Na2SO). Filtration and concentration parative liquid chromatography (Vydac 218TP1022 column) gave quantitative yield of a yellow oil that was used in the using a gradient of 70 to 100% B over 60 min (A=0.1% next Step without further purification. The Structure was TFA/water and B=0.1% TFA/acetonitrile) at a flow rate of verified by H and 'C NMR analysis. 10 ml/min. After lyophilisation a yield of 38 mg of pure iii) Synthesis of 4-2-hydroxy-3-(1-methylethyl)amino material was obtained (analytical HPLC: gradient 70–100% propoxylphenylacetic acid hydrochloride 60 B over 20 min, A=0.1% TFA/water and B =0.1% TFA/ A solution of methyl 4-2-hydroxy-3-(1-methylethyl) acetonitrile, flow rate 1 ml/min, column Vydac 218TP54, amino-propoxyphenylacetate (563 mg, 2.00 mmol) in 6 M detection UV 214 nm, retention time 25 min). Further hydrochloric acid (15 ml) was heated at 100° C. for 4h. The characterisation was carried out using MALDI maSS Spec reaction mixture was concentrated (rotavapor) and the resi trometry (ACH matrix), giving M+H at 1258, expected due was taken up in water and lyophilised. "Hand 'C NMR 65 1257. spectra were in accordance with the strucure and MALDI d) Preparation of Gas-filled Microbubbles of DSPS Com mass Spectrometry gave a M+H at 268 as expected. prising a Lipopeptide Consisting of a Heparin Sulphate US 6,331,289 B1 97 98 Binding Peptide (KRKR) (SEQ ID NO:1) and a Fibronectin detectable level of compound from a) in the final wash Peptide (WOPPRARI) (SEQ ID NO:2) and a Lipopeptide Solution. Incorporation of chlorambucil cholesteryl ester Containing Atenolol into the bubbles was confirmed by MALDI-MS as follows: A solution of 1.4% propylene glycol/2.4% glycerol (1.0 ca 50 ul of microbubbles were transferred to a clean vial ml) was added to a mixture of DSPS (Avanti, 5.0 mg), containing ca 100 ul of 90% methanol. The mixture was product from a) (0.5 mg) and product from c) (0.5 mg) in a Sonicated for 30s and analysed by MALDI-MS, giving a vial. The mixture was Sonicated for 5 min and then heated M+H peak at 668 corresponding to structure from a). at 80° C. for 5 min (vial was shaken during warming). The In combination with a tumour specific vector these Solution was filtered and cooled. Head Space was flushed microbubbles are considered useful as targeted drug delivery with perfluorobutane gas and the vial was shaken in a cap agents. mixer for 45s followed by extensive washing with deionised Water. EXAMPLE 27 Incorporation of atenolol containing lipopeptide into the bubbles was confirmed by MALDI-MS as described in 15 Multiple-specific Gas-filled Microbubbles of DSPS example 1b). Comprising a Lipopeptide Containing Atenolol and e) In Vitro Study of Multiple-specific Gas-filled a Cholesterol Derivative of Chlorambucil for Microbubbles. Diagnostic and Therapeutic Applications a) Synthesis of a Protected Atenolol Derivative Suitable for In vitro analysis of the microbubble suspension was Solid Phase Coupling carried out as described in example 1c). A gradual accumu As described in example 25 section b). lation of the microbubbles on the cells took place which was b) Synthesis of a Lipopeptide Functionalised with Atenolol dependant on the flow rate. By increasing the flow rate the AS described in example 25 Section c). cells Started to become detached from the coverslip, the c) Synthesis of Cholesteryl 4-4-bis(2-chloroethyl)amino microbubbles were still bound to the cells. Control bubbles 25 phenylbutanoate not carrying the vector did not adhere to the endothelial cells AS described in example 25 Section d). and disappeared from the cells under minimal flow condi d) Preparation of Microbubbles of DSPS Comprising a tions. Lipopeptide Containing Atenolol and a Cholesteryl Ester of Chloambucil EXAMPLE 26 A solution of 1.4% propylene glycol/2.4% glycerol (1.0 PFB Gas-filled Microbubbles of DSPS Containing ml) was added to a mixture of DSPS (Avanti, 5.0 mg), a Cholesterol Ester of Chlorambucil for Diagnostic product from b) (0.5 mg) and c) (0.5 mg) and in a vial. The and Therapeutic Applications mixture was sonicated for 5 min and then warmed to 80° C. This example is directed at non-Specific modification of a for 5 min (vial was shaken during warming). The Solution multiplicity of cell receptors on endothelial cells. 35 was filtered and cooled. Head space was flushed with a) Synthesis of Cholesterol 4-4-bis(2-chloroethyl)amino perfluorobutane gas and the Vial was shaken in a cap mixer phenylbutanoate for 45 s followed by extensive washing with deionised DIC (170 ul, 1.10 mmol) was added to a solution of water. Incorporation of atenolol containing lipopeptide and chlorambucil (Sigma, 669 mg, 2.20 mmol) in dry dichlo 40 chlorabucil analogue into the bubble membrane was con romethane (15 ml). The mixture was stirred at room tem firmed by MALDI-MS as described in example 1c). perature for 0.5 h and added to a solution of cholesterol e) In Vitro Study of Multiple-specific PFB Gas-containing (Aldrich, 387 mg, 1.00 mmol) and DMAP (122 mg, 1.00 Microbubbles of DSPS Comprising a Lipopeptide Contain mmol) in dichloromethane (10 ml). The reaction mixture ing Atenolol and a Cholesterol Derivative of Chlorambucil was stirred overnight and then poured onto 5% sodium 45 for Diagnostic and Therapeutic Applications bicarbonate. The phases were separated and the organic The in vitro assay described in example 1c) was used to phase was washed with brine and dried (MgSO4). The assess cellular binding under flow conditions. A gradual Solution was filtered and concentrated and the product was accumulation of the microbubbles on the cells took place purified by column chromatography (Silica, chloroform) to 50 which was dependant on the flow rate. By increasing the give 560 mg (83%) yield of colouless oil. The product was flow rate the cells started to become detached from the characterised by MALDI mass spectrometry, giving M--H at coverslip, the microbubbles were still bound to the cells. 674 as expected. Further characterisation was carried out Control bubbles not carrying the vector did not adhere to the using H (500 MHz) and 'C (125 MHz) NMR analysis, endothelial cells and disappeared from the cells under mini giving spectra in accordance with the Structure. 55 mal flow conditions. b) Preparation of Gas-containing Microbubbles of DSPS Comprising a Cholesteryl Ester of Chloambucil for Diag EXAMPLE 28 nostic and/or Therapeutic Applications A solution of 1.4% propylene glycol/2.4% glycerol (1.0 Multiple-specific Gas-filled Microbubbles of DSPS 60 Comprising a Lipopeptide Containing Atenolol for ml) was added to a mixture of DSPS (Avanti, 4.5 mg) and Cell Targeting and a Lipophilic Thiol Ester of product from a) (0.5 mg) in a vial. The mixture was Captopril for Therapeutic use. Sonicated for 5 min and then heated at 80° C. for 5 min (vial a) Synthesis of a Protected Atenolol Derivative Suitable for was shaken during warming) and cooled. Head space was Solid Phase coupling flushed with perfluorobutane gas and the Vial was Shaken in 65 As described in example 25 section b). a cap mixer for 45s followed by extensive washing with b) Synthesis of a Lipopeptide Functionalised with Atenolol deionised water. MALDI mass spectrometry showed no AS described in example 25 Section c). US 6,331,289 B1 99 100 c) Synthesis of Cholanic Acid Thiol Ester of Captopril After filtration and evaporation the crude product was chro A mixture of 5-B-cholanic acid (Sigma, 361 mg, 1.00 matographed (silica, chloroform/methanol 99:1) to give 1.63 mmol) and DIC (77 ul, 0.50 mmol) in dichloromethane (5 g (97%) of white solid. The structure was confirmed by 'H ml) was stirred for 10 min and then added to a solution of NMR (500 MHz). captopril (Sigma, 130 mg, 0.600 mmol) and DBU (180 ul, b) Synthesis of Cholesterol B-alaninate Hydrochloride A solution of compound from a) (279 mg, 0.500 mmol) 1.20 mmol) in dichloromethane (10 ml). The reaction mix in 1 M hydrochloric acid in 1,4-dioxan (5 ml) was stirred at ture was stirred overnight and then poured onto dilute room temperature for 4 h. The reaction mixture was con hydrochloric acid. Chloroform (30 ml) was added. The centrated to give a quantitative yield of cholesteryl phases were separated and the organic phase was washed B-alaninate hydrochloride. The structure was confirmed by with water and brine and dried (MgSO). After filtration and 1H NMR (500 MHz) analysis and by MALDI mass concentration the crude material was chromatographed Spectrometry, giving a M+Na peak at 482, expected 481. (silica, chloroform/methanol/acetic acid 95:4:1). The prod c) Biotin-PEGoo-B-Ala-Cholesterol uct was lyophilised from a acetonitrile/water/ethanol mix To a solution of cholesteryl B-alaninate hydrochloride (15 ture. Yield 137 mg (49%) of off-white solid. The structure 15 mg, 0.03 mmol) in chloroform/wet methanol (2.6:1, 3 ml) was verified by H (500 MHz) and 'C (125 MHz) NMR was added triethylamine (42 ul, 0.30 mmol). The mixture Spectroscopy. Further characterisation was carried out using was stirred for 10 minutes at room temperature and a solution of biotin-PEG3400-NHS (100 mg, 0.03 mmol) in MALDI mass spectrometry, giving a M--Na peak in positive 1,4-dioxane (1 ml) was added dropwise. After stirring at mode at m/z 584. room temperature for 3 hours, the mixture was evapourated d) Preparation of Gas-filled Microbubbles of DSPS Com to dryneSS and the residue purified by flash chromatography prising a Lipopeptide Containing Atenolol for Cell Targeting to give white crystals, yield; 102 mg (89%). The structure and a Liiophilic Thiol Ester of Captopril for Therapeutic use. was verified by MALDI-MS and by NMR analysis. A solution of 1.4% propylene glycol/2.4% glycerol (1.0 d) Synthesis of Cholesteryl 4-4-bis(2-chloroethyl)amino ml) was added to a mixture of DSPS (Avanti, 5.0 mg) and 25 phenylbutanoate product from b) (0.5 mg) and c) (0.5 mg) in a vial. The DIC (170 ul, 1.10 mmol) was added to a solution of mixture was Sonicated for 5 min and then heated at 80 C. chlorambucil (Sigma, 669 mg, 2.20 mmol) in dry dichlo for 5 min (vial was shaken during warming) and cooled. romethane (15 ml). The mixture was stirred at room tem Head Space was flushed with perfluorobutane gas and the perature for 0.5 h and added to a solution of cholesterol vial was shaken in a cap mixer for 45s followed by extensive (Aldrich, 387 mg, 1.00 mmol) and DMAP (122 mg, 1.00 washing with deionised water. MALDI mass spectrometry mmol) in dichloromethane (10 ml). The reaction mixture showed no detectable level of compound from b) and c) in was stirred overnight then poured into a solution of 5% the final wash Solution. Incorporation of compounds from b) Sodium bicarbonate. The organic phase was washed with and from c) into the bubbles was confirmed by MALDI-MS brine and dried over MgSO. The solution was filtered and as follows. Ca. 50 ul of microbubbles were transferred to a 35 concentrated and the product was purified by column chro clean vial containing ca 100 ul of 90% methanol. The matography (silica, chloroform) to give 560 mg (83%) yield mixture was sonicated for 30s and analysed by MALDI-MS of colouless oil. The product was characterised by MALDI (ACH-matrix)...giving peaks according to structures from b) mass spectrometry, giving M-H at 674 as expected. Further and c), respectively. characterisation was carried out using H (500 MHz) and e) In Vitro Study of Gas-containing Microbubbles from d) 40 'C (125 MHz) NMR analysis, giving spectra in accordance The in vitro assay described in example 1c) was used to with the structure. assess cellular binding under flow conditions. A gradual e) Preparation of Gas-filled Microbubbles accumulation of the microbubbles on the cells took place A solution of 1.4% propylene glycol/2.4% glycerol (1.0 which was dependant on the flow rate. By increasing the ml) was added to a mixture of DSPS (Avanti, 5 mg) and flow rate the cells started to become detached from the 45 coverslip, the microbubbles were still bound to the cells. product from c) (0.5 mg) and d) (0.5 mg) in a vial. The Control bubbles not carrying the vector did not adhere to the mixture was Sonicated for 5 min and then heated at 80 C. endothelial cells and disappeared from the cells under mini for 5 min (vial was Shaken during warming) and cooled. mal flow conditions. Head Space was flushed with perfluorobutane gas and the vial was shaken in a cap mixer for 45s followed by extensive EXAMPLE 29 50 washing with deionised water. MALDI mass spectrometry showed no detectable level of compound from c and d) in the Gas-filled Microbubbles of Phosphatidylserine final wash Solution. Comprising Biotinamide-PEG-B-Ala-Cholesterol Incorporation of compounds from c) and d) into the and a Cholesterol Ester of Chlorambucil for bubbles was confirmed by MALDI-MS as described in Diagnostic and Therapeutic Applications 55 example 1b). a) Synthesis of Cholesterol N-Boc-B-alaninate DIC (510 ul) was added to a solution of Boc-f-Ala-OH EXAMPLE 30 (1.25 g, 6.60 mmol) in dichloromethane (15 ml) under an inert atmosphere. The reaction mixture was stirred for 30 Gas-filled Microbubbles of DSPS Comprising a min and then transferred to a flask containing a Solution of 60 Lipopeptide Containing Chlorambucil for cholesterol (1.16 g, 3.00 mmol) and DMAP (367 mg, 3.00 Diagnostic and Therapeutic Applications mmol) in dichloromethane (15 ml). The reaction mixture was stirred for 2 hand then mixed with an aqueous Solution This example is directed at the preparation of functiona of potassium hydrogensulphate. The phases were separated lised microbubbles with non-specific affinity for a multiplic and the aqueous phase extracted with chloroform. The 65 ity of cell Surface molecules. combined organic phases were washed with aqueous potas a) Synthesis of a Lipopeptide Containing Chlorambucil sium hydrogensulphate and water and dried over MgSO. (SEQ ID NO:20) US 6,331,289 B1 101

(SEQ ID NO: 20)

~s NH2

O O H H N N N NH2 E H E O l

O C

cCl

25 The Structure shown above was Synthesised on a manual The microbubbles were evaluated using the in vitro flow nitrogen bubbler starting with Fmoc protected Rink Amide assay described in example 1c). A gradual accumulation of MBHA resin (Novabiochem) on a 0.125 mmol scale. Stan the microbubbles on the cells took place which was depen dard amino acids were purchased from Novabiochem and palmitic acid from Fluka. Coupling was carried out using dant on the flow rate. By increasing the flow rate the cells standard TBTU/HOBt/DIEA protocol. Chlorambucil Started to become detached from the coverslip, the (Sigma) was coupled through the Side-chain of Lys as a microbubbles were still bound to the cells. Control bubbles Symmetrical anhydride using DIC preactivation. not carrying the vector did not adhere to the endothelial cells Simultaneous removal of the peptide from the resin and and disappeared from the cells under minimal flow condi deprotection of Side-chain protecting groups was carried out tions. in TEA containing 5% EDT, 5% water and 5% ethyl methyl 35 sulphide for 2 h. An aliqout of 10 mg of the crude material EXAMPLE 31 was purified by preparative liquid chromatography (Vydac 218TP1022 column) using a gradient of 70 to 100% B over Gas-filled Microbubbles of DSPS Comprising a 60 min (A=0.1% TFA/water and B=0.1% TFA/acetonitrile) Lipopeptide Containing Atenolol and a Lipophilic at a flow rate of 10 ml/min. After lyophilisation a yield of 30 Derivative of Captopril for Diagnostic and mg of pure material was obtained (analytical HPLC: gradi 40 Therapeutic Applications ent 70–100% B over 20 min, A=0.1% TFA/water and a) Synthesis of a Protected Atenolol Derivative Suitable for B=0.1% TFA/acetonitrile; flow rate 1 ml/min; column Vydac Solid Phase Coupling 218TP54; detection UV 214 nm; retention time 26.5 min). As described in example 25) b) Further characterisation was carried out using MALDI maSS b) Synthesis of N-(S)-3-hexadecylthio-2-methylpropionyl spectrometry, giving M--H at 1295, expected 1294. 45 proline b) Preparation of Qas-filled Microbubbles Comprising a DIEA (188 ul, 1.10 mmol) was added to a solution of Lipopeptide Containing Chlorambucil for Diagnostic and 1-iodohexadecane (176 mg, 0.500 mmol), captopril (120 Therapeutic Applications mg, 0.550 mmol) and DBU (165ul, 1.10 mmol) in tetrahy A solution of 1.4% propylene glycol/2.4% glycerol (1.0 drofuran (5 ml). The mixture was heated at 70° C. for 2h and ml) was added to a mixture of DSPS (Avanti, 4.5 mg) and 50 then concentrated. The residue was poured onto water product from a) (0.5 mg) in a vial. The mixture was Saturated with potassium hydrogensulphate and organic Sonicated for 5 min and then heated at 80° C. for 5 min (vial material was extracted into chloroform. The organic phase was shaken during warming) and cooled. Head space was was washed with water and dried (MgSO). The product flushed with perfluorobutane gas and the Vial was Shaken in purified by chromatography (silica, CHCl/MeOH/AcOH a cap mixer for 45s followed by extensive washing with 55 deionised water. MALDI mass spectrometry showed no 85:10:5) and lyophilised to give 105 mg (48%) of white detectable level of compound from a) in the final wash solid material. The structure was verified by 1H (500 MHz) Solution. and 13C (125 MHz) analysis and further characterised by Incorporation of chlorambucil containing lipopeptide into MALDI mass spectrometry, giving M-H in negative mode at the bubbles was confirmed by MALDI-MS as follows. Ca50 m/Z 440 as expected. All of microbubbles were transferred to a clean vial contain 60 c) Preparation of Gas-filled Microbubbles of DSPS Com ing ca 100 ul of 90% methanol. The mixture was Sonicated prising a Lipopeptide Containing Atenolol and a Lipophilic for 30s and analysed by MALDI-MS (ACH-matrix), giving Derivative of Captopril for Diagnostic and Therapeutic a M+H peak at 1300, expected at 1294 and a M+Na peak at Applications 1324, expected 1317. A solution of 1.4% propylene glycol/2.4% glycerol (1.0 c) In Vitro Study of Gas-containing Microbubbles of DSPS 65 ml) was added to a mixture of DSPS (Avanti, 4.5 mg), Doped with a Lipopeptide Containing Chlorambucil for product from b) (0.5 mg) and c) in a vial. The mixture was Diagnostic and Therapeutic Applications Sonicated for 5 min and then heated at 80° C. for 5 min (vial US 6,331,289 B1 103 104 was shaken during warming) and cooled. Head space was EXAMPLE 33 flushed with perfluorobutane gas and the Vial was Shaken in Gene Transfer by PFB Gas-filled Microbubbles a cap mixer for 45s followed by extensive washing with This example is directed at the preparation of targeted deionised water. MALDI mass spectrometry showed no microbubbles for gene transfer. detectable level of compound from b)or c) in the final wash 5 a) Preparation of DSPS Lipopeptide Bubbles/PFB Gas, Solution. Incorporation of compound b) and c) containing Coated with Polyl-L-lysine lipopeptide into the bubbles was confirmed by MALDI-MS DSPS (4.5 mg) and lipopeptide from 17b)(0.5 mg) were as described in example 1b). weighed in two 2-ml vials. To each vial, 0.8 ml d) In Vitro Study of Gas-containing Microbubbles of DSPS propyleneglycol/glycerol (4%) in water was added. The Comprising a Lipopeptide Containing Atenolol and a Lipo Solution was heated at 80 C. for 5 minutes and shaken. The philic Derivative of Captopril for Diagnostic and Therapeu Solution was then cooled to ambient temperature and the tic Applications headspace flushed with perfluorobutane. The vials were The microbubbles were evaluated using the in vitro flow Shaken on a Capmix (Espe Capmix, 4450 oscillations/min) assay described in example 1c). A gradual accumulation of for 45 seconds and put on a roller table for 5 minutes. The the microbubbles on the cells took place which was depen 15 content of the Vials were mixed and the Sample washed by dant on the flow rate. By increasing the flow rate the cells centrifugation at 2000 rpm for 5 minutes. The infranatant Started to become detached from the coverslip, the was removed and the same volume of distilled water added. microbubbles were still bound to the cells. Control bubbles The Washing procedure was repeated once. not carrying the vector did not adhere to the endothelial cells poly-L-lysine HBr (Sigma, 20.6 mg) was dissolved in 2 and disappeared from the cells under minimal flow condi mL water then an aliquot (0.4 mL) made up to 2 mL water. tions. To 1.2 mL of the diluted poly-L-lysine solution was added 0.12 mL of the DSPS-lipopeptide bubble suspension. Fol EXAMPLE 32 lowing incubation exceSS polylysine was removed by exten Sive Washing with water. Floatation of Endothelial Cells by DSPS 25 b) Transfection of Cells Microbubbles Comprising a Multiple-specific Endothelial cells (ECV304) were cultured in 6 well plates Lipopeptide that binds to the Endothelial Cells to a uniform Subconfluent layer. A transfection mixture consisting of 5 ug DNA (an Enhanced Green Fluorescent This example was carried out to show that the invention Protein vector from CLONTECH) and 50 ul of microbubble could also be used for cell Separation. suspension from a) in RPMI medium at a final volume of The human endothelial cell line ECV 304, derived from a 250 ul was prepared. The mixture was left standing for 15 normal umbilical cord (ATCC CRL-1998) was cultures in min at room temperature then 1 mL of complete RPMI Nunc culture flasks (chutney 153732) in RPMI 1640 medium added. The medium was removed from the cell medium (Bio Whitaker) to which L-Glutamine 200 mM, culture dish, and the DNA-microbubble mixture added to Penicillin/Streptomycin (10.000 U/ml and 10.00 mcg/ml) the cells. The cells were incubated in a cell culture incubator and 10% Fetal Calf Serum (Hyclone Lot no AFE 5183) were 35 (37° C). added. The cells were subcultured following trypsination c) Ultrasonic Treatment with a split ratio of 1:5 to 1:7 when reaching confluence. 2 After 15 minutes incubation, Selected wells were exposed mill. cells from trypsinated confluent cultures were added to to continious wave ultrasound of 1 MHz, 0.5 W/cm, for 30 a set of 5 centrifuge tubes followed by either control Seconds. microbubbles of DSPS, microbubbles from example 1 or 40 d) Incubation and Examination microbubbles of DSPS doped with the endothelial cell The cells were further incubated in the cell culture incu binding lipopeptide from example 14a) at a concentration of bator (37° C.) for approximately 4% hours. The medium 2, 4, 6.8 or 10 mill bubbles per tube. The cells at the bottom containing DNA-microbubbles was then removed by of the tubes after centrifugation at 400 g for 5 minutes were 45 aspiration, and 2 ml complete RPMI medium was added. counted by Coulter counter. It was found that binding of four The cells were incubated for 40-70 hours before examina or more microbubbles to a cell brought about floatation. tion. Most of the medium was then removed, and the cells Furthermore all cells were floated by the endothelial cell were examined by fluorescence microscopy. The results binding lipopeptide bubbles while around 50% were floated were compared to the results from control experiments were with microbubbles from example 1). DNA or DNA-polylysine were added to the cells.

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS: 27 <21 Oc SEQ ID NO 1 <211 LENGTH 4 <212> TYPE PRT <213> ORGANISM: Artificial Sequence <22O > FEATURE OTHER INFORMATION: Description of Artificial Sequence: Heparin sulphate binding peptide

<400 SEQUENCE: 1 Lys Arg Lys Arg US 6,331,289 B1 105 106

-continued

SEQ ID NO 2 LENGTH 8 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence:Fibronectin peptide

<400 SEQUENCE: 2 Trp Gln Pro Pro Arg Ala Arg Ile 1 5

SEQ ID NO 3 LENGTH 13 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence:Lipopeptide consisting of heparin sulphate binding peptide and fibronectin peptide NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine

<400 SEQUENCE: 3 Lys Lys Arg Lys Arg Trp Gln Pro Pro Arg Ala Arg Ile 1 5 10

SEQ ID NO 4 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic RGDC sequence

<400 SEQUENCE: 4 Arg Gly Asp Cys 1

SEQ ID NO 5 LENGTH 24 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic fusion peptide comprising a PS binding component and a fibronectin peptide sequence

<400 SEQUENCE: 5 Phe Asn. Phe Arg Lieu Lys Ala Gly Glin Lys Ile Arg Phe Gly Gly Gly 1 5 10 15 Gly Trp Gln Pro Pro Arg Ala Ile

SEQ ID NO 6 LENGTH 6 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence:Biotinylated endothelin-1 peptide NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Biotin-D-Trp <400 SEQUENCE: 6 US 6,331,289 B1 107 108

-continued

Trp Lieu. Asp Ile Ile Trp 1 5

<210 SEQ ID NO 7 &2 11s LENGTH 10 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence:Biotinylated fibrin-antipolymerant peptide <221 NAME/KEY: MODRES <222> LOCATION: (1) <223> OTHER INFORMATION: Biotin-Gly <221 NAME/KEY: MODRES <222> LOCATION: (10) &223> OTHER INFORMATION AMIDATION

<400 SEQUENCE: 7 Gly Pro Arg Pro Pro Glu Arg His Glin Ser 1 5 10

<210 SEQ ID NO 8 &2 11s LENGTH 6 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence:Lipopeptide <221 NAME/KEY: MODRES <222> LOCATION: (5) <223> OTHER INFORMATION: Biotinylated-lys <221 NAME/KEY: MODRES <222> LOCATION: (1) <223> OTHER INFORMATION: Dipalmitoyl-lysine <400 SEQUENCE: 8 Lys Trp Llys Lys Lys Gly 1 5

<210 SEQ ID NO 9 &2 11s LENGTH 25 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence:Biotinylated synthetic oligonucleotide <221 NAME/KEY: misc feature <222> LOCATION: (1) <223> OTHER INFORMATION: Biotinylated <400 SEQUENCE: 9 gaaagg tagt ggggtogtgt gcc.gg 25

<210> SEQ ID NO 10 &2 11s LENGTH 25 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence:Biotinylated synthetic oligonucleotide <221 NAME/KEY: misc feature <222> LOCATION: (1) <223> OTHER INFORMATION: Biotinylated <400 SEQUENCE: 10 ggcgct gatg atgttgttga ttctt 25

<210> SEQ ID NO 11 &2 11s LENGTH 5 &212> TYPE PRT US 6,331,289 B1 109 110

-continued ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence:Lipopeptide containing the RGD sequence and a fluorescein reporter group NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lys NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Acetyl-RGD-K-fluorescein side chain

<400 SEQUENCE: 11 Lys Lys Lys Lys Gly 1 5

SEQ ID NO 12 LENGTH 18 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic endothelial cell binding lipopeptide NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: 2-n-hexadecyl stearyl-lysine NAME/KEY: MODRES LOCATION: (18) OTHER INFORMATION AMIDATION

<400 SEQUENCE: 12 Lys Lieu Ala Lieu Lys Lieu Ala Lieu Lys Ala Lieu Lys Ala Ala Lieu Lys 1 5 10 15

Leu Ala

SEQ ID NO 13 LENGTH 5 TYPE PRT ORGANISM: Artificial Sequence FEATURE: NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: Acp OTHER INFORMATION: Description of Artificial Sequence: Thiol functionalised lipid molecule <400 SEQUENCE: 13 Lys Lys Lys Xala Cys 1 5

SEQ ID NO 14 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Amide-linked via side chain to captopril NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION AMIDATION OTHER INFORMATION: Description of Artificial Sequence: Synthetic lipopeptide functionalised with captopril

<400 SEQUENCE: 14 US 6,331,289 B1 111 112

-continued Lys Lys Lys Lys 1

SEQ ID NO 15 LENGTH 13 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic lipopeptide with affinity for endothelial cells NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Acp NAME/KEY: MOD RES LOCATION: (13) OTHER INFORMATION AMIDATION

<400 SEQUENCE: 15 Lys Lys Lys Xala Ile Arg Arg Val Ala Arg Pro Pro Leu 1 5

SEQ ID NO 16 LENGTH 14 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence:Lipopeptide comprising an interleukin 1 receptor binding peptide NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine

<400 SEQUENCE: 16 Lys Gly Asp Trp Asp Glin Phe Gly Lieu Trp Arg Gly Ala Ala 1 5

SEQ ID NO 17 LENGTH 12 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Core peptide comprising dabsylated-atherosclerotic plaque binding sequence and RGDS NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dabsylated-tyrosine NAME/KEY: MOD RES LOCATION: (10) OTHER INFORMATION: Arg-Gly-Asp-Ser chain linked via NH2 group of lysine

<400 SEQUENCE: 17 Tyr Arg Ala Lieu Val Asp Thr Lieu Lys Lys Gly Cys 1 5

SEQ ID NO 18 LENGTH 15 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence:Lipopeptide with an affinity for thrombi NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine NAME/KEY: MODRES LOCATION: (15) US 6,331,289 B1 113 114

-continued

&223> OTHER INFORMATION AMIDATION

SEQUENCE: 18 Lys Asn Asp Gly Asp Phe Glu Glu Ile Pro Glu Glu Tyr Lieu Glin 1 5 15

SEQ ID NO 19 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence:Lipopeptide functionalised with atenolol NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to atenolol NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION AMIDATION

<400 SEQUENCE: 19 Lys Lys Lys Lys 1

SEQ ID NO 20 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence:Lipopeptide containing chlorambucil NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to chlorambucil NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION AMIDATION

<400 SEQUENCE: 20 Lys Lys Lys Lys 1

SEQ ID NO 21 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic RGDS sequence

<400 SEQUENCE: 21 Arg Gly Asp Ser 1

SEQ ID NO 22 LENGTH 9 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Atherosclerotic plaque-binding peptide <400 SEQUENCE: 22 US 6,331,289 B1 115 116

-continued

Tyr Arg Ala Lieu Val Asp Thr Lieu Lys 1 5

<210> SEQ ID NO 23 &2 11s LENGTH 16 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Atherosclerotic plaque-binding peptide <400 SEQUENCE: 23 Tyr Ala Lys Phe Arg Glu Thir Lieu Glu Asp Thr Arg Asp Arg Met Tyr 1 5 10 15

<210> SEQ ID NO 24 &2 11s LENGTH 17 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Atherosclerotic plaque-binding peptide <400 SEQUENCE: 24 Arg Ala Lieu Val Asp Thr Glu Phe Lys Val Lys Glin Glu Ala Gly Ala 1 5 10 15 Lys

<210> SEQ ID NO 25 <211& LENGTH: 14 212s. TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Thrombus binding peptide

<400 SEQUENCE: 25 Asn Asp Gly Asp Phe Glu Glu Ile Pro Glu Glu Tyr Lieu Glin 1 5 10

<210> SEQ ID NO 26 <211& LENGTH 4 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Thrombus binding peptide

<400 SEQUENCE: 26 Gly Pro Arg Gly 1

<210 SEQ ID NO 27 &2 11s LENGTH 13 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Platelet binding peptide

<400 SEQUENCE: 27 Pro Leu Tyr Lys Lys Ile Ile Lys Lys Lieu Lieu Glu Ser 1 5 10 US 6,331,289 B1 117 118 What is claimed is: adhesion proteins which have corresponding ligands on 1. A targetable diagnostic and/or therapeutically active endothelial cell Surfaces. agent comprising a Suspension in an aqueous carrier liquid 12. An agent as claimed in claim 1 wherein the vectors are of a reporter comprising gas-containing material in the form sited Such that they are not readily exposed to the target. of phospholipid-Stabilized gas microbubbles, Said reporter 13. An agent as claimed in claim 1 wherein the vectors are being conjugated to more than one type of vector, the vectors coupled or linked to the reporter by means of avidin-biotin binding to different targets on the same or different cells. and/or Streptavidin-biotin interactions. 2. An agent as claimed in claim 1 wherein the gas is 14. An agent as claimed in claim 1 wherein the vectors Selected from the group consisting of air, nitrogen, oxygen, may be covalently or non-covalently coupled or linked to the carbon dioxide, hydrogen, an inert gas, a Sulphur fluoride, reporter. Selenium hexafluoride, a low molecular weight hydrocarbon, a ketone, an ester, a halogenated low molecu 15. An agent as claimed in claim 1 wherein the vectors are lar weight hydrocarbon or a mixture of any of the foregoing. coupled or linked to the reporter by means of electroStatic 3. An agent as claimed in claim 2 wherein the gas is charge interaction. Selected from the group consisting of a perfluorinated 15 16. An agent as claimed in claim 1 which further contains ketone, perfluorinated ether and a perfluorocarbon. moieties which are radioactive or are effective as X-ray 4. An agent as claimed in claim 2 wherein the gas is contrast agents, light imaging probes or Spin labels. Selected from the group consisting of Sulphur hexafluoride, 17. An agent as claimed in claim 1 further comprising a perfluoropropane, perfluorobutane and perfluoropentane. therapeutic compound. 5. An agent as claimed in claim 1 wherein at least 75% of 18. An agent as claimed in claim 17 wherein said thera the phospholipid comprises phospholipid molecules indi peutic compound is an antineoplastic agent, blood product, vidually bearing net overall charge. biological response modifier, antifungal agent, hormone or 6. An agent as claimed in claim 5 wherein at least 75% of hormone analogue, Vitamin, enzyme, antiallergic agent, tis the phospholipids are Selected from the group consisting of Sue factor inhibitor, platelet inhibitor, coagulation protein phosphatidyl Serine S, phosphatidylglycerols, 25 target inhibitor, fibrin formation inhibitor, fibrinolysis phosphatidylinositols, phosphatidic acids and cardiolipins. promoter, antiangiogenic, circulatory drug, metabolic 7. An agent as claimed in claim 6 wherein at least 80% of potentiator, antitubercular, antiviral, vasodilator, antibiotic, Said phospholipids are phosphatidylserines. antiinflammatory, antiprotozoan, antirheumatic, narcotic, 8. An agent as claimed in claim 1, wherein Said gas opiate, cardiac glycoside, neuromuscular blocker, Sedative, containing material further comprises moieties capable of local anaesthetic, general anaesthetic or genetic material. binding to a receptor System So as to induce a therapeutic 19. An agent as claimed in claim 17 wherein said thera response. peutic compound is covalently coupled or linked to the 9. An agent as claimed in claim 1 wherein the vectors are reporter through disulphide groups. Selected from the group consisting of antibodies, cell adhe 20. An agent as claimed in claim 17 wherein a lipophilic Sion molecules, cell adhesion molecule receptors, cytokines, 35 or lipophilically-derivatised therapeutic compound is linked growth factors, peptide hormones, non-bioactive binders of to the reporter through hydrophobic interactions. receptors for cell adhesion molecules, cytokines, growth 21. A process for the preparation of a targetable diagnostic factors and peptide hormones, oligonucleotides and modi and/or therapeutically active agent as defined in claim 1 fied oligonucleotides, DNA-binding drugs, protease which comprises coupling or linking more than one type of Substrates/inhibitors, and proteins and peptides which bind 40 vector to the reporter comprising gas-containing material to cell-Surface proteoglycans. wherein the vectors bind to different targets on the same or 10. An agent as claimed in claim 1 wherein the vectors different cells. have affinity for targets at a level Such that the agent interacts 22. A proceSS as claimed in claim 21 wherein a therapeutic with but does not fixedly bind to said targets. compound is also combined with the reporter. 11. An agent as claimed in claim 10 wherein the vectors 45 are Selected from ligands for cell adhesion proteins and cell