DOCSLIB.ORG

Improving Cellulase Production in Submerged Fermentation by the Expression of a Vitreoscilla Hemoglobin in Trichoderma Reesei

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Improving Cellulase Production in Submerged Fermentation by the Expression of a Vitreoscilla Hemoglobin in Trichoderma Reesei Lin et al. AMB Expr (2017) 7:203 DOI 10.1186/s13568-017-0507-x ORIGINAL ARTICLE Open Access Improving cellulase production in submerged fermentation by the expression of a Vitreoscilla hemoglobin in Trichoderma reesei Jie Lin1,2 , Xiamei Zhang1,2, Bingran Song1,2, Wei Xue1, Xiaoyun Su3, Xiuzhen Chen1* and Zhiyang Dong1,2* Abstract Trichoderma reesei is well known as an industrial workhorse fungus in cellulase production. The low dissolved oxy- gen supply in the highly viscous medium of T. reesei remains a major bottleneck that hampers growth and cellulase production in submerged fermentation. Vitreoscilla hemoglobin (VHb) has been demonstrated to improve metabo- lism and protein production in diferent heterologous hosts under hypoxic conditions, but the use of VHb in T. reesei remains uninvestigated. This study examines the efect of VHb in improving T. reesei performance in submerged fer- mentation. The VHb gene (vgb)-expressing cassette was successfully transformed into the TU-6 strain, integrated into the genome of T. reesei, and functionally expressed with biological activity, which was confrmed by carbon monoxide diference analysis. Compared to the parent strain, the expression of VHb increased the glucose consumption rate of the transformant. Moreover, in cellulase-inducing medium total protein secretion of the VHb expressing strain was 2.2-fold of the parental strain and the flter paper cellulase activity was increased by 58% under oxygen-limiting condi- tions. In summary, our results demonstrate that VHb has benefcial efects on improving total protein secretion and cellulase activity of T. reesei in submerged fermentation. Keywords: Trichoderma reesei, Vitreoscilla hemoglobin, Submerged fermentation, Oxygen limitation, Cellulase Introduction a major obstacle that hinders scale-up of biotransforma- Lignocellulosic biomass is the most abundant renewable tion of lignocellulose (Klein-Marcuschamer et al. 2012). resource on Earth. Te bioconversion of lignocellulose Strategies that can improve cellulase production will be into liquid biofuels and biochemicals using enzymatic of great value for the efcient utilization of lignocellulose depolymerization with subsequent microbial fermenta- and the reduction of cellulase cost. tion is an important strategy in dealing with the global Trichoderma reesei (teleomorph Hypocrea jecorina) is energy shortage as well as associated environmental one of the most important commercial cellulase producers problems (Gupta and Verma 2015). Cellulase can ef- and has been widely used in a variety of industries, includ- ciently degrade the complex polysaccharide components ing food, feed and biorefnery (Bouws et al. 2008; Schus- of lignocellulosic into monomeric sugars, which is a key ter and Schmoll 2010). In industry, cellulase is produced process in biomass bioconversion (Sun and Cheng 2002). by T. reesei mainly by way of submerged fermentation, Te high cost of cellulase production, however, remains which is an aerobic fermentation process with a long cul- ture period. Tus, adequate dissolved oxygen is required to maintain cell growth and metabolism during the liquid- *Correspondence: [email protected]; [email protected] state fermentation. However, the high viscosity of the cul- 1 Institute of Microbiology, Chinese Academy of Sciences, No. 1 West tures severely hinders mass mixing and oxygen transfer, Beichen Road, Chaoyang District, Beijing 100101, People’s Republic of China which directly leads to metabolic activity slowdown, cell Full list of author information is available at the end of the article growth retardation and even cell death. Consequently, © The Author(s) 2017. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. Lin et al. AMB Expr (2017) 7:203 Page 2 of 8 fermentation production of cellulase is hampered (Peciu- uridine was added to the culture medium for TU-6. All lyte et al. 2014). Traditional approaches such as increasing DNA manipulations were carried out in Escherichia coli agitation rate or ventilation to enhance oxygen supply are strain DH5α (TransGen Biotech, Beijing, China). costly and often have little efect on ameliorating the oxy- gen limitation (Serrano-Carreon et al. 2015). Plasmid construction and fungal transformation Te bacterial hemoglobin (VHb) from the obligate aero- Te plasmids pUCVHb and pNOM102 (Roberts et al. bic bacterium Vitreoscilla is an oxygen-binding protein, 1989) were kindly provided by Professor Guomin Tang functioning as an oxygen carrier and transporter (Waka- from the Institute of Microbiology, Chinese Academy bayashi et al. 1986). In bacteria (Horng et al. 2010), yeasts of Sciences. Te vgb gene (GenBank accession number: (Wu and Fu 2012), plants (Jokipii et al. 2008) and animals L21670) encoding the Vitreoscilla hemoglobin protein (Pendse and Bailey 1994), the introduction of VHb has was cloned from the pUCVHb plasmid with the prim- been proven to efciently facilitate cellular aerobic metab- ers VHb-F and VHb-R (Table 1). Te pNOM102 vector olism, by which the growth rate and protein synthesis backbone, which contained the strong constitutive Asper- are improved under oxygen-limited conditions. Recently, gillus nidulans gpdA promoter (PgpdA) and trpC termi- examples have demonstrated that this strategy also works nator (TtrpC), was amplifed with the primers TRP-F and well in flamentous fungi. For example, VHb expression GPD-R (Table 1). Te plasmid pNOM102-VHb was con- increased the yields of biomass, protease and exopecti- structed by placing the vgb gene under the control of the nases of Aspergillus sojae in solid-state fermentation, in gpdA promoter and trpC terminator with a MultiS One- which strains encounter oxygen transfer problems (Mora- Step Cloning Kit (Vazyme Biotech, Nanjing, China). Lugo et al. 2015). Paecilomyces lilacinus carrying the vgb Te vgb-expression cassette (Fig. 1a) was amplifed with gene has also been shown to yield higher amounts of bio- the primers M13F and M13R (Table 1) from pNOM102- mass, protease and chitinase under hypoxic conditions VHb and co-transformed into the TU-6 strain with the during submerged fermentation, which improves the plasmid pSK-pyr4 (Qin et al. 2012) via the PEG-medi- value of this biocontrol fungus in practical applications ated protoplast transformation method (Pentillä et al. (Zhang et al. 2014). In Aspergillus niger, secreted metabo- 1987). Transformants were selected on an MM (minimal lites and oxygen uptake were analyzed and demonstrated medium) plate without uridine. that VHb expression technology is an efective strategy to reduce unwanted side efects of oxygen limitation during Analysis of fungal transformants submerged fermentation, and was particularly benefcial To confrm the chromosomal integration of the heter- to flamentous fungi where oxygen transfer to the cell is ologous vgb gene, genomic DNA from both the paren- often limited by the highly viscous broth (Hofmann et al. tal TU-6 strain and the transformants were isolated 2009). However, this strategy has not been explored in the and used as templates. PCR analysis was performed to industrial strain T. reesei until now. amplify the vgb-expression cassette with the specifc In this study, we report for the frst time application primer pairs TF/TR (Table 1). of the VHb expression technology in T. reesei. Te VHb For western blot analysis, the TU-6 and the verifed gene (vgb) was successfully integrated into the T. ree- TU6-vgb+ strains were grown in glucose medium for sei genome, and the efects of VHb expression on the 48 h at 28 °C at 200 rpm. Mycelia were then collected and growth, total protein secretion and production of cellu- washed twice with sterilized water for protein extraction. lase were analyzed. Our study provides an efcient means Equal amounts of mycelia were ground into powder with to improve the endogenous cellulase production of T. liquid nitrogen, homogenized in 50 mM potassium phos- reesei, and sheds light on improving exogenous protein phate bufer (pH 7.0) and centrifuged at 4 °C at 5000g for expression. Table 1 Primers used in this study Materials and methods Primer Primer sequence (5′–3′) Strains and media VHb-F AGACATCACAATGTTAGACCAGCAAACCAT Te T. reesei TU-6 strain (ATCC MYA-256, a uridine VHb-R TTAATGATGATGATGATGATGTTCAACCGCTTGAGCGTA auxotrophic strain) was grown at 28 °C for 7–10 days on TRP-F ATCATCATCATCATCATTAAGGATCCACTTAACGTTACTG potato dextrose agar (PDA) plates supplemented with GPD-R GGTCTAACATTGTGATGTCTGCTCAAGCGG 5 mM uridine for sporulation. Minimal medium (Pen- TF AAGGATTTCGGCACGGCTAC tillä et al. 1987) was supplemented with 2% glucose or TR GCACTCTTTGCTGCTTGGAC 1% Avicel PH101 (Sigma-Aldrich, St. Louis, MO) as the M13F GTAAAACGACGGCCAGT sole carbon source and used for fungal vegetative growth M13R CAGGAAACAGCTATGACC and fermentation, respectively. When necessary, 5 mM The underlined nucleotide sequence represents the C-terminal 6 His tag × Lin et al. AMB Expr (2017) 7:203 Page 3 of 8 glucose concentration of the culture medium during growth was determined using a modifed glucose oxi- dase method (Trinder 1969). Te dry weight of the har- vested mycelia was measured according to a previously described protocol (Aro et al. 2003). Microscopic images were captured
Load more

Recommended publications
  • Comparison of Fatty Acid Content and DNA Homology of the Filamentous Gliding Bacteria Vitreoscilla, Flexibacter, Filibacter
    Archives of Arch Microbiol (1986) 146 : 1 - 6 Hicrebiology Springer-Verlag ~986 Original papers Comparison of fatty acid content and DNA homology of the filamentous gliding bacteria Vitreoscilla, Flexibacter, Filibacter Peter Nichols ~, *, Benne K. Stulp ~, J. Gwynfryn Jones 2, and David C. White ~ 1 Department of Biological Science, Florida State University, Tallahassee, FL 32306, USA 2 Freshwater Biological Association, The Ferry House, Ambleside, Cumbria, LA22 0LP, UK Abstract. DNA hybridization experiments showed that there Measurement of DNA homology and analysis of cell was a high degree of homology among Vitreoscilla strains fatty acid profiles have become standard tools in but not with DNA from Filibacter limicola. Flexibacter spp chemotaxonomy (Goodfellow and Minnikin 1985). Bac- were much more heterogeneous indicating a low genetic terial fatty acids are also used as biomarkers in microbial similarity. These results were also reflected in the membrane ecology and often provide valuable information on the fatty acids of the bacteria. The VitreosciIla strains were very structure of the microbial community when other methods similar with the 16:1~07c fatty acid being dominant. The fail (White 1983). Finally, fatty acids provide the geochemist membrane fatty acids of F. limicola were dominated by with an historical record of the sediment biota (Cranwell a15:0 and a17:0 components which provided additional 1982). Filamentous bacteria present a challenge to both support for its relatedness to the genus Bacillus. There was ecologists and taxonomists. Their role in aquatic sediments much greater diversity in the fatty acid patterns of the and their taxonomic relationships are imperfectly under- Flexibacter spp. F.
    [Show full text]
  • Vitreoscilla Hemoglobin in Escherichia Coli ROGER A
    APPLIED AND ENVIRONMENTAL MICROBIOLOGY, JUlY 1994, p. 2431-2437 Vol. 60, No. 7 0099-2240/94/$04.00+0 Copyright C) 1994, American Society for Microbiology Effect of Biosynthetic Manipulation of Heme on Insolubility of Vitreoscilla Hemoglobin in Escherichia coli ROGER A. HART,t PAULI T. KALLIO,t AND JAMES E. BAILEY* Division of Chemistry and Chemical Engineering, Califomia Institute of Technology, Pasadena, Califomia 91125 Received 15 December 1993/Accepted 10 May 1994 Vitreoscilla hemoglobin (VHb) is accumulated at high levels in both soluble and insoluble forms when expressed from its native promoter on a pUC19-derived plasmid in Escherichia coli. Examination by atomic absorption spectroscopy and electron paramagnetic resonance spectroscopy revealed that the insoluble form uniformly lacks the heme prosthetic group (apoVHb). The purified, soluble form contains heme (holoVHb) and is spectroscopically indistinguishable from holoVHb produced by VitreosciMla cells. This observation suggested that a relationship may exist between the insolubility of apoVHb and biosynthesis of heme. To examine this possibility, a series of experiments were conducted to chemically and genetically manipulate the formation and conversion of 5-aminolevulinic acid (ALA), a key intermediate in heme biosynthesis. Chemical perturbations involved supplementing the growth medium with the intermediate ALA and the competitive inhibitor levulinic acid which freely cross the cell barrier. Genetic manipulations involved amplifying the gene dosage for the enzymes ALA synthase and ALA dehydratase. Results from both levulinic acid and ALA supplementations indicate that the level of soluble holoVHb correlates with the heme level but that the level of insoluble apoVHb does not. The ratio of soluble to insoluble VHb also does not correlate with the level of total VHb accumulated.
    [Show full text]
  • A New Symbiotic Lineage Related to Neisseria and Snodgrassella Arises from the Dynamic and Diverse Microbiomes in Sucking Lice
    bioRxiv preprint doi: https://doi.org/10.1101/867275; this version posted December 6, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. A new symbiotic lineage related to Neisseria and Snodgrassella arises from the dynamic and diverse microbiomes in sucking lice Jana Říhová1, Giampiero Batani1, Sonia M. Rodríguez-Ruano1, Jana Martinů1,2, Eva Nováková1,2 and Václav Hypša1,2 1 Department of Parasitology, Faculty of Science, University of South Bohemia, České Budějovice, Czech Republic 2 Institute of Parasitology, Biology Centre, ASCR, v.v.i., České Budějovice, Czech Republic Author for correspondence: Václav Hypša, Department of Parasitology, University of South Bohemia, České Budějovice, Czech Republic, +42 387 776 276, [email protected] Abstract Phylogenetic diversity of symbiotic bacteria in sucking lice suggests that lice have experienced a complex history of symbiont acquisition, loss, and replacement during their evolution. By combining metagenomics and amplicon screening across several populations of two louse genera (Polyplax and Hoplopleura) we describe a novel louse symbiont lineage related to Neisseria and Snodgrassella, and show its' independent origin within dynamic lice microbiomes. While the genomes of these symbionts are highly similar in both lice genera, their respective distributions and status within lice microbiomes indicate that they have different functions and history. In Hoplopleura acanthopus, the Neisseria-related bacterium is a dominant obligate symbiont universally present across several host’s populations, and seems to be replacing a presumably older and more degenerated obligate symbiont.
    [Show full text]
  • Studies on the Filamentous Gliding Bacteria Laura Frances Biggs
    University of Plymouth PEARL https://pearl.plymouth.ac.uk 04 University of Plymouth Research Theses 01 Research Theses Main Collection 2003 Studies on the filamentous gliding bacteria Vitreoscilla stercoraria Biggs, Laura Frances http://hdl.handle.net/10026.1/2513 University of Plymouth All content in PEARL is protected by copyright law. Author manuscripts are made available in accordance with publisher policies. Please cite only the published version using the details provided on the item record or document. In the absence of an open licence (e.g. Creative Commons), permissions for further reuse of content should be sought from the publisher or author. Studies on the filamentous gliding bacteria Vitreoscilla stercoraria By Laura Frances Biggs A thesis submitted to the University of Plymouth in partial fulfilment for the degree of Doctor of Philosophy School of Biological Sciences Faculty of Science December 2003 Ill Abstract Strains of Vitreoscil/a stercoraria were isolated from the environment and characterised. Cell width, motility and requirement of each strain for sodium chloride were investigated. Two strains were selected for further study and the effect of monensin and FCCP on growth of the strains was investigated. One strain of Vitreoscil/a (l813) was chosen for further study, cells from strain LB 13 were found to be 1.38 J..lm ± 0.041 (± 1 SEM, n=1 0) wide, were motile by gliding and had an optimum requirement for sodium chloride for growth of 43 mM. The organism was grown in batch culture and respiratory membranes were isolated. Cytochrome bo was extracted from the respiratory membranes and further purification was achieved using column chromatography.
    [Show full text]
  • Expression of Vitreoscilla Hemoglobin in Gordonia Amarae Enhances Biosurfactant Production
    J Ind Microbiol Biotechnol (2006) 33: 693–700 DOI 10.1007/s10295-006-0097-0 ORIGINAL PAPER Ilhan Dogan Æ Krishna R. Pagilla Æ Dale A. Webster Benjamin C. Stark Expression of Vitreoscilla hemoglobin in Gordonia amarae enhances biosurfactant production Received: 22 June 2005 / Accepted: 29 January 2006 / Published online: 21 February 2006 Ó Society for Industrial Microbiology 2006 Abstract The gene (vgb) encoding Vitreoscilla (bacterial) Introduction hemoglobin (VHb) was electroporated into Gordonia amarae, where it was stably maintained, and expressed 1 Release of organic contaminants into the environment at about 4 nmol VHb gÀ of cells. The maximum cell can be problematic because of their toxicity and their mass (OD )ofvgb-bearing G. amarae was greater than 600 stability. Bioremediation by microorganisms, however, that of untransformed G. amarae for a variety of media can often be an effective method to clean up contami- and aeration conditions (2.8-fold under normal aeration nated sites [29]. and 3.4-fold under limited aeration in rich medium, and Use of biologically produced surfactants as a tool in 3.5-fold under normal aeration and 3.2-fold under lim- bioremediation has become a subject of increasing ited aeration in mineral salts medium). The maximum study, as they can dramatically increase the apparent level of trehalose lipid from cultures grown in rich solubility of insoluble and sparingly soluble compounds medium plus hexadecane was also increased for the re- so that they can be taken up by cells and metabolized combinant strain, by 4.0-fold in broth and 1.8-fold in [19].
    [Show full text]
  • Microbiome-Assisted Carrion Preservation Aids Larval Development in a Burying Beetle
    Microbiome-assisted carrion preservation aids larval development in a burying beetle Shantanu P. Shuklaa,1, Camila Plataa, Michael Reicheltb, Sandra Steigerc, David G. Heckela, Martin Kaltenpothd, Andreas Vilcinskasc,e, and Heiko Vogela,1 aDepartment of Entomology, Max Planck Institute for Chemical Ecology, 07745 Jena, Germany; bDepartment of Biochemistry, Max Planck Institute for Chemical Ecology, 07745 Jena, Germany; cInstitute of Insect Biotechnology, Justus-Liebig-University of Giessen, 35392 Giessen, Germany; dEvolutionary Ecology, Institute of Organismic and Molecular Evolution, Johannes Gutenberg University, 55128 Mainz, Germany; and eDepartment Bioresources, Fraunhofer Institute for Molecular Biology and Applied Ecology, 35394 Giessen, Germany Edited by Nancy A. Moran, The University of Texas at Austin, Austin, TX, and approved September 18, 2018 (received for review July 30, 2018) The ability to feed on a wide range of diets has enabled insects to their larvae, thereby modifying the carcass substantially (12, 23, 26, diversify and colonize specialized niches. Carrion, for example, is 27). Application of oral and anal secretions is hypothesized to highly susceptible to microbial decomposers, but is kept palatable support larval development (27), to transfer nutritive enzymes (21, several days after an animal’s death by carrion-feeding insects. Here 28, 29), transmit mutualistic microorganisms to the carcass (10, 21, we show that the burying beetle Nicrophorus vespilloides preserves 22, 30), and suppress microbial competitors through their antimi- – carrion by preventing the microbial succession associated with car- crobial activity (11, 23, 31 34). The secretions inhibit several Gram- rion decomposition, thus ensuring a high-quality resource for their positive and Gram-negative bacteria, yeasts, and molds (11, 31, 35), developing larvae.
    [Show full text]
  • 81 Review Article Vitreoscilla Sp. Hemoglobin (Vhb) Expression In
    Qaralleh et al., 2019 J. basic appl. Res biomed 5(2): 81-88 BAAR JournalJ of Basic and Applied Research in Biomedicine ISSN 2413-7014 Review Article Vitreoscilla sp. hemoglobin (VHb) Expression in Heterologous Hosts: Some Aspects of Their Biotechnological Application Haitham Qarallehb, Muhamad O. Al-limouna, Khaled M. Khleifata, Khaled Y Alsharafaa, Amjad A. Al c Tarawneh aBiology Department, Mutah University, Mutah, Karak, 61710, Jordan; bDepartment of Medical Laboratory Sciences, Mutah University, Mutah, Karak, 61710, Jordan; cPrince Faisal Center for Dead Sea, Environmental and Energy Research, Mutah University, Karak, Jordan *Corresponding author: [email protected] Received: 3-7-2019 Abstract: It is worth mentioning that the high output of different physiological Revised: 3-9-2019 responses under the expression of vgb, may have a considerable effect on the Published: 15-9-2019 enzyme productivity, dairy industry, heavy metal uptake, biodegradation of different organic pollutants and other applications. The expression of bacterial Keywords: Vitreoscilla, haemoglobin is useful in lessening the load of perceived toxic conditions such Haemoglobin, as high oxygen levels. This in turn probably has the same impact on some Biodegradation peripheral toxic materials. This, hemoglobin biotechnology can be extended to enhance production of pollutants degrading enzymes or production of some valuable manufacturing materials on the case-by-case bases. It is likely that the mechanism of bacterial hemoglobin (VHb) effects is intermediated via an oxygen trapping action. This may drive the enrichment of ATP production, which is mostly required for higher productivity of needed substances for that activity. Cite this article as Qaralleh, H., Al-limoun, M.O., Khleifat, K.M, Alsharafa, K.Y., Al Tarawneh, A.A.
    [Show full text]
  • 1 Supporting Information Disturbance Opens Recruitment Sites for Bacterial
    Supporting Information Disturbance opens recruitment sites for bacterial colonization Vuono et al. SI Materials and Methods Biodiversity analysis. Biodiversity analyses were accomplished in the R environment for statistical computing (http://www.r-project.org/). Briefly, the Vegan package (1) was used to calculate Hill diversities of orders 0≤q≤2, and permutational multivariate analysis of variance (MANOVA or ADONIS) with 999 permutations to test for significant differences in community structure between treatment groups. Hill diversities are interpreted as the effective number of species, or a community of S equally abundant species; these diversity measurements produce ecologically intuitive quantities that possess mathematical doubling properties. Thus, diversity can be compared on a linear scale that implies the magnitude of difference between community assemblages (2, 3). Multivariate cutoff level analysis (MultiCoLA) was performed with Spearman correlation coefficients between full and reduced datasets (singletons excluded) as described by (4). To assess shared bacterial diversity between influent and sludge samples, a dendrogram displaying the clustering pattern of bacterial OTUs was constructed by the complete linkage hierarchical clustering algorithm in hcluster (Damian Eads, code.google.com/p/scipy-cluster) as described by (5). The corresponding heatmap (Figure 4), which displays relative abundance of bacterial OTUs in the dendrogram, was constructed with custom Python scripts from (5) that incorporated Python modules from Matplotlib (6). The software package Explicet v2.9.4 (www.explicet.org) was used to calculate Two-Part statistics (7) and generate figures (8). 1 Null model consideration. The standardized effect size of each community’s mean phylogenetic distance (MPD) was estimated (Picante package in R; (9)) by comparing it to the rarified values of 999 randomized communities generated from null models as described by (10).
    [Show full text]
  • International Code of Nomenclature of Prokaryotes
    2019, volume 69, issue 1A, pages S1–S111 International Code of Nomenclature of Prokaryotes Prokaryotic Code (2008 Revision) Charles T. Parker1, Brian J. Tindall2 and George M. Garrity3 (Editors) 1NamesforLife, LLC (East Lansing, Michigan, United States) 2Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Braunschweig, Germany) 3Michigan State University (East Lansing, Michigan, United States) Corresponding Author: George M. Garrity ([email protected]) Table of Contents 1. Foreword to the First Edition S1–S1 2. Preface to the First Edition S2–S2 3. Preface to the 1975 Edition S3–S4 4. Preface to the 1990 Edition S5–S6 5. Preface to the Current Edition S7–S8 6. Memorial to Professor R. E. Buchanan S9–S12 7. Chapter 1. General Considerations S13–S14 8. Chapter 2. Principles S15–S16 9. Chapter 3. Rules of Nomenclature with Recommendations S17–S40 10. Chapter 4. Advisory Notes S41–S42 11. References S43–S44 12. Appendix 1. Codes of Nomenclature S45–S48 13. Appendix 2. Approved Lists of Bacterial Names S49–S49 14. Appendix 3. Published Sources for Names of Prokaryotic, Algal, Protozoal, Fungal, and Viral Taxa S50–S51 15. Appendix 4. Conserved and Rejected Names of Prokaryotic Taxa S52–S57 16. Appendix 5. Opinions Relating to the Nomenclature of Prokaryotes S58–S77 17. Appendix 6. Published Sources for Recommended Minimal Descriptions S78–S78 18. Appendix 7. Publication of a New Name S79–S80 19. Appendix 8. Preparation of a Request for an Opinion S81–S81 20. Appendix 9. Orthography S82–S89 21. Appendix 10. Infrasubspecific Subdivisions S90–S91 22. Appendix 11. The Provisional Status of Candidatus S92–S93 23.
    [Show full text]
  • The Biochemistry of Vitreoscilla Hemoglobin
    Volume No: 3, Issue: 4, October 2012, e201210002, http://dx.doi.org/10.5936/csbj.201210002 CSBJ The Biochemistry of Vitreoscilla hemoglobin Benjamin C. Stark a,*, Kanak L. Dikshit b, Krishna R. Pagilla c Abstract: The hemoglobin (VHb) from Vitreoscilla was the first bacterial hemoglobin discovered. Its structure and function have been extensively investigated, and engineering of a wide variety of heterologous organisms to express VHb has been performed to increase their growth and productivity. This strategy has shown promise in applications as far-ranging as the production of antibiotics and petrochemical replacements by microorganisms to increasing stress tolerance in plants. These applications of “VHb technology” have generally been of the “black box” variety, wherein the endpoint studied is an increase in the levels of a certain product or improved growth and survival. Their eventual optimization, however, will require a thorough understanding of the various functions and activities of VHb, and how VHb expression ripples to affect metabolism more generally. Here we review the current knowledge of these topics. VHb’s functions all involve oxygen binding (and often delivery) in one way or another. Several biochemical and structure-function studies have provided an insight into the molecular details of this binding and delivery. VHb activities are varied. They include supply of oxygen to oxygenases and the respiratory chain, particularly under low oxygen conditions; oxygen sensing and modulation of transcription factor activity; and detoxification of NO, and seem to require interactions of VHb with “partner proteins”. VHb expression affects the levels of ATP and NADH, although not enormously. VHb expression may affect the level of many compounds of intermediary metabolism, and, apparently, alters the levels of expression of many genes.
    [Show full text]
  • Recombinant E. Coli Expressing Vitreoscilla Haemoglobin Prefers Aerobic Metabolism Under Microaerobic Conditions: a Proteome-Level Study
    Recombinant E. coli expressing Vitreoscilla haemoglobin prefers aerobic metabolism under microaerobic conditions: A proteome-level study 1 2 3, BINI RAMACHANDRAN , KANAK LATA DIKSHIT and KUPPAMUTHU DHARMALINGAM * 1Department of Genetic Engineering, School of Biotechnology, Madurai Kamaraj University, Madurai 625 021 2Institute of Microbial Technology, Sector 39A, Chandigarh 160036 3National Facility for Clinical Proteomics, School of Biotechnology, Madurai Kamaraj University, Madurai 625 021 *Corresponding author (Fax, +0091-452-2459280; Email, [email protected]) Vitreoscilla haemoglobin (VHb) expression in heterologous host was shown to enhance growth and oxygen utilization capabilities under oxygen-limited conditions. The exact mechanism by which VHb enhances the oxygen utilization under oxygen-limiting conditions is still unknown. In order to understand the role of VHb in promoting oxygen utilization, changes in the total protein profile of E. coli expressing the vgb gene under its native promoter was analysed. Two-dimensional difference gel electrophoresis (2D DIGE) was employed to quantify the differentially expressed proteins under oxygen-limiting conditions. Overexpression of proteins involved in aerobic metabolic pathways and suppression of proteins involved in non-oxidative metabolic pathways shown in this study indicates that the cells expressing VHb prefer aerobic metabolic pathways even under oxygen limitation. Under these conditions, the expression levels of proteins involved in central metabolic pathways, cellular adaptation and cell division were also found to be altered. These results imply that Vitreoscilla haemoglobin expression alters aerobic metabolism specifically, in addition to altering proteins involved in other pathways, the significance of which is not clear as of now. [Ramachandran B, Dikshit KL and Dharmalingam K 2012 Recombinant E.
    [Show full text]
  • The Characterisation and Control of Ochre Deposits
    THE CHARACTERISATION AND CONTROL OF OCHRE DEPOSITS IN LAND DRAINAGE SYSTEMS A thesis for the Degree of PhD by I Ap Dewi BSc(Wales) February 1985 Acknowledgements It is with gratitude that I acknowledge the guidance and assistance given by my supervisors Mr W I Kelso and Dr D B Johnson. I am indebted to all the staff in the Biochemistry and Soil Science department at Bangor for their advice and help. I wish to thank the farmers and others who allowed access to ochre sites and helped to collect the deposits. I am grateful to Mrs M Pritchard for typing the untidily written drafts and to Mrs E Richter for translating some German and Dutch articles. My wife, Sian,A deserves all gratitude for her support, encouragement, and patience. This work was supported by a Ministry of Agriculture, Fisheries and Food Postgraduate Studentship. CONTENTS Page 1. Summary 7 2. Literature Review 2.1 Introduction 9 2.2 The nature of iron ochre 13 2.2.1 Types of ochre 14 2.2.2 The composition of ochre 15 203 The microbiology of filamentous ochre 16 2.3.1 The filamentous bacteria 2.3.1.1 Definition and history 17 2.3.1.2 Taxonomy 18 2.3.1.3 Sphaerotilus 22 2.3.1.4 Leptothrix app 25 2.3.1.5 Other sheathed filamentous bacteria 27 2.3.1.6 The relationship between filamentous bacteria and iron 29 2.3.2 Gallionella 32 2.3.3 Other microorganisms 33 2.4 The microbiology of pyritic ochre 2.4.1 The Thiobacilli 34 2.4.2 Acidophilic heterotrophs 37 2.4.3 The coexistence of microorganisms associated with pyritic and filamentous ochre 38 2.5 The formation of iron ochre 2.5.1 Factors influencing ochre formation 40 2.5.2 The mechanisms of ochre formation 41 2.5.2.1 Chemical oxidation 43 2.5.2.2 The action of autotrophic iron bacteria (pyritic ochre formation) 46 2.5.2.3 Decomposition of the organic component of soluble complexes by heterotrophic organisms 50 2.5.2.4 The action of microorganisms causing environmental changes.
    [Show full text]