Atlas of Genetics and Cytogenetics in Oncology and Haematology

Home Genes Leukemias Tumors Cancer prone Deep Insight Case Reports Portal Journals Teaching

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

Atlas Journal

Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book.

TABLE OF CONTENTS

Volume 11, Number 4, Oct-Dec 2007 Previous Issue / Next Issue Genes WWOX (16q23.1). Teresa Druck, Hoda Hagrass, Kay Huebner. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 499-506. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/WWOXID508ch16q23.html VRK1 (14q32.2). Pedro A. Lazo, Francisco M. Vega, Ana Sevilla, Alberto Valbuena, Marta Sanz-Garcia,

Inmaculada Lopez-Sanchez, Sandra Blanco. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 507-514. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/VRK1ID43556ch14q32.html SPINK7 (5q33.1). Xiying Yu, Shih-Hsin Lu. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 515-519. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/SPINK7ID40396ch5q33.html PPM1D (17q23). Dmitry Bulavin, Oleg Demidov. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 520-525. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/PPM1DID41803ch17q23.html P53; TP53 (17p13) - updated. Magali Olivier. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 526-535. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/P53ID88.html LOXL4 (10q24.2). Kornelia Molnarne Szauter, Tibor Gorogh, Katalin Csiszar. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 536-541. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/LOXL4ID41193ch10q24.html

Atlas Genet Cytogenet Oncol Haematol 2007; 4 I ITK (5q33.3). Berthold Streubel. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 542-546. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ITKID43329ch5q33.html.html IKZF2 (2q34). Rupa Sridharan, Stephen Smale. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 547-551. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/IKZF2ID42885ch2q34.html EBAG9 (8q23.2). Ahmad Faried, Leri S. Faried. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 552-556. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/EBAG9ID40393ch8q23.html DKK1 (10q11.2). Oscar Aguilera, Alberto Munoz. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 557-562. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/DKK1ID44007ch10q11.html AKAP9 (7q21.2). Raffaele Ciampi, Yuri E Nikiforov. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 563-566. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/AKAP9ID42999ch7q21.html S100B (21q22.3). M Rosario Fernandez-Fernandez, Alan R Fersht. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 567-573. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/S100BID42195ch21q22.html PTGS2 (1q31.1). Panagiotis A Konstantinopoulos, Michalis V Karamouzis, Athanasios G Papavassiliou. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 574-580. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/PTGS2ID509ch1q31.html PLCB2 (15q15). Valeria Bertagnolo, Federica Brugnoli, Mascia Benedusi, Silvano Capitani. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 581-587. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/PLCB2ID41743ch15q15.html MME (3q25.2). Emina E Torlakovic. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 588-597. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/MMEID41386ch3q25.html GRB2 (17q25.1). Gagani Athauda, Donald P Bottaro. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 598-608. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/GRB2ID386ch17q25.html CENTG1 (12q14.1). Chan Chi Bun, Ye Keqiang.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 II Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 609-614. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/CENTG1ID44037ch12q14.html CARD8 (19q13.32). Frank A Kruyt. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 615-620. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/CARD8ID913ch19q13.html ARHGEF2 (1q22). Valery Poroyko, Anna Birukova. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 621-625. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ARHGEF2ID43150ch1q22.html Leukaemias t(7;9)(q11;p13). Marina Bousquet, Nicole Dastugue, Pierre Brousset. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 626-628. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/t0709q11p13ID1195.html t(6;8)(q27;p12). José Luis Vizmanos. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 629-634. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/t68ID1090.html t(5;9)(q33;q22). Berthold Streubel. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 635-638. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/t0509q33q22ID1458.html T-lineage acute lymphoblastic leukemia (T-ALL). Susana C Raimondi. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 639-660. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/TALLID1374.html t(9;11)(p22;p15). Cristina Morerio, Claudio Panarello. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 661-663. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/t0911p22p15ID1232.html Solid Tumours Thyroid: Papillary Carcinoma with inv(7)(q21q34). Raffaele Ciampi, Yuri E. Nikiforov. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 664-667. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Tumors/PapilThyrCarcinv7ID5459.html Soft Tissue Tumors: t(X;20)(p11.23;q13.33) in Biphasic Synovial Sarcoma. Clelia Tiziana Storlazzi, Fredrik Mertens. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 668-669. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Tumors/SynovialSarcomtX20ID5464.html Soft Tissue Tumors: Aggressive angiomyxoma. Francesca Micci, Petter Brandal.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 III Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 670-676. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Tumors/AggresAngiomyxomaID5203.html Posterior uveal melanoma - updated. Marco Castori, Paola Grammatico. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 677-684. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Tumors/UvealmelanomID5047.html Neurofibroma. Lan Kluwe, Christian Hagel, Victor Mautner. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 685-690. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Tumors/NeurofibromaID5098.html Head and Neck: Pleomorphic salivary gland adenoma with inv(8)(q12q12)

(CHCHD7/PLAG1). Julia Asp, Goran Stenman. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 691-693. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Tumors/SalivAdenCHCHD7PLAG1ID5431.html Head and Neck: Pleomorphic salivary gland adenoma with ins(8)(q12;q11q11) (TCEA1-

PLAG1). Julia Asp, Goran Stenman. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 694-696. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Tumors/SalivAdenTCEA1PLAG1ID5430.html Cancer Prone Diseases Hemihyperplasia isolated. Shubha R Phadke. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 697-699. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Kprones/HemihyperplasiaID10046.html Deep Insights Case Reports inv(8)(p11.2q13) found in a patient with chronic myelomonocytic leukemia that progressed

to acute myeloid leukemia. Jennifer JS Laffin, Sara J Morrison-Delap, Wayne A Bottner, Eric B Johnson, Patricia Howard-

Peebles, Kate J Thompson, Gordana Raca, Karen D Montgomery, Daniel F Kurtycz. Atlas Genet Cytogenet Oncol Haematol 2007; Vol 11: 700-703. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Reports/08LaffinID100027.html Educational Items

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

Home Genes Leukemias Tumors Cancer prone Deep Insight Case Reports Portal Journals Teaching

For comments and suggestions or contributions, please contact us

[email protected].

Atlas Genet Cytogenet Oncol Haematol 2007; 4 IV Atlas of Genetics and Cytogenetics in Oncology and Haematology

WWOX (WW domain containing oxidoreductase)

Identity Other names FOR murine name WOX1 Hugo WWOX Location 16q23.1 DNA/RNA Description WWOX is comprised of 9 coding exons in a region of approximately one million base pairs that includes the common fragile site FRA16D. Transcription RT-PCR amplification of Wwox in normal and tumor cDNA samples has shown products apparently originating from alternative transcripts or transcript variants, respectively. Expressed truncated proteins have not been detected. Pseudogene None reported. Protein

Atlas Genet Cytogenet Oncol Haematol 2007; 4 499 Alignment of human (hWwox), mouse (Mwwox), fly (fWwox), mosquito (moWwox) and worm (ceWwox) Wwox proteins. The locations of the WW1 and WW2 domains are shown, as well as the

predicted sites for nuclear localization, NADP binding, mitochondrial targeting, substrate binding and a proton acceptor.

Description WWOX is a 414 amino acid protein that contains two WW domains and a short-chain dehydrogenase/reductase (SDR) domain. Expression WWOX is highly expressed in secretory epithelial cells of reproductive, endocrine and exocrine organs and is expressed in all or most other tissues at a lower level. The protein is not expressed or is expressed at low level in many tumor types, including breast, pancreatic, gastric, hepatocellular, ovarian, lung and prostate cancers. Loss of WWOX expression can be due to inactivation by promoter methylation, allelic deletion or a combination of these mechanisms. Localisation Cytoplasm, mitochondria. Function Contains an N-terminal group 1 WW domain that binds proteins with a PPXY motif. Reportedly interacts with p53, p73, JUN, ERBB4, Ap2alpha, Ap2gamma, Ezrin/VIL2, Ack1/TNK2. Probably involved in apoptosis, steroid (estrogen) metabolism and signaling pathways. Mice carrying a targeted deletion of the Wwox gene develop osteosarcomas in juvenile Wwox(-/-) and lung papillary carcinomas in adult Wwox(+/-) mice spontaneously. Wwox(+/-) mice develop significantly more ethyl nitrosourea- induced lung tumors and lymphomas than wild-type littermates. Mutations Somatic Cancer cell lines from various tumor types, including ovarian, gastric and pancreatic, exhibit deletions within the WWOX gene, frequently in the introns surrounding exon 8. Implicated in Entity Breast cancer, esophageal and non-small cell lung cancer. Disease Breast, esophageal and non-small cell lung cancer show high LOH rates and low mutation rates. 27% of ER+ breast carcinomas versus 46% for ER- cases were completely negative for WWOX expression; when weakly WWOX expressing cases were included with negative cases the significance increased. Methylation of regulatory sequences in WWOX exon 1 distinguish breast cancer DNA from normal DNA and DNA from adjacent tissue. Treatment with 5'-Aza-2'-deoxycytidine to demethylate the WWOX promoter successfully restored WWOX expression in WWOX- deficient breast cancer cells. Prognosis In a sampling of 132 breast cancer tissues, high level WWOX expression was associated with better disease free survival. Breakpoints

Location of the t(14;16)(q32.3;q23) translocation breakpoints falling within the WWOX gene in 3 multiple myeloma cell lines. External links Nomenclature Hugo WWOX GDB WWOX Entrez_Gene WWOX 51741 WW domain containing oxidoreductase

Atlas Genet Cytogenet Oncol Haematol 2007; 4 500 Cards Atlas WWOXID508ch16q23 GeneCards WWOX Ensembl WWOX Genatlas WWOX GeneLynx WWOX eGenome WWOX euGene 51741 Genomic and cartography GoldenPath WWOX - 16q23.1 chr16:76691052-77804064 + 16q23.3-q24.1 (hg18-Mar_2006) Ensembl WWOX - 16q23.3-q24.1 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene WWOX Gene and transcription Genbank AF187015 [ ENTREZ ] Genbank AF211943 [ ENTREZ ] Genbank AF227526 [ ENTREZ ] Genbank AF227527 [ ENTREZ ] Genbank AF227528 [ ENTREZ ] RefSeq NM_016373 [ SRS ] NM_016373 [ ENTREZ ] RefSeq NM_130791 [ SRS ] NM_130791 [ ENTREZ ] RefSeq NM_130844 [ SRS ] NM_130844 [ ENTREZ ] RefSeq AC_000059 [ SRS ] AC_000059 [ ENTREZ ] RefSeq NC_000016 [ SRS ] NC_000016 [ ENTREZ ] RefSeq NT_010498 [ SRS ] NT_010498 [ ENTREZ ] RefSeq NW_926528 [ SRS ] NW_926528 [ ENTREZ ] AceView WWOX AceView - NCBI Unigene Hs.461453 [ SRS ] Hs.461453 [ NCBI ] HS461453 [ spliceNest ] Protein : pattern, domain, 3D structure SwissProt Q12953 [ SRS] Q12953 [ EXPASY ] Q12953 [ INTERPRO ] Interpro IPR002347 ADH_short_C2 [ SRS ] IPR002347 ADH_short_C2 [ EBI ] CluSTr Q12953 Blocks Q12953 HPRD 05501 Protein Interaction databases DIP Q12953 IntAct Q12953 Polymorphism : SNP, mutations, diseases OMIM 133239;605131 [ map ] GENECLINICS 133239;605131 SNP WWOX [dbSNP-NCBI] SNP NM_016373 [SNP-NCI]

Atlas Genet Cytogenet Oncol Haematol 2007; 4 501 SNP NM_130791 [SNP-NCI] SNP NM_130844 [SNP-NCI] SNP WWOX [GeneSNPs - Utah] WWOX] [HGBASE - SRS] HAPMAP WWOX [HAPMAP] HGMD WWOX General knowledge Family WWOX [UCSC Family Browser] Browser SOURCE NM_016373 SOURCE NM_130791 SOURCE NM_130844 SMD Hs.461453 SAGE Hs.461453 GO nucleus [Amigo] nucleus GO cytoplasm [Amigo] cytoplasm GO mitochondrion [Amigo] mitochondrion GO Golgi apparatus [Amigo] Golgi apparatus GO electron transport [Amigo] electron transport GO cell cycle [Amigo] cell cycle GO metabolic process [Amigo] metabolic process GO steroid metabolic process [Amigo] steroid metabolic process GO oxidoreductase activity [Amigo] oxidoreductase activity GO oxidoreductase activity [Amigo] oxidoreductase activity GO oxidoreductase activity [Amigo] oxidoreductase activity negative regulation of progression through cell cycle [Amigo] negative regulation of GO progression through cell cycle GO protein dimerization activity [Amigo] protein dimerization activity GO coenzyme binding [Amigo] coenzyme binding PubGene WWOX Other databases Probes Probe WWOX Related clones (RZPD - Berlin) PubMed PubMed 43 Pubmed reference(s) in LocusLink Bibliography Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells. Ried K, Finnis M, Hobson L, Mangelsdorf M, Dayan S, Nancarrow JK, Woollatt E, Kremmidiotis G, Gardner A, Venter D, Baker E, Richards RI. Hum Mol Genet. 2000; 9:1651-1663. Medline 10861292

WWOX, the FRA16D gene, behaves as a suppressor of tumor growth. Bednarek AK, Keck-Waggoner CL, Daniel RL, Laflin KJ, Bergsagel PL, Kiguchi K, Brenner AJ, Aldaz CM. Cancer Res. 2001; 61:8068-8073.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 502 Medline 11719429

WWOX: a candidate tumor suppressor gene involved in multiple tumor types. Paige AJ, Taylor KJ, Taylor C, Hillier SG, Farrington S, Scott D, Porteous DJ, Smyth JF, Gabra H, Watson JE. Proc Natl Acad Sci U S A. 2001; 98:11417-11422. Medline 11572989

Genetic alterations of the tumor suppressor gene WWOX in esophageal squamous cell carcinoma. Kuroki T, Trapasso F, Shiraishi T, Alder H, Mimori K, Mori M, Croce CM. Cancer Res. 2002; 62:2258-2260. Medline 11956080

WWOX, the common chromosomal fragile site, FRA16D, cancer gene. Ludes-Meyers JH, Bednarek AK, Popescu NC, Bedford M, Aldaz CM. Cytogenet Genome Res. 2003; 100:101-110. Medline 14526170

WW domain containing oxidoreductase gene expression is altered in non-small cell lung cancer. Yendamuri S, Kuroki T, Trapasso F, Henry AC, Dumon KR, Huebner K, Williams NN, Kaiser LR, Croce CM. Cancer Res. 2003; 63:878-881. Medline 12591741

Loss of WWOX expression in gastric carcinoma. Aqeilan RI, Kuroki T, Pekarsky Y, Albagha O, Trapasso F, Baffa R, Huebner K, Edmonds P, Croce CM. Clin Cancer Res. 2004; 10:3053-3058. Medline 15131042

Physical and functional interactions between the Wwox tumor suppressor protein and the AP- 2gamma transcription factor. Aqeilan RI, Palamarchuk A, Weigel RJ, Herrero JJ, Pekarsky Y, Croce CM. Cancer Res. 2004; 64:8256-8261. Medline 15548692

Functional association between Wwox tumor suppressor protein and p73, a p53 homolog. Aqeilan RI, Pekarsky Y, Herrero JJ, Palamarchuk A, Letofsky J, Druck T, Trapasso F, Han SY, Melino G, Huebner K, Croce CM. Proc Natl Acad Sci U S A. 2004; 101:4401-4406. Medline 15070730

The fragile genes FHIT and WWOX are inactivated coordinately in invasive breast carcinoma. Guler G, Uner A, Guler N, Han SY, Iliopoulos D, Hauck WW, McCue P, Huebner K. Cancer. 2004; 100:1605-1614. Medline 15073846

The tumor suppressor gene WWOX at FRA16D is involved in pancreatic carcinogenesis. Kuroki T, Yendamuri S, Trapasso F, Matsuyama A, Aqeilan RI, Alder H, Rattan S, Cesari R, Nolli ML, Williams NN, Mori M, Kanematsu T, Croce CM. Clin Cancer Res. 2004; 10:2459-2465. Medline 15073125

Atlas Genet Cytogenet Oncol Haematol 2007; 4 503

WWOX binds the specific proline-rich ligand PPXY: identification of candidate interacting proteins. Ludes-Meyers JH, Kil H, Bednarek AK, Drake J, Bedford MT, Aldaz CM. Oncogene. 2004; 23:5049-5055. Medline 15064722

Frequent downregulation and loss of WWOX gene expression in human hepatocellular carcinoma. Park SW, Ludes-Meyers J, Zimonjic DB, Durkin ME, Popescu NC, Aldaz CM. Br J Cancer. 2004; 91:753-759. Medline 15266310

WW domain-containing proteins, WWOX and YAP, compete for interaction with ErbB-4 and modulate its transcriptional function. Aqeilan RI, Donati V, Palamarchuk A, Trapasso F, Kaou M, Pekarsky Y, Sudol M, Croce CM. Cancer Res. 2005; 65:6764-6772. Medline 16061658

WWOX gene restoration prevents lung cancer growth in vitro and in vivo. Fabbri M, Iliopoulos D, Trapasso F, Aqeilan RI, Cimmino A, Zanesi N, Yendamuri S, Han SY, Amadori D, Huebner K, Croce CM. Proc Natl Acad Sci U S A. 2005; 102:15611-15616. Medline 16223882

Concordant loss of fragile gene expression early in breast cancer development. Guler G, Uner A, Guler N, Han SY, Iliopoulos D, McCue P, Huebner K. Pathol Int. 2005; 55:471-478. Medline 15998374

Fragile genes as biomarkers: epigenetic control of WWOX and FHIT in lung, breast and bladder cancer. Iliopoulos D, Guler G, Han SY, Johnston D, Druck T, McCorkell KA, Palazzo J, McCue PA, Baffa R, Huebner K. Oncogene. 2005; 24:1625-1633. Medline 15674328

Frequent loss of WWOX expression in breast cancer: correlation with estrogen receptor status. Nunez MI, Ludes-Meyers J, Abba MC, Kil H, Abbey NW, Page RE, Sahin A, Klein-Szanto AJ, Aldaz CM. Breast Cancer Res Treat. 2005; 89:99-105. Medline 15692750

WWOX protein expression varies among ovarian carcinoma histotypes and correlates with less favorable outcome. Nunez MI, Rosen DG, Ludes-Meyers JH, Abba MC, Kil H, Page R, Klein-Szanto AJ, Godwin AK, Liu J, Mills GB, Aldaz CM. BMC Cancer. 2005; 5:64. Medline 15982416

Deletion and mutation of WWOX exons 6-8 in human non-small cell lung cancer. Zhou Y, Xu Y, Zhang Z. J Huazhong Univ Sci Technolog Med Sci. 2005; 25:162-165. Medline 16116962

Atlas Genet Cytogenet Oncol Haematol 2007; 4 504

Physical association with WWOX suppresses c-Jun transcriptional activity. Gaudio E, Palamarchuk A, Palumbo T, Trapasso F, Pekarsky Y, Croce CM, Aqeilan RI. Cancer Res. 2006; 66 :11585-11589. Medline 17178850

Roles of FHIT and WWOX fragile genes in cancer. Iliopoulos D, Guler G, Han SY, Druck T, Ottey M, McCorkell KA, Huebner K. Cancer Lett. 2006; 232:27-36. Review. Medline 16225988

PKA-mediated protein phosphorylation regulates ezrin-WWOX interaction. Jin C, Ge L, Ding X, Chen Y, Zhu H, Ward T, Wu F, Cao X, Wang Q, Yao X. Biochem Biophys Res Commun. 2006; 341: 784-791. Medline 16438931

Activated tyrosine kinase Ack1 promotes prostate tumorigenesis: role of Ack1 in polyubiquitination of tumor suppressor Wwox. Mahajan NP, Whang YE, Mohler JL, Earp HS. Cancer Res. 2005; 65:10514-10523. Medline 16288044

WWOX protein expression in normal human tissues. Nunez MI, Ludes-Meyers J, Aldaz CM. J Mol Histol. 2006; 37: 115-125. Medline 16941225

Characterization of the tumor suppressor gene WWOX in primary human oral squamous cell carcinomas. Pimenta FJ, Gomes DA, Perdigao PF, Barbosa AA, Romano-Silva MA, Gomez MV, Aldaz CM, De Marco L, Gomez RS. Int J Cancer. 2006; 118:1154-1158. Medline 16152610

WWOX--the FRA16D cancer gene: expression correlation with breast cancer progression and prognosis. Pluciennik E, Kusinska R, Potemski P, Kubiak R, Kordek R, Bednarek AK. Eur J Surg Oncol. 2006; 32:153-157. Medline 16360296

A role for the WWOX gene in prostate cancer. Qin HR, Iliopoulos D, Semba S, Fabbri M, Druck T, Volinia S, Croce CM, Morrison CD, Klein RD, Huebner K. Cancer Res. 2006; 66: 6477-6481. Medline 16818616

Targeted deletion of Wwox reveals a tumor suppressor function. Aqeilan RI, Trapasso F, Hussain S, Costinean S, Marshall D, Pekarsky Y, Hagan JP, Zanesi N, Kaou M, Stein GS, Lian JB, Croce CM. Proc Natl Acad Sci U S A. 2007; 104: 3949-3954. Medline 17360458

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Atlas Genet Cytogenet Oncol Haematol 2007; 4 505 BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 04-2007 Teresa Druck, Hoda Hagrass, Kay Huebner BRT Rm. 940, 460 W. 12th Ave, Columbus, OH 43210. Citation This paper should be referenced as such : Druck T, Hagrass H, Huebner K . WWOX (WW domain containing oxidoreductase). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Genes/WWOXID508ch16q23.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 506 Atlas of Genetics and Cytogenetics in Oncology and Haematology

VRK1 (Vaccinia-related kinase 1)

Identity Other names VRK-1 MGC117401 MGC138280 MGC142070 vaccinia related kinase 1 Serine/threonine-protein kinase VRK1 Vaccinia-related kinase 1 Hugo VRK1 Location 14q32.2 Local_order Centromere-----PAPOLA--VRK1--BCL11B------Telomere. DNA/RNA

VRK1 gene structure based on data available in the Ensembl release 43. Upstream non- coding exons (green). Coding exons (yellow), 3' unstranslated sequence (red). The size of the exons in nucleotides is indicated below each exon. Exon number is indicated within the exon.

Description 13 exons in 84.22 kilobases. Transcription initiated from cetromere to telomere direction. Transcriptio Initiation codon located in exon 2. Normal message is 1702 nucleotides. Some n alternatively spliced RNA messages have been detected; but they are likely to represent splicing intermediates since there is no protein has been detected expressed from these alternative messages in humans. Pseudogene None. There are two closely related genes VRK2 and VRK3. SNP: 289 single nucleotide polymorphisms identified in human VRK1. ALLELE VARIANTS: CA Polymorphisms. Near the PAPOLA (Polyadenyl polymerase) with respect to VRK1 there is a polymorphic dinucleotide (CA) sequence that has high heterozygosity (0.81). Might be a useful marker in the genetic study of disorders localized at the 14q32 region, such as autosomal recessive congenital microphthalmia (CMIC). Protein

Atlas Genet Cytogenet Oncol Haematol 2007; 4 507

ABRS: ATP-binding region signature SRPKAS: Ser/Thr protein kinases active-site signature ELTS:Endosomal-lysosomal targeting sequence NLS: Nuclear localization signal Note Enzyme Number (IUBMB): "EC 2.7.11.1". Description Protein of 396 aminoacids. 46 kDa. Serine-threonine kinase domain (residues 26-300). Nuclear localization signal (in C-terminal region) Protein autophosphorylated in several residues. Expression VRK1 is widely expressed in proliferating cells, normal and tumoral. It is not present in quiescent or differentiated cells that do not divide in human biopsies. Localisation Subcellular localisation varies depending on cell type and growth conditions. Most commonly VRK1 is expressed and detected in the nucleus, excluding the nucleolus. However, in some cells it is in the cytosol, particularly associated with endoplasmic reticulum and Golgi. Occasionally it is observed in the nucleolus, but outside the nucleus .The regulation of the subcellular localization is unknown. Function Serine-threonine kinase activity. Phosphorylates p53 in Threonine-18 preventing its interaction with Hdm2 and activates p53-dependent transcription. Phosphorylates c-Jun and ATF2 transcription factors. VRK1 also phosphorylates BAF1 required for nuclear envelope assembly. In human cell lines siRNA specific for VRK1 results in defective cell proliferation. The level of VRK1 protein is regulated proteolytically by a p53-dependent-transcription mechanism. This mechanism results in the induction of a targeting of VRK1 to enter the endosomal-lysosomal pathway. Homology The kinase domain is highly homologous to that in other ser-thr kinases. The C- terminal region has no homology to any known protein or domain. This C-terminal region of VRK1 is different form that in human VRK2, or in the VRK-1 homolog of distant species such as Drosophila, C. elegans or Dario Rerio. This C-terminal divergence suggest the possibility of different protein interactions and thus of differential regulation. Mutations Note All mutations reported in study by Greenman el al. 2007. Germinal Normal: Mutation in nucleotide 45 in the cDNA coding region ; A to G that is silent (A15A). Mutation in nucleotide 705 in the cDNA coding region ; C to T that is silent (G235G). Somatic Colorectal carcinoma: Heterozygous mutation in nucleotide 42 in the cDNA coding region; T to C (silent S14S). Implicated in Entity T-cell acute lymphoblastic leukemia Cytogenetics Translocation t(5;14)(q35;q32). BCR (Breakpoint cluster region), detected as a DNAseI hypersensitive site between VRK1 and BCL11B in T-cell acute lymphoblastic leukemia with t(5,14)(q35;q32). Hybrid/Mutated Disregulation of TLX3 and NKX2-5 homeobox genes, but not of VRK1. Gene Abnormal None. Protein

Atlas Genet Cytogenet Oncol Haematol 2007; 4 508 Oncogenesis In this translocation the breakpoint occurs in a DNAseI hypersensitive site located between VRK1 and BCL11B genes; but the structure, or expression, of VRK1 does not appear to be affected. In this translocation there is a dysregulation of TLX3 and NKX2-5 homeobox genes (both on chromosome 5).

Entity Head and neck squamous cell carcinoma. Oncogenesis Overexpression of VRK1 protein that positively correlates with hdm2, cdk2, cdk4 and survivin.

Entity Neuroblastomas Cytogenetics Loss of heterozygosis (31 %) in marker (D14S987) in 14q32.2 which is located 5' with respect to the VRK1 gene.

Entity Colorectal carcinoma Cytogenetics Loss of heterozygosis (40-60 %) depending on markers (D14S65; D14S250; D14S5267) in 14q32.2 which is located 3' to the VRK1 gene at less than 0.3 Mb. D14S65 is 0.15 Mb 3' with respect to VRK1.

Entity Nasopharyngeal carcinoma Cytogenetics Loss of heterozygosis in marker (D14S51) in 14q32.2 which is located 0.15Mb 3' to the VRK1 gene.

Entity Chronic myelogenous leukemia (Blastic crisis) Cytogenetics Loss of heterozygosis in marker (D14S65) in 14q32.2 which is located 0.15Mb 3' to the VRK1 gene. Breakpoints

Localization of loss of heterozygosis (LOH) and translocation breakpoints reported in 14q32.2. The breakpoint cluster region has multiple DNAseI hypersensitive sites. External links Nomenclature Hugo VRK1 GDB VRK1 Entrez_Gene VRK1 7443 vaccinia related kinase 1 Cards Atlas VRK1ID43556ch14q32 GeneCards VRK1 Ensembl VRK1 Genatlas VRK1 GeneLynx VRK1

Atlas Genet Cytogenet Oncol Haematol 2007; 4 509 eGenome VRK1 euGene 7443 Genomic and cartography GoldenPath VRK1 - 14q32.2 chr14:96333437-96417703 + 14q32 (hg18-Mar_2006) Ensembl VRK1 - 14q32 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene VRK1 Gene and transcription Genbank AB000449 [ ENTREZ ] Genbank AK290110 [ ENTREZ ] Genbank BC005970 [ ENTREZ ] Genbank BC103761 [ ENTREZ ] Genbank BC112075 [ ENTREZ ] RefSeq NM_003384 [ SRS ] NM_003384 [ ENTREZ ] RefSeq AC_000057 [ SRS ] AC_000057 [ ENTREZ ] RefSeq NC_000014 [ SRS ] NC_000014 [ ENTREZ ] RefSeq NT_026437 [ SRS ] NT_026437 [ ENTREZ ] RefSeq NW_925561 [ SRS ] NW_925561 [ ENTREZ ] AceView VRK1 AceView - NCBI Unigene Hs.422662 [ SRS ] Hs.422662 [ NCBI ] HS422662 [ spliceNest ] Fast-db 5528 Protein : pattern, domain, 3D structure SwissProt Q99986 [ SRS] Q99986 [ EXPASY ] Q99986 [ INTERPRO ] PS00107 PROTEIN_KINASE_ATP [ SRS ] PS00107 PROTEIN_KINASE_ATP [ Prosite Expasy ] PS50011 PROTEIN_KINASE_DOM [ SRS ] PS50011 PROTEIN_KINASE_DOM [ Prosite Expasy ] PS00108 PROTEIN_KINASE_ST [ SRS ] PS00108 PROTEIN_KINASE_ST [ Prosite Expasy ] Interpro IPR011009 Kinase_like [ SRS ] IPR011009 Kinase_like [ EBI ] Interpro IPR000719 Prot_kinase [ SRS ] IPR000719 Prot_kinase [ EBI ] Interpro IPR008271 Ser_thr_pkin_AS [ SRS ] IPR008271 Ser_thr_pkin_AS [ EBI ] CluSTr Q99986 Pfam PF00069 Pkinase [ SRS ] PF00069 Pkinase [ Sanger ] pfam00069 [ NCBI-CDD ] Prodom PD000001 Prot_kinase[INRA-Toulouse] Q99986 VRK1_HUMAN [ Domain structure ] Q99986 VRK1_HUMAN [ sequences Prodom sharing at least 1 domain ] Blocks Q99986 HPRD 03701 Protein Interaction databases DIP Q99986 IntAct Q99986 Polymorphism : SNP, mutations, diseases

Atlas Genet Cytogenet Oncol Haematol 2007; 4 510 OMIM 602168 [ map ] GENECLINICS 602168 SNP VRK1 [dbSNP-NCBI] SNP NM_003384 [SNP-NCI] SNP VRK1 [GeneSNPs - Utah] VRK1] [HGBASE - SRS] HAPMAP VRK1 [HAPMAP] COSMIC VRK1 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD VRK1 General knowledge Family VRK1 [UCSC Family Browser] Browser SOURCE NM_003384 SMD Hs.422662 SAGE Hs.422662 2.7.11.1 [ Enzyme-SRS ] 2.7.11.1 [ Brenda-SRS ] 2.7.11.1 [ KEGG ] 2.7.11.1 [ Enzyme WIT ] GO nucleotide binding [Amigo] nucleotide binding protein serine/threonine kinase activity [Amigo] protein serine/threonine kinase GO activity GO ATP binding [Amigo] ATP binding GO nucleus [Amigo] nucleus GO protein amino acid phosphorylation [Amigo] protein amino acid phosphorylation GO transferase activity [Amigo] transferase activity PubGene VRK1 Other databases Probes Probe VRK1 Related clones (RZPD - Berlin) PubMed PubMed 17 Pubmed reference(s) in LocusLink Bibliography Identification of two novel human putative serine/threonine kinases, VRK1 and VRK2, with structural similarity to vaccinia virus B1R kinase. Nezu J, Oku A, Jones MH, Shimane M. Genomics 1997; 45: 327-331. Medline 9344656

Loss of heterozygosity on chromosome 14 in nasopharyngeal carcinoma. Mutirangura A, Pornthanakasem W, Sriuranpong V, Supiyaphun P, Voravud N. Int J Cancer 1998; 78: 153-156. Medline 9754644

Loss of heterozygosity of 14q32 in colorectal carcinoma. Bando T, Kato Y, Ihara Y, Yamagishi F, Tsukada K, Isobe M. Cancer Genet Cytogenet 1999; 111: 161-165. Medline 10347556

Isolation and mapping of a polymorphic CA repeat sequence at the human VRK1 locus.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 511 Sugimoto J, Yamauchi T, Hatakeyama T, Isobe M. J Hum Genet 1999; 44: 133-134. Medline 10083742

Detailed deletion mapping of chromosome band 14q32 in human neuroblastoma defines a 1.1- Mb region of common allelic loss. Hoshi M, Otagiri N, Shiwaku HO, Asakawa S, Shimizu N, Kaneko Y, Ohi R, Hayashi Y, Horii A. Br J Cancer 2000; 82: 1801-1807. Medline 10839294

The human vaccinia-related kinase 1 (VRK1) phosphorylates threonine-18 within the mdm-2 binding site of the p53 tumour suppressor protein. Lopez-Borges S, Lazo PA. Oncogene 2000; 19: 3656-3664. Medline 10951572

Consistent loss of heterozygosity at 14Q32 in lymphoid blast crisis of chronic myeloid leukemia. Sercan HO, Sercan ZY, Kizildag S, Undar B, Soydan S, Sakizli M. Leuk Lymphoma 2000; 39: 385-390. Medline 11342319

Kinetic Properties of p53 Phosphorylation by the Human Vaccinia-Related Kinase 1. Barcia R, Lopez-Borges S, Vega FM, Lazo PA. Arch Biochem Biophys 2002; 399: 1-5. Medline 11883897

Activation of HOX11L2 by juxtaposition with 3'-BCL11B in an acute lymphoblastic leukemia cell line (HPB-ALL) with t(5;14)(q35;q32.2). MacLeod RA, Nagel S, Kaufmann M, Janssen JW, Drexler HG. Genes Chromosomes Cancer 2003; 37: 84-91. Medline 12661009

The cardiac homeobox gene NKX2-5 is deregulated by juxtaposition with BCL11B in pediatric T-ALL cell lines via a novel t(5;14)(q35.1;q32.2). Nagel S, Kaufmann M, Drexler HG, MacLeod RA. Cancer Res 2003; 63: 5329-5334. Medline 14500364

Expression of the VRK (vaccinia-related kinase) gene family of p53 regulators in murine hematopoietic development. Vega FM, Gonzalo P, Gaspar ML, Lazo PA. FEBS Lett 2003; 544: 176-180. Medline 12782311

Identification of target genes of the p16INK4A-pRB-E2F pathway. Vernell R, Helin K, Muller H. J Biol Chem 2003; 278: 46124-46137. Medline 12923195

Members of a Novel Family of Mammalian Protein Kinases Complement the DNA-Negative Phenotype of a Vaccinia Virus ts Mutant Defective in the B1 Kinase. Boyle KA, Traktman P. J Virol 2004; 78: 1992-2005.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 512 Medline 14747564

Characterization of Three Paralogous Members of the Mammalian Vaccinia Related Kinase Family. Nichols RJ, Traktman P. J Biol Chem. 2004; 279: 7934-7946. Medline 14645249 c-Jun phosphorylation by the human vaccinia-related kinase 1 (VRK1) and its cooperation with the N-terminal kinase of c-Jun (JNK). Sevilla A, Santos CR, Barcia R, Vega FM, Lazo PA. Oncogene 2004a; 23: 8950-8958. Medline 15378002

Human Vaccinia-related Kinase 1 (VRK1) Activates the ATF2 Transcriptional Activity by Novel Phosphorylation on Thr-73 and Ser-62 and Cooperates with JNK. Sevilla A, Santos CR, Vega FM, Lazo PA. J Biol Chem 2004b; 279: 27458-27465. Medline 15105425 p53 Stabilization and Accumulation Induced by Human Vaccinia-Related Kinase 1. Vega FM, Sevilla A, Lazo PA. Mol Cell Biol 2004; 24: 10366-10380. Medline 15542844

Vaccinia-related kinase-1. Lazo PA, Vega FM, Sevilla A. Afcs Nature Molecule Page 2005; doi:10.1038/, mp.a003025.003001.(review)

The vaccinia-related kinases phosphorylate the N' terminus of BAF, regulating its interaction with DNA and its retention in the nucleus. Nichols RJ, Wiebe MS, Traktman P. Mol Biol Cell 2006; 17: 2451-2464. Medline 16495336

VRK1 Signaling Pathway in the Context of the Proliferation Phenotype in Head and Neck Squamous Cell Carcinoma. Santos CR, Rodriguez-Pinilla M, Vega FM, Rodriguez-Peralto JL, Blanco S, Sevilla A, Valbuena A, Hernandez T, van Wijnen AJ, Li F, de Alava E, Sanchez-Cespedes M, Lazo PA. Mol Cancer Res 2006; 4: 177-185. Medline 16547155 p53 Downregulates Its Activating Vaccinia-Related Kinase 1, Forming a New Autoregulatory Loop. Valbuena A, Vega FM, Blanco S, Lazo PA. Mol Cell Biol 2006; 26: 4782-4793. Medline 16782868

Patterns of somatic mutation in human cancer genomes. Greenman C, Stephens P, Smith R, Dalgliesh GL, Hunter C, Bignell G, Davies H, Teague J, Butler A, Stevens C, Edkins S, O'Meara S, Vastrik I, Schmidt EE, Avis T, Barthorpe S, Bhamra G, Buck G, Choudhury B, Clements J, Cole J, Dicks E, Forbes S, Gray K, Halliday K, Harrison R, Hills K, Hinton J, Jenkinson A, Jones D, Menzies A, Mironenko T, Perry J, Raine K, Richardson D, Shepherd R, Small A, Tofts C, Varian J, Webb T, West S, Widaa S, Yates A, Cahill DP, Louis DN, Goldstraw P, Nicholson AG, Brasseur F, Looijenga L, Weber BL, Chiew YE, DeFazio A, Greaves MF, Green AR, Campbell P,

Atlas Genet Cytogenet Oncol Haematol 2007; 4 513 Birney E, Easton DF, Chenevix-Trench G, Tan MH, Khoo SK, Teh BT, Yuen ST, Leung SY, Wooster R, Futreal PA, Stratton MR. Nature 2007; 446: 153-158. Medline 17344846

Activation of TLX3 and NKX2-5 in t(5;14)(q35;q32) T-Cell Acute Lymphoblastic Leukemia by Remote 3'-BCL11B Enhancers and Coregulation by PU.1 and HMGA1. Nagel S, Scherr M, Kel A, Hornischer K, Crawford GE, Kaufmann M, Meyer C, Drexler HG, MacLeod RAF. Cancer Res 2007; 67: 1461-1471. Medline 17308084

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written Pedro A. Lazo, Francisco M. Vega, Ana Sevilla, Alberto Valbuena, Marta 04-2007 Sanz-Garcia, Inmaculada Lopez-Sanchez, Sandra Blanco Instituto de Biologia Molecular y Celular del Cancer, CSIC-Universidad de

Salamanca, Salamanca, Spain. Citation This paper should be referenced as such : Lazo PA, Vega FM, Sevilla A, Valbuena A, Sanz-Garcia M, Lopez-Sanchez I, Blanco S . VRK1 (Vaccinia-related kinase 1). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Genes/VRK1ID43556ch14q32.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 514 Atlas of Genetics and Cytogenetics in Oncology and Haematology

SPINK7 (serine peptidase inhibitor, Kazal type 7 (putative))

Identity Other names ECRG2 ECG2 MGC133105 MGC133106 Hugo SPINK7 Location 5q33.1 Local_order telomeric to SPINK5L3 and centromeric to SPINK1 DNA/RNA

Diagram of ECRG2 gene. Exons are represented by red boxes. Exons 1 to 4 from 5' to 3' direction.

Description The ECRG2 gene contains 4 exons and spans about 3540 bp. Transcriptio The full-length of cDNA of ECRG2 gene was revealed 569 bp, the open reading frame n (ORF) is 258 bp. The sequence upstream of the exon-1 upon the NT_2023158.1 genomic sequence revealed a typical TATA box contained promotor at 44 bp from the predicted translation start site. The transcription start site is just 6 bp upstream of the 5' end sequence. Pseudogene None Protein

Note The N-terminal 1-19 is the single peptide of the protein. The C-terminal 30-85 of the protein contains a typical x(8)-C-x(6)-C-x(7)-C-x(6)-Y-x(3)-C-x(2,3)-C-x(17)-C conserve region, coding a Kazal type serine protease inhibitors (Kazal) domain. Description The molecular weight of the encoding protein contained 85 amino acids is about 9.23 kDa. ECRG2 gene contains a typical Kazal serine protease inhibitors conserved domain about 56 amino acids at its C-terminal and three kinase phosphorlation site

Atlas Genet Cytogenet Oncol Haematol 2007; 4 515 (protein kinase C, Casein kinase II and Tyrosine kinase). Expression ECRG2 gene was expressed in normal tissues, such as esophagus, liver, colon and lung. But it was less expressed in the cancerous tissues, especially low frequency of expression of ECRG2 gene in esophageal cancer but was less expressed in the cancerous tissues, especially low frequency of expression of ECRG2 gene in esophageal cancer. Localisation The protein was localized on the cell membrane. Function The expression of ECRG2 can inhibit the migratory ability of high metastasic tumor cells. Homology The sequence of the ECRG2 gene did not reveal remarkable similarity to the known sequence in the homology analysis with the public database of GenBank while the deduced amino acid sequence showed 97% homology to a tumor associated KAZAL- type serine protease inhibitor peptide (US patent 5851987). Mutations Note None Implicated in Entity Esophageal cancer Note Expression profile of ECRG2 gene in 7 normal esophageal epithelia, 51 esophageal cancer and 33 tumor adjacent tissues were 100%, 21% and 52% respectively. About 79% of ECRG2 gene was no expressed in the esophageal cancer. ECRG2 was highly expressed in the adult normal esophageal tissue, low expressed in the fetal esophageal tissue and completely loss of expression in the esophageal cancer and corresponding adjacent tissues. The results show that the ECRG2 gene may be a specific gene for carcinogenesis of esophagus. The studies provide more evidences on the role of ECRG2 in the inhibition of tumor cell proliferation, migration and metastasis, and give a straightforward way to block enzymatic activity in extra-cellular matrix to achieve the therapeutic benefit in the tested human cancers. 1. Short tandem repeat polymorphism in a novel esophageal cancer-related gene (ECRG2) implicates susceptibility to esophageal cancer 2. Potential interaction partner for ECRG2 might be involved in regulation of cell proliferation and apoptosis and in various physiological processes. 3. Data suggest that the physical interaction of esophageal cancer related gene 2 (ECRG2) and metallothionein2A (MT2A) may play an important role in the carcinogenesis of esophageal cancer. External links Nomenclature Hugo SPINK7 GDB SPINK7 Entrez_Gene SPINK7 84651 serine peptidase inhibitor, Kazal type 7 (putative) Cards Atlas SPINK7ID40396ch5q33 GeneCards SPINK7 Ensembl SPINK7 Genatlas SPINK7 GeneLynx SPINK7 eGenome SPINK7 euGene 84651 Genomic and cartography GoldenPath SPINK7 - 5q33.1 chr5:147672183-147675672 + 5q33.1 (hg18-Mar_2006)

Atlas Genet Cytogenet Oncol Haematol 2007; 4 516 Ensembl SPINK7 - 5q33.1 [CytoView] NCBI Mapview HomoloGene SPINK7 Gene and transcription Genbank AF268198 [ ENTREZ ] Genbank AY359072 [ ENTREZ ] Genbank BC109385 [ ENTREZ ] Genbank BC110067 [ ENTREZ ] RefSeq NM_032566 [ SRS ] NM_032566 [ ENTREZ ] RefSeq AC_000048 [ SRS ] AC_000048 [ ENTREZ ] RefSeq NC_000005 [ SRS ] NC_000005 [ ENTREZ ] RefSeq NT_029289 [ SRS ] NT_029289 [ ENTREZ ] RefSeq NW_922784 [ SRS ] NW_922784 [ ENTREZ ] AceView SPINK7 AceView - NCBI Unigene Hs.244569 [ SRS ] Hs.244569 [ NCBI ] HS244569 [ spliceNest ] Fast-db 11768 Protein : pattern, domain, 3D structure SwissProt P58062 [ SRS] P58062 [ EXPASY ] P58062 [ INTERPRO ] Prosite PS00282 KAZAL [ SRS ] PS00282 KAZAL [ Expasy ] Interpro IPR002350 Prot_inh_Kazal [ SRS ] IPR002350 Prot_inh_Kazal [ EBI ] Interpro IPR001239 Prot_inh_Kazal-m [ SRS ] IPR001239 Prot_inh_Kazal-m [ EBI ] CluSTr P58062 Pfam PF00050 Kazal_1 [ SRS ] PF00050 Kazal_1 [ Sanger ] pfam00050 [ NCBI-CDD ] Smart SM00280 KAZAL [EMBL] Blocks P58062 HPRD 16850 Protein Interaction databases DIP P58062 IntAct P58062 Polymorphism : SNP, mutations, diseases SNP SPINK7 [dbSNP-NCBI] SNP NM_032566 [SNP-NCI] SNP SPINK7 [GeneSNPs - Utah] SPINK7] [HGBASE - SRS] HAPMAP SPINK7 [HAPMAP] HGMD SPINK7 General knowledge Family SPINK7 [UCSC Family Browser] Browser SOURCE NM_032566 SMD Hs.244569 SAGE Hs.244569 serine-type endopeptidase inhibitor activity [Amigo] serine-type endopeptidase GO inhibitor activity GO protein binding [Amigo] protein binding

Atlas Genet Cytogenet Oncol Haematol 2007; 4 517 PubGene SPINK7 Other databases Probes Probe SPINK7 Related clones (RZPD - Berlin) PubMed PubMed 8 Pubmed reference(s) in LocusLink Bibliography Cloning and identification of cDNA fragments related to human esophageal cancer. Su T, Liu H, Lu S. Zhonghua Zhong Liu Za Zhi. 1998; 20(4): 254-257. Medline 10920976

Using yeast two-hybrid system to identify ECRG2 associated proteins and their possible interactions with ECRG2 gene. Cui YP, Wang JB, Zhang XY, Bi MX, Guo LP, Lu SH. World J Gastroenterol. 2003; 9(9): 1892-1896. Medline 12970870

ECRG2, a novel candidate of tumor suppressor gene in the esophageal carcinoma, interacts directly with metallothionein 2A and links to apoptosis. Cui Y, Wang J, Zhang X, Lang R, Bi M, Guo L, Lu SH. Biochem Biophys Res Commun. 2003; 302(4): 904-915. Medline 12646258

Short tandem repeat polymorphism in a novel esophageal cancer-related gene (ECRG2) implicates susceptibility to esophageal cancer in Chinese population. Yue CM, Bi MX, Tan W, Deng DJ, Zhang XY, Guo LP, Lin DX, Lu SH. Int J Cancer. 2004; 108(2): 232-236. Medline 14639608

Monoclonal antibodies to esophageal cancer-related gene2 protein. Huang G, Wang D, Guo L, Zhao N, Li Y, Lu SH. Hybridoma (Larchmt). 2005; 24(2): 86-91. Medline 15857172

Inhibitory effects of esophageal cancer related gene 2 on proliferation of human esophageal cancer cell EC9706. Li MN, Huang G, Guo LP, Lu SH. Zhonghua Yi Xue Za Zhi. 2005; 85(39): 2785-2788. Medline 16324322

Short tandem repeat polymorphisms of exon 4 in Kazal-type gene ECRG2 in pancreatic carcinoma and chronic pancreatitis. Kaifi JT, Cataldegirmen G, Wachowiak R, Schurr PG, Kleinhans H, Kosti G, Yekebas EF, Mann O, Kutup A, Kalinin V, Strate T, Izbicki JR. Anticancer Res. 2007; 27(1A): 69-73. Medline 17352218

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Atlas Genet Cytogenet Oncol Haematol 2007; 4 518 BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 04-2007 Xiying Yu, Shih-Hsin Lu Department of Etiology and Carcinogenesis, Cancer Institute Peking Union,

Medical College and Chinese Academy of Medical Sciences Beijing 100021 Citation This paper should be referenced as such : Yu X, Lu SH . SPINK7 (serine peptidase inhibitor, Kazal type 7 (putative)). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Genes/SPINK7ID40396ch5q33.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 519 Atlas of Genetics and Cytogenetics in Oncology and Haematology

PPM1D (protein phosphatase 1D magnesium-dependent, delta isoform)

Identity Other names Wip1 phosphatase PP2C delta (PP2Cd) EC 3.1.3.16 Hugo PPM1D Location 17q23 Local_order centromere - USP32- APPBP2 PPM1D BCAS3 - telomere. DNA/RNA Description The gene encompasses 64.5 kb of DNA; 6 exons; several SNPs have been found. Transcription Transcript length: 3,163 bps. Several splice forms have been predicted. Wip1 mRNA transcription is induced in a p53-dependent manner after stress, however p53-independent induction of Wip1 mRNA also has been described. For example, E2F1 was shown to regulate Wip1 expression as well. Protein Note Other names: Protein phosphatase 2C isoform delta (EC 3.1.3.16) (PP2C-delta) (p53- induced protein phosphatase 1) (Protein phosphatase magnesium- dependent 1 delta). Description 605 amino acids; predicted size almost 65 kDa, however overexpressed Wip1 runs at almost 83 kDa. Expression Widely expressed (human expression). Localisation Primarily nucleus. Function Wip1 phosphatase is a weak oncogene that can compliment other oncogenes (Hras, Neu:) in transformation of primary rodent cells with low efficiency. Does not complement p53-deficient cells. Wip1 phophatase has broad substrate specificity towards the threonine (p38 and UNG) or the serine residues (ATM, Chk2, p53, H2AX). Deficiency of Wip1 results in activation of p38- and ATM / Chk2-dependent signaling pathways. Inactivation of Wip1 suppresses the ability of mouse embryo fibroblasts undergo transformation in vitro and grow into tumors when explanted into nude mice. Wip1-deficient mice are resistant to multiple types of cancer including breast cancer and B-cell lymphomas. Homology Other PP2C phospatases Mutations Note Have not been described. Implicated in Entity Primary breast cancer Disease Wip1 overexpression primarily due to its gene amplification was found in almost 15% of primary breast cancers. Majority of Wip1-overexpressing tumors also have structurally intact p53. Overexpression of Wip1 inversely correlates with the level of active (phospho-) p38 MAPK. Wip1-overexpressing tumors also exhibited no or low levels of p16, which normally accumulates upon p38 MAPK activation. PPM1D amplification is associated with ERBB2 expression implying that PPM1D overexpression occurs in tumors with poor prognosis.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 520 Prognosis High expression correlates with poor prognosis.

Entity Neuroblastoma Prognosis High expression correlates with poor clinical outcome.

Entity Pancreatic adenocarcinoma Prognosis High expression correlates with poor prognosis.

Entity Ovarian adenocarcinomas Prognosis High expression correlates with poor prognosis. External links Nomenclature Hugo PPM1D GDB PPM1D Entrez_Gene PPM1D 8493 protein phosphatase 1D magnesium-dependent, delta isoform Cards Atlas PPM1DID41803ch17q23 GeneCards PPM1D Ensembl PPM1D Genatlas PPM1D GeneLynx PPM1D eGenome PPM1D euGene 8493 Genomic and cartography GoldenPath PPM1D - 17q23 chr17:56032336-56096818 + 17q23.2 (hg18- Mar_2006) Ensembl PPM1D - 17q23.2 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene PPM1D Gene and transcription Genbank AA326266 [ ENTREZ ] Genbank AU280469 [ ENTREZ ] Genbank BC016480 [ ENTREZ ] Genbank BC032826 [ ENTREZ ] Genbank BC033893 [ ENTREZ ] RefSeq NM_003620 [ SRS ] NM_003620 [ ENTREZ ] RefSeq AC_000060 [ SRS ] AC_000060 [ ENTREZ ] RefSeq NC_000017 [ SRS ] NC_000017 [ ENTREZ ]

Atlas Genet Cytogenet Oncol Haematol 2007; 4 521 RefSeq NT_010783 [ SRS ] NT_010783 [ ENTREZ ] RefSeq NW_926907 [ SRS ] NW_926907 [ ENTREZ ] AceView PPM1D AceView - NCBI Unigene Hs.591184 [ SRS ] Hs.591184 [ NCBI ] HS591184 [ spliceNest ] Fast-db 13580 Protein : pattern, domain, 3D structure SwissProt O15297 [ SRS] O15297 [ EXPASY ] O15297 [ INTERPRO ] Prosite PS01032 PP2C [ SRS ] PS01032 PP2C [ Expasy ] Interpro IPR000222 PP2C [ SRS ] IPR000222 PP2C [ EBI ] Interpro IPR001932 PP2C-like [ SRS ] IPR001932 PP2C-like [ EBI ] CluSTr O15297 Pfam PF00481 PP2C [ SRS ] PF00481 PP2C [ Sanger ] pfam00481 [ NCBI- CDD ] Smart SM00332 PP2Cc [EMBL] Blocks O15297 HPRD 05482 Protein Interaction databases DIP O15297 IntAct O15297 Polymorphism : SNP, mutations, diseases OMIM 114480;605100 [ map ] GENECLINI 114480;605100 CS SNP PPM1D [dbSNP-NCBI] SNP NM_003620 [SNP-NCI] SNP PPM1D [GeneSNPs - Utah] PPM1D] [HGBASE - SRS] HAPMAP PPM1D [HAPMAP] COSMIC PPM1D [Somatic mutation (COSMIC-CGP-Sanger)] HGMD PPM1D General knowledge Family PPM1D [UCSC Family Browser] Browser SOURCE NM_003620 SMD Hs.591184 SAGE Hs.591184 3.1.3.16 [ Enzyme-SRS ] 3.1.3.16 [ Brenda-SRS ] 3.1.3.16 [ KEGG Enzyme ] 3.1.3.16 [ WIT ] regulation of progression through cell cycle [Amigo] regulation of GO progression through cell cycle

Atlas Genet Cytogenet Oncol Haematol 2007; 4 522 G2/M transition of mitotic cell cycle [Amigo] G2/M transition of mitotic GO cell cycle GO magnesium ion binding [Amigo] magnesium ion binding GO nucleus [Amigo] nucleus protein amino acid dephosphorylation [Amigo] protein amino acid GO dephosphorylation protein amino acid dephosphorylation [Amigo] protein amino acid GO dephosphorylation GO cell cycle [Amigo] cell cycle negative regulation of cell proliferation [Amigo] negative regulation of cell GO proliferation protein serine/threonine phosphatase complex [Amigo] protein GO serine/threonine phosphatase complex GO response to radiation [Amigo] response to radiation GO response to bacterium [Amigo] response to bacterium protein phosphatase type 2C activity [Amigo] protein phosphatase type 2C GO activity protein phosphatase type 2C activity [Amigo] protein phosphatase type 2C GO activity GO hydrolase activity [Amigo] hydrolase activity GO manganese ion binding [Amigo] manganese ion binding PubGene PPM1D Other databases Other http://genome.ewha.ac.kr/cgi- database bin/ECquery.cgi?organism=human&query=PPM1D http://modbase.compbio.ucsf.edu/modbase- Other cgi/model_details.cgi?queryfile=1173350594_2949&searchmode=default database &displaymode=moddetail&referer=yes&snpflag= Probes Probe PPM1D Related clones (RZPD - Berlin) PubMed PubMed 28 Pubmed reference(s) in LocusLink Bibliography Wip1, a novel human protein phosphatase that is induced in response to ionizing radiation in a p53-dependent manner. Fiscella M, Zhang H, Fan S, Sakaguchi K, Shen S, Mercer WE, Vande Woude GF, O Connor PM, Appella E. Proc Natl Acad Sci USA 1997; 94: 6048-6053. Medline 9177166 p53-inducible wip1 phosphatase mediates a negative feedback regulation of p38 MAPK-p53 signaling in response to UV radiation. Takekawa M, Adachi M, Nakahata A, Nakayama I, Itoh F, Tsukuda H, Taya Y, Imai K. EMBO J 2000; 19: 6517-6526.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 523 Medline 11101524

Amplification of PPM1D in human tumors abrogates p53 tumor-suppressor activity. Bulavin DV, Demidov ON, Saito S, Kauraniemi P, Phillips C, Amundson SA, Ambrosino C, Sauter G, Nebreda AR, Anderson CW, Kallioniemi A, Fornace AJ Jr, Appella E. Nat Genet 2002; 31: 210-215. Medline 12021785

Oncogenic properties of PPM1D located within a breast cancer amplification epicenter at 17q23. Li J, Yang Y, Peng Y, Austin RJ, van Eyndhoven WG, Nguyen KC, Gabriele T, McCurrach ME, Marks JR, Hoey T, Lowe SW, Powers S. Nat Genet 2002; 31: 133-134. Medline 12021784

Inactivation of the Wip1 phosphatase inhibits mammary tumorigenesis through p38 MAPK- mediated activation of the p16(Ink4a)-p19(Arf) pathway. Bulavin DV, Phillips C, Nannenga B, Timofeev O, Donehower LA, Anderson CW, Appella E, Fornace AJ Jr. Nat Genet 2004; 36: 343-350. Medline 14991053

The p53-induced oncogenic phosphatase PPM1D interacts with uracil DNA glycosylase and suppresses base excision repair. Lu X, Bocangel D, Nannenga B, Yamaguchi H, Appella E, Donehower LA. Mol Cell 2004; 15: 621-634. Medline 15327777

PPM1D dephosphorylates Chk1 and p53 and abrogates cell cycle checkpoints. Lu X, Nannenga B, Donehower LA. Genes Dev 2005; 19: 1162-1174. Medline 15870257

Substrate specificity of the human protein phosphatase 2Cdelta, Wip1. Yamaguchi H, Minopoli G, Demidov ON, Chatterjee DK, Anderson CW, Durell SR, Appella E. Biochemistry 2005; 44: 5285-5294. Medline 15807522

Regulation of the antioncogenic Chk2 kinase by the oncogenic Wip1 phosphatase. Fujimoto H, Onishi N, Kato N, Takekawa M, Xu XZ, Kosugi A, Kondo T, Imamura M, Oishi I, Yoda A, Minami Y. Cell Death Differ 2006; 13: 1170-1180. Medline 16311512

Wip1 phosphatase modulates ATM-dependent signaling pathways. Shreeram S, Demidov ON, Hee WK, Yamaguchi H, Onishi N, Kek C, Timofeev ON, Dudgeon C, Fornace AJ, Anderson CW, Minami Y, Appella E, Bulavin DV. Mol Cell 2006; 23: 757-764. Medline 16949371

Regulation of ATM/p53-dependent suppression of myc-induced lymphomas by Wip1 phosphatase. Shreeram S, Hee WK, Demidov ON, Kek C, Yamaguchi H, Fornace AJ Jr, Anderson CW, Appella E, Bulavin DV. J Exp Med 2006; 203: 2793-2799.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 524 Medline 17158963

Overexpression of the wip1 gene abrogates the p38 MAPK/p53/Wip1 pathway and silences p16 expression in human breast cancers. Yu E, Ahn YS, Jang SJ, Kim MJ, Yoon HS, Gong G, Choi J. Breast Cancer Res Treat 2007; 101: 269-278. Medline 16897432

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 04-2007 Dmitry Bulavin, Oleg Demidov 61 Biopolis Dr, Proteos, IMCB, Room 5-13, Singapore, 138673 Citation This paper should be referenced as such : Bulavin D, Demidov O . PPM1D (protein phosphatase 1D magnesium-dependent, delta isoform). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Genes/PPM1DID41803ch17q23.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 525 Atlas of Genetics and Cytogenetics in Oncology and Haematology

P53 (Protein 53 kDa)

TP53 (tumor protein p53 (Li-Fraumeni syndrome))

Identity Other names TP53 (Tumour Protein 53) Hugo TP53 Location 17p13 DNA/RNA Description The gene encompasses 20 kb of DNA; 11 exons (the first is non-coding). Transcription 3.0 kb mRNA; 1179 bp open reading frame. Protein Description 393 amino acids; 53 kDa protein; numerous post translational modifications: phosphorylation, acetylation, ubiquitination, sumoylation, neddylation. Contains from N-term to C-term, a transactivation domain ((1-42), a Proline rich domain (63-97), a specific DNA binding domain (102-292), 3 nuclear localization signals (305-322), a tetramerization domain that include a nuclear export signal (325-355) and a negative regulatory domain (360-393). Expression Widely expressed Localisation Nucleus Function Tumour suppressor gene. P53 is a transcription factor present at minute level in any normal cells. Upon various types of stress (DNA damage, hypoxia, nucleotide pool depletion, viral infection, oncogene activation), postranslational modification lead to p53 stabilisation and activation. Although the number of genes activated by p53 is rather large, the outcome of p53 activation is either cell cycle arrest in G1 (by p21 ), in G2 (by 14-3-3 s) or apoptosis (by BAX, PUMA or NOXA). The cell growth arrest activity of p53 allows the activation of the DNA repair system of the cell. Homology The five domains are highly-conserved regions between species (from human to fly). Two new genes homologous to p53 have been discovered, p73 localized at 1p36 and p63 localized at 3q27. Mutations Germinal In Li-Fraumeni syndrome, a dominantly inherited disease in which affected individuals are predisposed to develop sarcomas, osteosarcomas, leukemias and breast cancers at unusually early ages. Inherited TP53 mutations are associated with Li-Fraumeni and Li-Fraumeni-like syndromes, characterized by a familial clustering of tumors, with a predominance of soft tissue and bone sarcomas, breast cancers, brain tumors, and adrenocortical carcinomas, diagnosed before the age of 45 years. Somatic P53 is mutated in about 50% of human cancers, and the non-mutated allele is generally lost. The frequency and the type of mutation may vary from one tumour type to another. Somatic TP53 mutations are frequent in most human cancers, ranging from 5% to 80% depending on the type, stage and etiology of tumors. Most mutations are missense (75%) and other include non-sense (7.5%), deletions, insertions or splicing mutations (17.5%). There are some hot-spots for mutations at CpG dinucleotides at codon positions 175, 248, 273 and 282. TP53 gene mutation is a marker of bad prognosis in a number of cancers, such as breast cancer. Specific mutation spectra are observed in lung, liver and skin cancer that are related to specific carcinogen exposure (tobacco smoke, aflatoxin and UV respectively).

Atlas Genet Cytogenet Oncol Haematol 2007; 4 526 Implicated in Entity Li-Fraumeni syndrome (LFS) Disease Autosomal dominant condition, cancer prone disease, Li-Fraumeni syndrome (LFS) is defined by the existence of a proband with early onset sarcoma and a first degree relative with cancer before 45 years, plus another first/second degree relative with cancer at before 45 years or sarcoma at any age. Clinical definitions for Li-Fraumeni like syndromes (LFL) have also been proposed by Eeles and Birch. Germline mutation of TP53 is found in about 70% of LFS and 50% of LFL cases. In a few cases of LFS/LFL families free of TP53 mutations, germline mutations in genes connected to the p53 pathway have been found: CHK2, PTEN, CDKN2A. Prognosis Most common cancer in Li-Fraumeni children (before the age of 10 years) are: soft tissues sarcoma, brain tumors and adrenocortical carcinomas; osteosarcoma predominate in adolescents; afterwards, female breast cancer, soft tissue sarcomas and brain tumors prevail, and other less frequent cancers such as leukaemias or colon carcinomas are also observed. Multiple primary cancers are quite characteristic of Li- Fraumeni syndrome but may also be representative of Bloom's syndrome. Cancers in this disease, as in other cancer-prone diseases, often occur early in life: 50% of patients aged 30 years have had a cancer (i.e. penetrance is 50%, according to this disease definition), and penetrance is 90% at age 60 years. Oncogenesis (known) germinal mutations are variable, but are mostly missense mutations located in exons 4 to 10. In tumours occurring in these patients, the other (wild-type) allele is often lost, in accordance with the two-hit model for neoplasia. Entity Haematological malignancies Oncogenesis TP53 gene alterations have been found in: - 20 - 30% of blast crisis CML (mostly in the myeloid type), often associated with i(17q). - 5% of MDS cases and 15% of ANLL often with a visible del(17p). - 2% of ALL (but with high variations according to the ALL type, reaching 50% of L3 ALL (and Burkitt lymphomas). - 15% of CLL (and 40% in the aggressive CLL transformation into the Richter's syndrome) and 30% of adult T-cell leukaemia (only found in the aggressive form). - 5-10% of multiple myelomas. - 60-80% of Hodgkin disease. - 30% of high grade B-cell NHL (rare in low grade NHL), and 50% of HIV-related NHL. TP53 gene alterations in haematological malignancies are associated with a poor prognosis. Entity Skin cancers Disease Skin cancers include basal cell carcinomas, squamous cell cercinomas, and melanomas. Prognosis Highly different according to the pathological group. Oncogenesis TP53 is mutated in 40% of basal cell carcinomas and squamous cell carcinomas while mutations are infrequent in malignant melanoma. The pattern of TP53 mutation in skin cancer is highly related to UV exposure with a high frequency of CC->TT and C->T transitions and specific hotspots at codons 196 and 278. Entity Melanoma Disease Melanoma is a malignant tumor of melanocytes. Epidemiologic evidence suggests that exposure to ultraviolet (UV) radiation and the sensitivity of an individual's skin to UV radiation are risk factors for skin cancer including melanoma. Oncogenesis TP53 gene mutations are rare in melanoma. They often lose Apaf-1, a cell-death effector that acts with cytochrome c and caspase-9 to mediate p53-dependent apoptosis. It may contribute to the low frequency of TP53 mutations observed in this highly chemoresistant tumour type. Entity Breast cancer Oncogenesis TP53 is mutated in 25% of breast cancers with hotspots at codons 175, 220, 245, 248, 273. Geographical variations in mutation patterns have been observed. The prevalence

Atlas Genet Cytogenet Oncol Haematol 2007; 4 527 of mutations is higher in large size, high grade and estrogen receptor negative tumors. It is also higher in BRCA1-related tumors. TP53 mutation is a factor of poor prognosis independently of tumor stage and hormone receptor content. It is associated with poor response to doxorubicin therapy. Entity Head and neck squamous cell carcinoma Disease Head and neck cancer is an important health problem around the world accounting for approximately 500 000 new cases each year. The carcinogenesis of head and neck results from a dysregulation of cellular proliferation, differentiation and cell death. The major etiologic agents are tobacco and alcohol consumption and for some cases human papilloma virus (HPV) infection. Oncogenesis TP53 mutation can be found in about 40-60% of HNSCC cancers and is thought to be an early event as it is often detected in precancerous lesions. TP53 mutation is associated with poor prognosis in HNSCC. Entity Lung cancers Disease Lung cancers are neuroendocrine lung tumours (small cell lung carcinomas, carcinoids, large cell neuroendocrine carcinomas) or non neuroendocrine lung tumours (squamous carcinomas, adenocarcinomas, large cell carcinomas). Oncogenesis Is multistep, through C-MYC or N-MYC activation, H-RAS1 or K-RAS2 mutation, P53, RB1, and P16 inactivation, loss of heterozygosity (LOH) at 3p, 13q, 17p. TP53 is mutated in 40% of lung cancers with frequent G->T transversions at codons 157, 158, 245, 248, 249 and 273. These mutations are linked to exposure to tobacco smoke. TP53 gene mutations may be associated with bad prognosis. Entity Oesophagus cancers Disease Two main forms: squamous cell carcinoma and adenocarcinoma Oncogenesis TP53 is mutated in 45% of oesophageal cancers with hotspots at codons 175, 176, 248, 273, 282. It is thought to be an early event as it is often detected in precancerous lesions. Entity Liver cancer Cytogenetics Losses of 1p, 4q, 5p, 5q, 8q, 13q, 16p, 16q, and 17p in 20 to 50% of cases. Oncogenesis Specific mutation at codon 249 related to aflatoxin B1 dietary exposure in exposed area (China, Africa); low frequency of mutation in developed countries. Entity Gastric cancer Disease Risk factors for gastric cancer include: Helicobacter pylori gastric infection, advanced age, male gender, diet including dry salted foods, atrophic gastritis, pernicious anemia, cigarette smoking, Menetrier's disease , and familial polyposis. Adenocarcinoma histology accounts for 90% to 95% of all gastric malignancies. The prognosis of patients with gastric cancer is related to tumor extent and includes both nodal involvement and direct tumor extension beyond the gastric wall. Tumor grade may also provide some prognostic information. Oncogenesis TP53 mutations are found in about 30% of gastric cancer with a spectrum similar to the one of colorectal cancer. The prognostic value of these mutations is unknown. Entity Colorectal cancers Disease There are two types of colorectal cancers, according to the ploidy: - The diploid form, RER+ (Replication Error+), sporadic, without loss of heterozygosity (LOH), with few mutations of p53 and APC, and right-sided. -The polyploid form, RER-, with LOH (5q, 17p, 18q), mutations in p53, and more often left-sided, they have a worse prognosis. Prognosis Survival, although improving, is not much more than 50% after 5 years. Cytogenetics Diploid tumours without frequent allelic losses; aneuploid tumours with numerous allelic losses; LOH on chromosomes 17 and 18 in more than 75% of cases; other chromosome arms losses in about 50% of cases. Oncogenesis A number of genes are known to be implicated in tumour progression in colorectal

Atlas Genet Cytogenet Oncol Haematol 2007; 4 528 cancers : APC, P53, KRAS2, mismatch repair genes (MMR genes). TP53 is mutated in 45% of colorectal cancer cases with a majority of C->T transitions at CpG sites and hotspots at codons 175, 245, 248, 273 and 282. TP53 mutation may be associated with poor prognosis in patient treated with chemotherapy. Entity Bladder cancer Prognosis Highly variable, according to the stage and the grade. Cytogenetics -9, -11 or del(11p), del(17p) and LOH at 17p, del(13q), frequent other LOH, aneuploidy, polyploidy, complex karyotypes. Oncogenesis Multi-step and largely unknown process; loss of 9q and P53 mutations would be early events; RB1, and P16 inactivation, EGFR overexpression, LOH at 3p, 8p, 11p, 13q, 17p, 18q. TP53 is mutated in 30% of bladder cancers with a majority of G->A transitions at non-CpG sites and 2 hotspots at codons 280 and 285. Entity Cervical cancer Disease Risk factors for cervical cancer include predominantly infection with certain human papillomaviruses such as HPV16 and HPV18. Carcinoma of the uterine cervix is one of the most common neoplasias among women worldwide. Oncogenesis The frequency of TP53 mutation in cervical cancer is very low. The p53 pathway is inactivated by the E6 protein that binds and inactivates the p53 protein. Rare TP53 mutations have been detected in HPV negative cancer. Entity Ovary carcinoma Disease Epithelial carcinoma of the ovary is one of the most common gynecologic malignancies. The most important risk factor for ovarian cancer is a family history of a first-degree relative (mother, daughter, or sister) with the disease. Oncogenesis TP53 mutation is present in 20% in early stage to 80% in late stage ovarian cancers. The prognostic value of TP53 gene mutation is still a matter of debate, although positive IHC staining for p53 protein seems to be associated with poor prognosis. Entity Prostate cancer Oncogenesis TP53 mutations are found in less than 20% of prostate cancers with a main hotspot at codon 273. Little is known about the role and prognostic value of these mutations. Entity Glioblastoma Disease Glioblastoma is the most malignant astrocytic tumor and is preferentially located in the cerebral hemisphere. It may develop from a less malignant precursor lesion such as diffuse astrocytoma or anaplastic astrocytoma, or may develop de novo (secondary glioblastoma and primary glioblastoma respectively). Secondary glioblastoma are more frequent in younger patients and have a better prognosis. Oncogenesis TP53 mutation is an early and frequent (over 60%) event in secondary glioblastomas while it is rare in primary glioblastomas (inferior to 10%) with hotspots at codons 175, 248 and 273. TP53 mutation is associated with good prognosis as it is more frequent in secondary glioblastomas which occur in young patients and are of better prognosis. To be noted Germinal mutations of P53 have also been found in families where the criteria for LFS or LFL were not reached. External links Nomenclature Hugo TP53 GDB TP53 Entrez_Gene TP53 7157 tumor protein p53 (Li-Fraumeni syndrome) Cards Atlas P53ID88 GeneCards TP53

Atlas Genet Cytogenet Oncol Haematol 2007; 4 529 Ensembl TP53 Genatlas TP53 GeneLynx TP53 eGenome TP53 euGene 7157 Genomic and cartography GoldenPath TP53 - 17p13 chr17:7512444-7531642 - 17p13.1 (hg18-Mar_2006) Ensembl TP53 - 17p13.1 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene TP53 Gene and transcription Genbank AB082923 [ ENTREZ ] Genbank AF052180 [ ENTREZ ] Genbank AF307851 [ ENTREZ ] Genbank AK223026 [ ENTREZ ] Genbank AK225838 [ ENTREZ ] RefSeq NM_000546 [ SRS ] NM_000546 [ ENTREZ ] RefSeq AC_000060 [ SRS ] AC_000060 [ ENTREZ ] RefSeq NC_000017 [ SRS ] NC_000017 [ ENTREZ ] RefSeq NT_010718 [ SRS ] NT_010718 [ ENTREZ ] RefSeq NW_926584 [ SRS ] NW_926584 [ ENTREZ ] AceView TP53 AceView - NCBI Unigene Hs.654481 [ SRS ] Hs.654481 [ NCBI ] HS654481 [ spliceNest ] Fast-db 3234 Protein : pattern, domain, 3D structure Protein Interaction databases Polymorphism : SNP, mutations, diseases OMIM 114480;114500;114550;151623;161550;191170;202300;260350 [ map ] GENECLINICS 114480;114500;114550;151623;161550;191170;202300;260350 SNP TP53 [dbSNP-NCBI] SNP NM_000546 [SNP-NCI] SNP TP53 [GeneSNPs - Utah] TP53] [HGBASE - SRS] HAPMAP TP53 [HAPMAP] COSMIC TP53 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD TP53 General knowledge Family TP53 [UCSC Family Browser] Browser SOURCE NM_000546 SMD Hs.654481 SAGE Hs.654481 GO DNA strand annealing activity [Amigo] DNA strand annealing activity GO response to tumor cell [Amigo] response to tumor cell

Atlas Genet Cytogenet Oncol Haematol 2007; 4 530 GO chromatin binding [Amigo] chromatin binding GO transcription factor activity [Amigo] transcription factor activity GO transcription factor activity [Amigo] transcription factor activity GO nuclease activity [Amigo] nuclease activity GO copper ion binding [Amigo] copper ion binding GO protein binding [Amigo] protein binding GO ATP binding [Amigo] ATP binding GO insoluble fraction [Amigo] insoluble fraction GO nucleus [Amigo] nucleus GO nucleus [Amigo] nucleus GO nucleoplasm [Amigo] nucleoplasm GO nucleolus [Amigo] nucleolus GO cytoplasm [Amigo] cytoplasm GO mitochondrion [Amigo] mitochondrion GO endoplasmic reticulum [Amigo] endoplasmic reticulum GO base-excision repair [Amigo] base-excision repair GO nucleotide-excision repair [Amigo] nucleotide-excision repair regulation of transcription, DNA-dependent [Amigo] regulation of transcription, DNA- GO dependent regulation of transcription, DNA-dependent [Amigo] regulation of transcription, DNA- GO dependent GO protein complex assembly [Amigo] protein complex assembly GO apoptosis [Amigo] apoptosis GO response to DNA damage stimulus [Amigo] response to DNA damage stimulus GO ER overload response [Amigo] ER overload response GO cell cycle [Amigo] cell cycle GO cell cycle arrest [Amigo] cell cycle arrest GO multicellular organismal development [Amigo] multicellular organismal development GO cell aging [Amigo] cell aging GO protein localization [Amigo] protein localization GO zinc ion binding [Amigo] zinc ion binding GO zinc ion binding [Amigo] zinc ion binding GO cell proliferation [Amigo] cell proliferation induction of apoptosis by intracellular signals [Amigo] induction of apoptosis by GO intracellular signals GO caspase activation via cytochrome c [Amigo] caspase activation via cytochrome c GO nuclear matrix [Amigo] nuclear matrix GO RNA-protein covalent cross-linking [Amigo] RNA-protein covalent cross-linking GO enzyme binding [Amigo] enzyme binding GO cell differentiation [Amigo] cell differentiation GO negative regulation of cell growth [Amigo] negative regulation of cell growth cellular response to glucose starvation [Amigo] cellular response to glucose GO starvation DNA damage response, signal transduction by p53 class mediator resulting in GO induction of apoptosis [Amigo] DNA damage response, signal transduction by p53

Atlas Genet Cytogenet Oncol Haematol 2007; 4 531 class mediator resulting in induction of apoptosis GO regulation of apoptosis [Amigo] regulation of apoptosis negative regulation of progression through cell cycle [Amigo] negative regulation of GO progression through cell cycle positive regulation of transcription from RNA polymerase II promoter [Amigo] positive GO regulation of transcription from RNA polymerase II promoter GO metal ion binding [Amigo] metal ion binding regulation of mitochondrial membrane permeability [Amigo] regulation of GO mitochondrial membrane permeability GO protein heterodimerization activity [Amigo] protein heterodimerization activity GO protein N-terminus binding [Amigo] protein N-terminus binding GO negative regulation of helicase activity [Amigo] negative regulation of helicase activity GO protein tetramerization [Amigo] protein tetramerization PubGene TP53 Other databases Other IARC TP53 Mutation Database database Other P53 Knowledge Database database Other http://p53.free.fr/Database/p53_database.html database Other Database of germline p53 mutations database Probes Probe TP53 Related clones (RZPD - Berlin) PubMed PubMed 499 Pubmed reference(s) in LocusLink Bibliography Li-Fraumeni syndrome - A molecular and clinical review. Varley JM, Evans DGR, Birch JM. Brit J Cancer 1997; 76: 1-14. Medline 9218725

Dial 9-1-1 for p53: mechanisms of p53 activation by cellular stress. Ljungman M. Neoplasia 2000; 2: 208-225. Medline 10935507

Surfing the p53 network. Vogelstein B, Lane D, Levine AJ. Nature 2000; 408: 307-310. Medline 11099028 p53: death star. Vousden KH. p53. Cell 2000; 103(5): 691-694. Medline 11114324 p63 and p73: p53 mimics, menaces and more.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 532 Yang A, McKeon F. Nature Cell Biology 2000; 1: 199-207. Medline 11252895

Assessing TP53 status in human tumours to evaluate clinical outcome. Soussi T, Béroud C. Nature Cancer Review 2001; 1: 233-240. Medline 11902578

The evolution of diverse biological responses to DNA damage: insights from yeast and p53. Wahl, GM, Carr AM. Nat Cell Biol 2001; 3: 277-286. Medline 11781586 p73: friend or foe in tumorigenesis. Melino G, De Laurenzi V, Vousden KH. Nat Rev Cancer 2002; 2: 605-615. Medline 12154353

Li-Fraumeni and related syndromes: correlation between tumor type, family structure, and TP53 genotype. Olivier M, Goldgar DE, Sodha N, Ohgaki H, Kleihues P, Hainaut P, Eeles RA. Cancer Res. 2003; 63(20): 6643-6650. Medline 14583457

Focus on the p53 gene and cancer: Advances in TP53 mutation research Soussi T. Hum Mutat. 2003; 21(3): 173-5. Special Issue Medline 12619102

25 Years of p53 Research Pierre Hainaut and Klas G. Wiman Eds. Springer, Dordrecht, Netherlands, 2005 Hardback: 458 pp

The p53 pathway: positive and negative feedback loops. Harris SL, Levine AJ. Oncogene. 2005; 24(17): 2899-2908 Medline 15838523

Transcription-independent pro-apoptotic functions of p53. Moll UM, Wolff S, Speidel D, Deppert W. Curr Opin Cell Biol. 2005; 17(6): 631-636. Medline 16226451 p53 aerobics: the major tumor suppressor fuels your workout. Kruse JP, Gu W. Cell Metab. 2006; 4(1): 1-3. Medline 16814724 p53: more research and more questions. Cell Death Differ. 2006; 13(6): 877-880. Special issue Medline 16708075

Atlas Genet Cytogenet Oncol Haematol 2007; 4 533 TP53 mutations in human cancers: functional selection and impact on cancer prognosis and outcomes. Petitjean A, Achatz MI, Borresen-Dale AL, Hainaut P, Olivier M. Oncogene. 2007; 26(15): 2157-2165. Medline 17401424

Impact of mutant p53 functional properties on TP53 mutation patterns and tumor phenotype: lessons from recent developments in the IARC TP53 database. Petitjean A, Mathe E, Kato S, Ishioka C, Tavtigian SV, Hainaut P, Olivier M. Human Mutation. 2007; 28(6): 622-629. Medline 17311302

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 07-1998 Richard Hamelin, Jean-Loup Huret INSERM U434, Laboratoire de Genetique des Tumeurs, CEPH, Paris (RH), and Genetics, Dept Medical Information, University of Poitiers; CHU Poitiers Hospital, F-86021 Poitiers (JLH), France. Updated 10-1998 Richard Hamelin, Jean-Loup Huret INSERM U434, Laboratoire de Genetique des Tumeurs, CEPH, Paris (RH), and Genetics, Dept Medical Information, University of Poitiers; CHU Poitiers Hospital, F-86021 Poitiers (JLH), France. Updated 12-2001 Thierry Soussi INSERM U434, Laboratoire de Genetique des Tumeurs, CEPH, Paris (RH), and Genetics, Dept Medical Information, University of Poitiers; CHU Poitiers Hospital, F-86021 Poitiers (JLH), France. Updated 10-2002 Thierry Soussi INSERM U434, Laboratoire de Genetique des Tumeurs, CEPH, Paris (RH), and Genetics, Dept Medical Information, University of Poitiers; CHU Poitiers Hospital, F-86021 Poitiers (JLH), France. Updated 04-2007 Magali Olivier INSERM U434, Laboratoire de Genetique des Tumeurs, CEPH, Paris (RH), and Genetics, Dept Medical Information, University of Poitiers; CHU Poitiers Hospital, F-86021 Poitiers (JLH), France. Citation This paper should be referenced as such : Hamelin R, Huret JL . P53 (Protein 53 kDa); TP53 (tumor protein p53 (Li-Fraumeni syndrome)). Atlas Genet Cytogenet Oncol Haematol. July 1998 . URL : http://AtlasGeneticsOncology.org/Genes/P53ID88.html Hamelin R, Huret JL . P53 (Protein 53 kDa); TP53 (tumor protein p53 (Li-Fraumeni syndrome)). Atlas Genet Cytogenet Oncol Haematol. October 1998 . URL : http://AtlasGeneticsOncology.org/Genes/P53ID88.html Soussi T . P53 (Protein 53 kDa); TP53 (tumor protein p53 (Li-Fraumeni syndrome)). Atlas Genet Cytogenet Oncol Haematol. December 2001 . URL : http://AtlasGeneticsOncology.org/Genes/P53ID88.html Soussi T . P53 (Protein 53 kDa); TP53 (tumor protein p53 (Li-Fraumeni syndrome)). Atlas Genet

Atlas Genet Cytogenet Oncol Haematol 2007; 4 534 Cytogenet Oncol Haematol. October 2002 . URL : http://AtlasGeneticsOncology.org/Genes/P53ID88.html Olivier M . P53 (Protein 53 kDa); TP53 (tumor protein p53 (Li-Fraumeni syndrome)). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Genes/P53ID88.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 535 Atlas of Genetics and Cytogenetics in Oncology and Haematology

LOXL4 (lysyl oxidase-like 4)

Identity Other names LOXC (mouse) EER-7 (endothelial estrogen-regulated gene-7) Hugo LOXL4 Location 10q24.2 DNA/RNA Note LOXL4 (lysyl oxidase-like 4) is a member of the lysyl oxidase (LOX) family. Its C- terminal region is conserved in all five members of this copper-dependent amine oxidase family and includes a copper-binding site, lysyl and tyrosine residues that form the lysyltyrosine-quinone cofactor (LTQ) and a cytokine receptor-like domain. The N- terminal region of LOXL4 contains four scavenger receptor cysteine-rich (SRCR) domains and has homology with LOXL2 and LOXL3, but not with LOX or LOXL that do not contain these domains. The second SRCR domain contains a 13 amino acid insertion that is unique to LOXL4. Description The LOXL4 genomic sequence is 14.095 kb with an open reading frame of 2.278 kb and a 5¹ UTR of 384 bases. The TATA-box is at -25 and the TRE sequence, TGACTCA (TPA-responsive element), is at -75. The GATA domain is located at -113 and -669, and the RFX1 transactivator binding site, GGAA, is found at -149. Sp1 transcription factor consensus sequence, GGCGGC, is at -181, CCAAT (CP1-factor) at -257 and -892 and the repetitive sequence motif GAAA at -310 and 329. No GC box is present in the promoter region. Transcription The 14 exons of the LOXL4 gene make up an mRNA of 3.877 kb with a coding region of 2.278 kb. Transcriptional start site is at +384 upstream of the translation initiation codon (ATG). The first stop codon (TGA) is at position 14.480. In the 3¹ UTR there is a 1230 bp untranslated trailer sequence and two consensus polyadenylation signals have been located 30 bp and 322 upstream of the poly-A tail. Protein Note Western blot analysis of HT-1080 cells detected the recombinant and secreted LOXL4 form as slightly larger than the cellular 85 kDa form probably due to glycosylation or other modifications, some of which may be cell type dependent. Description The predicted LOXL4 protein is 756 amino acids including a 24 amino acid signal peptide, with a molecular mass of approximately 84.5 kDa. Expression In tissues the LOXL4 mRNA is expressed in the placenta, trachea, lung, kidney, pancreas, testis, aorta liver, fetal liver and at lover levels in several other tissues that include the heart, skeletal muscle, spleen, prostate, ovary, small intestine, colon, bladder, and thyroid, adrenal, salivary and mammary glands. LOXL4 mRNA was also reported in vocal cord, laryngeal, hypopharyngeal, parotid and oropharyngeal carcinoma tumor biopsies. The LOXL4 mRNA was reported in cultured fibroblasts, smooth muscle cells, MDA-MB-231 breast cancer and osteosarcoma (OHS) cells. Both mRNA and immunohistochemistry analyses demonstrated LOXL4 expression in head and neck squamous cell carcinoma (HNSSC) tissues and cultured cell lines. No mRNA expression was detected in HCT-116 and DLD-1 colon, MCF7, T47D and Hs578T breast and DU-145 prostate cancer lines. The mouse homologue of LOXL4, reported as LOXC, was identified as a mRNA expressed in calcified ATDC5 cells, MC3T3-E1 cells, C3H10T1/2 embryonic fibroblast and myoblastic C2C12 cells. Up-regulation of the LOXL4 mRNA (EER-7) was reported 100-fold in human umbilical vein endothelial cells (HUVECs) transfected with estrogen

Atlas Genet Cytogenet Oncol Haematol 2007; 4 536 receptor (alpha and beta) in response to treatment with 17beta-estrogen. Localisation The recombinant LOXL4 protein in human HT-1080 fibrosarcoma cell line localized both intra- and extracellularly. In HNSCC, LOXL4 immunohistochemical staining was prevalently cytoplasmic in poorly differentiated cases with increasing perinuclear staining in well-differentiated areas. In HTB-43 pharyngeal SCC cells LOXL4 staining revealed a punctate pattern within cells with perinuclear enrichment. This pattern suggested containment of LOXL4 in the endomembrane sytem of cells at sites of synthesis and vesicular transport for secretion at the cell surface. Flow cytometry (FACS) analysis demonstrated that approximately 15% of these cells had LOXL4 localized on their surface. In contrast, LOXL4 expression was not detected (or only to a very low extent) in cultured normal epithelial cells derived from oral mucosa samples. Function LOXL4 may function as an active amine oxidase, as betaAPN (beta- aminopropionitrile) inhibitable enzymatically active recombinant human LOXL4 was generated in an E. coli expression system and positively evaluated for its catalytic activity with a diamine substrate. The mouse homologue of LOXL4, LOXC, showed similar betaAPN inhibitable catalytic activity when tested using a collagen substrate. Homology LOXL4 has homology with the C-terminal domains to LOX, LOXL1, LOXL2 and LOXL3 and homology with the four N-terminal SRCR domains of LOXL2 and LOXL3. Implicated in Entity Breast cancer invasion Note LOXL4 mRNA was expressed in MDA-MB-231 highly invasive breast cancer cells, but not in poorly invasive and non-metastatic breast cancer cells MCF7 and T47D. Disease Breast cancer

Entity Human head and neck squamous cell carcinoma (HNSSC) Note LOXL4 mRNA was detected in 16 HNSSC cell lines, obtained from recurrent and primary tumors, whereas no expression was detected in normal epithelial cells. LOXL4 was also found over-expressed in 71% of invasive HNSSC tumors and primary tumors of the glottic larynx, parotic gland, oropharynx and nose synus, primary and metastatic tumors of the larynx, hypopharynx and tongue and metastatic tumor of the thyroid glandand in 90% of primary or metastatic HNSSC cell lines. Disease Invasive head and neck carcinoma Prognosis Significant correlation was found between LOXL4 expression and regional lymph node metastases and strong LOXL4 expression was present in metastatic HNSCC cell lines. There is no information regarding LOXL4 expression in distant metastases as patients with distant metastases are predominantly treated not surgically, but with radio - and/or chemotherapy. Cytogenetics Isochromosome i(10)(q10) was found associated with an amplification of the LOXL4 gene locus at 10q24 in a subset of interphase nuclei in UTSCC19A and HLAC78 head and neck carcinoma cells. External links Nomenclature Hugo LOXL4 GDB LOXL4 Entrez_Gene LOXL4 84171 lysyl oxidase-like 4 Cards Atlas LOXL4ID41193ch10q24 GeneCards LOXL4 Ensembl LOXL4

Atlas Genet Cytogenet Oncol Haematol 2007; 4 537 Genatlas LOXL4 GeneLynx LOXL4 eGenome LOXL4 euGene 84171 Genomic and cartography GoldenPath LOXL4 - 10q24.2 chr10:99997433-100017997 - 10q24 (hg18-Mar_2006) Ensembl LOXL4 - 10q24 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene LOXL4 Gene and transcription Genbank AF338441 [ ENTREZ ] Genbank AF395336 [ ENTREZ ] Genbank AK025542 [ ENTREZ ] Genbank AK172781 [ ENTREZ ] Genbank AY036093 [ ENTREZ ] RefSeq NM_032211 [ SRS ] NM_032211 [ ENTREZ ] RefSeq AC_000053 [ SRS ] AC_000053 [ ENTREZ ] RefSeq NC_000010 [ SRS ] NC_000010 [ ENTREZ ] RefSeq NT_030059 [ SRS ] NT_030059 [ ENTREZ ] RefSeq NW_924884 [ SRS ] NW_924884 [ ENTREZ ] AceView LOXL4 AceView - NCBI Unigene Hs.671890 [ SRS ] Hs.671890 [ NCBI ] HS671890 [ spliceNest ] Fast-db 16349 Protein : pattern, domain, 3D structure SwissProt Q5W0B3 [ SRS] Q5W0B3 [ EXPASY ] Q5W0B3 [ INTERPRO ] Prosite PS00926 LYSYL_OXIDASE [ SRS ] PS00926 LYSYL_OXIDASE [ Expasy ] Prosite PS00420 SRCR_1 [ SRS ] PS00420 SRCR_1 [ Expasy ] Prosite PS50287 SRCR_2 [ SRS ] PS50287 SRCR_2 [ Expasy ] Interpro IPR001695 Lysyl_oxidase [ SRS ] IPR001695 Lysyl_oxidase [ EBI ] Interpro IPR001190 Srcr_rcpt [ SRS ] IPR001190 Srcr_rcpt [ EBI ] CluSTr Q5W0B3 PF01186 Lysyl_oxidase [ SRS ] PF01186 Lysyl_oxidase [ Sanger ] pfam01186 [ Pfam NCBI-CDD ] Pfam PF00530 SRCR [ SRS ] PF00530 SRCR [ Sanger ] pfam00530 [ NCBI-CDD ] Smart SM00202 SR [EMBL] Prodom PD013887 Lysyl_oxidase[INRA-Toulouse] Q5W0B3 Q5W0B3_HUMAN [ Domain structure ] Q5W0B3 Q5W0B3_HUMAN [ Prodom sequences sharing at least 1 domain ] Blocks Q5W0B3 HPRD 09538 Protein Interaction databases DIP Q5W0B3 IntAct Q5W0B3

Atlas Genet Cytogenet Oncol Haematol 2007; 4 538 Polymorphism : SNP, mutations, diseases OMIM 607318 [ map ] GENECLINICS 607318 SNP LOXL4 [dbSNP-NCBI] SNP NM_032211 [SNP-NCI] SNP LOXL4 [GeneSNPs - Utah] LOXL4] [HGBASE - SRS] HAPMAP LOXL4 [HAPMAP] COSMIC LOXL4 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD LOXL4 General knowledge Family LOXL4 [UCSC Family Browser] Browser SOURCE NM_032211 SMD Hs.671890 SAGE Hs.671890 GO protein-lysine 6-oxidase activity [Amigo] protein-lysine 6-oxidase activity GO scavenger receptor activity [Amigo] scavenger receptor activity GO copper ion binding [Amigo] copper ion binding GO extracellular region [Amigo] extracellular region GO membrane [Amigo] membrane GO oxidoreductase activity [Amigo] oxidoreductase activity GO metal ion binding [Amigo] metal ion binding PubGene LOXL4 Other databases Probes Probe LOXL4 Related clones (RZPD - Berlin) PubMed PubMed 12 Pubmed reference(s) in LocusLink Bibliography A novel human lysyl oxidase-like gene (LOXL4) on chromosome 10q24 has an altered scavenger receptor cysteine rich domain. Asuncion L, Fogelgren B, Fong KS, Fong SF, Kim Y, Csiszar K. Matrix Biol. 2001; 20(7): 487-491. Medline 11691588

Molecular cloning and biological activity of a novel lysyl oxidase-related gene expressed in cartilage. Ito H, Akiyama H, Iguchi H, Iyama K, Miyamoto M, Ohsawa K, Nakamura T. J Biol Chem. 2001; 276(26): 24023-24029. Medline 11292829

Cloning and characterization of a fifth human lysyl oxidase isoenzyme: the third member of the lysyl oxidase-related subfamily with four scavenger receptor cysteine-rich domains. Maki JM, Tikkanen H, Kivirikko KI. Matrix Biol. 2001; 20(7): 493-496. Medline 11691589

Atlas Genet Cytogenet Oncol Haematol 2007; 4 539 Estrogen receptors alpha and beta have similar activities in multiple endothelial cell pathways. Evans MJ, Harris HA, Miller CP, Karathanasis SK, Adelman SJ. Endocrinology. 2002; 143(10): 3785-3795. Medline 1223908

A molecular role for lysyl oxidase in breast cancer invasion. Kirschmann DA, Seftor EA, Fong SF, Nieva DR, Sullivan CM, Edwards EM, Sommer P, Csiszar K, Hendrix MJ. Cancer Res. 2002; 62(15): 4478-4483. Medline 12154058

Overexpression of a novel lysyl oxidase-like gene in human head and neck squamous cell carcinomas. Holtmeier C, Gorogh T, Beier U, Meyer J, Hoffmann M, Gottschlich S, Heidorn K, Ambrosch P, Maune S. Anticancer Res. 2003; 23(3B): 2585-2591. Medline 12894545

Expression and purification of enzymatically active forms of the human lysyl oxidase-like protein 4. Kim MS, Kim SS, Jung ST, Park JY, Yoo HW, Ko J, Csiszar K, Choi SY, Kim Y. J Biol Chem. 2003; 278(52): 52071-52074. Medline 14551188

Selective upregulation and amplification of the lysyl oxidase like-4 (LOXL4) gene in head and neck squamous cell carcinoma. Gorogh T, Weise J, Holtmeier C, Rudolph P, Hedderich J, Gottschlich S, Hoffmann M, Ambrosch P, Csiszar K. J Pathol. 2007; [Epub ahead of print] Medline 17354256

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 04-2007 Kornelia Molnarne Szauter, Tibor Gorogh, Katalin Csiszar Cardiovascular Research Center, Associate Chair for Research, CAM Department, John A. Burns School of Medicine, Associate Member, Cancer

Research Center of Hawaii, University of Hawaii, 1960 East West Road, Biomed T415, Honolulu, HI 96822 Citation This paper should be referenced as such : Szauter KM, Gorogh T, Csiszar K . LOXL4 (lysyl oxidase-like 4). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Genes/LOXL4ID41193ch10q24.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 540

Atlas Genet Cytogenet Oncol Haematol 2007; 4 541 Atlas of Genetics and Cytogenetics in Oncology and Haematology

ITK (IL2-inducible T-cell kinase)

Identity Other names EMT LYK MGC126257 MGC126258 PSCTK2 Hugo ITK Location 5q33.3 DNA/RNA Description centromere to telomere orientation; Exons: 17 Transcription Transcript length: 4,419 bps Protein

ITK protein

Description Number of residues: 620 residues; Molecular weight: 71 kDa; Conserved domains: PH-Tec, Tec pleckstrin homology (PH) domain; BTK, Bruton's tyrosine kinase Cys-rich motif; SH3, Src homology 3 domains; SH2, Src homology 2 domains; TyrKc, Tyrosine kinase, catalytic domain. Function Although originally described as an important component of proximal TCR signaling pathways, the Tec family tyrosine kinase Itk has become increasingly recognized for its important role in regulating T-helper-cell differentiation. Itk has a crucial role in Th2 responses, both the protective responses to pathogenic infections in addition to the pathological responses resulting in allergic asthma. Itk is not required for Th2 differentiation per se, but effector Th2 cytokine production during recall responses is severely impaired in the absence of Itk. Implicated in Entity t(5;9)(q33;q22) Disease peripheral T-cell lymphomas, unspecified (PTCL-u). ITK-SYK transcripts were detected in 5 of 30 (17%) unspecified peripheral T-cell lymphomas, but not in cases of angioimmunoblastic T-cell lymphoma (n=9) and ALK-negative anaplastic large cell lymphoma (n=7) Hybrid/Mutated N-terminal pleckstrin homology domain and proline-rich region of ITK fused to the Gene tyrosine kinase domain of SYK. External links Nomenclature Hugo ITK GDB ITK

Atlas Genet Cytogenet Oncol Haematol 2007; 4 542 Entrez_Gene ITK 3702 IL2-inducible T-cell kinase Cards Atlas ITKID43329ch5q33 GeneCards ITK Ensembl ITK Genatlas ITK GeneLynx ITK eGenome ITK euGene 3702 Genomic and cartography GoldenPath ITK - 5q33.3 chr5:156540485-156614687 + 5q31-q32 (hg18-Mar_2006) Ensembl ITK - 5q31-q32 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene ITK Gene and transcription Genbank AB209622 [ ENTREZ ] Genbank BC109077 [ ENTREZ ] Genbank BC109078 [ ENTREZ ] Genbank BX538196 [ ENTREZ ] Genbank D13720 [ ENTREZ ] RefSeq NM_005546 [ SRS ] NM_005546 [ ENTREZ ] RefSeq AC_000048 [ SRS ] AC_000048 [ ENTREZ ] RefSeq NC_000005 [ SRS ] NC_000005 [ ENTREZ ] RefSeq NT_023133 [ SRS ] NT_023133 [ ENTREZ ] RefSeq NW_922784 [ SRS ] NW_922784 [ ENTREZ ] AceView ITK AceView - NCBI Unigene Hs.558348 [ SRS ] Hs.558348 [ NCBI ] HS558348 [ spliceNest ] Fast-db 12506 Protein : pattern, domain, 3D structure SwissProt Q08881 [ SRS] Q08881 [ EXPASY ] Q08881 [ INTERPRO ] Prosite PS50003 PH_DOMAIN [ SRS ] PS50003 PH_DOMAIN [ Expasy ] PS00107 PROTEIN_KINASE_ATP [ SRS ] PS00107 PROTEIN_KINASE_ATP [ Prosite Expasy ] PS50011 PROTEIN_KINASE_DOM [ SRS ] PS50011 PROTEIN_KINASE_DOM [ Prosite Expasy ] PS00109 PROTEIN_KINASE_TYR [ SRS ] PS00109 PROTEIN_KINASE_TYR [ Prosite Expasy ] Prosite PS50001 SH2 [ SRS ] PS50001 SH2 [ Expasy ] Prosite PS50002 SH3 [ SRS ] PS50002 SH3 [ Expasy ] Prosite PS51113 ZF_BTK [ SRS ] PS51113 ZF_BTK [ Expasy ] Interpro IPR001562 BTK [ SRS ] IPR001562 BTK [ EBI ] Interpro IPR011009 Kinase_like [ SRS ] IPR011009 Kinase_like [ EBI ] Interpro IPR001849 PH [ SRS ] IPR001849 PH [ EBI ]

Atlas Genet Cytogenet Oncol Haematol 2007; 4 543 Interpro IPR011993 PH_type [ SRS ] IPR011993 PH_type [ EBI ] Interpro IPR000719 Prot_kinase [ SRS ] IPR000719 Prot_kinase [ EBI ] Interpro IPR000980 SH2 [ SRS ] IPR000980 SH2 [ EBI ] Interpro IPR001452 SH3 [ SRS ] IPR001452 SH3 [ EBI ] Interpro IPR013315 Spectrin_alpha [ SRS ] IPR013315 Spectrin_alpha [ EBI ] Interpro IPR001245 Tyr_pkinase [ SRS ] IPR001245 Tyr_pkinase [ EBI ] Interpro IPR008266 Tyr_pkinase_AS [ SRS ] IPR008266 Tyr_pkinase_AS [ EBI ] CluSTr Q08881 Pfam PF00779 BTK [ SRS ] PF00779 BTK [ Sanger ] pfam00779 [ NCBI-CDD ] Pfam PF00169 PH [ SRS ] PF00169 PH [ Sanger ] pfam00169 [ NCBI-CDD ] PF07714 Pkinase_Tyr [ SRS ] PF07714 Pkinase_Tyr [ Sanger ] pfam07714 [ Pfam NCBI-CDD ] Pfam PF00017 SH2 [ SRS ] PF00017 SH2 [ Sanger ] pfam00017 [ NCBI-CDD ] Pfam PF00018 SH3_1 [ SRS ] PF00018 SH3_1 [ Sanger ] pfam00018 [ NCBI-CDD ] Smart SM00107 BTK [EMBL] Smart SM00233 PH [EMBL] Smart SM00252 SH2 [EMBL] Smart SM00326 SH3 [EMBL] Smart SM00219 TyrKc [EMBL] Prodom PD000001 Prot_kinase[INRA-Toulouse] Q08881 ITK_HUMAN [ Domain structure ] Q08881 ITK_HUMAN [ sequences Prodom sharing at least 1 domain ] Prodom PD000001[INRA-Toulouse] Q08881 ITK_HUMAN [ Domain structure ] Q08881 ITK_HUMAN [ sequences Prodom sharing at least 1 domain ] Prodom PD000001[INRA-Toulouse] Q08881 ITK_HUMAN [ Domain structure ] Q08881 ITK_HUMAN [ sequences Prodom sharing at least 1 domain ] Blocks Q08881 PDB 1SM2 [ SRS ] 1SM2 [ PdbSum ], 1SM2 [ IMB ] 1SM2 [ RSDB ] PDB 1SNU [ SRS ] 1SNU [ PdbSum ], 1SNU [ IMB ] 1SNU [ RSDB ] PDB 1SNX [ SRS ] 1SNX [ PdbSum ], 1SNX [ IMB ] 1SNX [ RSDB ] HPRD 01746 Protein Interaction databases DIP Q08881 IntAct Q08881 Polymorphism : SNP, mutations, diseases OMIM 186973 [ map ] GENECLINICS 186973 SNP ITK [dbSNP-NCBI] SNP NM_005546 [SNP-NCI] SNP ITK [GeneSNPs - Utah] ITK] [HGBASE - SRS] HAPMAP ITK [HAPMAP] COSMIC ITK [Somatic mutation (COSMIC-CGP-Sanger)]

Atlas Genet Cytogenet Oncol Haematol 2007; 4 544 HGMD ITK General knowledge Family ITK [UCSC Family Browser] Browser SOURCE NM_005546 SMD Hs.558348 SAGE Hs.558348 2.7.10.2 [ Enzyme-SRS ] 2.7.10.2 [ Brenda-SRS ] 2.7.10.2 [ KEGG ] 2.7.10.2 [ Enzyme WIT ] GO nucleotide binding [Amigo] nucleotide binding non-membrane spanning protein tyrosine kinase activity [Amigo] non-membrane GO spanning protein tyrosine kinase activity GO ATP binding [Amigo] ATP binding GO protein amino acid phosphorylation [Amigo] protein amino acid phosphorylation GO cellular defense response [Amigo] cellular defense response GO intracellular signaling cascade [Amigo] intracellular signaling cascade GO zinc ion binding [Amigo] zinc ion binding GO membrane [Amigo] membrane GO kinase activity [Amigo] kinase activity GO transferase activity [Amigo] transferase activity GO metal ion binding [Amigo] metal ion binding BIOCARTA The Co-Stimulatory Signal During T-cell Activation [Genes] PubGene ITK Other databases Probes Probe ITK Related clones (RZPD - Berlin) PubMed PubMed 36 Pubmed reference(s) in LocusLink Bibliography Altered T cell receptor signaling and disrupted T cell development in mice lacking Itk. Liao XC, Littman DR. Immunity 1995; 3: 757-769. Medline 8777721

Regulatory intramolecular association in a tyrosine kinase of the Tec family. Andreotti AH, Bunnell SC, Feng S, Berg LJ, Schreiber SL. Nature 1997; 385: 93-97. Medline 8985255

T cell receptor-initiated calcium release is uncoupled from capacitative calcium entry in Itk- deficient T cells. Liu K, Bunnell SC, Gurniak CB, Berg LJ. J Exp Med 1998; 187: 1721-1727. Medline 9584150

Requirement for Tec kinases Rlk and Itk in T cell receptor signaling and immunity. Schaeffer EM, Debnath J, Yap G, McVicar D, Liao XC, Littman DR, Sher A, Varmus HE, Lenardo MJ, Schwartzberg PL.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 545 Science 1999; 284: 638-641. Medline 10213685

Tec kinases: a family with multiple roles in immunity. Yang W, Collette Y, Nunes JA, Olive D. Immunity 2000; 12: 373-382. Medline 10795735

Tec kinases: modulators of lymphocyte signaling and development. Lewis CM, Broussard C, Czar MJ, Schwartzberg PL. Curr Opin Immunol 2001; 13: 317-325. Medline 11406363

Novel t(5;9)(q33;q22) fuses ITK to SYK in unspecified peripheral T-cell lymphoma. Streubel B, Vinatzer U, Willheim M, Raderer M, Chott A. Leukemia 2006; 20: 313-318. Medline 16341044

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 04-2007 Berthold Streubel Department of Pathology, Medical University of Vienna, Waehringer,

Guertel 18-20, A-1090 Vienna, Austria Citation This paper should be referenced as such : Streubel B . ITK (IL2-inducible T-cell kinase). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Genes/ITKID43329ch5q33.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 546 Atlas of Genetics and Cytogenetics in Oncology and Haematology

IKZF2 (IKAROS family zinc finger 2)

Identity Other names Helios ZNFN1A2 Mouse Ikzf2 Hugo IKZF2 Location 2q34 Note Belongs to the Ikaros family of zinc finger containing DNA binding proteins. DNA/RNA Description 143kb encoding 7 exons. Transcription 12kb transcript, alternatively spliced to give two predominant isoforms. Protein

Helios with the zinc finger domain shown as blocks and the exon junctions in black lines. Note 526 amino acids. Mouse protein migrates at 70kD. Description Largest isoform contains four N-terminal zinc fingers used for DNA binding and two C terminal zinc fingers for homodimerization and heterodimerization with other Ikaros family members. Expression Largely restricted to the thymus. In mice, besides thymocytes and T cells, low levels are found in proB cells and bone marrow multipotent progenitors. Localisation Nuclear. Often localizes to the pericentric heterochromatin as punctate spots in cycling cells, with diffuse nuclear localization in non-cycling cells. Function Helios is thought to be important for T cell development and may function as a repressor of transcription. However, Helios mutant mice have not been reported. In mice, Helios can recruit the NuRD chromatin remodeling complex to the pericentric heterochromatin. Homology High level of identity to Ikaros over the zinc finger domains. Implicated in Entity Leukemia Note Shorter isoforms of Helios are expressed in certain human leukemias. They may function as dominant negative inhibitors of full-length proteins due to the lack of DNA binding domain. However, dominant negative functions have not been demonstrated experimentally. Disease T cell acute lymphoblastic leukemia.

Entity Lymphoma

Atlas Genet Cytogenet Oncol Haematol 2007; 4 547 Note Overexpression of Helios in B cells of mice promotes lymphomagenesis. Overexpression of a DNA binding mutant in hematopoietic progenitors leads to aggressive and transplantable T cell lymphomas in 60% of the mice. External links Nomenclature Hugo IKZF2 GDB IKZF2 Entrez_Gene IKZF2 22807 IKAROS family zinc finger 2 (Helios) Cards Atlas IKZF2ID42885ch2q34 GeneCards IKZF2 Ensembl IKZF2 Genatlas IKZF2 GeneLynx IKZF2 eGenome IKZF2 euGene 22807 Genomic and cartography GoldenPath IKZF2 - 2q34 chr2:213572658-213724578 - 2q34 (hg18-Mar_2006) Ensembl IKZF2 - 2q34 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene IKZF2 Gene and transcription Genbank AF130863 [ ENTREZ ] Genbank AI458439 [ ENTREZ ] Genbank AY008294 [ ENTREZ ] Genbank AY587062 [ ENTREZ ] Genbank AY587063 [ ENTREZ ] RefSeq NM_001079526 [ SRS ] NM_001079526 [ ENTREZ ] RefSeq NM_016260 [ SRS ] NM_016260 [ ENTREZ ] RefSeq AC_000045 [ SRS ] AC_000045 [ ENTREZ ] RefSeq NC_000002 [ SRS ] NC_000002 [ ENTREZ ] RefSeq NT_005403 [ SRS ] NT_005403 [ ENTREZ ] RefSeq NW_921618 [ SRS ] NW_921618 [ ENTREZ ] AceView IKZF2 AceView - NCBI Unigene Hs.604950 [ SRS ] Hs.604950 [ NCBI ] HS604950 [ spliceNest ] Protein : pattern, domain, 3D structure SwissProt Q53QP1 [ SRS] Q53QP1 [ EXPASY ] Q53QP1 [ INTERPRO ] PS00028 ZINC_FINGER_C2H2_1 [ SRS ] PS00028 ZINC_FINGER_C2H2_1 [ Prosite Expasy ] PS50157 ZINC_FINGER_C2H2_2 [ SRS ] PS50157 ZINC_FINGER_C2H2_2 [ Prosite Expasy ] Interpro IPR007087 Znf_C2H2 [ SRS ] IPR007087 Znf_C2H2 [ EBI ] CluSTr Q53QP1

Atlas Genet Cytogenet Oncol Haematol 2007; 4 548 Pfam PF00096 zf-C2H2 [ SRS ] PF00096 zf-C2H2 [ Sanger ] pfam00096 [ NCBI-CDD ] Smart SM00355 ZnF_C2H2 [EMBL] Blocks Q53QP1 HPRD 05872 Protein Interaction databases DIP Q53QP1 IntAct Q53QP1 Polymorphism : SNP, mutations, diseases OMIM 606234 [ map ] GENECLINICS 606234 SNP IKZF2 [dbSNP-NCBI] SNP NM_001079526 [SNP-NCI] SNP NM_016260 [SNP-NCI] SNP IKZF2 [GeneSNPs - Utah] IKZF2] [HGBASE - SRS] HAPMAP IKZF2 [HAPMAP] COSMIC IKZF2 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD IKZF2 General knowledge Family IKZF2 [UCSC Family Browser] Browser SOURCE NM_001079526 SOURCE NM_016260 SMD Hs.604950 SAGE Hs.604950 GO molecular_function [Amigo] molecular_function GO nucleic acid binding [Amigo] nucleic acid binding GO DNA binding [Amigo] DNA binding GO intracellular [Amigo] intracellular GO nucleus [Amigo] nucleus GO transcription [Amigo] transcription regulation of transcription, DNA-dependent [Amigo] regulation of transcription, DNA- GO dependent GO biological_process [Amigo] biological_process GO zinc ion binding [Amigo] zinc ion binding GO metal ion binding [Amigo] metal ion binding PubGene IKZF2 Other databases Probes Probe IKZF2 Related clones (RZPD - Berlin) PubMed PubMed 12 Pubmed reference(s) in LocusLink Bibliography Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 549 Hahm K, Cobb BS, McCarty AS, Brown KE, Klug CA, Lee R, Akashi K, Weissman IL, Fisher AG, Smale ST. Genes Dev. 1998; 12(6):782-796. Medline 9512513

Helios, a novel dimerization partner of Ikaros expressed in the earliest hematopoietic progenitors. Kelley CM, Ikeda T, Koipally J, Avitahl N, Wu L, Georgopoulos K, Morgan BA. Curr Biol. 1998; 8(9):508-515 Medline 9560339

Human Helios, an Ikaros-related zinc finger DNA binding protein: cDNA cloning and tissue expression pattern. Hosokawa Y, Maeda Y, Seto M. Immunogenetics. 1999; 50(1-2):106-108. Medline 10541817

Overexpression of novel short isoforms of Helios in a patient with T-cell acute lymphoblastic leukemia. Nakase K, Ishimaru F, Fujii K, Tabayashi T, Kozuka T, Sezaki N, Matsuo Y, Harada M. Exp Hematol. 2002; 30(4):313-317 Medline 11937265

Transgenic expression of Helios in B lineage cells alters B cell properties and promotes lymphomagenesis. Dovat S, Montecino-Rodriguez E, Schuman V, Teitell MA, Dorshkind K, Smale ST. J Immunol. 2005; 175(6):3508-3515. Medline 16148093

Expression of a non-DNA-binding isoform of Helios induces T-cell lymphoma in mice. Zhang Z, Swindle CS, Bates JT, Ko R, Cotta CV, Klug CA. Blood. 2007; 109(5):2190-2197. Medline 17110463

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 04-2007 Rupa Sridharan, Stephen Smale Room 6730 MacDonald Research Laboratories, Howard Hughes Medical Institute, 675 Charles Young Drive South, University of California, Los Angeles, CA 90095-1662, USA. Citation This paper should be referenced as such : Sridharan R, Smale S . IKZF2 (IKAROS family zinc finger 2). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Genes/IKZF2ID42885ch2q34.html

Atlas Genet Cytogenet Oncol Haematol 2007; 4 550 © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 551 Atlas of Genetics and Cytogenetics in Oncology and Haematology

EBAG9 (Estrogen receptor-binding fragment-associated antigen 9)

Identity Other names EB9 PDAF RCAS1 Hugo EBAG9 Location 8q23.2 DNA/RNA Description The EBAG9 gene contains 7 exons and 6 introns. It was predicted to span over approximately 24.6 kb of the genomic DNA with mRNA size approximately 1182 bp. The exon 3 was the smallest at 79 bp; the other exons ranged from 92-720 bp. The EBAG9 was isolated from MCF-7, human breast cancer cell library and it has been reported identical with RCAS1 (receptor-binding cancer antigen expressed on SiSo cells) gene from human uterine adenocarcinoma cell line. Transcription The EBAG9 mRNA is up-regulated by estrogen in MCF-7 cells and its promoter responds to estrogen through the complete palindromic estrogen responsive element (ERE) that was located in the 5'-up stream region of the gene. Pseudogene One pseudogene located in chromosome 10 associated with RCAS1/EBAG9. Protein Description The EBAG9/RCAS1 consists of 213 amino acids (aa) corresponding to a molecular weight of 24.4 kDa. The EBAG9/RCAS1 has an N-terminal trans-membrane segment (8-27 aa) and a coiled-coil structure in the C-terminal portion (179-206 aa), indicating that the EBAG9/RCAS1 is a type II membrane protein able to form oligomers through the coiled-coil structure, which is expressed on the surfaces of human cancer cells. Expression The EBAG9/RCAS1 mRNA is expressed in ovary, testis, prostate, thymus, muscle, and heart. At the protein level the EBAG9/RCAS1 not detected in normal ovary tissues or any of the other above. Neither mRNA nor protein was detected in small intestine, colon, lymph node or peripheral blood lymphocytes. Localisation Mainly in the golgi, membrane and cytoplasm of cancer tissues, but its expression is very low or hardly detected in normal tissues. Function The biological functions of the EBAG9/RCAS1 secreted by non-cancerous tissues remain unknown. In cancer cells, the EBAG9/RCAS1 is a ligand for a putative receptor present on various human cell lines and normal peripheral lymphocytes such as T-, B- and natural killer (NK)-cells. The expression of this receptor is enhanced by activation of these lymphocytes. The EBAG9/RCAS1 acts to inhibit the growth of receptor-binding cells and induced apoptotic cell death. Over-expression of the EBAG9/RCAS1 is known to inhibit the growth and induced apoptosis of immune cells. As the results, cancer cells might evade immune surveillance by expressing the EBAG9/RCAS1 and inducing the apoptosis of the EBAG9/RCAS1 receptor-positive immune cells. Homology Mouse and human EBAG9/RCAS1 shows a high degree of homology at the amino acid level (98%). Mouse (Mus musculus) ebag9 gene spans about 30 kb in genomic DNA and consists of 7 exons. Dog (Canis familiaris) EBAG9/RCAS1 also shows highly homologues to human (96,2%) and to mouse (96,7%). For chimpanzee- (Pan troglodytes) 100%, rat- (Rattus norvegicus) 94% and chicken-ebag9 (Gallus gallus) 91%.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 552 Mutations Germinal Not known in Homo sapiens. Somatic Not known in Homo sapiens. Implicated in Entity Immunity Note During pregnancy, EBAG9/RCAS1 may play a role in the down-regulation of the maternal immune response and may participate in the initiation of the labor. In the healthy women, higher EBAG9/RCAS1 expression was observed in the periovulatory and the secretory menstrual cycle phases than in the proliferation phase. The changes in EBAG9/RCAS1 expression were combined with significant differences in the number of immune cells and their activity. It suggested that EBAG9/RCAS1 endometrial expression may favor the coexistence of active lymphocytes and endometrial cells. Disease The elevated serum level of EBAG9/RCAS1 reported to be associated with a poor immunological prognosis in HIV-1-infected patients, and also associated with the apoptosis of CD4+ T cells in HIV infection. In addition, the induction and secretion of EBAG9/RCAS1 in HIV-Trans-acting transcriptional activator-stimulated CD4+ T cells and monocytes suggested that EBAG9/RCAS1 may involved in the CD4+ T cell apoptosis observed in HIV-1 infection along with FasL and TRAIL. Entity Malignancy. Disease The EBAG9/RCAS1 reported to be over-expressed in many human cancers. Among them: breast, female-genital, gastrointestinal, blood, lung, pancreas, liver, renal, billiary-tract, hepatic, prostate, thyroid, gall bladder, and brain cancer. Prognosis The EBAG9/RCAS1 over-expression could be used as a predictor of poor prognosis in malignant diseases. Oncogenesis The EBAG9/RCAS1 plays a role in the immune escape of cancer cells. The EBAG9/RCAS1 could help cancer cells to survive and avoid immunosurveillance. This gene over-expression might cause progression, invasion and metastasis. The EBAG9 acts as one of the estrogen responsive genes in estrogen receptor-positive tumors and mediate estrogen function. Overall, the EBAG9/RCAS1 has an etiological role in the development and progression of cancer cells. External links Nomenclature Hugo EBAG9 GDB EBAG9 Entrez_Gene EBAG9 9166 estrogen receptor binding site associated, antigen, 9 Cards Atlas EBAG9ID40393ch8q23 GeneCards EBAG9 Ensembl EBAG9 Genatlas EBAG9 GeneLynx EBAG9 eGenome EBAG9 euGene 9166 Genomic and cartography GoldenPath EBAG9 - 8q23.2 chr8:110621486-110646565 + 8q23 (hg18-Mar_2006) Ensembl EBAG9 - 8q23 [CytoView] NCBI Mapview

Atlas Genet Cytogenet Oncol Haematol 2007; 4 553 OMIM Disease map [OMIM] HomoloGene EBAG9 Gene and transcription Genbank AB007619 [ ENTREZ ] Genbank AF006265 [ ENTREZ ] Genbank AK290651 [ ENTREZ ] Genbank AL515533 [ ENTREZ ] Genbank AY515724 [ ENTREZ ] RefSeq NM_004215 [ SRS ] NM_004215 [ ENTREZ ] RefSeq NM_198120 [ SRS ] NM_198120 [ ENTREZ ] RefSeq AC_000051 [ SRS ] AC_000051 [ ENTREZ ] RefSeq NC_000008 [ SRS ] NC_000008 [ ENTREZ ] RefSeq NT_008046 [ SRS ] NT_008046 [ ENTREZ ] RefSeq NW_923984 [ SRS ] NW_923984 [ ENTREZ ] AceView EBAG9 AceView - NCBI Unigene Hs.409368 [ SRS ] Hs.409368 [ NCBI ] HS409368 [ spliceNest ] Fast-db 7832 Protein : pattern, domain, 3D structure SwissProt O00559 [ SRS] O00559 [ EXPASY ] O00559 [ INTERPRO ] CluSTr O00559 Blocks O00559 HPRD 05775 Protein Interaction databases DIP O00559 IntAct O00559 Polymorphism : SNP, mutations, diseases OMIM 605772 [ map ] GENECLINICS 605772 SNP EBAG9 [dbSNP-NCBI] SNP NM_004215 [SNP-NCI] SNP NM_198120 [SNP-NCI] SNP EBAG9 [GeneSNPs - Utah] EBAG9] [HGBASE - SRS] HAPMAP EBAG9 [HAPMAP] COSMIC EBAG9 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD EBAG9 General knowledge Family EBAG9 [UCSC Family Browser] Browser SOURCE NM_004215 SOURCE NM_198120 SMD Hs.409368 SAGE Hs.409368 GO regulation of cell growth [Amigo] regulation of cell growth GO soluble fraction [Amigo] soluble fraction

Atlas Genet Cytogenet Oncol Haematol 2007; 4 554 GO Golgi apparatus [Amigo] Golgi apparatus GO apoptosis [Amigo] apoptosis GO membrane [Amigo] membrane GO integral to membrane [Amigo] integral to membrane GO apoptotic protease activator activity [Amigo] apoptotic protease activator activity PubGene EBAG9 Other databases Probes Probe EBAG9 Related clones (RZPD - Berlin) PubMed PubMed 43 Pubmed reference(s) in LocusLink Bibliography Tumor-associated antigen 22-1-1 expression in the uterine cervical squamous neoplasias. Sonoda K, Kaku T, Kamura T, Nakashima M, Watanabe T, Nakano H. Clin. Cancer Res. 1998; 4: 1517-1520. Medline 9626471

Isolation in estrogen-responsive genes with a CpG island library. Watanabe T, Inoue S, Hiroi H, Orimo A, Kawashima H, Muramatsu M. Mol. Cell Biol. 1998; 18: 442-449. Medline 9418891

Inhibition of cell growth and induction of apoptotic cell death by the human tumor-associated antigen RCAS1. Nakashima M, Sonoda K, Watanabe T. Nat. Med. 1999; 5: 938-942. Medline 10426319

Promoter analysis and chromosomal mapping of human EBAG9 gene. Ikeda K, Sato M, Tsutsumi O, Tsuchiya F, Tsuneizumi M, Emi M, Imoto I, Inazawa J, Muramatsu M, Inoue S. Biochem. Biophys. Res. Commun. 2000; 273: 654-660. Medline 10873660

Molecular cloning and characterization of mouse EBAG9, homolog of a human cancer associated surface antigen: Expression and regulation by estrogen. Tsuchiya F, Ikeda K, Tsutsumi O, Hiroi H, Momoeda M, Taketani Y, Muramatsu M, Inoue S. Biochem. Biophys. Res. Commun. 2001; 284: 2-10. Medline 11374862

Overexpression of the EBAG9 gene at 8q23 associated with early-satge breast cancers. Tsuneizumi M, Emi M, Nagai H, Harada H, Sakamoto G, Kasumi F, Inoue S, Kazui T, Nakamura Y. Clin. Cancer Res. 2001; 7: 3526-3532. Medline 11705872

Molecular cloning of canine RCAS1 cDNA. Okamura Y, Ma Z, Khatlani TS, Okuda M, Une S, Nakaichi M, Taura Y. J. Vet. Med. Sci. 2003; 65: 913-915. Medline 12951425

The role of RCAS1 and oxytocinase in immune tolerance during pregnancy.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 555 Wicherek L, Dutsch-Wicherek M, Mak P, Klimek M. Fetal Diagn. Ther. 2005; 5: 420-425. Medline 16113565

RCAS1 induced by HIV-Tat is involved in the apoptosis of HIV-1 infected and uninfected CD4+ T cells. AUTHORS Minami R, Yamamoto M, Takahama S, Miyamura T, Watanabe H, Suematsu E. Cell. Immunol. 2006; 243: 41-47. Medline 17250817

Cycle dependent RCAS1 expression with respect to the immune cells presence and activity. Wicherek L, Klimek M, Galazka K, Obrzut B. Neuro. Endoctinol. Lett. 2006; 5: 645-650. Medline 17159823

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 04-2007 Ahmad Faried, Leri S. Faried Department of General Surgical Science (Surgery I), Graduate School of

Medicine, Gunma University, Maebashi, Japan. Citation This paper should be referenced as such : Faried A, Faried LS . EBAG9 (Estrogen receptor-binding fragment-associated antigen 9). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Genes/EBAG9ID40393ch8q23.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 556 Atlas of Genetics and Cytogenetics in Oncology and Haematology

DKK1 (dickkopf homolog 1 (Xenopus laevis))

Identity Other names Dickkkopf-1 DKK-1 mdkk1 hDkk1 dickkopf (Xenopus laevis) homolog 1 SK Hugo DKK1 Location 10q11.2 DNA/RNA

hDKK1 contains 3 introns and 4 exons (depictured in red). Description Position: 53744064 - 53747595 ; Strand: ( + ). DKK1 is present in the contig NT008583 of Genebank; 4 Exon(s) all coding; DNA size 3.07 Kb. Transcription 1 detected transcript; open reading frame: 1494 bp. Protein

Boxes in red: 1) Signal peptide (1 to 24 aa) 2) Low complexity region (45 to 57 aa) 3) Dickkopf domain (84 to 140 aa) Description This gene encodes a protein that is a member of the dickkopf family. HDKK1 encode for a 266 amino acids (aa) protein. The calculated molecular weight is 28.7 KDa. Isoelectric point: 8.74. It possesses two clusters of ten cysteine residues separated by a linker region. Expression Highly expressed in thyroid, small intestine, stomach, liver, placenta, pancreas, uterus, abdominal cavity, bladder and skin. Weaker expression has been detected in colon and spleen. It is involved in embryonic development through its inhibition of the WNT signaling pathway. Localisation Extracellular region; secreted protein. Function Inhibitor of the Wnt signaling pathway.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 557 Implicated in Entity Myeloma bone disease Disease Patients with multiple myeloma frequently show painful bone lesions and in a recent analysis an increase in Dkk1 in the serum of those patients was noted, whose levels correlated with lesion occurrence. Bone marrow serum containing an elevated level of Dkk1 inhibited the differentiation of osteoblast precursor cells in vitro. Authors propose that Dkk1 produced by myeloma cells blocks osteoblast differentiation, thereby causing the lytic bone lesions. Supporting this idea, treatment of myeloma patients by autologous stem cell transplantation induces a decrease in Dkk1 levels, which is accompanied with elevation of bone formation markers. This raises again interesting therapeutic approaches for interference with the Lrp5/Lrp6-Dkk1 interaction. Entity Cancer Disease Different studies displayed changes of Dkk expression in tumor cell lines or tissues. In colon cancer, DKK-1 is a downstream target gene of beta-catenin, as it is in human ovarian endometrioid adenocarcinomas. DKK-1 is silenced in colon cancer by DNA hypermethylation and this correlates with advanced Dukes' stages of colorectal tumorigenesis. DKK-1 overexpression in colon cancer cells or Hela cells reduces colony formation and tumor growth in xenografts, pointing out to a tumor-suppressor function for DKK-1. Entity Alzheimer Disease DKK-1 has been also related to neurodegenerative disease. DKK-1 has been shown to be induced in degenerating neurons from Alzheimer patients as well as in cultured neurons challenged with beta-amyloid peptide. Hence, DKK-1 may promote apoptosis in Alzheimer neurons by enhancing Gsk3-mediated phosphorylation of the Tau protein in beta-amyloid-treated neurons. Entity Epilepsia Disease Recently, it has been shown that induction of the wnt inhibitor, dickkopf-1, is associated with neurodegeneration related to temporal lobe epilepsy. Strong DKK-1 expression was found in six bioptic samples and in one autoptic sample from patients with mesial temporal lobe epilepsy associated with hippocampal sclerosis. Furthermore, DKK-1 expression was undetectable or very low in autoptic samples from nonepileptic patients or in bioptic samples from patients with complex partial seizures without neuronal loss and/or reactive gliosis in the hippocampus. External links Nomenclature Hugo DKK1 GDB DKK1 Entrez_Gene DKK1 22943 dickkopf homolog 1 (Xenopus laevis) Cards Atlas DKK1ID44007ch10q11 GeneCards DKK1 Ensembl DKK1 Genatlas DKK1 GeneLynx DKK1 eGenome DKK1 euGene 22943 Genomic and cartography GoldenPath DKK1 - 10q11.2 chr10:53744047-53747422 + 10q11.2 (hg18-Mar_2006) Ensembl DKK1 - 10q11.2 [CytoView] NCBI Mapview

Atlas Genet Cytogenet Oncol Haematol 2007; 4 558 OMIM Disease map [OMIM] HomoloGene DKK1 Gene and transcription Genbank AF127563 [ ENTREZ ] Genbank AF177394 [ ENTREZ ] Genbank AY359005 [ ENTREZ ] Genbank BC001539 [ ENTREZ ] Genbank BU752259 [ ENTREZ ] RefSeq NM_012242 [ SRS ] NM_012242 [ ENTREZ ] RefSeq AC_000053 [ SRS ] AC_000053 [ ENTREZ ] RefSeq NC_000010 [ SRS ] NC_000010 [ ENTREZ ] RefSeq NT_008583 [ SRS ] NT_008583 [ ENTREZ ] RefSeq NW_924796 [ SRS ] NW_924796 [ ENTREZ ] AceView DKK1 AceView - NCBI Unigene Hs.40499 [ SRS ] Hs.40499 [ NCBI ] HS40499 [ spliceNest ] Fast-db 10599 Protein : pattern, domain, 3D structure SwissProt O94907 [ SRS] O94907 [ EXPASY ] O94907 [ INTERPRO ] Interpro IPR006796 dickkopf_N [ SRS ] IPR006796 dickkopf_N [ EBI ] CluSTr O94907 PF04706 Dickkopf_N [ SRS ] PF04706 Dickkopf_N [ Sanger ] pfam04706 [ NCBI- Pfam CDD ] Blocks O94907 HPRD 05544 Protein Interaction databases DIP O94907 IntAct O94907 Polymorphism : SNP, mutations, diseases OMIM 605189 [ map ] GENECLINICS 605189 SNP DKK1 [dbSNP-NCBI] SNP NM_012242 [SNP-NCI] SNP DKK1 [GeneSNPs - Utah] DKK1] [HGBASE - SRS] HAPMAP DKK1 [HAPMAP] COSMIC DKK1 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD DKK1 General knowledge Family DKK1 [UCSC Family Browser] Browser SOURCE NM_012242 SMD Hs.40499 SAGE Hs.40499 GO signal transducer activity [Amigo] signal transducer activity GO protein binding [Amigo] protein binding

Atlas Genet Cytogenet Oncol Haematol 2007; 4 559 GO extracellular region [Amigo] extracellular region GO plasma membrane [Amigo] plasma membrane GO multicellular organismal development [Amigo] multicellular organismal development GO growth factor activity [Amigo] growth factor activity GO Wnt receptor signaling pathway [Amigo] Wnt receptor signaling pathway negative regulation of Wnt receptor signaling pathway [Amigo] negative regulation of GO Wnt receptor signaling pathway GO embryonic limb morphogenesis [Amigo] embryonic limb morphogenesis low-density lipoprotein receptor binding [Amigo] low-density lipoprotein receptor GO binding BIOCARTA Wnt/LRP6 Signalling [Genes] PubGene DKK1 Other databases Probes Probe DKK1 Related clones (RZPD - Berlin) PubMed PubMed 44 Pubmed reference(s) in LocusLink Bibliography Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Glinka A, Wu W, Delius H, Monaghan AP, Blumenstock C, Niehrs C. Nature. 1998; 391:357-362. Medline 9450748

Novel mechanism of Wnt signalling inhibition mediated by Dickkopf-1 interaction with LRP6/Arrow. Bafico A, Liu G, Yaniv A, Gazit A, Aaronson SA. Nat Cell Biol. 2001; 3:683-686. Medline 11433302

Head inducer Dickkopf-1 is a ligand for Wnt coreceptor LRP6. Semenov MV, Tamai K, Brott BK, Kuhl M, Sokol S, He X. Curr Biol. 2001; 11:951-961. Medline 11448771

The Wnt antagonist Dickkopf-1 is regulated by Bmp signaling and c-Jun and modulates programmed cell death. Grotewold L, Ruther U. EMBO J. 2002; 21:966-975. Medline 11867524

The role of the Wnt-signaling antagonist DKK1 in the development of osteolytic lesions in multiple myeloma. Tian E, Zhan F, Walker R, Rasmussen E, Ma Y, Barlogie B, Shaughnessy JD Jr. N Engl J Med. 2003; 349:2483-2494. Medline 14695408

Induction of Dickkopf-1, a negative modulator of the Wnt pathway, is associated with neuronal degeneration in Alzheimer's brain. Caricasole A, Copani A, Caraci F, Aronica E, Rozemuller AJ, Caruso A, Storto M, Gaviraghi G, Terstappen GC, Nicoletti F.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 560 J Neurosci. 2004; 24:6021-6027. Medline 15229249

A functional genomics approach for the identification of putative tumor suppressor genes: Dickkopf-1 as suppressor of HeLa cell transformation. Mikheev AM, Mikheeva SA, Liu B, Cohen P, Zarbl H. Carcinogenesis. 2004; 25:47-59. Medline 14555616

FGF-20 and DKK1 are transcriptional targets of beta-catenin and FGF-20 is implicated in cancer and development. Chamorro MN, Schwartz DR, Vonica A, Brivanlou AH, Cho KR, Varmus HE. EMBO J. 2005; 24:73-84. Medline 15592430

The Wnt antagonist DICKKOPF-1 gene is a downstream target of beta-catenin/TCF and is downregulated in human colon cancer. Gonzalez-Sancho JM, Aguilera O, Garcia JM, Pendas-Franco N, Pena C, Cal S, Garcia de Herreros A, Bonilla F, Munoz A. Oncogene. 2005; 24:1098-1103. Medline 15592505

Epigenetic inactivation of the Wnt antagonist DICKKOPF-1 (DKK-1) gene in human colorectal cancer. Aguilera O, Fraga MF, Ballestar E, Paz MF, Herranz M, Espada J, Garcia JM, Munoz A, Esteller M, Gonzalez-Sancho JM. Oncogene. 2006; 25:4116-4121. Medline 16491118

Serum concentrations of Dickkopf-1 protein are increased in patients with multiple myeloma and reduced after autologous stem cell transplantation. Politou MC, Heath DJ, Rahemtulla A, Szydlo R, Anagnostopoulos A, Dimopoulos MA, Croucher PI, Terpos E. Int J Cancer. 2006; 119:1728-1731. Medline 16646053

The Wnt antagonist DICKKOPF-1 gene is induced by 1(alpha),25-dihydroxyvitamin D3 associated to the differentiation of human colon cancer cells. Aguilera O, Pena C, Garcia JM, Larriba MJ, Ordonez-Moran P, Navarro D, Barbachano A, de Silanes IL, Ballestar E, Fraga MF, Esteller M, Gamallo C, Bonilla F, Gonzalez-Sancho JM, Munoz A. Carcinogenesis. 2007; [Epub ahead of print]. Medline 17449905

Induction of the wnt inhibitor, dickkopf-1, is associated with neurodegeneration related to temporal lobe epilepsy. Busceti CL, Biagioni F, Aronica E, Riozzi B, Storto M, Battaglia G, Giorgi FS, Gradini R, Fornai F, Caricasole A, Nicoletti F, Bruno V. Epilepsia. 2007; 48:694-705. Medline 17437412

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Atlas Genet Cytogenet Oncol Haematol 2007; 4 561 Contributor(s) Written 04-2007 Oscar Aguilera, Alberto Munoz Instituto de Investigaciones Biomedicas "Alberto Sols", C/ Arturo Duperier

n4, Madrid (Spain); [email protected] . Citation This paper should be referenced as such : Aguilera O, Munoz A . DKK1 (dickkopf homolog 1 (Xenopus laevis)). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Genes/DKK1ID44007ch10q11.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 562 Atlas of Genetics and Cytogenetics in Oncology and Haematology

AKAP9 (A kinase (PRKA) anchor protein (yotiao) 9) Identity Other names AKAP350 AKAP450 CG-NAP HYPERION KIAA0803 MU-RMS-40.16A PRKA9 YOTIAO Hugo AKAP9 Location 7q21.2 DNA/RNA Description AKAP9 gene consists of 51 encoding exons with a total gene size of 169797 bp. Transcription The AKAP9 transcript has an open reading frame (ORF) of 11724 bp. Four different transcript variants have been identified (NM147171, NM005751, NM147185, NM147166). Protein Description The 11.7 kb ORF encodes for a 3908 aa protein with a predicted size of 453 kDa. Four different protein products have been described (NP005742.4, NP671695.1, NP671700.1, NP671714.1). Localisation Centrosomes, Golgi apparatus. Function AKAP9 belongs to the family of A-Kinase Anchor Proteins (AKAPs), which are scaffold proteins able to bind the type II regulatory subunit (RII) of cAMP dependent Protein Kinase A (PKA) and several other protein kinases and phosphatases and to anchor them to specific intracellular compartments. AKAP9 shows centrosome and Golgi compartmentalization. Various splice variants of the transcript are found in different human tissues. The AKAP9 protein contains the PKA binding domain, a large coiled- coil domain and C-terminal centrosome binding domain. Implicated in Entity Papillary Thyroid Carcinoma (PTC) Cytogenetics inv(7)(q21-22q34) with AKAP9-BRAF fusion Breakpoints Note Breakpoint in AKAP9-BRAF fusion is located within intron 8 of the gene. In this fusion, exons 1-8 of AKAP9 are fused with last 10 exons 9-18 of BRAF. In the fusion, AKAP9 lacks the centrosome binding domain and, as a result, the AKAP9-BRAF protein looses its cytoplasmic compartmentalization and appears to be diffusely distributed in the cytoplasm, as detected by immunofluorescence. External links Nomenclature Hugo AKAP9 GDB AKAP9

Atlas Genet Cytogenet Oncol Haematol 2007; 4 563 Entrez_Gene AKAP9 10142 A kinase (PRKA) anchor protein (yotiao) 9 Cards GeneCards AKAP9 Ensembl AKAP9 Genatlas AKAP9 GeneLynx AKAP9 eGenome AKAP9 euGene 10142 Genomic and cartography GoldenPath AKAP9 - 7q21.2 chr7:91408128-91577925 + 7q21-q22 (hg18-Mar_2006) Ensembl AKAP9 - 7q21-q22 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene AKAP9 Gene and transcription Genbank AB018346 [ ENTREZ ] Genbank AB019691 [ ENTREZ ] Genbank AF026245 [ ENTREZ ] Genbank AF083037 [ ENTREZ ] Genbank AF091711 [ ENTREZ ] RefSeq NM_005751 [ SRS ] NM_005751 [ ENTREZ ] RefSeq NM_147166 [ SRS ] NM_147166 [ ENTREZ ] RefSeq NM_147171 [ SRS ] NM_147171 [ ENTREZ ] RefSeq NM_147185 [ SRS ] NM_147185 [ ENTREZ ] RefSeq AC_000050 [ SRS ] AC_000050 [ ENTREZ ] RefSeq AC_000068 [ SRS ] AC_000068 [ ENTREZ ] RefSeq NC_000007 [ SRS ] NC_000007 [ ENTREZ ] RefSeq NT_007933 [ SRS ] NT_007933 [ ENTREZ ] RefSeq NT_079595 [ SRS ] NT_079595 [ ENTREZ ] RefSeq NW_923574 [ SRS ] NW_923574 [ ENTREZ ] AceView AKAP9 AceView - NCBI Unigene Hs.651221 [ SRS ] Hs.651221 [ NCBI ] HS651221 [ spliceNest ] Fast-db 8192 Protein : pattern, domain, 3D structure SwissProt Q5GIA7 [ SRS] Q5GIA7 [ EXPASY ] Q5GIA7 [ INTERPRO ] Interpro IPR009053 Prefoldin [ SRS ] IPR009053 Prefoldin [ EBI ] CluSTr Q5GIA7 Blocks Q5GIA7 HPRD 04921 Protein Interaction databases DIP Q5GIA7 IntAct Q5GIA7 Polymorphism : SNP, mutations, diseases

Atlas Genet Cytogenet Oncol Haematol 2007; 4 564 OMIM 604001 [ map ] GENECLINICS 604001 SNP AKAP9 [dbSNP-NCBI] SNP NM_005751 [SNP-NCI] SNP NM_147166 [SNP-NCI] SNP NM_147171 [SNP-NCI] SNP NM_147185 [SNP-NCI] SNP AKAP9 [GeneSNPs - Utah] AKAP9] [HGBASE - SRS] HAPMAP AKAP9 [HAPMAP] COSMIC AKAP9 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD AKAP9 General knowledge Family AKAP9 [UCSC Family Browser] Browser SOURCE NM_005751 SOURCE NM_147166 SOURCE NM_147171 SOURCE NM_147185 SMD Hs.651221 SAGE Hs.651221 GO receptor binding [Amigo] receptor binding GO cytoplasm [Amigo] cytoplasm GO Golgi apparatus [Amigo] Golgi apparatus GO centrosome [Amigo] centrosome GO cytoskeleton [Amigo] cytoskeleton GO transport [Amigo] transport GO signal transduction [Amigo] signal transduction GO synaptic transmission [Amigo] synaptic transmission BIOCARTA Protein Kinase A at the Centrosome [Genes] PubGene AKAP9 Other databases Probes Probe AKAP9 Related clones (RZPD - Berlin) PubMed PubMed 26 Pubmed reference(s) in LocusLink Bibliography AKAP350, a multiply spliced protein kinase A-anchoring protein associated with centrosomes. Schmidt PH, Dransfield DT, Claudio JO, Hawley RG, Trotter KW, Milgram SL, Goldenring JR. J Biol Chem. 1999; 274(5): 3055-3066. Medline 9915845

Characterization of a novel giant scaffolding protein, CG-NAP, that anchors multiple signaling enzymes to centrosome and the golgi apparatus. Takahashi M, Shibata H, Shimakawa M, Miyamoto M, Mukai H, Ono Y. J Biol Chem. 1999; 274(24): 17267-17274.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 565 Medline 10358086

Cloning and characterization of a cDNA encoding an A-kinase anchoring protein located in the centrosome, AKAP450. Witczak O, Skalhegg BS, Keryer G, Bornens M, Tasken K, Jahnsen T, Orstavik S. EMBO J. 1999; 18: 1858-1868. Medline 10202149

A-kinase anchoring proteins: protein kinase A and beyond. Edwards AS, Scott JD. Curr Opin Cell Biol. 2000; 12(2): 217-221. Medline 10712918

The PACT domain, a conserved centrosomal targeting motif in the coiled-coil proteins AKAP450 and pericentrin. Gillingham AK, Munro S. EMBO Rep. 2000; 1(6): 524-529 Medline 11263498

Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Takahashi M, Yamagiwa A, Nishimura T, Mukai H, Ono Y. Mol Biol Cell. 2002; 13(9): 3235-3245. Medline 12221128

Oncogenic AKAP9-BRAF fusion is a novel mechanism of MAPK pathway activation in thyroid cancer. Ciampi R, Knauf JA, Kerler R, Gandhi M, Zhu Z, Nikiforova MN, Rabes HM, Fagin JA, Nikiforov YE. J Clin Invest. 2005; 115: 94-101. Medline 15630448

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 04-2007 Raffaele Ciampi, Yuri E Nikiforov Dip. di Endocrinologia e Metabolismo, Università di Pisa, via Paradisa, 2,

56124 Pisa, Italy. Citation This paper should be referenced as such : Ciampi R, Nikiforov YE . AKAP9 (A kinase (PRKA) anchor protein (yotiao) 9). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Genes/AKAP9ID42999ch7q21.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 566 Atlas of Genetics and Cytogenetics in Oncology and Haematology

S100B (S100 calcium binding protein B) Identity Other names NEF S100 S100Beta Hugo S100B Location 21q22.3 DNA/RNA Description The gene encompasses 17.3 Kb of DNA; 3 exons (the first one contains the 5' untranslated region). Transcription 1135 b mRNA; 279 b coding sequence. Protein Description 92 amino acids (including initial methionine that is generally processed in vivo); 10.5 kDa monomer (S100B can form homodimers and heterodimers with other proteins of the S100 family, described for S100A1). Expression S100B highest levels are found in brain. The protein is primarily found in astrocytes. Outside the central nervous system it can be found in chondrocytes and melanocytes. Localisation Nuclear and cytoplasmic. It has both intracellular and extracellular roles. Function The exact function of S100B is not fully understood. It inhibits microtubule assembly, has been involved in the regulation of cell cycle progression and differentiation and is able to induce neurite extension. This latest effect seems to be dependent on the concentration of S100B and occurs at nanomolar concentrations. But micromolar levels of extracellular S100B stimulate apoptosis in vitro. Calcium binding induces a conformational change in S100B that allows the interaction with a variety of target proteins. These include p53 tumour suppressor, the microtubule- associated protein tau, the cytoskeletal protein tubulin (and its prokaryotic ancestor FtsZ), the scaffold protein IQGAP1, the intermediate filament protein glial fibrillary acidic protein (GFAP),the actin capping protein CapZ and the giant phosphoprotein AHNAK. Over-expression of S100B has been proposed to play a role in different neuro-pathologies. Homology S100B belongs to the S100 family of calcium binding proteins, a highly homologous family. These proteins contain two EF-hand calcium binding domains. The S100 genes are present exclusively in vertebrates. Mutations Note Have not been reported. Implicated in Disease Overexpression of S100B has been generally linked to neurodegeneration. It is over- expressed in the brain of patients suffering from Alzheimer's disease, epilepsy or amyotrophic lateral sclerosis. The gene coding for S100B maps in the Down's syndrome region of chromosome 21, and its over-expression, due to the trisomic state, may be responsible for the neurological disturbances in Down's syndrome. Oncogenesis S100B may be involved in the proliferation of melanoma cells. It has been shown to be elevated in primary malignant melanomas. However, S100B is used as a predictor of survival prognosis as elevated levels of S100B in serum are associated with the survival rate.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 567 External links Nomenclature Hugo S100B GDB S100B Entrez_Gene S100B 6285 S100 calcium binding protein B Cards Atlas S100BID42195ch21q22 GeneCards S100B Ensembl S100B Genatlas S100B GeneLynx S100B eGenome S100B euGene 6285 Genomic and cartography GoldenPath S100B - 21q22.3 chr21:46842959-46849463 - 21q22.3 (hg18-Mar_2006) Ensembl S100B - 21q22.3 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene S100B Gene and transcription Genbank AA310307 [ ENTREZ ] Genbank BC001766 [ ENTREZ ] Genbank BC041935 [ ENTREZ ] Genbank CR542123 [ ENTREZ ] Genbank DQ892491 [ ENTREZ ] RefSeq NM_006272 [ SRS ] NM_006272 [ ENTREZ ] RefSeq AC_000064 [ SRS ] AC_000064 [ ENTREZ ] RefSeq NC_000021 [ SRS ] NC_000021 [ ENTREZ ] RefSeq NT_011515 [ SRS ] NT_011515 [ ENTREZ ] RefSeq NW_927384 [ SRS ] NW_927384 [ ENTREZ ] AceView S100B AceView - NCBI Unigene Hs.422181 [ SRS ] Hs.422181 [ NCBI ] HS422181 [ spliceNest ] Fast-db 5009 Protein : pattern, domain, 3D structure SwissProt P04271 [ SRS] P04271 [ EXPASY ] P04271 [ INTERPRO ] Prosite PS00018 EF_HAND_1 [ SRS ] PS00018 EF_HAND_1 [ Expasy ] Prosite PS50222 EF_HAND_2 [ SRS ] PS50222 EF_HAND_2 [ Expasy ] Prosite PS00303 S100_CABP [ SRS ] PS00303 S100_CABP [ Expasy ] Interpro IPR011992 EF-Hand_type [ SRS ] IPR011992 EF-Hand_type [ EBI ] Interpro IPR002048 EF_hand_Ca_bd [ SRS ] IPR002048 EF_hand_Ca_bd [ EBI ] Interpro IPR001751 S100_Ca_bd [ SRS ] IPR001751 S100_Ca_bd [ EBI ] Interpro IPR013787 S100_Ca_bd_sub [ SRS ] IPR013787 S100_Ca_bd_sub [ EBI ] CluSTr P04271

Atlas Genet Cytogenet Oncol Haematol 2007; 4 568 Pfam PF00036 efhand [ SRS ] PF00036 efhand [ Sanger ] pfam00036 [ NCBI-CDD ] Prodom PD003407 CaBP_S100[INRA-Toulouse] P04271 S100B_HUMAN [ Domain structure ] P04271 S100B_HUMAN [ sequences Prodom sharing at least 1 domain ] Prodom PD003407[INRA-Toulouse] P04271 S100B_HUMAN [ Domain structure ] P04271 S100B_HUMAN [ sequences Prodom sharing at least 1 domain ] Blocks P04271 PDB 1UWO [ SRS ] 1UWO [ PdbSum ], 1UWO [ IMB ] 1UWO [ RSDB ] HPRD 01505 Protein Interaction databases DIP P04271 IntAct P04271 Polymorphism : SNP, mutations, diseases OMIM 176990 [ map ] GENECLINICS 176990 SNP S100B [dbSNP-NCBI] SNP NM_006272 [SNP-NCI] SNP S100B [GeneSNPs - Utah] S100B] [HGBASE - SRS] HAPMAP S100B [HAPMAP] HGMD S100B General knowledge Family S100B [UCSC Family Browser] Browser SOURCE NM_006272 SMD Hs.422181 SAGE Hs.422181 GO ruffle [Amigo] ruffle GO calcium ion binding [Amigo] calcium ion binding GO nucleus [Amigo] nucleus GO cytoplasm [Amigo] cytoplasm GO cytoplasm [Amigo] cytoplasm GO axonogenesis [Amigo] axonogenesis GO central nervous system development [Amigo] central nervous system development GO memory [Amigo] memory GO zinc ion binding [Amigo] zinc ion binding GO cell proliferation [Amigo] cell proliferation GO protein homodimerization activity [Amigo] protein homodimerization activity GO protein homodimerization activity [Amigo] protein homodimerization activity GO cell soma [Amigo] cell soma GO S100 beta binding [Amigo] S100 beta binding GO tau protein binding [Amigo] tau protein binding regulation of neuronal synaptic plasticity [Amigo] regulation of neuronal synaptic GO plasticity

Atlas Genet Cytogenet Oncol Haematol 2007; 4 569 GO calcium-dependent protein binding [Amigo] calcium-dependent protein binding PubGene S100B Other databases Probes Probe S100B Related clones (RZPD - Berlin) PubMed PubMed 87 Pubmed reference(s) in LocusLink Bibliography Calcium-dependent interaction of S100b, troponin C, and calmodulin with an immobilized phenothiazine. Marshak DR, Watterson DM, Van Eldik LJ. Proc Natl Acad Sci USA. 1981; 78(11):6793-6797. Medline 6947252

Ions binding to S100 proteins: structural changes induced by calcium and zinc on S100a and S100b proteins. Baudier J, Gerard D. Biochemistry. 1983; 22(14):3360-3369. Medline 6615778

Comparison of S100b protein with calmodulin: interactions with melittin and microtubule- associated tau proteins and inhibition of phosphorylation of tau proteins by protein kinase C. Baudier J, Mochly-Rosen D, Newton A, Lee SH, Koshland DE Jr, Cole RD. Biochemistry. 1987; 26(10):2886-2893. Medline 3111527

Gene encoding the beta subunit of S100 protein is on chromosome 21: implications for Down syndrome. Allore R, O'Hanlon D, Price R, Neilson K, Willard HF, Cox DR, Marks A, Dunn RJ. Science 1988; 239(4845):1311-1313. Medline 2964086

Interactions between the microtubule-associated tau proteins and S100b regulate tau phosphorylation by the Ca2+/calmodulin-dependent protein kinase II. Baudier J, Cole RD. J Biol Chem. 1988; 263(12):5876-5883. Medline 2833519

The Ca2+ -binding sequence in bovine brain S100b protein beta-subunit. A spectroscopic study. Baudier J, Cole RD. Biochem J. 1989; 264(1):79-85. Medline 2604719

Characterization of the tumor supresor protein p53 as a protein kinase C substrate and a S100b-binding protein. Baudier J, Delphin C, Grunwald D, Khochbin S, Lawrence JJ. Proc Natl Acad Sci USA. 1992; 89(23):11627-11631. Medline 1454855

Astrocytosis and axonal proliferation in the hippocampus of S100b transgenic mice. Reeves RH, Yao J, Crowley MR, Buck S, Zhang X, Yarowsky P, Gearhart JD, Hilt DC.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 570 Proc Natl Acad Sci USA. 1994; 91(12):5359-5363. Medline 8202493

Solution structure of rat apo-S100B(beta beta) as determined by NMR spectroscopy. Drohat AC, Amburgey JC, Abildgaard F, Starich MR, Baldisseri D, Weber DJ. Biochemistry. 1996; 35(36):11577-11588. Medline 8794737

The solution structure of the bovine S100B protein dimer in the calcium-free state. Kilby PM, Van Eldik LJ, Roberts GC. Structure. 1996; 4(9):1041-1052. Medline 880559

S100B protein, 5-S-cysteinyldopa and 6-hydroxy-5-methoxyindole-2-carboxylic acid as biochemical markers for survival prognosis in patients with malignant melanoma. Karnell R, von Schoultz E, Hansson LO, Nilsson B, Arstrand K, Kagedal B. Melanoma Res. 1997;7(5):393-399. Medline 9429222

Identification of the binding site on S100B protein for the actin capping protein CapZ. Kilby PM, Van Eldik LJ, Roberts GC. Protein Sci. 1997; 6(12):2494-2503. Medline 9416599

Solution structure of calcium-bound rat S100B(beta beta) as determined by nuclear magnetic resonance spectroscopy. Drohat AC, Baldisseri DM, Rustandi RR, Weber DJ. Biochemistry 1998; 37(9): 2729-2740. Medline 9485423

Calcium regulation of Ndr protein kinase mediated by S100 calcium-binding proteins. Millward TA, Heizmann CW, Schafer BW, Hemmings BA. EMBO J. 1998; 17(20):5913-5922. Medline 9774336

The Ca(2+)-dependent interaction of S100B (beta beta) with a peptide derived from p53. Rustandi RR, Drohat AC, Baldisseri DM, Wilder PT, Weber DJ. Biochemistry. 1998; 37(7):1951-1960. Medline 9485322

Calcium and S100B regulation of p53-dependent cell growth arrest and apoptosis. Scotto C, Deloulme JC, Rousseau D, Chambaz, E, Baudier J. Mol Cell Biol. 1998; 18(7):4272-4281. Medline 9632811

Association of S100B with intermediate filaments and microtubules in glial cells. Sorci G, Agneletti Al, Bianchi R, Donato R. Biochim Biphys Acta. 1998; 1448(2):277-289. Medline 9920418

Calcium-dependent interaction of S100B with the C-terminal domain of the tumor suppressor p53. Delphin C, Roniat M, Deloulme JC, Garin G, Debussche L, Higashimoto Y, Sakaguchi K, Baudier J. J Biol Chem. 1999; 274(15):10539-10544.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 571 Medline 10187847

Concerted regulation of wild-type p53 nuclear accumulation and activation by S100B and calcium-dependent protein kinase C. Scotto C, Delphin C, Deloulme JC, Baudier J. Mol Cell Biol. 1999;19(10):7168-7180. Medline 10490652

Structure of the negative regulatory domain of p53 bound to S100B (betabeta). Rustandi RR, Baldisseri DM, Weber DJ. Nat Struct Biol. 2000; 7(7):570-574. Medline 10876243

Glial protein S100B modulates long-term neuronal synaptic plasticity. Nishiyama H, Knopfel T, Endo S, Itohara S. Proc Natl Acad Sci USA. 2002; 99(6):4037-4042. Medline 11891290

S100B inhibits myogenic differentiation and myotube formation in a RAGE-independent manner. Sorci G, Riuzzi F, Agneletti AL, Marchetti C, Donato R. Mol Cell Biol. 2003; 23(14):4870-4881. Medline 12832473

Proteins of the S100 family regulate the oligomerization of p53 tumor supresor. Fernandez-Fernandez MR, Veprintsev DB, Fersht AR. Proc Natl Acad Sci USA. 2005;102(13):4735-4740. Medline 15781852

S100B-induced microglial and neuronal IL-1 expression is mediated by cell type-specific transcription factors. Liu L, Li Y, Van Eldik LJ, Griffin WS, Barger SW. J Neurochem. 2005; 92(3):546-553. Medline 15659225

Key role of Src kinase in S100B-induced activation of the receptor for advanced glycation end products in vascular smooth muscle cells. Reddy MA, Li Sl, Sahar S, Kim YS, Xu ZG, Lanting L, Natarajan R. J Biol Chem. 2006; 281(19):13685-13693. Medline 16551628

Expression of S100B during development of the mouse cerebellum. Hachem S, Laurenson AS, Hugnot JP, Legraverend C. BMC Dev Biol. 2007; 7:17. Medline 17362503

Evidence for a wide extra-astrocytic distribution of S100B in human brain. Steiner J, Bernstein HG, Bielau H, Berndt A, Brisch R, Mawrin C, Keilhoff G, Bogerts B. BMC Neurosci. 2007; 8:2. Medline 17199889

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Atlas Genet Cytogenet Oncol Haematol 2007; 4 572

Contributor(s) Written 05-2007 M Rosario Fernandez-Fernandez, Alan R Fersht Centre for Protein Engineering, Medical Research Council, Hills Road,

Cambridge CB2 2QH, United Kingdom Citation This paper should be referenced as such : Fernandez-Fernandez MR, Fersht AR . S100B (S100 calcium binding protein B). Atlas Genet Cytogenet Oncol Haematol. May 2007 . URL : http://AtlasGeneticsOncology.org/Genes/S100BID42195ch21q22.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 573 Atlas of Genetics and Cytogenetics in Oncology and Haematology

PTGS2 (prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)) Identity Other names COX2 (Cyclooxygenase 2) COX-2 PGG/HS PGHS-2 PHS-2 hCox-2 Hugo PTGS2 Location 1q31.1 DNA/RNA Description 8633 bases, 10 Exons. Transcription One transcript (chr1:184907546-184916179). COX2 promoter is regulated via the interplay between two opposite beta isoforms of the CCAAT/enhancer binding protein and the p300 coactivator. Protein Description COX2 is an enzyme that belongs to the prostaglandin G/H synthase family. It consists of 604 amino acids and has a molecular weight of 68996Da. COX2 possesses two catalytic activities and respective active sites: a cyclooxygenase (COX) that converts arachidonic acid to a prostaglandin endoperoxide, prostaglandin G2 (PGG2), and a peroxidase (POX) that reduces PGG2 to PGH2. COX2 functions as homodimer although each subunit has both a POX and a COX active site. Each subunit binds one heme B (iron-protoporphyrin IX) group. Expression Wide expression in alimentary system (esophagus, pharynx), male reproductive system (prostate, seminal vesicles, ejaculatory duct), female reproductive system (cervix, uterus), hematopoietic system (bone marrow, monocytes). Localisation Intracellular, cytoplasm, microsome, microsomal membrane. Function Enzyme that functions both as a dioxygenase and as a peroxidase. COX-2 catalyzes the transformation of arachidonic acid to prostaglandin H2, which is the rate-limiting step in the formation of prostaglandins (PGs) and thromboxane A2 (TXA2). COX-2 is a potent mediator of inflammation and is implicated in prostanoid signaling in activity dependent plasticity. It is an inducible enzyme that plays an important role in several pathophysiological processes, including inflammation, angiogenesis, and tumorigenesis. Mutations Note Five heterozygous mutations (1 missense/nonsense, 1 splicing, 3 regulatory) have been identified. Two were associated with diabetes mellitus type 2, one with bladder cancer risk, one with increased risk of colorectal cancer and one with decreased risk of colorectal cancer. Implicated in Entity Colorectal Cancers Disease COX2 is involved in regulation of apoptosis, proliferation and invasiveness of

Atlas Genet Cytogenet Oncol Haematol 2007; 4 574 colorectal tumor cells and promotes angiogenesis in several animal colon cancer models. It is also implicated in several premalignant lesions including adenomatous polyps. COX2 stimulates colon cancer cell growth through its heterotrimeric guanine nucleotide-binding protein (G protein)-coupled receptor, EP2.

Entity Gastric Cancer Disease Expression of COX2 is elevated in gastric adenocarcinomas, which correlates with several clinicopathological parameters, including depth of invasion and lymph node metastasis.

Entity Non small cell lung cancer Disease Non-small-cell lung cancer (NSCLC), especially adenocarcinomas, overexpress COX2, which contributes to the progression of malignancy by several mechanisms.

Entity Cholangiocarcinoma Disease COX2 has been implicated in cholangiocarcinogenesis. Selective COX-2 inhibitors have been shown to inhibit cholangiocarcinoma cell growth in vitro and in animal models.

Entity Uterine Carcinosarcoma Disease COX2 is overexpressed in one-third of uterine carcinosarcomas. COX-2 expression is a strong indicator of unfavorable prognosis.

Entity Head and Neck squamous cell cancer Disease COX2 is overexpressed in a variety of premalignant and malignant conditions, including oral leukoplakia and squamous cell carcinoma of the head and neck.

Entity Ovarian cancer Disease COX-2 is increased in epithelial ovarian cancer and PGE2-synthesis and signalling are important for malignant transformation and progression.

Entity Pancreatic cancer Disease Mounting evidence suggests that COX2 is implicated in pancreatic cancer. Immunohistochemical, RT-PCR, and Western blotting studies have shown that COX2, is upregulated in human pancreatic cancer cell lines as well as human pancreatic cancer tissues compared with normal ductal cells and normal pancreas specimens. COX2 inhibitors significantly inhibit pancreatic cancer growth both in vitro and in vivo while simultaneously induce apoptosis.

Entity Other Malignant Diseases Disease Similar to above tumors, COX2 is implicated in carcinogenesis of multiple tumors including transitional cell bladder cancer, prostate cancer, uterine cancer, cervical cancer, angiosarcoma, hepatocellular cancer, melanoma, multiple myeloma, chronic lymphocytic leukemia, thyroid cancer, Wilms tumor.

Entity Primary Dysmenorrhea Disease In vivo studies have demonstrated that selective COX-2 inhibitors are effective in treatment of primary dysmenorrhea in women.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 575 Entity Inflammatory Conditions Disease COX2 occupies an important in several inflammatory diseases such as osteoarthritis and rheumatoid arthritis.

Entity Neurolomuscular Disorders Disease COX2 is implicated in encephalitis, cerebral infarction, polyneuropathy and muscular dystrophies.

Entity Cardiovascular toxicity and thromboembolic Discorders Note Selective inhibition of COX2 (without concomitant inhibition of COX1) is associated with significant cardiovascular risk and thromboembolic phenomena.

Entity Retinopathy Disease COX2 plays an important role in ischemic proliferative retinopathy, as in the case of diabetic retinopathy. External links Nomenclature Hugo PTGS2 GDB PTGS2 PTGS2 5743 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase Entrez_Gene and cyclooxygenase) Cards Atlas PTGS2ID509ch1q31 GeneCards PTGS2 Ensembl PTGS2 Genatlas PTGS2 GeneLynx PTGS2 eGenome PTGS2 euGene 5743 Genomic and cartography GoldenPath PTGS2 - 1q31.1 chr1:184907593-184916179 - 1q25.2-q25.3 (hg18-Mar_2006) Ensembl PTGS2 - 1q25.2-q25.3 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene PTGS2 Gene and transcription Genbank AJ634912 [ ENTREZ ] Genbank AK292167 [ ENTREZ ] Genbank AY151286 [ ENTREZ ] Genbank AY462100 [ ENTREZ ] Genbank BC013734 [ ENTREZ ] RefSeq NM_000963 [ SRS ] NM_000963 [ ENTREZ ] RefSeq AC_000044 [ SRS ] AC_000044 [ ENTREZ ] RefSeq NC_000001 [ SRS ] NC_000001 [ ENTREZ ]

Atlas Genet Cytogenet Oncol Haematol 2007; 4 576 RefSeq NT_004487 [ SRS ] NT_004487 [ ENTREZ ] RefSeq NW_926128 [ SRS ] NW_926128 [ ENTREZ ] AceView PTGS2 AceView - NCBI Unigene Hs.196384 [ SRS ] Hs.196384 [ NCBI ] HS196384 [ spliceNest ] Fast-db 17658 Protein : pattern, domain, 3D structure SwissProt P35354 [ SRS] P35354 [ EXPASY ] P35354 [ INTERPRO ] Prosite PS00022 EGF_1 [ SRS ] PS00022 EGF_1 [ Expasy ] Prosite PS01186 EGF_2 [ SRS ] PS01186 EGF_2 [ Expasy ] Prosite PS50026 EGF_3 [ SRS ] PS50026 EGF_3 [ Expasy ] Prosite PS50292 PEROXIDASE_3 [ SRS ] PS50292 PEROXIDASE_3 [ Expasy ] Interpro IPR006210 EGF [ SRS ] IPR006210 EGF [ EBI ] Interpro IPR000742 EGF_3 [ SRS ] IPR000742 EGF_3 [ EBI ] Interpro IPR006209 EGF_like [ SRS ] IPR006209 EGF_like [ EBI ] Interpro IPR013032 EGF_like_reg [ SRS ] IPR013032 EGF_like_reg [ EBI ] Interpro IPR010255 Haem_peroxidase [ SRS ] IPR010255 Haem_peroxidase [ EBI ] IPR002007 Haem_peroxidase_animal [ SRS ] IPR002007 Interpro Haem_peroxidase_animal [ EBI ] CluSTr P35354 PF03098 An_peroxidase [ SRS ] PF03098 An_peroxidase [ Sanger ] pfam03098 [ Pfam NCBI-CDD ] Pfam PF00008 EGF [ SRS ] PF00008 EGF [ Sanger ] pfam00008 [ NCBI-CDD ] Smart SM00181 EGF [EMBL] Blocks P35354 HPRD 02599 Protein Interaction databases DIP P35354 IntAct P35354 Polymorphism : SNP, mutations, diseases OMIM 600262 [ map ] GENECLINICS 600262 SNP PTGS2 [dbSNP-NCBI] SNP NM_000963 [SNP-NCI] SNP PTGS2 [GeneSNPs - Utah] PTGS2] [HGBASE - SRS] HAPMAP PTGS2 [HAPMAP] COSMIC PTGS2 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD PTGS2 General knowledge Family PTGS2 [UCSC Family Browser] Browser SOURCE NM_000963 SMD Hs.196384 SAGE Hs.196384 Enzyme 1.14.99.1 [ Enzyme-SRS ] 1.14.99.1 [ Brenda-SRS ] 1.14.99.1 [ KEGG ] 1.14.99.1

Atlas Genet Cytogenet Oncol Haematol 2007; 4 577 [ WIT ] GO peroxidase activity [Amigo] peroxidase activity GO peroxidase activity [Amigo] peroxidase activity prostaglandin-endoperoxide synthase activity [Amigo] prostaglandin-endoperoxide GO synthase activity prostaglandin-endoperoxide synthase activity [Amigo] prostaglandin-endoperoxide GO synthase activity GO iron ion binding [Amigo] iron ion binding GO nucleus [Amigo] nucleus GO cytoplasm [Amigo] cytoplasm GO cytoplasm [Amigo] cytoplasm GO endoplasmic reticulum [Amigo] endoplasmic reticulum GO microsome [Amigo] microsome GO electron transport [Amigo] electron transport GO fatty acid biosynthetic process [Amigo] fatty acid biosynthetic process GO cell motility [Amigo] cell motility GO response to oxidative stress [Amigo] response to oxidative stress GO blood pressure regulation [Amigo] blood pressure regulation GO membrane [Amigo] membrane GO oxidoreductase activity [Amigo] oxidoreductase activity oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Amigo] oxidoreductase activity, acting GO on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen GO cyclooxygenase pathway [Amigo] cyclooxygenase pathway GO heme binding [Amigo] heme binding GO anagen [Amigo] anagen GO metal ion binding [Amigo] metal ion binding GO regulation of inflammatory response [Amigo] regulation of inflammatory response BIOCARTA Mechanism of Acetaminophen Activity and Toxicity [Genes] BIOCARTA Eicosanoid Metabolism [Genes] Mechanism of Gene Regulation by Peroxisome Proliferators via BIOCARTA PPARa(alpha) [Genes] KEGG Prostaglandin and Leukotriene Metabolism PubGene PTGS2 Other databases Probes Probe PTGS2 Related clones (RZPD - Berlin) PubMed PubMed 499 Pubmed reference(s) in LocusLink Bibliography Cyclooxygenase-2: a novel molecular target for the prevention and treatment of head and neck cancer. Lin DT, Subbaramaiah K, Shah JP, Dannenberg AJ, Boyle JO. Head Neck 2002; 24(8): 792-799. Review. Medline 12203806

Atlas Genet Cytogenet Oncol Haematol 2007; 4 578

Dynamic regulation of cyclooxygenase-2 promoter activity by isoforms of CCAAT/enhancer- binding proteins. Zhu Y, Saunders MA, Yeh H, Deng WG, Wu KK. J Biol Chem 2002; 277(9): 6923-6928. Medline 11741938

Cyclooxygenase-2 and gastric carcinogenesis. Saukkonen K, Rintahaka J, Sivula A, Buskens CJ, Van Rees BP, Rio MC, Haglund C, Van Lanschot JJ, Offerhaus GJ, Ristimaki A. APMIS 2003; 111(10): 915-925. Review. Medline 14616542

Cyclooxygenase-2 inhibitors in lung cancer. Ramalingam S, Belani CP. Clin Lung Cancer 2004; 5(4): 245-253. Review. Medline 14967078

Cyclooxygenases in cancer: progress and perspective. Zha S, Yegnasubramanian V, Nelson WG, Isaacs WB, De Marzo AM. Cancer Lett 2004; 215(1): 1-20. Review. Medline 15374627

The cardiovascular toxicity of selective and nonselective cyclooxygenase inhibitors: comparisons, contrasts, and aspirin confounding. Konstantinopoulos PA, Lehmann DF. J Clin Pharmacol 2005; 45(7): 742-750. Review. Medline 15951464

COX-2, c-KIT and HER-2/neu expression in uterine carcinosarcomas: prognostic factors or potential markers for targeted therapies? Raspollini MR, Susini T, Amunni G, Paglierani M, Taddei A, Marchionni M, Scarselli G, Taddei GL. Gynecol Oncol 2005; 96(1): 159-167. Medline 15589595

Cyclooxygenase-2 and prostaglandin signaling in cholangiocarcinoma. Wu T. Biochim Biophys Acta 2005; 1755(2): 135-150. Review. Medline 15921858

Ovarian epithelial cancer: a role for PGE2-synthesis and signalling in malignant transformation and progression. Rask K, Zhu Y, Wang W, Hedin L, Sundfeldt K. Mol Cancer 2006; 5:62. Medline 17107625

NF-kappaB/PPARgamma and/or AP-1/PPARgamma 'on/off' switches and induction of CBP in colon adenocarcinomas: correlation with COX-2 expression. Konstantinopoulos PA, Vandoros GP, Sotiropoulou-Bonikou G, Kominea A, Papavassiliou AG. Int J Colorectal Dis 2007; 22(1): 57-68. Medline 16506021

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Atlas Genet Cytogenet Oncol Haematol 2007; 4 579 BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written Panagiotis A Konstantinopoulos, Michalis V Karamouzis, Athanasios G 05-2007 Papavassiliou Department of Biological Chemistry, Medical School, University of Athens,

GR-11527 Goudi-Athens, Greece (AGP). Citation This paper should be referenced as such : Konstantinopoulos PA, Karamouzis MV, Papavassiliou AG . PTGS2 (prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)). Atlas Genet Cytogenet Oncol Haematol. May 2007 . URL : http://AtlasGeneticsOncology.org/Genes/PTGS2ID509ch1q31.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 580 Atlas of Genetics and Cytogenetics in Oncology and Haematology

PLCB2 (phospholipase C, beta 2) Identity Other names FLJ38135 Hugo PLCB2 Location 15q15 DNA/RNA Note 32 exons; DNA size 19,93 Kb. Transcription mRNA size 4518 bp. Two alternatively spliced forms of PLC-b2 have been identified: PLC-b2a and PLC-b2b. The sequence of PLC-b2a consists of 1181 amino acids (molecular weight 133.7 kDa). PLC-b2b transcript lacks 45 nucleotides in the carboxyl-terminal region and the two splice variants differ by 15 amino acid residues, corresponding to aa 864-878. Pseudogene No known pseudogenes. Protein

PH: pleckstrin homology domain EF: EF-hand domain X and Y: catalytic domains C2: calcium-binding domain Description The sequence of PLC-b2 contains a PH-domain in the amino-terminal region, that binds to polyhosphoinositides and to cytoskeleton proteins. The catalytic site corresponds to the X and Y domains, highly conserved among PLCs. A C2 domain, present in numerous signaling molecules, is involved in the calcium binding. The long carboxyl-terminal region, located downstream to the C2 domain, is involved in the Gaq mediated activation of the catalytic domains and contains a nuclear localization signal. Additional EF domains are located between the PH and X regions and seem to simply constitute a flexible linker to the X-Y domain. Expression PLC-b2, first isolated from a HL-60 cDNA library, is expressed predominantly in cells of haematopoietic origin. The amount of PLC-b2 correlates with the functional maturation of differentiating cells. In platelets, leukocytes and erythroleukemia cells, both the two alternatively spliced forms are present. PLC-b2 is weakly expressed in breast epithelial cells and shows high levels in tumoral mammary tissues. PLC-b2 was also identified in ATP-secreting taste bud cells. Localisation PLC-b2 has both a cytoplasmic and a nuclear localization. In particular, PLC-b2 accumulates inside the nuclear compartment during agonist-induced granulocytic differentiation of tumoral myeloid precursors. In platelets, expressing both splicing variants, PLC-b2a is most abundant in the nuclear compartment. By means of immunocytochemical analysis, it has been demonstrated that in promyelocytes differentiating along the neutrophil lineage, PLC-b2 distribution evokes the spatial organization of the cytoskeleton. Function PLC-b2 catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) generating the second messenger molecules inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). In hematopoietic cells, PLC-b2 plays a crucial role in platelet activation and in response of neutrophils to chemoattractants. During maturation of tumoral myeloid precursors, it has been demonstrated that the

Atlas Genet Cytogenet Oncol Haematol 2007; 4 581 phosphodiesterase activity of PLC-b2 on the actin-associated PIP2 may be responsible, by modifying the phosphoinositide pools, for the modifications of cytoskeleton architecture that take place during motility of differentiating promyelocytes. In taste bud cells, PLC-b2 is a marker of early differentiation and functional taste signalling. Homology PLC-b2 is related to PLC-b1 with an amino acid sequence identity of 48%. Implicated in Entity Acute Promyelocytic Leukaemia (APL) Note This hematopoietic disorder is a M3 subtype of acute myeloblastic leukemia and is characterized by a block of granulocytopoiesis at the promyelocytic stage. APL blasts present a balanced reciprocal t(15;17) chromosomal translocation encoding the PML/ RARA fusion protein that plays a key role in the pathogenesis of the disease. Disease PLC-b2, highly present in neutrophils of peripheral blood, is weakly expressed in blasts purified from patients with APL and in APL-derived cell lines. Prognosis PLC-b2 shows a large increase of expression during ATRA (all-trans-retinoic acid ) and/or As2O3-induced granulocytic differentiation of both APL-derived cell lines and blasts purified from patients with APL. PLC-b2 expression during differentiating treatments correlates with the granulocytic maturation levels reached by myeloid precursors. In addition, the level of PLC-b2 after ex-vivo ATRA treatment of APL blasts strikingly correlates with the responsiveness of APL patients to ATRA-based therapies. This evidence demonstrates that PLC-b2 represents a specific marker for monitoring the agonist-induced overcoming of the maturation blockade of tumoral promyelocytes. Oncogenesis It has been reported that co-repressors bound to PML-RARa are released from DNA upon both ATRA and As2O3-treatment of APL cells leading to the activation of genes repressed by the fusion protein. This suggests that the reduced expression of PLC-b2, whose gene is located on chromosome 15, which is involved in the (15;17) translocation, may be related to the presence of the fusion protein. The increased expression of PLC-b2, induced by both ATRA and As2O3, may be related indeed to the removal of the fusion protein, that seems to constitute a common step of the differentiation pathways activated by the two agonists.

Entity Breast cancer Note Breast cancer is highly heterogeneous and, during its sequential in vivo progression from atypical hyperproliferation to metastatic disease, tumor cells undergo phenotype alterations, including the loss, to a variable extent, of epithelial-like features, and the gain of more aggressive and invasive mesenchymal-like traits. Like most human neoplasm, breast cancer has aberrations in signal transduction elements that can lead to increased proliferative potential, sustained angiogenesis, apoptosis inhibition and tissue invasion and metastasis. The portrait of breast tumors remains stable during progression and no major changes appear to explain why a tumor may evolve to the metastatic stage and, at present, no marker has been clearly associated with the progression from in situ to invasiveness. Disease It has recently been demonstrated, by means of immunohistochemical analysis on tissue microarrays composed of breast cancer specimens and normal epithelia, that PLC-b2, poorly expressed in normal tissues, is up-regulated in almost all tumor cells. In particular, the amount of PLC-b2 correlates with morphological features of the different primary cancers, since weak expression is showed by tumors that retain a differentiated appearance, while a progressively higher amount of protein was revealed in poorly differentiated and undifferentiated tumors. Prognosis By analyzing the relationship between PLC-b2 levels and biological and clinic- pathological factors, it has been found that the expression of PLC-b2 strikingly correlates with histological grade, mitotic index and size of primary tumors. No differences in PLC-b2 amount were found in breast tumors that express estrogens and/or progesterone receptors, while tumors negative for at least one of the two

Atlas Genet Cytogenet Oncol Haematol 2007; 4 582 receptors showed elevated expression of this enzyme, as well as the majority of HER- 2 positive tumours. These data suggest that high amounts of PLC-b2 might be associated to a worse response to therapy. Survival analysis of cancer-related death indicates that patients whose primary tumors express low levels of PLC-b2 show an overall survival significantly higher in comparison to patients whose primary tumors express high levels of protein. In addition, elevated PLC-b2 expression of primary breast cancer is associated with a shorter relapse-free time interval. External links Nomenclature Hugo PLCB2 GDB PLCB2 Entrez_Gene PLCB2 5330 phospholipase C, beta 2 Cards Atlas PLCB2ID41743ch15q15 GeneCards PLCB2 Ensembl PLCB2 Genatlas PLCB2 GeneLynx PLCB2 eGenome PLCB2 euGene 5330 Genomic and cartography GoldenPath PLCB2 - 15q15 chr15:38367392-38387466 - 15q15 (hg18-Mar_2006) Ensembl PLCB2 - 15q15 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene PLCB2 Gene and transcription Genbank AB209583 [ ENTREZ ] Genbank AK095454 [ ENTREZ ] Genbank AK130831 [ ENTREZ ] Genbank AK291657 [ ENTREZ ] Genbank BC000939 [ ENTREZ ] RefSeq NM_004573 [ SRS ] NM_004573 [ ENTREZ ] RefSeq AC_000058 [ SRS ] AC_000058 [ ENTREZ ] RefSeq NC_000015 [ SRS ] NC_000015 [ ENTREZ ] RefSeq NT_010194 [ SRS ] NT_010194 [ ENTREZ ] RefSeq NW_925840 [ SRS ] NW_925840 [ ENTREZ ] AceView PLCB2 AceView - NCBI Unigene Hs.355888 [ SRS ] Hs.355888 [ NCBI ] HS355888 [ spliceNest ] Fast-db 2104 Protein : pattern, domain, 3D structure SwissProt Q00722 [ SRS] Q00722 [ EXPASY ] Q00722 [ INTERPRO ] Prosite PS50004 C2 [ SRS ] PS50004 C2 [ Expasy ] Prosite PS50007 PIPLC_X_DOMAIN [ SRS ] PS50007 PIPLC_X_DOMAIN [ Expasy ]

Atlas Genet Cytogenet Oncol Haematol 2007; 4 583 Prosite PS50008 PIPLC_Y_DOMAIN [ SRS ] PS50008 PIPLC_Y_DOMAIN [ Expasy ] Interpro IPR000008 C2_Ca-dep [ SRS ] IPR000008 C2_Ca-dep [ EBI ] Interpro IPR008973 C2_CaLB [ SRS ] IPR008973 C2_CaLB [ EBI ] Interpro IPR011992 EF-Hand_type [ SRS ] IPR011992 EF-Hand_type [ EBI ] Interpro IPR011993 PH_type [ SRS ] IPR011993 PH_type [ EBI ] Interpro IPR001192 PI_PLC_C [ SRS ] IPR001192 PI_PLC_C [ EBI ] Interpro IPR000909 PI_PLC_X [ SRS ] IPR000909 PI_PLC_X [ EBI ] Interpro IPR013841 PI_PLC_X_Y [ SRS ] IPR013841 PI_PLC_X_Y [ EBI ] Interpro IPR001711 PI_PLC_Y [ SRS ] IPR001711 PI_PLC_Y [ EBI ] CluSTr Q00722 Pfam PF00168 C2 [ SRS ] PF00168 C2 [ Sanger ] pfam00168 [ NCBI-CDD ] PF00388 PI-PLC-X [ SRS ] PF00388 PI-PLC-X [ Sanger ] pfam00388 [ NCBI-CDD Pfam ] PF00387 PI-PLC-Y [ SRS ] PF00387 PI-PLC-Y [ Sanger ] pfam00387 [ NCBI-CDD Pfam ] Smart SM00239 C2 [EMBL] Smart SM00148 PLCXc [EMBL] Smart SM00149 PLCYc [EMBL] Prodom PD001202 PI_PLC_Y[INRA-Toulouse] Q00722 PLCB2_HUMAN [ Domain structure ] Q00722 PLCB2_HUMAN [ Prodom sequences sharing at least 1 domain ] Blocks Q00722 HPRD 04985 Protein Interaction databases DIP Q00722 IntAct Q00722 Polymorphism : SNP, mutations, diseases OMIM 604114 [ map ] GENECLINICS 604114 SNP PLCB2 [dbSNP-NCBI] SNP NM_004573 [SNP-NCI] SNP PLCB2 [GeneSNPs - Utah] PLCB2] [HGBASE - SRS] HAPMAP PLCB2 [HAPMAP] COSMIC PLCB2 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD PLCB2 General knowledge Family PLCB2 [UCSC Family Browser] Browser SOURCE NM_004573 SMD Hs.355888 SAGE Hs.355888 3.1.4.11 [ Enzyme-SRS ] 3.1.4.11 [ Brenda-SRS ] 3.1.4.11 [ KEGG ] 3.1.4.11 [ Enzyme WIT ] phosphoinositide phospholipase C activity [Amigo] phosphoinositide phospholipase C GO activity

Atlas Genet Cytogenet Oncol Haematol 2007; 4 584 phosphoinositide phospholipase C activity [Amigo] phosphoinositide phospholipase C GO activity GO signal transducer activity [Amigo] signal transducer activity GO calcium ion binding [Amigo] calcium ion binding GO phospholipid metabolic process [Amigo] phospholipid metabolic process GO phospholipase C activation [Amigo] phospholipase C activation GO intracellular signaling cascade [Amigo] intracellular signaling cascade GO lipid catabolic process [Amigo] lipid catabolic process GO hydrolase activity [Amigo] hydrolase activity GO sensory perception of bitter taste [Amigo] sensory perception of bitter taste BIOCARTA CCR3 signaling in Eosinophils [Genes] BIOCARTA Thrombin signaling and protease-activated receptors [Genes] BIOCARTA ß-arrestins in GPCR Desensitization [Genes] BIOCARTA Role of ß-arrestins in the activation and targeting of MAP kinases [Genes] BIOCARTA Cadmium induces DNA synthesis and proliferation in macrophages [Genes] BIOCARTA Regulation of ck1/cdk5 by type 1 glutamate receptors [Genes] BIOCARTA Phospholipids as signalling intermediaries [Genes] BIOCARTA Eicosanoid Metabolism [Genes] BIOCARTA fMLP induced chemokine gene expression in HMC-1 cells [Genes] PKC-catalyzed phosphorylation of inhibitory phosphoprotein of myosin BIOCARTA phosphatase [Genes] BIOCARTA Activation of PKC through G protein coupled receptor [Genes] BIOCARTA Phospholipase C Signaling Pathway [Genes] BIOCARTA G-Protein Signaling Through Tubby Proteins [Genes] KEGG Inositol Phosphate Metabolism KEGG Phosphatidylinositol Signaling System PubGene PLCB2 Other databases Probes Probe PLCB2 Related clones (RZPD - Berlin)

PubMed PubMed 33 Pubmed reference(s) in LocusLink Bibliography Cloning, sequencing, expression, and Gq-independent activation of phospholipase C-beta-2. Park D, Jhon DY, Kriz R, Knopf J, Rhee SG. J Biol Chem 1992; 267:16048-16055. Medline 1644792

Intranuclear translocation of phospholipase C beta2 during HL-60 myeloid differentiation. Bertagnolo V, Marchisio M, Capitani S, Neri LM. Biochem Biophys Res Commun 1997; 235:831-835. Medline 9207247

Roles of PLC-beta-2 and -beta-3 and PI3K-gamma in chemoattractant-mediated signal transduction.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 585 Li Z, Jiang H, Xie W, Zhang Z, Smrcka AV, Wu D. Science 2000; 287:1046-1049. Medline 10669417

Structure, function, and control of phosphoinositide-specific phospholipase C. Rebecchi MJ, Pentyala SN. Physiol Rev 2000; 80:1291-1335. Medline 11015615

Selective up-regulation of phospholipase C-beta2 during granulocytic differentiation of normal and leukemic hematopoietic progenitors. Bertagnolo V, Marchisio M, Pierpaoli S, Colamussi ML, Brugnoli F, Visani G, Zauli G, Capitani S. J Leukoc Biol 2002; 71:957-965. Medline 12050180

PLC-beta2 is highly expressed in breast cancer and is associated with a poor outcome: a study on tissue microarrays. Bertagnolo V, Benedusi M, Querzoli P, Pedriali M, Magri E, Brugnoli F, Capitani S. Int J Oncol 2006; 28:863-872. Medline 16525635

PLC-beta2 monitors the drug-induced release of differentiation blockade in tumoral myeloid precursors. Brugnoli F, Bovolenta M, Benedusi M, Miscia S, Capitani S, Bertagnolo V. J Cell Biochem 2006; 98:160-173. Medline 16408290

Taste bud contains both short-lived and long-lived cell populations. Hamamici R, Asano-Myyoshi M, Emori Y. Neuroscience 2006; 141:2129-2138. Medline 16843606

Phospholipase C-beta2 promotes mitosis and migration of human breast cancer derived cells. Bertagnolo V, Benedusi M, Brugnoli F, Lanuti P, Marchisio M, Querzoli P, Capitani S. Carcinogenesis 2007; Epub ahead of print. Medline 17429106

PLC-beta2 activity on actin associated polyphosphoinositides promotes migration of differentiating tumoral myeloid precursors. Brugnoli F, Bavelloni A, Benedusi M, Capitani S, Bertagnolo V. Cell Signal 2007; Epub ahead of print. Medline 17478077

Alternative splice variants of phospholipase C-beta2 are expressed in platelets: effects on Galphaq-dependent activation and localization. Sun L, Mao G, Kunapuli SP, Dhanasekaran DN, Rao AK. Platelets 2007; 18:217-223. Medline 17497434

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Atlas Genet Cytogenet Oncol Haematol 2007; 4 586 Contributor(s) Written 05-2007 Valeria Bertagnolo, Federica Brugnoli, Mascia Benedusi, Silvano Capitani Signal Transduction Unit, Laboratory of Cell Biology, Section of Human Anatomy, Department of Morphology and Embryology, University of Ferrara, Ferrara, Italy Citation This paper should be referenced as such : Bertagnolo V, Brugnoli F, Benedusi M, Capitani S . PLCB2 (phospholipase C, beta 2). Atlas Genet Cytogenet Oncol Haematol. May 2007 . URL : http://AtlasGeneticsOncology.org/Genes/PLCB2ID41743ch15q15.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 587 Atlas of Genetics and Cytogenetics in Oncology and Haematology

MME (membrane metallo-endopeptidase) Identity Other names common acute lymphocytic leukemia antigen (CALLA) CD10 DKFZp686O16152 MGC126681 MGC126707 Kidney-brush-border neutral proteinase Neprilysin (NEP) Enkephalinase Atriopeptidase Endopeptidase-2 Neutral endopeptidase Hugo MME Location 3q25.2 Note Membrane metallo-endopeptidase (MME) is a 100-kD type II transmembrane glycoprotein originally described on human acute lymphoblastic leukemia cell lines and therefore it was originally designated as common acute lymphocytic leukemia antigen (CALLA). MME is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including atrial natriuretic factor, glucagon, enkephalin, substance P, neurotensin, oxytocin, and bradykinin. It is also a major enzyme for degradation of beta-amyloid. DNA/RNA Note Gene:on chromosome 3 at location: 156284651-156384186 ; length: 99536 ; type: protein coding Description MME gene spans a region of 99536 bases and has 24 exons. Exons 1 and 2 encode 5' untranslated sequences. Initiation codon and transmembrane and cytoplasmic domain are encoded by exon 3, which has 170 bp. 20 short exons (exons 4-23) range in size from 36 to 162 bp. They encode large part of the extracellular portion of the enzyme. Exon 24 which has about 3400 bp encodes the COOH-terminal 32 amino acids and contains the entire 3' untranslated region (UTR). Exon 19 encodes the pentapeptide sequence associated with metalloproteinase zinc binding and substrate catalysis (His-Glu-Ile-Thr-His). The sequence is nearly identical to rat and rabbit NEP. Transcriptional regulation : MME is constitutively expressed in some tissues (kidney, adipose tissue, brain) and at some developmental stages in other (T- and B- lymphocytes, neutrophils). Its gene transcription is regulated by at least two alternative regulation regions including type 1 and type 2 promoter. Both regulatory regions are characterized by the presence of multiple transcription initiation sites and the absence of classic TATA boxes and consensus initiator elements. The purine-rich type 1 regulatory region, which includes 5' UTR exon 1 sequence, is characterized by multiple putative PU. l-binding sites and consensus ets-binding motifs. In marked contrast, the GC-rich type 2 regulatory region contains multiple putative Sp-l-binding sites, a potential consensus retinoblastoma control element (RCE); and an inverted CCAAT box. Type 2 promoter has a wide tissue distribution, a low constitutive level of expression, and multiple transcription initiation sites. However, normal and malignant lymphoid progenitors (fetal thymocytes and pre-B ALL) as well as fetal kidney and

Atlas Genet Cytogenet Oncol Haematol 2007; 4 588 glioblastoma cell line A172 showed significantly higher levels of type 1 transcripts. Transcription The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. The transcript variants 1, 1bis, and 2a contain an alternate 5' UTR exon, compared to variant 2b. The 2b variant is the longest transcript and includes alternate exon 2b. Variants 2b, 2a, 1bis and 1 all encode the same protein. Transcript variant 1 mRNA has 5643 bp. Transcript variant 1bis mRNA has 5619 bp. Transcript variant 2a mRNA has 5665 bp. Transcript variant 2b mRNA has 5710 bp. In normal human tissues, the highest mRNA levels were found in kidney, prostate, liver, and lung. Other tissues with high levels include whole blood, bone marrow, thymus, skeletal muscle, brain, ovary, testis, and placenta. Levels in lymph nodes and other secondary lymphoid tissues are dependent on the content of CD10+ B-cells in secondary germinal centers. Protein Note MME belongs to peptidase family M13, which belongs to a peptidase superfamily known as the metzincins. These are zinc-dependent metallopeptidases. Family M13 also includes endothelin-converting enzyme 1 (ECE-1), Kell blood group glycoprotein, and peptidase O from Lactococcus lactis (gene pepO). Description MME protein contains 750 amino acids, and is a type-II membrane anchored enzyme known to inactivate oligopeptides. It has a single 24-amino acid hydrophobic segment that could function as both a transmembrane region and a signal peptide. The COOH- terminal 700 amino acids compose the extracellular protein segment, whereas the 25 NH2-terminal amino acids remaining after cleavage of the initiation methionine form the cytoplasmic tail. Function Thermolysin-like specificity, but is almost confined on acting on polypeptides of up to 30 amino acids. Biologically important in the destruction of opioid peptides by cleavage of a Gly-Phe bond. Involved in the degradation of atrial natriuretic factor. Preferential cleavage of polypeptides between hydrophobic residues, particularly with Phe or Tyr at P1'. Inhibited in a dose dependent manner by opiorphin. Inhibited by phosphoramidon and thiorphan. Mutations Note Truncating mutations in the MME gene in mothers are the cause of alloimmunisation during pregnancy (1342 C to T nonsense mutation and 446delC). The absence of the MMP protein in pregnant women induces an alloimmunisation against MMP presented by fetus. Maternal antibodies attack fetal podocytes ensuing nephron loss, which could lead to chronic renal failure in early adulthood. This is the first model of idiopathic renal failure in early adulthood, which appears to be caused by immune-mediated fetal nephron loss. Implicated in Entity Alzheimer disease and normal aging Note Decreased MME expression in cerebral cortex correlates with amyloid-beta deposition but not with degeneration and dementia.

Entity Enkephalin metabolism in anxiety Note A dinucleotide polymorphism in the 5' region of the MME gene was linked to type of anxiety.

Entity T-cell apoptosis Note Both, CD8+ and CD4+ T-cells express MME upon induction of apoptosis in vitro as well as in apoptotic T-cells in vivo.

Entity Low amplitude of the P300 evoked potential waves (linked to substance abuse)

Atlas Genet Cytogenet Oncol Haematol 2007; 4 589 Note Based on the association of MME gene polymorphisms with P300 wave amplitudes of the parietal and coronal leads, it is suggested that MME plays a significant role in the regulation of the amplitude of the P300 wave. It is presumed that lower molecular weight alleles of the MME polymorphism are associated with increased levels of NEP and thus lower CNS enkephalin levels.

Entity Recessive dystrophic epidermolysis bullosa Note In recessive dystrophic epidermolysis bullose, MME activities were considerably increased in the skin and blister fluid samples compared with values found in normal control skin and in blister fluid from a patient with a burn.

Entity Acute lymphoblastic leukemia Note MME is expressed in majority acute lymphoblastic leukemias, in which MME was originally described as common acute lymphocytic leukemia antigen (CALLA). The role of MME in acute leukemia is not clear.

Entity Burkitt lymphoma Note Burkitt lymphoma/leukemia was originally misclassified with acute lymphoblastic leukemia due to its expression of CD10 and blastic cytologic appearance. However, now it is correctly classified as mature B-cell neoplasm and expression of MME (referred as to CD10 in this context) is secondary to its germinal center stage of development. In normal B-cell development MME transitory reappears on B-cells in germinal centers.

Entity Follicular lymphoma and other malignant lymphomas Note Follicular lymphomas originate from mature B-cells with germinal center stage of differentiation. Majority of follicular lymphomas typically express MME (referred to in this context as CD10) and its expression positively correlates with survival and negatively with the grade of follicular lymphoma. Other B-cell malignant lymphomas that typically express MME (CD10) are some diffuse large B-cell lymphomas (DLBCL) which are than subtyped as so-called germinal center type (GC-type DLBCL). Of T-cell lymphomas, angioimmunoblastic T- cell lymphoma typically shows expression of CD10.

Entity Carcinoma Note MME is expressed in some carcinomas that originate in organs, which normally express high levels of MME, which is best illustrated in renal cell carcinoma. MME detection is important for identification of bile canaliculi, which appear by neogenesis in hepatocellular carcinoma. This feature is diagnostically useful in hepatocellular carcinoma. It is also expressed in many other carcinomas including prostate carcinoma, urothelial carcinoma, colorectal carcinoma, and others in which expression of higher levels of MME were associated with more aggressive tumors.

Entity Melanoma Note Higher expression levels were associated with more aggressive disease.

Entity Stromal cells Note Various benign stromal cells express MME. In particular, adipose tissue, endometrial stroma, and dendritic stromal cells in the bone marrow are know to express significant levels of MME. The role of MME in these tissue is not know. However, it possibly contributes to functional changes of the endometrial stromal in the secretory phase when its levels are highest in this tissue. It is also known that dendritic MME+ stromal

Atlas Genet Cytogenet Oncol Haematol 2007; 4 590 cells of the bone marrow provide maturational niche for development of B-cells. Other MME+ benign stromal cells are induced by invasion of malignant tumors like melanoma, breast carcinoma, and others. In malignant stromal lesions MME has been found expressed in rhabdomyosarcoma, leiomyosarcoma and other sarcomas.

Entity Juvenile idiopathic arthritis (JIA) and rheumatoid arthritis (RA) Note Circulating MME levels were lower in JIA patients than in controls, while synovial fluid values were higher than those found in circulation, which might reflect a reactive effort to control synovial proliferation. RA patients have higher levels of MME in plasma and synovial fluid than patients with osteoarthritis.

Entity Acne Note Sebaceous glands in acne patients express high levels of MME. In addition, in vitro experiments using an organ culture system demonstrated that substance P induced expression MME in sebaceous glands in a dose dependent manner.

Entity Idiopathic diffuse hyperplasia of pulmonary neuroendorine cells (IDHPNC) Note MME expression in patients with IDHPNC was compared with MME expression in patients with idiopathic pulmonary fibrosis, hypersensitivity pneumonitis, and normal lung by using immunohistochemistry, ELISA, activity assay, and Western blot analysis. MME expression was highest in IDHPNC. Increased MME expression in lung tissue from patients with IDHPNC may reflect a compensatory increase that partly counteracts abundant neuropeptides, including BLP, present in this disorder.

Entity Pathophysiology of ischemia/reperfusion myocardial injury Note MME expression was increased in the neutrophils from patients with early phase of acute myocardial infarction (AMI) by 5.2- and by 4.2-fold of the neutrophils from patients with late phase of AMI, respectively. ANP and BNP, which increase in AMI, modulate the neutrophil functions and exert protective effects against the neutrophils- induced endothelial cytotoxity at the physiological concentrations. But the effects are suppressed due to their degradation by the neutrophil own MME. Thus, neutrophil MME, which also increases in AMI, may play a role in the pathophysiology of ischemia/reperfusion myocardial injury. External links Nomenclature Hugo MME GDB MME Entrez_Gene MME 4311 membrane metallo-endopeptidase Cards Atlas MMEID41386ch3q25 GeneCards MME Ensembl MME Genatlas MME GeneLynx MME eGenome MME euGene 4311 Genomic and cartography GoldenPath MME - 3q25.2 chr3:156280130-156384212 + 3q25.1-q25.2 (hg18-Mar_2006) Ensembl MME - 3q25.1-q25.2 [CytoView]

Atlas Genet Cytogenet Oncol Haematol 2007; 4 591 NCBI Mapview OMIM Disease map [OMIM] HomoloGene MME Gene and transcription Genbank AK291761 [ ENTREZ ] Genbank BC101632 [ ENTREZ ] Genbank BC101658 [ ENTREZ ] Genbank BC106070 [ ENTREZ ] Genbank BM151602 [ ENTREZ ] RefSeq NM_000902 [ SRS ] NM_000902 [ ENTREZ ] RefSeq NM_007287 [ SRS ] NM_007287 [ ENTREZ ] RefSeq NM_007288 [ SRS ] NM_007288 [ ENTREZ ] RefSeq NM_007289 [ SRS ] NM_007289 [ ENTREZ ] RefSeq AC_000046 [ SRS ] AC_000046 [ ENTREZ ] RefSeq NC_000003 [ SRS ] NC_000003 [ ENTREZ ] RefSeq NT_005612 [ SRS ] NT_005612 [ ENTREZ ] RefSeq NW_921807 [ SRS ] NW_921807 [ ENTREZ ] AceView MME AceView - NCBI Unigene Hs.307734 [ SRS ] Hs.307734 [ NCBI ] HS307734 [ spliceNest ] Fast-db 14162 Protein : pattern, domain, 3D structure SwissProt P08473 [ SRS] P08473 [ EXPASY ] P08473 [ INTERPRO ] Prosite PS00142 ZINC_PROTEASE [ SRS ] PS00142 ZINC_PROTEASE [ Expasy ] Interpro IPR006025 Pept_M_Zn_BS [ SRS ] IPR006025 Pept_M_Zn_BS [ EBI ] Interpro IPR000718 Peptidase_M13 [ SRS ] IPR000718 Peptidase_M13 [ EBI ] Interpro IPR008753 Peptidase_M13_N [ SRS ] IPR008753 Peptidase_M13_N [ EBI ] CluSTr P08473 PF01431 Peptidase_M13 [ SRS ] PF01431 Peptidase_M13 [ Sanger ] pfam01431 Pfam [ NCBI-CDD ] PF05649 Peptidase_M13_N [ SRS ] PF05649 Peptidase_M13_N [ Sanger Pfam ] pfam05649 [ NCBI-CDD ] Blocks P08473 PDB 1DL9 [ SRS ] 1DL9 [ PdbSum ], 1DL9 [ IMB ] 1DL9 [ RSDB ] PDB 1DMT [ SRS ] 1DMT [ PdbSum ], 1DMT [ IMB ] 1DMT [ RSDB ] PDB 1QVD [ SRS ] 1QVD [ PdbSum ], 1QVD [ IMB ] 1QVD [ RSDB ] PDB 1R1H [ SRS ] 1R1H [ PdbSum ], 1R1H [ IMB ] 1R1H [ RSDB ] PDB 1R1I [ SRS ] 1R1I [ PdbSum ], 1R1I [ IMB ] 1R1I [ RSDB ] PDB 1R1J [ SRS ] 1R1J [ PdbSum ], 1R1J [ IMB ] 1R1J [ RSDB ] PDB 1Y8J [ SRS ] 1Y8J [ PdbSum ], 1Y8J [ IMB ] 1Y8J [ RSDB ] HPRD 00392 Protein Interaction databases DIP P08473 IntAct P08473 Polymorphism : SNP, mutations, diseases

Atlas Genet Cytogenet Oncol Haematol 2007; 4 592 OMIM 120520 [ map ] GENECLINICS 120520 SNP MME [dbSNP-NCBI] SNP NM_000902 [SNP-NCI] SNP NM_007287 [SNP-NCI] SNP NM_007288 [SNP-NCI] SNP NM_007289 [SNP-NCI] SNP MME [GeneSNPs - Utah] MME] [HGBASE - SRS] HAPMAP MME [HAPMAP] HGMD MME General knowledge Family MME [UCSC Family Browser] Browser SOURCE NM_000902 SOURCE NM_007287 SOURCE NM_007288 SOURCE NM_007289 SMD Hs.307734 SAGE Hs.307734 3.4.24.11 [ Enzyme-SRS ] 3.4.24.11 [ Brenda-SRS ] 3.4.24.11 [ KEGG ] 3.4.24.11 Enzyme [ WIT ] GO neprilysin activity [Amigo] neprilysin activity GO protein binding [Amigo] protein binding GO plasma membrane [Amigo] plasma membrane GO integral to plasma membrane [Amigo] integral to plasma membrane GO proteolysis [Amigo] proteolysis GO proteolysis [Amigo] proteolysis GO cell-cell signaling [Amigo] cell-cell signaling GO metallopeptidase activity [Amigo] metallopeptidase activity GO zinc ion binding [Amigo] zinc ion binding GO membrane [Amigo] membrane GO metal ion binding [Amigo] metal ion binding PubGene MME Other databases Probes Probe MME Related clones (RZPD - Berlin) PubMed PubMed 97 Pubmed reference(s) in LocusLink Bibliography Leukemia-associated antigens in ALL. Pesando JM, Ritz J, Lazarus H, Costello SB, Sallan S, Schlossman SF. Blood. 1979; 54(6): 1240-1248. Medline 389310

Increased neutral protease and collagenase activity in recessive dystrophic epidermolysis

Atlas Genet Cytogenet Oncol Haematol 2007; 4 593 bullosa. Takamori K, Naito K, Taneda A, Ogawa H. Br J Dermatol. 1983; 108(6): 687-694. Medline 6305383

Common acute lymphocytic leukemia antigen is identical to neutral endopeptidase. Letarte M, Vera S, Tran R, Addis JB, Onizuka RJ, Quackenbush EJ, Jongeneel CV, McInnes RR. J Exp Med. 1988; 168(4): 1247-1253. Medline 2971756

Molecular cloning of the common acute lymphoblastic leukemia antigen (CALLA) identifies a type II integral membrane protein. Shipp MA, Richardson NE, Sayre PH, Brown NR, Masteller EL, Clayton LK, Ritz J, Reinherz EL. Proc Natl Acad Sci U S A. 1988; 85(13): 4819-4823. Medline 2968607

Organization of the gene encoding common acute lymphoblastic leukemia antigen (neutral endopeptidase 24.11): multiple miniexons and separate 5' untranslated regions. D'Adamio L, Shipp MA, Masteller EL, Reinherz EL. Proc Natl Acad Sci U S A. 1989; 86(18): 7103-7107. Medline 2528730

Cellular localization of membrane metalloendopeptidase (enkephalinase) in human endometrium during the ovarian cycle. Head JR, MacDonald PC, Casey ML. J Clin Endocrinol Metab. 1993; 76(3): 769-776. Medline 8445036

Neutral endopeptidase (3.4.24.11) in plasma and synovial fluid of patients with rheumatoid arthritis. A marker of disease activity or a regulator of pain and inflammation? Matucci-Cerinic M, Lombardi A, Leoncini G, Pignone A, Sacerdoti L, Spillantini MG, Partsch G. Rheumatol Int. 1993; 13(1): 1-4. Medline 8390712

Analysis of the human CD10/neutral endopeptidase 24.11 promoter region: two separate regulatory elements. Ishimaru F, Shipp MA. Blood. 1995; 85(11): 3199-3207. Medline 7756651

Neutral endopeptidase 24.11 in neutrophils modulates protective effects of natriuretic peptides against neutrophils-induced endothelial cytotoxity. Matsumura T, Kugiyama K, Sugiyama S, Ohgushi M, Amanaka K, Suzuki M, Yasue H. J Clin Invest. 1996; 97(10): 2192-2203. Medline 8636398

The type 2 CD10/neutral endopeptidase 24.11 promoter: functional characterization and tissue- specific regulation by CBF/NF-Y isoforms. Ishimaru F, Mari B, Shipp MA. Blood. 1997; 89(11): 4136-4145. Medline 9166856

High expression of neutral endopeptidase in idiopathic diffuse hyperplasia of pulmonary neuroendocrine cells.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 594 Cohen AJ, King TE Jr, Gilman LB, Magill-Solc C, Miller YE. Am J Respir Crit Care Med. 1998; 158(5 Pt 1): 1593-1599. Medline 9817713

Association of the enkephalinase gene with low amplitude P300 waves. Comings DE, Dietz G, Johnson JP, MacMurray JP. Neuroreport. 1999; 10(11): 2283-2285. Medline 10439449

Expression of CD10 by human T cells that undergo apoptosis both in vitro and in vivo. Cutrona G, Leanza N, Ulivi M, Melioli G, Burgio VL, Mazzarello G, Gabutti G, Roncella S, Ferrarini M. Blood. 1999; 94(9): 3067-3076. Medline 10556191

Paraffin-section detection of CD10 in 505 nonhematopoietic neoplasms. Frequent expression in renal cell carcinoma and endometrial stromal sarcoma. Chu P, Arber DA. Am J Clin Pathol. 2000; 113(3): 374-382. Medline 10705818

Association of the neutral endopeptidase (MME) gene with anxiety. Comings DE, Dietz G, Gade-Andavolu R, Blake H, Muhleman D, Huss M, Saucier G, MacMurray JP. Psychiatr Genet. 2000; 10(2): 91-94. Medline 10994648

Canalicular immunostaining of neprilysin (CD10) as a diagnostic marker for hepatocellular carcinomas. Borscheri N, Roessner A, Rocken C. Am J Surg Pathol. 2001; 25(10): 1297-1303. Medline 11688465

Sebaceous glands in acne patients express high levels of neutral endopeptidase. Toyoda M, Nakamura M, Makino T, Kagoura M, Morohashi M. Exp Dermatol. 2002; 11(3): 241-247. Medline 12102663

The type 1 CD10/neutral endopeptidase 24.11 promoter: functional characterization of the 5'- untranslated region. Sezaki N, Ishimaru F, Tabayashi T, Kataoka I, Nakase K, Fujii K, Kozuka T, Nakayama H, Harada M, Tanimoto M. Br J Haematol. 2003; 123(1): 177-183. Medline 14510963

Expression of bcl-6 and CD10 protein is associated with longer overall survival and time to treatment failure in follicular lymphoma. Bilalovic N, Blystad AK, Golouh R, Nesland JM, Selak I, Trinh D, Torlakovic E. Am J Clin Pathol. 2004; 121(1): 34-42. Medline 14750238

CD10 protein expression in tumor and stromal cells of malignant melanoma is associated with tumor progression. Bilalovic N, Sandstad B, Golouh R, Nesland JM, Selak I, Torlakovic EE. Mod Pathol. 2004; 17(10): 1251-1258. Medline 15205682

Atlas Genet Cytogenet Oncol Haematol 2007; 4 595

Role of truncating mutations in MME gene in fetomaternal alloimmunisation and antenatal glomerulopathies. Debiec H, Nauta J, Coulet F, van der Burg M, Guigonis V, Schurmans T, de Heer E, Soubrier F, Janssen F, Ronco P. Lancet. 2004; 364(9441): 1252-1259. Medline 15464186

CD10 is a diagnostic and prognostic marker in renal malignancies. Langner C, Ratschek M, Rehak P, Schips L, Zigeuner R. Histopathology. 2004; 45(5): 460-467. Medline 15500649

Anti-amyloid activity of neprilysin in plaque-bearing mouse models of Alzheimer's disease. Mohajeri MH, Kuehnle K, Li H, Poirier R, Tracy J, Nitsch RM. FEBS Lett. 2004; 562(1-3): 16-21. Medline 15043995

CD10 immunohistochemical staining in urothelial neoplasms. Am Murali R, Delprado W. J Clin Pathol. 2005; 124(3): 371-379. Medline 16191505

Overexpression of CD10 and reduced MUC2 expression correlate with the development and progression of colorectal neoplasms. Iwase T, Kushima R, Mukaisho K, Mitsufuji S, Okanoue T, Hattori T. Pathol Res Pract. 2005; 201(2): 83-91. Medline 15901128

Neprylisin (sic) decreases uniformly in Alzheimer's disease and in normal aging. Russo R, Borghi R, Markesbery W, Tabaton M, Piccini A. FEBS Lett. 2005; 579: 6027-6030 Medline 16226260

Neprilysin levels in plasma and synovial fluid of juvenile idiopathic arthritis patients. Simonini G, Azzari C, Gelli AM, Giani T, Calabri GB, Leoncini G, Del Rosso A, Generini S, Cimaz R, Cerinic MM, Falcini F. Rheumatol Int. 2005; 25(5): 336-340. Medline 14997340

CD10+ stromal cells form B-lymphocyte maturation niches in the human bone marrow. Torlakovic E, Tenstad E, Funderud S, Rian E. J Pathol. 2005; 205(3): 311-317. Medline 15682430

CD10 expression in cutaneous adnexal neoplasms and a potential role for differentiating cutaneous metastatic renal cell carcinoma. Bahrami S, Malone JC, Lear S, Martin AW. Arch Pathol Lab Med. 2006; 130(9): 1315-1319. Medline 16948517

CD10 expression in pancreatic endocrine tumors: correlation with prognostic factors and survival. Deschamps L, Handra-Luca A, O'Toole D, Sauvanet A, Ruszniewski P, Belghiti J, Bedossa P,

Atlas Genet Cytogenet Oncol Haematol 2007; 4 596 Couvelard A. Hum Pathol. 2006; 37(7): 802-808. Medline 16784978

Differential expression of CD10 in prostate cancer and its clinical implication. Dall'Era MA, True LD, Siegel AF, Porter MP, Sherertz TM, Liu AY. BMC Urol. 2007; 7: 3. Medline 17335564

Stromal CD10 expression in invasive breast carcinoma correlates with poor prognosis, estrogen receptor negativity, and high grade. Makretsov NA, Hayes M, Carter BA, Dabiri S, Gilks CB, Huntsman DG. Mod Pathol. 2007; 20(1): 84-89. Medline 17143263

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 05-2007 Emina E Torlakovic Department of Pathology, The Norwegian Radium Hospital, University of

Oslo Montebello, Oslo 0310 Norway Citation This paper should be referenced as such : Torlakovic EE . MME (membrane metallo-endopeptidase). Atlas Genet Cytogenet Oncol Haematol. May 2007 . URL : http://AtlasGeneticsOncology.org/Genes/MMEID41386ch3q25.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 597 Atlas of Genetics and Cytogenetics in Oncology and Haematology

GRB2 (Growth factor receptor-bound protein 2) Identity Other names ASH (Abundant Src Homology) Grb3-3 MST084 MSTP084 HTO27 EGFRBP (Epidermal Growth Factor Receptor Binding Protein)-GRB2 Hugo GRB2 Location 17q25.1 Chromosome 17, 87,632 bases, 5'- 70913384 - 70825752 -3'; strand: (-). The human Local_order GRB2 gene is telomeric to GGA3 (Golgi associated, gamma adaptin ear containing, ARF binding protein 3) and centromeric to ITGB4 (integrin, beta 4). DNA/RNA Transcription The GRB2 gene structure consists of five exons (ranging from 78 to 186 bp) and four introns (from approximately 1 to approximately 7 kb). Two human mRNA transcript variants arise from alternative splicing. GRB2 variant 1 mRNA encodes protein isoform 1, which is longer. Variant 2 mRNA, which encodes protein isoform 2, lacks an in- frame exon present in the 3' coding region of variant 1 encompassing residues 59 - 100 of the mature protein (see Protein, below). Pseudogene At least one potential human pseudogene may exist: LOC391157. A pseudogene of the mouse Grb2 homolog, known as Grb2-ps1 (growth factor receptor bound protein 2, pseudogene 1) also has been identified. Protein

A schematic representation of the domain structure of GRB2, which consists of a single Src homology 2 (SH2) domain (residues 59 - 152) flanked by two SH3 domains (amino-terminal: residues 3 - 54; carboxy-terminal: residues 160-212).

Description GRB2 (isoform 1) is a 217 residue protein with an expected molecular mass of 25,206 Da. GRB2 protein has homology to non-catalytic regions of c-Src, consisting of a single Src homology 2 (SH2) domain flanked by two Src homology 3 (SH3) domains. GRB2 isoform 2, encoded by an alternatively spliced mRNA transcript known as variant 2, has a deletion in the amino-terminal portion of the SH2 domain encompassing residues 59 - 100 of isoform 1. This protein isoform, known originally as GRB3-3, does not bind to phosphotyrosyl-containing proteins like isoform 1, but retains two functional SH3 domains. Expression Expressed in virtually all embryonic and adult tissues. Localisation Primarily cytosolic, but transient plasma membrane and nuclear localizations have been reported.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 598 Function Cell surface receptor signaling - The two GRB2 SH3 domains bind to the proline- rich regions of the guanine nucleotide releasing factor son of sevenless (SOS-1) protein, and the GRB2-SOS-1 complex preexists in the cytoplasm of resting cells. Phosphotyrosyl residues on in the context of the motif NH2- pYXNX-COOH (where pY represents phosphotyrosine, N represents asparagine, and X represents any other residue) are selectively recognized by the GRB2 SH2 domain. Growth factor receptor tyrosine kinases (RTKs), including those for epidermal growth factor (EGF), fibroblast growth factor, nerve growth factor (TrkA/TrkB), platelet-derived growth factor, colony- stimulating factor-1, and hepatocyte growth factor (HGF), as well as non-receptor tyrosine kinases (TKs) such as BCR-Abl and focal adhesion kinase (FAK), intracellular effectors such as insulin receptor substrate-1 and Shc, and phosphotyrosine phosphatases such as SHP-2 (PTPN11) and receptor-like tyrosine phosphatase alpha, all conditionally possess the pYXNX motif. Note that the environmental cue leading to protein tyrosyl phosphorylation on an appropriate GRB2 recognition motif is independent of GRB2 interaction; thus, ligand independent EGFR activation, such as growth hormone-induced EGFR tyrosine phosphorylation by JAK2, also leads to GRB2-mediated ERK kinase pathway activation and c-fos expression. Similarly, mechanical stress leading to increased angiotensin II production and transactivation of EGFR and other intracellular kinases implicates GRB2 recruitment in cardiac hypertrophy and myocardial remodeling. In many mitogenic signaling pathways, recruitment of GRB2 from the cytosol, where it is already bound to the guanine nucleotide exchange factor SOS-1 via its amino- terminal SH3 domain, brings SOS1 in close proximity to Ras at the plasma membrane. Ras, a small GTPase in the GDP-bound inactive state in quiescent cells, then undergoes nucleotide exchange of GDP for GTP, which facilitates binding of the serine/threonine protein kinase Raf-1 and its subsequent activation. This initiates a cascade of kinase activation: activated Raf-1 phosphorylates and activates MEK1/MEK2, which in turn phosphorylate and stimulate the MAP kinases ERK1/ERK2. Activated ERKs translocate to the nucleus and phosphorylate transcription factors such as Elk-1, STAT1, STAT3 and Myc, activating gene expression. In parallel, the phosphatidyl inositol 3-kinase (PI3K)/Akt pathway is activated via the adaptor Gab1, which is bound to the GRB2 carboxyl-terminal SH3 domain in many epithelial cell types. The gene expression programs activated by these pathways initiate a spectrum of fundamental cellular activities including proliferation, growth (increase in cell size), differentiation and survival. These processes are critical for normal embryonic development and adult homeostasis, and are frequently aberrantly activated in cancer. Stimulation of the T cell antigen receptor (TCR) induces the tyrosine phosphorylation of a variety of cellular proteins, including a protein called p36-38 or Linker for Activation of T cells (LAT), a protein tightly associated with the plasma membrane. Tyrosyl-phosphorylated sequences of LAT bind to the GRB2 SH2 domain. In these cells the SH3 domains of GRB2 bind Vav-family proteins, guanine nucleotide exchange factors for Rho-family GTPases. These interactions are essential for TCR- induced calcium flux and activation of the MAP kinase cascade, ultimately leading to T cell proliferation and effector functions. Receptor endocytosis and ubiquitinylation - Upon ligand-dependant activation of EGFR TK, c-Cbl binds to the EGFR directly through its SH2 domain and indirectly through its SH3 domain. c-Cbl binding and its consequential phosphorylation results in activation of the E3 ubiquitin ligase complex of which c-Cbl is a component, resulting in receptor ubiquitinylation. GRB2 also regulates internalization of EGF receptors through clathrin-coated pits. Actin-based cell motility - GRB2 participates directly in the regulation of actin filament formation and actin-based cell motility. GRB2 is a critical link between Wiskott-Aldrich Syndrome protein (WASp) and the actin cytoskeleton; WAS patients show defects in T cell polarization and migration in response to physiologic stimuli, resulting in thrombocytopenia, eczema and immunodeficiency. Studies of WASp function and the intracellular motility of invasive microbial pathogens such as Listeria monocytogenes and Vaccinia virus helped to elucidate an important role for GRB2 in directly promoting actin based motility. In most mammalian cells, the WASp family member N-WASp interacts with the Arp2/3 complex and G-actin to stimulate actin

Atlas Genet Cytogenet Oncol Haematol 2007; 4 599 polymerization. N-WASp activity is enhanced by other effectors such as Nck, Cdc42 and GRB2; disruption of GRB2 SH3 or SH2 domains diminishes actin polymerization and thus actin-based motility. Homology GRB2 amino acid sequence is very highly conserved among species. Human GRB2 shows 50% overall amino acid sequence identity with S. cerevisiae YPR154w, 58% identity with Sem-5 of C. elegans, 66% identity with the D. melanogaster homolog Drk and over 99% identity with both rat and mouse homologs. Mutations Note No known naturally-occurring mutations in human GRB2 have been reported. Implicated in Entity Normal embryogenesis Note A null mutation introduced into the mouse gene for Grb2 was used to demonstrate that Grb2 is required during embryogenesis for the differentiation of endodermal cells and epiblast formation. Replacing the carboxy-terminus of SOS-1 with the Grb2 SH2 domain yielded a fusion protein that rescued the defects caused by this Grb2 mutation. Grb2 signaling primarily regulates differentiation, rather than proliferation, in the early mouse embryo.

Entity Cardiac hypertrophy Note Engineered Grb2 +/- mice subjected to cardiac stress failed to activate p38 MAP kinase (MAPK14) and Jun N-terminal kinase (JNK), and the cardiac hypertrophy and fibrosis observed in normal mice were blocked. Transgenic mice with dominant- negative forms of MAPK p38-alpha and p38-beta developed cardiac hypertrophy but were resistant to cardiac fibrosis when subjected to cardiac stress. These and other findings suggest that Grb2 activity is essential for cardiac hypertrophy and fibrosis in response to pressure overload, and that different signaling pathways downstream of Grb2 regulate fibrosis, fetal gene induction, and cardiomyocyte growth.

Entity Cancer Note As a pivotal activator of cell-cycle control and motility pathways downstream of several growth factor receptors, GRB2 is involved in oncogenic signaling in a wide variety of human tumors. For example, GRB2 directly interacts with SOS-1 and the Bcr portion of the Bcr-Abl fusion protein, a tyrosine kinase oncoprotein which has been implicated in the pathogenesis of Philadelphia chromosome positive leukemias, such as CML, ALL, and AML. GRB2 is rate limiting for mammary carcinomas induced by polyomavirus middle T antigen. GRB2 over expression has been reported in human breast, bladder and prostate cancer cell lines. Selective small molecule inhibitors of GRB2 SH2 domain binding block solid tumor metastasis in animal models. External links Nomenclature Hugo GRB2 GDB GRB2 Entrez_Gene GRB2 2885 growth factor receptor-bound protein 2 Cards Atlas GRB2ID386ch17q25 GeneCards GRB2 Ensembl GRB2 Genatlas GRB2 GeneLynx GRB2 eGenome GRB2

Atlas Genet Cytogenet Oncol Haematol 2007; 4 600 euGene 2885 Genomic and cartography GoldenPath GRB2 - 17q25.1 chr17:70825752-70913384 - 17q24-q25 (hg18-Mar_2006) Ensembl GRB2 - 17q24-q25 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene GRB2 Gene and transcription Genbank AA452034 [ ENTREZ ] Genbank AF171699 [ ENTREZ ] Genbank AF246238 [ ENTREZ ] Genbank AF302079 [ ENTREZ ] Genbank AF498925 [ ENTREZ ] RefSeq NM_002086 [ SRS ] NM_002086 [ ENTREZ ] RefSeq NM_203506 [ SRS ] NM_203506 [ ENTREZ ] RefSeq AC_000060 [ SRS ] AC_000060 [ ENTREZ ] RefSeq NC_000017 [ SRS ] NC_000017 [ ENTREZ ] RefSeq NT_010641 [ SRS ] NT_010641 [ ENTREZ ] RefSeq NW_926918 [ SRS ] NW_926918 [ ENTREZ ] AceView GRB2 AceView - NCBI Unigene Hs.699367 [ SRS ] Hs.699367 [ NCBI ] HS699367 [ spliceNest ] Fast-db 14732 Protein : pattern, domain, 3D structure SwissProt P62993 [ SRS] P62993 [ EXPASY ] P62993 [ INTERPRO ] Prosite PS50001 SH2 [ SRS ] PS50001 SH2 [ Expasy ] Prosite PS50002 SH3 [ SRS ] PS50002 SH3 [ Expasy ] Interpro IPR000108 Neu_cyt_fact_2 [ SRS ] IPR000108 Neu_cyt_fact_2 [ EBI ] Interpro IPR000980 SH2 [ SRS ] IPR000980 SH2 [ EBI ] Interpro IPR001452 SH3 [ SRS ] IPR001452 SH3 [ EBI ] CluSTr P62993 Pfam PF00017 SH2 [ SRS ] PF00017 SH2 [ Sanger ] pfam00017 [ NCBI-CDD ] Pfam PF00018 SH3_1 [ SRS ] PF00018 SH3_1 [ Sanger ] pfam00018 [ NCBI-CDD ] Smart SM00252 SH2 [EMBL] Smart SM00326 SH3 [EMBL] Prodom PD000093 SH2[INRA-Toulouse] P62993 GRB2_HUMAN [ Domain structure ] P62993 GRB2_HUMAN [ sequences Prodom sharing at least 1 domain ] Prodom PD000093[INRA-Toulouse] P62993 GRB2_HUMAN [ Domain structure ] P62993 GRB2_HUMAN [ sequences Prodom sharing at least 1 domain ] Blocks P62993 PDB 1AZE [ SRS ] 1AZE [ PdbSum ], 1AZE [ IMB ] 1AZE [ RSDB ] PDB 1BM2 [ SRS ] 1BM2 [ PdbSum ], 1BM2 [ IMB ] 1BM2 [ RSDB ] PDB 1BMB [ SRS ] 1BMB [ PdbSum ], 1BMB [ IMB ] 1BMB [ RSDB ]

Atlas Genet Cytogenet Oncol Haematol 2007; 4 601 PDB 1CJ1 [ SRS ] 1CJ1 [ PdbSum ], 1CJ1 [ IMB ] 1CJ1 [ RSDB ] PDB 1FHS [ SRS ] 1FHS [ PdbSum ], 1FHS [ IMB ] 1FHS [ RSDB ] PDB 1FYR [ SRS ] 1FYR [ PdbSum ], 1FYR [ IMB ] 1FYR [ RSDB ] PDB 1GCQ [ SRS ] 1GCQ [ PdbSum ], 1GCQ [ IMB ] 1GCQ [ RSDB ] PDB 1GFC [ SRS ] 1GFC [ PdbSum ], 1GFC [ IMB ] 1GFC [ RSDB ] PDB 1GFD [ SRS ] 1GFD [ PdbSum ], 1GFD [ IMB ] 1GFD [ RSDB ] PDB 1GHU [ SRS ] 1GHU [ PdbSum ], 1GHU [ IMB ] 1GHU [ RSDB ] PDB 1GRI [ SRS ] 1GRI [ PdbSum ], 1GRI [ IMB ] 1GRI [ RSDB ] PDB 1IO6 [ SRS ] 1IO6 [ PdbSum ], 1IO6 [ IMB ] 1IO6 [ RSDB ] PDB 1JYQ [ SRS ] 1JYQ [ PdbSum ], 1JYQ [ IMB ] 1JYQ [ RSDB ] PDB 1JYR [ SRS ] 1JYR [ PdbSum ], 1JYR [ IMB ] 1JYR [ RSDB ] PDB 1JYU [ SRS ] 1JYU [ PdbSum ], 1JYU [ IMB ] 1JYU [ RSDB ] PDB 1QG1 [ SRS ] 1QG1 [ PdbSum ], 1QG1 [ IMB ] 1QG1 [ RSDB ] PDB 1TZE [ SRS ] 1TZE [ PdbSum ], 1TZE [ IMB ] 1TZE [ RSDB ] PDB 1X0N [ SRS ] 1X0N [ PdbSum ], 1X0N [ IMB ] 1X0N [ RSDB ] PDB 1ZFP [ SRS ] 1ZFP [ PdbSum ], 1ZFP [ IMB ] 1ZFP [ RSDB ] PDB 2AOA [ SRS ] 2AOA [ PdbSum ], 2AOA [ IMB ] 2AOA [ RSDB ] PDB 2AOB [ SRS ] 2AOB [ PdbSum ], 2AOB [ IMB ] 2AOB [ RSDB ] PDB 2H46 [ SRS ] 2H46 [ PdbSum ], 2H46 [ IMB ] 2H46 [ RSDB ] PDB 2HUW [ SRS ] 2HUW [ PdbSum ], 2HUW [ IMB ] 2HUW [ RSDB ] PDB 2HUY [ SRS ] 2HUY [ PdbSum ], 2HUY [ IMB ] 2HUY [ RSDB ] HPRD 00150 Protein Interaction databases DIP P62993 IntAct P62993 Polymorphism : SNP, mutations, diseases OMIM 108355 [ map ] GENECLINICS 108355 SNP GRB2 [dbSNP-NCBI] SNP NM_002086 [SNP-NCI] SNP NM_203506 [SNP-NCI] SNP GRB2 [GeneSNPs - Utah] GRB2] [HGBASE - SRS] HAPMAP GRB2 [HAPMAP] COSMIC GRB2 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD GRB2 General knowledge Family GRB2 [UCSC Family Browser] Browser SOURCE NM_002086 SOURCE NM_203506 SMD Hs.699367 SAGE Hs.699367 GO SH3/SH2 adaptor activity [Amigo] SH3/SH2 adaptor activity GO epidermal growth factor receptor binding [Amigo] epidermal growth factor receptor

Atlas Genet Cytogenet Oncol Haematol 2007; 4 602 binding GO cytosol [Amigo] cytosol epidermal growth factor receptor signaling pathway [Amigo] epidermal growth factor GO receptor signaling pathway GO intracellular signaling cascade [Amigo] intracellular signaling cascade GO Ras protein signal transduction [Amigo] Ras protein signal transduction GO cell-cell signaling [Amigo] cell-cell signaling GO insulin receptor signaling pathway [Amigo] insulin receptor signaling pathway GO insulin receptor substrate binding [Amigo] insulin receptor substrate binding Angiotensin II mediated activation of JNK Pathway via Pyk2 dependent BIOCARTA signaling [Genes] BIOCARTA Calcium Signaling by HBx of Hepatitis B virus [Genes] BIOCARTA TPO Signaling Pathway [Genes] BIOCARTA BCR Signaling Pathway [Genes] BIOCARTA Bioactive Peptide Induced Signaling Pathway [Genes] BIOCARTA CBL mediated ligand-induced downregulation of EGF receptors [Genes] BIOCARTA Transcription factor CREB and its extracellular signals [Genes] BIOCARTA The Co-Stimulatory Signal During T-cell Activation [Genes] BIOCARTA EGF Signaling Pathway [Genes] BIOCARTA EPO Signaling Pathway [Genes] BIOCARTA Role of Erk5 in Neuronal Survival [Genes] BIOCARTA Erk1/Erk2 Mapk Signaling pathway [Genes] BIOCARTA Fc Epsilon Receptor I Signaling in Mast Cells [Genes] BIOCARTA Growth Hormone Signaling Pathway [Genes] BIOCARTA Inhibition of Cellular Proliferation by Gleevec [Genes] BIOCARTA Role of ERBB2 in Signal Transduction and Oncology [Genes] BIOCARTA IGF-1 Signaling Pathway [Genes] Multiple antiapoptotic pathways from IGF-1R signaling lead to BAD BIOCARTA phosphorylation [Genes] BIOCARTA IL 2 signaling pathway [Genes] BIOCARTA IL-2 Receptor Beta Chain in T cell Activation [Genes] BIOCARTA IL 3 signaling pathway [Genes] BIOCARTA IL 4 signaling pathway [Genes] BIOCARTA IL 6 signaling pathway [Genes] BIOCARTA Insulin Signaling Pathway [Genes] BIOCARTA Integrin Signaling Pathway [Genes] BIOCARTA MAPKinase Signaling Pathway [Genes] BIOCARTA Signaling of Hepatocyte Growth Factor Receptor [Genes] BIOCARTA Nerve growth factor pathway (NGF) [Genes] BIOCARTA p38 MAPK Signaling Pathway [Genes] BIOCARTA PDGF Signaling Pathway [Genes] BIOCARTA PTEN dependent cell cycle arrest and apoptosis [Genes] BIOCARTA Links between Pyk2 and Map Kinases [Genes] BIOCARTA Sprouty regulation of tyrosine kinase signals [Genes]

Atlas Genet Cytogenet Oncol Haematol 2007; 4 603 BIOCARTA Activation of Src by Protein-tyrosine phosphatase alpha [Genes] BIOCARTA T Cell Receptor Signaling Pathway [Genes] BIOCARTA Trefoil Factors Initiate Mucosal Healing [Genes] BIOCARTA Trka Receptor Signaling Pathway [Genes] PubGene GRB2 Other databases Other Jackson Laboratory Mouse Genome Informatics Database; MGI: 99843 database Probes Probe GRB2 Related clones (RZPD - Berlin) PubMed PubMed 340 Pubmed reference(s) in LocusLink Bibliography C. elegans cell-signaling gene sem-5 encodes a protein with SH2 and SH3 domains. Clark SG, Stern MJ, Horvitz HR. Nature 1992; 356: 340-344. Medline 1372395

The SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signaling. Lowenstein EJ, Daly RJ, Batzer AG, Li W, Margolis B, Lammers R, Ullrich A, Skolnik EY, Bar-Sagi D, Schlessinger J. Cell 1992; 70: 431-442. Medline 1322798

A Drosophila SH2-SH3 adaptor protein implicated in coupling the sevenless tyrosine kinase to an activator of Ras guanine nucleotide exchange, Sos. Olivier JP, Raabe T, Henkemeyer M, Dickson B, Mbamalu G, Margolis B, Schlessinger J, Hafen E, Pawson T. Cell 1993; 73: 179-191. Medline 8462098

An SH3-SH2-SH3 protein is required for p21Ras1 activation and binds to sevenless and Sos proteins in vitro. Simon MA, Dodson GS, Rubin GM. Cell 1993; 73: 169-177. Medline 8462097

BCR-ABL-induced oncogenesis is mediated by direct interaction with the SH2 domain of the GRB-2 adaptor protein. Pendergast AM, Quilliam LA, Cripe LD, Bassing CH, Dai Z, Li N, Batzer A, Rabun KM, Der CJ, Schlessinger J. Cell 1993; 75: 175-185. Medline 8402896

The human GRB2 and Drosophila Drk genes can functionally replace the Caenorhabditis elegans cell signaling gene sem-5. Stern MJ, Marengere LE, Daly RJ, Lowenstein EJ, Kokel M, Batzer A, Olivier P, Pawson T, Schlessinger J. Mol Biol Cell 1993; 4: 1175-1188. Medline 8305738

Atlas Genet Cytogenet Oncol Haematol 2007; 4 604 Activation of the Ras signalling pathway in human breast cancer cells overexpressing erbB-2. Janes PW, Daly RJ, deFazio A, Sutherland RL. Oncogene 1994; 9: 3601-3608. Medline 7970720

Mutant forms of growth factor-binding protein-2 reverse BCR-ABL-induced transformation. Gishizky ML, Cortez D, Pendergast AM. Proc Natl Acad Sci U S A 1995; 92: 10889-10893. Medline 7479904

Pathways downstream of Shc and Grb2 are required for cell transformation by the tpr-Met oncoprotein. Fixman ED, Fournier TM, Kamikura DM, Naujokas MA, Park M. J Biol Chem 1996; 271: 13116-13122. Medline 8662733

Specific uncoupling of GRB2 from the Met receptor. Differential effects on transformation and motility. Ponzetto C, Zhen Z, Audero E, Maina F, Bardelli A, Basile ML, Giordano S, Narsimhan R, Comoglio P. J Biol Chem 1996; 271: 14119-14123. Medline 8662889

A point mutation in the MET oncogene abrogates metastasis without affecting transformation. Giordano S, Bardelli A, Zhen Z, Menard S, Ponzetto C, Comoglio PM. Proc Natl Acad Sci U S A 1997; 94: 13868-13872. Medline 9391119

Growth hormone-induced tyrosine phosphorylation of EGF receptor as an essential element leading to MAP kinase activation and gene expression. Yamauchi T, Ueki K, Tobe K, Tamemoto H, Sekine N, Wada M, Honjo M, Takahashi M, Takahashi T, Hirai H, Tsushima T, Akanuma Y, Fujita T, Komuro I, Yazaki Y, Kadowaki T. Endocr J 1998; 45 Suppl: 27-31. (REVIEW) Medline 9790226

Mammalian Grb2 regulates multiple steps in embryonic development and malignant transformation. Cheng AM, Saxton TM, Sakai R, Kulkarni S, Mbamalu G, Vogel W, Tortorice CG, Cardiff RD, Cross JC, Muller WJ, Pawson T. Cell 1998; 95: 793-803. Medline 9865697

Concomitant activation of pathways downstream of Grb2 and PI 3-kinase is required for MET- mediated metastasis. Bardelli A, Basile ML, Audero E, Giordano S, Wennstrom S, Menard S, Comoglio PM, Ponzetto C. Oncogene 1999; 18: 1139-1146. Medline 10022119

Ligand-induced ubiquitination of the epidermal growth factor receptor involves the interaction of the c-Cbl RING finger and UbcH7. Yokouchi M, Kondo T, Houghton A, Bartkiewicz M, Horne WC, Zhang H, Yoshimura A, Baron R. J Biol Chem. 1999; 274: 31707-31712. Medline 10531381

The gene structure of the human growth factor bound protein GRB2.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 605 Bochmann H, Gehrisch S, Jaross W. Genomics 1999; 56: 203-207. Medline 10051406

GRB2 Links Signaling to Actin Assembly by Enhancing Interaction of Neural Wiskott-Aldrich Syndrome Protein (N-WASp) with Actin-related Protein (ARP2/3) Complex. Carlier MF, Nioche P, Broutin-L'Hermite I, Boujemaa R, Le Clainche C, Egile C, Garbay C, Ducruix A, Sansonetti P, Pantaloni D. J Biol Chem 2000; 275: 21946-21952. Medline 10781580

Significance of the Grb2 and son of sevenless (Sos) proteins in human bladder cancer cell lines. Watanabe T, Shinohara N, Moriya K, Sazawa A, Kobayashi Y, Ogiso Y, Takiguchi M, Yasuda J, Koyanagi T, Kuzumaki N, Hashimoto A. IUBMB Life 2000; 49: 317-320. Medline 10995035

The role of membrane-associated adaptors in T cell receptor signalling. Zhang W, Samelson LE. Semin Immunol 2000; 12: 35-41. (REVIEW) Medline 10723796

Up-regulation of the protein tyrosine phosphatase SHP-1 in human breast cancer and correlation with GRB2 expression. Yip SS, Crew AJ, Gee JM, Hui R, Blamey RW, Robertson JF, Nicholson RI, Sutherland RL, Daly RJ. Int J Cancer 2000; 88: 363-368. Medline 11054664

Disruption of T cell signaling networks and development by Grb2 haploid insufficiency. Gong Q, Cheng AM, Akk AM, Alberola-Ila J, Gong G, Pawson T, Chan AC. Nat Immunol 2001; 2: 29-36. Medline 11135575

Coordinated traffic of Grb2 and Ras during epidermal growth factor receptor endocytosis visualized in living cells. Jiang X, Sorkin A. Mol Biol Cell 2002; 13: 1522-1535. Medline 12006650

Grb2 and Nck act cooperatively to promote actin-based motility of vaccinia virus. Scaplehorn N, Holmstrom A, Moreau V, Frischknecht F, Reckmann I, Way M. Current Biology 2002; 12: 740-745. Medline 12007418

Use of signal specific receptor tyrosine kinase oncoproteins reveals that pathways downstream from Grb2 or Shc are sufficient for cell transformation and metastasis. Saucier C, Papavasiliou V, Palazzo A, Naujokas MA, Kremer R, Park M. Oncogene 2002; 21: 1800-1811. Medline 11896612

Actin-based motility: from molecules to movement. Carlier MF, Le Clainche C, Wiesner S, Pantaloni D. Bioessays 2003; 25: 336-345. (REVIEW)

Atlas Genet Cytogenet Oncol Haematol 2007; 4 606 Medline 12655641

Met, Metastasis, Motility and More. Birchmeier C, Birchmeier W, Gherardi E, Vande Woude GF. Nature Reviews Molecular Cell Biology 2003; 4: 915-925. (REVIEW) Medline 14685170

The role of the Grb2-p38 MAPK signaling pathway in cardiac hypertrophy and fibrosis. Zhang S, Weinheimer C, Courtois M, Kovacs A, Zhang CE, Cheng AM, Wang Y, Muslin AJ. Journal of Clinical Investigation 2003; 111: 833-841. Medline 12639989

KGF-induced motility of breast cancer cells is dependent on Grb2 and Erk1,2. Zang XP, Siwak DR, Nguyen TX, Tari AM, Pento JT. Clin Exp Metastasis 2004; 21: 437-443. Medline 15672868

Potentiation of signal transduction mitogenesis and cellular proliferation upon binding of receptor-recognized forms of alpha2-macroglobulin to 1-LN prostate cancer cells. Misra UK, Pizzo SV. Cell Signal 2004; 16: 487-496. Medline 14709337

Vav-family proteins in T-cell signalling. Tybulewicz VL. Curr Opin Immunol 2005; 17: 267-274. (REVIEW) Medline 15886116

Molecular targeting of Grb-2 as an anti-cancer strategy. Dharmawardana PG, Peruzzi B, Giubellino A, Bottaro DP. Anti-Cancer Drugs 2006, 17:13-20. (REVIEW) Medline 16317285

Inhibition of tumor metastasis by a Grb-2 SH2 domain binding antagonist. Giubellino A, Gao Y, Medepalli S, Burke TR Jr, Bottaro DP. Cancer Research 2007, In Press.

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 05-2007 Gagani Athauda, Donald P Bottaro Miami Project to Cure Paralysis, Miller School of Medicine, University of Miami, Miami, FL 33136 USA and Urologic Oncology Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health,

Bethesda, MD 20892, USA (GA) ; Urologic Oncology Branch, CCR, NCI, Bldg 10 CRC Rm 1-3961, 10 Center Drive MSC 1107, Bethesda, MD 20892-1107, USA (DPB) Citation This paper should be referenced as such :

Atlas Genet Cytogenet Oncol Haematol 2007; 4 607 Athauda G, Bottaro DP . GRB2 (Growth factor receptor-bound protein 2). Atlas Genet Cytogenet Oncol Haematol. May 2007 . URL : http://AtlasGeneticsOncology.org/Genes/GRB2ID386ch17q25.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 608 Atlas of Genetics and Cytogenetics in Oncology and Haematology

CENTG1 (Centaurin , gamma1) Identity Other names Posphoinositide-3-kinase enhancers (PIKE)-A AGAP-2 GGAP2 KIAA0167 Hugo CENTG1 Location 12q14.1 DNA/RNA

Schematic diagram of the CENTG1 gene. The exon numbers are labeled. Description CENTG1 gene, located on reverse strand, comprises of 18439 bp, which consists of 20 exons and 19 introns. Transcription Transcription of CENTG1 takes place in a telomeric to centromere orientation. Two isoforms, namely PIKE-L (3579) and PIKE-A (3938 bp) were identified. No systematic investigations on the production of the two isoforms have been reported but it is suggested that they were produced through alternative splicing and utilization of transcription initiation site. Transcription of PIKE-L begins at exon 2 through 20. Transcription of PIKE-A utilizes another initiation site which begins at exon 1 through 20. Moreover, exon 15 is skipped during the transcription of PIKE-A. Pseudogene No pseudogene of CENTG1 has been reported. Protein

Schematic diagram of PIKE-A protein. PIKE-A contains a GTPase domain, a pleckstrin homology (PH) domain, an ADP ribosylation factor-GTPase activating protein (Arf- GAP) domain and ankyrin repeats (ANK). Description PIKE-A proteins contains 836 amino acids (about 91kDa). It possesses a GTPase domain (aminoacids 143-300), a pleckstrin homology (PH) domain (aminoacids 343- 552), an ADP ribosylation factor3 GTPase Activating Protein (Arf-GAP) domain (aminoacids 577-695) and ankyrin repeats (ANK) (aminoacids 702-291). PIKE-A could be cleaved at Asp474 and Asp592 during apoptosis. However, phosphorylation of PIKE-A by Fyn at Tyr682 and Tyr774 protects this apoptotic cleavage. Expression PIKE-A mRNA is ubiquitously expressed. Northern blot analysis revealed that the highest expression was found in brain (cerebellum, cerebral cortex, occipital pole, frontal lobe, temporal lobe and putamen) followed by spleen, thymus and periphery blood leukocytes. Detectable amount of PIKE-A mRNA could be found in lung, liver, and small intestine. No signal was detected in heart, placenta, kidney, prostate gland, pancreas, testis, ovary and colon. Localisation PIKE-A localizes in both the cytoplasm and the nucleus in COS-7, NIH3T3 and CRL- 2061 sarcoma cells. In HEK293 cells, PIKE-A exclusively locates in the cytoplasm. Within the NIH3T3 nucleus, PIKE-A resides in the nucleolus.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 609 Function PIKE-A is a GTPase that catalyze the bound GTP to GDP. Its intrinsic GTPase activity is regulated by its C-terminal Arf-GAP domain and PI(3,4,5)P3. In the studies aiming at determining the GTPase activity of various PIKE-A domain in vitro, it was found that the GTPase activity of PIKE-A was dampened when the Arf-GAP domain was absence. Further studies revealed that full-length PIKE-A possessed negligible GTPase activity in the absence of phosphatidylinositol lipid which could be enhanced in the presence of PI(3,4,5)P3. It is suggested that phosphatidylinositol lipids may regulate PIKE-A conformation through its PH domain, leading to the C-terminal Arf- GAP domain accessible to its GTPase domain and accelerating its intrinsic GTPase activity.

PIKE-A is also a physiological interacting partner of protein kinase B (Akt). It was reported that PIKE-A specifically interacted with the regulatory domain and partial catalytic domain of activated Akt thorough its GTPase domain. Moreover, this interaction was guanine nucleotide dependent as the presence of GTPgammaS strongly stimulated their binding. Through interacting with PIKE-A, both basal and growth factor (e.g. EGF) stimulated Akt activity is greatly enhanced. This enhanced Akt activity is not triggered by uplifting PI3-kinase activity as PIKE-A neither interacts with PI3-kinase nor affects its activity. Instead, PIKE-A maintains and initiates Akt activation directly in both U87MG and LN-Z308 cells.

Overexpression of PIKE-A in U87MG glioblastoma cells promotes cell proliferation and enhances its invasion activity by stimulating Akt activity. In contrast, depletion of PIKE- A decreases U87MG viability upon staurosporine treatment via enhancing apoptosis. Homology PIKE-A is a member of gamma subfamily of centaurin GTPase superfamily, which consists of alpha, beta, gamma, and dela subfamilies. Centaurin gamma subfamily has three members which are gamma1 (PIKE-A), gamma2 (CENTG2) and gama3 (CENTG3). PIKE-A shares only about 56% and 47% amino acid identity with CENTG2 and CENTG3. Mutations Germinal No germinal mutation of CENTG1 has been reported. Somatic PIKE-A mutation was observed in bone sarcoma CRL2098 (R182G, V591M and deletion of aa 756-777), neuroblastoma NGP-127 (T232I), glioblastomas M067 (V119A, S666P) and SF188 (A315V, L360E, E431V and N583D). These mutations altered the GTP binding, GTPase activity and cellular localization of PIKE-A. PIKE-A mutant from NGP-127 hydrolyzed GTP into GDP more potently than those from CRL2098, M067 and SF188. On the other hand, GTP binding to PIKE-A is more profound in CRL2098, M067, SF188 mutant than NGP-127 mutant. All PIKE-A mutants showed similar cytoplasmic localization patternin HEK293 cells under basal condition. However, when the cells were stimulated with EGF, those mutants from CRL2098, M067 and NGP-127 aggregated in perinuclear zone. No such aggregation was detected in mutants from SF188 cells. Furthermore, cellular morphological transformation from regular round shape to spindle-shaped refractile morphology was observed in NIH3T3 cells transfected with PIKE-A mutants derived from M067 and SF188 cells. Implicated in Entity Glioblastoma Cytogenetics Chromosome 12q13-q15 is frequently amplified in brain tumors. This chromosomal region contains the MDM2, CDK2 and CENTG1 gene. Subsequent studies revealed CENTG1 was substantially amplified in glioblastoma cell line TP366, LN-Z308 and CRL-2061 genome in addition to a normal CENTG1 on chromosome 12. Further, PIKE-A is markedly amplified as double-minute chromatin bodies in SF-188. This amplification occurs in about 16.7% of primary glioblastoma and 11.1% of glioblastoma cell lines. Oncogenesis In addition to overexpression in glioblastoma TP366, LN-Z308, CRL2061 and SF188 cells, mutation of PIKE-A is observed in M067 and SF188 glioblastoma. Studies using

Atlas Genet Cytogenet Oncol Haematol 2007; 4 610 nontransforming NIH3T3 cells revealed that overexpression of these PIKE-A mutants strongly promoted cell proliferation in an anchorage-independent manner possibly through enhanced Akt activity. In U87MG glioblastoma, which has low PIKE-A expression, overexpression of PIKE-A mutants derived from M067 and SF188 greatly enhanced Akt and ERK phosphorylation, thereby enhancing cell proliferation and invasion, and preventing apoptotic cell death. To be noted PIKE-A is overexpressed in human cancers derived from a great variety of tissues including breast, ovary, colon, stomach, lung, kidney, bladder, vulva, uterus, cervix, rectum, testis and skin. External links Nomenclature Hugo CENTG1 GDB CENTG1 Entrez_Gene CENTG1 116986 centaurin, gamma 1 Cards Atlas CENTG1ID44037ch12q14 GeneCards CENTG1 Ensembl CENTG1 Genatlas CENTG1 GeneLynx CENTG1 eGenome CENTG1 euGene 116986 Genomic and cartography GoldenPath CENTG1 - 12q14.1 chr12:56405262-56422207 - 12q14.1 (hg18-Mar_2006) Ensembl CENTG1 - 12q14.1 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene CENTG1 Gene and transcription Genbank AF384128 [ ENTREZ ] Genbank AF413077 [ ENTREZ ] Genbank AK122827 [ ENTREZ ] Genbank AK292672 [ ENTREZ ] Genbank AY128689 [ ENTREZ ] RefSeq NM_014770 [ SRS ] NM_014770 [ ENTREZ ] RefSeq AC_000055 [ SRS ] AC_000055 [ ENTREZ ] RefSeq NC_000012 [ SRS ] NC_000012 [ ENTREZ ] RefSeq NT_029419 [ SRS ] NT_029419 [ ENTREZ ] RefSeq NW_925395 [ SRS ] NW_925395 [ ENTREZ ] AceView CENTG1 AceView - NCBI Unigene Hs.302435 [ SRS ] Hs.302435 [ NCBI ] HS302435 [ spliceNest ] Fast-db 9500 Protein : pattern, domain, 3D structure SwissProt Q99490 [ SRS] Q99490 [ EXPASY ] Q99490 [ INTERPRO ]

Atlas Genet Cytogenet Oncol Haematol 2007; 4 611 Prosite PS50297 ANK_REP_REGION [ SRS ] PS50297 ANK_REP_REGION [ Expasy ] Prosite PS50088 ANK_REPEAT [ SRS ] PS50088 ANK_REPEAT [ Expasy ] Prosite PS50115 ARFGAP [ SRS ] PS50115 ARFGAP [ Expasy ] Prosite PS50003 PH_DOMAIN [ SRS ] PS50003 PH_DOMAIN [ Expasy ] Interpro IPR002110 ANK [ SRS ] IPR002110 ANK [ EBI ] Interpro IPR001164 ArfGAP [ SRS ] IPR001164 ArfGAP [ EBI ] Interpro IPR013684 Miro-like [ SRS ] IPR013684 Miro-like [ EBI ] Interpro IPR001849 PH [ SRS ] IPR001849 PH [ EBI ] Interpro IPR011993 PH_type [ SRS ] IPR011993 PH_type [ EBI ] Interpro IPR001806 Ras_trnsfrmng [ SRS ] IPR001806 Ras_trnsfrmng [ EBI ] CluSTr Q99490 Pfam PF00023 Ank [ SRS ] PF00023 Ank [ Sanger ] pfam00023 [ NCBI-CDD ] Pfam PF01412 ArfGap [ SRS ] PF01412 ArfGap [ Sanger ] pfam01412 [ NCBI-CDD ] Pfam PF08477 Miro [ SRS ] PF08477 Miro [ Sanger ] pfam08477 [ NCBI-CDD ] Pfam PF00169 PH [ SRS ] PF00169 PH [ Sanger ] pfam00169 [ NCBI-CDD ] Smart SM00248 ANK [EMBL] Smart SM00105 ArfGap [EMBL] Smart SM00233 PH [EMBL] Blocks Q99490 PDB 2BMJ [ SRS ] 2BMJ [ PdbSum ], 2BMJ [ IMB ] 2BMJ [ RSDB ] PDB 2IWR [ SRS ] 2IWR [ PdbSum ], 2IWR [ IMB ] 2IWR [ RSDB ] HPRD 05687 Protein Interaction databases DIP Q99490 IntAct Q99490 Polymorphism : SNP, mutations, diseases OMIM 605476 [ map ] GENECLINICS 605476 SNP CENTG1 [dbSNP-NCBI] SNP NM_014770 [SNP-NCI] SNP CENTG1 [GeneSNPs - Utah] CENTG1] [HGBASE - SRS] HAPMAP CENTG1 [HAPMAP] COSMIC CENTG1 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD CENTG1 General knowledge Family CENTG1 [UCSC Family Browser] Browser SOURCE NM_014770 SMD Hs.302435 SAGE Hs.302435 GO nucleotide binding [Amigo] nucleotide binding GO GTPase activity [Amigo] GTPase activity GO GTPase activator activity [Amigo] GTPase activator activity GO GTP binding [Amigo] GTP binding

Atlas Genet Cytogenet Oncol Haematol 2007; 4 612 GO intracellular [Amigo] intracellular GO nucleus [Amigo] nucleus GO cytoplasm [Amigo] cytoplasm GO signal transduction [Amigo] signal transduction small GTPase mediated signal transduction [Amigo] small GTPase mediated signal GO transduction GO zinc ion binding [Amigo] zinc ion binding GO protein transport [Amigo] protein transport GO regulation of GTPase activity [Amigo] regulation of GTPase activity GO metal ion binding [Amigo] metal ion binding PubGene CENTG1 Other databases Probes Probe CENTG1 Related clones (RZPD - Berlin) PubMed PubMed 20 Pubmed reference(s) in LocusLink Bibliography Prediction of the coding sequences of 40 new genes (KIAA0161-KIAA0200) deduced by analysis of cDNA clones from human cell line KG-1. Nagase T, Seki N, Ishikawa K, Tanaka A, Nomura N. DNA Res 1996; 3: 17-24. Medline 8724849

Transcript mapping in a 46-kb sequenced region at the core of 12q13.3 amplification in human cancers. Elkahloun AG, Krizman DB, Wang Z, Hofmann TA, Roe B, Meltzer PS. Genomics 1997; 42: 295-301. Medline 12640130

GGAPs, a new family of bifunctional GTP-binding and GTPase-activating proteins. Xia C, Ma W, Stafford LJ, Liu C, Gong L, Martin JF, Liu M. Mol Cell Biol 2003; 23: 2476-2488. Medline 12640130

PIKE-A is amplified in human cancers and prevents apoptosis by up-regulating Akt. Ahn JY, Hu Y, Kroll TG, Allard P, Ye K. Proc Natl Acad Sci USA 2004; 101: 6993-6998. Medline 15118108

PIKE (phosphatidylinositol 3-kinase enhancer)-A GTPase stimulates Akt activity and mediates cellular invasion. Ahn JY, Rong R, Kroll TG, Van Meir EG, Snyder SH, Ye K. J Biol Chem 2004; 279: 16441-16451. Medline 14761976

Phosphoinositol lipids bind to phosphatidylinositol 3 (PI3)-kinase enhancer GTPase and mediates its stimulatory effect on PI3-kinase and Akt signalings. Hu Y, Liu Z, Ye K. Proc Natl Acad Sci USA 2005; 102: 16853-16858. Medline 16263930

Atlas Genet Cytogenet Oncol Haematol 2007; 4 613

Genetic alteration and expression of the phosphoinositol-3-kinase/Akt pathway genes PIK3CA and PIKE in human glioblastomas. Knobbe CB, Trampe-Kieslich A, Reifenberger G. Neuropath Appl Neurobiol 2005; 31: 486-490. Medline 16150119

Src-family tyrosine kinase Fyn phosphrylates phosphatidylinositol 3-kinase enhancer activating Akt, preventing its apoptotic cleavage and promoting cell survival. Tang X, Feng Y, Ye K. Cell Death Differ 2006; 14: 368-377. Medline 16841086

PIKE tyrosine phosphorylation regulates its apoptotic cleavage during programmed cell death. Tang X, Ye K. Advan Enzyme Regul 2006; 46: 289-300. Medline 16854451

PIKE-A is a proto-oncogene promoting cell growth, transformation and invasion. Liu X, Hu Y, Hao C, Rempel SA, Ye K. Oncogene 2007; in press Medline 17297440

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 05-2007 Chan Chi Bun, Ye Keqiang Department of Pathology and Laboratory Medicine, Emory University

School of Medicine, Atlanta, USA Citation This paper should be referenced as such : Chi Bun C, Keqiang Y . CENTG1 (Centaurin , gamma1). Atlas Genet Cytogenet Oncol Haematol. May 2007 . URL : http://AtlasGeneticsOncology.org/Genes/CENTG1ID44037ch12q14.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 614 Atlas of Genetics and Cytogenetics in Oncology and Haematology

CARD8 (caspase recruitment domain family, member 8) Identity Other names CARDINAL DACAR DKFZp779L0366 KIAA0955 MGC57162 NDPP1 TUCAN Hugo CARD8 Location 19q13.32 DNA/RNA Description The CARD8 gene contains 13 exons spanning over approximately 30 kb of genomic DNA Transcription At least 5 transcripts have been identified generated by alternative splicing that together with different start codon usage yield different CARD8 isoforms. Gene products encoded by exons 1 to 13 and 5 to 13 yield TUCAN/CARD8-54-kDa and TUCAN/CARD8-48-kDa, respectively. Protein

Schematic representation of two CARD8 variants. The CARD domain, the NAC/DEFCAP/CARD7 homology domain, and the amino-terminal residues that differ between the isoforms are indicated. Description The CARD8 gene encodes different CARD8 isoforms that contain the caspase- associated recruitment domain (CARD) in their carboxy-termini that acts as a protein- protein interaction interface. A 431 amino acids CARD8 protein of 48-kDa (TUCAN-48) has been best studied and more recently a 54-kDa isoform (TUCAN-54, 487 amino acids) was identified sharing the same CARD motif but with a different stretch of 80 amino-terminal residues. In the amino terminal part of the protein a NAC/DEFCAP/CARD7 homology domain is present. Expression Normal tissue: wide and differential expression at mRNA level in tissues; present in heart, brain, lung, muscle, spleen, ovary; high in kidney, testis and spinal cord; absent in liver. Cancer: the CARD8 (48 kDa) protein is differentially expressed in cancer. High levels of CARD8 expression were found in tumor cell lines, including breast, prostate, ovarian and colon cancer cells as well as high expression in non-small cell lung cancer (NSCLC) cells and with hardly detectable expression in normal lung, in contrast to a lack of expression in small-cell lung cancer cell lines. In tumor specimens from patients CARD8 expression has been demonstrated in colon cancer and non-small cell lung cancer. The 54-kDa CARD8 isoform has a different expression profile when compared to TUCAN/CARD8-48. For example a number of breast cancer cell lines do

Atlas Genet Cytogenet Oncol Haematol 2007; 4 615 not express TUCAN/CARD8-54, although some of them express TUCAN/CARD8-48. Expression also varies widely among different tumor cell lines with high levels in colon cancer cells. Localisation In MCF-7 cells overexpressed CARD8 localized to both the cytoplasmic and nuclear compartment. In specimens derived from colon cancer cells a predominant cytoplasmic expression was found, whereas in NSCLC tumor samples CARD8 was either exclusively nuclear or cytoplasmic or present in both compartments. Function CARD8 belongs to the CARD family of proteins that play a role in apoptosis regulation and NF-kB signaling associated with the innate or adaptive immune response. For example the binding of CARDs present in caspase-9 and Apaf-1 mediate the assembly of the apoptosome in which caspase-9 is activated. CARD motifs have different binding selectivity towards each other and the presence of additional structural/ functional domains in the various CARD-containing proteins may also determine the choice of interaction partner. In literature there is some controversy on the function of CARD8. Some reports mention an apoptosis inhibitory function of CARD8 involving its CARD-dependent binding to procaspase-9, whereas others did not find an association between CARD8 and caspase-9 and instead found either pro-apoptotic activity of CARD8 and associations with the inflammatory caspase-1 or the regulatory subunit of IkB kinase (NEMO) thereby suppressing NF-kB activation. Also an interaction between the p53- responsive gene DRAL (FLH2) and CARD8 has been reported resulting in the suppression of NF-kB activation. Furthermore, TUCAN/CARD8-54 was found to inhibit chemotherapy-induced caspase-9 activation and Fas ligand-induced caspase-8 activation. Based mainly on its proposed anti-apoptotic activity CARD8 is considered as a possible therapeutic target for cancer. Homology CARD family proteins. Mutations Somatic Ten single nucleotide polymorphisms (SNPs) across TUCAN/CARD8 have been identified in healthy persons and patients suffering from inflammatory bowl disease. Implicated in Entity Colon cancer Prognosis TUCAN/CARD8 expression has been analyzed by immunohistochemistry in paraffin- embedded colon cancer specimens (N=102) derived from patients with clinical stage II that were surgically treated. TUCAN/CARD8 staining was stronger in colon cancer cells when compared to normal cells in 64% of the 102 specimens examined. Scoring staining intensity revealed a significant correlation between high TUCAN/CARD8 expression in tumor cells and shorter patient survival. Entity Non-small cell lung cancer (NSCLC) Prognosis The expression of TUCAN/CARD8 has been determined by immunohistochemistry in tumor specimens derived from NSCLC patients (N=49, stage III and IV) that received neoadjuvant or palliative chemotherapy. TUCAN/CARD8 expression was detected in 69% of the samples, showing exclusively cytoplasmic (27%) or nuclear (11%) staining, or in both compartments (31%). No correlation between response to chemotherapy or expression/ localization was found, although, cytoplasm-only staining NSCLC samples predicted shorter survival, suggesting a possible prognostic value. Entity Inflammatory bowel disease (IBD) Disease Crohn¹s disease and ulcerative colitis Prognosis Patients with IBD (Crohn¹s disease (CD) and ulcerative colitis) and healthy individuals were genotyped for SNP. A significant association between a TUCAN SNP and CD was found. However, in other reports this association was not confirmed, rejecting TUCAN/CARD8 as a possible susceptibility gene for IBD. External links Nomenclature

Atlas Genet Cytogenet Oncol Haematol 2007; 4 616 Hugo CARD8 GDB CARD8 Entrez_Gene CARD8 22900 caspase recruitment domain family, member 8 Cards Atlas CARD8ID913ch19q13 GeneCards CARD8 Ensembl CARD8 Genatlas CARD8 GeneLynx CARD8 eGenome CARD8 euGene 22900 Genomic and cartography GoldenPath CARD8 - 19q13.32 chr19:53403325-53444734 - 19q13.32 (hg18-Mar_2006) Ensembl CARD8 - 19q13.32 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene CARD8 Gene and transcription Genbank AB023172 [ ENTREZ ] Genbank AF143869 [ ENTREZ ] Genbank AF322184 [ ENTREZ ] Genbank AF331519 [ ENTREZ ] Genbank AF405558 [ ENTREZ ] RefSeq NM_014959 [ SRS ] NM_014959 [ ENTREZ ] RefSeq AC_000062 [ SRS ] AC_000062 [ ENTREZ ] RefSeq NC_000019 [ SRS ] NC_000019 [ ENTREZ ] RefSeq NT_011109 [ SRS ] NT_011109 [ ENTREZ ] RefSeq NW_927240 [ SRS ] NW_927240 [ ENTREZ ] AceView CARD8 AceView - NCBI Unigene Hs.655940 [ SRS ] Hs.655940 [ NCBI ] HS655940 [ spliceNest ] Fast-db 13866 Protein : pattern, domain, 3D structure SwissProt Q4G0N6 [ SRS] Q4G0N6 [ EXPASY ] Q4G0N6 [ INTERPRO ] Prosite PS50209 CARD [ SRS ] PS50209 CARD [ Expasy ] Interpro IPR001315 CARD [ SRS ] IPR001315 CARD [ EBI ] Interpro IPR011029 DEATH_like [ SRS ] IPR011029 DEATH_like [ EBI ] CluSTr Q4G0N6 Pfam PF00619 CARD [ SRS ] PF00619 CARD [ Sanger ] pfam00619 [ NCBI-CDD ] Smart SM00114 CARD [EMBL] Blocks Q4G0N6 HPRD 16425 Protein Interaction databases DIP Q4G0N6

Atlas Genet Cytogenet Oncol Haematol 2007; 4 617 IntAct Q4G0N6 Polymorphism : SNP, mutations, diseases OMIM 609051 [ map ] GENECLINICS 609051 SNP CARD8 [dbSNP-NCBI] SNP NM_014959 [SNP-NCI] SNP CARD8 [GeneSNPs - Utah] CARD8] [HGBASE - SRS] HAPMAP CARD8 [HAPMAP] COSMIC CARD8 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD CARD8 General knowledge Family CARD8 [UCSC Family Browser] Browser SOURCE NM_014959 SMD Hs.655940 SAGE Hs.655940 GO protein binding [Amigo] protein binding GO protein binding [Amigo] protein binding GO intracellular [Amigo] intracellular GO nucleus [Amigo] nucleus GO cytoplasm [Amigo] cytoplasm GO caspase activator activity [Amigo] caspase activator activity GO NACHT domain binding [Amigo] NACHT domain binding GO protein homodimerization activity [Amigo] protein homodimerization activity GO regulation of apoptosis [Amigo] regulation of apoptosis negative regulation of I-kappaB kinase/NF-kappaB cascade [Amigo] negative GO regulation of I-kappaB kinase/NF-kappaB cascade GO positive regulation of caspase activity [Amigo] positive regulation of caspase activity positive regulation of interleukin-1 beta secretion [Amigo] positive regulation of GO interleukin-1 beta secretion PubGene CARD8 Other databases Probes Probe CARD8 Related clones (RZPD - Berlin) PubMed PubMed 13 Pubmed reference(s) in LocusLink Bibliography CARDINAL, a novel caspase recruitment domain protein, is an inhibitor of multiple NF-kappa B activation pathways. Bouchier-Hayes L, Conroy H, Egan H, Adrain C, Creagh EM, MacFarlane M, Martin SJ. J Biol Chem 2001; 276: 44069-44077. Medline 11551959

TUCAN, an antiapoptotic caspase-associated recruitment domain family protein overexpressed in cancer. Pathan N, Marusawa H, Krajewska M, Matsuzawa S, Kim H, Okada K, Torii S Kitada S, Krajewski S,

Atlas Genet Cytogenet Oncol Haematol 2007; 4 618 Welsh K, Pio F, Godzik A, Reed JC. J Biol Chem 2001; 276: 32220-32229. Medline 11408476

CARD games in apoptosis and immunity. Bouchier-Hayes L, Martin SJ. EMBO Rep 2002; 3: 616-621. (REVIEW) Medline 12101092

TUCAN /CARDINAL and DRAL participate in a common pathway for modulation of NF-kappaB activation. Stilo R, Leonardi A, Formisano L, Di Jeso B, Vito P, Liguoro D. FEBS Lett 2002; 521: 165-179. Medline 12067710

NDPP1 is a novel CARD domain containing protein which can inhibit apoptosis and suppress NF-kB activation. Zhang H, Fu W. Int J Oncol 2002; 20: 1035-1040. Medline 11956601

CARD-8 protein, a new CARD family member that regulates caspase-1 activation and apoptosis. Razmara M, Srinivasula SM, Wang L, Poyet JL, Geddes, DiStefano PS, Bertin J, Alnemri ES. J Biol Chem 2003; 277: 13952-13968. Medline 11821383

CARD proteins as therapeutic targets in cancer. Damiano JS, Reed JC. Curr Drug Targets 2004; 5: 367-374. (REVIEW) Medline 15134219

A novel isoform of TUCAN is overexpressed in human cancer tissues and suppresses both caspase-8- and caspase-9-mediated apoptosis. Yamamoto M, Torigoe T, Kamiguchi K, Hirohashi Y, Nakanishi K, Nabeta C, Asanuma H, Tsuruma T, Sato T, Hata F, Ohmura T, Yamaguchi K, Kurotaki T, Hirata K, Sato N. Cancer Res 2005; 65: 8706-8714. Medline 16204039

TUCAN/CARDINAL/CARD8 and apoptosis resistance in non-small cell lung cancer cells. Checinska A, Giaccone G, Hoogeland BS, Ferreira CG, Rodriguez JA, Kruyt FA. BMC Cancer 2006; 6: 166. Medline 16796750

The expression of TUCAN, an inhibitor of apoptosis protein, in patients with advanced non- small cell lung cancer treated with chemotherapy. Checinska A, Oudejans JJ, Span SW, Rodriguez JA, Kruyt FA, Giaccone G. Anticancer Res 2006; 26: 3819-3824. Medline 17094407

TUCAN (CARD8) genetic variants and inflammatory bowel disease. McGovern DP, Butler H, Ahmad T, Paolucci M, van Heel DA, Negoro K, Hysi P, Ragoussis J, Travis SP, Cardon LR, Jewell DP. Gastroenterology 2006; 131: 1190-1196.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 619 Medline 17030188

Combined Evidence From Three Large British Association Studies Rejects TUCAN/CARD8 as an IBD Susceptibility Gene. Fisher SA, Mirza MM, Onnie CM, Soars D, Lewis CM, Prescott NJ, Mathew CG, Sanderson J, Forbes A, Todhunter C, Donaldson P, Mansfield J. Gastroenterology 2007; 132: 2078-2080. Medline 17484911

No Association Between the TUCAN (CARD8) Cys10Stop Mutation and Inflammatory Bowel Disease in a Large Retrospective German and a Clinically Well-Characterized Norwegian Sample. Franke A, Rosenstiel P, Balschun T, Von Kampen O, Schreiber S, Sina C, Hampe J, Karlsen TH, Vatn MH; The IBSEN Study Group; Solberg C. Gastroenterology 2007; 132: 2080. Medline 17484912

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 05-2007 Frank A. Kruyt Citation This paper should be referenced as such : Kruyt FA . CARD8 (caspase recruitment domain family, member 8). Atlas Genet Cytogenet Oncol Haematol. May 2007 . URL : http://AtlasGeneticsOncology.org/Genes/CARD8ID913ch19q13.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 620 Atlas of Genetics and Cytogenetics in Oncology and Haematology

ARHGEF2 (rho/rac guanine nucleotide exchange factor (GEF) 2) Identity Other names DKFZp547L106 DKFZp547P1516 GEF GEF-H1 GEFH1 KIAA0651 LFP40 P40 Hugo ARHGEF2 Location 1q22 DNA/RNA Note Cloning of human ARHGEF2/GEF-H1 from HELA cells. Cloning and characterization of murine (Lfc) and canine (cGEF-H1) rho/rac guanine nucleotide exchange factors homologues to ARHGEF2/GEF-H1. Transcription 4093 bp mRNA; 2877 bp open reading frame Protein

A schematics representing the domain structure of full length ARHGEF2/GEF-H1 Description The gene encodes a guanine nucleotide exchange factor for Rho GTPase; 985 amino acids; NH2- Protein kinase C conserved region 1 (zinc finger motif), Dbl-homologous domain (DH domain), pleckstrin homology (PH) domain - coiled coil c-terminus domain -COOH. Expression Wide (cochlea, bone marrow, lymph, blood, lung, ovary, cranial nerve, lymph node, colon, spleen, kidney, muscle, eye, bone, cervix, nerve, adrenal gland, heart, skin, thyroid, uterus, testis, pancreas, brain, mouth, stomach, thymus, pharynx, prostate, vascular, mammary gland, placenta). Localisation Microtubules Function ARHGEF2/GEF-H1 belongs to a Dbl family of Rho activators and exhibits Rho-specific GDP/GTP exchange activity for RhoA but not for Rac1 or Cdc42. ARHGEF2/GEF-H1 activity is downregulated by interaction of its C-terminus with microtubules. Therefore, ARHGEF2/GEF-H1 links changes in microtubule integrity to Rho-dependent regulation of the actin cytoskeleton. Activated RhoA transduces various signals into downstream signaling cascades, such as cytoskeleton reorganization, cellular invasion, and cell proliferation, all of which contribute to cancer progression. Like other RhoGEF Dbl members, ARHGEF2/GEF-H1 possesses the Dbl-homology (DH) domain responsible for its GEF activity the pleckstrin-homology (PH) domain, adjacent and C-terminal to the DH domain. In addition, ARHGEF2/GEF-H1 also contains a cysteine-rich zinc finger-like motif at its amino terminus and a proline-rich coiled coil domain at its carboxy terminus. The N- and C-terminal motifs mediate microtubule localization of ARHGEF2/GEF-H1.Pointmutated(cys53toarg)inazinc

Atlas Genet Cytogenet Oncol Haematol 2007; 4 621 finger-like motif, as well as N- and C-terminally truncated ARHGEF2/GEF-H1 proteins are loosing ability to bind microtubules. These truncated forms have no affect on microtubule stability, and displaying even higher GEF activity then microtubule-bound forms. The coiled coil domain at C-terminus may interact with SH3 domain-containing proteins and has a potential binding site for 14-3-3 proteins. The ser885 within the 14- 3-3-binding site is a phosphorylation site for p21-activated kinase 1 (PAK1), an effector of RAC and CDC42 GTPases. The phosphorylation of ARHGEF2/GEFH1 by PAK may coordinate Rac/Cdc42- and Rho-dependent signaling pathways. Homology The high level of homology has been shown for three known rho/rac guanine nucleotide exchange factors originated from human, mouse and dog. Implicated in Entity gastrointestinal mesenchymal malignancies Disease Microarray analysis identified ARHGEF2/GEF-H1 as one of response markers for a treatment of gastrointestinal stromal tumors, implicating its role in the development of gastrointestinal mesenchymal malignancies. Oncogenesis A cell line transformed by ARHGEF2/GEF-H1 transfection can induce tumor development after injection into nude mice. The increased ARHGEF2/GEF-H1 expression was found contributing to the tumor progression phenotype associated with the p53 mutation. External links Nomenclature Hugo ARHGEF2 GDB ARHGEF2 Entrez_Gene ARHGEF2 9181 rho/rac guanine nucleotide exchange factor (GEF) 2 Cards Atlas ARHGEF2ID43150ch1q22 GeneCards ARHGEF2 Ensembl ARHGEF2 Genatlas ARHGEF2 GeneLynx ARHGEF2 eGenome ARHGEF2 euGene 9181 Genomic and cartography GoldenPath ARHGEF2 - 1q22 chr1:154183270-154214575 - 1q21-q22 (hg18-Mar_2006) Ensembl ARHGEF2 - 1q21-q22 [CytoView] NCBI Mapview OMIM Disease map [OMIM] HomoloGene ARHGEF2 Gene and transcription Genbank AB014551 [ ENTREZ ] Genbank AF486838 [ ENTREZ ] Genbank AL512715 [ ENTREZ ] Genbank AL832538 [ ENTREZ ] Genbank AM393305 [ ENTREZ ] RefSeq NM_004723 [ SRS ] NM_004723 [ ENTREZ ] RefSeq AC_000044 [ SRS ] AC_000044 [ ENTREZ ] RefSeq NC_000001 [ SRS ] NC_000001 [ ENTREZ ]

Atlas Genet Cytogenet Oncol Haematol 2007; 4 622 RefSeq NT_004487 [ SRS ] NT_004487 [ ENTREZ ] RefSeq NW_925683 [ SRS ] NW_925683 [ ENTREZ ] AceView ARHGEF2 AceView - NCBI Unigene Hs.655209 [ SRS ] Hs.655209 [ NCBI ] HS655209 [ spliceNest ] Fast-db 17384 Protein : pattern, domain, 3D structure SwissProt Q5VY92 [ SRS] Q5VY92 [ EXPASY ] Q5VY92 [ INTERPRO ] Prosite PS50010 DH_2 [ SRS ] PS50010 DH_2 [ Expasy ] Prosite PS50003 PH_DOMAIN [ SRS ] PS50003 PH_DOMAIN [ Expasy ] Prosite PS00479 ZF_DAG_PE_1 [ SRS ] PS00479 ZF_DAG_PE_1 [ Expasy ] Prosite PS50081 ZF_DAG_PE_2 [ SRS ] PS50081 ZF_DAG_PE_2 [ Expasy ] Interpro IPR002219 DAG_PE_bd [ SRS ] IPR002219 DAG_PE_bd [ EBI ] Interpro IPR001849 PH [ SRS ] IPR001849 PH [ EBI ] Interpro IPR011993 PH_type [ SRS ] IPR011993 PH_type [ EBI ] Interpro IPR000219 RhoGEF [ SRS ] IPR000219 RhoGEF [ EBI ] CluSTr Q5VY92 Pfam PF00130 C1_1 [ SRS ] PF00130 C1_1 [ Sanger ] pfam00130 [ NCBI-CDD ] Pfam PF00169 PH [ SRS ] PF00169 PH [ Sanger ] pfam00169 [ NCBI-CDD ] Pfam PF00621 RhoGEF [ SRS ] PF00621 RhoGEF [ Sanger ] pfam00621 [ NCBI-CDD ] Smart SM00109 C1 [EMBL] Smart SM00233 PH [EMBL] Smart SM00325 RhoGEF [EMBL] Blocks Q5VY92 HPRD 10458 Protein Interaction databases DIP Q5VY92 IntAct Q5VY92 Polymorphism : SNP, mutations, diseases OMIM 607560 [ map ] GENECLINICS 607560 SNP ARHGEF2 [dbSNP-NCBI] SNP NM_004723 [SNP-NCI] SNP ARHGEF2 [GeneSNPs - Utah] ARHGEF2] [HGBASE - SRS] HAPMAP ARHGEF2 [HAPMAP] COSMIC ARHGEF2 [Somatic mutation (COSMIC-CGP-Sanger)] HGMD ARHGEF2 General knowledge Family ARHGEF2 [UCSC Family Browser] Browser SOURCE NM_004723 SMD Hs.655209 SAGE Hs.655209 GO cell morphogenesis [Amigo] cell morphogenesis GO cell morphogenesis [Amigo] cell morphogenesis

Atlas Genet Cytogenet Oncol Haematol 2007; 4 623 Rho guanyl-nucleotide exchange factor activity [Amigo] Rho guanyl-nucleotide GO exchange factor activity GO intracellular [Amigo] intracellular GO microtubule [Amigo] microtubule GO microtubule [Amigo] microtubule GO intracellular protein transport [Amigo] intracellular protein transport GO actin filament organization [Amigo] actin filament organization GO actin filament organization [Amigo] actin filament organization negative regulation of microtubule depolymerization [Amigo] negative regulation of GO microtubule depolymerization negative regulation of microtubule depolymerization [Amigo] negative regulation of GO microtubule depolymerization GO intracellular signaling cascade [Amigo] intracellular signaling cascade GO microtubule binding [Amigo] microtubule binding GO microtubule binding [Amigo] microtubule binding GO zinc ion binding [Amigo] zinc ion binding GO zinc ion binding [Amigo] zinc ion binding Rac guanyl-nucleotide exchange factor activity [Amigo] Rac guanyl-nucleotide GO exchange factor activity Rac guanyl-nucleotide exchange factor activity [Amigo] Rac guanyl-nucleotide GO exchange factor activity regulation of Rho protein signal transduction [Amigo] regulation of Rho protein signal GO transduction regulation of Rho protein signal transduction [Amigo] regulation of Rho protein signal GO transduction GO regulation of cell proliferation [Amigo] regulation of cell proliferation GO metal ion binding [Amigo] metal ion binding GO Rac GTPase binding [Amigo] Rac GTPase binding GO Rac GTPase binding [Amigo] Rac GTPase binding PubGene ARHGEF2 Other databases Probes Probe ARHGEF2 Related clones (RZPD - Berlin) PubMed PubMed 24 Pubmed reference(s) in LocusLink Bibliography Cloning and characterization of GEF-H1, a microtubule-associated guanine nucleotide exchange factor for Rac and Rho GTPases. Ren Y, Li R, Zheng Y, Busch H. J Biol Chem. 1998; 273(52): 34954-34960. Medline 9857026

The Dbl-related protein, Lfc, localizes to microtubules and mediates the activation of Rac signaling pathways in cells. Glaven JA, Whitehead I, Bagrodia S, Kay R, Cerione RA. J Biol Chem. 1999; 274(4): 2279-2285. Medline 9890991

Atlas Genet Cytogenet Oncol Haematol 2007; 4 624 Nucleotide exchange factor GEF-H1 mediates cross-talk between microtubules and the actin cytoskeleton. Krendel M, Zenke FT, Bokoch GM. Nat Cell Biol. 2002; 4(4): 294-301. Medline 11912491

Identification of a tight junction-associated guanine nucleotide exchange factor that activates Rho and regulates paracellular permeability. Benais-Pont G, Punn A, Flores-Maldonado C, Eckert J, Raposo G, Fleming TP, Cereijido M, Balda MS, Matter K. J Cell Biol. 2003; 160(5): 729-740. Medline 12604587 p21-activated kinase 1 phosphorylates and regulates 14-3-3 binding to GEF-H1, a microtubule- localized Rho exchange factor. Zenke FT, Krendel M, DerMardirossian C, King CC, Bohl BP, Bokoch GM. J Biol Chem. 2004; 279(18): 18392-18400. Medline 14970201

Activation of gef-h1, a guanine nucleotide exchange factor for RhoA, by DNA transfection. Brecht M, Steenvoorden AC, Collard JG, Luf S, Erz D, Bartram CR, Janssen JW. Int J Cancer. 2005; 113(4): 533-540. Medline 15455375

Mutant p53 induces the GEF-H1 oncogene, a guanine nucleotide exchange factor-H1 for RhoA, resulting in accelerated cell proliferation in tumor cells. Mizuarai S, Yamanaka K, Kotani H. Cancer Res. 2006; 66(12): 6319-6326. Medline 16778209

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

BiblioGene - INIST Search in all EBI NCBI

Contributor(s) Written 05-2007 Valery Poroyko, Anna Birukova The University of Chicago, Department of Medicine, Section of Pulmonary and Critical Care, 929 E. 57th Street, GCIS Bldg, Office W410, Chicago, IL 60637. USA Citation This paper should be referenced as such : Poroyko V, Birukova A . ARHGEF2 (rho/rac guanine nucleotide exchange factor (GEF) 2). Atlas Genet Cytogenet Oncol Haematol. May 2007 . URL : http://AtlasGeneticsOncology.org/Genes/ARHGEF2ID43150ch1q22.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 625

Atlas of Genetics and Cytogenetics in Oncology and Haematology

t(7;9)(q11;p13) Identity

t(7;9)(q11;p13) RHG-banding (Courtesy Nicole Dastugue). Clinics and Pathology Disease B-cell acute lymphoblastic leukemia (B-ALL) Phenotype / cell stem Pre-B3 phenotype (CD10+ Cmu+) and pre-B2 phenotype (CD10+ Cmu-) origin Treatment GRAAL 2003 trial and LALA94 trial Evolution Relapse post allograft for both patients Prognosis Poor (16 months survival for both patients) Cytogenetics Probes BAC probes: RP11-243F8 for PAX5 and CTD-2278A11 for ELN Additional del(9)(p11p13) in 1 of 2 cases but without PAX5 deletion anomalies Genes involved and Proteins Gene Name PAX5 Location 9p13 The PAX5 locus spans approximately 200kb. PAX5 contains 10 exons and two distinct promoters resulting in two alternative 5' exons (1a and 1b). PAX5b is transcribed in the Dna / Rna central nervous system and testis as well as in the B lymphoid lineage. PAX5a, also named B-cell specific activator protein (BSAP), is specifically transcribed in the B lymphoid lineage. Protein PAX5 is a member of the highly conserved paired box (PAX)-domain family of transcription factors. The PAX5 plays an important role in cell differentiation and in embryonic development. PAX5 is expressed from early stages of B-cell development up to mature B-cells and is down-regulated during terminal differentiation into plasma cells. PAX5 contains a paired box domain (DNA binding domain), a conserved octapeptide motif and a partial homeodomain. Its C-terminal region contains a transcriptional activation domain and the extreme C-terminal region acts as a

Atlas Genet Cytogenet Oncol Haematol 2007; 4 626 repression domain. Gene Name ELN Location 7q11 Dna / Rna ELN locus spans approximately 40kb and contains 33 exons. Protein ELN is a 72-kDa insoluble extracellular matrix protein. Result of the chromosomal anomaly Hybrid gene 5¹PAX5-3¹ELN, PAX5 exon 7 is fused in frame with ELN exon 2. Description Transcript The same PAX5-ELN transcript was amplified for both patients. Of note, the two alternative transcripts PAX5a-ELN and PAX5b-ELN were presents. The reciprocal ELN-PAX5 fusion transcript could not be amplified. Detection The fusion transcript can be detected by RT-PCR using the 5' PAX5 sense primer: 5'- CCCTGTCCATTCCATCAAGTCCTG-3¹and the 3' ELN antisense primer 5¹- ATGAGGTCGTGAGTCAGGGGTC-3¹. Fusion Protein

Schematic representation of PAX5-ELN chimera. (A) Sequence of the in-frame fusion between exon 7 of PAX5 and exon 2 of ELN. (B) Structure of PAX5, PAX5-ELN and ELN proteins. PBD, Paired box domain; OCT, octapeptide; NLS, nuclear localization sequence; TD, transactivation domain; RD, repressor domain.

Description The PAX5-ELN fusion protein conserves the DNA binding domain of PAX5 and its NLS, but looses its transactivation and repression domain. The quasi entire sequence of ELN is preserved without its signal peptide. Oncogenesis PAX5-ELN acts as a dominant negative on wild-type PAX5 in in vitro experiments that could explain the blockade of differentiation in leukemic cells. External links Other t(7;9)(q11;p13) Mitelman database (CGAP - NCBI) database Other t(7;9)(q11;p13) CancerChromosomes (NCBI) database To be noted Additional cases are needed to delineate the epidemiology of this rare entity: you are welcome to submit a paper to our new Case Report section. Bibliography

Atlas Genet Cytogenet Oncol Haematol 2007; 4 627 A novel PAX5-ELN fusion protein identified in B-cell acute lymphoblastic leukemia acts as a dominant negative on wild-type PAX5. Bousquet M, Broccardo C, Quelen C, Meggetto F, Kuhlein E, Delsol G, Dastugue N Brousset P. Blood 2007; 109(8): 3417-3423. Medline 17179230

Contributor(s) Written 04-2007 Marina Bousquet, Nicole Dastugue, Pierre Brousset Citation This paper should be referenced as such : Bousquet M, Dastugue N, Brousset P . t(7;9)(q11;p13). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Anomalies/t0709q11p13ID1195.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 628

Atlas of Genetics and Cytogenetics in Oncology and Haematology

t(6;8)(q27;p12) Identity

G-band analysis. Partial karyotype showing the t(6;8)(q27;p12); courtesy José Luis Vizmanos. Clinics and Pathology Disease BCR-ABL negative chronic myeloproliferative disease associates with 8p11 chromosomal rearrangements and a clinical entity named "8p11 myeloproliferative syndrome" (EMS) or "stem cell leukemia/lymphoma" (SCLL) syndrome. These chromosomal rearrangements fuse FGFR1 (a receptor tyrosine kinase gene) with other genes resulting in new chimeric genes which are translated in constitutionally activated FGFR1-like proteins. This is a multilineage disorder with combined occurrence of myeloid malignancy and T- cell NHL, or myeloid metaplasia. Phenotype / The same t(6;8)(q27;p12) is found both in the bone marrow and in the lymph node: the cell stem multilineage involvement suggests the malignant transformation of a primitive origin hematopoietic stem cell. Epidemiology Rare, very few cases described with this translocation (eight until date, four female and four male). A higher number have been described with other FGFR1 fusions, mainly t(8;13) and ZNF198-FGFR1 fusion. Clinics This is a myeloproliferative aggressive disease; complex picture of myeloid hyperplasia progressing to myelodysplasia and T- lymphoma, and acute non lymphocytic leukemia; enlarged lymph node infiltrated by myeloid blast cells; blood data: high WBC (median 40 X 109/l); myelemia; monocytosis and eosinophilia. The clinical phenotype at presentation may vary between different partner genes involved in the FGFR1 fusion and, furthermore, between individuals. Only eight cases with the t(6;8)(q27;p11) have been reported. Four of these patients had features at presentation and/or a clinical course typical of EMS: malignant T-cell lymphoma and CML, AML/myeloproliferative disease, CML-like disease with eosinophilia that progressed rapidly to AML, and primary AML that evolved to EMS following chemotherapy. Two cases presented with polycytemia vera (PV), one of them progressed to AML after a period of 5 years and the other one progressed to an EMS-like myeloproliferative disorder. The remaining case reported showed a B-ALL at presentation. This phenotype has been also described in the transformation phase of some cases with other FGFR1 fusions. Treatment EMS or SCLL seems to be refractory to conventional chemotherapy and some good results have been reached with allogeneic stem cell transplantation. Imatinib is not effective against constitutional activated FGFR1, but this disease could be responsive to specific FGFR1 inhibitors. Evolution CR could be obtained, but is promptly followed by relapse progressing rapidly to an

Atlas Genet Cytogenet Oncol Haematol 2007; 4 629 AML, rarely ALL. Prognosis Median survival: 6 months. Although the number of reported cases is low, EMS seems to be disease with bad prognosis that generally progresses to acute leukemia. Cytogenetics Cytogenetics Available data shows that sometimes the t(6;8)(q27;p12) is not the sole abnormality. Morphological BM: 46,XX,t(6;8)(6pter-6q27::8p12-8pter;6qter-6q27::8p12-8qter) BM: 46,XY,t(6;8)(q27;p11) [100%] BM: 46,XY,t(6;8)(q27;p11) [100%] BM: 46,XY,t(6;8)(q27;p11.2) BM: 46,XX,t(6;8)(q27;p11.2),+8,+10,-18,- 19,+dic(18;19)(p11.2;p13.3) BM: 46,XX,t(6;8)(q27;p12),+der(6)add(6)(q27) [66% ]; 46,XX,t(6;8)(q27;p12) [34%] BM: 45,XY,t(6;8)(q27;p12),-7 [100%] Cytogenetics Mega YAC 959-A -4 (1260kb) from CEPH; FGFR1-specific cosmid 134.8 Molecular Variants t(6;8)(q27;p12) is one of the reported rearrangements of 8p11 that fuses FGFR1 with other partner genes. Genes involved and Proteins Gene Name FGFR1 Location 8p12 Note This gene is involved in several fusions. 24 exons spanning about 55.9 Kb on 8p12. Transcription is from centromere to Dna / Rna telomere. Based on Entrez data, FGFR1OP has seven different transcripts. Based on EnsEMBL data it has five different transcripts. Protein According to UniProt-SwissProt FGFR1 (FGFR1_HUMAN) or fibroblast growth factor receptor 1 is a receptor for basic fibroblast growth factor located in the membrane. Binding of FGF1 and heparin promotes autophosphorylation on tyrosine residues and activation of the receptor. FGFR1 contains 3 Ig-like C2-type (immunoglobulin-like) domains and a protein kinase domain. It belongs to the protein tyrosine kinase family, fibroblast growth factor receptor subfamily. Defects in FGFR1 have been associated with Pfeiffer syndrome (PS) or acrocephalosyndactyly type V (ACS5), hypogonadotropic hypogonadism (IHH), Kallmann syndrome type 2 (KAL2) ; osteoglophonic dysplasia (OGD) ; or osteoglophonic dwarfism, non-syndromic trigonocephaly or metopic craniosynostosis, and the EMS/SCLL due to fusion with other genes and constitutive activation of this receptor. Gene Name FGFR1OP (formerly known as FOP, FGFR1 oncogene partner) Location 6q27 Note This gene is involved only in this fusion. 13 exons spanning about 43.2 Kb on 6q27. Transcription is from centromere to Dna / Rna telomere. Based on Entrez data, FGFR1OP has two different transcripts. Based on EnsEMBL-Vega data it has up to 6 different transcripts. Protein According to UniProt-SwissProt FGFR1OP (FR1OP_HUMAN) is a centrosomal protein associated with gamma-tubulin and required for anchoring microtubules to the centrosomes. Other centrosomal proteins have been described as fusion partner of tyrosine kinases like FGFR1. FGFR1OP is a hydrophilic protein that contains several leucine-rich regions with consensus sequences L-X2-L-X35-L-X35-L (in some of them leucine is substituted by either valine or isoleucine) in its amino and carboxy termini. It has a putative role as a regulator of normal proliferation and differentiation of the erythroid lineage and could belong to a novel family of the leucine-rich proteins. FGFR1OP also contains a Lis- homology (LisH) motif found in more than 100 eukaryotic proteins. These motifs are believed to be involved in microtubule dynamics and organization, cell migration and chromosome segregation; several of them are associated with genetic diseases. Its expression is ubiquitous but is higher in heart, liver, muscle, kidney, intestine,

Atlas Genet Cytogenet Oncol Haematol 2007; 4 630 colon, adrenal gland, prostate, testis, and pancreas. Result of the chromosomal anomaly Hybrid gene

Schematic representation of the fusion FGFR1OP-FGFR1 resulting from the t(6;8)(q27;p12). Top figure courtesy José Luis Vizmanos : From top to bottom: structure of FGFR1, FGFR1OP and the putative chimeric FGFR1OP-FGFR1. TM, transmembrane domain; TK, tyrosine kinase domain. The breakpoints on FGFR1OP are variable as described in refs. 4, 5 and 10; Bottom figure courtesy Marie-Josèphe Pébusque

Description Three different hybrid genes have been described, based on different breakpoints on the FGFR1OP gene. An in-frame fusion between FGFR1OP exon 6 and FGFR1 exon 9 was described; later, two variants in different patients, both in-frame with FGFR1 exon 9, one of them involving FGFR1OP exon 5 and the other involving FGFR1OP exon 7 was described. The presence of two different transcripts (one with a breakpoint in FGFR1OP exon 6 and the other with a breakpoint in exon 7) was reported. Transcript 5' FGFR1OP-FGFR1 3' Detection See ref. 4 below. Fusion The fusion gene is predicted to encode an aberrant tyrosine kinase composed of the Protein putative leucine-rich N-terminal region of FOP, and the FGFR1 intracellular region. Description Like other fusions involving RTKs, FGFR1OP-FGFR1 lacks the FGFR1 transmembrane domain. Oncogenesis Through constitutive activation of FGFR1 signal transduction pathways, via putative dimerization of the fusion protein via the FOP leucine-rich repeats FGFR1OP shares

Atlas Genet Cytogenet Oncol Haematol 2007; 4 631 features in common with other tyrosine kinase fusion partners, namely widespread expression and the presence of putative oligomerization domains. There is experimental proof that expression of FOP-FGFR1 in primary bone marrow cells induced by retroviral transduction generates a rapid MPD in mice. However, lymphoproliferation and progression to acute phase were not observed in the murine model. External links Other t(6;8)(q27;p12) Mitelman database (CGAP - NCBI) database Other t(6;8)(q27;p12) CancerChromosomes (NCBI) database Other Mitelman database (CGAP - NCBI) database Other CancerChromosomes (NCBI) database Other FGFR1 TICdb database To be noted Additional cases are needed to delineate the epidemiology of this rare entity: you are welcome to submit a paper to our new Case Report section. Bibliography Simultaneous occurrence of a T-cell lymphoma and a chronic myelogenous leukemia with an unusual karyotype. Vannier JP, Bizet M, Bastard C, Bernard A, Ducastelle T, Tron P. Leukemia Res 1984; 8: 647-657. Medline 6590932

An uncommon chromosomal translocation t(6;8) associated with atypical myelogenous leukemia/myeloproliferative disease detected by fluorescence in situ hybridisation. Elsner S, Martin H, Rode C, Wassman B, Ganser A, Hoelzer D. Br J Haematol, 1994; 87: 124.

A new myeloproliferative disorder associated with chromosomal translocations involving 8p11: a review. MacDonald D, Aguiar RC, Mason PJ, Goldman JM, Cross NC. Leukemia 1995; 9: 1628-1630. Medline 7564500 t(6;8), t(8;9) and t(8;13) translocations associated with stem cell myeloproliferative disorders have close or identical breakpoints in chromosome region 8p11-12. Chaffanet M, Popovici C, Leroux D, Jacrot M, Adélaïde J, Dastugue N, Grégoire M-J, Lafage Pochitaloff M, Birnbaum D, Pébusque M-J. Oncogene 1998; 16: 945-949. Medline 9484786

The t(6;8)(q27;p11) translocation in a stem cell myeloproliferative disorder fuses a novel gene, FOP, to fibroblast growth factor receptor 1. Popovici C, Zhang B, Gregoire MJ, Jonveaux P, Lafage-Pochitaloff M, Birnbaum D, Pebusque MJ. Blood, 1999; 93: 1381-1389. Medline 9949182

Identification of four new translocations involving FGFR1 in myeloid disorders.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 632 Sohal J, Chase A, Mould S, Corcoran M, Oscier D, Iqbal S, Parker S, Welborn J, Harris RI, Martinelli G, Montefusco V, Sinclair P, Wilkins BS, van den Berg H, Vanstraelen D, Goldman JM, Cross NC. Genes Chromosomes Cancer 2001; 32(2): 155-163. Medline 11550283

Tyrosine kinase fusion genes in chronic myeloproliferative diseases. Cross NC, Reiter A. Leukemia. 2002; 16(7): 1207-1212. Medline 12094244

The 8p11 myeloproliferative syndrome: a distinct clinical entity caused by constitutive activation of FGFR1. Macdonald D, Reiter A, Cross NCP Acta Haematol 2002; 107: 101-107 Medline 11919391

Sequential transformation of t(8;13)-related disease: a case report Roy S, Szer J, Campbell LJ, Juneja S Acta Hematol 2002; 107: 95-97 Medline 11919389

FOP-FGFR1 tyrosine kinase, the product of a t(6;8) translocation, induces a fatal myeloproliferative disease in mice. Guasch G, Delaval B, Arnoulet C, Xie MJ, Xerri L, Sainty D, Birnbaum D, Pebusque MJ. Blood 2004; 103(1): 309-312. Medline 12969958

Clinical variability of patients with the t(6;8)(q27;p12) and FGFR1OP-FGFR1 fusion: two further cases. Vizmanos JL, Hernandez R, Vidal MJ, Larrayoz MJ, Odero MD, Marin J, Ardanaz MT, Calasanz MJ, Cross NC. Hematol J 2004; 5(6): 534-537. Medline 15570299

Structure of the N-terminal domain of the FOP (FGFR1OP) protein and implications for its dimerization and centrosomal localization. Mikolajka A, Yan X, Popowicz GM, Smialowski P, Nigg EA, Holak TA. J Mol Biol 2006; 359(4): 863-875. Medline 16690081

A complex of two centrosomal proteins, CAP350 and FOP, cooperates with EB1 in microtubule anchoring. Yan X, Habedanck R, Nigg EA. Mol Biol Cell 2006; 17(2): 634-644. Medline 16314388

A biphenotypic transformation of 8p11 myeloproliferative syndrome with CEP1/FGFR1 fusion gene. Yamamoto K, Kawano H, Nishikawa S, Yakushijin K, Okamura A, Matsui T. Eur J Haematol 2006; 77(4): 349-354. Medline 16879608

Contributor(s) Written 12-2000 Marie-Josèphe Pébusque

Atlas Genet Cytogenet Oncol Haematol 2007; 4 633 Updated 05-2007 José Luis Vizmanos Citation This paper should be referenced as such : Pébusque MJ . t(6;8)(q27;p12). Atlas Genet Cytogenet Oncol Haematol. December 2000 . URL : http://AtlasGeneticsOncology.org/Anomalies/t68ID1090.html Vizmanos JL . t(6;8)(q27;p12). Atlas Genet Cytogenet Oncol Haematol. May 2007 . URL : http://AtlasGeneticsOncology.org/Anomalies/t68ID1090.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 634 Atlas of Genetics and Cytogenetics in Oncology and Haematology

t(5;9)(q33;q22) Identity

t(5;9)(q33;q22) G-banding Clinics and Pathology Disease ITK-SYK transcripts were detected in 5 of 30 (17%) unspecified peripheral T-cell lymphomas, but not in cases of angioimmunoblastic T-cell lymphoma (n=9) and ALK- negative anaplastic large cell lymphoma (n=7). Phenotype / The majority of t(5;9)(q33;q22)+ unspecified peripheral T-cell lymphomas share a very cell stem similar histological pattern with predominant involvement of lymphoid follicles and the origin same CD3+CD5+CD4+bcl-6+CD10+ immunophenotype. Cytogenetics

Atlas Genet Cytogenet Oncol Haematol 2007; 4 635

Colocalized fusion signals on the der(5) and der(9) confirm ITK-SYK rearrangement

Probes RP11-563G12 and RP11-1091N2 dual color, break apart rearrangement probe for ITK, RP11-31B18 and RP11-47O12 dual color, break apart rearrangement probe for SYK, and RP11-956N15 and CTB4E7 dual color, dual fusion rearrangement probe for ITK- SYK rearrangement Genes involved and Proteins Gene Name ITK Location 5q33 Dna / Rna centromere to telomere orientation; Exons: 17 Protein The Tec family tyrosine kinase Itk has become increasingly recognized for its important role in regulating T-helper-cell differentiation. ITK is not required for Th2 differentiation per se, but effector Th2 cytokine production during recall responses is severely impaired in the absence of ITK. Gene Name SYK Location 9q22 Dna / Rna centromere to telomere orientation; Exons: 13-14 (alternative spliced) Protein SYK is a nonreceptor protein kinase that serves as a key regulator of multiple biochemical signal transduction events and has high homology to ZAP70 protein tyrosine kinase. In contrast to ITK, a translocation of SYK has been observed in hematopoietic neoplasia. Syk is expressed in a wide variety of hematopoietic cells but only in low levels in peripheral T-cells. Treatment of human Jurkat T-cells with the proapoptotic and inflammatory cytokine TNF activates SYK which consequently plays an essential role in TNF-induced activation of JNK, p38 MAPK, p44/p42 MAPK, NF- B, and apoptosis. Result of the chromosomal

Atlas Genet Cytogenet Oncol Haematol 2007; 4 636 anomaly Hybrid gene 5'ITK-3'SYK Description Transcript N-terminal ITK (bp 1-577) fused in frame with C-terminal SYK cDNA (breakpoint bp 1063) Fusion Protein

In frame fusion of N-terminal ITK to C-terminal SYK. The individual domains of Itk are indicated PH (pleckstrin homology), TH (proline-rich Tec homology), SH3 (Src homology), SH2 (Src homology), TK (tyrosine kinase) and of SYK N-terminal and C- terminal SH2 (Src homology), and TK (tyrosine kinase). External links Other t(5;9)(q33;q22) Mitelman database (CGAP - NCBI) database Other t(5;9)(q33;q22) CancerChromosomes (NCBI) database To be noted Additional cases are needed to delineate the epidemiology of this rare entity: you are welcome to submit a paper to our new Case Report section. Bibliography Differential expression of ZAP-70 and Syk protein tyrosine kinases, and the role of this family of protein tyrosine kinases in TCR signaling. Chan AC, van Oers NSC, Tran A, Turka L, Law CL, Ryan JC, Clark EA, Weiss A. J Immunol 1994; 152: 4758-4766. Medline 8176201

Altered T cell receptor signaling and disrupted T cell development in mice lacking Itk. Liao XC, Littman DR. Immunity 1995; 3: 757-769. Medline 8777721

Leukocyte protein tyrosine kinases: potential targets for drug discovery. Bolen JB, Brugge JS. Annu Rev Immunol 1997; 15: 371-404. Medline 9143693

T cell receptor-initiated calcium release is uncoupled from capacitative calcium entry in Itk- deficient T cells. Liu K, Bunnell SC, Gurniak CB, Berg LJ. J Exp Med 1998; 187: 1721-1727. Medline 9584150

Requirement for Tec kinases Rlk and Itk in T cell receptor signaling and immunity.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 637 Schaeffer EM, Debnath J, Yap G, McVicar D, Liao XC, Littman DR, Sher A, Varmus HE, Lenardo MJ, Schwartzberg PL. Science 1999; 284: 638-641. Medline 10213685

Constitutive kinase activation of the TEL-Syk fusion gene in myelodysplastic syndrome with t(9;12)(q22;p12). Kuno Y, Abe A, Emi N, Iida M, Yokozawa T, Towatari M, Tanimoto M, Saito H. Blood 2001; 97: 1050-1055. Medline 11159536

TNF Activates Syk Protein Tyrosine Kinase Leading to TNF-Induced MAPK Activation, NF- B Activation, and Apoptosis. Takada Y, Aggarwal BB. J Immunol 2004; 173: 1066-1077. Medline 8176201

Novel t(5;9)(q33;q22) fuses ITK to SYK in unspecified peripheral T-cell lymphoma. Streubel B, Vinatzer U, Willheim M, Raderer M, Chott A. Leukemia 2006; 20: 313-318. Medline 16341044

Contributor(s) Written 05-2007 Berthold Streubel Citation This paper should be referenced as such : Berthold Streubel B . t(5;9)(q33;q22). Atlas Genet Cytogenet Oncol Haematol. May 2007 . URL : http://AtlasGeneticsOncology.org/Anomalies/t0509q33q22ID1458.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 638 Atlas of Genetics and Cytogenetics in Oncology and Haematology

T-lineage acute lymphoblastic leukemia (T-ALL) Identity Note Most of the recurrent abnormalities in T-ALL are different from those associated with B-lineage ALL. Clinical aspects of the main chromosomal abnormalities observed by conventional cytogenetics are herein described. The numerous oncogenes involved in T-ALL were first characterized by cloning of recurrent chromosomal abnormalities. Subsequently, distinct oncogenic T-ALL subgroups were defined by modern molecular methods. A brief description of the novel cryptic genetic lesions that are intertwined with the molecular cytogenetics of T-cell disease is presented here. Other names T-cell ALL Clinics and Pathology Etiology Immunophenotypic and gene expression analyses of T-ALL cells have revealed heterogeneity that is partially related to arrest at distinct stages of development. Initial cytogenetics studies of T-ALL cases showed nonrandom breakpoints within the following three T-cell receptor (TCR) gene clusters: TRA@ (TCRA), TRD@ (TCRD) locus (14q11.2), or TRB@ (TCRB) locus (7q34). The TCR breakpoints were present in about 30% to 35% of T-ALL cases. The TRG@ (TCRG) locus (7p14) may be restricted to T-cell ALL in patients with ataxia telangiectasia. During T-cell differentiation, these four loci undergo structural rearrangement that is analogous to the rearrangement of immunoglobulin genes during B-cell development.

The TCR promoter and enhancer elements are juxtaposed to a relatively small number of developmentally important genes that encode transcription factors leading to T-cell malignancies. The chromosomal aberrations that affect the TCR loci were among the first to be reported in T-ALL. Subsequently, these and other rarer translocations facilitated the identification of genes that are altered in T-ALL, many of which are also transcriptionally activated without evidence of any detectable chromosomal rearrangement affecting these loci. In summary, the ectopic expression of TAL1(SCL),LYL1, LMO1, LMO2, TLX1(HOX11), and TLX3 (HOX11L2), NOTCH1- activating mutations, and CDKN2-inactivating deletions are among the most prevalent causes of human T-ALL. Epidemiology Among acute leukemia, T-ALL accounts for about 15% of pediatric cases and 20% of adults cases. As detected by conventional cytogenetic methods, patients with T-ALL have a smaller percentage of abnormal clones (60%-70%) than do patients with B- lineage ALL (80%-90%). Tetraploidy is observed in about 3% of patients with T-ALL, but it has no known prognostic significance. Cytogenetic abnormalities that are common in B-cell ALL (e.g., high-hyperdiploidy) are uncommon in T-cell ALL. Many of the translocations seen in T-ALL are recurrent but with a low frequency.

A high number of T-ALL cases have cryptic abnormalities, as shown by fluorescent in situ hybridization (FISH) or other molecular methods. In some instances, this occurs because some of the loci involved in oncogenic rearrangements of T-ALL have a near- telomeric location that generates subtle exchanges in DNA material, and these changes subsequently cause the cryptic translocations. As many as 80% of patients with T-ALL have cryptic deletions of the putative tumor suppressor gene CDKN2A (INK4A) (9p21), and as many as 60% have cryptic deletions of TAL1 (1p32). Other genes such as TLX1 (HOX11) (10q24) and NOTCH1 (9q34) are activated at a much higher frequency than expected from cytogenetic studies alone; thus, simultaneous dysregulation of different signaling pathways may contribute to the multistep pathogenesis of T-ALL subgroups. Clinics The incidence of T-ALL increases with age, i.e., at 1 to 10 years of age , the incidence

Atlas Genet Cytogenet Oncol Haematol 2007; 4 639 is about 7%; at 10 to 15 years, about 14%; and at 15 to 18 years, about 29%. T-ALL is more common in boys and is characterized by hyperleukocytosis, enlarged mediastinal lymph nodes, and the scarcity of hyperdiploid (>50 chromosomes) leukemic cells. T-ALL also often involves the central nervous system (CNS). Children and adolescents with T-ALL are much more likely than children with B-lineage ALL to meet "high-risk" age and white blood cell count criteria (75% for T-ALL versus 32% for B-precursor ALL). However, unlike that in B-precursor ALL, high leukocyte count does not identify high-risk T-ALL in children or adults. Prognosis The historically unfavorable outcome of patients with T-ALL has recently improved through the use of highly effective treatment protocols. T-ALL is now treated the same way as high-risk B-progenitor ALL. With appropriately intensive therapy, children with T-ALL have an outcome similar to that of children with B-precursor ALL, i.e., the estimated 5-year event-free survival (EFS) is 75% to 80%. Nevertheless, patients with T-ALL remain at increased risk for remission induction failure, early relapse, and isolated CNS relapse. In a recent study of adolescents with ALL, no significant difference in outcome of T-ALL was found on the basis of age; older patients did as well as younger ones.

At present, there are no genetic markers in T-ALL that reliably predict treatment response or outcome. Gene expression analysis has revealed the prognostic significance of T-ALL oncogenes and the stage of thymocyte differentiation in which they are expressed. Some genetic markers have been shown to be of clinical relevance in a small series of pediatric patients with T-ALL: TLX1(HOX11)+ was associated with favorable outcome, and TAL1+ and LYL1+ were associated with unfavorable outcome. A favorable prognosis was also found with TLX1(HOX11)+ in adult T-ALL, possibly due to downregulation of antiapoptotic genes. The poor prognosis associated with T-ALL subtypes expressing TAL1 or LYL1 is thought to be caused by the concomitant upregulation of antiapoptotic genes that confer resistance to chemotherapy.

In early studies, the overexpression of TLX3(HOX11L2) was associated with poor prognosis; however, similar, more recent studies have not confirmed such findings. This difference is probably a reflection of the current aggressive treatments that have improved the therapeutic response in this subgroup of T-ALL. Therefore, the clinical significance of genetic lesions in T-ALL remains largely unknown. The prognostic significance of T-ALL subtypes most likely depends on the type and intensity of the treatment administered. The development of targeted therapy for T-ALL might be contentious, given the simultaneous presence and the high prevalence of some genetic lesions affecting T-ALL. Cytogenetics Note Conventional molecular cytogenetic analyses of genetic lesions in T-ALL are summarized below. The following section presents prominent, recurring chromosomal abnormalities that affect either TCR or genes other than TCR (non-TCR genes) in T-ALL (Table 1). The breakpoints of some chromosomal rearrangements and gene names may have been modified from the original report for consistency and according to current HUGO gene nomenclature. Cytoge TCR GENETIC LESIONS IN T-ALL netics Morpho TRB@ (7q34) logical Conventional cytogenetic analysis revealed that chromosomal abnormalities affecting 7q34 (TRB@) occur in 5% to 8% of T-ALL cases with an abnormal karyotype. Recent molecular cytogenetics studies have revealed a higher incidence of TRB@ locus rearrangements (about 20% of all T-ALL cases). This finding demonstrates that the frequency of TRB@ rearrangements is similar to that of TRA@ (14q11.2) (about 24% of all T-ALL cases). Simultaneous rearrangements targeting both the TRB@ and TRA@ loci were observed in five of 126 (4%) patients with T-ALL, possibly reflecting the higher susceptibility for errors in VDJ recombination.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 640 t(1;7)(p32;q34). The variant t(1;7)(p32;q34) disrupts TAL1(TCL5/SCL) by juxtaposing to the TRB@ locus. t(1;7)(p34;q34) This rare t(1;7)(p34;q34) is present in less than 1% of T-ALL cases and results in the fusion of LCK and TRB@ loci, thereby activating LCK. t(7;9)(q34;q34.3). The t(7;9)(q34;q34.3) occurs in about 2% of T-ALL, resulting in the fusion of TRB@ and NOTCH1 loci. NOTCH1 is an early transcription factor that commits lymphoid progenitor cells toward T-cell development. NOTCH1-activating mutations have been shown in more than 50% of T-ALL cases. This finding suggests that NOTCH1 helps transform T-lineage cells. One study demonstrated that NOTCH1-activating mutations predict a more rapid, early treatment response and significantly better 4-year EFS than those without mutations (90% vs. 71%). NOTCH1 mutations are associated with the expression of TAL1, LYL1, TLX1, TLX3, MLL - MLLT1, and PICALM-MLLT10, all of which define the major subtypes of T-ALL. These findings highlight the importance of the multiple pathways regulated by NOTCH1 signaling in the process of leukemogenesis. Targeted therapies directed toward the NOTCH1 pathway may be of potential clinical relevance for patients with T-ALL who carry such activating mutations. Furthermore, gama-secretase inhibitors (GSI) induce cell cycle arrest in vitro in T-ALL cell lines harboring NOTCH1 mutations. Therefore, GSIs are a potential therapeutic strategy for the treatment of T-ALL. However, the integration of such targeted therapy should be implemented with caution because of the recently reported excellent treatment outcome for patients with NOTCH1- activating mutations. t(7;9)(q34;q32). The infrequent t(7;9)(q34;q32) results in the altered expression of TAL2. t(7;10)(q34;q24). A variant of the more common t(10;14)(q24;q11.2), t(7;10)(q34;q24) activates the expression of the DNA-binding transcription factor gene TLX1(HOX11). t(7;11)(q34;p13).A variant of the more common t(11;14)(p13;q11.2), t(7;11)(q34;p13) activates the expression of the DNA-binding transcription factor gene LMO2. t(7;12)(q34;p13.3). The rare t(7;12)(q34;p13.3) deregulates CCND2 by chromosomal translocations to the TRB@ locus in T-ALL. This translocation and its variant, t(12;14)(p13;q11.2), are also associated with other genetic lesions observed in T-ALLs, a finding that suggests that CCND2 dysregulation contributes to multievent oncogenesis in various subtypes of T-ALL. t(7;14)(q34;q32.1)/TCL1. The variant t(7;14)(q34;q32.1) is also seen in T-cell leukemias, juxtaposing TRB@ with TCL1A. t(7;19)(q34;p13.2). In the t(7;19)(q34;p13.2), the LYL1 gene is juxtaposed to the TRB@ locus, resulting in the constitutive expression of LYL1, which is not expressed in normal T cells. Patients whose leukemic blast cells ectopically express LYL1 have an unfavorable outcome, which is thought to be due to the upregulation of antiapoptotic proteins. inv(7)(p15.3;q34)/t(7;7)(p15.3;q34). As a result of a cryptic inv(7)(p15q34) and t(7;7)(p15;q34), the TRB@ locus is juxtaposed to the HOXA@ at 7p15 in about 3.3% of T- ALL cases. This rearrangement leads to transcriptional activation of several HOXA genes, including HOXA10 and HOXA11. One case was identified carrying a triplication of the TRB@-HOXA fusion on a ring chromosome 7; this finding suggested an additional mechanism of transcriptional activation of HOXA@. Furthermore, HOXA@ expression is increased in the absence of these chromosomal rearrangements in 25% of T-ALL cases. The upregulation of HOXA gene expression was also found in MLL-MLLT1(ENL)+ and PICALM(CALM)-MLLT10(AF10)+ T-ALLs, a NOTCH1-activating mutation, and a deletion of 9p21. These findings indicated a more general role of HOXA@ genes in T-cell oncogenesis. The outcome of 14 patients with the TRB@-HOXA@ in a larger study was similar to that of other patients with T-ALL who did not carry the fusion transcript. Other cryptic breakpoints. Evaluations of cryptic 7q34/TRB@ with FISH probes include new putative transcription factor genes at 11q24, 20p12, and 6q22. The subtle rearrangements at 7q34 can be explained by distant chromosomal location of the TRB@ (7q34) and the partner gene(s). For example, the t(7;7)(p15.3;q34), inv(7)(p15.3q34), t(7;11)(q34;q24), and t(7;10)(q34;q24) all have distal breakpoints.

TRG@ (7p14)) The TRG@(TCRG) locus (7p14) may be restricted to T-cell tumors in patients with ataxia telangiectasia. The TRG@ locus is not involved in translocations in T-ALL. Historically, it was thought that the inv(7)(p15;q34) or t(7;7)(p15;q34) juxtaposed TRB@ to TRG@, but

Atlas Genet Cytogenet Oncol Haematol 2007; 4 641 recently it was shown that the TRB@-HOXA fusion is generated by such rearrangements. One exception was a t(1;7)(p31-32;p13) in a 16 year-old male patient who had precursor T- cell lymphoblastic leukemia/lymphoma. This rearrangement was identified during the evaluation of FISH probes to detect TCR breakpoints. It was speculated that the breakpoint at 1p may have involved the TAL1 or LCK oncogenes.

TRA@ or TRD@ (14q11.2) Among the most common chromosomal abnormalities observed by conventional cytogenetics, those associated with T-ALL are chromosome 14 alterations in which the breakpoint is located at 14q11.2. By conventional cytogenetics, this abnormality represents about 17% of all T-ALL cases (Table 1). By molecular cytogenetics studies, the incidence of TRA@/TRD@ rearrangements is about 24% of all T-ALL cases.

t(1;14)(p32;q11.2). This translocation is observed in about 3% of T-ALL. The TAL1(TCL5/SCL) gene, which is located on 1p32, is juxtaposed with the TRD@ locus. As a result of t(1;14)(p32;q11.2), TAL1 is controlled by the regulatory elements of the TRD@, which results in disruption of TAL1 and its ectopic expression (see 1p32/TAL1(SCL) deletion below). t(5;14)(q35.1;q11.2). The t(5;14)(q35.1;q11.2) disrupts the TLX3(HOX11L2) by translocating to TRD@. t(7;14)(p15.1;q11.2). The cloning of T-ALL from one patient who carried a t(7;14)(p15.1;q11.2) showed the juxtaposition of HOXA@ with the TRD@ overexpressing HOXA genes. The leukemic cells of this patient also had a t(10;11)(p12;q14)/PICALM- MLLT10. t(8;14)(q24.1;q11.2). This translocation is seen in approximately 2% of patients with T- ALL, but it is not restricted to the T-lineage. The t(8;14)(q24.1;q11.2) results in the rearrangement of the TRA@ locus with the MYC(CMYC) oncogene, which in turn dysregulates MYC transcription. The disease in these cases is aggressive, and the response to conventional therapy is poor. t(10;14)(q24;q11.2). The t(10;14)(q24;q11.2) and its variant t(7;10)(q34;q24) is seen in 5% to 10% of patients with T-ALL or T-cell lymphomas. These rearrangements are more frequent in adults than in children. The t(10;14) results in the translocation of TLX1(HOX11) (10q24) to TRA@/TRD@ (14q11.2) and the overexpression of TLX1. The t(10;14) can be detected by PCR, and a dual-color FISH probe is often used to detect HOX11 translocations on 10q24. However, TLX1 overexpression in leukemic blasts has been observed in the absence of 10q24 rearrangement in as many as 50% of T-ALL cases. Therefore, other trans-acting mechanisms, e.g., disruption of gene silencing, may cause aberrant expression of the gene. The gene expression pattern of TLX1-expressing lymphoblasts is similar to that of early cortical thymocytes. Therefore, the lack of expression of antiapoptotic genes during this stage of thymocyte development (and in TLX1-expressing lymphoblasts) may explain why pediatric and adult patients with this type of lymphoblast have a highly favorable outcome. Other studies have not demonstrated significant improvement in outcome. Furthermore, activation of other mutant genes, including NOTCH1, is found in most TLX1+ T-ALL. This finding suggests that multiple cooperating changes lead to T-cell differentiation arrest. t(11;14)(p13;q11.2) The t(11;14)(p13;q11.2) is among the most common nonrandom abnormalities detected by conventional cytogenetic methods in T-ALL blast cells. This rearrangement is found in less than 10% of children with T-ALL. The t(11;14)(p13;q11.2) TRA@ or TRD@ dysregulates LMO2. A rare variant, t(7;11)(q34;p13), may also be found with an LMO2-TRB@ fusion that constitutively activates the LMO2 gene. However, high levels of LMO2 expression have also been reported in the absence of translocations in as many as 30% of T-ALL cases. This finding suggests that alternative mechanisms in T-ALL cells activate LMO2. t(11;14)(p15;q11.2) The t(11;14)(p15;q11.2) occurs in 1% of patients with T-ALL. The breakpoint on chromosome 11 is found in one of the rhombotin-2-related, stage-specific differentiation genes (e.g., LMO1). LMO1 and LMO2 are expressed in patients whose leukemic cells also have deregulated expression of TAL1 or LYL1. t(12;14)(p13.3;q11.2). The t(12;14)(p13.3;q11.2) dysregulates CCND2 by translocating it to the TRA@/TRD@ loci. t(14;14)(q11.2;q32.1) or inv(14)(q11.2q32.1). These chromosomal abnormalities have

Atlas Genet Cytogenet Oncol Haematol 2007; 4 642 been detected with high frequency in patients with ataxia telangiectasia and mature T-cell leukemias but less frequently in patients with acute T-cell leukemias. Most cases with a t(14;14)(q11.2;q32.1) or inv(14)(q11.2q32.1) result in the rearrangement of the TRA@ or TRD@ loci with the TCL1A oncogene on 14q32.1 centromeric to the IGH@ locus (14q32.3). The variant t(7;14)(q34;q32.1) was also seen in T-ALL, juxtaposing TRB@ with TCL1A. A study to evaluate the detection of TCR breakpoints by FISH showed that most, but not all, cases with 14q11.2 breaks involve TRA@/TRD@; likewise, not all 14q32 breaks involve TCL1A. In that series, one adult T-cell leukemia/lymphoma case with a t(14;14)(q11.2;q32) indicated a breakpoint in BCL11B, which is the gene involved in the t(5;14)(q35;q32), generating the BCL11B-TLX3 fusion. In another study, the leukemic blasts of a patient with T-ALL had other complex chromosomal aberrations and an inv(14)(q11.2q32) that juxtaposed the disrupted BCL11B gene with TRD@. Other genes located to the same 14q32.1 region, centromeric to TCL1A (e.g., TCL1b(TML1) and TCL6), are activated in T-cell malignancies. Of note, a few cases with t(14;14)(q11.2;q32) and B- lineage ALL were reported with IGH involvement. t(14;21)(q11.2;q22.1). The t(14;21)(q11.2;q22.1) translocates OLIG2(BHLHB1) to the TRA@ locus. t(X;14)(q28;q11.2). The t(X;14)(q28;q11.2) is mostly observed in mature T-cell leukemias and dysregulates the MTCP1 gene.

NON-TCR GENETIC LESIONS IN T-ALL

del(1)(p32)/TAL1(SCL). A cryptic interstitial deletion of TAL1 in the chromosome region 1p32 is observed in as many as 30% of patients with T-ALL. The deletion (about 90 kb) is in the coding region of the STIL(SIL) gene, which is also located on 1p32, and in the untranslated region of the TAL1 gene, thereby placing the TAL1-coding region under the control of the STIL(SIL) promoter region and generating STIL-TAL1 fusion transcripts. The common site-specific deletion in TAL1 results in its ectopic expression via illegitimate recombinase activity. Also, misexpression of TAL1 has been observed in approximately 30% of patients who have T-ALL but no detectable TAL1 abnormality. Therefore, TAL1 protein is ectopically expressed in leukemic blast cells in as many as 60% of patients with T-ALL. The 90-kb deletion in the TAL1-coding region can be detected by FISH, Southern blot analysis, genomic PCR, or RT-PCR for identification of the various types of fusion genes generated. It is not detected by conventional cytogenetics. TAL1 is essential for primitive hematopoiesis and adult erythropoiesis and megakaryopoiesis. In one study, patients with T-ALL whose leukemic blast cells ectopically expressed TAL1 had an unfavorable outcome, which was thought to be due to the upregulation of antiapoptotic proteins. However, the clinical relevance of TAL1 rearrangements remains unclear. t(1;3)(p32;p21). The t(1;3)(p32;p21) disrupts TAL1(SCL/TCL5) by juxtaposing with the TCTA gene. t(1;5)(p32;q31). The t(1;5)(p32;q31) dysregulates the expression of TAL1 by an unknown gene. t(4;11)(q21;p15.5). The t(4;11)(q21;p15.5) was observed in a subgroup of T-ALL whose leukemic cells coexpressed myeloid markers. The t(4;11) results in the NUP98-RAP1GDS1 fusion. t(4;21)(q31;q22). A t(4;21)(q31;q22) was seen in a 12-year-old boy with T-ALL. FISH analysis showed that the RUNX1(AML1/CBFA2) (21q22) gene was rearranged by the translocation. +4. Trisomy 4 as the sole chromosomal abnormality in ALL has been reported in T-ALL, but it is not limited to this lineage of disease. The clinical implications of +4 remain unknown. t(5;14)(q35.1;q32.2). The t(5;14)(q35.1;q32.2), a recurrent cryptic translocation specific to T cells, has been observed in as many as 20% of pediatric patients and 13% of adults patients with T-ALL. The t(5;14) is not observed by conventional cytogenetics, but FISH probes are available for its detection. In most instances, the t(5;14) results in the activation of the TLX3(HOX11L2) homeobox gene at 5q35.1. This gene is activated by T-cell regulatory elements downstream of BCL11B(CTIP2) gene, which is located at 14q32.2 and is highly expressed during T-cell differentiation. A neighboring, related homeobox gene at 5q35.1, NKX2-5(CSX), is similarly activated in T-ALL by a rarer variant t(5;14)(q35.1;q32.2) or by t(5;14)(q35.1;q11.2) involving TRD@ locus. Ectopic expression of TLX3 has also

Atlas Genet Cytogenet Oncol Haematol 2007; 4 643 been identified in cases of childhood T-ALL without evidence of the t(5;14). A few case with t(5;14)/BCL11B-TLX3 fusion have also shown the 9q34amp/NUP214-ABL1 fusion. Some studies reported that TLX3 overexpression was associated with poor prognosis, whereas other studies did not confirm these findings. t(5;7)(q35.1;q21) A variant t(5;7)(q35.1;q21) involving the CDK6 gene on 7q21, TLX3, and other cryptic rearrangements affecting TLX3 have been reported. del(6q). Cytogenetic analyses revealed that deletion of the q arm of chromosome 6 occurs in about 15% of T-ALL cases. Molecular analyses revealed that this rearrangement occurs in 15% to 32% of cases. Furthermore, del(6q) is more frequent in T-ALL than in precursor B-lineage ALL. The crucial regions of loss of heterozygocity in the q arm of 6q are between 6q15 and 6q21, but no tumor suppressor gene has yet been identified. Earlier studies reported that del(6q) is associated with an inferior early response to treatment and poor outcome, but no prognostic significance has been noted in subsequent studies. This most likely reflects the fact that T-ALL cases are now stratified into the high-risk arm of treatment protocols; thus, the prognostic value of del(6q) depends on the treatment. t(6;7)(q23;q32-36). The t(6;7)(q23;q32-36) is an infrequent but recurrent translocation in T-ALL. The 6q breakpoints established in two cases were only 150 kb apart. In one case, the breakpoint potentially disrupted or deregulated the MYB gene, and in the other case, it potentially disrupted the AHI1 gene. dup6q23/MYB. Recently, a duplication of 6q23 region was identified in 9 of 107 (8.4%) patients with T-ALL by the array comparative genome hybridization (array-CGH) method. The commonly duplicated region covered the MYB gene del(9)(p21). Deletion or inactivation of genes located in close proximity on 9p21 is one of the most common genetic defects in T-ALL. By conventional cytogenetics, translocations involving 9p have been seen in 9% to 12% of children with ALL. However, FISH and other molecular methods have shown that homozygous deletions of CDKN2A(INK4A) [encoding p16 (INK4a) and p14(ARF) proteins] occur in 60% to 80% of children with T-ALL; homozygous deletions of CDKN2B(INK4B) (encoding p15 protein) occur in approximately 20% of children with T-ALL. Hemizygous deletion of INK4A occurs in about 10% of pediatric T-ALL cases, and that of INK4B occurs in about 15%. One study has reported inactivation of INK4A in 93% of T-ALL cell samples tested and that of INK4B in 99%. Other contiguous genes such as IFN1@ and MTAP can be included in the deletions; thus, ALL with 9p21 is a rather heterogeneous group. Because proteins encoded by these genes might influence the response to treatment, the prognosis of patients with 9p21-deleted T- ALL could vary according to the extent of the deletion. The prognostic significance of loss of heterozygocity of CDKN2A in childhood ALL remains controversial. 9p13/PAX5. The gene involved in 9p13 abnormalities is PAX5; its role is unclear in leukemogenesis in T-cells. t(9;12)(p24;p13). JAK2 was fused to ETV6(TEL) as a result of the t(9;12)(p24;p13) in a child with T-ALL. The role of the ETV6-JAK2 fusion gene in T-ALL pathogenesis was confirmed by the finding that fatal leukemia accompanied by preferential expansion of CD8+ T cells developed in mice whose lymphoid cells contained an ETV6-JAK2 transgene. t(8;9)(p22;p24). This t(8;9) formed a PCM1-JAK2 fusion in a patient with T-cell lymphoma. Such translocations have been found in other patients with myeloid diseases. 9q34/ABL1. The genetic lesions affecting the ABL1 locus generate fusion proteins that are constitutively phosphorylated tyrosine kinases. These kinases, which are described in more detail below, excessively activate pathways that regulate cell survival and proliferation. Gene-targeted therapy aimed to inhibit tyrosine kinases (e.g., imatinib mesylate) could improve the outcome of patients with ABL-fusion+ T-ALL. CYTOGENETICS_MORPHOL t(9;22)(q34;q11.2)/BCR-ABL1(ABL). The t(9;22)(q34;q11.2)/BCR-ABL1(ABL), also known as Philadelphia (Ph)+ ALL, is associated with the worst prognosis in children. It occurs in 3% to 5% of children and in 25% of adults with the disease. Most cases of Ph+ ALL are phenotypically pre-B cell lineage, but an international pediatric study showed that 2% had a T-cell immunophenotype. In that series, there was no significant prognostic difference between Ph+ pre-B ALL and Ph+ T-ALL. Most cases of Ph+ T-ALL have an aggressive course, persistence of the clone, as detected by minimal residual disease (MRD), and a dismal prognosis. Distinguishing Ph+ T-ALL from chronic myelogenous leukemia (CML) with T cell-derived leukemic blast crisis may be challenging and of clinical relevance in the imatinib era.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 644 9q34amp/NUP214-ABL1. The 9q34 amplification (multiple signals of the ABL1 gene per nucleus) is a cryptic abnormality. Although this rearrangement is not detectable by conventional cytogenetics, it occurs in about 3% to 6% of T-ALL cases. It is detected by FISH using ABL1 or BCR-ABL1 probes that show a variable number of extrachromosomal amplified elements of the ABL1 locus independent of BCR in metaphase, and multiple signals in most interphase cells. The episomes contained ABL1, LAMC3, and NUP214 genes localized within a 500-kb region on 9q34. Subsequently, the circular nature of the genomic region from ABL1 to NUP214 was discovered; this formation created an extrachromosomal episomal structure that contains the NUP214-ABL1 fusion genes. The copy number of the episome may vary from cell to cell, increasing due to unequal segregation during cell division. Most karyotypes of cases with 9q34amp are abnormal, including some of the recurrent translocations seen in T-ALL. The 9q34 amp is associated with the deletion of CDKN2A and CDKN2B and ectopic expression of TLX1 or TLX3. A few cases with t(5;14) also had the NUP214-ABL1 extrachromosomal episomal amplification. Of interest, a T-ALL case with t(5;14)/BCL11B-TLX3 fusion also had an amplified NUP214- ABL1 fusion inserted in the 2q21 region. This was in addition to the normal ABL1 signals on both 9q34 copies, without evidence of extrachromosomal episomal amplification. The NUP214-ABL1 fusion appears to be associated with aggressive disease and poor outcome. A recent report of NUP214-ABL1 in adult T-ALL did not find a statistically significant difference in overall survival when compared with that in patients lacking the fusion. Like BCR-ABL1, the NUP214-ABL1 fusion is a constitutively active tyrosine kinase with transforming activity in vitro. However, because of the heterogeneity in the genetic lesions observed in many cases, the response to imatinib in NUP214-ABL1+ cases should be evaluated with caution. Ph+ CML with amplification of BCR-ABL1 is resistant to imatinib. 9q34dup/amp. Recently, a duplication of 9q34 region was identified in 33% of pediatric T-ALL cases by array-CGH. The exact size of the amplified region differed slightly among patients, but the crucial region encompassed many genes such as NOTCH1 that were distal from ABL1 and NUP214. The size of the 9q34-amplified region varied among patients, and in some cases, it was observed as only a minor leukemic clone. The duplication appears to be an independent genetic event from both the episomal NUP214- ABL1 amplification and the NOTCH1 mutations but may lead to the activation of other putative regulatory genes in the 9q34 region. Some of the patients with the 9q34dup also had NUP214-ABL1 episomal amplification but in an independent leukemic clone. The subclones with the 9q34dup were also observed in patients with other clonal abnormalities frequently seen in T-ALL cases. At present, the meaning of this finding is unclear. t(9;12)(q34;p13). Another ABL1 fusion seen in a T-cell ALL case is t(9;12)(q34;p13), which generates the ETV6-ABL1 fusion. t(9;14)(q34;q32). A cryptic t(9;14)(q34;q32) was seen in one T-ALL case. This rearrangement resulted in EML1-ABL1 fusion with dysregulated tyrosine kinase activity. The leukemic cells from this patient also showed ectopic expression of TLX1 and hemizygous deletion of the CDKN2A. Subsequently, the patient experienced T-ALL relapse with no evidence of the EML1-ABL1 but newly acquired NUP214-ABL1 positivity. t(10;11)(p12;q14). The PICALM(CALM)-MLLT10(AF10) fusion gene is created by the t(10;11)(p12;q14), which is a recurrent abnormality in about 4% to 9% of T-ALL cases. However, this rearrangement also has been observed in non-T-cell acute leukemias. The translocation is not always evident by conventional cytogenetic methods, but it can be detected by FISH or RT-PCR. Furthermore, distinction of this chromosomal abnormality from t(10;11)(p12;q23) involving MLL-MLLT10(AF10) can be challenging, often requiring FISH or RT-PCR to make the differential diagnosis. Some T-ALL cases with the PICALM- MLLT10 fusion also demonstrate upregulation of the HOXA@ genes. t(10;11)(q25;p15.5). This t(10;11)(q25;p15.5) was seen in a patient with T-ALL whose leukemic cells expressed myeloid markers. The rearrangement resulted in the NUP98- ADD3 fusion. del(11)(p12p13)/LMO2. A cryptic deletion of 11p was detected recently by array-CGH in about 4% of pediatric patients with T-ALL. The localization of genomic breakpoints in the deletion was heterogeneous. In most del(11p) cases, the oncogene LMO2 was activated independent from other recurrent cytogenetic abnormalities that are frequently present in T-ALL. In one of six patients, the RAG2 promoter controlled the expression of LMO2, thereby generating a RAG2-LMO2 fusion. In other cases, the deletion of negative regulatory sequences upstream of LMO2 was suggested to contribute to its ectopic

Atlas Genet Cytogenet Oncol Haematol 2007; 4 645 expression. 11p13/LMO2 - Insertional Mutagenesis. T-ALL developed in two of 10 infants enrolled in the retroviral IL2RG gene therapy trial for X-linked severe combined immunodeficiency (X1-SCID). Retroviral insertion in the proximity of the LMO2 gene leads to aberrant transcription and expression of LMO2. In that trial, leukemia was diagnosed 3 years after the gene therapy was completed. 11q23/MLL. Abnormalities of 11q23 have been observed in approximately 4% of children with T-ALL and in 6% to 8% of adults with the disease. In an international collaborative study of ALL with 11q23 abnormality and known immunophenotype, T-ALL was present in 40 of 459 (8.7%) cases. Most patients with T-ALL and 11q23 rearrangements have a t(11;19)(q23;p13.3), though cases with a del(11)(q23) should be further evaluated by FISH using the MLL probe to rule-out a subtle translocation such as t(6;11)(q27;q23). Other translocations seen infrequently in T-ALL include (4;11)(q21;q23), t(9;11)(p22;q23), t(10;11)(p12;q23), and others seen in B-lineage ALL or AML. MLL fusion proteins have increased transcriptional activity; thus, these proteins can also cause increased expression of HOXA9, HOXA10, HOXC6, and the MEIS1 HOX coregulator. T- ALL cells with MLL fusions are characterized by differentiation arrest at an early stage of thymocyte differentiation. Despite the historical, relatively adverse outcome generally associated with T-ALL, those cases with MLL aberrations have a much better prognosis than do their 11q23+ B-lineage counterparts. t(11;18)(p15.5;q12). The t(11;18)(p15.5;q12) was observed in a 9 year-old boy with T- ALL. The t(11;18) results in the NUP98-SETBP1 fusion. t(11;19)(q23;p13.3 T-ALL with t(11;19)(q23;p13.3) results in the MLL-MLLT1(ENL) fusion, which is associated with a good prognosis.

Summary:

In addition to conventional cytogenetic studies, molecular techniques that are more reliable, rapid, and sensitive are needed to detect multiple genetic lesions associated with T-ALL. The improved characterization of T-ALL genetic subgroups may facilitate the development of targeted gene therapy for those patients with refractory disease and less toxic therapy for those with responsive disease.

In recent years, the introduction of more intensive therapy has improved the overall outcome of patients with T-ALL, as indicated in the following landmark discoveries: Most of the recurrent abnormalities in T-ALL are different from those associated with B-lineage ALL.

In B-lineage ALL, certain chromosomal subgroups have strong prognostic association. In contrast and with a few exceptions, cytogenetic features have no predictive value in T- ALL. Most cases of Ph+ T-ALL have an aggressive course and poor prognosis, similar to those of Ph+ B-lineage ALL. Cases of T-ALL with MLL aberrations have a much better prognosis than do their 11q23+ B-lineage counterparts. The t(10;14)(q24;q11.2) or upregulation of TLX1(HOX11) appears to be associated with better prognosis. Treatment outcome for patients with a NOTCH1-activating mutation is typically good. Tetraploidy is observed in about 3% of T-ALL and has no known prognostic significance. Hyperdiploidy (>50 chromosomes), which is seen in 25% to 30% of children with ALL, is rarely observed in T-ALL.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 646

Table 1. Immunophenotype-specific rearrangements generated by T-cell receptor (TRC) and non-TCR genes Bibliography A new translocation, t(10;14)(q24;q11), in T cell neoplasia. Dube ID, Raimondi SC, Pi D, Kalousek DK. Blood 1986; 67: 1181-1184. Medline 3485458

Deregulation of c-myc by translocation of the alpha-locus of the T-cell receptor in T-cell leukemias. Erikson J, Finger L, Sun L, ar-Rushdi A, Nishikura K, Minowada J, Finan J, Emanuel BS, Nowell PC, Croce CM. Science 1986; 232: 884-886. Medline 3486470

Atlas Genet Cytogenet Oncol Haematol 2007; 4 647 Juxtaposition of the T-cell receptor alpha-chain locus (14q11) and a region (14q32) of potential importance in leukemogenesis by a 14;14 translocation in a patient with T-cell chronic lymphocytic leukemia and ataxia-telangiectasia. Davey MP, Bertness V, Nakahara K, Johnson JP, McBride OW, Waldmann TA, Kirsch IR. Proc Natl Acad Sci USA 1988; 85: 9287-9291. Medline 3194425

Cytogenetics of childhood T-cell leukemia. Raimondi SC, Behm FG, Roberson PK, Pui CH, Rivera GK, Murphy SB, Williams DL. Blood 1988; 72: 1560-1566. Medline 3263151 lyl-1, a novel gene altered by chromosomal translocation in T cell leukemia, codes for a protein with a helix-loop-helix DNA binding motif. Mellentin JD, Smith SD, Cleary ML. Cell 1989; 58: 77-83. Medline 2752424

The SCL gene is formed from a transcriptionally complex locus. Aplan PD, Begley CG, Bertness V, Nussmeier M, Ezquerra A, Coligan J, Kirsch IR. Mol Cell Biol 1990; 10: 6426-6435. Medline 2247063

Disruption of the human SCL locus by "illegitimate" V-(D)-J recombinase activity. Aplan PD, Lombardi DP, Ginsberg AM, Cossman J, Bertness VL, Kirsch IR. Science 1990; 250: 1426-1429. Medline 2255914

Abnormalities of the long arm of chromosome 6 in childhood acute lymphoblastic leukemia. Hayashi Y, Raimondi SC, Look AT, Behm FG, Kitchingman GR, Pui CH, Rivera GK, Williams DL. Blood 1990; 76: 1626-1630. Medline 2207332

Two site-specific deletions and t(1;14) translocation restricted to human T-cell acute leukemias disrupt the 5' part of the tal-1 gene. Bernard O, Lecointe N, Jonveaux P, Souyri M, Mauchauffe M, Berger R, Larsen CJ, Mathieu-Mahul D. Oncogene 1991; 6: 1477-1488. Medline 1886719

Inversions and tandem translocations involving chromosome 14q11 and 14q32 in T- prolymphocytic leukemia and T-cell leukemias in patients with ataxia telangiectasia. Brito-Babapulle V, Catovsky D. Cancer Genet. Cytogenet. 1991; 55: 1-9. Medline 1913594

TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Ellisen LW, Bird J, West DC, Soreng AL, Reynolds TC, Smith SD, Sklar J. Cell 1991; 66: 649-661. Medline 1831692 c-tal, a helix-loop-helix protein, is juxtaposed to the T-cell receptor- beta chain gene by a reciprocal chromosomal translocation: t(1;7)(p32;q35). Fitzgerald TJ, Neale GA, Raimondi SC, Goorha RM.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 648 Blood 1991; 78: 2686-2695. Medline 1824262

Chromosomal translocations joining LCK and TCRB loci in human T cell leukemia. Tycko B, Smith SD, Sklar J. J Exp Med 1991; 174: 867-873. Medline 1680958

TAL2, a helix-loop-helix gene activated by the (7;9)(q34;q32) translocation in human T-cell leukemia. Xia Y, Brown L, Yang CY, Tsan JT, Siciliano MJ, Espinosa R, III, Le Beau MM, Baer RJ. Proc. Natl Acad Sci USA 1991; 88: 11416-11420. Medline 1763056

Pediatric leukemia/lymphoma with t(8;14)(q24;q11). Lange BJ, Raimondi SC, Heerema N, Nowell PC, Minowada J, Steinherz PE, Arenson EB, O'Connor R, Santoli D. Leukemia 1992; 6: 613-618. Medline 1385638

Molecular analysis of T-cell receptor transcripts in a human T-cell leukemia bearing a t(1;14) and an inv(7); cell surface expression of a TCR-beta chain in the absence of alpha chain. Bernard O, Groettrup M, Mugneret F, Berger R, Azogui O. Leukemia 1993; 7: 1645-1653. Medline 8412327

The chromosomal translocation t(X;14)(q28;q11) in T-cell pro- lymphocytic leukaemia breaks within one gene and activates another. Fisch P, Forster A, Sherrington PD, Dyer MJ, Rabbitts TH. Oncogene 1993; 8: 3271-3276. Medline 8247530

Identification of the TCL1 gene involved in T-cell malignancies. Virgilio L, Narducci MG, Isobe M, Billips LG, Cooper MD, Croce CM, Russo G. Proc Natl Acad Sci USA 1994; 91: 12530-12534. Medline 7809072

Cloning and characterization of TCTA, a gene located at the site of a t(1;3) translocation. Aplan PD, Johnson BE, Russell E, Chervinsky DS, Kirsch IR. Cancer Res 1995; 55: 1917-1921. Medline 7728759

Does activation of the TAL1 gene occur in a majority of patients with T- cell acute lymphoblastic leukemia? A pediatric oncology group study. Bash RO, Hall S, Timmons CF, Crist WM, Amylon M, Smith RG, Baer R. Blood 1995; 86: 666-676. Medline 7605997

Alternative origin of p13MTCP1-encoding transcripts in mature T-cell proliferations with t(X;14) translocations. Gritti C, Choukroun V, Soulier J, Madani A, Dastot H, Leblond V, Radford-Weiss I, Valensi F, Varet B, Sigaux F, Stern MH. Oncogene 1997; 15: 1329-1335. Medline 9315101

Atlas Genet Cytogenet Oncol Haematol 2007; 4 649

A TEL-JAK2 fusion protein with constitutive kinase activity in human leukemia. Lacronique V, Boureux A, Valle VD, Poirel H, Quang CT, Mauchauffe M, Berthou C, Lessard M, Berger R, Ghysdael J, Bernard OA. Science 1997; 278: 1309-1312. Medline 9360930

Molecular analysis of the t(8;14)(q24;q11) chromosomal breakpoint junctions in the T-cell leukemia line MOLT-16. Shima-Rich EA, Harden AM, McKeithan TW, Rowley JD, Diaz MO. Genes Chromosomes Cancer 1997; 20: 363-371. Medline 9408752

MLL and CALM are fused to AF10 in morphologically distinct subsets of acute leukemia with translocation t(10;11): both rearrangements are associated with a poor prognosis. Dreyling MH, Schrader K, Fonatsch C, Schlegelberger.B, Haase D, Schooch C, Ludwig WD, Loffler H, Buchner T, Wormann B, Hiddemann W, Bohlander SK. Blood 1998; 91: 4662-4667. Medline 9616163

Deregulated expression of the TAL1 gene by t(1;5)(p32;31) in patient with T-cell acute lymphoblastic leukemia. Francois S, Delabesse E, Baranger L, Dautel M, Foussard C, Boasson M, Blanchet O, Bernard O, Macintyre EA, Ifrah N. Genes Chromosomes Cancer 1998; 23: 36-43. Medline 9713995

Frequency and clinical significance of cytogenetic abnormalities in pediatric T-lineage acute lymphoblastic leukemia: a report from the Children's Cancer Group. Heerema NA, Sather HN, Sensel MG, Kraft P, Nachman JB, Steinherz PG, Lange BJ, Hutchinson RS, Reaman GH, Trigg ME, Arthur DC, Gaynon PS, Uckun FM. J Clin Oncol 1998; 16: 1270-1278. Medline 9552025

6q deletions in acute lymphoblastic leukemia and non-Hodgkin's lymphomas. Merup M, Moreno TC, Heyman M, Ronnberg K, Grander D, Detlofsson R, Rasool O, Liu Y, Soderhall S, Juliusson G, Gahrton G, Einhorn S. Blood 1998; 91: 3397-3400. Medline 9558398

Frequent loss of heterozygosity on the long arm of chromosome 6: identification of two distinct regions of deletion in childhood acute lymphoblastic leukemia. Takeuchi S, Koike M, Seriu T, Bartram CR, Schrappe M, Reiter A, Park S, Taub HE, Kubonishi I, Miyoshi I, Koeffler HP. Cancer Res 1998; 58: 2618-2623. Medline 9635588

The (4;11)(q21;p15) translocation fuses the NUP98 and RAP1GDS1 genes and is recurrent in T- cell acute lymphocytic leukemia. Hussey DJ, Nicola M, Moore S, Peters GB, Dobrovic A. Blood 1999; 94: 2072-2079. Medline 10477737

Abnormalities at 14q32.1 in T cell malignancies involve two oncogenes. Pekarsky Y, Hallas C, Isobe M, Russo G, Croce CM.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 650 Proc. Natl. Acad. Sci. U.S.A 1999; 96: 2949-2951. Medline 10077617

Childhood acute lymphoblastic leukemia with the MLL-ENL fusion and t(11;19)(q23;p13.3) translocation. Rubnitz JE, Camitta BM, Mahmoud H, Raimondi SC, Carroll AJ, Borowitz MJ, Shuster JJ, Link MP, Pullen DJ, Downing JR, Behm FG, Pui CH. J Clin Oncol 1999; 17: 191-196. Medline 10458233

Identification of the TCL1/MTCP1-like 1 (TML1) gene from the region next to the TCL1 locus. Sugimoto J, Hatakeyama T, Narducci MG, Russo G, Isobe M. Cancer Res 1999; 59: 2313-2317. Medline 10344735

Outcome of treatment in children with Philadelphia chromosome-positive acute lymphoblastic leukemia. Arico M, Valsecchi MG, Camitta B, Schrappe M, Chessells J, Baruchel A, Gaynon P, Silverman L, Janka-Schaub G, Kamps W, Pui CH, Masera G. N Engl J Med 2000; 342: 998-1006. Medline 10749961

Clinical significance of deletions of chromosome arm 6q in childhood acute lymphoblastic leukemia: a report from the Children's Cancer Group. Heerema NA, Sather HN, Sensel MG, Lee MK, Hutchinson R, Lange BJ, Bostrom BC, Nachman JB, Steinherz PG, Gaynon PS, Uckun FM. Leukemia Lymphoma 2000; 36: 467-478. Medline 10784391

Universal inactivation of both p16 and p15 but not downstream components is an essential event in the pathogenesis of T-cell acute lymphoblastic leukemia. Omura-Minamisawa M, Diccianni MB, Batova A, Chang RC, Bridgeman LJ, Yu J, Pullen J, Bowman WP, Yu AL. Clin Cancer Res 2000; 6: 1219-1228. Medline 10778944

Identification of the TCL6 genes within the breakpoint cluster region on chromosome 14q32 in T-cell leukemia. Saitou M, Sugimoto J, Hatakeyama T, Russo G, Isobe M. Oncogene 2000; 19: 2796-2802. Medline 10851082

New recurring cytogenetic abnormalities and association of blast cell karyotypes with prognosis in childhood T-cell acute lymphoblastic leukemia: a pediatric oncology group report of 343 cases. Schneider NR, Carroll AJ, Shuster JJ, Pullen DJ, Link MP, Borowitz MJ, Camitta BM, Katz JA, Amylon MD. Blood 2000; 96: 2543-2549. Medline 11001909

The t(14;21)(q11.2;q22) chromosomal translocation associated with T-cell acute lymphoblastic leukemia activates the BHLHB1 gene. Wang J, Jani-Sait SN, Escalon EA, Carroll AJ, de Jong PJ, Kirsch IR, Aplan PD. Proc Natl Acad Sci USA 2000; 97: 3497-3502. Medline 10737801

Atlas Genet Cytogenet Oncol Haematol 2007; 4 651

B-cell acute lymphoblastic leukemia with tandem t(14;14)(q11;q32). Berger R, Busson M, Daniel MT. Cancer Genet Cytogenet 2001; 130: 84-86. Medline 11672780

A new recurrent and specific cryptic translocation, t(5;14)(q35;q32), is associated with expression of the Hox11L2 gene in T acute lymphoblastic leukemia. Bernard OA, Busson-LeConiat M, Ballerini P, Mauchauffe M, Della VV, Monni R, Nguyen KF, Mercher T, Penard-Lacronique V, Pasturaud P, Gressin L, Heilig R, Daniel MT, Lessard M, Berger R. Leukemia 2001; 15: 1495-1504. Medline 11587205

Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Gorre ME, Mohammed M, Ellwood K, Hsu N, Paquette R, Rao PN, Sawyers CL. Science 2001; 293: 876-880. Medline 11423618

Cytogenetic analysis and clinical significance in adult T-cell leukemia/lymphoma: a study of 50 cases from the human T-cell leukemia virus type-1 endemic area, Nagasaki. Itoyama T, Chaganti RS, Yamada Y, Tsukasaki K, Atogami S, Nakamura H, Tomonaga M, Ohshima K, Kikuchi M, Sadamori N. Blood 2001; 97: 3612-3620. Medline 11369658

Molecular cytogenetic and clinical findings in ETV6/ABL1-positive leukemia. Van Limbergen H, Beverloo HB, van Drunen E, Janssens A, Hahlen K, Poppe B, Van Roy N, Marynen P, De Paepe A, Slater R, Speleman F. Genes Chromosomes Cancer 2001; 30: 274-282. Medline 11170285

HOX11L2 expression defines a clinical subtype of pediatric T-ALL associated with poor prognosis. Ballerini P, Blaise A, Busson-Le CM, Su XY, Zucman-Rossi J, Adam M, van den AJ, Perot C, Pellegrino B, Landman-Parker J, Douay L, Berger R, Bernard OA. Blood 2002; 100: 991-997. Medline 12130513

Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Ferrando AA, Neuberg DS, Staunton J, Loh ML, Huard C, Raimondi SC, Behm FG, Pui CH, Downing JR, Gilliland DG, Lander ES, Golub TR, Look AT. Cancer Cell 2002; 1: 75-87. Medline 12086890

Disruption of the RanBP17/Hox11L2 region by recombination with the TCRdelta locus in acute lymphoblastic leukemias with t(5;14)(q34;q11). Hansen-Hagge TE, Schafer M, Kiyoi H, Morris SW, Whitlock JA, Koch P, Bohlmann I, Mahotka C, Bartram CR, Janssen JW. Leukemia 2002; 16: 2205-2212. Medline 12399963

Recurrent involvement of the MLL gene in adult T-lineage acute lymphoblastic leukemia. Hayette S, Tigaud I, Maguer-Satta V, Bartholin L, Thomas X, Charrin C, Gadoux M, Magaud JP,

Atlas Genet Cytogenet Oncol Haematol 2007; 4 652 Rimokh R. Blood 2002; 99: 4647-4649. Medline 12066788

Partial deletions of long arm of chromosome 6: biologic and clinical implications in adult acute lymphoblastic leukemia. Mancini M, Vegna ML, Castoldi GL, Mecucci C, Spirito F, Elia L, Tafuri A, Annino L, Pane F, Rege- Cambrin G, Gottardi M, Leoni P, Gallo E, Camera A, Luciano L, Specchia G, Torelli G, Sborgia M, Gabbas A, Tedeschi A, Della SI, Cascavilla N, Di RF, Mandelli F, Foa R. Leukemia 2002; 16: 2055-2061. Medline 12357357

High incidence of Hox11L2 expression in children with T-ALL. Mauvieux L, Leymarie V, Helias C, Perrusson N, Falkenrodt A, Lioure B, Lutz P, Lessard M. Leukemia 2002; 16: 2417-2422. Medline 12454747

A new translocation that rearranges the AML1 gene in a patient with T-cell acute lymphoblastic leukemia. Mikhail FM, Serry KA, Hatem N, Mourad ZI, Farawela HM, El Kaffash DM, Coignet L, Nucifora G. Cancer Genet. Cytogenet. 2002; 135: 96-100. Medline 12072207

Involvement of the MLL gene in T-lineage acute lymphoblastic leukemia. Moorman AV, Richards S, Harrison CJ. Blood 2002; 100: 2273-2274. Medline 12229886

CALM-AF10 is a common fusion transcript in T-ALL and is specific to the TCRgammadelta lineage. Asnafi V, Radford-Weiss I, Dastugue N, Bayle C, Leboeuf D, Charrin C, Garand R, Lafage-Pochitaloff M, Delabesse E, Buzyn A, Troussard X, Macintyre E. Blood 2003; 102: 1000-1006. Medline 12676784

CDKN2A, CDKN2B, and MTAP gene dosage permits precise characterization of mono- and bi- allelic 9p21 deletions in childhood acute lymphoblastic leukemia. Bertin R, Acquaviva C, Mirebeau D, Guidal-Giroux C, Vilmer E, Cave H. Genes Chromosomes Cancer 2003; 37: 44-57. Medline 12661005 t(4;11)(q21;p15), including one complex translocation t(1;4;11)(p32;q21;p15), in adult T-cell acute lymphoblastic leukemia. Douet-Guilbert N, Morel F, Le Bris MJ, Herry A, Le CG, Marion V, Berthou C, De BM. Leuk Res 2003; 27: 965-967. Medline 12860018

Gene expression signatures in MLL-rearranged T-lineage and B-precursor acute leukemias: dominance of HOX dysregulation. Ferrando AA, Armstrong SA, Neuberg DS, Sallan SE, Silverman LB, Korsmeyer SJ, Look AT. Blood 2003; 102: 262-268. Medline 12637319

Molecular cytogenetic detection of chromosomal breakpoints in T-cell receptor gene loci.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 653 Gesk S, Martin-Subero JI, Harder L, Luhmann B, Schlegelberger B, Calasanz MJ, Grote W, Siebert R. Leukemia 2003; 17: 738-745. Medline 12682631

Childhood T-cell acute lymphoblastic leukemia: the Dana-Farber Cancer Institute acute lymphoblastic leukemia consortium experience. Goldberg JM, Silverman LB, Levy DE, Dalton VK, Gelber RD, Lehmann L, Cohen HJ, Sallan SE, Asselin BL. J Clin Oncol 2003; 21: 3616-3622. Medline 14512392

LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Hacein-Bey-Abina S, Von Kalle C, Schmidt M, McCormack MP, Wulffraat N, Leboulch P, Lim A, Osborne CS, Pawliuk R, Morillon E, Sorensen R, Forster A, Fraser P, Cohen JI, de Saint BG, Alexander I, Wintergerst U, Frebourg T, Aurias A, Stoppa-Lyonnet D, Romana S, Radford-Weiss I, Gross F, Valensi F, Delabesse E, Macintyre E, Sigaux F, Soulier J, Leiva LE, Wissler M, Prinz C, Rabbitts TH, Le Deist F, Fischer A, Cavazzana-Calvo M. Science 2003; 302: 415-419. Medline 14564000

Expression of HOX11 in childhood T-lineage acute lymphoblastic leukaemia can occur in the absence of cytogenetic aberration at 10q24: a study from the Children's Cancer Group (CCG). Kees UR, Heerema NA, Kumar R, Watt PM, Baker DL, La MK, Uckun FM, Sather HN. Leukemia 2003; 17: 887-893. Medline 12750702

NUP98 is fused to adducin 3 in a patient with T-cell acute lymphoblastic leukemia and myeloid markers, with a new translocation t(10;11)(q25;p15). Lahortiga I, Vizmanos JL, Agirre X, Vazquez I, Cigudosa JC, Larrayoz MJ, Sala F, Gorosquieta A, Perez-Equiza K, Calasanz MJ, Odero MD. Cancer Res 2003; 63: 3079-3083. Medline 12810632

The cardiac homeobox gene NKX2-5 is deregulated by juxtaposition with BCL11B in pediatric T-ALL cell lines via a novel t(5;14)(q35.1;q32.2). Nagel S, Kaufmann M, Drexler HG, MacLeod RA. Cancer Res 2003; 63: 5329-5334. Medline 14500364

Clinical heterogeneity in childhood acute lymphoblastic leukemia with 11q23 rearrangements. Pui CH, Chessells JM, Camitta B, Baruchel A, Biondi A, Boyett JM, Carroll A, Eden OB, Evans WE, Gadner H, Harbott J, Harms DO, Harrison CJ, Harrison PL, Heerema N, Janka-Schaub G, Kamps W, Masera G, Pullen J, Raimondi SC, Richards S, Riehm H, Sallan S, Sather H, Shuster J, Silverman LB, Valsecchi MG, Vilmer E, Zhou Y, Gaynon PS, Schrappe M. Leukemia 2003; 17: 700-706. Medline 12682627

Amplification of the ABL gene in T-cell acute lymphoblastic leukemia. Barber KE, Martineau M, Harewood L, Stewart M, Cameron E, Strefford JC, Rutherford S, Allen TD, Broadfield ZJ, Cheung KL, Harris RL, Jalali GR, Moorman AV, Robinson HM, Harrison CJ. Leukemia 2004; 18: 1153-1156. Medline 15057249

Clinical significance of HOX11L2 expression linked to t(5;14)(q35;q32), of HOX11 expression, and of SIL-TAL fusion in childhood T-cell malignancies: results of EORTC studies 58881 and

Atlas Genet Cytogenet Oncol Haematol 2007; 4 654 58951. Cave H, Suciu S, Preudhomme C, Poppe B, Robert A, Uyttebroeck A, Malet M, Boutard P, Benoit Y, Mauvieux L, Mechinaud F, Grardel N, Mazingue F, Dupont M, Margueritte G, Pages MP, Bertrand Y, Plouvier E, Brunie G, Bastard C, Plantaz D, Vande Velde I, Hagemeijer A, Speleman F, Lessard M, Otten J, VilmerE, Dastugue N; EORTC-CLG. Blood 2004; 103:442-450. Medline 14504110

Biallelic transcriptional activation of oncogenic transcription factors in T-cell acute lymphoblastic leukemia. Ferrando AA, Herblot S, Palomero T, Hansen M, Hoang T, Fox EA, Look AT. Blood 2004; 103: 1909-1911. Medline 14604958

Prognostic importance of TLX1 (HOX11) oncogene expression in adults with T-cell acute lymphoblastic leukaemia. Ferrando AA, Neuberg DS, Dodge RK, Paietta E, Larson RA, Wiernik PH, Rowe JM, Caligiuri MA, Bloomfield CD, Look AT. Lancet 2004; 363: 535-536. Medline 14975618

Fusion of NUP214 to ABL1 on amplified episomes in T-cell acute lymphoblastic leukemia. Graux C, Cools J, Melotte C, Quentmeier H, Ferrando A, Levine R, Vermeesch JR, Stul M, Dutta B, Boeckx N, Bosly A, Heimann P, Uyttebroeck A, Mentens N, Somers R, MacLeod RA, Drexler HG, Look AT, Gilliland DG, Michaux L, Vandenberghe P, Wlodarska I, Marynen P, Hagemeijer A. Nat Genet 2004; 36: 1084-1089. Medline 15361874

IGH gene involvement in two cases of acute lymphoblastic leukemia with t(14;14)(q11;q32) identified by sequential R-banding and fluorescence in situ hybridization. Liu S, Bo L, Liu X, Li C, Qin S, Wang J. Cancer Genet. Cytogenet. 2004; 152: 141-145. Medline 15262434

Activation of the T-cell oncogene LMO2 after gene therapy for X-linked severe combined immunodeficiency. McCormack MP, Rabbitts TH. N Engl J Med 2004; 350: 913-922. Medline 14985489

Various types of rearrangements target TLX3 locus in T-cell acute lymphoblastic leukemia. Su XY, Busson M, Della VV, Ballerini P, Dastugue N, Talmant P, Ferrando AA, Baudry-Bluteau D, Romana S, Berger R, Bernard OA. Genes Chromosomes Cancer 2004; 41: 243-249. Medline 15334547

Split-signal FISH for detection of chromosome aberrations in acute lymphoblastic leukemia. van der Burg M, Poulsen TS, Hunger SP, Beverloo HB, Smit EM, Vang-Nielsen K, Langerak AW, van Dongen JJ. Leukemia 2004; 18: 895-908. Medline 15042105

Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Weng AP, Ferrando AA, Lee W, Morris JP, Silverman LB, Sanchez-Irizarry C, Blacklow SC, Look AT, Aster JC.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 655 Science 2004; 306: 269-271. Medline 15472075

Molecular genetics of acute lymphoblastic leukemia. Armstrong SA, Look AT. J Clin Oncol 2005; 23: 6306-6315. Medline 16155013

NUP214-ABL1 amplification in t(5;14)/HOX11L2-positive ALL present with several forms and may have a prognostic significance. Ballerini P, Busson M, Fasola S, van den AJ, Lapillonne H, Romana SP, Marynen P, Bernard OA, Landman-Parker J, Berger R. Leukemia 2005; 19: 468-470. Medline 15674415

ABL1 amplification in T-cell acute lymphoblastic leukemia. Bernasconi P, Calatroni S, Giardini I, Inzoli A, Castagnola C, Cavigliano PM, Rocca B, Boni M, Quarna J, Zappatore R, Caresana M, Bianchessi C, Pallavicini EB, Lazzarino M. Cancer Genet Cytogenet 2005; 162: 146-150. Medline 16213363

Fusion of EML1 to ABL1 in T-cell acute lymphoblastic leukemia with cryptic t(9;14)(q34;q32). De Keersmaecker K, Graux C, Odero MD, Mentens N, Somers R, Maertens J, Wlodarska I, Vandenberghe P, Hagemeijer A, Marynen P, Cools J. Blood 2005; 105: 4849-4852. Medline 15713800

Genetic insights in the pathogenesis of T-cell acute lymphoblastic leukemia. De Keersmaecker K, Marynen P, Cools J. Haematologica 2005; 90: 1116-1127. Medline 16079112

Significance of HOX11L2/TLX3 expression in children with T-cell acute lymphoblastic leukemia treated on Children's Cancer Group protocols. Gottardo NG, Jacoby PA, Sather HN, Reaman GH, Baker DL, Kees UR. Leukemia 2005; 19: 1705-1708. Medline 15990867

Novel cryptic chromosomal rearrangements in childhood acute lymphoblastic leukemia detected by multiple color fluorescent in situ hybridization. Poppe B, Cauwelier B, Van LH, Yigit N, Philippe J, Verhasselt B, De PA, Benoit Y, Speleman F. Haematologica 2005; 90: 1179-1185. Medline 16154840

Disruption of the BCL11B gene through inv(14)(q11.2q32.31) results in the expression of BCL11B-TRDC fusion transcripts and is associated with the absence of wild-type BCL11B transcripts in T-ALL. Przybylski GK, Dik WA, Wanzeck J, Grabarczyk P, Majunke S, Martin-Subero JI, Siebert R, Dolken G, Ludwig WD, Verhaaf B, van Dongen JJ, Schmidt CA, Langerak AW. Leukemia 2005; 19: 201-208. Medline 15668700

Quest for effective agents to combat T-cell acute lymphoblastic leukemia. Pui CH.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 656 Eur J Cancer 2005; 41: 1243-1245. Medline 15939259

Philadelphia-chromosome-positive T-lymphoblastic leukemia: acute leukemia or chronic myelogenous leukemia blastic crisis. Raanani P, Trakhtenbrot L, Rechavi G, Rosenthal E, Avigdor A, Brok-Simoni F, Leiba M, Amariglio N, Nagler A, Ben-Bassat I. Acta Haematol 2005; 113: 181-189. Medline 15870488

Analysis of balanced rearrangements of chromosome 6 in acute leukemia: clustered breakpoints in q22-q23 and possible involvement of c-MYB in a new recurrent translocation, t(6;7)(q23;q32 through 36). Sinclair PB, Harrison CJ, Jarosova M, Foroni L. Haematologica 2005; 90: 602-611. Medline 15921375

HOXA genes are included in genetic and biologic networks defining human acute T-cell leukemia (T-ALL). Soulier J, Clappier E, Cayuela JM, Regnault A, Garcia-Peydro M, Dombret H, Baruchel A, Toribio ML, Sigaux F. Blood 2005; 106: 274-286. Medline 15774621

A new recurrent inversion, inv(7)(p15q34), leads to transcriptional activation of HOXA10 and HOXA11 in a subset of T-cell acute lymphoblastic leukemias. Speleman F, Cauwelier B, Dastugue N, Cools J, Verhasselt B, Poppe B, Van RN, Vandesompele J, Graux C, Uyttebroeck A, Boogaerts M, De MB, Benoit Y, Selleslag D, Billiet J, Robert A, Huguet F, Vandenberghe P, De PA, Marynen P, Hagemeijer A. Leukemia 2005; 19: 358-366. Medline 15674412

Fusion of NUP214 to ABL1 on amplified episomes in T-ALL--implications for treatment. Stergianou K, Fox C, Russell NH. Leukemia 2005; 19: 1680-1681. Medline 16015385

A t(8;9) translocation with PCM1-JAK2 fusion in a patient with T-cell lymphoma. Adelaide J, Perot C, Gelsi-Boyer V, Pautas C, Murati A, Copie-Bergman C, Imbert M, Chaffanet M, Birnbaum D, Mozziconacci MJ. Leukemia 2006; 20: 536-537. Medline 16424865

HOXA cluster deregulation in T-ALL associated with both a TCRD-HOXA and a CALM-AF10 chromosomal translocation. Bergeron J, Clappier E, Cauwelier B, Dastugue N, Millien C, Delabesse E, Beldjord K, Speleman F, Soulier J, Macintyre E, Asnafi V. Leukemia 2006; 20: 1184-1187. Medline 16572206

Activating NOTCH1 mutations predict favorable early treatment response and long-term outcome in childhood precursor T-cell lymphoblastic leukemia. Breit S, Stanulla M, Flohr T, Schrappe M, Ludwig WD, Tolle G, Happich M, Muckenthaler MU, Kulozik AE. Blood 2006; 108: 1151-1157.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 657 Medline 16614245

NUP214-ABL1 in adult T-ALL: the GMALL study group experience. Burmeister T, Gokbuget N, Reinhardt R, Rieder H, Hoelzer D, Schwartz S. Blood 2006; 108: 3556-3559. Medline 16873673

Molecular cytogenetic study of 126 unselected T-ALL cases reveals high incidence of TCRbeta locus rearrangements and putative new T-cell oncogenes. Cauwelier B, Dastugue N, Cools J, Poppe B, Herens C, De PA, Hagemeijer A, Speleman F. Leukemia 2006; 20: 1238-1244. Medline 16673021

Cyclin D2 dysregulation by chromosomal translocations to TCR loci in T-cell acute lymphoblastic leukemias. Clappier E, Cuccuini W, Cayuela JM, Vecchione D, Baruchel A, Dombret H, Sigaux F, Soulier J. Leukemia 2006; 20: 82-86. Medline 16270038

Transition from EML1-ABL1 to NUP214-ABL1 positivity in a patient with acute T-lymphoblastic leukemia. De Keersmaecker K, Lahortiga I, Graux C, Marynen P, Maertens J, Cools J, Vandenberghe P. Leukemia 2006; 20: 2202-2204. Medline 17024111

Notch 1 activation in the molecular pathogenesis of T-cell acute lymphoblastic leukaemia. Grabher C, von BH, Look AT. Nat Rev Cancer 2006; 6: 347-359. Medline 16612405

High incidence of Notch-1 mutations in adult patients with T-cell acute lymphoblastic leukemia. Mansour MR, Linch DC, Foroni L, Goldstone AH, Gale RE. Leukemia 2006; 20: 537-539. Medline 16424867

CUTLL1, a novel human T-cell lymphoma cell line with t(7;9) rearrangement, aberrant NOTCH1 activation and high sensitivity to gamma-secretase inhibitors. Palomero T, Barnes KC, Real PJ, Bender JL, Sulis ML, Murty VV, Colovai AI, Balbin M, Ferrando AA. Leukemia 2006; 20: 1279-1287. Medline 16688224

Fusion of NUP98 and the SET binding protein 1 (SETBP1) gene in a paediatric acute lymphoblastic leukemia with t(11;18)(p15;q12). Panagopoulos I, Kerndrup G, Carlsen N, Strombeck B, Isaksson M, Johansson B. Br J Haematol. 2006; 136:294-296. Medline 17233820

The effect of a novel recombination between the homeobox gene NKX2-5 and the TRD locus in T-cell acute lymphoblastic leukemia on activation of the NKX2-5 gene. Przybylski GK, Dik WA, Grabarczyk P, Wanzeck J, Chudobska P, Jankowski K, von BA, van Dongen JJ, Schmidt CA, Langerak AW. Haematologica 2006; 91: 317-321. Medline 16531254

Atlas Genet Cytogenet Oncol Haematol 2007; 4 658 HOX11L2/TLX3 is transcriptionally activated through T-cell regulatory elements downstream of BCL11B as a result of the t(5;14)(q35;q32). Su XY, la-Valle V, ndre-Schmutz I, Lemercier C, Radford-Weiss I, Ballerini P, Lessard M, Lafage- Pochitaloff M, Mugneret F, Berger R, Romana SP, Bernard OA, Penard-Lacronique V. Blood 2006; 108: 4198-4201. Medline 16926283

The outcome of molecular-cytogenetic subgroups in pediatric T-cell acute lymphoblastic leukemia: a retrospective study of patients treated according to DCOG or COALL protocols. van Grotel M, Meijerink JP, Beverloo HB, Langerak AW, Buys-Gladdines JG, Schneider P, Poulsen TS, den Boer ML, Horstmann M, Kamps WA, Veerman AJ, Van Wering ER, van Noesel MM, Pieters R. Haematologica 2006; 91: 1212-1221. Medline 16956820

A new recurrent 9q34 duplication in pediatric T-cell acute lymphoblastic leukemia. van Vlierberghe P, Meijerink JP, Lee C, Ferrando AA, Look AT, Van Wering ER, Beverloo HB, Aster JC, Pieters R. Leukemia 2006; 20: 1245-1253. Medline 16673019

The cryptic chromosomal deletion del(11)(p12p13) as a new activation mechanism of LMO2 in pediatric T-cell acute lymphoblastic leukemia. van Vlierberghe P, van GM, Beverloo HB, Lee C, Helgason T, Buijs-Gladdines J, Passier M, Van Wering ER, Veerman AJ, Kamps WA, Meijerink JP, Pieters R. Blood 2006; 108: 3520-3529. Medline 16873670

Trisomy 4 as sole karyotypic abnormality in acute lymphoblastic leukemia: different clinical features and treatment response between B and T phenotypes? Yip SF, Wan TS, Chan LC, Chan GC. Cancer Genet Cytogenet. 2006; 164: 94-95. Medline 16364773

Favorable outcome for adolescents with acute lymphoblastic leukemia treated on Dana-Farber Cancer Institute Acute Lymphoblastic Leukemia Consortium Protocols. Barry E, DeAngelo DJ, Neuberg D, Stevenson K, Loh ML, Asselin BL, Barr RD, Clavell LA, Hurwitz CA, Moghrabi A, Samson Y, Schorin M, Cohen HJ, Sallan SE, Silverman LB. J Clin Oncol. 2007; 25: 813-819. Medline 17327603

Clinical, cytogenetic and molecular characteristics of 14 T-ALL patients carrying the TCRbeta- HOXA rearrangement: a study of the Groupe Francophone de Cytogenetique Hematologique. Cauwelier B, Cave H, Gervais C, Lessard M, Barin C, Perot C, van den AJ, Mugneret F, Charrin C, Pages MP, Gregoire MJ, Jonveaux P, Lafage-Pochitaloff M, Mozzicconacci MJ, Terre C, Luquet I, Cornillet-Lefebvre P, Laurence B, Plessis G, Lefebvre C, Leroux D, Antoine-Poirel H, Graux C, Mauvieux L, Heimann P, Chalas C, Clappier E, Verhasselt B, Benoit Y, Moerloose BD, Poppe B, Van RN, Keersmaecker KD, Cools J, Sigaux F, Soulier J, Hagemeijer A, Paepe AD, Dastugue N, Berger R, Speleman F. Leukemia 2007; 21: 121-128. Medline 17039236

Duplication of the MYB oncogene in T cell acute lymphoblastic leukemia. Lahortiga,I.; De,Keersmaecker K.; van,Vlierberghe P.; Graux,C.; Cauwelier,B.; Lambert,F.; Mentens,N.; Beverloo,H.B.; Pieters,R.; Speleman,F.; Odero,M.D.; Bauters,M.; Froyen,G.; Marynen,P.; Vandenberghe,P.; Wlodarska,I.; Meijerink,J.P.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 659 Nat Genet. 2007; 39: 593-595. Medline 17435759

Activation of TLX3 and NKX2-5 in t(5;14)(q35;q32) T-cell acute lymphoblastic leukemia by remote 3'-BCL11B enhancers and coregulation by PU.1 and HMGA1. Nagel S, Scherr M, Kel A, Hornischer K, Crawford GE, Kaufmann M, Meyer C, Drexler HG, MacLeod RA. Cancer Res. 2007; 67: 1461-1471. Medline 17308084

Contributor(s) Written 05-2007 Susana C Raimondi Citation This paper should be referenced as such : Raimondi SC . T-lineage acute lymphoblastic leukemia (T-ALL). Atlas Genet Cytogenet Oncol Haematol. May 2007 . URL : http://AtlasGeneticsOncology.org/Anomalies/TALLID1374.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 660 Atlas of Genetics and Cytogenetics in Oncology and Haematology

t(9;11)(p22;p15) Identity Note rare abnormality Clinics and Pathology Disease Acute non lymphoblastic leukemia (ANLL), one case of transformed chronic myeloid leukemia (CML-BC). Phenotype / cell stem ANLL FAB TYPE M1, M2, M2/M3 origin Epidemiology Five cases reported to date: four adults and one 5-year-old girl. Prognosis Unfavorable outcome Cytogenetics

A) Partial Q-banded karyotype showing the t(9;11)(p22;p15); derivative chromosomes are on the right of each pair. B) FISH analysis using PAC 1173K1 (NUP98) and RP11- 356J15 (PSIP1) probes (green and red signals, respectively). Arrow and arrowhead indicate the fusion signals on the der(9) and the der(11), respectively.

Additional Sole anomaly in the four ANLL cases, t(9;11) in addition to the t(9;22) in the CML-BC anomalies case. Genes involved and Proteins

Atlas Genet Cytogenet Oncol Haematol 2007; 4 661 Gene Name NUP98 Location 11p15.5 Protein Nucleoporin 98, a 98 kDa component of the nuclear pore complex involved in nucleo- cytoplasmic transport. Gene Name PSIP1 (PC4 and SFRS1 interacting protein 1) aliases LEDGF (lens epithelium-derived growth factor), p75, p52. Location 9p22.3 Note The gene contains at least 15 exons and 14 introns Dna / Rna Two alternative splice variants: p75 and p52 Protein Chromatin-associated protein involved in trascriptional regulation, mRNA splicing and cell survival in vitro. Contains a PWWP domain and AT hook-like motifs. Result of the chromosomal anomaly Hybrid gene 5'NUP98 - 3'PSIP1; The breakpoint in the NUP98 gene is the same in three out of four Description cases studied (nucleotide 1230), while the breakpoints in PSIP1 are variable. Fusion Protein It fuses the GLFG repeat domains of NUP98 to the COOH-terminal of the PSIP1 Description External links Other t(9;11)(p22;p15) Mitelman database (CGAP - NCBI) database Other t(9;11)(p22;p15) CancerChromosomes (NCBI) database To be noted Additional cases are needed to delineate the epidemiology of this rare entity: you are welcome to submit a paper to our new Case Report section. Bibliography Biphenotypic leukemia with t(9;11)(p22;p15). Ha SY, Chan LC. Cancer Genet Cytogenet 1994; 76: 116-117. Medline 7923059 t(9;11)(p22;p15) in acute myeloid leukemia results in a fusion between NUP98 and the gene encoding transcriptional coactivators p52 and p75-lens epithelium-derived growth factor (LEDGF). Ahuja HG, Hong J, Aplan PD, Tcheurekdjian L, Forman SJ, Slovak ML. Cancer Res 2000; 60: 6227-6229. Medline 11103774

Lens epithelium-derived growth factor (LEDGF/p75) and p52 are derived from a single gene by alternative splicing. Singh DP, Kimura A, Chylack LT, Shinohara T. Gene 2000; 242: 265-273. Medline 10721720

Fusion of the NUP98 gene with the LEDGF/p52 gene defines a recurrent acute myeloid leukemia translocation. Hussey DJ, Moore S, Nicola M, Dobrovic A. BMC Genet 2001; 2: 20. Medline 11737860

Atlas Genet Cytogenet Oncol Haematol 2007; 4 662

NUP98-LEDGF fusion and t(9;11) in transformed chronic myeloid leukemia. Grand FH, Koduru P, Cross NC, Allen SL. Leuk Res 2005; 29: 1469-1472. Medline 15982735 t(9;11)(p22;p15) with NUP98-LEDGF fusion gene in pediatric acute myeloid leukemia. Morerio C, Acquila M, Rosanda C, Rapella A, Tassano E, Micalizzi C, Panarello C. Leuk Res 2005; 29: 467-470. Medline 15725483

Disruption of Ledgf/Psip1 results in perinatal mortality and homeotic skeletal transformations. Sutherland HG, Newton K, Brownstein DG, Holmes MC, Kress C, Semple CA, Bickmore WA. Mol Cell Biol 2006; 26: 7201-7210. Medline 16980622

Contributor(s) Written 05-2007 Cristina Morerio, Claudio Panarello Dipartimento di Ematologia ed Oncologia Pediatrica, IRCCS Istituto

Giannina Gaslini, Largo G. Gaslini 5, 16147 Genoa, Italy. Citation This paper should be referenced as such : Morerio C, Panarello C . t(9;11)(p22;p15). Atlas Genet Cytogenet Oncol Haematol. May 2007 . URL : http://AtlasGeneticsOncology.org/Anomalies/t0911p22p15ID1232.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 663 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Thyroid: Papillary Carcinoma with inv(7)(q21q34) Identity Note Intrachromosomal rearrangement.

The fusion is product of a paracentric inversion of the long arm of chromosome 7. Clinics and Pathology Disease Papillary Thyroid Carcinoma (PTC). Note Papillary carcinoma is a well-differentiated tumor of thyroid follicular cell origin and is the most common thyroid malignancy, constituting about 80% of all cases. The only known etiologic factor for this type of tumor is exposure to ionizing radiation, although the history of radiation exposure is found in less than 10% of all cases. In the last year it became evident that alterations in the MAPK pathway, an intracellular cascade that regulates cell differentiation, proliferation and survival, are highly prevalent in papillary carcinomas. One type of genetic alterations found in these tumors involve the proto- oncogene RET, which encodes a receptor tyrosine kinase, and is a result of

Atlas Genet Cytogenet Oncol Haematol 2007; 4 664 chromosomal rearrangements called RET/PTC (20-30% of cases). A small portion of cases presents with chromosomal rearrangements involving the NTRK gene, encoding another receptor tyrosine kinase. Point mutations of the RAS gene, another effector of the MAPK pathway, are found in about 15% of cases, and are particularly common in the follicular variant of papillary carcinoma. The most common alteration in these tumors is a point mutation of the serine-threonine kinase BRAF, yet another effector of the MAPK pathway (40% of cases). The point mutation typically involves nucleotide 1799 and leads to V600E substitution. The AKAP9-BRAF rearrangement is another mechanism of BRAF activation and is found in up to 11% of tumors associated with radiation exposure, but in less than 1% of sporadic tumors in the general population. Cytogenetics Cytogenetics Fluorescence in situ hybridization (FISH) with probes for the AKAP9 and BRAF gene Molecular can be used to detect the AKAP9-BRAF rearrangement, as it displays split of signals corresponding to both genes and fusion of signals on one chromosome.

Reciprocal fusion detected by FISH with probes corresponding to the BRAF (red) and AKAP9 (green) genes. Genes involved and Proteins Gene Name AKAP9 Location 7q21.2 Protein AKAP9 belongs to a family of Protein A kinase (PKA) anchor proteins that bind the regulatory subunit of the PKA and target it to different locations within the cell. AKAP9, in particular, displays a centrosomal and Golgi compartmentalization. Gene Name BRAF Location 7q34 Protein BRAF belongs to the family of RAF proteins which are effectors of the MAPK signaling cascade, a crucial pathway that regulates cell differentiation, proliferation and survival. Among 3 RAF isoforms (ARAF, BRAF, CRAF), BRAF displays the highest basal kinase activity. BRAF point mutations within the kinase domain of the protein occur in several tumor types including papillary thyroid carcinoma.

Result of the chromosomal anomaly

Atlas Genet Cytogenet Oncol Haematol 2007; 4 665 Hybrid Gene

Scheme of the AKAP9-BRAF fusion. Arrows indicate breakpoints within both genes. Description Breakpoints occur within AKAP9 intron 8 and BRAF intron 8. The fusion transcript contains exon 1-8 of AKAP9 fused in frame with exon 9-18 of BRAF for a total open reading frame 4476 bp in size. Detection AKAP9-BRAF rearrangement can be detected by RT-PCR using primers flanking the breakpoint area (forward: 5'-AGCAAGAACAGTTGATTTTGGA-3'; reverse: 5'- GCAGACAAACCTGTGGTTGA-3') with the expected product of 181 bp. Amplify for 35 cycles (94C 5 min, 55C 1 min, 72C 1 min 20 sec). Fusion

Protein Description The AKAP9-BRAF fusion protein contains the N-terminal portion of AKAP9 (1087 aa) and the C-terminal part of BRAF (386 aa) for a total protein size of 1473 aa (MW: 172 kDa). In the fusion protein, AKAP9 lacks the region responsible for binding to the regulatory subunit of PKA and BRAF lacks the auto-inhibitory N-terminal portion of the protein and maintain intact the C-terminal tyrosine kinase domain. Oncogenesis The functioning of AKAP9-BRAF as an oncogene has been demonstrated by in vitro kinase assay and in vivo tumorigenesis assay. The oncogenic mechanism is probably due to the loss of the auto-inhibitory portion of BRAF in the fusion protein and fusion of the kinase domain of BRAF to the active promoter of AKAP9, resulting in constitutive activation of the BRAF tyrosine kinase and of the MAPK pathway. Bibliography Mutations of the BRAF gene in human cancer. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W, Davis N, Dicks E, Ewing R, Floyd Y, Gray K, Hall S, Hawes R, Hughes J, Kosmidou V, Menzies A, Mould C, Parker A, Stevens C, Watt S, Hooper S, Wilson R, Jayatilake H, Gusterson BA, Cooper C, Shipley J, Hargrave D, Pritchard-Jones K, Maitland N, Chenevix-Trench G, Riggins GJ, Bigner DD, Palmieri G, Cossu A, Flanagan A, Nicholson A, Ho JW, Leung SY, Yuen ST, Weber BL, Seigler HF, Darrow TL, Paterson H, Marais R, Marshall CJ, Wooster R, Stratton MR, Futreal PA. Nature. 2002; 417: 949-954. Medline 12068308

Oncogenic AKAP9-BRAF fusion is a novel mechanism of MAPK pathway activation in thyroid cancer. Ciampi R, Knauf JA, Kerler R, Gandhi M, Zhu Z, Nikiforova MN, Rabes HM, Fagin JA, Nikiforov YE. J Clin Invest. 2005; 115: 94-101.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 666 Medline 15630448

Alterations of the BRAF gene in thyroid tumors. Ciampi R, Nikiforov YE. Endocr Pathol. 2005; 16: 163-172. (REVIEW) Medline 16299399

A new mechanism of BRAF activation in human thyroid papillary carcinomas. Fusco A, Viglietto G, Santoro M. J Clin Invest. 2005; 115: 20-23. Medline 15630436

Minireview: RET/PTC Rearrangements and BRAF mutations in thyroid tumorigenesis. Ciampi R, Nikiforov YE. Endocrinology. 2007; 148(3): 936-941 (REVIEW). Medline 16946010

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed Contributor(s) Written 04-2007 Raffaele Ciampi, Yuri E. Nikiforov Dip. di Endocrinologia e Metabolismo, Università di Pisa, via Paradisa, 2,

56124 Pisa, Italy. Citation This paper should be referenced as such : Ciampi R, Nikiforov YE . Thyroid: Papillary Carcinoma with inv(7)(q21q34). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Tumors/PapilThyrCarcinv7ID5459.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 667 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Soft Tissue Tumors: t(X;20)(p11.23;q13.33) in Biphasic Synovial Sarcoma Clinics and Pathology Disease Biphasic Synovial Sarcoma Pathology The excised tumor consisted of a single 3-cm nodulus with relatively well-defined borders and a grey cut surface. No necrosis was seen. In histological sections stained with H and E, the tumor was mainly composed of uniform, closely packed spindle cells, with a high nuclear/cytoplasmic ratio and finely dispersed chromatin. The tumor cells were arranged in fascicles and whorls, with small foci of calcification. The mitotic activity was low. In addition, small and irregular glandular formations lined by flattened cuboidal cells were noted in the peripheral parts of the tumor, supporting the diagnosis of biphasic synovial sarcoma. These cells, as well as many spindle cells, expressed cytokeratins and epithelial membrane antigen (EMA). Treatment The patient was given postoperative chemo- and radiotherapy. Evolution Four months postoperatively, the patient is alive without any sign of local recurrence or metastatic disease. Cytogenetics Cytogenetics 48,XY,+mar1,+mar2[5]/47,idem,dic(19;22)(q13;q13)[3] . Morphological

Top: Partial karyotype showing G-banded chromosomes X, 18, 20 and markers 1 and 2. Bottom: FISH cohybridization using a pool of RP11-552E4 and RP11-344N17 (red), RP5-1005F21 (purple), and pZ20 (green) as probes for chromosomes X, 20, and the two markers. The results on mar2 are shown as a three-color image (left), as well as separately for each of the probes (right).

Cytogenetics With a pool of SSX BAC probes, one and two signals were seen on mar1 and mar2, Molecular respectively. On the latter marker chromosome, one of the signals co-localized with the signal from RP5-1005F21, suggesting the presence of a fusion gene between SS18L1 and one of the SSX genes. Probes RP5-1005F21 (SS18L1), RP11-552E4 and RP11-344N17 (pool of SSX genes). Genes involved and Proteins

Atlas Genet Cytogenet Oncol Haematol 2007; 4 668 Gene Name SS18L1 Location 20q13.33 Note Paralogous gene to SS18 (18q11.2). Dna / Rna Genomic (chr20:60,169,869-60,189,352). Transcript of 4566 bp (NM_198935). Gene Name SSX1 Location Xp11.23 Note Gene belonging to the SSX gene family. Dna / Rna Genomic (chrX:47,999,741-48,011,823). Transcript of 1271 bp (NM_005635). Protein 188 amino acids (Q16384).

Result of the chromosomal anomaly Hybrid Gene Description Nucleotide 1216 (exon 10) of SS18L1 (Accession Number XM_037202) was fused in- frame with nt 422 (exon 6) of SSX1 (Accession Number X86174). Fusion

Protein Description In the putative SS18L1/SSX1 chimeric protein, the last 8 amino acid residues of the SS18L1 protein are replaced by 78 amino acids from the COOH-terminal part of SSX1. By analogy with what is presumed to be the case for the SS18/SSX fusion protein, SS18L1/SSX1 is likely to show an altered transcriptional pattern, with the COOH- terminal SSX domain redirecting the SS18L1 activation domain to new target promoters. Bibliography A novel fusion gene, SS18L1/SSX1, in synovial sarcoma. Storlazzi CT, Mertens F, Mandahl N, Gisselsson D, Isaksson M, Gustafson P, Domanski HA, Panagopoulos I. Genes Chromosomes Cancer. 2003; 37:195-200. Medline 12696068 REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed Contributor(s) Written 04-2007 Clelia Tiziana Storlazzi, Fredrik Mertens Department of Genetics and Microbiology, University of Bari, Via Amendola 165/A, 70126 Bari, Italy (CTS); and Dept of Clinical Genetics, Lund University Hospital, SE-221 85 Lund, Sweden (FM). Citation This paper should be referenced as such : Storlazzi CT, Mertens F . Soft Tissue Tumors: t(X;20)(p11.23;q13.33) in Biphasic Synovial Sarcoma. Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Tumors/SynovialSarcomtX20ID5464.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 669 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Soft Tissue Tumors: Aggressive angiomyxoma Identity Note The term aggressive was introduced to emphasize the locally aggressive behaviour and the high potential for local recurrence, it does not reflect a high probability for metastasis, as only 2 cases with metastatic disease have been reported. The name angiomyxoma was chosen because of the similarity to myxoma and the notable vascular component. Other names Deep "aggressive" angiomyxoma Classification Aggressive angiomyxoma (AA) is a soft tissue neoplasm. The term AA was not coined until 1983 but similar tumours were described as early as in the 1860ies. In the latest WHO-classification AA is now classified under "Tumours of uncertain differentiation". Clinics and Pathology Disease AA is a neoplasm. It is defined as benign but has infiltrative potential into skeletal muscle and fat. The disease is therefore considered locally aggressive although it does not infiltrate surrounding viscus. Only 2 cases with metastatic disease have been published. Etiology No etiologic factors are known. Epidemiology AA is a rare neoplasm with about 150 reported cases. It is most often found in women in reproductive age with a peak incidence in the fourth decade of life. The female:male ratio is 6:1. Clinics AA is most often found in or in proximity to the lower pelvis, more specifically perineum, vulva, vagina or inguinal regions. The majority of patients present with a slow-growing mass which is otherwise asymptomatic and this is frequently the only symptom/sign. Observed accompanying symptoms and signs are regional pain, a feeling of local pressure, or dyspareunia. Tumour size is often underestimated by physical examination. It is worth noticing that the frequency of symptoms and signs attributable to local growth is lower than what would be expected from the relatively large size of most of these tumours. AA is often clinically misdiagnosed, most often mistaken for a Bartholin cyst. Radiographically, AA is isointense or has low signal intensity on T1-weighted MRI, and have a whorled pattern of high signal intensity on T2-weighted MRI. These tumours show contrast enhancement, reflecting their inherent vasculature, and tend to displace and grow around structures rather than infiltrate them. Pathology Most AA are big, often more than 10 cm in largest diameter. These tumours are macroscopically lobulated and may adhere to surrounding soft tissue. Microscopically, cells with a spindled or stellate morphology are seen, embedded in a loose matrix consisting of wavy collagen and oedema. Cellularity is generally low to moderate. Infiltration into fat, muscle, and nerves is seen. The hallmark of AA is vessels of varying calibre haphazardly scattered throughout the tumour parenchyma, whereas mitotic figures are scarce. Immunohistochemically, most AA are positive for desmin, smooth muscle actin, muscle-specific actin, vimentin, oestrogen receptor, and progesterone receptor. Some tumours are positive for CD34, whereas S100 is invariably negative. Based on these observations, a myofibroblastic differentiation of the neoplastic cells is suggested. Treatment Radical surgery with wide margins is the treatment of choice. Because most tumours are large, grow infiltrative and blends with adjacent soft tissue, and are located in close proximity to vital organs such as bladder and rectum, wide excision is not always possible and/or may cause significant morbidity. In such situations watchful waiting

Atlas Genet Cytogenet Oncol Haematol 2007; 4 670 may be advisable because these tumours may be stable with no or very limited growth over long periods of time. Several reported attempts using chemotherapy and radiotherapy as part of the treatment for AA have been disappointing, probably due to the low mitotic activity/growth fraction of cells. Most AA express oestrogen and progesterone receptors and are likely to have a hormone-dependent growth. Because of this, treatment with GnRH agonists has been administered to AA patients, and some case reports with dramatic responses to such GnRH agonists have been reported Prognosis The prognosis is very good. Only 2 cases with metastatic disease followed by death have been reported. Recurrences are common, though, reported to be between 9 and 72 %. These numbers are uncertain because late recurrences may develop several years after the primary tumour was found, and long-term follow-up of the patients is therefore very important. The major problem posed by this tumour is the often mutilating surgery necessary to cure the patient. Cytogenetics Cytogenetics Although only 6 cases of AA showing chromosomal aberrations have been described Morphological so far, a non-random involvement of chromosomal band 12q15 has been identified. The cytogenetic rearrangements hitherto described, involving this band, are: t(11;12)(q23;q15), t(7;12)(q22;q13-14), t(8;12)(p12;q15), and der(12)t(5;12)(q31;p11)inv(12)(p11q14). An additional case with 12q15 rearrangement has been described using fluorescence in situ hybridization.

Ideograms and G-banded images of chromosomes 11 and 12 from an AA are depicted. Normal chromosome homologs and rearranged chromosomes are shown. Arrows indicate breakpoint positions. Cytogenetics The 12q15 rearrangements lead to alterations of the high mobility group (HMG) gene Molecular HMGA2 (previously known as HMGIC). Monosomy of the X chromosome has been reported in one AA, whereas another AA showed monosomy 12 among other abnormalities. Genes involved and Proteins Gene Name HMGA2

Atlas Genet Cytogenet Oncol Haematol 2007; 4 671 Location 12q15 Dna / Rna The HMGA2 gene consists of 5 exons spanning 141 kb of genomic DNA. It is highly expressed in embryonic tissue. In normal adult tissues, only low gene expression levels have been detected, and only in kidney, lung, and synovia. In all other terminally differentiated cells, no expression of this gene has been detected. Protein The HMGA2 gene encodes a member of the high-mobility group A (HMGA) of small, non-histonic, chromatin-associated proteins. These proteins are believed to affect transcription in several ways. They act as architectural elements by bending the DNA, they interact with a large number of other proteins, mainly transcription factors, and they also influence upon chromatin changes during cell cycle. As all proteins in this family, HMGA2 contains three copies of a conserved DNA-binding peptide motif called AT-hook. This AT-hook preferentially binds to the minor groove of stretches of AT-rich sequences. Somatic Increased protein levels of HMGA2 have been reported in a variety of benign mutation mesenchymal tumours, including lipoma, leiomyoma, chondroid tumours, pulmonary hamartoma, endometrial polyps, and fibroadenoma of the breast. In all these neoplasms rearrangements of chromosomal band 12q15 have been found at the cytogenetic resolution level.

Result of the chromosomal anomaly Hybrid Gene Description In general, two types of HMGA2 rearrangement are known. In some cases, HMGA2 is interrupted after the end of the third exon, whereby the AT hook domains are separated from the 3¹ portion of the gene. This 3¹ portion of the gene, coding for the protein-binding domains of HMGA2, is thereby lost. In other cases, breakpoints outside the coding region of the gene are found. These extragenic breaks suggest a disruption of regulatory sequences, which lead to abnormal expression of HMGA2. Expression of the entire HMGA2 gene is achieved through alterations affecting 5¹ regulatory elements or the 3' untranslated region, leading to a stabilized mRNA. It is important to note that even if the fusion products mentioned above are in-frame, some of HMGA2's partner genes contribute with very few amino acids to the chimeric product. It has therefore been suggested that the minimal requirement for tumourigenesis would be activating HMGA2 rearrangements leaving at least exons 1-3 of HMGA2 intact. For the specific translocation t(11;12)(q23;q15), the result is the abnormal expression of an intact, full-length product of HMGA2. Bibliography Aggressive angiomyxoma of the female pelvis and perineum. Report of nine cases of a distinctive type of gynaecologic soft-tissue neoplasm. Steeper TA, Rosai J. Am J Surg Pathol 1983; 7:463-475. Medline 6684403

Aggressive angiomyxoma of the pelvis: Cytogenetic findings in a single case. Horsman DE, Berean KW, Salski CB, Clement PB. Cancer Genet Cytogenet 1991; 56(1):130-131.

Cytogenetic findings in a case of angiomyxoma of the vaginal wall. Betz JL, Meloni AM, U Ren LA, Moore GE, Sandberg AA. Cancer Genet Cytogenet 1995; 84(1):157.

Cytogenetic and molecular analysis of an aggressive angiomyxoma.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 672 Kazmierczak B, Wanschura S, Meyer-Bolte K, Caselitz J, Meister P, Bartnitzke S, Van de Ven W, Bullerdiek J. Am J Pathol. 1995; 147(3):580-585. Medline 7677171

Aggressive angiomyxoma. A clinicopathologic study of 29 female patients. Fetsch JF, Laskin WB, Lefkowitz M, Kindblom LG, Meis-Kindblom JM. Cancer 1996; 78:79-90. Medline 8646730

HMGI-C rearrangements as the molecular basis for the majority of pulmonary chondroid hamartomas: A survey of 30 tumors. Kazmierczak B, Rosigkeit J, Wanschura S, Meyer-Bolte K, van de Ven WJM, Kayser K, Krieghoff B, Kastendiek H, Bartnitzke S, Bullerdiek J. Oncogene 1996; 12:515-521. Medline 8637707

Loss of an X chromosome in aggressive angiomyxoma of female soft parts: A case report. Kenny-Moynihan MB, Hagen J, Richman B, McIntosh DG, Bridge JA. Cancer Genet Cytogenet 1996; 89(1):61-64. Medline 8689613

HMGI-C expression patterns in human tissues. Implications for the genesis of frequent mesenchymal tumors. Rogalla P, Drechsler K, Frey G, Hennig Y, Helmke B, Bonk U, Bullerdiek J. Am J Pathol 1996; 149(3):775-779. Medline 8780382

Translocation breakpoints upstream of the HMGIC gene in uterine leiomyomata suggest dysregulation of this gene by a mechanism different from that in lipomas. Schoenberg Fejco M, Ashar HR, Krauter KS, Lee Powell W, Rein MS, Weremowicz S, Yoon SJ, Kucherlapati RS, Chada K, Morton CC. Genes Chromosomes Cancer 1996; 17:1-6. Medline 8889500

Aggressive angiomyxoma: reappraisal of its relationship to angiomyofibroblastoma in a series of 16 cases. Granter SR, Nucci MR, Fletcher CDM. Histopathology 1997; 30:3-10. Medline 9023551

The expression pattern of the Hmgic gene during development. Hirning-Folz U, Wilda M, Rippe V, Bullerdiek J, Hameister H. Genes, Chromosomes Cancer 1998; 23:350-357. Medline 9824208

HMGIC expression in human adult and fetal tissues and in uterine leiomyomata. Gattas GJF, Quade, BJ, Nowak RA, Morton CC. Genes, Chromosomes Cancer 1999; 25:316-322. Medline 10398424

Aggressive angiomyxoma: Findings on CT and MR imaging. Outwater E, Marchetto BE, Wagner BJ, Siegelman ES. Am J Roentgenol 1999; 172(2):435-438.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 673 Medline 9930798

Metastasizing aggressive angiomyxoma. Siassi RM, Papadopoulos T, Matzel KE. N Engl J Med 1999; 341:1772. Medline 10610453

HMGI-C and HMGI(Y) immunoreactivity correlates with cytogenetic abnormalities in lipomas, pulmonary chondroid hamartomas, endometrial polyps, and uterine leiomyomas and is compatible with rearrangement of the HMGI-C and HMGI(Y) genes. Tallini G, Vanni R, Manfioletti G, Kazmierczak B, Faa G, Pauwels P, Bullerdiek J, Giancotti V, van den Berghe H, Dal Cin P. Lab Invest 2000; 80(3):359-369. Medline 10744071

The expression of HMGA genes is regulated by their 3´UTR. Borrmann L, Wilkening S, Bullerdiek J. Oncogene 2001; 20:4537-4541. Medline 11494149

The tumor-associated gene HMGIC is expressed in normal and osteoarthritis-affected synovia. Broberg K, Tallini g, Höglund M, Lindsrand A, Toksvig-Larsen S, Mertens F. Modern Pathol 2001; 14(4):311-317. Medline 11301347

Primary medical management of recurrent aggressive angiomyxoma of the vulva with a gonadotropin-releasing hormone agonist. Fine BA, Kunoz AK, Litz CE, Gershenson GE. Gynecol oncol 2001; 81:120-122. Medline 11277663

Chromosomal translocation t(8;12) induces aberrant HMGIC expression in aggressive angiomyxoma of the vulva. Nucci MR, Weremowicz S, Neskey DM, Sornberger K, Tallini G, Morton CC, Quade BJ. Genes, Chromosomes Cancer. 2001; 32:172-176. Medline 11550285

Molecular biology of HMGA proteins: hubs of nuclear function. Reeves R. Gene 2001; 277(1-2):63-81. Medline 11602345

World Health Organization classification of tumours. Pathology and genetics of tumours of soft tissue and bone. Fletcher CDM, Unni KK, Mertens F (eds). IARC Press: Lyon, 2002.

Aggressive angiomyxoma: A second case of metastasis with patient´s death. Blandamura S, Cruz J, Faure Vergara L, Machado Puerto I, Ninfo V. Human Pathol 2003; 34(10):1072-1074. Medline 14608546

Fusion transcripts involving HMGA2 are not a common molecular mechanism in uterine leiomyomata with rearrangements in 12q15.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 674 Quade BJ, Weremowitcz S, Neskey DM, Vanni R, Ladd C, Dal Cin P, Morton CC. Cancer Res 2003; 63:1351-1358. Medline 12649198

Aggressive angiomyxoma of the female genital tract: a clinicopathologic and immunohistochemical study of 12 cases. Amezcua CA, Begley SJ, Mata N, Felix JC, Ballard CA. Int J Gynecol Cancer. 2005; 15:140-145. Medline 15670309

Aggressive angiomyxoma: a clinicopathological and immunohistochemical study of 11 cases with long-term follow-up. Graadt van Roggen JF, van Unnik JAM, Briaire-de Bruijn IH, Hogendoorn PCW. Virchows Arch 2005; 446:157-163. Medline 15735978

Aggressive angiomyxoma: multimodality treatments can avoid mutilating surgery. Han-Geurts IJM, van Geel AN, van Doorn L, den Bakker M, Eggermont AMM, Verhoef C. Eur J Surg Oncol 2006; 32:1217-1221. Medline 16870390

Aggressive angiomyxoma of the vulva: Dramatic response to gonadotropin-releasing hormone agonist therapy. McCluggage WG, Jamieson T, Dobbs SP, Grey A. Gynecolo Oncol 2006; 100:623-625. Medline 16246403

Deregulation of HMGA2 in an aggressive angiomyxoma with t(11;12)(q23;q15). Micci F, Panagopoulos I, Bjerkehagen B, Heim S. Virchows Arch 2006; 448(6):838-842. Medline 16568309

HMGA2 rearrangement in a case of vulvar aggressive angiomyxoma. Rabban JT, Dal Cin P, Oliva E. Int J Gynecol Pathol 2006; 25:403-407. Medline 16990720

Case 106: Aggressive angiomyxoma. Sinha R, Verma R. Radiology 2007; 242: 625-627. Medline 17255431

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed Contributor(s) Written 04-2007 Francesca Micci, Petter Brandal Section of Cancer Cytogenetics, Department of Medical Genetics,

Rikshspital-Radiumhospital Medical Centre, 0310 Oslo, Norway. Citation This paper should be referenced as such : Micci F, Brandal P . Soft Tissue Tumors: Aggressive angiomyxoma. Atlas Genet Cytogenet Oncol Haematol. April 2007 .

Atlas Genet Cytogenet Oncol Haematol 2007; 4 675 URL : http://AtlasGeneticsOncology.org/Tumors/AggresAngiomyxomaID5203.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 676 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Posterior uveal melanoma Identity Other names Ocular melanoma Classification Note Uveal melanoma is a tumor of the adult age, which derives from the pigmented uveal tract of the eye, comprising iris, ciliary body and choroid. The most common site of origin is the choroid (80-90% of cases), while tumors arising from the ciliary body (5- 12%) and iris (3-8%) are extremely rare. Choroid melanomas are the commonest type (60-70%), while iris melanomas are particularly rare (5-8%). Clinics and Pathology Embryonic Neuroectodermal cell lineage. origin Etiology Despite a large amount of epidemiological and molecular studies, the etiology of uveal melanoma remains largely obscure. Unlike cutaneous melanoma, which shows familial aggregation in at least 10% of cases and for which two major responsible genes have been identified to date, uveal melanoma is rarely caused by inherited mutations. In fact, less than 2% of uveal melanoma are associated to germline mutations in BRCA2 and CDKN2A genes. Moreover, the influence of environmental factors, especially exposure to sunlight, is still debated. However, it is well known that uveal melanomas are more common in older patients, particularly if of Caucasian ancestry and with blue/grey eyes. Therefore, to date, a potential role of sunlight exposure in the pathogenesis of uveal melanoma could not be excluded. Epidemiology Uveal melanoma is the most common human intraocular tumor in adult patients, although it represents only 3% of all melanomas. Overall annual incidence is 5-7 cases per million/year. In particular, the mean age-adjusted incidence of uveal melanoma is 4.3 per million/year in the United States, where this value remained stable in a 25-year period. Conversely, in Sweden, the incidence of uveal melanoma declined from 11.7 to 8.4 per million males/year and from 10.3 to 8.7 per million females/year over a 4-decade period. There is no evidence of sex predominance. Likely cutaneous melanoma, the incidence is higher amongst fair skinned pale eyed individuals. Clinics Obscured vision symptons of a retinal detachment. Uveal melanoma is a tumor of the adult age. The mean age at diagnosis is about 55 years. The early progression of uveal melanoma is usually asymptomatic. In fact, nearly half of the patients are free of symptoms at the time of the diagnosis. The most common reported abnormalities are blurred vision, photopsia and visual field loss. Additional features are inflamed and painful eye, cataract and glaucoma. Occasionally, uveal melanoma may be externally visible and mimick iris cysts. The diagnosis is established by the ophthalmologist. Binocular indirect ophthalmoscopy and documentation by colour and digital photography greatly enhanced the diagnosis of uveal melanoma. Indocyanine green angiography represents a diagnostic support in defining tumor margins. Ocular ultrasonography is useful for measuring tumor dimensions when planning treatment. Pathology Uveal melanoma may develop from melanocytoma, ocular melanocytosis or choroidal nevus. Histologically, six different types of uveal melanoma can be identified: (i) spindle A, (ii) spindle B, (iii) fascicular, (iv) mixed spindle and epithelioid, (v) necrotic, and (vi) epithelioid.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 677 The mixed (spindle and epithelioid) type is largely the most common variant among the choroid melanomas. Spindle cell melanoma has the best prognosis. Epithelioid is most likely to spread, whilst mixed cell melanomas have an intermediate behaviour. Of note, the size and position of the tumour also affects the prognosis of individual melanomas. Uveal melanomas can invade locally within the eye, and form deposits in other organs, but most commonly the liver. Treatment Local resection, enucleation, photocoagulation, external beam irradiation, brachytherapy, and laser therapy (these techniques are all included in the following sentences but with a different sequence). The major aims of the actual therapeutic protocols for uveal melanoma are: (i) to prevent metastatic disease, (ii) to reduce disfiguring consequences, and (iii) to preserve ocular function. Conservative therapeutic procedures include brachytherapy, proton beam radiotherapy, stereotactic radiotherapy, transpupillary thermotherapy, trans- scleral local resection, transretinal resection and diode laser therapy. However, local resection and enucleation is still required in a significant proportion of patients. Evolution Metastasis occurs, mainly to the liver, with approximately half of patients treated with enucleation dying within ten to fifteen years; the highest rates of metastasis ocurr in the first five years, but have been recorded over forty years after the primary tumour was detected. Prognosis Despite recent progress in local therapy, the prognosis of patients with uveal melanoma have remained stable. 15-30% of treated patients died within 5 years following the diagnosis and initial therapy due to metastases, particularly in the liver. Disseminated disease is usually fatal within 1 year after the diagnosis. Spindle cell tumours, and those less than 10 mm in diameter have the best outcome. Ciliary body melanomas and those with extravascular matrix patterns and where there is scleral invasion have a worse prognosis. Other prognostic modifiers are emerging from cytogenetic and molecular studies (see below). Cytogenetics Cytogenetics Most analysis have been performed on ciliary body and choroid melanomas, usually Morphological revealing relatively simple chromosome alterations, often with diploid karyotypes. The most common abnormality is loss of all or part of chromosome 3. Chromosome 3 monosomy is the major genetic factor of poor prognosis, as it is associated with a 70% rate of mortality within 4 years following tumor enucleation. This cytogenetic anomaly is also associated with other clinical and histological poor prognostic factors and, therefore, seems to represent a distinct pathologic entity. A significant proportion of uveal melanomas show gross abnormalities of one of the 2 copies of chromosome 6 (either duplication of 6p, or deletion of 6q). Trisomy of 6p appears to be mutually exclusive with chromosome 3 monosomy and links with a better prognosis. Conversely, 6q deletion occurs more commonly in metastasizing tumors. A further poor prognostic factor, strongly associated with metastatic death, is 8q trisomy (also in form of 8q isochrosome), which usually appears later in the natural history of uveal melanoma. Other less frequent chromosome abnormalities reported in uveal melanoma include 1p and 13q monosomy, as well as chromosome 21 trisomy. Cytogenetics Comparative genomic hybridization and spectral karyotyping studies mainly confirmed Molecular cytogenetic data and identified other minor chromosome abnormalities, such as alterations on 7q and 9p, which at the moment do not show a clear relationship with tumor formation, progression and prognosis. Loss of heterozygosity (LOH) analysis by microsatellite genotyping significantly increased the rate of detected chromosome imbalances, especially of chromosome 3, 6 and 8. This finding is explained by the fact that LOH studies detect not only monosomy/trisomy but also isodisomy. The actual

Atlas Genet Cytogenet Oncol Haematol 2007; 4 678 rate of the major chromosome abnormalities in uveal melanoma, resulting from an integrated approach of standard cytogenetics, comparative genomic hybridization, spectral karyotyping and LOH studies by microsatellite analysis is: 50-60% for chromosome 3 monosomy, 40% for 8q trisomy, 25% for 6p trisomy, 25% for 6q monosomy, 17% for 1p monosomy and 15% for 13q monosomy. Fluorescent in-situ hybridization techniques are used to detect single gene or small chromosome region amplification (see below). Recently, an MLPA kit has been developed in order to quickly identify the more common chromosome abnormalities in uveal melanoma. Genes involved and Proteins Gene Name TGFBR2 (Transforming growth factor-beta receptor, type 2) Location 3p22 Note LOH of the 3p22 chromosome region, in which maps TGFBR2, has been identified in 6 out of 19 uveal melanomas, and 61% of these tumors demonstrated perturbed TGFbeta pathway. At the moment, no mutation in genes encoding components of this pathways has been demonstrated in uveal melanoma. TGFbeta seems to upregulate levels of MMP-2 and, in particular, to increase adhesion of non-invasive uveal melanoma cell to hepatic ones. Therefore, it may contribute to the preferential targeting of the liver by uveal melanoma. Gene Name MDM2 (HDM2, Mouse double minute 2 homolog). Location 12q14.3-q15 Note More than 90% of the analyzed uveal melanomas show HDM2 overexpression. HDM2 is an inhibitor of p53. Thus, overexpression of HDM2 may partially inhibit p53 pathway in uveal melanoma and is associated to poor outcome. Gene Name CCND1 (Cyclin D1) Location 11q13 Note Cyclin D1 is overexpressed in nearly 40% of uveal melanoma. This protein activates CDK4, which is the Rb kinase. Therefore, overexpression of Cyclin D1 blocks the active repressor function of Rb on the cell cycle. Also Cyclin D1 overexpression seems to link to poor prognosis. Gene Name CDKN2A (Cyclin-dependent kinase inhibitor 2A) Location 9p21 Note Although CDKN2A mutations are extremely rare in uveal melanoma, LOH at the CDKN2A locus and CDKN2A promoter methylation occur in 24% and 6% of the analyzed tumors, respectively. A further study demonstrated that CDKN2A promoter methylation is more frequent and may occur up to 32% of the cases. Gene Name C-MYC Location 8q24 Note C-MYC is a protoncogene regulating cell proliferation, apoptosis and differentiation. Seventy to 90% uveal melanoma display overexpression of C-MYC. This finding associates to larger tumor size and improved survival. There are emerging evidences that C-MYC overexpression could be related to interferon resistance of the tumor. Recently, over expression of two other genes, namely DDFE1 and NBS1, mapping to 8q24 and 8q21, respectively, has been documented in uveal melanomas as a potential relevant consequence of 8q amplification. Gene Name BCL2 (B cell CLL/lymphoma 2) Location 18q21.3 Note The vast majority of uveal melanoma shows overexpression of BCL-2. This gene seems to be required for tumor cell survival and proliferation, as its inhibition leads to cell apoptosis.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 679 To be noted The molecular basis of tumor progression is recently emerging. It is hypothesized that the earliest event may be the underactivity of the Rb pathway, for example due to overexpression of Cyclin D or underexpression of CDKN2A. These features could determine the formation of a choroidal nevus. The switch to melanoma could be determined by the inhibition of the p53 pathway. Monosomy of the chromosome 3 determines the transformation in a more aggressive type of uveal melanoma with features of neoangiogenesis and local infiltration. Finally, 8q triplication, with the consequent overexpression of several protoncogenes, among others C-MYC, NBS1 and DDEF1, lead to metastasis formation. External links Other http://www.mlpa.com database Bibliography Monosomy 3 and isochromosome 8q in a uveal melanoma. Horsman DE, Sroka H, Rootman J, White VA. Cancer Genet Cytogenet 1990; 49: 249-253. Medline 2317773

Nonrandom chromosomal abnormalities in primary uveal melanoma. Prescher G, Bornfeld N, Becher R. J Natl Cancer Inst 1990; 82: 1765-1769. Medline 2231772

Loss of chromosome 3 alleles and multiplication of chromosome 8 alleles in uveal melanoma. Horsthemke B, Prescher G, Bornfeld N, Becher R. Genes Chromosomes Cancer 1992; 4(3): 217-221. Medline 93002698

C-myc oncogene expression in ocular melanomas. Royds JA, Sharrard RM, Parsons MA, Lawry J, Rees R, Cottam D, Wagner B, Rennie IG. Graefes Arch Clin Exp Ophthalmol 1992; 230: 366-371. Medline 1505770

Cytogenetic analysis of posterior uveal melanoma. Wiltshire RN, Elner VM, Dennis T, Vine AK, Trent JM. Cancer Genet Cytogenet 1993; 66: 47-53. Medline 8467475

Cytogenetics of twelve cases of uveal melanoma and patterns of nonrandom anomalies and isochromosome formation. Prescher G, Bornfeld N, Friedrichs W, Seeber S, Becher R. Cancer Genet Cytogenet 1995; 80(1): 40-46 Medline 7697631

Comparative genomic hybridization analysis of archival formalin-fixed paraffin-embedded uveal melanomas. Ghazvini S, Char DH, Kroll S, Waldman FM, Pinkel D. Cancer Genet Cytogenet 1996; 90: 95-101. Medline 8830715

Expression of bcl-2 in uveal malignant melanoma. Jay V, Yi Q, Hunter WS, Zielenska M.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 680 Arch Pathol Lab Med 1996; 120: 497-498. Medline 8639055

Abnormalities of chromosomes 3 and 8 in posterior uveal melanoma correlate with prognosis. Sisley K, Rennie IG, Parsons MA, Jacques R, Hammond DW, Bell SM, Potter AM, Rees RC. Genes Chromosomes Cancer 1997; 19(1): 22-28. Medline 9135991 c-myc, p53, and Bcl-2 expression and clinical outcome in uveal melanoma. Analysis of p16 (CDKN2/MTS-1/INK4A) alterations in primary sporadic uveal melanoma. Chana JS, Wilson GD, Cree IA, Alexander RA, Myatt N, Neale M, Foss AJ, Hungerford JL. Merbs SL, Sidransky D. Br J Ophthalmol 1999; 83: 110-114. Invest Ophthalmol Vis Sci 1999; 40: 779-783. Medline 10067984

Allelotype of posterior uveal melanoma: implications for a bifurcated tumor progression pathway. Parrella P, Sidransky D, Merbs SL. Cancer Res 1999; 59: 3032-3037. Medline 10397238

Deregulation of the Rb and p53 pathways in uveal melanoma. Brantley MA Jr, Harbour JW. Am J Pathol 2000; 157: 1795-1801. Medline 11106551

Inactivation of retinoblastoma protein in uveal melanoma by phosphorylation of sites in the COOH-terminal region. Brantley MA Jr, Harbour JW. Cancer Res 2000; 60: 4320-4323. Medline 10969768

The prognostic value of cyclin D1, p53, and MDM2 protein expression in uveal melanoma. Coupland SE, Anastassiou G, Stang A, Schilling H, Anagnostopoulos I, Bornfeld N, Stein H. J Pathol 2000; 191: 120-126. Medline 10861569

Abnormalities of the transforming growth factor-beta pathway in ocular melanoma. Myatt N, Aristodemou P, Neale MH, Foss AJ, Hungerford JL, Bhattacharya S, A Cree. J Pathol 2000; 192: 511-518. Medline 11113869

Concomitant loss of chromosome 3 and whole arm losses and gains of chromosome 1, 6, or 8 in metastasizing primary uveal melanoma. Aalto Y, Eriksson L, Seregard S, Larsson O, Knuutila S. Invest Ophthalmol Vis Sci 2001; 42: 313-317. Medline 11157859

Detection of uveal melanoma by optometrists in the United Kingdom. Damato B. Ophthalmic Physiol Opt 2001; 21: 268-271. Medline 11430620

Detection of c-myc amplification in uveal melanoma by fluorescent in situ hybridization.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 681 Parrella P, Caballero OL, Sidransky D, Merbs SL. Invest Ophthalmol Vis Sci 2001; 42: 1679-1684. Medline 11431428

Promoter hypermethylation: a common cause of reduced p16(INK4a) expression in uveal melanoma. van der Velden PA, Metzelaar-Blok JA, Bergman W, Monique H, Hurks H, Frants RR, Gruis NA, Jager MJ. Cancer Res 2001; 61: 5303-5306. Medline 11431374

Incidence of uveal melanoma in Sweden from 1960 to 1998. Bergman L, Seregard S, Nilsson B, Ringborg U, Lundell G, Ragnarsson-Olding B. Invest Ophthalmol Vis Sci 2002; 43: 2579-2583. Medline 12147588

Transducible peptide therapy for uveal melanoma and retinoblastoma. Harbour JW, Worley L, Ma D, Cohen M. Arch Ophthalmol 2002; 120: 1341-1346. Medline 12365913

Contribution of germline mutations in BRCA2, P16(INK4A), P14(ARF) and P15 to uveal melanoma. Hearle N, Damato BE, Humphreys J, Wixey J, Green H, Stone J, Easton DF, Houlston RS. Invest Ophthalmol Vis Sci 2003; 44: 458-462. Medline 12556369

Role of MC1R variants in uveal melanoma. Hearle N, Humphreys J, Damato BE, Wort R, Talaban R, Wixey J, Green H, Easton DF, Houlston RS. Br J Cance. 2003; 89: 1961-1965. Medline 14612910

Molecular genetics of uveal melanoma. Loercher AE, Harbour JW. Curr Eye Res 2003; 27: 69-74. Medline 14632157

Monosomy 3 in uveal melanoma: correlation with clinical and histologic predictors of survival. Scholes AG, Damato BE, Nunn J, Hiscott P, Grierson I, Field JK. Invest Ophthalmol Vis Sci 2003; 44: 1008-1011. Medline 12601021

Incidence of uveal melanoma in the United States: 1973-1997. Singh AD, Topham A. Ophthalmology 2003; 110: 956-961. Medline 12750097

Developments in the management of uveal melanoma. Damato B. Clin Experiment Ophthalmol 2004; 32: 639-647. Medline 15575836

Gene expression profiling in uveal melanoma reveals two molecular classes and predicts metastatic death. AUTHORS Onken MD, Worley LA, Ehlers JP, Harbour JW.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 682 Cancer Res 2004; 64: 7205-7209. Medline 15492234

Sunlight exposure and pathogenesis of uveal melanoma. Singh AD, Rennie IG, Seregard S, Giblin M, McKenzie J. Surv Ophthalmol 2004; 49: 419-428. Medline 15231397

The relation between c-myc expression and interferon sensitivity in uveal melanoma. Tulley PN, Neale M, Jackson D, Chana JS, Grover R, Cree I, Grobbelaar AO, Wilson GD. Br J Ophthalmol 2004;88:1563-1567. Medline 15548813

Major cytogenetic aberrations and typical multidrug resistance phenotype of uveal melanoma: current views and new therapeutic prospects. Baggetto LG, Gambrelle J, Dayan G, Labialle S, Barakat S, Michaud M, Grange JD, Gayet L. Cancer Treat Rev 2005; 31: 361-379. Medline 15994016

NBS1 expression as a prognostic marker in uveal melanoma. Ehlers JP, Harbour JW. Clin Cancer Res 2005; 11: 1849-1853. Medline 15756009

DDEF1 is located in an amplified region of chromosome 8q and is overexpressed in uveal melanoma. Ehlers JP, Worley L, Onken MD, Harbour JW. Clin Cancer Res 2005; 11: 3609-3613. Medline 15897555

A potential role for TGFbeta in the regulation of uveal melanoma adhesive interactions with the hepatic endothelium. Woodward JK, Rennie IG, Burn JL, Sisley K. Invest Ophthalmol Vis Sci 2005; 46: 3473-3477. Medline 16186321

Progressive enlargement of cavity within melanoma masquerading as iris cyst. Criss JS, Shields CL, Materin MA, Reichel E, Eagle RC Jr, Shields JA. Cornea 2006; 25: 863-865. Medline 17068469

Treatment of primary intraocular melanoma. Damato B. Expert Rev Anticancer Ther 2006; 6: 493-506. Medline 16613538

Molecular pathobiology of uveal melanoma. Ehlers JP, Harbour JW. Int Ophthalmol Clin 2006; 46: 167-180. Medline 16365562 REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed Contributor(s)

Atlas Genet Cytogenet Oncol Haematol 2007; 4 683 Written 06-1999 Karen Sisley The Institute for Cancer Studies, University of Sheffield Medical School,

Beech Hill Road, Sheffield S10 2RX, UK Updated 04-2007 Marco Castori, Paola Grammatico Citation This paper should be referenced as such : Sisley K . Posterior uveal melanoma. Atlas Genet Cytogenet Oncol Haematol. June 1999 . URL : http://AtlasGeneticsOncology.org/Tumors/UvealmelanomID5047.html Castori M, Grammatico P . Posterior uveal melanoma. Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Tumors/UvealmelanomID5047.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 684 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Neurofibroma Identity

Numerous cutaneous neurofibromas (A.) and a large plexiform neurofibroma (B.). Classification Neurofibromas are benign tumors of the peripheral nerves. Dermal neurofibromas are well circumscribed solid cutaneous tumors with limited size. Plexiform neurofibromas (PNF) originate from subcutaneous or visceral peripheral nerves and involve multiple fascicles extending along the length of a nerve. In contrast to dermal neurofibromas, plexiform neurofibromas vary in size and can be extremely large. Multiple dermal neurofibromas are the hallmark of neurofibromatosis type 1 (NF1), an autosomal dominant genetic disease with an incidence of approximately 1 in 3000. Plexiform neurofibromas develop in approximately 30% of NF1 patients. While dermal neurofibromas also occur in non-NF1 patients, PNFs are almost exclusively associated with NF1. Clinics and Pathology Disease Neurofibromatosis type 1 (NF1) is an autosomal genetic disease caused by heterozygous dysfunction of the NF1 tumor suppressor gene on the long arm of chromosome 17. Embryonic Neurocrest. origin Etiology The genetic cause for neurofibromas is the bi-allelic inactivation of the NF1 tumor suppressor gene. Epidemiology Both sex can be affected. Neurofibromas are rare in children, but start develop in

Atlas Genet Cytogenet Oncol Haematol 2007; 4 685 puberty. Up to thousands of neurofibromas can develop in one adult NF1 patient. In contrast to dermal neurofibromas, PNF are often congenital and may develop already before birth. Clinics Neurofibromas are mostly benign. These tumors can lead to transient stinging, itching, and pain. Multiplicity of these tumors often cause disfigurement with psychological impact on the individual's selfesterm, partnerships and social relations. However, dermal neurofibromas usually do not cause any further serious dysfunction. There is no evidence for malignant transformation of dermal neurofibromas. In contrast, PNF often lead to pain, disfigurement, neurological and other clinical deficits. PNF mostly show net-like growth pattern along nerve roots extending from a main nerve root to a small distal branch, and can be divided into two main types: internal tumors and superficial ones. Superficial PNF do not cross tissue planes and are amenable to complete or nearly complete surgical resection. Internal PNF extend through multiple tissue planes and can not be completely removed in most cases without damaging tissues and organs. PNF located in the chest, abdomen or pelvis are frequently detected as paraspinal masses that involves multiple spinal levels. These tumors may also appear as anterior mediastinal masses, sciatic nerve lesions with pelvic extension, and perirectal plexiform and uterine tumors, all leading to sever clinical complications. Furthermore, there is a risk of malignant progression in PNF, especially the internal ones. While dermal neurofibromas mostly appear during adolescence, PNF are mainly congenital though some of them become apparent later. Growth of PNF is slows down with increasing age. Pathology According to the WHO classification dermal and plexiform neurofibromas are grade I tumours. Histologically they consist of transformed Schwann cells with wavy contours and ovoid to elongated nuclei with fine dense heterochromatin. The tumours show a diffuse growth or an arrangement of cells in streams. The Schwann cells are intermingled with fibroblasts and perineurial-like cells in a matrix of muco-substances and a varying amount of collagen fibres. Within the tumour, especially in dermal neurofibromas, mast cells and perivascular lymphocytic infiltrates may be demonstrated. In some patients focal palisading of small groups of nuclei may resemble Meissner corpuscles and arrangement of cells in dense whorls may resemble Pacini corpuscles. Plexiform tumours typically show a low cellularity, loose texture and an abundant myxoid matrix. Degenerating nerve fibres may be seen within the tumour. There are no signs of malignancy and proliferative activity is low or absent in both, dermal and plexiform neurofibroma. Some cases may show a mixed Schwannoma-neurofibroma differentiation, these tumours are termed "Schwannoma in Neurofibroma". Immunohistochemical labelling of tumour cells with antibodies against S-100 protein is particularly helpful in tumours with extremely low cellularity like in dermal neurofibromas of the mamilla.

Labelling of tumour cells in dermal (left) and plexiform neurofibroma (right)with antibodies against S-100 protein.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 686 Treatment Surgery: Plastic surgeons should be consulted for surgical resection of neurofibromas, especially for those of face and neck. The result of the surgery dipendends on the size, localization, and structure (diffuse, nodular, or pendunculated) of the tumors. Pendunculated neurofibromas can be excised with a very satisfactory result. Various techniques can be applied for resection of neurofibromas: conventional scalpel, laser or electrocauterization. According to our experience, conventional scalpel is suitable for larger, exophytic tumors. Laser and electrocauterization are useful for tumors with intracutaneous localization with abundent blood vessels. There is no proven benefit for carbon dioxide laser treatment for neurofibromas. No relapse will occur upon completely resection. Anti-histamine is not always satisfactory as a treatment for itching of neurofibromas. Hormones: Hormonal factors seem to contribute to the growth of neurofibromas, as neurofibroma growth is stimulated by puberty and pregnancy. A recent study has shown that 75% of neurofibromas carry progesterone receptors. However, there is no evidence that progesterone and combined oral contraceptive pill stimulate growth of neurofibromas. For pregnant NF1 patient, obstetrician and clinicians should be aware that spinal and pelvic neurofibromas may progress rapidly and thus need to be monitored closely. Plexiform neurofibromas: Deeply located tumors PNF often lead to pain and neurological deficits and thus need special attention and closely monitoring. Patients developing deficits or pain should undergo surgery whenever a positive outcome is suggested. Annual examination helps to detect first indication of possible spinal cord compression. Regular MRI is important for early detection of malignant transformation.

Results of surgery of PNF are usually unsatisfactory because of the network-like growth of the tumors often involve multiple nerve fascicles and other adjacent tissues. Typically surgical interventions for PNF are restricted to debulking procedures of large tumors causing significant clinical complications or aesthetic disfigurement. However, successful subtotal resections of the superficial PNF with significant improvement in cosmetic appearance are possible. Furthermore, a recent study reported the advantage of early surgical intervention of small PNF in children under 15 years of age. Total resection was achieved in all 7 cases without causing any neurological or organic deficit. Annual control within four years with magnetic resonance tomography did not reveal any relapse of the tumors. Prognosis Neurofibromas are benign tumors. However, there is a risk of malignant transformation in PNF, leading to malignant peripheral nerve sheath tumors. Cytogenetics Note Neurofibromas are benign and usually do not have gross chromosomal abnormality beside allelic loss of chromosome 17. Genes involved and Proteins Gene Name NF1 Location 17q11.2 Note The direct genetic cause for neurofibromas is the bi-allelic inactivation of the tumor suppressor gene NF1. The NF1 gene is located on 17q11.2. Dna / Rna It encompasses 335kb genomic DNA, consists of 60 exons, and gives rise to an 11- 13-kb transcript. Protein The NF1 gene product, neurofibromin, has a RAS GTPase-activating region (GAP) and is likely involved in RAS-signaling pathway. Germinal The first inactivation of the NF1 gene in a neurofibroma is the constitutional mutation in mutation the patient. Constitutional mutations are mostly minor lesions such as point mutations in exons and in conserved splicing sites, and deletions/insertions of one to few base pairs, mostly leading to frameshift of the transcript. Somatic The 2nd inactivation of the NF1 gene in neurofibromas is somatic and specific to each mutation tumor which does not exist in non-tumor tissues of the patient. Somatic inactivation

Atlas Genet Cytogenet Oncol Haematol 2007; 4 687 involve small lesions and loss of the 2nd NF1 allele. Neurofibromas are composed mainly of Schwann cells and fibroblasts. By selectively culturing Schwann cells and fibroblasts, respectively, from an neurofibroma, is has been demonstrated that the somatic NF1 alterations only exist in the former but not in the later cell type. These results provided genetic evidence that Schwann cells are the progenitor tumor cells in neurofibromas.

Result of the chromosomal anomaly Hybrid Gene Note Loss of chromosome 17 leads to bi-allelic inactivation of the NF1 gene. Bibliography Mutation and cancer: statistical study of retinoblastoma. Knudson AG Pro Natl Acad Sci USA. 1971; 68:820-823. Medline 5279523

The NF1 locus encodes a protein functionally related to mammalian GAP and yeast IRA proteins. Ballester R, Marchuk D, Boguski M, Saulino A, Letcher R, Wigler M, Collins F. Cell. 1990; 63(4):851-859. Medline 2121371

A major segment of neurofibromatosis type 1 gene: cDNA sequence, genomic structure and point mutations. Cawthon R, Weiss R, Xu G, Viskochil D, Vulver M, Stevens J, Robertson M, Dunn D, Gesteland R, O Connell P, White R. Cell. 1990; 62:193-201. Medline 2114220

Deletions and translocations interrupt a cloned gene at the neurofibromatosis type 1 locus. Viskochil D, Buchberg AM, Xu G, Stevens J, Wolff RK, Culver M, Carey JC, Copeland NG, Jenkins NA, White R, O Connel P. Cell. 1990; 62:187-192. Medline 1694727

Benign neurofibromas in type 1 neurofibromatosis (NF1) show somatic deletions of NF1 gene. Colman SD, Williams CA, Wallace MR. Nat Genet. 1995; 11:90-92. Medline 7550323

Confirmation of a double-hit model for the NF1 gene in benign neurofibromas. Serra E, Puig S, Otero D, Gaona A, Kruyer H, Ars E, Estivill X, Lazaro C. Am J Hum Genet. 1997; 61:512-519. Medline 9326316

CT imaging in adults with neurofibromatosis-1: frequent asymptomatic plexiform lesions. Tonsgard JH, Kwak SM, Short MP, Dachman AH. Neurology. 1998; 50(6):1755-1760. Medline 9633723

Atlas Genet Cytogenet Oncol Haematol 2007; 4 688 Loss of NF1 allele in Schwann cells but not in fibroblasts derived from an NF1-associated neurofibroma. Kluwe L, Friedrich R, Mautner VF. Genes Chromosomes Cancer. 1999; 3:283-285. Medline 10451710

Schwann cells harbor the somatic NF1 mutation in neurofibromas: evidence of two different Schwann cell subpopulations. Serra E, Rosenbaum T, Winner U, Aledo R, Ars E, Estivill X, Lenard H-G, Lazaro C. Hum Mol Genet. 2000; 9:3055-3064. Medline 11115850

World Health Organization Classification of Tumours. Pathology and Genetics of Tumours of the Nervous System. Woodruff JM, Kourea HP, Louis DN, Scheithauer BW. Neurofibroma. In: IARC Press, Lyon, 2000; 167-168. [P Kleihues, WK Cavenee (Eds.)].

NF1 tumor suppressor gene function: narrowing the GAP. Cichowski K, Jacks T. Cell. 2001; 104(4):593-604. Review. Medline 11239415

Progesterone receptor expression in neurofibromas. McLaughlin ME, Jacks T. Cancer Res. 2003; 63(4):752-755. Medline 12591720

Characterization of the somatic mutational spectrum of the neurofibromatosis type 1 (NF1) gene in neurofibromatosis patients with benign and malignant tumors. Upadhyaya M, Han S, Consoli C, Majounie E, Horan M, Thomas NS, Potts C, Griffiths S, Ruggieri M, von Deimling A, Cooper DN. Hum Mutat. 2004; 23:134-146. Medline 14722917

Subtotal and total resection of superficial plexiform neurofibromas of face and neck: four case reports. Friedrich RE, Schmelzle R, Hartmann M, Mautner VF. J Craniomaxillofac Surg. 2005; 33:55-60. Medline 15694151

Resection of small plexiform neurofibromas in neurofibromatosis type 1 children. Friedrich RE, Schmelzle R, Hartmann M, Funsterer C, Mautner VF. World J Surg Oncol. 2005; 3:6. Medline 15683544

Prevalence of neurofibromatosis 1 in German children at elementary school enrollment. Lammert M, Friedman JM, Kluwe L, Mautner VF. Arch Dermatol. 2005; 141(1):71-74. Medline 15655144

Do hormonal contraceptives stimulate growth of neurofibromas? A survey on 59 NF1 patients. Lammert M, Mautner VF, Kluwe L. BMC Cancer. 2005; 5:16. Medline 15703081

Atlas Genet Cytogenet Oncol Haematol 2007; 4 689

MRI growth patterns of plexiform neurofibromas in patients with neurofibromatosis type 1. Mautner VF, Hartmann M, Kluwe L, Friedrich RE, Funsterer C. Neuroradiology. 2006; 48(3):160-165. Medline 16432718

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed Contributor(s) Written 04-2007 Lan Kluwe, Christian Hagel, Victor Mautner Laboratory for Tumor Biology and Developmental Disorders, University

Hospital Eppendorf, Martinistr. 52, 20246 Hamburg, Germany. Citation This paper should be referenced as such : Kluwe L, Hagel C, Mautner V . Neurofibroma. Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Tumors/NeurofibromaID5098.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 690 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Head and Neck: Pleomorphic salivary gland adenoma with inv(8)(q12q12) (CHCHD7/PLAG1) Clinics and Pathology Disease Pleomorphic salivary gland adenomas (PA) are benign, slow-growing tumors, which show a remarkable degree of morphological diversity. They constitute the most common form of all salivary gland neoplasms and the majority of the PAs occur in the parotid gland, while the remaining tumors are found in the submandibular and minor salivary glands. Although PAs are benign tumors, subsets of these tumors have a tendency to recur and/or undergo malignant transformation. Cytogenetics inv(8)(q12.1;q12.1) Genes involved and Proteins Gene Name CHCHD7 (Coiled-coil-helix-coiled-coil-helix domain containing 7) Location 8q12.1 Dna / Rna The gene spans about 7 kb and includes 5 exons. Six isoforms of RNA, spliced with or without exon 2, exist with transcript sizes ranging from 1575 bp to 1767 bp. Protein The protein contains a conserved CHCH domain and is included in a multifamily of proteins which show a strong conservation at the structural level but a low conservation at the amino acid level.

Gene Name PLAG1 (Pleomorphic Adenoma Gene 1) Location 8q12 Dna / Rna The gene spans 50 kb and includes 5 exons. The size of the transcript is about 7.3 kb. Two splicing forms of RNA have been found, with or without exon 2. Protein 500 amino acids (aa), 74 kDa. The gene encodes a zinc finger protein with two putative nuclear localization signals. It contains a conserved SFP1 domain (aa 58- 139), which is a putative transcriptional repressor regulating G2/M transition.

Result of the chromosomal anomaly Hybrid Gene Note The two genes CHCHD7 and PLAG1 are located head-to-head about 500 bp apart in 8q12. The fusion results from a cryptic, paracentric inversion.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 691

Map of the 8q12 region including the CHCHD7 and PLAG1 genes (not drawn to scale). Exons are shown as boxes and the start and stop codons are shown as asterisks and arrowheads, respectively. Breakpoints are shown in red. Reprinted partially from publication CHCHD7-PLAG1 and TCEA1-PLAG1 gene fusions resulting from cryptic, intrachromosomal 8q rearrangements in pleomorphic salivary gland adenomas, Genes Chromosomes Cancer, Vol. 45, No. 9, 2006, 820-828. Copyright 2006 Wiley-Liss, Inc. Reprinted with permission of Wiley-Liss, Inc..

Description The CHCHD7-PLAG1 fusion transcript is formed by fusion of exon 1 of CHCHD7 to exon 2 or 3 of PLAG1. Detection RT-PCR using total RNA extracted from frozen tumor tissue. The CHCHD7-PLAG1 gene fusion was detected by amplification of cDNA using the primers CHCHD22S, 5'- GTGAGCCATTGACGTGTTTG-3' located in exon 1 of CHCHD7, and PLAG564AS, 5'- GGTTTCACCACGCTTACGTT3' located in exon 4 of PLAG1. Fusion transcripts of 467 and 362 bp were detected. Fusion

Protein Description Exon 1 of CHCHD7 fused to either exon 2 or 3 of PLAG1 results in a promoter swapping where the intact coding region of PLAG1 is expressed from a different promoter. Expression Nucleus. Localisation Bibliography Salivary gland tumours. A review of 2410 cases with particular reference to histological types, site, age and sex distribution. Eveson JW, Cawson RA. J Pathol. 1985; 146:51-58. Medline 4009321

Promoter swapping between the genes for a novel zinc finger protein and beta-catenin in pleiomorphic adenomas with t(3;8)(p21;q12) translocations. Kas K, Voz ML, Roijer E, Astrom AK, Meyen E, Stenman G, Van de Ven WJ. Nat Genet. 1997; 15:170-174. Medline 9020842

C2360, a nuclear protein expressed in human proliferative cytotrophoblasts, is a representative member of a novel protein family with a conserved coiled coil-helix-coiled coil-helix domain. Westerman BA, Poutsma A, Steegers EA, Oudejans CB. Genomics. 2004; 83:1094-1104. Medline 15177562

Fusion oncogenes and tumor type specificity insights from salivary salivary gland tumors. Stenman G. Semin Cancer Biol. 2005; 15:224-235. Medline 15826837

CHCHD7-PLAG1 and TCEA1-PLAG1 gene fusions resulting from cryptic, intrachromosomal 8q rearrangements in pleomorphic salivary gland adenomas. Asp J, Persson F, Kost-Alimova M, Stenman G. Genes Chromosomes Cancer. 2006; 45:820-828. Medline 16736500

Atlas Genet Cytogenet Oncol Haematol 2007; 4 692 REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed Contributor(s) Written 04-2007 Julia Asp, Goran Stenman Molecular Cell Biology and Regenerative Medicine, Department of Clinical Chemistry and Transfusion Medicine, Institute of Biomedicine, Bruna Straket 16, Sahlgrenska University Hospital, 413 45 Goteborg, Sweden. Citation This paper should be referenced as such : Asp J, Stenman G . Head and Neck: Pleomorphic salivary gland adenoma with inv(8)(q12q12) (CHCHD7/PLAG1). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Tumors/SalivAdenCHCHD7PLAG1ID5431.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 693 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Head and Neck: Pleomorphic salivary gland adenoma with ins(8)(q12;q11q11) (TCEA1-PLAG1) Clinics and Pathology Disease Pleomorphic salivary gland adenomas (PA) are benign, slow-growing tumors, which show a remarkable degree of morphological diversity. They constitute the most common form of all salivary gland neoplasms and the majority of the PAs occur in the parotid gland, while the remaining tumors are found in the submandibular and minor salivary glands. Although PAs are benign tumors, subsets of these tumors have a tendency to recur and/or undergo malignant transformation. Cytogenetics Cytogenetics ins(8)(q12.1q11.23q11.23). Molecular Genes involved and Proteins Gene Name TCEA1 (Transcription elongation factor A 1) Note An intronless, ubiquitously expressed pseudogene designated TCEA1P2 or SII is located at 3p22-p21.3. Dna / Rna The gene spans about 56 kb and includes 10 exons. Two alternative splicing forms, with and without exon 2, has been detected, yielding transcript sizes of 2784 bp and 2721 bp, respectively. Protein The gene codes for two proteins of 301 amino acids (aa) and 280 aa. They contain an N-terminal conserved TFIIS-I domain, a TFS2M domain, and a C-terminal TFIIS domain.

Gene Name PLAG1 (Pleomorphic Adenoma Gene 1) Location 8q12.1 Dna / Rna The gene spans about 50 kb and includes 5 exons. The size of the transcript is about 7.3 kb. Two splicing forms of RNA have been found, with or without exon 2. Protein 500 aa, 74 kDa. The gene encodes a zinc finger protein with two putative nuclear localization signals. It contains a conserved SFP1 domain (aa 58-139), which is a putative transcriptional repressor regulating G2/M transition.

Result of the chromosomal anomaly Hybrid Gene Note The fusion occurs as a result of a cryptic, intrachromosomal rearrangement in tumors with apparently normal karyotypes.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 694

Map of the 8q11.2-q12 region including the PLAG1 and TCEA1 genes (not drawn to scale). Exons are shown as boxes and the start and stop codons are shown as asterisks and arrowheads, respectively. Reprinted partially from publication CHCHD7- PLAG1 and TCEA1-PLAG1 gene fusions resulting from cryptic, intrachromosomal 8q rearrangements in pleomorphic salivary gland adenomas, Genes Chromosomes Cancer, Vol. 45, No. 9, 2006, 820-828. Copyright 2006 Wiley-Liss, Inc. Reprinted with permission of Wiley-Liss, Inc.

Description The TCEA1-PLAG1 fusion transcript is formed by fusion of exon 1 of TCEA1 to exon 2 or 3 of PLAG1. Detection 1) RT-PCR using total RNA extracted from frozen tumor tissue. The TCEA1-PLAG1 fusion transcript was amplified by nested RT-PCR using the first round primers SII-UP, 5¹-CATGCGGTGGTGGGGGTTGCT-3', and MV5, 5'- CAGGAGAATGAGTAGCCATGTGC-3', and the second round primers S2-764S, 5'- GGGGTCGCTCCTGCTGTGTCT3' and MV6, 5'- TGCACTTGTAGGGCCTCTCTCCTG-3'. Fusion transcripts of 557 bp and 662 bp were detected. 2) Dual-color FISH and fiber-FISH on metaphase chromosomes using the BAC clones RP11-140I16 (PLAG1) and RP11-410P17 (TCEA1) as probes. Fusion

Protein Expression Nucleus. Localisation Bibliography Salivary gland tumours. A review of 2410 cases with particular reference to histological types, site, age and sex distribution. Eveson JW, Cawson RA. J Pathol. 1985; 146:51-58. Medline 4009321

Promoter swapping between the genes for a novel zinc finger protein and beta-catenin in pleiomorphic adenomas with t(3;8)(p21;q12) translocations. Kas K, Voz ML, Roijer E, Astrom AK, Meyen E, Stenman G, Van de Ven WJ. Nat Genet. 1997; 15:170-174. Medline 9020842

Conserved mechanism of PLAG1 activation in salivary gland tumors with and without chromosome 8q12 abnormalities: identification of SII as a new fusion partner gene. Astrom AK, Voz ML, Kas K, Roijer E, Wedell B, Mandahl N, Van de Ven W, Mark J, Stenman G. Cancer Res. 1999; 59:918-923. Medline 10029085

Fusion oncogenes and tumor type specificity insights from salivary salivary gland tumors. Stenman G. Semin Cancer Biol. 2005; 15:224-235. Medline 15826837

Atlas Genet Cytogenet Oncol Haematol 2007; 4 695

CHCHD7-PLAG1 and TCEA1-PLAG1 gene fusions resulting from cryptic, intrachromosomal 8q rearrangements in pleomorphic salivary gland adenomas. Asp J, Persson F, Kost-Alimova M, Stenman G. Genes Chromosomes Cancer. 2006; 45:820-828. Medline 16736500

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed Contributor(s) Written 04-2007 Julia Asp, Goran Stenman Molecular Cell Biology and Regenerative Medicine, Department of Clinical Chemistry and Transfusion Medicine, Institute of Biomedicine, Bruna Straket 16, Sahlgrenska University Hospital, 413 45 Goteborg, Sweden. Citation This paper should be referenced as such : Asp J, Stenman G . Head and Neck: Pleomorphic salivary gland adenoma with ins(8)(q12;q11q11) (TCEA1-PLAG1). Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Tumors/SalivAdenTCEA1PLAG1ID5430.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 696 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Hemihyperplasia isolated Identity Note Excludes Proteus syndrome, Klippel Trenaunay Weber syndrome, neurofibromatosis, Beckwith Wiedemann syndrome, other syndromes associated with hemihypertrophy Other names Isolated hemihypertrophy Inheritance Sporadic Clinics Note Usually hemihypertrophy occurs sporadically but familial cases are reported. Though molecular defects have not been identified in all cases, there is evidence that IH occurs due to epigenetic defects or paternal uniparental disomy of genes of 11p15 in somatic mosaic form. Phenotype Cases with hemihypertrophy not fulfilling criteria of complicated hemihypertrophies are and clinics grouped under isolated hemihypertrophy or hemihyperplasia. Though the title included the word 'hemi', only one limb may be involved. The condition is usually nonprogressive and the body disproportion does not change. Bone age may or may not be increased on the hypertrophied side. Some cases of isolated hemihyperplasia have other features like naevi, capillary haemangiomas and hypertrichosis. Mental retardation may be present. There are no specific laboratory abnormalities. Viscera (kidney) on the hypertrophied side may be enlarged. Plexiform neurofibromas may look like hemihypertrophy.

A child with isolated hemihypertrophy involving left lower limb. Note Poland anomaly and hypoplastic nipple on left side - a rare associated feature.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 697 Neoplastic risk The risk of neoplasm is around 5%. Wilms tumour is the commonest; but other tumors like hepatoblastoma, adrenal cell tumour and leiomyosarcoma are also reported. Three monthly ultrasonographic follow up for Wilms tumour up to 5 years and then yearly up to the completion of growth is recommended. Treatment Usually limb discrepancy is mild and no treatment is required. Corrective shoes, orthopedic procedures may be needed to correct limb length discrepancy. Evaluation of cognitive function and appropriate training may be needed. Prognosis The condition is nonprogressive and the prognosis is good. Close follow up for early detection of Wilms tumour is needed. Cytogenetics Note Mosaic paternal uniparental disomy for 11p15 (a region involved in Beckwith Wiedemann syndrome) was reported in an affected twin of a monozygotic twin pair discordant for hemihyperplasia. Paternal uniparental disomy of 11p15 in somatic mosaic form is reported in 16% of patients with isolated hemihyperplasia. Abnormal methylation of either LIT1 or H19 genes on chromosome 11p was seen in 8 out of 27 children with isolated hemihyperplasia; suggesting that isolated hemihyperplasia might belong to the phenotype spectrum of Beckwith Wiedemann syndrome. But there may be some differences in the types of epigenetic defects in both disorders. It has also been shown that the cases of isolated hemihyperplasia with uniparental disomy of 11p15 are at a higher risk of Wilms tumour as compared to the cases of hemihyperplasia without uniparental disomy. Bibliography Clinical differentiation between Proteus syndrome and hemihyperplasia: description of a distinct form of hemihyperplasia. Biesecker LG, Peters KF, Darling TN, Choyke P, Hill S, Schimke N, Cunningham M, Meltzer P, Cohen MM Jr. Am J Med Genet. 1998; 79(4): 311-318. Medline 9781913

Isolated hemihyperplasia (hemihypertrophy): report of a prospective multicenter study of the incidence of neoplasia and review. Hoyme HE, Seaver LH, Jones KL, Procopio F, Crooks W, Feingold M. Am J Med Genet. 1998; 79(4): 274-278. Medline 9781907

Paternal uniparental disomy in monozygotic twins discordant for hemihypertrophy. West PM, Love DR, Stapleton PM, Winship IM. J Med Genet. 2003; 40(3): 223-226. Medline 12624145

Children with idiopathic hemihypertrophy and Beckwith-Wiedemann syndrome have different constitutional epigenotypes associated with Wilms tumor. Niemitz EL, Feinberg AP, Brandenburg SA, Grundy PE, DeBaun MR. Am J Hum Genet. 2005; 77(5): 887-891. Medline 16252245

LIT1 and H19 methylation defects in isolated hemihyperplasia. Martin RA, Grange DK, Zehnbauer B, Debaun MR. Am J Med Genet A. 2005; 134(2): 129-131. Medline 15651076

Constitutional UPD for chromosome 11p15 in individuals with isolated hemihyperplasia is associated with high tumor risk and occurs following assisted reproductive technologies. Shuman C, Smith AC, Steele L, Ray PN, Clericuzio C, Zackai E, Parisi MA, Meadows AT, Kelly T,

Atlas Genet Cytogenet Oncol Haematol 2007; 4 698 Tichauer D, Squire JA, Sadowski P, Weksberg R. Am J Med Genet A. 2006; 140(14): 1497-1503. Medline 16770802

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed Contributor(s) Written 04-2007 Shubha R Phadke Citation This paper should be referenced as such : Phadke SR . Hemihyperplasia isolated. Atlas Genet Cytogenet Oncol Haematol. April 2007 . URL : http://AtlasGeneticsOncology.org/Kprones/HemihyperplasiaID10046.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 699 Atlas of Genetics and Cytogenetics in Oncology and Haematology

CASE REPORTS in HAEMATOLOGY (Paper co-edited with the European LeukemiaNet) inv(8)(p11.2q13) found in a patient with chronic myelomonocytic leukemia that progressed to acute myeloid leukemia

Jennifer JS Laffin, Sara J Morrison-Delap, Wayne A Bottner, Eric B Johnson, Patricia Howard- Peebles, Kate J Thompson, Gordana Raca, Karen D Montgomery, Daniel F Kurtycz Clinics Age and sex : 67 yrs old male patient Previous history : preleukaemia no previous malignant disease; -no inborn condition of note 67 year old man with normal CBC until 02.23.1993, when first noted to have monocytosis (wbc 6900; mono 17%; Absolute Mono Count (AMC) 1173/mm3), mild anemia (Hgb 13.4/ nl 13.6-16.7) and thrombocytopenia (121,000/nl 150-400,000). Otherwise clinically well. No significant other medical history. CMML by marrow biopsy 12/2001 (WBC 15,300; Hg 13.0; plt 65,000; AMC 3060/mm3). Initial cytogenetic analysis was normal, 46,XY. No treatment for 5 years because of stable counts and no symptoms. He presented with fatigue and purpura December 2006 (see description below) Organomegaly : no hepatomegaly; splenomegaly; no enlarged lymph nodes; no central nervous system involvement Blood WBC : 30.5 x 109/l; Hb : 13.5 g/dl; platelets : 17,000 x 109/l; blasts : 1% Bone marrow : AML, M4; 80% monocytoid blasts. Cyto pathology classification Cytology and immunophenotype : M4 Negative for: CD34, CD2, CD3, CD19, CD20, TdT, cyto CD3, CD7 Rearranged Ig Tcr : not done Pathology : AML, M4 Electron microscopy : not done Precise diagnosis : AML, M4 Survival Date of diagnosis: 12-2006 Treatment : Ara-C/Daunorubicin Complete remission : None Relapse : + Phenotype at relapse : normal karyotype 46,XY. The patient died shortly after the last cytogenetic analysis due to disease relapse. Status : Dead 02-2007 Survival : 2 Karyotype Sample : Bone Marrow; culture time : Overnight and 24; banding : G-banding; 450 band level Results : (using ISCN): 46,XY,inv(8)(p11.2q13)[6]/46,XY[14]

Atlas Genet Cytogenet Oncol Haematol 2007; 4 700

Partial metaphases and partial karyotypes showing the inv(8)(p11q13) Comments A review of the literature revealed six reports of inv(8)(p11q13) associated with AML M4 or M5 all involving female patients ages 10 months, 15, 19, 21, 29, and 56 years old (References 1-6, 8-9). This is the first report of inv(8)(p11.2q13) associated with AML M4 in a male patient and older than 56 years. The inversion causes the fusion of the MOZ gene at 8p11.2 with TIF2 at 8q13. Deguchi et al described the requirement for C2HC nucleosome recognition of MOZ and the CBP recruitment activity of TIF2 for transformation leading to leukemogenesis. The propensity of affected females requires further investigation, but may just be a bias in the literature (Reference 7). Internal links Atlas Card inv(8)(p11q13) Bibliography Abnormalities of chromosome band 8p11 in leukemia: two clinical syndromes can be distinguished on the basis of MOZ involvement. Aguiar RC, Chase A, Coulthard S, Macdonald DH, Carapeti M, Reiter A, Sohal J, Lennard A, Goldman JM, Cross NC. Blood 1997; 90(8): 3130-3135. Medline 9376594

A novel fusion between MOZ and the nuclear receptor coactivator TIF2 in acute myeloid leukemia. Carapeti M, Aguiar RC, Goldman JM, Cross NC. Blood 1998; 91(9): 3127-3133. Medline 9558366

Two cases of inv(8)(p11q13) in AML with erythrophagocytosis: a new cytogenetic variant. Coulthard S, Chase A, Orchard K, Watmore A, Vora A, Goldman JM, Swirsky DM. Br J Haematol 1998; 100(3): 561-563. Medline 9504640

Acute mixed lineage leukemia with an inv(8)(p11q13) resulting in fusion of the genes for MOZ and TIF2. Liang J, Prouty L, Williams BJ, Dayton MA, Blanchard KL. Blood 1998; 92(6): 2118-2122.

Atlas Genet Cytogenet Oncol Haematol 2007; 4 701 Medline 9731070

Acute myeloid leukemia with inv(8)(p11q13). Panagopoulos I, Teixeira MR, Micci F, Hammerstrøm J, Isaksson M, Johansson B, Mitelman F, Heim S. Leuk Lymphoma 2000; 39(5-6): 651-656. Medline 11342350

A further case of acute myeloid leukaemia with inv(8)(p11q13) and MOZ-TIF2 fusion. Billio A, Steer EJ, Pianezze G, Svaldi M, Casin M, Amato B, Coser P, Cross NC. Haematologica 2002; 87(5): ECR15. Medline 12010678

MOZ-TIF2-induced acute myeloid leukemia requires the MOZ nucleosome binding motif and TIF2-mediated recruitment of CBP. Deguchi K, Ayton PM, Carapeti M, Kutok JL, Snyder CS, Williams IR, Cross NC, Glass CK, Cleary ML, Gilliland DG. Cancer Cell 2003; 3(3): 259-271. Medline 12676584

Rearrangement of the MOZ gene in pediatric therapy-related myelodysplastic syndrome with a novel chromosomal translocation t(2;8)(p23;p11). Imamura T, Kakazu N, Hibi S, Morimoto A, Fukushima Y, Ijuin I, Hada S, Kitabayashi I, Abe T, Imashuku S. Genes Chromosomes Cancer 2003; 36(4): 413-419. Medline 12619166

A further case of acute myelomonocytic leukemia with inv(8) chromosomal rearrangement and MOZ-NCOA2 gene fusion. Murati A, Adelaide J, Popovici C, Mozziconacci MJ, Arnoulet C, Lafage-Pochitaloff M, Sainty D, Birnbaum D, Chaffanet M. Int J Mol Med 2003; 12(4): 423-428. Medline 12964013 inv(8)(p11q13). Boyer J. Atlas Genet Cytogenet Oncol Haematol 2004; 8 (2): 197-200. http://AtlasGeneticsOncology.org/Anomalies/inv8p11q13ID1189.html

Contributor(s) Written Jennifer JS Laffin, Sara J Morrison-Delap, Wayne A Bottner, Eric B 02-2007 Johnson, Patricia Howard-Peebles, Kate J Thompson, Gordana Raca, Karen D Montgomery, Daniel F Kurtycz Citation This paper should be referenced as such : Laffin JJS, Morrison-Delap SJ, Bottner WA, Johnson EB, Howard-Peebles P, Thompson KJ, Raca G, Montgomery KD, Kurtycz DF . inv(8)(p11.2q13) found in a patient with chronic myelomonocytic leukemia that progressed to acute myeloid leukemia. Atlas Genet Cytogenet Oncol Haematol. February 2007 . URL : http://AtlasGeneticsOncology.org/Reports/08LaffinID100027.html

Atlas Genet Cytogenet Oncol Haematol 2007; 4 702 © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2007; 4 703