ResearchOnline@JCU
This file is part of the following reference:
Kitahara, Visentini Marcelo (2011) Morphological and molecular systematics of scleractinian corals (Cnidaria, Anthozoa), with emphasis on deep-water species. PhD thesis, James Cook University.
Access to this file is available from:
http://researchonline.jcu.edu.au/39370/
The author has certified to JCU that they have made a reasonable effort to gain permission and acknowledge the owner of any third party copyright material included in this document. If you believe that this is not the case, please contact [email protected] and quote http://researchonline.jcu.edu.au/39370/
CHAPTER 3
Diversity of deep-sea corals from New Caledonia: a central Pacific
“hot spot” for azooxanthellate scleractinians
Following extant zooxanthellate scleractinian diversity, the western Pacific is by far the most diverse region for azooxanthellate scleractinians in the world. Within this region, recent studies on species richness suggested that the Philippines azooxanthellate scleractinian fauna is the most diverse, totalling 157 species. However, literature review and examination of over 3000 specimens from New Caledonia (from 80-1200 m depth) revealed the occurrence of 170 species to this small southwestern Pacific Archipelago. Species rarefaction analysis for New Caledonian samples shows that the species diversity for this region still underestimated implying that this region has a much more diverse azooxanthellate scleractinian coral fauna than previously examined regions. Based on published taxonomic revisions, each of the 438 azooxanthellate scleractinians known to occur in the Western Pacific was scored for 8 geographical macroregions, resulting in a data matrix of 3440 cells. Zoogeographical affinities of these localities were determined by performing cluster analysis using unweighted pair-group average method (UPGMA), followed by a non-metric multi-dimensional ordination (MDS). Three major clusters were distinguished: (i) Australian; (ii) Philippines / Indonesia / Japan; and (iii) New Zealand / Australian eastern seamounts / New Caledonia / Vanuatu / Wallis and Futuna. The results presented herein corroborate with the idea that the submerged ridges and seamounts between New Zealand and New Caledonia function as conduits for deep-water coral migration, and advocate for the necessity for additional azooxanthellate scleractinian taxonomic revisions for other southern Pacific archipelagos. Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
3.1 INTRODUCTION
Due to their capacity to deposit calcium carbonate, the corals of the order Scleractinia form some of the most three-dimensionally complex habitats in the ocean (Roberts et al., 2006). Known as shallow or deep-water reefs (see Roberts et al., 2009), these habitats sustain some of the most diverse ecosystems on the planet (Rogers, 1999; Dower & Perry, 2001; Reed, 2002). Comprising nearly 47% of the extant scleractinian species (Cairns, 2007; 2009), azooxanthellate corals do not live in association with photosynthetic dinoflagellates, being considered heterotrophic and usually referred as deep- or cold-water corals (Cairns, 2007). In contrast to their zooxanthellate shallow-water counterparts, azooxanthellate corals are ubiquitous in all oceans and are reported from off continental Antarctica (Cairns, 1982) to the Arctic Circle (Roberts et al., 2009). Amongst their representatives, many colonial and solitary species are considered cosmopolitan in distribution (e.g. Enallopsammia rostrata, Stenocyathus vermiformis, etc). Furthermore, the lack of symbiosis enabled azooxanthellate corals to thrive in aphotic regions, in waters deeper than 6300 m (Keller, 1976), with temperatures as low as -1ºC (Vaughan & Wells, 1943). Nonetheless, most azooxanthellate species live between 200 and 1000 m (Cairns, 2007), and the small number of azooxanthellate species inhabiting tropical shallow-water reef ecosystems is probably the result of their lack of competitiveness in relation to zooxanthellate species and the nutrient poor characteristic of these habitats.
Interestingly, the comparison between species diversity from different ocean basins have shown that the most diverse region for both, zooxanthellate and azooxanthellate scleractinians, are located in the tropical western Pacific (Veron, 1995; Cairns, 2007). To date, there are about 438 azooxanthellate scleractinian species reported from the western Pacific, which represent nearly 61% of all known species of this “ecological” coral group. Within this region, the Philippines azooxanthellate coral fauna was purported to be the most diverse totalling 157 species (Cairns, 2007). Literature review and examination of nearly 3000 specimens from New Caledonia Exclusive Economic Zone (EEZ) (representing about 30% of the specimens collected to this region as explained in Chapter 2) resulted in the identification of 170 azooxanthellate scleractinians. Therefore, it is likely that New Caledonia represents the richest locality for this fauna worldwide.
336 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
In contrast to shallow-water zooxanthellate corals, to date only few studies have explored biogeographic patterns of azooxanthellate corals. Most of these studies had focused on Atlantic fauna (e.g. Cairns & Chapman, 2002; Dawson, 2002). Based on all previous records of azooxanthellate corals from western Pacific, a cluster analysis using unweighted pair-group average method (UPGMA) followed by a non-metric multi-dimensional ordination (MDS) presented herein, represents the first attempt to understand the zoogeographical affinities of the western Pacific azooxanthellate corals. In addition, even acknowledging that non-systematically sampling across different depths potentially included some bias into part of the analysis, a brief discussion of New Caledonian azooxanthellate corals distribution in correlation with potential abiotic factors such bathymetry, and other oceanographic aspects is also provided.
3.2 MATERIAL AND METHODS
The present study is primarily based on the New Caledonian azooxanthellate scleractinian taxonomic review (Chapter 2), which comprised the examination of approximately 3000 previously unstudied specimens collected by French expeditions between 1985 and 2003 (Bathus 3, Bathus 4, Biocal, Gemini, Halical I, Halipro I, Musorstom 5, Musorstom 7, Musorstom 8, Musorstom 9, Norfolk 1, Norfolk 2, and SMIB 10). Collection of these specimens was carried out using waren-dredge and beam-trawl, between 80 and 1434 m (Fig. 3.1) across 178 stations (Chapter 2 – Tab. 2.2). The examined collection is a subset of the specimens sampled during those cruises, with thousands specimens still unstudied at French/New Caledonian Institutions (MNHN, Paris – Cairns and Bouchet, personnal communication; IRD, Nouméa – Pichon, personal communication).
Based on previously published large taxonomic revisions (see section 3.3.2), the following 8 western Pacific macroregions were defined: (i) Japan; (ii) Philippines and Indonesia; (iii) New Caledonia; (iv) Vanuatu, and Wallis and Futuna Islands; (v) New Zealand; (vi) Northeastern Australia; (vii) Southeastern Australia; and (viii) Australia eastern seamounts (Fig. 3.2). The Australian eastern coast was divided in two regions (vi and vii - with boundary located between Queensland and New South Wales states) because it expands for
337 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians more than 30º of latitude and is influenced by different oceanographic conditions. A complete database (species presence/absence) of all azooxanthellate scleractinians reported from each one of the above 8 regions was assembled (data not shown) and used in the species richness estimators and zoogeographical analysis.
Figure 3.1 –Map of the study area showing the stations with occurrence of azooxanthellate corals examined in the present study. Stations number are colour-coded based on the number of species identified: Black indicates 1 species; Gray indicates 2 to 5 species; Blue indicates 6 to 10 species; Green indicates 11 to 15 species; and Red indicates 16 or more species identified.
For each one of the 8 defined regions species accumulation curves and species richness estimators were produced by randomly adding samples to the accumulation curve and then plotting the mean of the 999 permutations random drawings using the Primer ver.6 (Clarke & Gorley, 2006). Western Pacific azooxanthellate scleractinian zoogeographical affinities were analysed employing the same approach used by Cairns & Chapman (2002), by first
338 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians constructing a cluster analysis of the regions using a UPGMA, followed by a MDS, here using the software PAST ver. 1.89 (Hammer et al., 2001) and Raup-Crick and Simpson indices. According to Hurbalek (1982) and Hammer & Harper (2006) the similarity indices Dice, Jaccard, Simpson, Ochiai, Kulcynski, and Raup-Crick can be used for presence/absence data, although the Raup-Crick index is less affected by sampling bias (Gast et al., 2005), and the Simpson’s coefficient of similarity “is suitable when the sampling is considered to be incomplete” (Hammer & Harper, 2006: 212). Nonetheless, to test the groups retrieved from Raup-Crick and Simpson indices, Kulcynski, Ochiai, Dice, and Jaccard similarity indices were also tested with the same data set returning identical clusters (data not shown).
Figure 3.2 –Map of the 8 western Pacific regions analysed in the present study. Japan EEZ - dark-blue; Philippines / Indonesia - light-blue; North Australia – green; South Australia – yellow; Australian eastern seamounts – purple; New Caledonia – dark-orange; Vanuatu and Wallis and Futuna – light-orange; New Zealand – red.
339 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
3.3 RESULTS
3.3.1 NEW CALEDONIA
Identification of specimens from 178 stations (Chapter 2, Tab. 2.2) and literature review totalled 170 species records from New Caledonian EEZ (Tab. 3.1), or nearly 24% of the known extant azooxanthellate scleractinians. Among them, all 14 extant families that have azooxanthellate representatives were recorded. A vast majority of the New Caledonian azooxanthellate scleractinians is solitary in growth form (87.6%), and only 21 species (12.4%) are colonial. Overall, 5.1 species were identified per station, although the richest station (Norfolk 2 stn. DW 2024 – 370 m deep) had 26 species. In general, the coral fauna from stations shallower than 200 m was poorer than those from greater depths, typically consisting of less than 5 species. Nonetheless, 24 stations deeper than 200 m (7 using beam-trawl and 17 using warren-dredge) had only 1 species collected.
Table 3.1 –Geographical distribution of extant azooxanthellate scleractinian species known from New Caledonia. Bathymetric ranges are given in meters. Regional abbreviations: J – Japan; P – Philippines and Indonesia; N – northern Australian coast (north from Queensland-New South Wales border); S – southern Australian coast (south from Queensland-New South Wales border); E – Australian eastern seamounts; C – New Caledonia; V – Vanuatu and Wallis and Futuna; and Z – New Zealand.
WESTERN PACIFIC REGIONS DEPTH (M) J P N S E C V Z BASAL SCLERACTINIAN GROUP FAMILY MICRABACIIDAE VAUGHAN, 1905 Letepsammia formosissima (Moseley, 1876) X X X X X 95-610 Letepsammia suprestes (Ortmann, 1888) X X X X X 77-710 Rhombopsammia niphada Owens, 1986 X X X X X 390-852 Stephanophyllia complicata Moseley, 1876 X X X X X X 73-1110 Stephanophyllia neglecta Boschma, 1923 X X X X 49-616 FAMILY GARDINERIIDAE STOLARSKI, 1996 Gardineria alloiteaui sp. nov. X 260-410 Gardineria hawaiiensis Vaughan, 1907 X X X X X 142-1200 Gardineria paradoxa (Pourtalès, 1868) X X X 91-730 Stolarskicyathus pocilliformis Cairns, 2004a X X 300-625 COMPLEX SCLERACTINIAN GROUP FAMILY TURBINOLIIDAE MILNE EDWARDS & HAIME, 1848A Alatotrochus rubescens (Moseley, 1876) X X X X X X 180-751 Australocyathus vincentinus (Dennant, 1904) X X 16-148 Cyathotrochus pileus (Alcock, 1902) X X X X X X X 123-1110 Idiotrochus alatus Cairns, 2004a X X X 315-600 Idiotrochus australis (Duncan, 1865) X 265-305 Notocyathus conicus (Alcock, 1902) X X X X X X 34-1110 Notocyathus venustus (Alcock, 1902) X X X X 70-580
340 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
Table 3.1 - Continue Pleotrochus venustus (Alcock, 1902) X X X X 200-820 Pleotrochus zibrowii Cairns, 1997 X X 700-1150 Tropidocyathus labidus Cairns & Zibrowius, 1997 X X X X 206-536 FAMILY FUNGIACYATHIDAE CHEVALIER, 1987 Fungiacyathus (F.) fragilis Sars, 1872 X X X 200-2200 Fungiacyathus (F.) paliferus (Alcock, 1902) X X X X X 69-823 Fungiacyathus (F.) pusillus pacificus Cairns, 1995 X X X X 350-1150 Fungiacyathus (F.) sandoi Cairns, 1999 X X X X 77-600 Fungiacyathus (F.) stephanus (Alcock, 1893) X X X X X X 245-2000 Fungiacyathus (B.) granulosus Cairns, 1989a X X X X X 230-1050 Fungiacyathus (B.) margaretae Cairns, 1995 X X X X X 440-1175 Fungiacyathus (B.) turbinolioides Cairns, 1989a X X X X X 589-930 Fungiacyathus (B.) variegatus Cairns, 1989a X X X X X X 84-715 FAMILY FLABELLIDAE BOURNE, 1905 Flabellum (F.) arcuatile Cairns, 1999 X X X X 300-1074 Flabellum (F.) politum Cairns, 1989a X X X 40-402 Flabellum (U.) aotearoa Squires, 1964 X X X X X 130-1300 Flabellum (U.) deludens Marenzeller, 1904b X X X 106-1035 Flabellum (U.) disaequabilis sp. nov. X 699-715 Flabellum (U.) hoffmeisteri Cairns & Parker, 1992 X X X X X 110-842 Javania amplissima sp. nov. X 377-401 Javania antarctica (Gravier, 1914a) X 53-1280 Javania deforgesi sp. nov. X 275-348 Javania exserta Cairns, 1999 X X X 91-1150 Javania fusca (Vaughan, 1907) X X X X X X 260-1434 Javania insignis Duncan, 1876 X X X X 46-1050 Javania lamprotichum (Moseley, 1880) X X X X X X 191-1150 Placotrochides minuta Cairns, 2004a X X 119-458 Polymyces wellsi Cairns, 1991a X X X X 355-1203 Rhizotrochus flabelliformis Cairns, 1989a X X X X X X 228-1050 Rhizotrochus levidensis Gardiner, 1899 X X X 1-73 Rhizotrochus typus Milne Edwards & Haime, 1848a X X X X 20-1048 Truncatoflabellum candeanun (M. Edwards & Haime, 1848a) X X X X 70-350 Truncatoflabellum dens (Alcock, 1902) X X X X 286-555 Truncatoflabellum formosum Cairns, 1989a X X X 42-1200 Truncatoflabellum incrustatum Cairns, 1989a X X X 30-415 Truncatoflabellum paripavoninum (Alcock, 1894) X X X 394-1450 Truncatoflabellum pusillum Cairns, 1989a X X X 85-460 Truncatoflabellum sp. A X 245-268 Truncatoflabellum sp. B X 245-268 Truncatoflabellum sp. C X 220-344 Truncatoflabellum sp. D X 300-305 Truncatoflabellum vigintifarium Cairns, 1999 X X X X 288-1050 FAMILY DENDROPHYLLIIDAE GRAY, 1847 Balanophyllia (B.) laysanensis Vaughan, 1907 X X 238-400 Balanophyllia (B.) cornu Moseley, 1881 X X X 60-570 Balanophyllia (B.) cylindrica sp. nov. X 208-405 Balanophyllia (B.) desmophyllioides Vaughan, 1907 X X X X X X 95-1050 Balanophyllia (B.) galapagensis Vaughan, 1906 X 18-462 Balanophyllia (B.) cf. B. generatrix Cairns & Zibrowius, 1997 X X 96-535 Balanophyllia (B.) gigas Moseley, 1881 X X X X X 90-640 Balanophyllia (B.) profundicella Gardiner, 1899 X X 73 Balanophyllia (B.) rediviva Moseley, 1881 X X X 90-256 Balanophyllia (B.) sp. X 260-400 Balanophyllia (B.) spinosa sp. nov. X 187-896 Cladopsammia sp. X 276-371 Cladopsammia willeyi (Gardiner, 1900) X Shallow Dendrophyllia alcocki (Wells, 1954) X X X X X X 118-1200 Dendrophyllia cf. D. arbuscula Van der Horst, 1922 X X X X X X 2-353 Dendrophyllia ijimai Yabe & Eguchi, 1934 X X X X 10-366 Eguchipsammia fistula (Alcock, 1902) X X X X X 86-1434 Eguchipsammia gaditana (Duncan, 1873) X X X X X X 30-1074 Enallopsammia rostrata (Pourtalès, 1878) X X X X X X X X 110-2165 Endopachys grayi Milne Edwards & Haime, 1848a X X X X X X X 37-386 Endopsammia regularis (Gardiner, 1899) X X 8-73 Heteropsammia cochlea (Spengler, 1781) X X X 6-762 Tubastraea coccinea Lesson, 1829 X X X X X 0-110 Tubastraea micranthus (Ehrenberg, 1834) X X X X 0-50 FAMILY GUYNIIDAE HICKSON, 1910
341 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
Table 3.1 - Continue Guynia annulata Duncan, 1872 X X X X X X 28-653 FAMILY AGARICIIDAE GRAY, 1847 Dactylotrochus cervicornis (Moseley, 1881) X X X X 73-852 Thalamophyllia riisei (Duchassaing & Michelotti, 1860) X 4-914 Thalamophyllia tenuescens (Gardiner, 1899) X X X X X 8-360 ROBUST SCLERACTINIAN GROUP FAMILY ANTHEMIPHYLLIIDAE VAUGHAN, 1907 Anthemiphyllia dentata (Alcock, 1902) X X X X X X X X 50-1050 Anthemiphyllia pacifica Vaughan, 1907 X X X X 205-351 Anthemiphyllia patera costata Cairns, 1999 X X 320-1150 Anthemiphyllia spinifera Cairns, 1999 X X X X X X 282-1009 FAMILY A Deltocyathus cameratus Cairns, 1999 X X X 305-1175 Deltocyathus corrugatus Cairns, 1999 X X 250-620 Deltocyathus crassiseptum Cairns, 1999 X X 370-668 Deltocyathus heteroclitus Wells, 1984 X X 208-600 Deltocyathus inusitatus Kitahara & Cairns, 2009 X 410-966 Deltocyathus ornatus Gardiner, 1899 X X X 73-550 Deltocyathus rotulus (Alcock, 1898) X X X X X X 143-1986 Deltocyathus suluensis Alcock, 1902 X X X X X X 142-1050 Deltocyathus vaughani Yabe & Eguchi, 1932 X X X X 88-1097 FAMILY B Aulocyathus recidivus (Dennant, 1906) X X X X X X X 128-1137 Conotrochus funicolumna (Alcock, 1902) X X X X X X 80-1078 Faustinotrochus neocaledonensis sp. nov X 230-1434 Stephanocyathus (O.) coronatus (Pourtalès, 1867) X X X X X X 533-1989 Stephanocyathus (S.) regius Cairns & Zibrowius, 1997 X X X X 563-2160 Stephanocyathus (A.) spiniger (Marenzeller, 1888) X X X X X X X X 120-1188 Vaughanella concinna Gravier, 1915 X X 316-3018 Vaughanella sp. A X 834-870 FAMILY POCILLOPORIDAE GRAY, 1842 Madracis kauaiensis Vaughan, 1907 X X X 44-541 FAMILY C Madrepora oculata Linnaeus, 1758 X X X X X X X 55-1950 Madrepora porcellana (Moseley, 1881) X X X 55-757 FAMILY CARYOPHYLLIIDAE DANA, 1846 Bourneotrochus stellulatus (Cairns, 1984) X X X X X X 210-896 Caryophyllia (C.) abrupta Cairns, 1999 X X 300-699 Caryophyllia (C.) aspera Kitahara et al., 2010 X 400-550 Caryophyllia (C.) cinticulata (Alcock, 1898) X 282-384 Caryophyllia (C.) concreta Kitahara et al., 2010 X 215-570 Caryophyllia (C.) crosnieri Cairns & Zibrowius, 1997 X X X X X X 133-1434 Caryophyllia (C.) diomedeae Marenzeller, 1904b X X X X X X 225-2200 Caryophyllia (C.) hawaiiensis Vaughan, 1907 X X X X X X 85-650 Caryophyllia (C.) laevigata Kitahara et al., 2010 X 410-1074 Caryophyllia (C.) lamellifera Moseley, 1881 X X X X X 89-1152 Caryophyllia (C.) oblonga Kitahara et al., 2010 X 670-1005 Caryophyllia (C.) octopali Vaughan, 1907 X 410-627 Caryophyllia (C.) quadragenaria Alcock, 1902 X X X X X 54-443 Caryophyllia (C.) ralphae Cairns, 1995 X X 270-896 Caryophyllia (C.) rugosa Moseley, 1881 X X X X X X 71-724 Caryophyllia (C.) scobinosa Alcock, 1902 X X X X X X X 302-2450 Caryophyllia (C.) sp. A X 416-433 Caryophyllia (C.) versicolorata Kitahara et al., 2010 X 215-708 Caryophyllia (A.) unicristata Cairns & Zibrowius, 1997 X X X 251-620 Crispatotrochus rubescens (Moseley, 1881) X X X X X 110-870 Crispatotrochus rugosus Cairns, 1995 X X X X X X 142-1050 Crispatotrochus septumdentatus Kitahara & Cairns, 2008 X 187-400 Desmophyllum dianthus (Esper, 1794) X X X X X X X 8-2460 Heterocyathus aequicostatus Milne Edwards & Haime, 1848a X X 0-268 Heterocyathus sulcatus (Verrill, 1866) X X X 11-351 Labyrinthocyathus limatulus (Squires, 1964) X X X X X 20-580 Monohedotrochus circularis (Cairns, 1998) X X X 190-545 Monohedotrochus epithecatus (Cairns, 1999) X X 215-544 Oxysmilia corrugata Cairns, 1999a X X 180-348 Premocyathus dentiformis (Alcock, 1902) X X X X X 22-960 Rhizosmilia multipalifera Cairns, 1998 X 11-348 Rhizosmilia robusta Cairns, 1993 X X X 66-510 Rhizosmilia sagamiensis (Eguchi, 1968) X X X 60-371
342 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
Table 3.1 - Continue Stenocyathus vermiformis (Pourtalès, 1868) X X X X X 110-1500 FAMILY D Tethocyathus cylindraceus (Pourtalès, 1868) X X 183-649 Tethocyathus minor (Gardiner, 1899) X X 73 Tethocyathus sp. X 400 Tethocyathus virgatus (Alcock, 1902) X X X X X X 137-1200 Trochocyathus (T.) caryophylloides Alcock, 1902 X X X 115-724 Trochocyathus (T.) cepulla Cairns, 1995 X X X 398-980 Trochocyathus (T.) discus Cairns & Zibrowius, 1997 X X X X 240-700 Trochocyathus (T.) efateensis Cairns, 1999 X X 245-500 Trochocyathus (T.) maculatus Cairns, 1995 X X X X X X X 77-550 Trochocyathus (T.) philippinensis Semper, 1872 X X X X 54-330 Trochocyathus (T.) cf. T. rawsonii Pourtalès, 1874 X 55-1200 Trochocyathus (T.) vasiformis Bourne, 1903 X X X 270-1150 Trochocyathus (T.) wellsi Cairns, 2004a X X 75-230 Trochocyathus (T.) sp. cf. T. wellsi Cairns, 2004a X X 215-270 Trochocyathus (A.) brevispina Cairns & Zibrowius, 1997 X X X X 240-560 FAMILY E Paracyathus peysonneli sp. nov. X X 90-455 Paracyathus lifuensis Gardiner, 1899 X 73 Paracyathus montereyensis Durham, 1947 X 75-371 Paracyathus parvulus Gardiner, 1899 X 73 Paracyathus sp. X 1000-1005 Polycyathus fulvus Wijsman-Best, 1970 X 30-50 FAMILY RHIZANGIIDAE d’Orbigny, 1851 Culicia fragilis Chevalier, 1971 X 14-20 Culicia rubeola (Quoy & Gaimard, 1833) X 0-82 Oulangia cyathiformis Chevalier, 1971 X 10-20 INCERTAE SEDIS Deltocyathus magnificus Moseley, 1876 X X X X X X 88-1500 Trochocyathus (T.) rhombcolumna Alcock, 1902 X X X X X X 110-1074 FAMILY SCHIZOCYATHIDAE STOLARSKI, 2000 Temnotrochus kermadecensis Cairns, 1995 X X X 321-425 FAMILY STENOCYATHIDAE STOLARSKI, 2000 Truncatoguynia irregularis Cairns, 1989a X X X X 80-400
The average number of species collected with the two different sampling gears shows that warren-dredge outperforms beam-trawl for collecting azooxanthellate scleractinians (with a ratio of 5.7 species collected per station in the former against 3 in the latter). However, the difference between sampling gear appears to not have a large effect within regional diversity evaluation, once only 26 stations were sampled using beam-trawl, of which 17 had warren-dredge stations nearby. Additionally, waren-dredge was used in the vast majority of stations in the southwestern and southeastern New Caledonia EEZ regions, which were among the most speciose regions for azooxanthellate scleractinians within the study area, with many stations having more than 8 species identified (Fig. 3.1).
These two regions have extremely complex geomorphologic features, being remarkably rich in seamounts, which are known to be unique deep-sea environments dominated by suspension feeders such corals (Rogers, 1994; Richer de Forges et al., 2000) with highly ecological importance to deep-sea diversity (Rogers, 1999). According to Genin et al.
343 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
(1986), complex underwater geomorphology changes local hydrodynamics, probably enhancing current speed and providing a rich supply of nutrients for heterotrophic organisms. In addition, complex underwater geomorphology is also correlated with substrate mosaics, which is known to enhance coral diversity (Roberts et al., 2009).
Following the new classification scheme suggested in Chapters 2, which was based on molecular and morphological data, the family Caryophylliidae is represented in the study area by 11 genera, being especially diverse for the genus Caryophyllia, which totalled 18 species. Other genera previously thought to belong to this family, such as Deltocyathus, Stephanocyathus, and Trochocyathus also display high diversity in New Caledonia region if compared to other regions in the world. However, it is worth to note that according to the molecular results (Chapter 9), these three genera most likely represent three new families. The family Flabellidae also appears to be very diverse in the study area with 29 species recorded to date or almost 30% of its representatives. Amongst flabellids, the genus Javania is represented by 7 of the extant 12 species.
The following 7 species are reported from New Caledonia, but display a very disjunct distribution, been previously recorded from other oceans worldwide, but not from western Pacific waters: (1) Balanophyllia galapagensis (eastern Pacific [Vaughan, 1906; Cairns, 1991a; 1994]); (2) Caryophyllia cinticulata (known from Indian Ocean [Alcock, 1898; Gardiner, 1904]); (3) Caryophyllia octopali (reported to Hawaiian Islands and adjacent waters [Vaughan, 1907; Maragos, 1977; Cairns 1984]); (4) Paracyathus montereyensis (recorded from western coast of United States [Durham, 1947; Cairns, 1994]); (5) Thalamophyllia riisei (previously reported only for central western Atlantic [Duchassaing, 1870; Cairns, 1979; 2000]); (6) Rhizosmilia multipalifera (known from Australia western coast [Cairns 1998; 2004a]); and (7) Javania antarctica (reported only from Antarctic water [Gravier 1914a; Cairns, 1982]).
The colonial species Madrepora oculata, Enallopsammia rostrata, and Dendrophyllia alcocki appears to be the deep-water bank framework species in the study area, however, to date there is no record of Lophelia pertusa in the region. Although very widely distributed throughout the Atlantic Ocean and considered to be the primary framework species of deep-water coral reefs (Cairns & Stanley, 1992), L. pertusa is rarely collected in the
344 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians western Pacific, been its previous records sparse and composed of few, usually dead, fragments. Its western Pacific records are restricted to Sub-Antarctic region (small branch with 5 damaged corallites [Cairns, 1982]), Japan (2 branches [Cairns, 1994]), Wallis and Futuna (several dead fragments [Cairns, 1999]), and Philippines (1 branch [Cairns, personal communication]). In general Caryophyllia diomedeae, Dactylotrochus cervicornis, Trochocyathus rhombcolumna, Javania fusca, and Flabellum arcuatile were the most commonly collected species with some of them being identified from more than 30 stations.
Within the 170 species reported from New Caledonia, 10 were identified only to genus level, but due to comparison to the identified species, they represent different taxa. Furthermore, the identification of Balanophyllia cf. B. generatrix, Dendrophyllia cf. D. arbuscula, Trochocyathus cf. T. rawsonii, and Trochocyathus sp. cf. T. wellsi were just tentative due to (i) the restricted number of individuals available for the present study, and (ii) the poorly known extent of intraspecific morphological variation within each species.
The species versus bathymetry chart (Fig. 3.3) shows a rapid increment of species between 200 and 250 m. Species richness peak between 251 and 400 m (83-84 species), followed by a slow diversity decline in direction to deeper waters, represented by an asymmetric long right tail below 1200 m. This most speciose bathymetric range in New Caledonian waters is similar to the Caribbean one (Cairns, 1979; 2000), and is included in the prime bathymetric range of azooxanthellate scleractinians in the world (Cairns, 2007).
The family Dendrophylliidae is the only one to display representatives in all depths sampled in the present study, being the genus Tubastraea restricted to shallow-waters, and Eguchipsammia the deepest family representative, reaching 1434 m. The families Caryophylliidae and Flabellidae are present in most depths sampled, corroborating to Wells (1956: F367) who quoted that the Caryophylliina “is one of the most successful of all scleractinian groups in adaptation to extremes of environment and prolific in generic differentiation”. The other families appear to be more restricted to narrow bathymetric ranges than dendrophylliids, caryophylliids, and flabellids.
345 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
Figure 3.3 –Non-cumulative bathymetric range of azooxanthellate corals from New Caledonian region at 50 m intervals.
The diversity accumulation curves (Fig. 3.4) based on Chao 1, Jacknife (1 and 2) and Bootstrap richness estimators did not reach a plateau, indicating that New Caledonia is probably more diverse than estimated in the present study. It also suggests that the sampling across the study region is not saturated, extrapolating to up to 270 the total number of species predicted to the region.
Figure 3.4 –New Caledonian species accumulation curves showing: Species observed (Sobs) and four species richness estimators (Chaos 1, Jacknife 1 & 2, and Bootstrap).
346 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
3.3.2 OTHER WESTERN PACIFIC REGIONS
The compilation of all azooxanthellate scleractinian records for each one of the selected western Pacific regions resulted in 7 matrices of sizes dependent on the respective number of stations for each region (data not shown). Even acknowledging that probably some references were overlooked during the literature review process, it is believed that all species reported for each region were included in the present analysis, and were composed as shown below:
• Japan – 179 stations ranging in depth between 28 and 1950 m (Cairns, 1994; Tachikawa, 2005; 2008; Ogawa, 2006); • Philippines and Indonesia – 640 stations ranging in depth between 1 and 2570 m (Cairns & Zibrowius, 1997); • Vanuatu and Wallis and Futuna Islands – 227 stations ranging in depth between 80 and 1620 m (Cairns, 1999); • New Zealand – 806 stations ranging in depth between 0 and 1800 m with 3 stations at more than 4000 m (Cairns, 1995); • Northeastern Australia, Southeastern Australia and Australia eastern seamounts – 380 stations ranging between in depth 32 and 1750 m (Cairns & Parker, 1992; Cairns, 1998; 2004; Kitahara, unpublished data).
Diversity accumulation curves (Fig. 3.5) suggest that the most sampled regions (Japan, Philippines / Indonesia, and New Zealand) have a well-known azooxanthellate scleractinian fauna. Consequently their respective species observed curves, almost reached a plateau, as well as their species estimators curves. All the other western Pacific regions had their respective species richness estimators showing that more species will be added once more sampling be undertaken. Amongst these regions, the north Australian appears to be the most underestimated one, with only 135 species previously reported and Jacknife 2 estimating more than 250.
347 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
Figure 3.5 –Accumulation curves showing species observed (Sobs) and four species richness estimators (Chaos 1, Jacknife 1 & 2, and Bootstrap) for each one of the 7 western Pacific regions analyzed in the present study.
348 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
3.4 DISCUSSION
The New Caledonia azooxanthellate coral fauna (170 spp.) lies in species diversity between the large tropical Philippines / Indonesian region (208 spp.), and the high latitudinal New Zealand (114 spp.) and Japanese (116 spp.) regions. The known diversity in New Caledonia region represents 24% of the extant species of the group, making it one of the richest regions in the world for these hexacorallians. Even having a more diverse azooxanthellate coral fauna than most of the other 7 western Pacific regions examined herein, the New Caledonia EEZ has a dramatically lower number of stations if compared within the well- sampled Philippines / Indonesian region (> 640 stations). Furthermore, if not the same, the sampling techniques employed in New Caledonian stations were more conservative than those employed in other western Pacific regions, showing that its regional azooxanthellate scleractinian diversity is not related to sampling effort or collection method bias. Comparison between the diversity estimative for each of the 8 western Pacific regions (Figs. 3.4 and 3.5) suggests that New Caledonia probably have more than 275 azooxanthellate scleractinian species, or more than 100 yet to be reported for this region. The north Australian region is predicted herein to reach a total number of 245 species, being followed by Philippines / Indonesian region (210 spp.), Vanuatu / Wallis and Futuna (160 spp.), Japan and New Zealand (about 150 spp. each), Australian eastern seamounts (120 spp.), and south Australian region with predicted number of species not exceeding 100.
It is expected that additional sampling stations in all depths will dramatically increase the number of species recorded from New Caledonia. However, the number of species reported from shallow (between 0 and 200 m) and deep-waters (below 1000 m) is probably underestimated as a function of the low number of stations in those depths in comparison to stations between 200 and 1000 m. Nonetheless, the pattern of species diversity through depths found in New Caledonia region follows worldwide trend, once the vast majority of species are found between 200 and 1000 m (Cairns, 2007; Roberts et al., 2009), rapidly decreasing to deeper waters (Cairns, 2007).
349 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
Part of the explanation why New Caledonian region is so diverse in terms of azooxanthellate corals seems to be the propensity for more species to occur in large, spatially heterogeneous regions that are relatively stable over time or “area effect” tendency proposed by Stehli & Wells (1971) and Rosen (1971; 1981). The “area effect” tendency is direct influenced by substratum availability, with more species being reported from regions with more diverse substrate types. However, the Aragonite Saturation Horizon (ASH) depth also appears to have a profound impact on azooxanthellate scleractinian species richness worldwide. According to Guinotte et al. (2006), in 1995 the New Caledonia ASH depth was estimated to be between 1000-2000 m, which was one of the deepest horizons in Pacific waters. According to the same author, regions that have shallow ASH (e.g. North Pacific) have less diverse azooxanthellate scleractinian fauna. Although “area effect”, substrate availability and ASH depth being considered as the primary limiting factors on azooxanthellate scleractinian distribution (Cairns, 2007), other oceanographic aspects (such available nutrients, temperature, oxygen concentration, salinity, etc) play important roles in New Caledonian Scleractinia species diversity. In fact, Roberts et al. (2009) propose that temperature may be one of the most important ecological factors influencing distribution of corals worldwide, with species usually reported to waters deeper than 200 m being recently recorded from shallow environments (e.g. Chilean fjords – see Cairns et al., 2005) where cold upwelled waters are favourable. Furthermore, corals must inhabit regions with a constant or periodic water flow, which should provide enough organic / inorganic food and oxygen for these “sessile” organisms.
Briefly, the complex underwater geomorphology found around the New Caledonian archipelago probably follows previous observations from other sites in the world, enhancing water masses current speed. Around this region, five main water-masses occur in the first 4000 m: Tropical Surface Water (TSW); Subtropical Lower Water (SLW); Sub- Antarctic Mode Water (SAMW); Antarctic Intermediate Water (AIW); and Circumpolar Deep Water (CDW) (some of the water mass characteristics can be found in: Wyrtki [1960], McCartney [1977], Georgi [1979], Piola & Georgi [1982], and Sokolov & Rintoul [2000]).
350 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
Comparing species diversity with regional environmental conditions (temperature, oxygen and nutrient concentrations), it was observed that more stable temperature conditions usually reached below 200 m, and high concentration of oxygen and nutrients as observed in the SLW, SAMW, AIW, and upper layer of CDW, result in higher species diversity. Nonetheless, even with high nutrient concentration and stable temperatures, the deeper waters sampled (below 1000 m) do not display high species diversity, a fact that may be related to the extremely low levels of oxygen in the upper layer of the CDW, also known as oxygen minimum layer (Sokolov & Rintoul, 2000). However, as discussed above, it is expected that the number of species recorded below 1000 m will slightly increase when additional sampling be undertaken.
To summarize, all main factors that enhance the diversity of azooxanthellate corals occurs around New Caledonia: stable and proper temperature ranges; great substrate mosaics including appropriate hard substratum for settlement; high concentration of ridges, seamounts, and rock outcrops where current speed is enhanced, providing good source of food and nutrients; and deep ASH.
Comparing the New Caledonia azooxanthellate scleractinian coral fauna with the other western Pacific regions mentioned above, there are 40 species known only from the study area (Tab. 3.1). Not surprisingly, as many species of azooxanthellate corals have much broader latitudinal distribution if compared to their tropical counterparts, 35 species were previously reported in both Japan and New Zealand regions, which represent more than 60º between their northernmost and southernmost records. Amongst these species, 24 occur in New Caledonia, and Anthemiphyllia dentata, Stephanocyathus spiniger, and E. rostrata were the only species known to occur in all 8 zoogeographical regions analyzed herein. Nonetheless, Dasmosmilia lymani, Desmophyllum dianthus, Madrepora oculata, and Enallopsammia rostrata are considered cosmopolitan (Kitahara, 2007). However, it is expected that the “distributional gaps” (other western Pacific regions) of most of the 35 species reported from Japanese and New Zealand regions be filled when more samples be available, once it is not likely that a species presents such disjunct distribution being present, for example, in Japan and southern Australia regions and absent in northern Australia region as Conotrochus funicolumna.
351 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
Using the presence/absence records of azooxanthellate scleractinians from all zoogeographical regions analyzed in the present study, the UPGMA and MDS cluster analysis (Figs. 3.5, 3.6) indicates three well-resolved groups: (1) northern and southern Australia (Fig. 3.5 [D]); (2) Philippines/Indonesia and Japan regions (Fig. 3.5 [C]); and (3) Australia eastern seamounts, Vanuatu, Wallis and Futuna Islands, New Caledonia (Fig. 3.5 [A]), with New Zealand slightly less similar (Fig. 3.5 [B]). The deep-sea corals from eastern Australia cluster together based on Raup-Crick, Simpson, Ochiai, and Kulczynski similarity indices, with nearly 62% of the species reported from southeastern Australia also reported from northeastern Australia region. However, Dice and Jaccard similarity indices (data not shown) isolate southeastern Australia and indicate that northeastern Australia coral fauna is more similar to Philippines and Indonesia region.
Figure 3.6 –Dendrogram of the 9 western Pacific regions, produced by UPGMA clustering with the Raup-Crick (solid lines) and Simpson (dashed lines) similarity indices. Node labels represent main regional groupings. Abbreviations: Japan - Jp; Philippines and Indonesia - Ph+Ind; Northern Australia - Aus_(N); Southern Australia - Aus_(S); Eastern Australia Seamounts - Aus_(Sea); New Caledonia – NC; Vanuatu and Wallis and Futuna Islands –Va+WF; and New Zealand - NZ.
352 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
The Japan and Philippines/Indonesia regions form another cluster with high similarity, with 70 species shared between both regions. Interestingly, the cluster analysis shows that the azooxanthellates of the New Caledonia region have more similarity with the northern coral fauna reported to Philippines/Indonesia and Japan regions than to the more adjacent eastern Australia ones, which could be explained by the flowing regimes of the water masses in the region, especially the SLW, SAMW, and AAIW which have northwestward as main direction. The azooxanthellates from Australia eastern seamounts, New Caledonia, Vanuatu, Wallis and Futuna Islands, and to a lesser extent the New Zealand form the last cluster. This grouping is parsimonious once they are physically adjacent to one another, or in the case of New Zealand is interconnected by submerged ridges, and has in the SLW and AIW a way to disperse throughout these regions. New Caledonia shares more than 50 species with New Zealand region, and more than 70 with Vanuatu/Wallis and Futuna Islands, indicating that the deep-sea coral fauna of these regions are very similar.
Figure 3.7 –Multi-Dimensional plotting of the 9 regions, showing 3 major clusters. Lines uniting the major clusters were drawn by hand and represent the similarity index of each of the 3 major groups according to the cluster analysis.
353 Chapter 3 Diversity of deep-sea corals from New Caledonia: a central Pacific “hot spot” for azooxanthellate scleractinians
The species diversity among western Pacific regions, which include the most diverse regions for azooxanthellate scleractinians in the world (Cairns, 2007; Roberts et al., 2009), indicates that the present study area can be considered, to date, the “hot-spot” region for this fauna. Corroborating with previous studies, the idea that the western sides of oceans are remarkably more speciose in comparison to the eastern sides (Keller, 1998; Cairns, 2007; Roberts et al., 2009) is strengthened. This idea is related to the fact that the western ocean basins are “passive” and the eastern ones are “active”. Additionally, the bathymetric range of azooxanthellate scleractinians from New Caledonia follows worldwide tendency, in having a more diverse fauna between 200 and 500 m. However, contradicting the hypothesis that corals are more common in the northern hemisphere tropics, the present study suggests that at least in western Pacific waters, the southern hemisphere appears to be more diverse. Extrapolating this result for other ocean basins, it is expected that the western sides of Atlantic and Indian oceans located in the southern hemisphere will, with additional sampling effort, surpass the high diverse regions of the Caribbean and northern Indian respectively.
354 CHAPTER 4
Monophyletic origin of Caryophyllia (Scleractinia, Caryophylliidae), with
description of six new species
The genus Caryophyllia Lamarck, 1816 is the most diverse genus within the azooxanthellate Scleractinia comprising 66 Recent species and a purported 195 nominal fossil species. Examination of part of the deep-sea scleractinian collection made by the Paris Museum off New Caledonia and part of the material collected by CSIRO off Australian waters revealed the occurrence of 23 species of Caryophyllia, of which six are new to science. All new records, including the new species, are described, and synonyms, distribution, type locality, type material, and illustration are provided for each species. An identification key to all Recent species of Caryophyllia is suggested. In addition, the validity of the genus Caryophyllia was investigated by phylogenetic analyses of a dataset consisting of partial mitochondrial 16S rDNA sequences from 12 species assigned to this genus together with 7 species representing some of the most morphologically similar caryophylliid genera, and 14 non- caryophyllid species representing 14 scleractinian families. Irrespective of the method of analysis employed, all of the Caryophyllia species formed a well-supported clade together with Dasmosmilia lymani and Crispatotrochus rugosus. Although based on a subset of the Recent Caryophyllia species, these results are consistent with Caryophyllia being a valid genus, but call for a reexamination of Dasmosmilia and Crispatotrochus. Chapter 4 Monophyly of the Genus Caryophyllia
4.1 INTRODUCTION
The family Caryophylliidae Dana, 1846 is represented by 89 valid genera. Of those, 38 are only known as fossil records, with the oldest fossil record dating from the Jurassic (about 180 Mya). The other 51 Recent valid genera of this family are ubiquitous through all oceans of the world, being recorded from shallow (Cairns et al., 2005) to deep (Squires, 1959) waters, from coastal Antarctic (Cairns, 1982) to the Arctic Circle (Roberts et al., 2003). Representatives of this family include the largest colonial azooxanthellate species of coral (e.g., Lophelia pertusa (Linnaeus, 1758) – one of the primary deep-water coral bank constructor [Cairns & Stanley, 1982], attaining more than 35 m in high and several km wide), to some of the smallest ones (e.g., Coenocyathus parvulus [Cairns, 1979], which is less than 1 cm in CD).
The trabecular wall structure of every caryophylliid begins as a marginotheca, but transforms into a septo- or parathecal wall later in ontogeny, these more mature wall structures usually having well-developed costae (Stolarski, 1995), and occasionally non-trabecular calcium carbonate is deposited on the exterior of the corallum in the form of tectura or even epitheca (e.g., Tethocyathus Kühn, 1933) (Cairns, 2002). According to Wells (1956), this family is characterized as: “solitary or colonial; colony formation usually by extratentacular (rarely intratentacular) budding, forming phaceloid or dendroid colonies; costae commonly covered by tectura or epitheca; septa exsert; columella formed by curled trabecular laths, solid, spongy, or absent; pali or paliform lobes common; endothecal dissepiments developed in some groups”.
Within this family, the exclusively azooxanthellate genus Caryophyllia, is common worldwide and consists of 66 Recent valid species (Appendix 4.1), being the most diverse Recent genus of azooxanthellate corals. All representatives of this genus are solitary, including forms firmly attached to the substrate, such as Caryophyllia berteriana Duchassaing, 1870, and others that detach at an early stage, such as Caryophyllia ambrosia Alcock, 1898, to continue a free life form on soft bottoms (sand or mud).
With the first fossil record from the Upper-Jurassic (Vaughan & Wells, 1943) and today predominantly collected between 0-2700 m, the first Caryophyllia was described 15 years before the description of the genus as Madrepora cyathus (Ellis & Solander,
356 Chapter 4 Monophyly of the Genus Caryophyllia
1786) (=Caryophyllia cyathus), which was selected by Stokes & Broderip (1828) as the type species for the genus. According to Zibrowius (1980), this species was already well known and commonly collected in the Mediterranean Sea. In the same study, Caryophyllia smithii Stokes & Broderip (1828) was described based on specimens collected from southwestern England. Not surprisingly, C. smithii is the Caryophyllia with the highest number of synonyms, totaling 14 between the years 1828 to 1878.
Described as Acanthocyathus grayi, C. (A.) grayi (Milne Edwards & Haime, 1848) is often collected in Pacific waters and has previous records from the Indian Ocean. However, no information regarding type material deposition or type locality where provided by the species authors. Two years after the description of C. grayi, Caryophyllia berteriana Duchassaing, 1850 was described based on a specimen collected off Guadeloupe, differentiated from C. cyathus by Duchassaing (1850) by its pali disposition. Continuing his studies on the Caryophyllia from the Caribbean Sea, Duchassaing (1870) described C. corona and C. protei, both species collected off the Antilles at 60 and 100 m, respectively. However, since the original description no one has examined or even mentioned these species, being both considered as nomen oblitum in the present study. Using the stony corals deposited at the British Museum, Kent (1871) described Acanthocyathus spiniger Kent, 1871 (=Caryophyllia (A.) spinigera) from specimens collected in Japanese waters. In a study of the corals dredged during the expeditions of H.M.S. Porcupine from North Atlantic between 1869 and 1870, for the first time scleractinians were reported below 2000 m (Duncan, 1873). During these expeditions “hempen tangles” were employed instead of the crushing dredge, which resulted in the collection of fourteen new species of Scleractinia, including four valid species of Caryophyllia: C. abyssorum Duncan, 1873; C. atlantica (Duncan, 1873); C. seguenzae Duncan, 1873; and C. calveri Duncan, 1873. In the same study the genus Ceratocyathus was synonymised as Caryophyllia. Using the material collected by the Hassler Expedition off Barbados and the Blake Expedition off Florida, Pourtalès described C. antillarum Pourtalès, 1874, and C. polygona Pourtalès, 1878, and followed with the second study of the H.M.S. Porcupine material that included the description of Caryophyllia inornata (Duncan, 1878).
One of the largest additions to the genus was made during 1881 with the material collected worldwide during the voyage of H.M.S. Challenger between the years 1873- 1876, resulting in seven species being described: C. dentata (Moseley, 1881); C.
357 Chapter 4 Monophyly of the Genus Caryophyllia lamellifera Moseley, 1881; C. paucipalata Moseley, 1881; C. profunda Moseley, 1881; C. rugosa Moseley, 1881; C. spinicarens (Moseley, 1881); and C. transversalis Moseley, 1881. Subsequently, Marenzeller published a study about the turbinoliids from Japanese waters, describing C. japonica Marenzeller, 1888, which today is one of the Caryophyllia species with the greatest depth range (77 to 1680 m). The penultimate study from the 19th century describing species belonging to this genus was published using the material collected off Indian waters by H.M.S. Investigator during the years 1881-1893. Scleractinians described in those studies included: Caryophyllia ambrosia Alcock, 1898, C. cinticulata (Alcock, 1898), and C. paradoxa (=C. paradoxus Alcock, 1898). Finally, the last description of a Recent Caryophyllia in the 19th century was based in a fossil (Pleistocene) specimen from California named C. arnoldi Vaughan, 1900, being the only specimen of this species to have an unattached pedicel (Cairns, 1994).
Starting a very rich century for Caryophyllia descriptions (40 species), Lieut.-Col. Alfred Alcock named: C. ephyala Alcock, 1901, C. quadragenaria Alcock, 1902, and C. scobinosa Alcock, 1902, the last one having a very widespread distribution, being reported from the western south Atlantic, western Indian Ocean, Indo-Pacific, and Pacific Ocean. Subsequently, C. antarctica Marenzeller, 1904 and C. diomedeae Marenzeller, 1904 were described from specimens collected by the Valdivia Expedition. Before the First World War, another 3 species were described: C. planilamellata Dennant, 1906 from Australian waters, and C. hawaiiensis Vaughan, 1907 and C. octopali Vaughan, 1907 from Hawaiian waters. After a gap of more than 30 years without new species known from the genus, Gardiner & Waugh (1938), studying the material collected by the John Murray Expedition, described C. grandis Gardiner & Waugh, 1938, C. mabahithi Gardiner & Waugh, 1938, and C. sewelli Gardiner & Waugh, 1938. During the years 1939 and 1967 (probably due to the Second World War), only C. alaskensis Vaughan, 1941 was described.
The last pulse of descriptions of new species of Caryophyllia started with C. jogashimaensis Eguchi, 1968, C. sarsiae Zibrowius, 1974, and C. horologium Cairns, 1977, followed by revisions of large collections of azooxanthellate corals deposited in museums, and especially revisions of all previous data. Species described from the western Atlantic include: C. ambrosia caribbeana Cairns, 1979, C. barbadensis Cairns, 1979, C. corrugata Cairns, 1979, and C. zopyros Cairns, 1979. Subsequently, during the
358 Chapter 4 Monophyly of the Genus Caryophyllia
1980’s, studies from the eastern North Atlantic Ocean increased the number of species from this genus including the descriptions of C. alberti Zibrowius, 1980 and C. foresti Zibrowius, 1980. Studying specimens collected from Antarctic and sub-Antarctic waters, two species with depth range between 406 to 814 m were described: C. eltaninae Cairns, 1982, and C. squiresi Cairns, 1982. These two species along with C. antarctica are probably the southernmost records for the genus. After these descriptions from the southern ocean, almost all subsequent descriptions of Caryophyllia were based on specimens collected from Pacific or Indo-Pacific region, the only exception being C. balaenacea Zibrowius & Gili, 1990, and C. valdiviae Zibrowius & Gili, 1990, collected from Walvis Ridge and/or South Africa, south eastern Atlantic, and C. crypta Cairns, 2000 from Caribbean waters. The others 16 Pacific or Indo-Pacific species are: C. marmorea Cairns, 1984; C. quangdongensis Zou, 1984; C. zanzibarensis Zou, 1984; C. perculta Cairns, 1991; C. solida Cairns, 1991; C. ralphae Cairns, 1995; C. cornulum Cairns & Zibrowius, 1997; C. crosnieri Cairns & Zibrowius, 1997; C. karubarica Cairns & Zibrowius, 1997; C. octonaria Cairns & Zibrowius, 1997; C. secta Cairns & Zibrowius, 1997; C. unicristata Cairns & Zibrowius, 1997; C. decamera Cairns, 1998; C. stellula Cairns, 1998; C. abrupta Cairns, 1999; and C. huinayensis Cairns et al., 2005, the last Caryophyllia described to date (Appendix 4.1).
As a result of the examination of part of the collections made by the MNHN from New Caledonia, CSIRO from Australian waters, and C. transversalis deposited at WAM, 23 species of Caryophyllia were identified. The present study reports all new records of this genus, providing updated synonymies, type locality, type material, description, distribution, and illustrations of all species examined, including the description of six new species collected during the expeditions: MNHN – PrFo; Halipro I; Bathus 3; Bathus 4; Norfolk 1; and Norfolk 2, and CSIRO – SS0197; SS0105; SS0207; and NORFANZ. Also, an identification key for all species pertaining to the genus is proposed.
Until now, no phylogenetic analysis had been performed of any caryophylliid genera, which constitute by far the most diverse family of azooxanthellate Scleractinia. However, recent molecular studies (Romano & Palumbi, 1996; Romano & Cairns, 2000; Le Goff-Vitry et al., 2004) suggested that the family is unnatural, or polyphyletic, having representatives grouping with the two big scleractinian clades: the robust and complex corals, in more than two separated clades.
359 Chapter 4 Monophyly of the Genus Caryophyllia
Our study of the Caryophyllia from New Caledonia and the new records from Australian waters combine morphological descriptions and genetic data, and therefore has the following aims: 1) comprehensive morphological descriptions of all Caryophyllia from New Caledonia waters, including five new species; 2) a report of the first records of 4 species of Caryophyllia in Australian waters, including a new species; and 3) a reconstruction of the phylogenetic relationships based on partial 16S rDNA sequences of the genus Caryophyllia, supporting its monophyletic status.
4.2 MATERIAL AND METHODS
4.2.1 SAMPLING LOCATIONS
Between 1993 and 2003, French expeditions collected and preserved more than 2700 specimens of deep-water scleractinians (ranging in depth from 170 to 1434 m) from approximately 135 stations off New Caledonia from 18°00’S, 160°00’E to 26°00’S, 170°00’E (Fig. 4.1-4.6; Appendix 4.2). Also, between 1997 and 2007, Australian expeditions collected hundreds of azooxanthellate scleractinians from Pacific and Indian Ocean waters. The examination of these specimens revealed the occurrence of 23 species belonging to the genus Caryophyllia, all of them being fully described herein. Additionally, for each new record a complete citation synonym, type locality, type material, new records, distribution, and illustrations are provided.
Measurements and counts follow Wells (1956), Zibrowius (1980) and Cairns (1979, 2000). The basic morphological terminology used is explained by Vaughan & Wells (1943), Wells (1956), Alloiteau (1957) and Cairns (1982), and in case of septal formula by Cairns (1989).
All specimens examined are deposited primarily at the Muséum National d’Histoire Naturelle, Paris (MNHN), the National Museum of Natural History, Washington D.C. (USNM), the Australian Museum, Sydney (AMS), or at the Western Australian Museum, Perth (WAM).
360 Chapter 4 Monophyly of the Genus Caryophyllia
Figures 4.1-4.6. –Map of the stations with occurrence of Caryophyllia examined in the present study: 1, New Caledonia region; 2 and 3, Western Australian region; 4, southern Western Australian region; 5, Tasmania region; 6; southwestern Pacific region.
4.2.2 DNA PREPARATION, AMPLIFICATION AND SEQUENCE ANALYSES
Tissue was collected from a whole mesentery using a forceps when the species was large, or an entire sector (including the skeleton) was taken when the species was too small to collect only the mesentery. Genomic DNA was extracted using the DNeasy Tissue Kit of QIAGEN following the manufacturer’s instructions. For each species the concentration of genomic DNA extracted was measured in Nanodrop 1000 (Thermo Scientific), and when necessary an aliquot of the genomic DNA was diluted or concentrated to achieve the final concentration of 25ng/ul.
Using the primers developed by Le Goff-Vitry et al. (2004) (LP16SF 5’- TTGACCGGTATGAATGGTGT and LP16SR 5’-TCCCCAGGGTAACTTTTATC) a fragment of the mitochondrial 16S rDNA ranging between 290 to 303 bp according to the species being amplified. Reactions were carried out in 50 µl, with 5 µl of 10X PCR Buffer, 5 µl of 2 mM dNTP, 3 µl of 25 mM MgCl2, 2 µl of each primer (10 mM each), 0.3 µl of Taq polymerase, and 5 µl of template. PCR conditions used were: a denaturation first step of 95ºC for 5 min, followed by 35 cycles of 30 s at 94ºC, 30 s at
361 Chapter 4 Monophyly of the Genus Caryophyllia
50ºC, and 45 s at 72ºC, followed by 10 min at 72ºC. When the amplification of the 16S failed, a new reaction using the Clontech Advantage-2 Kit with the same template, primers and PCR conditions were performed following the manufacturer’s instructions. All cycles were performed using Bio-Rad DNA engine (Peltier Thermal Cycler). The PCR products were then purified using Mo-Bio Ultra Clean (PCR Clean Up) spin columns, and then submitted to the Macrogen (Korea) sequencing facility to be sequenced using ABI3730XL (Applied Byosystems). Sequence were verified and manipulated with Sequencher ver. 4.8 (Gene Codes Corporation). A Blast search was performed on Genbank for each sequence and the matching homologous Caryophyllia sequences were retained for subsequent alignment. Using this protocol, 2 previously published sequences were added to the alignment (C. ambrosia and C. inornata). Based on morphological similarity, another seven 16S rDNA sequences (3 first time sequenced plus 4 retrieved from Genbank – Appendix 4.3) belonging to seven different caryophylliid genera were added to the analyses. For those species for which more than one specimen was sequenced, all sequences were aligned and only the consensus sequence was used. Intending to include a large representation of non-caryophylliids to the analysis, additional 14 16S rDNA sequences representing 14 scleractinian families were retrieved from GenBank and added to the alignment.
Sequences were initially aligned in ClustalW (EBI) using the default settings. The resulting alignment was then manually refined using JalView version 8.0 (Clamp et al., 2004), totaling 448 bp and 33 species in the final alignment. Using the final alignment, the General Time Reversible with gamma distribution (GTR+G) model of DNA substitution was determined by the hierarchical likelihood ratio test implemented in MrModeltest (Nylander, 2004) as the best model for the data. Phylogenetic analyses were performed using PhyML (Guindon & Gascuel, 2003) for maximum likelihood (ML) and MrBayes version 3.1.2 (Huelsenbeck & Ronquist, 2001) for the Bayesian Inference (BI). The maximum likelihood analyses were performed under the GTR model with a non-parametric Shimodaira-Hasegawa-like procedure, and also with 100 bootstrap replicates. For the Bayesian inference, two runs each of 10 million generations were calculated with topologies saved at each 1000 generations, with the average standard deviation of split frequencies between runs of each marker converging to 0.003. First quarter of the 10000 topologies were discarded as burnin, and the remaining used to calculate the posterior probability.
362 Chapter 4 Monophyly of the Genus Caryophyllia
4.3 RESULTS
4.3.1 SYSTEMATIC ACCOUNT
Order Scleractinia “Robust” Scleractinian Group sensu Kitahara et al., 2010b Family Caryophylliidae Dana, 1846 Genus Caryophyllia Lamarck, 1816
Diagnosis. –Corallum soitary, attached or free: if attached, corallum cylindrical, trochoid, or ceratoid; if free, corallum usually cornute. Calice circular, elliptical, or compressed; thecal edge spines present on species having compressed coralla. Septal symmetry variable, but hexameral symmetry with four cycles of septa most common (Cairns, 1991). One crown of pali present before penultimate or rarely the antipenultimate cycle of septa. Columella fascicular, composed of several twisted laths. Exclusively azooxanthellate and common in deep water.
Caryophyllia (Caryophyllia) Lamarck, 1816
Diagnosis. –Caryophyllia in which the calice is circular to elliptical (not compressed), and which do not have thecal edge spines or crests (Cairns, 1994).
Type species. –Madrepora cyathus Ellis & Solander, 1786, by subsequent designation (Broderip, 1828).
Caryophyllia (Acanthocyathus) Milne Edward & Haime, 1848
Diagnosis. –Caryophyllia having coralla with edge spines or crests.
Type species. –Acanthocyathus grayi Milne Edwards & Haime, 1848, by subsequent designation (Milne Edwards & Haime, 1850: xiii).
363 Chapter 4 Monophyly of the Genus Caryophyllia
Key to the Recent valid species of Caryophyllia
1a Corallum bears edge spines or lateral crests Caryophyllia (Acanthocyathus) (2) 1b Corallum does not bear edge spines or lateral crests Caryophyllia (Caryophyllia) (10)
2a Coralla having edge spines (3) 2b Coralla having lateral crests (7)
3a Spines present on convex thecal edge, and sometimes only one spine present on concave thecal edge (4) 3b Spines present on both thecal edges (5)
4a Septa hexamerally arranged C. dentata 4b Septa decamerally arranged C. decamera
5a Thecal face spines present C. spinigera 5b Thecal face spines absent (6)
6a Septa arranged in 12 sectors (48 septa) with 12 pali C. quangdongensis 6b Septa usually arranged in 14 sectors (56 septa) with 14 pali C. grayi
7a Only convex side of the corallum having carinate thecal edge C. unicristata 7b Both thecal edges bear crests (8)
8a GCD:LCD >1.75 C. zanzibarensis 8b GCD:LCD < 1.70 (9)
9a Rounded primary costae; 14 primary septa C. karubarica 9b Ridged primary costae; 12 primary septa C. spinicarens
10a Transverse division present (11) 10b Transverse division absent (12)
11a Septa octamerally arranged C. abrupta 11b Septa hexamerally arranged C. secta
12a Corallum unattached (usually ceratoid) (13) 12b Corallum attached (ceratoid, trochoid, or subcylindrical) (23)
13a Adult corallum with 96 or more septa (14) 13b Adult corallum with less than 96 septa (usually 48-72) (15)
14a S4 wider than S5; pedicel may be present (73) 14b S5 equal to or wider than S4; pedicel absent C. ambrosia
15a Adult stage with 3 septa size classes (16) 15b Adult stage with 4 or 5 septa size classes (18)
16a S2 wider thanS3 (17) 16b S2 equal to or less wide than S3 (19)
17a Septa arranged octamerally (32 septa); 8 pali present C. mabahithi 17b Septa arranged in many cycles (more than 80 septa); 18-24 pali present C. planilamellata
18a Septa little exsert; S1>S3≥S2 C. cornulum 18b S1 and S3 highly exsert; S1>S2-S3 C. valdiviae
19a Pali equal or wider than the paliferus septa C. horologium 19b Pali smaller than septa (20)
20a Last septal cycle more exsert than penultimate, usually fusing to primaries forming triangular lancets above calicular edge (21) 20b Septa not exsert or all cycles equally exsert (22)
21a Adult stage with small (< 25 mm) GCD; 12-16 pali C. scobinosa 21b Adult stage with large (> 35 mm) GCD; >20 pali C. seguenzae
22a Corallum small (GCD < 12 mm); curved up to 90º; all septa sinuous C. stellula 22b GCD >13 mm; base rarely curved more than 40º; S1, S2 with straight axial edges C. squiresi
23a Theca covered with transverse ridges (24)
364 Chapter 4 Monophyly of the Genus Caryophyllia
Identification key - Continue 23b Theca granular or glisten; longitudinal costae usually present (29)
24a Axial edge of S1 straight; septa and pali highly granular C. aspera sp. nov. 24b All septa with sinuous axial edges (S1 usually only slightly sinuous) (25)
25a Septa hexamerally arranged in 4 cycles (26) 25b Septa octamerally or decamerally arranged in 3 cycles (28)
26a S1 highly exsert (27) 26b S1 slightly exsert; septal colour usually different from colour of pali and columellar elements C. versicolorata sp. nov.
27a S1>S2; S3>>S4; C1-3 usually ridged C. corrugata 27b S1=S2; S3>S4; C1-3 not ridged, but sometimes pigmented C. lamellifera
28a Columellar elements easily distinguished from pali C. rugosa 28b Columellar elements not clearly separated from pali C. cinticulata
29a Pali before antipenultimate cycle of septa (30) 29b Pali before penultimate cycle of septa (31)
30a Septa pentamerally arranged (40 septa and 5 pali present) C. paucipalata 30b Septa hexamerally arranged in 4 or 5 cycles (74)
31a Septa octamerally arranged (32) 31b Septa pentamerally, hexamerally, heptamerally, or decamerally arranged (35)
32a Pali very granular or bearing short horizontal carinae (33) 32b Pali not granular (34)
33a Corallum subcylindrical; axial edges of all septa sinuous C. barbadensis 33b Corallum ceratoid; axial edge of S3 relatively straight C. marmorea
34a PD:GCD = 0.26-.045; corallum not elongate (72) 34b PD:GCD > 0.5; corallum elongate and subcylindrical C. octopali
35a Septa arranged decamerally (36) 35b Septa arranged pentamerally, hexamerally, or heptamerally (41)
36a Septal faces high granular or carinate (37) 36b Septal faces smooth to slightly granular (38)
37a Long and obliquely oriented carinae present on lower axial septal faces; pali wide C. perculta 37b Septal faces granular, but carinae absent; pali narrow C. zopyros
38a Axial edge of pali straight to slightly sinuous C. solida 38b Axial edge of pali highly sinuous (39)
39a PD:GCD ≥ 0.44; theca porcellanous covered by very low, rounded granules (40) 39b PD:GCD = 0.22-0.39; theca granular; fossa of moderate depth C. quadragenaria
40a Theca very thick; calicular diameter smaller than diameter below calice C. concreta sp. nov. 40b Theca normal; calicular diameter larger than diameter of the rest of corallum C. antillarum
41a Septa arranged pentamerally C. hawaiiensis 41b Septa arranged hexamerally or heptamerally (42)
42a S1>S2 in width (43) 42b S1=S2 in width (53)
43a Axial edge of S1 straight (44) 43b Axial edge of S1 slightly to very sinuous (48)
44a Last septal cycle extends equally or further than penultimate (usually S4≥S3) (45) 44b Penultimate septal cycle wider than last septal cycle (47)
45a Septa arranged in 3 size classes, and 14-16-18 sectors C. atlantica 45b Septa hexamerally arranged in 4 cycles, and thus 12 sectors (46)
46a Axial edge of all septa straight to slightly sinuous C. polygona 46b Axial edge of S3 more sinuous than axial edges of S1, S2, and S4 C. balaenacea
47a 12 pali present; pedicel robust; S1 slightly more exsert than S2 C. inornata
365 Chapter 4 Monophyly of the Genus Caryophyllia
Identification key - Continue 47b 14 pali usually present; pedicel slender; S1 well exserted C. transversalis
48a Theca porcellanous, not costate, and covered with low granules (49) 48b Costae present, usually C1 and C2 slightly ridged near calice (51)
49a Pali thin (0.4-0.5 mm); pali separated from their corresponding septa by a wide gap equal to or greater than its own width C. solida 49b Pali with more than 1 mm in width (50)
50a S4 equal to or wider than S3 (S4≥S3) C. crosnieri 50b S3 wider than S4 (S3>S4) C. diomedeae
51a S1=S2 in width; S1 as thick as S2 C. diomedeae 51b S1>S2 in width; S1 thicker than other septa (52)
52a Fossa shallow; S4 rudimentary C. oblonga sp. nov. 52b Fossa deep; S4 fuse to S1 above calicular edge forming lancets C. crypta
53a Axial edge of S1 straight (54) 53b Axial edge of S1 usually slightly sinuous (59)
54a Pali (P3) not sinuous (55) 54b Pali (P3) sinuous (56)
55a Adult stage with 5 cycles of septa; 16-23 pali present C. profunda 55b Adult stage with 4 cycles of septa; 12-14 pali present C. sewelli
56a Pedicel robust (PD:GCD > 0.5) C. arnoldi 56b Pedicel slender (PD:GCD < 0.5) (57)
57a S4 more exsert than S3 C. smithii 57b S4 less exsert than S3 (58)
58a S1-2 1.5-2.1 mm exsert; S4 only slightly less wide than S3 C. japonica 58b S1-2 less than 1 mm exsert; S4 about 3/4 width of S3 C. alaskensis
59a Highest septal cycles equal to or wider than penultimate in adult specimen (60) 59b Last septal cycle smaller than penultimate in adult specimen (62)
60a S1 highly exsert (up to 2.1 mm); sometimes septa decamerally arranged C. calveri 60b S1 only slightly exsert; septa always hexamerally arranged (61)
61a Theca not glisteny; P3 usually 1/2 (or larger) width of S3; P3 bear carinae C. alberti 61b Theca glisten; P3 less than 1/2 width of S3; P3 with pointed granules instead of carinae C. laevigata
62a 14 or more pali present (63) 62b 13 or less pali present (64)
63a Corallum robust (GCD up to 30 mm); >20 pali present C. cyathus 63b Corallum small (GCD < 13 mm); < 20 pali present C. jogashimaensis
64a Axial edge of S4 straight (65) 64b Axial edge of S4 sinuous (usually slightly sinuous) (67)
65a In adult stage paliferus septa much more wide than pali (septa more than 3 times wider C. sarsiae than pali) 65b Paliferus septa less than 3 times width of pali (66)
66a Calicular margin not lanceted; S3 as exsert as S1-2 C. huinayensis 66b Calicular margin slightly lanceted; S3 less exsert than S1-2 C. ephyala
67a Only 10 palif present C. abyssorum 67b 12 or more pali present (68)
68a Septal faces ornamented with carinae and squared-off granules C. antarctica 68b Septal faces not ornamented with carinae (69)
69a C1-3 sharply ridged from calice to pedicel C. horologium 69b C1-3 slightly ridged only near calicular edge (70)
70a Columella not arranged in one or two rows aligned with GCD (usually arranged in an elliptical field) C. foresti 70b Columella usually arranged in one or two rows aligned with GCD (71)
366 Chapter 4 Monophyly of the Genus Caryophyllia
Identification key - Continue 71a Septal granules high and blunt, sometimes fusing into short, oblique carinae C. berteriana 71b Septal granules do not form carinae, and usually are low and rounded C. diomedeae
72a Primary septa highly exsert (1.7-2.2 mm) C. octonaria 72b Primary septa only slightly exsert (up to 1 mm) C. tangaroae sp. nov.
73a Pali present before antipenultimate septal cycle C. eltaninae 73b Pali present before penultimate septal cycle C. grandis
74a S1 more exsert than S2 C. ralphae 74b S1 as exsert as S2 C. eltaninae *C. paradoxa not included due to the high variability of the species.
Caryophyllia abrupta Cairns, 1999 (Figures 4.7-4.10) Caryophyllia abrupta Cairns, 1999: 71-72, figs. 5d-e.
Type material. -The holotype and 33 paratypes are deposited at the MNHN (uncatalogued ?), and 22 paratypes are at the USNM (USNM 98606 to 98612).
Type locality. -Musorstom 7 stn. 535 (12º29.6’S, 176º41.3’W – Waterwitch Bank), 340-470 m.
New records. -MNHN-IC.2009-0067 (8) and USNM 1130994 (5) (Bathus 3, stn. DW 786, 13 specimens); MNHN-IC.2009-0068 (Bathus 4, stn. DW 914, 2 specimens); MNHN-IC.2009-0069 (6) and USNM 1130995 (5) Bathus 4, stn. DW 918, 11 specimens).
Distribution. -New Caledonia, 600-699 m; Wallis and Futuna region (Cairns, 1999), 305-650 m; Vanuatu (Cairns, 1999), 300-400 m.
Description. -Corallum ceratoid, curved between 45 and 90º usually in the plane of GCD, and free. Largest New Caledonian specimens (DW 918) 9.0 x0, 7.1 mm in CD and 27.5 mm in height. Base always open, having a small circular scar of less than 2
367 Chapter 4 Monophyly of the Genus Caryophyllia mm in diameter displaying 8 major septa. Calice circular to elliptical, with serrate calicular edge. Theca smooth or bearing small granules, especially in the lower 2/3 of corallum. Costae equal in width, flat, and separated by shallow, thin striae, which are more visible near calice. Rejuvenescence common. Coralla of most specimens cream to yellowish-brown.
Septa usually octamerally arranged in 3 cycles (8:8:16 [32 septa]) according to formula: S1>S2≥S3. However, 2 specimens from the station DW 914 and specimens from station DW 918, have septa decamerally arranged (10:10:20 [40 septa]). Eight exsert (up to 2 mm) primary septa with highly sinuous axial edges extend 3/5 distance to columella. S2 least exsert septa but only slightly smaller than S1, and have very sinuous axial edges. Sometimes S2 more sinuous than S1. A pair of S3 fuses to adjacent S1 forming small triangular lancets. S3 equal to or slightly smaller than S2, having slightly sinuous axial edges. A crown of 8-10 very sinuous lamellar pali encircle the well-developed columella. Fossa ranging from shallow to moderately deep, containing a fascicular columella formed by 2-6 twisted, linearly arranged elements.
Remarks. -Among the 66 previously described Recent species of Caryophyllia, only two propagate by transverse division: C. secta and C. abrupta. However, C. abrupta is distinguished by the octamerally or decamerally arranged septa versus the consistent hexameral symmetry of C. secta.
Caryophyllia aspera, sp. nov. (Figures 4.12-4.15) Holotype. -MNHN-IC.2009-0083 (Norfolk 2, stn. DW 2117). Paratype. -MNHN-IC.2009-0084 (Norfolk 2, stn. DW 2117, 1 specimen).
Type locality. -23º24’S, 168º00’E (New Caledonia), 400 m.
Distribution. -Same as type locality.
368 Chapter 4 Monophyly of the Genus Caryophyllia
Etymology. -The species is named aspera (Latin asper = rough, harsh, uneven) referring to the roughness of the septal and palar faces observed in this species.
Description. - Corallum ceratoid, straight, and fixed through a robust pedicel (PD:GCD = 0.57-0.6) that expands into a thin encrusting base. Larger specimen (paratype) 5.4 x 4.8 mm in CD, 3.3 mm in PD, and 10.4 mm in height. Calice elliptical and calicular edge serrate. Theca covered with narrow transverse ridges. Costae absent or slightly ridged near calicular edge. Corallum white.
Septa hexamerally arranged in 4 incomplete cycles according to formula: S1>S2>S3>S4. S1 thick, highly exsert (up to 1 mm), with straight and thickened axial edges that fuse to columella. S2 less exsert, 1/2 to 3/4 width of S1, and with sinuous axial edges. S3 less wide and exsert than S2, also with slightly sinuous axial edges. Sometimes at calicular edge, S3 fuse to adjacent S1. When a half system is complete (5 septa), S4 rudimentary and only present near calicular edge, fusing to adjacent S1, and pali indistinguishable from columellar elements. However, when S4 are absent (half- system with 3 or 4 septa), a wide paliform lobe with highly sinuous outer edge is present before S2, easily distinguishable from columellar elements. Septal and palar faces bear several high and sharp pointed granules, giving the impression of a rough texture. Fossa shallow, containing a well-developed columella usually fused into a mass. Columella composed of 2 or 3 slightly twisted but highly granular pillars.
Remarks. -Among the six Recent congeners that have theca covered with transverse ridges, three have hexamerally arranged septa and are sympatric in New Caledonian waters: C. aspera sp. nov., C. corrugata, and C. lamellifera. C. aspera sp. nov. is distinguished by having septal and palar faces that are highly granular. Another species commonly collected in New Caledonian and Australian waters having transverse ridge theca and about the same size of C. aspera is C. rugosa. In the present study C. rugosa is reported having octamerally arranged septa (common condition), but also found with decameral and hexameral symmetry (see C. rugosa description). However, C. aspera
369 Chapter 4 Monophyly of the Genus Caryophyllia sp. nov. differs in septal sinuosity (S1 with straight axial edge versus very sinuous in C. rugosa), and also in the roughness of septal and palar faces (very granular in C. aspera sp. nov. and not granular in C. rugosa).
Caryophyllia atlantica (Duncan, 1873) (Figures 4.11 and 4.16) Bathycyathus atlanticus Duncan, 1873: 318, pl. 48, figs. 1-2. Caryophyllia laevicostata Moseley, 1881: 134, pl. 1, fig. 1. ?Caryophyllia panda Alcock, 1902a: 91. –Alcock, 1902b: 9, pl. 1, figs. 3, 3a. Caryophyllia alcocki Vaughan, 1907: 73-74, pl. V, figs. 1a-b. Caryophyllia atlantica. –Zibrowius, 1980: 56-57, pl. 20, figs. A-K. –Cairns, 1991: 12. –Cairns, 1995: 47- 48, pl. 8d, e. –Cairns, 1998: 376. –Cairns et al., 1999: 20. –Cairns, 2004: 277. Caryophyllia profunda. –Squires & Keyes, 1967: 23 (in part). ?Caryophyllia pacifica Keller, 1981a: 16-17, pl. 1, figs. 2a-b. –Keller, 1981b: 33, pl. 1, figs. 1a-b.
Type material. -According to Zibrowius (1980), the lecto- and paralectotype of B. atlanticus are deposited at NHM (1882.12.10.132).
Type locality. -39º39’N, 9º43’W (off Portugal), 1355-2000 m.
New records. -TMAG-K3827 (SS022007, stn. 50, 1 specimen).
Distribution. -Australia (Cairns, 1998; Cairns, 2004; present study), 193-1230 m; eastern Atlantic including Portugal (Duncan, 1873), Morocco, Madeira Archipelago, Azores, Mediterranean Sea (Zibrowius, 1980), 860-2165 m; Ceram Sea (Alcock, 1902b), 776-2165 m; Marcus-Necker Ridge (Keller, 1981a), 1420 m; Hawaii (Vaughan, 1907 as C. alcocki), 1602 m; New Zealand (Squires & Keyes, 1967 as C. profunda; Cairns, 1995), 1004-1474 m.
Diagnosis. -Corallum ceratoid, curved, extremely robust, and presumably attached. Specimen examined 39.0 x 34.0 mm in CD, and 36.0 mm in height (base broken).
370 Chapter 4 Monophyly of the Genus Caryophyllia
Calice elliptical with serrate calicular edge. Theca porcellaneous, slightly granular, and slightly ridged C1. Corallum white encircling the calice and tinted brown in direction of pedicel. Septa arranged in 3 size classes and 17 sectors (17:17:34 [68 septa]) according to formula: S1>S3>S2. Wide (up to 5 mm) and slightly sinuous pali present before S2. Columella elongate composed of a fused mass of twisted elements.
Remarks. -This species described as Bathycyathus atlanticus Duncan, 1873, and over a century later transferred to the genus Caryophyllia (Zibrowius, 1980), has an interesting disjunct distribution, being reported from the eastern Atlantic (including Mediterranean Sea), western Pacific (from Japanese to New Zealand waters), and Indian Ocean (just Indonesia and western Australia regions). The skeletal morphology of the specimen briefly described above agrees with the New Zealand specimens described by Cairns (1995) especially in the high number of septal sectors. Among their congeners, C. atlantica can be distinguished by the robustness of the corallum, the presence of 3 septal size classes (usually with 16-18 sectors), S3>S2, and straight axial edges of the S1.
Caryophyllia cinticulata (Alcock, 1898) (Figures 4.17-4.21) Thecocyathus cinticulatus Alcock, 1898: 17-18, pl. ii, figs. 5, 5a. Trochocyathus cincticulatus. –Gardiner, 1904: 99, 103-104, pl. II, fig. 2. –Squires, 1961: 17. –Cairns et al., 1999: 24.
Type material. -The type species is purported to be deposited at the Calcutta Museum, India (see Alcock, 1898: prefatory note).
Type locality. -off Maldives, 384 m.
New records. -MNHN-IC.2009-0081 (1) and USNM 1131001 (1) (Norfolk 1, stn. DW 1652, 2 specimens). MNHN-IC.2009-0082 (Norfolk 2, stn. DW 2023, 1 specimen).
371 Chapter 4 Monophyly of the Genus Caryophyllia
Distribution. -New Caledonia (from 23º26.1’S, 167º50.3’E to 23º27’S, 167º51’E), 282- 378 m; Maldives (Alcock, 1898), 384 m; South Africa (33º2'59’’S, 27º56'59’’E) (Gardiner, 1904).
Description. -Corallum ceratoid to subcylindrical, robust, fixed, and with elliptical and slightly serrate calicular edges. Largest specimen examined (DW 1652) 10.5 x 9.7 mm in CD, 7 mm in PD, and 20 mm in height. Pedicel robust (PD:GCD = 0.65-0.8) expanding into a large encrusting base. Theca glistens, covered with thin, rounded, transverse ridges from outer septal edges to base. However, some specimens have transverse ridges best developed on lower half of corallum. Costal granules absent, however, some intercostal striae detectable and dividing the transverse ridges. Width of costae marked between two striae equal for all cycles. Corallum colour variable, 2 specimens display calicular edge and mid corallum slightly yellowish-brown, bisected by a white belt. Another 2 specimens display faint vertical pigmented strips in one side of the corallum.
Septa decamerally arranged in 3 cycles (10:10:20 [40 septa]) according to the formula: S1>S2>S3. However, one specimen (DW 1652) has 44 septa in 11 systems and a corresponding 11 pali. S1 less than 1.5 mm exsert, with vertical and sinuous axial edges fusing to columella low in fossa. S2 only slightly less exsert and smaller than S1, also having vertical and sinuous axial edges. S3 least exsert septa, and with slightly sinuous axial edges. All septal faces covered with quite small low and rounded granules. Upper edge of each S1 sometimes has small short carinae oriented perpendicular to trabecula. A well-developed pali before each S2 forms a crown encircling the fascicular columella. Pali with highly sinuous outer and less sinuous axial edges and ornately carinate faces, giving the pali the appearance of even greater sinuosity. Fossa of moderate depth containing a columella recessed well below pali. Columella composed of 5-9 twisted elements often fused basally.
Remarks. -Of the 66 previously described species of Caryophyllia (Appendix 4.1), only a small group of six have circumferential transverse ridges on the theca: C. rugosa; C. lamellifera; C. corrugata; C. cinticulata; and C. aspera sp nov, the others having theca
372 Chapter 4 Monophyly of the Genus Caryophyllia ranging from porcellanous to granular and/or longitudinally ridged, i.e., costate. Caryophyllia cinticulata is distinguished from its congeners that have transversely ridged theca by its decameral septal symmetry, adult size larger than 10 mm in GCD, S3 smaller than S2, and extremely sinuous axial edges of S1 and S2. Only the second time collected since its original description in 1898, C. cinticulata has a disjunct distribution, being reported from temperate waters off South Africa, and tropical waters off Maldives and New Caledonia.
Caryophyllia concreta, sp. nov. (Figures 4.22-4.32) Holotype. -MNHN-IC.2009-0057 (Norfolk 2, stn. DW 2024). Paratypes. -MNHN-IC.2009-0058, MNHN-IC.2009-0059, MNHN-IC.2009-0060, MNHN-IC.2009-0061, MNHN-IC.2009-0062, MNHN-IC.2009-0063, and USNM 1130992 (4) (Norfolk 2, stn. DW 2024, 10 specimens); MNHN-IC.2009-0064 and USNM 1130993 (Norfolk 2, stn. DW 2037, 2 specimens); MNHN-IC.2009-0065 (Norfolk 2, stn. DW 2133, 1 specimen).
Type locality. -23º28’S, 167º51’E (New Caledonia), 370-371 m.
Distribution. -New Caledonia (from 23º01’S, 168º18’E to 23º40’S, 167º41’E), 215-570 m.
Etymology. -The species name concreta (Latin: concretus, thick, hard, stiff) refers to the very thick theca found in this species.
Description. -Corallum trochoid to ceratoid, straight to slightly curved, having a robust pedicel (PD:GCD = 0.44-0.53) that is firmly attached by a thin encrusting base. Largest specimen (DW 2037) 11.3 x 10.2 mm in CD, 6 mm in PD, and 27.6 mm in height (base is broken). Calice circular to slightly elliptical (GCD:LCD = 0.09-1.1). Theca extremely thick, glistening with low rounded granules or heavily encrusted. Costae poorly developed or absent, especially in younger specimens. However, in larger specimens costae unequal (C1 slightly thinner than C2-3), flat, and separated by thin and shallow
373 Chapter 4 Monophyly of the Genus Caryophyllia intercostal striae. Costae fade/disappear in direction of pedicel. Rejuvenescence common. Corallum white to yellowish-brown.
Septa symmetry appears to have a correlation with calicular diameter: specimens with GCD < 10 display septa decamerally arranged in 3 cycles (10:10:20 [40 septa]) according to formula: S1>S2≥S3, but two larger (GCD > 10) specimens collected from station DW 2037 have 11 and 12 primaries respectively. S1 largest and most exsert septa, extending 4/5 distance to columella with slightly sinuous axial edges. S2 slightly more exsert and larger than S3, otherwise S2 equal in width to S3. Axial and upper edges of S2 sinuous, extending only 1/4 to 1/2 distance to columella. S3 equal to slightly smaller than S2, with slightly sinuous axial edges. Ten to 12 well-developed and sinuous lamellar pali present before S2, forming a crown encircling the fascicular columella. Septa and pali lateral faces bear several tall granules, especially in smaller specimens. Fossa of moderate depth containing a fascicular columella composed of 3-8, aligned to the GCD, twisted elements.
Remarks. -Caryophyllia concreta sp. nov. appears to be unique among Caryophyllia due to its extremely thick theca, and septa that are arranged in three cycles. Small specimens have a thick “belt” or thickening below the calicular edge, making the calicular edge slightly smaller than this area. The different septal symmetry observed in this species probably is related to ontogenetic differences, with systems being added until twelve primaries are present.
Caryophyllia crosnieri Cairns & Zibrowius, 1997 (Figures 4.33-4.36) Caryophyllia elongata Cairns in Cairns & Keller, 1993: 236-237, pl. 4, figs. A-B [junior homonym of C. clavus var. elongata Duncan, 1873: 311-312 (= C. smithii Stokes & Broderip, 1828)]. –Cairns, 1995: 52, pl. 10, figs. d-f. –Cairns, 1999: 70, figs. A-B. Caryophyllia crosnieri Cairns & Zibrowius, 1997: 87, 89. –Cairns, 1999: 70, figs. 5a, b. –Cairns et al., 1999: 20. –Cairns, 2004: 277.
Type material. -The holotype of C. elongata is deposited at the IO (V-2716), Moscow.
374 Chapter 4 Monophyly of the Genus Caryophyllia
Type locality. -33º17’S, 44º55’E (Madagascar Plateau), 630-680 m.
New records. -MNHN-IC.2009-0041 (2) and USNM 1130986 (1) (Norfolk 2, stn. DW 2024, 4 specimens). MNHN-IC.2009-0042 (Norfolk 2, stn. DW 2112, 2 specimens).
Distribution. -New Caledonia (Cairns & Zibrowius, 1997; and present study), 165-1434 m (but more common between 165 and 640 m); Madagascar Plateau (Cairns & Keller, 1993), 630-680 m; New Zealand (Cairns, 1995), 165-590 m; Philippines and Indonesia (Cairns & Zibrowius, 1997), 206-330 m; Australian seamounts, and north eastern and western coasts (Cairns, 1998; 2004), 133-1400 m; Wallis and Futuna, 550-600 m; and Vanuatu region (Cairns, 1999), 366-536 m.
Description. -Corallum ceratoid, straight to slightly curved, and attached by a robust pedicel (PD:GCD = 0.5-0.71). Largest specimen examined (DW 2024) 12.8 x 11.9 mm in CD, 6.5 mm in PD, and 22.6 mm in height, but base is broken. Theca granular and porcellanous. Costae flat to slightly convex separated by thin, shallow striae near calicular edge, however, sometimes C1-2 ridged and sinuous. Corallum yellowish- brown (including septa, pali, and columella), but darker near calicular edge. Base and pedicel white.
Septa hexamerally arranged in 4 cycles (6:6:12:24 [48 septa]) according to formula: S1>S2>S4≥S3. S1 highly exsert, extending to columella with straight and slightly convex upper edge, which becomes vertical deeper in fossa. S2 less exsert and narrower than S1, having slightly sinuous axial edges. S3 least exsert septa and equal or slightly smaller than S4. Upper edge of S3 oblique, becoming vertical at same level of the upper edge of P3. Axial edge of S3 sinuous. S4 dimorphic: those adjacent to S1 wider than S3, and those adjacent to S2 equal in width to S3. Upper, outer edge of S4 fuses to adjacent S1 or S2 forming low triangular lancets at calicular edge. Septal faces covered with blunt triangular granules, which sometimes fuse forming small carinae perpendicular to plane of septa. A well-developed and sinuous pali (P3) separated by a moderately deep notch present before each S3. Sometimes lateral palar faces bear short carinae.
375 Chapter 4 Monophyly of the Genus Caryophyllia
Fossa deep, containing a fascicular columella aligned in axis of GCD and composed of 7 to 12 highly twisted elements that always terminate lower in fossa than palar crown.
Remarks. -Caryophyllia crosnieri is distinguished from its New Caledonian and Australian congeners by having well-developed S1 that separate a pair of pali, or, as observed by Cairns & Zibrowius (1997), by having small “paired” pali.
Caryophyllia diomedeae Marenzeller, 1904 (Figures 4.37-4.46) Caryophyllia diomedeae Marenzeller, 1904: 79-80, pl. 1, fig. 2. –Durham & Barnard, 1952: 10, 82, pl. 9, fig. 43. –Cairns, 1991: 11-13, pl. 4, figs. c-e. –Cairns, 1995: 49-50, pl. 9, figs. a-d. –Cortés, 1997: 330. –Cairns & Zibrowius, 1997: 88. –Koslow & Gowlett-Holmes, 1998: 38. –Cairns, 1999: 74. –Cairns et al., 1999:20. –Piñón, 1999: 20, 81. –Cairns, 2004: 264, 277, 328. –Cairns et al., 2005: 17, 25, 28, figs. 2D-E. –González-Romero et al., 2008: 1-2, fig. 1. Caryophyllia profunda. –Cairns, 1982: 17-19 (in part: Eltanin-1403). Caryophyllia sarsiae. –Cairns & Parker, 1992: 19-20, figs. 5c, e, f.
Type material. -One syntype is deposited at the USNM (22083).
Type locality. -Albatross stn. 3358 (6º30’N, 81º44’W, 1043 m – Pacific coast of Panama).
New records. -MNHN-IC.2009-0003 (Bathus 3, stn. CP 833, 1 specimen). MNHN- IC.2009-0004 (Bathus 4, stn. DW 914, 1 specimen). MNHN-IC.2009-0005 (Norfolk 2, stn. DW 2046, 2 specimens). MNHN-IC.2009-0006 (Norfolk 2, stn. DW 2047, 2 specimens). MNHN-IC.2009-0007 (Norfolk 2, stn. DW 2063, 1 specimen). MNHN- IC.2009-0008 (Norfolk 2, stn. DW 2065, 3 specimens). MNHN-IC.2009-0009 (Norfolk 2, stn. DW 2068, 3 specimens). MNHN-IC.2009-0010 (8) and USNM 1130978 (4) (Norfolk 2, stn. DW 2069, 12 specimens). MNHN-IC.2009-0011 (Norfolk 2, stn. DW 2070, 3 specimens). MNHN-IC.2009-0012 (Norfolk 2, stn. DW 2074, 5 specimens). MNHN-IC.2009-0013 (Norfolk 2, stn. DW 2075, 3 specimens). MNHN-IC.2009-0014 (6) and USNM 1130979 (2) (Norfolk 2, stn. DW 2078, 8 specimens). MNHN-IC.2009-
376 Chapter 4 Monophyly of the Genus Caryophyllia
0015 (Norfolk 2, stn. DW 2086, 9 specimens). MNHN-IC.2009-0016 (Norfolk 2, stn. DW 2091, 1 specimen). MNHN-IC.2009-0017 (Norfolk 2, stn. DW 2100, 1 specimen). MNHN-IC.2009-0018 (14) and USNM 1130980 (4) (Norfolk 2, stn. DW 2102, 18 specimens). MNHN-IC.2009-0019 (12) and USNM 1130981 (4) (Norfolk 2, stn. DW 2103, 16 specimens). MNHN-IC.2009-0020 (Norfolk 2, stn. DW 2104, 1 specimen). MNHN-IC.2009-0021 (Norfolk 2, stn. DW 2107, 9 specimens). MNHN-IC.2009-0022 (Norfolk 2, stn. DW 2156, 1 specimen). TMAG-K3815 (SS011997, stn. ??, 4 specimens). TMAG-K3816 (6) and MTQ a61479 (4) (SS011997, stn. 17, 10 specimens). TMAG-K3817 (SS011997, stn. 22, 7 specimens). TMAG-K3818 (6) and MTQ a61480 (4) (SS011997, stn. 57, 10 specimens). TMAG-K3819 (4) and MTQ a61481 (1) (SS011997, stn. 67, 5 specimens). TMAG-K3820 (25) and MTQ a61482 (5) (SS011997, stn. 70, 30 specimens). WAM Z21463 (1) and MTQ a61454 (1) (SS102005, stn. 44, 2 specimens). TMAG-K3821 (SS022007, stn. 21, 1 specimen). TMAG-K3822 (SS022007, stn. 36, 3 specimens). TMAG-K3823 (SS022007, stn. 37, 4 specimens). TMAG-K3824 (SS022007, stn. 41, 2 specimens). TMAG-K3825 (SS022007, stn. 66, 3 specimens). AM-G.17614 (Norfanz: stn. 51, 1 specimen).
Distribution. -New Caledonia and Australia regions, 336-1786 m; off Pacific Panama (Marenzeller, 1904), 1043 m; Cocos and Galapagos Islands (Cairns, 1991), 245-806 m; New Zealand (Cairns, 1982; 1995), 660-1200 m; northeastern Atlantic from the Mediterranean to the Azores; Bermuda; Cook Islands (Cairns, 1995), 1585 m; Philippines and Indonesia (Cairns & Zibrowius, 1997), 300-885 m; off southeastern and western Australia (Cairns, 1998; 2004), 600-900 m; Vanuatu (Cairns, 1999), 475-799 m; off northern Pacific from 0º to 31ºN (Piñón, 1999; González-Romero et al., 2008), 55-2086 m; off northern Chile (Cairns et al., 2005), 1760 m.
Description (based on New Caledonian specimens): Corallum ceratoid, always attached through a robust pedicel reinforced by concentric layers of stereome (or tectura), which expands into a thin encrusting base. Coralla usually straight or slightly curved near base, but some specimens, especially when fixed to Solenosmilia variabilis, display different shapes. Pedicel up to 11.0 mm in diameter. Largest New Caledonian specimen
377 Chapter 4 Monophyly of the Genus Caryophyllia examined (DW 2066) 25.1 x 21.1 mm in CD, 6.3 mm in PD, and 30.9 mm in height (base broken). Calice slightly elliptical with jagged margins. Theca thick and porcellanous, however expression of costae quite variable. Some specimens have scarce or no indication of costae; some have low and rounded, equal costae separated by shallow grooves; whereas others have C1 and C2 ridged and more prominent than C3 and C4 especially near the calicular edge. Costal granules not common, but when present 3 or 4 (sometimes fused) can be counted across each costa. Corallum white to yellowish-brown, normally darker near base.
Septa hexamerally arranged in 4 complete cycles (6:6:12:24 [48 septa]) according to formula: S1-2>S3≥S4. S1-2 very exsert (up to 3.2 mm) especially in larger coralla, with rounded upper edges, and vertical, sinuous axial edges extending about 3/5 distance to columella. Paliferus S3 about 1/2 to 3/4 the exsertness of S1-2, with very sinuous lower axial edges that extend about halfway to columella. Each S3 is separated from their respective P3 by a deep notch (~1mm wide). S4 least exsert septa and equal in width to S3 in smaller coralla, but smaller in larger specimens having only slightly sinuous axial edges. Axial and outer edges of P3 very sinuous and lateral faces granular, forming a distinctive crown around the columella. Septal faces smooth above calicular edge, becoming granular below it. Fossa of moderate depth containing a fascicular columella composed of 3 to 18 twisted elements aligned in the plane of GCD.
Remarks. -Among the species belonging to the genus Caryophyllia, C. diomedeae groups with species that are fixed and contain four complete septal cycles, which is the most common morphologic pattern within the genus. C. diomedeae can be distinguished from the other species from New Caledonia and Australian regions by the presence of a complete fourth septal cycle, well-developed pali before the penultimate septal cycle, and a septal formula of S1-2>S3≥S4. However, due to the broad distribution reported for this species (see Distribution), some intraspecific morphological variations are observed especially in costae, septal exsertness, and size of corallum. Some specimens collected off New Caledonia could be confused with C. stellula, but differ in having always an attached corallum, and a PD:GCD > 0.2.
378 Chapter 4 Monophyly of the Genus Caryophyllia
Caryophyllia grandis Gardiner & Waugh, 1938 (Figures 4.47-4.52) Caryophyllia grandis Gardiner & Waugh, 1938: 177, pl. 1, fig. 2. –Cairns, 1991: 12. –Cairns & Keller, 1993: 234. –Cairns & Zibrowius, 1997: 96, figs. 9g-h. –Cairns, 1998: 376. –Cairns et al., 1999: 20. –Cairns, 2004: 277.
Type material. -Four syntypes are deposited at NHM (1950.1.9.211-215).
Type locality. -4º58’42’’N, 73º16’24’’E (west side of Fadiffolu Atol, Maldives Islands), 494 m.
New records. -WAM Z21466 (SS102005, stn. 95, 1 specimen). WAM Z21467 (SS102005, stn. 171, 1 specimen).
Distribution. -Australia, 399-431 m; Indonesia (Cairns & Zibrowius, 1997), 251-567 m; Malaysia (?); from South Africa to western Sumatra (Cairns & Keller, 1993), 183-595 m.
Diagnosis. -Corallum up to 50 mm in GCD, usually free and curved. C1-3 slightly ridged or absent. Upper theca and septal faces light beige, but lower theca white or discoloured. Septa usually hexamerally arranged in 5 cycles (S1-3>S4>S5). S5 more exsert than S4, fusing with their adjacent S1-3 forming highly exsert lancets. Twenty- four P4, which are usually narrower than S4 they border, form a crown encircling a fascicular columella composed of broad, twisted elements.
Remarks. -The examination of the two specimens collected off western Australian waters does not add to our knowledge of morphological variation. However, images from freshly collected specimens from Australian waters show that even with the low
379 Chapter 4 Monophyly of the Genus Caryophyllia amount of tissue present in this species, just above the pali the tissue exhibits a green fluorescent colour, and below the pali the tissue is orange.
Caryophyllia grayi (Milne Edwards & Haime, 1848) (Figures 4.53-55, 4.58-59) Acanthocyathus grayi Milne Edwards & Haime, 1848: 293, pl. 9, fig. 2. –Alcock, 1898: 15. –van der Horst, 1931: 6. –Umbgrove, 1938: 264-265. –Umbgrove, 1950: 641-642, pl. 81, figs. 27-32. – Wells, 1984: 209, pl. 2, figs. 5-9. –Zou, 1988: 76, figs. 8-9. Caryophyllia grayi. –Cairns, 1994: 49, pl. 21i-k. –Cairns & Zibrowius, 1997: 97-98, figs. 7c, f, i. –Cairns, 1998: 377. –Cairns, 1999: 76. –Cairns et al., 1999: 20. –Cairns, 2004: 276.
Type material. -Syntype is deposited at NHM (1840.9.29.42).
Type locality. -Not stated.
New records. -WAM Z21469 (SS102005, stn. 115, 3 specimens). WAM Z21470 (SS102005, stn. 139, 1 specimen). WAM Z21471 (4) and MTQ a61469 (1) (SS102005, stn. 153, 5 specimens).
Distribution. -Japan (Cairns, 1994), 37-490 m; Philippines and Indonesia (Cairns & Zibrowius, 1997), 50-268 m; Wallis and Futuna region (Cairns, 1999), 125-360 m; South Africa; Australia (Cairns, 2004; present study), 100-166 m.
Diagnosis (based on Australian specimens): Corallum ceratoid, compressed (GCD:LCD = 1.3-1.5), and usually attached to a small object by a slender pedicel 1.5-1.8 mm in diameter or secondarily unattached. Thecal edges rounded, the concave (or one of the edges) edge having 1 to 3 elongate spines, and the other edge bearing 2 to 5 elongate spines, but an equal number of spines not observed. Edge spines circular to elliptical in cross section. Costae rounded, not ridged. Septa usually arranged in 14 sectors. Primary
380 Chapter 4 Monophyly of the Genus Caryophyllia septa highly exsert, forming small calicular lancets. Pairs of S4 sometimes present in end half-systems. A crown of 14 pali (P2) encircle the fascicular elongated columella.
Remarks. -Comparisons between the Japanese specimens described by Cairns (1994) and the Australian specimens available for the present study show that the latter have primary septa with sinuous axial edges, in contrast to the Japanese specimens that have straight axial edges. Otherwise, they are practically indistinguishable. Among its congeners, C. grayi can be identified by the asymmetrical arrangement of the edge spines on both thecal edges, and a corallum with usually more than 56 septa (14 pali). C. grayi is more fully described by Cairns (1994).
Caryophyllia hawaiiensis Vaughan, 1907 (Figures 4.56-57, 4.60-61) Caryophyllia hawaiiensis Vaughan, 1907: 76, pl. 5, figs. 4a, b. –Cairns, 1984: 11. Cairns, 1991: 12. – Cairns, 1995: 44-45, pl. 7, figs. d-f. –Cairns & Zibrowius, 1997: 93. –Cairns, 1999: 69-70. – Cairns et al., 1999: 20. –Cairns, 2004: 277. –Cairns, 2006: 47.
Type material. -Four syntypes are deposited at the NMNH (USNM 20749-20750).
Type locality. -21º04’05’’N, 157º10’35’’W (off Molokai, Hawaiian Islands), 168-388 m.
New records. -MNHN-IC.2009-0043 (1) and USNM 1130987 (1) (Bathus 4, stn. DW 902, 2 specimens).
Distribution. -New Caledonia, 341-351 m; Hawaii (Vaughan, 1907; Cairns, 1984), 44- 388 m; Japan (Cairns, 1995), 128-174 m; New Zealand and Australia (Cairns, 1995; 2004), 126-279 m; Philippines and Indonesia (Cairns & Zibrowius, 1997), 97-170 m; Wallis and Futuna, and Vanuatu region (Cairns, 1999), 252-300 m; South China Sea.
381 Chapter 4 Monophyly of the Genus Caryophyllia
Description. -Corallum ceratoid to trochoid, straight to slightly curved, and firmly attached by a robust pedicel that expands into a thin encrusting base (PD:GCD = 0.32- 0.34). Largest specimen examined 9.5 x 7.8 mm in CD and 21.6 mm in height. Theca coarsely granular and all costae ridged. C1-2 more prominent but narrower than C3-4, and extending further in direction of the pedicel. Corallum usually white, however upper and axial edges of S1-2 slightly yellowish-brown.
Septa pentamerally arranged in 4 complete cycles (5:5:10:20 [40 septa]) according to formula: S1>S2>S4>S3. Septal exsertness and sinuosity following the same pattern of C. lamellifera, however, in C. hawaiiensis S4 is/are wider than S3. Twelve well- developed pali (P3) form a palar crown encircling the columella. Fossa of moderate depth containing a fascicular columella consisting of 3-12 twisted elements.
Remarks. -Within the New Caledonian Caryophyllia group, C. hawaiiensis is distinguished by the presence of highly exsert S1 (which are larger than S2), and S4 that are larger than S3. However, according to Cairns (1995) this species has even with a tendency toward pentameral symmetry and a total of 40 septa, eventually specimens with 11 pali and 44 septa (Hawaiian Islands) and 12 pali and 48 septa (New Zealand) occur as well.
Caryophyllia laevigata, sp. nov. (Figures 4.62-4.63) Holotype. -MNHN-IC.2009-0023 (Norfolk 2, stn. DW 2066). Paratypes. -MNHN-IC.2009-0024, MNHN-IC.2009-0025, USNM 1130982 (2) (Bathus 3, stn. DW 781, 4 specimens). MNHN-IC.2009-0002 (3) and USNM 1130977 (1) (Bathus 3, stn. DW 783, 4 specimens). MNHN-IC.2009-0026 (Bathus 3, stn. DW 784, 1 specimen). MNHN-IC.2009-0027, MNHN-IC.2009-0028, MNHN-IC.2009-0029, MNHN-IC.2009-0030, MNHN-IC.2009-0031, MNHN-IC.2009-0032 and USNM 1130983 (3) (Bathus 3, stn. DW 786, 9 specimens). MNHN- IC.2009-0033 (Norfolk 2, stn. DW 2025, 1 specimen). MNHN-IC.2009-0034 (Norfolk 2, stn. DW 2058, 1 specimen). MNHN-IC.2009-0035 (Norfolk 2, stn. DW 2066, 1 specimen). MNHN- IC.2009-0036, MNHN-IC.2009-0037 and USNM 1130984 (2) (Norfolk 2, stn. DW 2069, 4 specimens). MNHN-IC.2009-0038 and USNM 1130985 (Norfolk 2, stn. DW 2102, 2 specimens). MNHN-IC.2009-0039 (Norfolk 2, stn. DW 2107, 1 specimen). MNHN-IC.2009- 0040 (Norfolk 2, stn. DW 2113, 1 specimen).
Type locality. -25º17’S, 168º55’E (Banc Athos, New Caledonia), 834-870 m.
382 Chapter 4 Monophyly of the Genus Caryophyllia
Distribution. -New Caledonia (from 23º27’S, 167º51’E to 25º20’S, 168º58’E), 410- 1032 m.
Etymology. -The species name laevigata (Latin: laevigatus = smooth, slippery) refers to the porcellanous theca present in this species.
Description. -Corallum ceratoid, usually curved up to 45º or only slightly bent in the axis of the GCD, and attached by a robust pedicel (PD:GCD = 0.29-0.63), which expand into a thin encrusting base, but most specimens examined have a broken base. Holotype 9.9 x 9.1 mm in CD, 5 mm in PD, and more than 35.0 mm in height. Calice always elliptical with GCD:LCD between 1.07 and 1.14 (the smaller ratio is related to smaller specimens) with a serrate calicular edge. Theca smooth and porcellanous, bearing very low and rounded granules. Costae usually poorly defined or absent. If present, all costae flat to slightly ridged (especially near calicular edge), with C1 slightly narrower than C2-4. All costae separated by extremely thin and shallow intercostal striae. Theca usually yellowish-brown near calicular edge with lower part of corallum lighter; however, specimens completely white or completely yellowish-brown also present.
Septa hexamerally arranged in four complete cycles (6:6:12:24 [48 septa]) according to formula: S1-2>S4≥S3, however, smaller specimens have S3≥S4. Primaries and secondaries equal in width and exsertness (up to 1.2 mm exsert), extending 1/2 to 3/5 distance to columella with sinuous axial edges. Tertiaries equal to or slightly less exsert than quaternaries (S4 usually fuses to adjacent S1 above calicular edge forming low lancets), being slightly wider in small specimens, and smaller in mature coralla. Axial edge of tertiaries very sinuous, but quaternaries only slightly sinuous. A tall and sinuous palus is present before each tertiary, forming a well-developed crown encircling the columella, and terminate higher in fossa than columellar elements. All septal and palar faces bear tall pointed granules. Fossa of moderate depth, containing a fascicular columella composed of an elongate field of 2-9 twisted and closely spaced elements.
383 Chapter 4 Monophyly of the Genus Caryophyllia
Remarks. -Caryophyllia laevigata sp. nov. is morphologically grouped within the largest group of Caryophyllia, i.e., species having hexameral symmetry in four complete cycles. However, it can be distinguished by the presence of the following characters: porcellanous theca, S4 usually larger than S3 (especially in mature coralla), and slightly (instead of highly) exsert S1-2. C. laevigata sp. nov. may be confused with C. diomedeae, and in fact they are probably sister species, being differentiated especially by the septal exsertness, size of adult corallum (GCD < 11 mm in C. laevigata sp. nov. and usually > 20 mm in C. diomedeae), and corallum colour (most C. diomedeae are completely white and darker near the base, and C. laevigata sp. nov. is usually darker near calicular edge).
Caryophyllia lamellifera Moseley, 1881 (Figures 4.64-4.68) Caryophyllia lamellifera Moseley, 1881: 140-141, pl. 1, figs. 7a, b. –Hutton, 1904: 315. –Cairns, 1991: 12. –Cairns, 1995: 51-52, pl. 9, fig. i, pl. 10, figs. a-c. –Cairns& Zibrowius, 1997: 90. –Cairns, 1999: 74-75. –Cairns et al., 1999: 20. –Cairns, 2004: 278.
Type material. -Two uncataloged syntypes are deposited at NHM.
Type locality. -Challenger stn. 170: 29º55’S, 178º14’W (Kermadec Ridge), 1152 m.
New records. -MNHN-IC.2009-0044 (Bathus 4, stn. DW 882, 1 specimen). AM- G.17615 (Norfanz 0308, stn. 24, 1 specimen).
Distribution. -New Caledonia, 250-350 m; New Zealand (Cairns, 1995), 89-1152; Australia (Cairns, 1995; 2004, and present study), 143-164 m; Philippines and Indonesia (Cairns & Zibrowius, 1997), 100-300 m; Wallis and Futuna region, and Vanuatu (Cairns, 1999), 180-516 m.
384 Chapter 4 Monophyly of the Genus Caryophyllia
Description (based on New Caledonia specimens): Corallum small, ceratoid to trochoid, with circular to elliptical calice, and attached by a pedicel (PD:GCD = 0.32–0.47) which expands into a thin encrusting base. Specimen examined (DW 882) 12.2 x 10.5 mm in CD, but has a broken pedicel. Costae inconspicuous, each separated by very shallow and narrow intercostal striae disappearing toward pedicel. Theca covered with closely spaced, rounded on edge, transverse ridges. Ridges continuous and best developed on lower part of the corallum. Corallum white to reddish-brown near calicular edge.
Septa hexamerally arranged in 4 complete cycles (6:6:12:24 [48 septa]), according to formula: S1-S2>S3>S4. S1-S2 equally exsert (up to 2 mm), extending about 80% distance to columella, with rounded upper edges, and vertical and slightly sinuous axial edges. Higher cycles progressively less exsert and wide. However, S4 almost as exsert as S2, fusing to adjacent S1 above calicular edge forming tall triangular lancets. Axial edge of S3 very sinuous, and S4 straight to slightly sinuous. Twelve well-developed pali, each separated from their corresponding S3 by a V notch, form a palar crown encircling columella. Fossa of moderate depth containing a fascicular columella consisting of 3-12 twisted elements.
Remarks. -Among the six species of Caryophyllia that have theca covered with transverse ridges (sometimes as aligned granules), C. lamellifera is most easily distinguished by its lack of costae, S1=S2, S3>S4, septal symmetry, and septal exsertness (especially the primaries).
Caryophyllia oblonga, sp. nov. (Figures 4.69-4.71) Holotype. -MNHN-IC.2009-0085 (Norfolk 2, stn. DW 2053). Paratypes. -MNHN-IC.2009-0086 (1) and USNM 1131003 (1) (Norfolk 2, stn. DW 2072, 2 specimens).
Type locality. -23°40’S, 168°16’E (off New Caledonia), 670-708 m.
385 Chapter 4 Monophyly of the Genus Caryophyllia
Distribution. -New Caledonia (from 23º40’S, 168º16’E to 25º21’S, 168º57’E), 670- 1005 m.
Etymology. -The species is named oblonga (Latin oblongus = longer than broad, having an elongate shape) referring to the elongate corallum of this species.
Description. -Corallum elongate, ceratoid, straight to slightly curved, and attached by a robust pedicel (PD:GCD = 0.43-0.71) that expands into a thin encrusting) base. Holotype 4.1 x 4.0 mm in CD, 15.5 mm in height, and 2.9 mm in PD. Calice circular (GCD:LCD = 1.0-1.04), with serrate calicular margin. Theca porcellanous, bearing low rounded granules. Costae unequal in width: C1 and C2 slightly ridged; C3 flat and slightly broader than C1 and C2; when present, C4 only distinguishable near calicular edge. Costae separated by very shallow intercostal striae, extending from calicular edge to pedicel. Corallum white to cream.
Septa hexamerally arranged in 4 incomplete cycles (6:6:12:x) according to formula: S1>S2>S3>S4. S1 thicker than other septa, up to 1 mm exsert, extending about 3/5 distance to columella with moderately sinuous and vertical axial edges. S2 slightly narrower and less exsert than S1, with highly sinuous axial edges. S3 1/2 to3/4 width of S2, with slightly sinuous axial edges. S4 rudimentary and present only near calicular edge. A crown composed of 6 pali stands before the S2 encircling the columella. Pali extremely sinuous, occupying the space between a pair of S1 (pali better developed in holotype). Pali of paratypes indistinguishable from columellar elements. Fossa shallow to moderately deep, containing a fascicular columella composed of several twisted laths.
Remarks. -Not many species of Caryophyllia have an elongate, subcylindrical corallum with small calicular diameter. Among the ones that do, Caryophyllia oblonga sp. nov. is most similar to C. marmorea, but is easily distinguished by its septal symmetry (octameral in C. marmorea).
386 Chapter 4 Monophyly of the Genus Caryophyllia
Caryophyllia octopali Vaughan, 1907 (Figures 4.72-4.75) Caryophyllia octopali Vaughan, 1907: 74-75, pl. 5, fig. 4. –Cairns, 1984: 11. –Cairns, 1991: 12. –Cairns & Zibrowius, 1997: 92. –Cairns et al., 1999: 20. –Cairns, 2006: 47.
Type material. -The holotype and paratypes are deposited at NMNH (USNM 20746 and 20747, respectively).
Type locality. -Albatross stn. 3827 and 3828 (South of Molokai, Hawaii), 513-678 m.
New records. -MNHN-IC.2009-0066 (Norfolk 2, stn. DW 2025, 1 specimen).
Distribution. -New Caledonia, 410-443 m; Hawaiian Islands (Vaughan, 1907; Cairns, 1984), 457-627 m.
Description. -Corallum elongate to subcylindrical, straight to slightly curved, and attached by a robust pedicel (PD:GCD = 0.65) that expands into a thin encrusting base. Largest specimen examined 4.5 mm in CD, 18.1 mm in height, and 2.9 mm in PD. Calice circular, theca smooth and porcellanous near calice. Costae flat, not well defined, and more conspicuous near pedicel and lower corallum, where they are equal in width and separated by very shallow and narrow intercostal striae. Upper 3 mm of corallum, including upper and outer septal edges, reddish-brown, and lower part display an opaque yellowish-brown colour. Axial septal edges, pali, and columellar elements white.
Septa octamerally arranged in 3 incomplete cycles (4 S3 usually missing from end half- systems, totalling 28 septa), according to formula: S1>S2-S3. S1 less than 1 mm exsert, with rounded upper edge and moderately sinuous axial edges that almost reach columella. S2 least exsert septa (<0.5 mm), also with moderately sinuous axial edges,
387 Chapter 4 Monophyly of the Genus Caryophyllia and extending about 3/4 width of S1. S3 equal to or slightly wider than S2, with less sinuous axial edges. At calicular edge, each S3 fuses to its adjacent S1 forming very low calicular lancets that rises higher than the S2. All septal faces highly granular. Each S2 bears a sinuous 0.5 mm wide palus. Fossa shallow. Columella fascicular composed of 3 twisted elements.
Remarks. -Among the four previously described Caryophyllia that lack transversely ridged theca, and with octamerally arranged septa with tertiaries equal to or wider than their secondaries (C. octopali, C. barbadensis, C. marmorea and C. octonaria), C. octopali is distinguished by its non-granular pali, PD:GCD ≥ 0.5, and elongate to subcylindrical corallum. The new records of this species extend its occurrence from the Hawaiian Islands to the southwestern Pacific.
Caryophyllia planilamellata Dennant, 1906 (Figures 4.76-77, 4.82) Caryophyllia planilamellata Dennant, 1906: 157-158, pl. 6, figs. 4a, b. –Howchin, 1909. –Squires, 1961: 18. –Veron, 1986: 605. –Cairns, 1991: 12. –Cairns & Parker, 1992: 17-19, figs. 4g-i. –Stranks, 1993: 20. –Cairns et al., 1999: 20. –Cairns, 2004: 278. Caryophyllia cyathus. –Hoffmeister, 1933: 14, pl. 4, figs. 4-5. –Squires, 1961: 18. Caryophyllia clavus. –Wells, 1958: 262, 265, pl. 1, figs. 12-13. –Squires, 1961: 18.
Type material. -The holotype is deposited at the NMV (F41521).
Type locality. -Cape Jaffa (220-549 m) or off Beachport (201 m), South Australia (Stranks, 1993).
New records. -WAM Z21464 (6) and MTQ a61449 (3) (SS102005, stn. 20, 9 specimens). WAM Z21465 (SS102005, stn. 40, 1 specimen). TMAG-K3826 (1) and MTQ a61442 (1) (SS022007, stn. 32, 2 specimens).
388 Chapter 4 Monophyly of the Genus Caryophyllia
Distribution. -Australia (Cairns & Parker, 1992; Cairns, 1998; Cairns, 2004; present study), 128-1220 m.
Diagnosis. -Corallum ceratoid to cornute, gradually tapering to a curved pedicel. Calice slightly elliptical (GCD:LCD between 1.05-1.14). Theca porcellanous composed of equal flat costae that bear low rounded granules. Septa arranged in 3 size-classes according to the formula: S1>S2>S3. Specimens examined have about 80 septa (20:20:40), and consequently 20 well-developed pali (P2). Primary septa moderately exsert, extending about 3/5 distance to columella, with straight vertical axial edges. Paliferus secondaries less exsert and about 2/3 width of primaries, bearing straight to slightly sinuous axial edges. Tertiaries slightly less exsert and wide than secondaries with straight axial edges. Fossa shallow, containing a robust and fascicular columella.
Remarks. -Even more than a century after the description of C. planilamellata, this species is reported only from Australian waters, and can be distinguished from its congeners by the absence of spines and transverse division, and the presence of 3 septal size classes, S2 > S3, and more than 18 pali. Sometimes specimens can weakly attached to the substratum. Freshly collected specimens have orange tentacles.
Caryophyllia quadragenaria Alcock, 1902 (Figures 4.78-4.81) Caryophyllia quadragenaria Alcock, 1902a: 91-92. –Alcock, 1902b: 10, pl. 1, figs. 4, 4a. –Keller, 1981a: 18. –Cairns, 1991: 12. –Cairns, 1994: 46-47, pl. 20, figs. c-h, pl. 51, figs. c-d. –Cairns, 1995: 45- 46, pl. 7, figs. g-h. –Cairns & Zibrowius, 1997: 88, 93. –Cairns, 1998: 375. –Cairns, 1999: 73. – Cairns et al., 1999:20. –Cairns, 2004: 278. –González-Romero et al., 2008: 1-2, fig. 2. Caryophyllia scobinosa. –Yabe & Eguchi, 1942: 119 (in part). Caryophyllia scobinosa decapali Yabe & Eguchi, 1942: 120, 149, pl. 10, figs. 6, 7. –Eguchi, 1968: C33- 34. –Eguchi & Miyawaki, 1975: 56. –Cairns, 1991: 12. Caryophyllia profunda. –Squires & Keyes, 1967: 23 (in part). Caryophyllia decapali. –Grygier, 1983: 420. –Zibrowius & Grygier, 1985: 120, figs. 10, 11.
Type material. -Two syntypes of C. quadragenaria are deposited at the ZMA (Coel. 5534, and Coel. 5529). The holotype and paratypes of C. scobinosa decapali are deposited at the TIUS (holotype catalogue number 53640).
389 Chapter 4 Monophyly of the Genus Caryophyllia
Type locality. -C. quadragenaria: Siboga stns 90, 251, and 289 (Makassar Strait, Banda, and Timor Seas), 54-281 m. C. scobinosa decapali: Soyo Maru-210 (33º29’N, 135º28’E – Kii Strait, Japan), 165 m.
New records. -MNHN-IC.2009-0070 (PrFo, stn. ??, 2 specimens). MNHN-IC.2009- 0071 (Bathus 4, stn. DW 894, 1 specimen). MNHN-IC.2009-0072 (Norfolk 2, stn. DW 2025, 1 specimen). MNHN-IC.2009-0073 (2) and USNM 1130996 (1) (Norfolk 2, stn. DW 2117, 3 specimens). MNHN-IC.2009-0074 (2) and USNM 1130997 (2) (Norfolk 2, stn. DW 2150, 4 specimens).
Distribution. -New Caledonia, 245-443 m; Japan, East China Sea, and Eastern Channel of Korea (Cairns, 1994), 70-422 m; New Zealand (Cairns, 1995), 77-198 m; Indonesia (Cairns & Zibrowius, 1997), 112-385 m; Western Australia (Cairns, 1998), 154-201 m; Wallis and Futuna, and Vanuatu regions (Cairns, 1999), 314-430 m; eastern North Pacific (González-Romero et al., 2008), 986-1669 m.
Description. -Corallum ceratoid to subcylindrical, fixed, straight to slightly curved, and attached by a narrow pedicel (PD:GCD = 0.35-0.5), which expands into a thin encrusting base. Largest New Caledonian specimen examined (PrFo) 9.2 x 8.5 mm in CD, 16.9 mm in height, and 3.5 mm in PD. Calice circular to slightly elliptical, with calicular margin vaguely serrate, especially in specimens in which a pair of S3 fuses to their adjacent S1 at calicular edge. Theca thick, costae equal in width, slightly ridged and separated by moderately deep furrows near calicular edge. Near pedicel costae become flat and less prominent, being virtually indistinguishable. All costae covered with low rounded granules. Corallum white and reddish-brown near calicular edge.
Septa decamerally arranged in 3 cycles (10:10:20 [40 septa]) according to the formula: S1>S2≥S3 or S1>S3≥S2. Primary septa up to 1 mm exsert, extending 4/5 distance to columella and having vertical slightly sinuous axial edges. Size of S2 in relation to S3
390 Chapter 4 Monophyly of the Genus Caryophyllia quite variable, the examined specimens having: S2>S3, S2=S3, and S2 Remarks. -With a broad latitudinal range in western Pacific waters and also with records in Indian Ocean, C. quadragenaria is distinguished from its decameral congeners by having sinuous pali axial edges, theca granular, and PD:GCD between 0.22 and 0.39. A brief comparison with C. perculta is provided in the discussion of that species. Caryophyllia ralphae Cairns, 1995 (Figures 4.83-4.87) Caryophyllia ralphae Cairns, 1995: 48-49, pl. 8, figs. f-i. –Cairns et al., 1999:20. –Cairns, 2004: 278. Type material. -The holotype is deposited at the NZOI (now NIWA, H-623). Three paratypes are deposited at AMS (G15500) and other at USNM (94006). Type locality. -22º43’S, 159º16’E (northern Lord Howe Seamount Chain), 328 m. New records. -MNHN-IC.2009-0075 (Norfolk 2, stn. DW 2038, 1 specimen). MNHN- IC.2009-0076 (3) and USNM 1130998 (2) (Norfolk 2, stn. DW 2091, 5 specimens). MNHN-IC.2009-0077 (3) and USNM 1130999 (2) (Norfolk 2, stn. DW 2092, 5 specimens). MNHN-IC.2009-0078 (Norfolk 2, stn. DW 2095, 2 specimens). MNHN- IC.2009-0079 (2) and USNM 1131000 (1) (Norfolk 2, stn. DW 2125, 3 specimens). MNHN-IC.2009-0080 (Norfolk 2, stn. DW 2140, 1 specimen). 391 Chapter 4 Monophyly of the Genus Caryophyllia Distribution. -New Caledonia, 270-896 m; Australia (Cairns, 1995), 328 m. Description. -Corallum ceratoid, robust, flared distally, straight to slightly curved, and attached by a robust pedicel enlarged by concentric layers of stereome (PD:GCD = 0.25-0.42). Calice always elliptical and jagged. Theca thick and smooth, covered with low rounded granules (3 or 4 across width of a costa) that sometimes fuse, forming short transverse ridges but never larger than costal width. Near calicular edge, all costae ridged and separated by deep intercostal furrows. In direction of pedicel costae become flat and poorly defined. Corallum white. Septa hexamerally arranged in 5 cycles according to formula: S1≥S2>S3≥S4≥S5. However, a full fifth cycle (96 septa) not observed. S1 thick, extending 4/5 distance to columella, up to 5 mm exsert, with rounded upper edges, and straight to slightly sinuous vertical axial edges. S2 less exsert than S1, having sinuous axial edges. S3 3/4 width of S2, up to 3 mm exsert, with moderately sinuous axial edges. S4 3/4 width of S3 and only slightly less exsert. However, if a pair of S5 is present, S4 enlarged to S3 size. S5 usually enlarge to S4 size, and in all specimens examined S5 present only flanking one S4 per half-system. To summarize: each half-system usually have 1 S1, 1 S2, 1 S3, 2 S4 (1 equal to S3), and 2 S5 (1 enlarged to S4 size). The middle septa within each half- system (S5) is slightly smaller than the S5 adjacent to its S1. Each S3 bears a narrow and sinuous pali (P3). When a half-system has 1 S4 enlarged to S3 size, the lower axial edge of S4 fuses to the P3 and the P3 seems to migrate between the S2 and the accelerated S4. All septal and palar faces covered with numerous pointed granules. Fossa deep, containing a slightly twisted papillose columella composed of few granular elements, and aligned in the axis of GCD. Remarks. -One of the most distinctive species of Caryophyllia especially due to the large size in adult stage, C. ralphae can be grouped with another three species that are characterized by having pali before the antipenultimate septal cycle: C. paucipalata, C. capensis, and C. eltaninae (Lesser Antilles, off South Africa, and off South Georgia, 392 Chapter 4 Monophyly of the Genus Caryophyllia respectively). C. ralphae is distinguished by its highly exsert septa and very deep fossa. However, C. ralphae can easily be confused with Rhizosmilia robusta, both having about the same adult corallum size, septal symmetry and exsertness, colour, and fossa depth. But R. robusta can be differentiated by the presence of concentric rings of partitioned chambers resembling polycyclic development in the base cross section, the pedicel/base of C. ralphae being completely solid. Figures 4.88 to 4.92 are provided for comparison between these two caryophylliid species. Caryophyllia rugosa Moseley, 1881 (Figures 4.93-4.97) Caryophyllia rugosa Moseley, 1881: 141-143, pl. 1, figs. 8a-b. –Kock, 1889: 10-20, 7 figs. –Faustino, 1927: 70-71, pl. 8, figs. 12-14. –Wells, 1954: 469, pl. 177, figs. 5-6. –Cairns, 1984: 11-13, pl. 2, figs. A-B, pl. 4, fig. I. –Cairns, 1991: 12. –Cairns & Keller, 1993: 236, pl. 3, fig. 1. –Cairns, 1994: 47, pl. 20, fig. i, pl. 21, fig. a. –Cairns, 1995: 43-44, pl. 6, fig. h, pl. 7, figs. a-c. –Cairns & Zibrowius, 1997: 91-92. –Cairns, 1998: 375. –Cairns, 1999: 71. –Cairns et al., 1999:20. –Cairns, 2004: 264, 278. –Cairns, 2006: 47. –Ogawa, 2006:105, 109. Caryophyllia paraoctopali Yabe & Eguchi, 1941: 150, pl. 10, fig. 12. Type material. -The syntypes of C. rugosa are deposited at NHM (? uncatalogued). Type locality. -Challenger stns 192 and 201 (Banda and Sulu Seas), 187-230 m. New records. -MNHN-IC.2009-0054 (3) and USNM 1130990 (1) (Bathus 4, stn. DW 902, 4 specimens). MNHN-IC.2009-0055 (Norfolk 2, stn. DW 2063, 1 specimen). MNHN-IC.2009-0056 (2) and USNM 1130991 (1) (Norfolk 2, stn. DW 2117, 3 specimens). AM-G.17616 (Norfanz, stn. 55, 1 specimen). AM-G.17617 (1) and MTQ a61485 (1) (Norfanz, stn. 57, 2 specimens). Distribution. -New Caledonia, 212-724 m; Hawaiian region (Cairns, 1984), 137-439 m; off Zululand, Mozambique, Kenya, and Maldives (Cairns & Keller, 1993), 95-250 m; Japan and East China Sea (Cairns, 1994), 71-240 m; New Zealand (Cairns, 1995), 142- 508 m; Philippines and Indonesia (Cairns & Zibrowius, 1997), 137-581 m; Australia 393 Chapter 4 Monophyly of the Genus Caryophyllia (Cairns, 1998; 2004, and present study), 180-330 m; Wallis and Futuna, and Vanuatu region (Cairns, 1999), 286-580 m. Description. -Corallum small, ceratoid to trochoid, and attached by a robust pedicel (PD:GCD > 0.5), which expands into a large encrusting base. Largest specimen examined (DW 2063) 8.5 x 7.7 mm in CD and 4.3 mm in PD, but base is broken. Costae covered with narrow, well-defined transverse ridges. Circumferential ridges split and rejoin around corallum, being present from encrusting base to septal projection above calicular edge. In some specimens ridges more prominent 2–4 mm below calice. Corallum white to light cream. Septa octamerally arranged in 3 cycles (8:8:16 [32 septa]) according to formula: S1>S2>S3. However, one specimen (DW 2063) has decameral symmetry (10:10:20 [40 septa]), and another three (DW 2053) have hexameral symmetry (6:6:12:24 [48 septa]). S1 most exsert septa (up to 1.5 mm), extending about 3/5 distance to columella. Higher septal cycles progressively less exsert and wide. Axial edges of all septa sinuous, especially those of S1 and S2. A well-developed ring of 8 to 12 (usually 8) quite sinuous pali encircle the fascicular columella, which is composed of few twisted elements. Remarks. -This small, cryptic, but commonly collected species of Caryophyllia is easily distinguished from its congeners by the presence of transverse ridges in the theca, and the extremely sinuous septa and pali. The normal condition of septal arrangement of this species is octameral, however, three specimens with hexamerally arranged septa are noted in the present study. Caryophyllia scobinosa Alcock, 1902 (Figures 4.113 and 4.117) Caryophyllia cultrifera Alcock, 1902a: 89-90. –Alcock, 1902b: 7-8, figs. 1, 1a. –Faustino, 1927: 67-68, pl. 8, figs. 8-9. –Veron, 1986: 905. Caryophyllia scobinosa Alcock, 1902a: 90. –Alcock, 1902b: 8, pl. 1, figs. 2, 2a. –Faustino, 1927: 68-69, pl. 8, figs. 10-11. –Yabe & Eguchi, 1942: 119-120 (in part). –Utinomi, 1965: 254. –Eguchi, 1965: 285. –Keller, 1981a: 17, fig. 2. –Cairns, 1991: 12. –Cairns & Keller, 1993: 235. –Cairns, 1994: 45-46, pl. 20, figs. a-b (in part). –Cairns, 1995: 52-53, pl. 10, figs. g-i, pl. 11, figs. a-c. – 394 Chapter 4 Monophyly of the Genus Caryophyllia Cairns & Zibrowius, 1997: 94. –Cairns, 1999: 75. –Cairns et al., 1999:20. –Kitahara, 2007: 498, 507, 510, fig. 2K. –Kitahara et al., 2008: 16, fig. 2D. –Cairns, 2004: 278. Caryophyllia cf. scobinosa. –Utinomi, 1956: 42. Type material. -Six syntypes of C. scobinosa are deposited at the ZMA (Coel. 574, 575), and the holotype of C. cultrifera is also deposited at ZMA (Coel. 1180). Type localities: C. scobinosa: Siboga stns. 45 and 102 (Flores and Sulu Seas), 535-794 m. C. cultrifera: Siboga stn. 101 (Sulu Sea), 1270 m. New records. -MNHN-IC.2009-0088 (1) and USNM 1131004 (1) (Bathus 2, stn. DW 734, 2 specimens). MNHN-IC.2009-0089 (22) and USNM 1131005 (10) (Bathus 4, stn. CP 842, 32 specimens). MNHN-IC.2009-0090 (Bathus 4, stn. DW 905, 1 specimen). MNHN-IC.2009-0091 (Halipro I, stn. CH 78, 1 specimen). MNHN-IC.2009-0092 (Norfolk 2, stn. DW 2103, 1 specimen). WAM Z21468 (3) and MTQ a61467 (2) (SS102005, stn. 150, 5 specimens). AM-G.17619 (Norfanz, stn. 51, 1 specimen). Distribution. -New Caledonia, 354-830 m; Australia (Cairns, 1995; 2004; present study), 296-2450 m; Tanzania, Madagascar Plateau, Sulu Sea, Celebes Sea, off Tonga and Samoa (Cairns, 1995), 535-1270 m; Philippines and Indonesia (Cairns & Zibrowius, 1997), 253-1270 m; Wallis and Futuna, and Vanuatu regions (Cairns, 1999), 715-900 m; Brazil (Kitahara, 2007), depth unknown. Description (based on New Caledonian specimens): Corallum solitary, cornute, free, and usually curved 90º in the plane of GCD. Unattached pedicel usually eroded, but if intact pointed and about 1 mm in diameter. Largest specimen examined (DW 2103) 15.5 x 12.9 mm in CD, and 15.4 mm in height. Costae usually absent (especially in adult corolla), but if present C1 and C2 slightly more ridged than others. Ridges near calicular edge sometimes slightly sinuous. C3 and C4 flat. Costae separated by shallow striae, and covered with numerous low rounded granules, more conspicuous in lower 395 Chapter 4 Monophyly of the Genus Caryophyllia half of corallum. Juvenile specimens normally entirely white, however, theca of adult specimens has 2 distinct colours: white in the first 5 mm from calicular edge, and discoloured in direction of pedicel. Almost all specimens examined have hexamerally arranged septa in 4 cycles (or 5 incomplete cycles) according to the formula: S1-2>S3≥S4>S5. However, some specimens have heptamerally arranged septa in 14 sectors and thus 14 pali. These two different septal patterns were observed in specimens collected in the same stations and having the same size. S1-2 highly exsert (up to 2-2.5 mm), with rounded upper edge, and vertical and slightly sinuous axial edge. S1 and S2 fuse to columella deep in fossa. S3 least exsert septa (less than 1 mm), with moderately sinuous axial edges each of which bear a paliform lobe. S4 slightly smaller to same size of S3, but each S4 fuses to adjacent S1 or S2 at calicular edge forming rectangular lancets. A crown of 12-14 well- developed pali encircles columella. Pointed granules cover all septa and palar faces. Columella fascicular, composed of 5-9 twisted elements aligned in 1 or 2 rows in the plane of GCD. Remarks. -Caryophyllia scobinosa is distinguished from the other Indo-Pacific unattached species of Caryophyllia previously described (C. ambrosia. C. mabahithi, C. planilamellata, C. cornulum, C. stellula, and C. grandis), by the presence in the adult corallum of 48-72 septa (not 96 as in C. ambrosia and C. grandis); 12 to 14 pali; and in having an extremely jagged calicular margin. Caryophyllia sp. A. (Figures 4.98-4.102) Material examined: MNHN-IC.2009-0087 (Bathus 4, stn. CP 889, 1 specimen). Distribution. -Known only from the single specimen (21º00.83’S, 164º27.34’E) off New Caledonia, 416-433 m. 396 Chapter 4 Monophyly of the Genus Caryophyllia Description. -Corallum ceratoid, straight, presumably fixed (base broken), and slightly flared distally. Calice elliptical: 18.5 mm in GCD and 14.0 mm in LCD (GCD:LCD = 0.76). Theca thick and covered with 5-7 (usually aligned) low, rounded granules across width of each costa. Intercostal striae absent, C1-3 slightly ridged especially near calicular edge. Corallum cream coloured, but C1-4, S1-2, and outer and upper edges of S3-4 dark brown. Columellar elements and pali completely white. Septa hexamerally arranged in 4 complete cycles (6:6:12:24 [48 septa]) according to formula: S1-2>S3>S4. Upper edge of S1-2 rounded and highly exsert (up to 3.5 mm) and axial edge sinuous and slightly inclined, extending about 2/3 distance to columella. S1-2 fuses to columella deep in fossa. S3 up to 2 mm exsert, about 0.9 width of S1-2, and have highly sinuous vertical axial edges. S4 usually least exsert septa, but usually fusing to adjacent S1 and S2 above calicular edge, forming low lancets. Upper and axial edges of S4 slightly sinuous, extending 2/5 distance to columella. All septal faces covered with low rounded granules arranged in rows oblique to trabecula, and in some S1-2, granules fused into low and short carinae. Below 1-2 mm of septal upper edge the granules are white. Twelve slightly sinuous, well-developed lamellar pali (P3) with inclined outer edge and vertical axial edge present before S3. Fossa of moderate depth containing a fascicular columella composed of 12 small twisted ribbons. Remarks. -The specimen described above is almost indistinguishable from C. lamellifera but does not have transverse thecal ridges, which are diagnostic for that species. Otherwise, septal symmetry and exsertness are the same. However, the skeleton colour pattern is indistinguishable from some specimens of C. versicolorata, sp. nov. Although probably representing an undescribed taxa, more material is needed to fully describe this species. Caryophyllia tangaroae, sp. nov. (Figures 4.103-4.106) Holotype. -AM-G.17618 (Norfanz, stn. 50). Type locality. -29º07’44’’S, 158º35’26’’E (Australia), 505-900 m. 397 Chapter 4 Monophyly of the Genus Caryophyllia Distribution. -Same as type locality. Etymology. -The species is named tangaroae in honour of the RV Tangaroa (NIWA), for the numerous research expeditions undertaken into deep waters of the southern Pacific and Indian Oceans. Description. -Corallum ceratoid, small, slightly curved, and attached through a small pedicel (PD:GCD = 0.48), which expands into a thin and small encrusting base. Holotype 9.7 x 9.4 mm in CD, 18.3 mm in height, and 4.7 mm in PD. Calice slightly elliptical, with calicular margin vaguely serrate. Theca thick, costae visible only near calicular edge. Lower part of corallum covered with stereome or eroded. Costae equal in width and covered with low rounded granules, usually 3-5 across width of each costa. Corallum beige to white. Septa octamerally arranged in 3 complete cycles (8:8:16 [32 septa]) according to formula: S1>S2>S3. Primary septa up to 1 mm exsert, their sinuous axial edges almost reaching the columella deep in fossa. Secondaries slightly less wide and exsert than primaries, also having sinuous axial edges. Tertiaries least exsert septa and only 2/3 width of secondaries. Axial edges of S3 slightly sinuous. Tall and wavy pali present before each S2. All septa and palar faces bear tall granules sometimes fused as small carinae perpendicular to trabeculae. Fossa of moderate depth containing a columella formed by 1 twisted element. Remarks. -Even with only one specimen available, Caryophyllia tangaroae sp. nov. is very distinctive among the five congeners previously described that have octamerally arranged septa (C. barbadensis, C. marmorea, C. octopali, C. rugosa and C. octonaria), being distinguished by the following characters: corallum shape; PD:GCD < 0.5; corallum ceratoid; and pali not or only slightly granular (not as in C. barbadensis and C. marmorea, which present granular or carinate palar faces). 398 Chapter 4 Monophyly of the Genus Caryophyllia Caryophyllia unicristata Cairns & Zibrowius, 1997 (Figures 4.114-4.116) Caryophyllia unicristata Cairns & Zibrowius, 1997: 101-102, figs. 9d, e. –Cairns, 1998: 337. –Cairns et al., 1999:20. –Cairns, 2004: 277. Type material. -The holotype is deposited at the MNHN (uncatalogued), and the paratypes are deposited at: MNHN (28 paratypes distributed in 4 lots), POLIPI (8 paratypes distributed in 3 lots), and USNM (97038 [1], 97040 [75], 97041 [3]). Type locality. -Karubar stn. 76, 8º49’S, 131º36’E (South of Tanimbar Islands), 400 m. New records. -MNHN-IC.2009-0093 (1) and USNM 1131006 (1) (Bathus 4, stn. CP 893, 2 specimens). MNHN-IC.2009-0094 (9) and USNM 1131007 (5) (Bathus 4, stn. CP 967, 14 specimens). WAM Z21472 (SS102005, stn. 105, 8 specimens). WAM Z21473 (SS102005, stn. 113, 4 specimens). WAM Z21474 and MTQ a61474 (20) (SS102005, stn. 171, >200 specimens). WAM Z21475 and MTQ a61477 (20) (SS102005, stn. 172, > 200 specimens). Distribution. -New Caledonia, 386-620 m; Arafura Sea, Indonesia (Cairns & Zibrowius, 1997), 251-477 m; Australia (Cairns, 1998; 2004; present study), 302-477 m. Description (based on New Caledonia specimens). –Corallum cornute, usually curved 45-90º in the plane of GCD, and free in adult stage, but commonly collected with scars of previous attachment, or even attached to octocorals, gastropod shells, and dead coral skeletons. Calice elliptical with one side meeting in a sharp angle (not rounded). Largest specimen examined (CP 893) 14.4 x 10.3 mm in CD, 1 mm in PD, and 19.2 mm in height. Theca covered with tall pointed granules. Costae well defined with C1-2 slightly ridged, especially near calice. Principal C1 in the convex edge of the corallum always 399 Chapter 4 Monophyly of the Genus Caryophyllia sinuously crested. C3-4 slightly convex but not ridged, bearing 1 or 2 granules across their width. Intercostal striae shallow and thin. Corallum usually yellowish-brown when collected dead, and slightly reddish-brown when alive. C1-2 and upper outer edge of S1-2 darker than the rest of the coralla. Septa of most specimens decamerally arranged in 3 cycles (5:5:10 [30 septa]) according to formula: S1>S2>S3, however, 5 specimens have hexameral symmetry arranged in 4 cycles (6:6:12:24 [48 septa]), 1 has heptameral symmetry in 3 cycles (7:7:14 [28 septa]), and one has octameral symmetry arranged in 3 cycles (8:8:16 [32 septa]). S1 up to 1.6 mm exsert, extending about 4/5 distance to columella, and have slightly sinuous axial edges. S2 least exsert septa, 3/5 width of S1, with moderately sinuous axial edges, being separated from their sinuous pali by a deep narrow notch. A pair of S3 fuses to adjacent S1 forming rectangular lancets. S3 more exsert but less sinuous than S2. Septal faces covered with tall and pointed granules arranged in rows perpendicular to trabecula. Pali terminate higher than columellar elements. Fossa of moderate depth containing a fascicular columella aligned in the axis of GCD, being composed by 1-9 twisted elements. Remarks. -Among the Caryophyllia that bear edge spines or lateral crests, C. unicristata is easily distinguished by the presence of a highly sinuous crest only on the convex thecal edge. Caryophyllia versicolorata, sp. nov. (Figures 4.107-4.112) Holotype. -MNHN-IC.2009-0045 (Norfolk 2, stn. DW 2037). Paratypes. -MNHN-IC.2009-0046 (Bathus 4, stn. DW 822, 1 specimen). MNHN-IC.2009-0047, MNHN- IC.2009-0048, MNHN-IC.2009-0049 and USNM 1130988 (3) (Norfolk 2, stn. DW 2037, 6 specimens). MNHN-IC.2009-0050, MNHN-IC.2009-0051 and USNM 1130989 (Norfolk 2, stn. DW 2053, 3 specimens). MNHN-IC.2009-0052 (Norfolk 2, stn. DW 2109, 1 specimen). MNHN-IC.2009-0053 (Norfolk 2, stn. DW 2133, 1 specimen). Type locality. -23º40’S, 167º41’E (New Caledonia), 517-570 m. 400 Chapter 4 Monophyly of the Genus Caryophyllia Distribution. -New Caledonia (from 22º02.43’S, 165º56.24’E to 23º47’S, 168º17’E), 215-708 m. Etymology. -The species is named versicolorata (Latin: versicolor = of various colours, variegated) alluding to the two very distinct colours present in the septa and C1-3 (brown pigmented) and the pali and columellar elements (white). Description. -Corallum ceratoid, straight to slightly curved, slightly flared distally, and attached by a thin encrusting base (PD:GCD = 0.33-0.44). Holotype 9.0 x 8.5 mm in CD, 3.8 mm in PD, and 20.1 mm in height. Largest specimen examined (DW 2109) 12.3 x 10.5 mm in CD, 4.1 mm in PD, and 30.2 mm in height. Calice always slightly elliptical, with serrate edges. Theca moderately thick, covered with thin transverse ridges. Ridges present from outer septal edge to pedicel, but more developed in lower part of corallum. Equal and flat costae sometimes present near calice, separated by thin, shallow intercostal striae; however, some specimens have slightly ridged C1-2. Well- preserved specimens have costae near calicular edge, and septa brown pigmented, white pali and columellar elements, and rest of the corallum cream. Septa always hexamerally arranged in 4 complete cycles (6:6:12:24 [48 septa]) according to formula: S1≥S2>S3>S4. S1 most exsert (up to 1.5 mm), extending half distance to columella with slightly sinuous axial edges. Higher septal cycles progressively less exsert and wide (but S2 sometimes as wide as S1). Axial edge of S3 highly sinuous. Before each S3 is a well-developed, tall, rounded, lamellar (slightly sinuous) palus (P3), together forming a well-defined crown of 12 elements. Each palus terminates well above columellar elements. Fossa of moderate depth, containing a fascicular columella composed of 4-10 twisted rods aligned with the axis of GCD. Remarks. -Among the six previously described species of Caryophyllia with transversely ridged theca, C. versicolorata is unique in having: septa hexamerally arranged in four complete cycles, septa only slightly exsert, C1-3 and S1-3 usually pigmented dark-brown, and white pali and columellar elements. 401 Chapter 4 Monophyly of the Genus Caryophyllia Figures 4.7-4.37. –Caryophyllia abrupta (MNHN-IC.2009-0067): 7, lateral view; 8, calicular view. (MNHN-IC.2009-0069) 9, lateral view; 10, calicular view. Caryophyllia atlantica (TMAG-K3827): 11, calicular view; 16, lateral view. Caryophyllia aspera sp. nov. (MNHN-IC.2009-0083 - Holotype): 12 and 13, stereo pair calicular view; 14, oblique calicular view; 15, lateral view. Caryophyllia cinticulata (USNM 1131001): 17, calicular view; 20, lateral view. (MNHN-IC.2009-0082): 18, calicular view; 19, oblique calicular view; 21, lateral view. Caryophyllia concreta sp. nov. (USNM 1130993 – Paratype): 22, lateral view. (MNHN-IC.2009-0057 – Holotype): 23 and 24, stereo pair of calicular view; 25, oblique calicular view; 26, lateral view. (MNHN- IC.2009-0058 – Paratype): 27, lateral view; 28 and 29, stereo pair of calicular view; 30, oblique calicular view. (MNHN-IC.2009-0059 – Paratype): 31, lateral view. (MNHN- IC.2009-0060 – Paratype): 32, lateral view. Caryophyllia crosnieri (MNHN-IC.2009- 0041): 33 and 34, stereo pair of calicular view; 35, oblique calicular view; 36, lateral view. Caryophyllia diomedeae (TMAG-K3818): 37, lateral view. Scale bars represent 5 mm. 402 Chapter 4 Monophyly of the Genus Caryophyllia Figures 4.38-4.66 –Caryophyllia diomedeae (TMAG-K3818): 38, calicular view. Caryophyllia diomedeae (MNHN-IC.2009-0016): 39 and 40, stereo pair of calicular view; 41, oblique calicular view; 42, lateral view. (MNHN-IC.2009-0015): 43, calicular view; 44, oblique calicular view; 45, lateral view. (MNHN-IC.2009-0003): 46, lateral view. Caryophyllia grandis (WAM Z21467): 52, lateral view; 47, calicular view; 48, calicular view. (WAM Z21466): 49, calicular view; 50, oblique calicular view; 51, lateral view. Caryophyllia grayi (WAM Z21471): 53, calicular view; 54, lateral view; 55, lateral view of the LCD. (WAM Z21470): 58, lateral view; 59, lateral view. Caryophyllia hawaiiensis (MNHN-IC.2009-0043): 56, oblique calicular view; 57, lateral view; 60 and 61, stereo pair of calicular view. Caryophyllia laevigata (MNHN- IC.2009-0023 – Holotype): 62, calicular view; 63, lateral view. Caryophyllia lamellifera (MNHN-IC.2009-0044): 64 and 65, stereo pair of calicular view; 66 oblique calicular view. Scale bars represent 5 mm. 403 Chapter 4 Monophyly of the Genus Caryophyllia Figures 4.67-4.97. –Caryophyllia lamellifera (MNHN-IC.2009-0044): 67, lateral view; 68, detail of a broken base. Caryophyllia oblonga sp. nov. (MNHN-IC.2009-0085 – Holotype): 69, calicular view; 70, oblique calicular view; 71, lateral view. Caryophyllia octopali (MNHN-IC.2009-0066): 72, oblique calicular view; 73 and 74, stereo pair of calicular view; 75, lateral view. Caryophyllia planilamellata (WAM Z21464): 76, calicular view; 77, oblique calicular view; 82, lateral view. Caryophyllia quadragenaria (MNHN-IC.2009-0070): 78 and 79, stereo pair of calicular view; 80, oblique calicular view; 81, lateral view. Caryophyllia ralphae (MNHN-IC.2009-0077): 83 and 84, stereo pair calicular view; 85, oblique calicular view; 86, lateral view; 87, broken base. Rhizosmilia robusta (DW 2124): 88 and 89, stereo pair calicular view; 90, oblique calicular view; 91, lateral view; 92, broken base. Caryophyllia rugosa (MNHN- IC.2009-0055): 93 and 94, stereo pair of calicular view; 95, oblique calicular view; 96, lateral view. (MNHN-IC.2009-0056): 97, lateral view. Scale bars represent 5 mm. 404 Chapter 4 Monophyly of the Genus Caryophyllia Figures 4.98-4.117. –Caryophyllia sp. A (MNHN-IC.2009-0087): 98 and 99, stereo pair of calicular view; 100, oblique calicular view; 101, lateral view; 102, broken base view. Caryophyllia tangaroae sp. nov. (AM-G.17618 - Holotype): 103 and 104, stereo pair calicular view; 105, oblique calicular view; 106, lateral view. Caryophyllia versicolorata sp. nov. (MNHN-IC.2009-0045 – Holotype): 107, oblique calicular view; 108, lateral view. (MNHN-IC.2009-0053 – Paratype): 109 and 110, stereo pair of calicular view; 111, oblique calicular view; 112, lateral view. Caryophyllia scobinosa (MNHN-IC.2009-0089): 113, calicular view; 117, lateral view. Caryophyllia unicristata (MNHN-IC.2009-0094): 114, calicular view; 115, lateral view; 116, oblique calicular view. Scale bars represent 5 mm. 4.3.2 PHYLOGENETIC ANALYSIS To test the hypothesis that Caryophyllia is a valid genus, 16S rDNA sequences were obtained from 12 Caryophyllia species, 7 representatives of morphologically related caryophylliid genera, and 14 representatives of non-caryophyllid families (Appendix 4.3). In a broad view, the “complex” and “robust” scleractinan clades were well resolved, with representatives of the Fungiacyathidae, Flabellidae, Turbinoliidae, 405 Chapter 4 Monophyly of the Genus Caryophyllia Poritidae, Dendrophylliidae, Acroporidae, and Agariciidae grouping as the “complex” corals, and the other families present in our analyses grouping as the “robust” corals. With the exception of Polycyathus Duncan, 1876 and Rhizosmilia Cairns, 1978, all of the Caryophylliidae used are solitary. Each caryophyllid genera examined bear pali or paliform lobes (with exception of Crispatotrochus Tenison-Woods, 1878), have a corallum resembling that of at least one Caryophyllia species, have septotheca that are usually costate, characteristically have columellar elements, and have septa that are exserted to some degree. The twelve Caryophyllia species included in the analyses capture most of the range of morphological variation within the genus, with the following characters being represented: attached and free species; presence or absence of thecal spines, crests or transverse ridges; differences in septal symmetry; different numbers of pali; and corallum robustness. Results of the Bayesian inference (BI) are shown as Figure 4.118 and summarized below. The Maximum-likelihood results using Shimodaira-Hasegawa-like procedure and 100 bootstrap replicates are not shown due to poorly supported distal nodes. Figure 4.118. –Unrooted cladogram generated from partial 16S rDNA gene from 19 species of Caryophylliidae and 14 non-caryophylliid scleractinians showing their phelogenetic relationships. Numbers on branches show posterior probability calculated based on Bayesian Inference. Light shaded area shows the Caryophyllia clade, and the dark shaded area shows the “robust” corals clade. 406 Chapter 4 Monophyly of the Genus Caryophyllia However, each of the methods of phylogenetic analyses recovered a strongly supported clade containing all twelve Caryophyllia species together with representatives of two morphologically similar caryophyllid genera: Crispatotrochus and Dasmosmilia Pourtalès, 1880. The major difference between Caryophyllia and Crispatotrochus is the absence of pali or paliform lobes in the latter, suggesting the possibility of secondary loss of this morphological character. By contrast, Dasmosmilia has paliform lobes before all but the last septal cycle (a morphological character shared with Rhizosmilia, Paracyathus Milne Edwards & Haime, 1848, Polycyathus, Tethocyathus Kühn, 1933, and Trochocyathus Milne Edwards & Haime, 1848), and grouped with four different Caryophyllia species. One of the major differences between Dasmosmilia lymani (Pourtalès, 1871) and all of the other species included in our analyses is its reproductive strategy (parricidal budding resulting in unattached coralla with an open/fractured base or base still attached to inner theca of parent coralla), a characteristic probably acquired due to the low amount of hard substrata available in the habitat of this species, or the brooding of non-swimming larvae that colonize the first part of the skeleton without tissue cover. The Caryophyllia species examined fell into two subclades formed by: (1) C. unicristata, C. grandis, C. transversalis, and C. scobinosa; and (2) the other eight species examined. Each subclade contains some species with attached adult stages and some free-living species. For example, the unattached species C. unicristata and C. scobinosa groups with the attached species C. transversalis in the first subclade, and C. ambrosia groups with the presumably attached C. atlantica in the second. Likewise, even though the presence/absence of spines or crests is often used to distinguish Caryophyllia subgenera, these features may have multiple origins, as the two species from the subgenus Acanthocyathus included in the analyses, C. (A.) grayi (spinose) and C. (A.) unicristata (crested) were split between the two subclades. On the other hand, some morphological characters do correlate with the groupings within the Caryophyllia clade; for example, the two species examined that have transverse ridges covering the theca (C. rugosa and C. lamellifera) fall into the second subclade with high posterior probability. Another implication is that C. ambrosia and C. scobinosa may not be as closely related as was assumed on the basis of morphology implying that their similar morphology may reflect convergence driven by their occupying similar ecological niches. Consistent with 407 Chapter 4 Monophyly of the Genus Caryophyllia this, C. ambrosia and C. scobinosa overlap both in distribution (particularly in the Pacific) and depth range. Although the analyses presented here are of limited scope, two groupings of species external to the Caryophyllia clade are worthy of comment and probably are representatives of an undescribed family once they appear relatively distant in relation to Caryophyllia. First, the phylogeny presented here suggests that Tethocyathus and Trochocyathus may be sister genera as this clade has strong posterior probability support. A second implication of our analyses is that the genera Paracyathus, Polycyathus and Rhizosmilia maculata may be closed related. The morphological similarity of Paracyathus and Polycyathus has previously been commented on, and Polycyathus senegalensis Chevalier, 1966 was characterized by Hubbard & Wells (1986) as a “quasicolonial Paracyathus pulchellus (Philippi, 1842) with smaller corallites”. However, whilst agreeing on the similarity of the genera, Cairns (2000) showed that Polycyathus forms a true colony. In this case, colonial and solitary genera group together, which is consistent with the hypothesis that coloniality may have evolved on multiple occasions. When testing the validity of a taxonomic group, one should ideally include as many as possible of the known species (Barraclough & Nee, 2001). However, in the case of molecular phylogenetics of deep-sea corals this is presently unrealistic, as older museum material is often preserved in ways that are incompatible with DNA based analyses. The genus Caryophyllia is particularly challenging because fresh material is rarely collected - this is particularly true for the small solitary species. Although based on only 12 of the 73 Recent Caryophyllia species, the analysis presented here supports the monophyly of the genus, but does not necessarily imply that all of the species currently assigned to this genus belong there. These analyses also call for a reevaluation of the genera Dasmosmilia and Crispatotrochus. 408 CHAPTER 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data Classical morphological taxonomy places the approximately 1400 recognized species of Scleractinia (hard corals) into 27 families, but many aspects of coral evolution remain unclear despite the application of molecular phylogenetic methods. In part, this may be a consequence of such studies focusing on the reef-building (shallow water and zooxanthellate) Scleractinia, and largely ignoring the large number of deep-sea species. To better understand broad patterns of coral evolution, I generated molecular data for a broad and representative range of deep sea scleractinians collected off New Caledonia and Australia during the last decade, and conducted the most comprehensive molecular phylogenetic analysis to date of the order Scleractinia. Partial (595 bp) sequences of the mitochondrial cytochrome oxidase subunit 1 (CO1) gene were determined for 65 deep-sea (azooxanthellate) scleractinians and 11 shallow-water species. These new data were aligned with 158 published sequences, generating a 234 taxon dataset representing 25 of the 27 currently recognized scleractinian families. There was a striking discrepancy between the taxonomic validity of coral families consisting predominantly of deep-sea or shallow water species. Most families composed predominantly of deep-sea azooxanthellate species were monophyletic in both maximum likelihood and Bayesian analyses but, by contrast, most families composed predominantly of shallow-water zooxanthellate taxa were polyphyletic, although Acroporidae, Poritidae, Pocilloporidae, and Fungiidae were exceptions to this general pattern. One factor contributing to this inconsistency may be the greater environmental stability of deep-sea environments, effectively removing taxonomic “noise” contributed by phenotypic plasticity. The phylogenetic analyses imply that the most basal extant scleractinians are azooxanthellate solitary corals from deep-water, their divergence predating that of the “Robust” and “Complex” corals. Deep-sea corals are likely to be critical to understanding anthozoan evolution and the origins of the Scleractinia. Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data 5.1 INTRODUCTION Although principally known as the architects of coral reefs, the order Scleractinia, or stony corals, comprises two distinct ecological groups: the zooxanthellate species that live in symbiosis with a photosynthetic dinoflagellate occur in shallow tropical waters, but there are around the same number of azooxanthellate species, which are primarily associated with deeper and colder waters. Of the approximately 1490 valid extant scleractinian species (Cairns, 2007), more than 47% are azooxanthellate (Cairns, 2007; Cairns et al., 1999) and occur from polar (Cairns, 1982; Kerby & Hall-Spencer, 2007) to equatorial regions, and from shallow to bathyal depths. The deepest record of a living stony coral is from approximately 6,000 m in the Kuril-Kamchatcka Trench in the NE Pacific (Keller, 1976). Scleractinians are first known in the fossil record as shallow-water forms from the Middle Triassic (ca. 245 Ma), but by this time were already highly diverged at the subordinal level (Wells, 1956). However, the small number of reliable skeletal characteristics and the uncertain impact of environmental variables on these morphological characters (Boschma, 1959) have severely hampered attempts to infer relationships among families and suborders (Romano & Cairns, 2000; Stolarski & Roniewicz, 2001; Le Goff-Vitry et al., 2004; Fukami et al., 2008). Traditionally the inference of evolutionary relationships among corals has relied heavily on comparing extant and fossil material in terms of micro- and macromorphological skeletal characteristics, but this has resulted in several very different schemes (Wells, 1956; Alloiteau, 1957; Chevalier & Beauvais, 1987; Veron, 1995). Attempts to establish phylogenetic relationships within coral families based on skeletal characteristics have proved to be challenging, and as a consequence have been applied to date to only six of the 27 extant families – Fungiidae (Cairns, 1984; Hoeksema, 1989), Mussidae (Pandolfi, 1992; Budd & Stolarski, 2009), Siderastreidae (Pandolfi, 1992), Turbinoliidae (Cairns, 1997), Acroporidae (Wallace, 1999) and Dendrophylliidae (Cairns, 2001). During the last two decades, there have been various attempts to infer coral phylogeny based on molecular sequence data independent of skeletal morphology. To date, a wide range of markers have been used, both mitochondrial (Romano & Palumbi, 1996; 410 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data Romano & Palumbi, 1997; Romano & Cairns, 2000; Chen et al., 2002; Daly et al., 2003; Le Goff-Vitry et al., 2004; Fukami et al., 2004; Medina et al., 2006; Fukami et al., 2008) and nuclear (Chen et al., 1995; Veron et al., 2006; Berntson et al., 1999; Romano & Cairns, 2000; Chen et al., 2002; Daly et al., 2003; Fukami et al., 2004; Fukami et al., 2008; Forsman et al., 2009). However, these studies imply quite different evolutionary scenarios for scleractinians, particularly in terms of relationships between suborders and families (Romano & Palumbi, 1996; Romano & Cairns, 2000). Furthermore, solitary azooxanthellate species have rarely been included in these analyses, despite accounting for approximately a third of the extant scleractinian species (Cairns, 2007). In an attempt to address these sampling biases and resolve some of the taxonomic uncertainties, I have undertaken the most comprehensive molecular phylogenetic study of the Scleractinia to date. Molecular sequence data were obtained for a ~590 bp fragment of the mitochondrial cytochrome oxidase subunit 1 gene for 65 deep-sea azooxanthellate scleractinian species collected off New Caledonia and Australia, representing 25 genera and 9 families. With the inclusion of 11 novel sequences from shallow water corals kindly provided by Dr. Hironobu Fukami (Kyoto University) and 156 additional sequences from GenBank, the dataset covered all of the scleractinian suborders, comprising a total of 234 species from 104 genera representing 25 of the 27 extant families. Unfortunately, I was unable to include representatives of the families Guyniidae and Schizocyathidae in my analyses; these are small (comprising a total of only four monotypic genera) families of deep-sea corals for which material appropriate for molecular analyses rarely becomes available due to their minute size (sometimes less than 2 mm in calicular diameter). Database sequences for corallimorpharians (11 species), actiniarians (2 species), zoanthids (3 species), an antipatharian, and octocorals (4 species) were also included in the analyses as outgroups. The results imply that most families composed predominantly of deep-sea azooxanthellate taxa (Gardineriidae, Micrabaciidae, Flabellidae, Dendrophylliidae, Fungiacyathidae, and Turbinoliidae) are monophyletic, but the caryophylliids and anthemiphylliids, as well as most of the shallow-water zooxanthellate families, require revision. 411 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data 5.2 MATERIALS AND METHODS 5.2.1 SAMPLING LOCATIONS Between 1993 and 2007, French and Australian expeditions collected and preserved in ethanol hundreds of specimens of deep-water scleractinians (ranging in depth from 170 to 1434 m) from off New Caledonia and Australian waters (including Pacific and Indian Ocean). Based on morphological characters all these specimens were identified to the lower taxonomic level possible, and most of them had their genomic DNA extracted. 5.2.2 DNA EXTRACTION AND PCR CONDITIONS Tissue was collected from a whole mesentery using a forceps when the species was large, or an entire sector (including the skeleton) was taken when the species was small. However, intending to preserve museum vouchers, if just one specimen of a small solitary species was available, the specimen was completely submerged in the lysis buffer to have its genomic DNA extracted. Genomic DNA was extracted using DNeasy Tissue and Blood Kit (QIAGEN) following the manufacturer’s instructions. For each species the concentration of genomic DNA extracted was measured using a Nanodrop 1000 (Thermo Scientific), and when necessary, an aliquot of the genomic DNA was diluted or concentrated to achieve the final concentration of 25 ng/ul. Using the primers developed by Folmer et al. (1994) (LCO1 490 - GGTCAACAAATCATAAAGATATTGG and HCO2 198 – TAAACTTCAGGGTGA CCAAAAAATCA) a fragment of the mitochondrial cytochrome oxidase subunit 1, ranging between 700 and 710 bp according to the species, was amplified. Reactions were carried out in 50 µl, with 5 µl of 10X PCR Buffer, 5 µl of 2 mM dNTPs, 5 µl of 25 mM MgCl2, 2.5 µl of each primer (10 mM each), 0.4 µl of Taq polymerase, and 2 µl of template. PCR conditions used were: a denaturation first step of 95ºC for 1 min, followed by 35 cycles of 30 s at 95ºC, 30 s at 40ºC, and 90 s at 72ºC, followed by 10 min at 72ºC. If the amplification using this protocol failed, a new reaction using the Advantage-2 kit (Clontech) with the same template, primers and PCR conditions were performed following the manufacturer’s instructions. All cycles were performed using 412 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data Bio-Rad DNA engine (Peltier Thermal Cycler). The PCR products were then purified using Ultra Clean PCR clean up (Mo-Bio) spin columns, and then submitted to Macrogen (Korea) sequencing facility to be sequenced using ABI3730XL (Applied Byosystems). Sequences were verified and manipulated with Sequencher ver. 4.8 (Gene Codes Corporation). A Blast search was performed on GenBank for each sequence and the matching homologous Scleractinian sequences were retained for subsequent alignment. Using this protocol, 158 previously published sequences were added to the alignment (Appendix 5.1). All sequences were aligned in ClustalW (EBI) using default settings. The resultant alignment was then checked using JalView ver. 8.0 (Clamp et al., 2004), totaling 595 bp in the final alignment (Fig. 5.1). The alignment was then submitted to the test of substitution saturation (Xia et al., 2003) available in DAMBE (Xia & Xie, 2001). Using the final alignment, GTR + Gamma + Proportion Invariant (GTR+G+I) model of DNA evolution was determined by the hierarchical likelihood ratio test implemented in MrModeltest (Nylander, 2004) as the best model for the data. The phylogenetic analysis was performed using PhyML for maximum likelihood (Guindon & Gascuel, 2003) and MrBayes for Bayesian inference (Huelsenbeck & Ronquist, 2001; Ronquist & Huelsenbeck, 2003). The most likely topology was calculated based on Shimodaira and Hasegawa (Sh-like) branch support implemented in PhyML. For the Bayesian inference, four runs with 10 million generations each were calculated with topologies saved at each 1000 generations. One fourth of the 10000 topologies were discarded as burnin, and the remaining used to calculate the posterior probability. Additional Bayesian analyses were conducted using BEAST (Drummond & Rambaut, 2007) specifically to test the hypothesis that the “Robust” shallow water scleractinian families are monophyletic. The BEAST analyses were based on the same alignment as the PhyML and MrBayes phylogenetic analysis, but with and without the constraint of monophyly of the “Robust” shallow water scleractinian families. 413 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data 5.3 RESULTS The advantage of using CO1 sequence data for coral phylogeny is that, unlike the 16S rDNA, 12S rDNA, and 28S rDNA genes, the sequences are unambiguously alignable because they contain no indels. In addition to 234 scleractinian species, the present analysis also included representatives of each of the anthozoan subclasses with the exception of Ceriantharia. The list of all sequences used in the present study is available as Figure S1. The saturation test showed that there was no significant saturation (P<0.0001; Iss Figure 5.1 –Partial CO1 gene alignment from 255 anthozoans, including 234 scleractinians from 104 genera representing 25 of the 27 extant families. (for large version see: http ://www.plosone.org/article/fetchSingleRepresentation.action?uri=info: doi/10.1371/journal.pone.0011490.s002). 414 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data Forcing monophyly of the “Robust” shallow-water coral families resulted in significantly worse likelihood scores than in the absence of constraint (data not shown), implying that, large taxonomical revisions should be carried out. The results of phylogenetic analyses are summarized in figure 5.2; the four octocoral sequences were used to root the phylogenetic tree because of the sister group relationship between hexacorallians and octocorallians (Bridge et al., 1192; Chen et al., 1995; France et al., 1996; Song & Won, 1997; Berntson et al., 1999). Maximum likelihood and Bayesian analyses strongly supported monophyly of both Scleractinia and Corallimorpharia (Fig. 5.2 – B), and therefore contradict the “naked corals” hypothesis (Medina et al., 2006), which suggested that corallimorphs are descended from scleractinians via skeleton loss. In contrast to previous studies (Daly et al., 2003), Antipatharia were not basal within the Hexacorallia in the present analysis. Note, however, the relatively weak support for the position of Antipatharia in the topology. Within the Scleractinia, the most deeply diverging clade was composed of members of Gardineriidae and Micrabaciidae, two exclusively solitary and azooxanthellate coral families. The overall shape of the remainder of the scleractinian tree is that the “Robust” coral clade branches from within the “Complex” corals. However, some morphologically defined families are split between these two major groups as documented in several previous papers (Romano & Cairns, 2000; Cuif et al., 2003; Le Goff-Vitry et al., 2004; Fukami et al., 2008) - the families Astrocoeniidae, Siderastreidae, Oculinidae, Meandrinidae, Euphylliidae, and Caryophylliidae have representatives within both the “Complex” and “Robust” corals. In addition to members of these families, the “Robust” clade comprises Anthemiphyllidae*, Pocilloporidae, Stenocyathidae, Faviidae*, Fungiidae, Mussidae*, Trachyphylliidae, Merulinidae*, Rhizangiidae, and Pectiniidae*. The “Complex” coral clade consists of representatives of families Agariciidae*, Acroporidae, Poritidae*, Dendrophylliidae, Flabellidae, Turbinoliidae and Fungiacyathidae in addition to the six families that are split across the “Robust/Complex” divide. Some families and suborders appear to urgently require revision; those indicated above by asterisks are paraphyletic within the “Complex” or “Robust” clades, whereas oculinids and caryophylliids are paraphyletic within the “Robust” corals as well as in the “Complex” clade. 415 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data Nucleotide composition did not differ significantly between sequences in the “Complex” and “Robust” clades, with % (A+T) mean composition of 61.7% and 67.9%, respectively, and the “Basal” scleractinian clade likewise did not differ significantly from the “Complex” or “Robust” clade (Tab. 5.1). The average difference between sequences within each scleractinian clade was no more than 8%, and within the corallimorpharian clade was 4%, but between “Robust” and “Complex”, “Robust” and “Basal”, and “Robust” and corallimorpharian clades the corresponding values were 19.1%, 20.1%, and 19.6%, respectively. Members of the “Complex” clade displayed an average of 12.3% differences with those of the “Basal” clade, and 13.2% differences with corallimorpharian sequences. In total, 27.4% of bases were invariant across the Scleractinia, the transition: transversion ratio was 2.21, and the average difference compared to corallimorpharian sequences was 17.4% (Tab. 5.1). Table 5.1. –Nucleotide composition, proportion of invariant sites (Pinv), transition vs transversion rate (Ts/Tv), average distance between sequences (DS), and average distance between clades calculated based on GTR+I+G evolution model. Nucleotide composition Pinv DS Average distance between clades (%) Clades (%) Ts/Tv (%) (%) A T C G R C B S R 22.8 39.1 15.0 22.9 32.5 2.084 8 - - - - C 22.7 39.0 16.8 21.3 33.6 2.565 8 19.1 - - - B 22.0 35.9 18.0 23.9 69.8 2.954 8 20.1 12.3 - - S 22.7 38.7 15.7 22.7 27.4 2.210 13 - - - - Co 23.4 35.7 17.5 23.3 35.1 2.666 4 19.6 13.2 13.2 17.4 A 24.1 37.6 16.7 21.5 28.8 2.354 14 - - - - R = “Robust” scleractinian clade C = “Complex” scleractinian clade B = “Basal” scleractinian clade S = Scleractinia clade (“Robust” + “Complex” + “Basal”) Co = Corallimorpharia clade A = All alignment (including Octocorallia, Antipatharia, Zoanthidea, Actiniaria, Corallimorpharia, Scleractinia) For some genera, the molecular phylogeny is inconsistent with family placements based on classical taxonomy, implying that the positions of these should be re-evaluated. This category includes the azooxanthellate genera Conotrochus, Madrepora, Stenocyathus, Phyllangia, Cladocora, Trochocyathus, and Dactylotrochus, as well as the zooxanthellate genera Pachyseris, Galaxea, Ctenella, Alveopora, and most of the “Robust” coral representatives. 416 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data 5.4 DISCUSSION Both maximum likelihood and Bayesian analyses support the distinction of two major clades (“Complex” and “Robust” corals) within the Scleractinia (Fig. 5.2 – C and D), as was previously implied by molecular analyses based on mitochondrial 16S rDNA (Romano & Palumbi, 1996; 1997; Romano & Cairns, 2000; Le Goff-Vitry et al., 2004), 12S rDNA (Chen et al., 2002), and CO1 + Cyt B data (Fukami et al., 2008), and on (nuclear) 28S rDNA sequences (Chen et al., 1995; Veron et al., 1996; Cuif et al., 2003; Fukami et al., 2008). However, rather than the deep split between these two groups implied by analyses of ribosomal sequences, my phylogeny places the “Robust” coral clade within the “Complex” radiation, following the precedent of Fukami et al. (2008). This topology has high Sh-like (ML) and posterior probability (BI) support, and was not significantly affected by weighting the analyses for codon position. The analyses imply that the families Gardineriidae and Micrabaciidae, which are exclusively azooxanthellate and contain only solitary species, represent the most basal lineage of modern scleractinians, supporting the concept that deep-sea corals hold important clues regarding the evolutionary history of the order (chapter 8). The basal position of these families suggests that the ancestral scleractinian may also have been solitary and azooxanthellate. According to Squires (1967) and Owens (1984), ancestral micrabaciids probably inhabited shallow-water environments but may have been essentially pre-adapted for deep-sea life by having automobile coralla, and thus been able to gradually invade deep-waters, resulting in an increase of skeleton porosity. Similarly, fossils thought to represent the oldest known gardineriid (Rodinosmilia elegantula) were described from Morocco (Beauveais, 1986), suggesting that this family may also have first appeared in shallow-water environments. Under this scenario, the early Mesozoic appearance of diverse, highly integrated colonial forms may reflect the advent of symbioses with the dinoflagellate Symbiodinium, as has been suggested based on stable isotope data (Stanley & Swart, 1995). Since all early Mesozoic records of Scleractinia represent rather shallow-water ecological settings, it is not yet possible to infer whether the Scleractinia were initially abyssal and then colonized shallow waters (as hypothesized by Lindner et al. (2008) for the calcified stylasterids), or vice-versa. 417 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data 418 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data Recent molecular analyses are inconsistent with widely used sub-ordinal classification schemes of Vaughan & Wells (1943) and Wells (1956), which were based on morphology. Although morphological support for the “Robust” and “Complex” dichotomy is still lacking, it is consistently supported by molecular analyses and the three clades recovered here (“Basal”, “Complex”, and “Robust”) could represent a new sub-ordinal scheme for the classification and evolutionary history of the order. One general implication of the phylogenetic analyses reported here is that the majority of the azooxanthellate coral families (six of the eight) are monophyletic, whereas only a minority of families (four of seventeen) that are predominantly or exclusively zooxanthellate are supported strongly by the molecular data. Thus many of the morphologically defined families of shallow-water corals do not represent “natural” families. This conclusion is broadly consistent with Fukami et al. (2008), although this work was based on more limited sampling of azooxanthellate corals. Below I discuss the status of some individual families based on the overall CO1 phylogeny. 5.4.1 Flabellidae. The flabellids are a large family of exclusively azooxanthellate corals that formed a single well-supported clade in the present analyses, which were based on 27 species representing the full morphological spectrum of the family (only missing genera with root-like structures, e.g. Rhizotrochus). Interestingly, the CO1 analyses Figure 5.2. -Phylogenetic analyses based on Bayesian inference and Maximum likelihood of the partial mitochondrial CO1 gene from 234 scleractinian species, 11 corallimorpharians, 2 actiniarians, 3 zoanthids, 1 antipatharian, and 4 octocorallians. Topology was reconstructed under the GTR+I+G model of nucleotide evolution in MrBayes. Numbers on branches show Sh-like support (top) calculated using PhyML, and posterior probability (bottom) calculated using MrBayes. Hyphen (-) indicates no support from the respective method. (A) Zoanthids, actiniarians, and antipatharian clade. (B) Corallimorpharian clade. (C) “Basal” and “Complex” scleractinian clades. (D) “Robust” scleractinian clade. Colored names indicate families with azooxanthellate representatives that morphological revisions need to be carried out. Asterisks indicate azooxanthellate deep-water species (for large version see: http://www.plosone.org/ article/slideshow.action?uri=info:doi/10.1371/journal.pone.0011490&imageURI=info:d oi/10.1371/journal.pone.0011490.g001). 419 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data suggest that there may be a major dichotomy within the family, with representatives of many genera examined occurring in both of the resulting clades. The general pattern is that Truncatoflabellum species occupy basal positions in both clades, with different Javania species branching next. These results suggest that the relationship of flabellids with substrata and their mode of reproduction diversified during their evolution. To date I can infer that the most basal form of substrata relationship and reproduction within the extant flabellid genera is fixed by fragile pedicel, with transverse division as the main reproduction mode respectively (as observed in Truncatoflabellum). Subsequently, multiple, concentric layers of sclerenchyme reinforcing the pedicel and the attachment of the corallum to substrate, as observed in Javania and being a trait also shared with the anthocaulus of Placotrochides, appears in the analysis. Later, the substrate relationship became less evident, or present only in very early developmental stages, with adult specimens becoming free-living forms, such as observed within Flabellum. The evolutionary position of different root-like attachment structures present in other flabellid genera (e.g. Monomyces, Polymyces, Rhizotrochus) needs to be further investigated. The analyses imply a close relationship between the Flabellidae and two other exclusively azooxanthellate coral families – Turbinoliidae and Fungiacyathidae. Both monophyly of Flabellidae and the relationship between this family and Turbinoliidae and Fungiacyathidae are consistent with previous work of Le Goff-Vitry et al. (2004). 5.4.2 Fungiacyathidae and Turbinoliidae. The five fungiacyathid representatives sequenced formed a well-supported group notwithstanding the method used, corroborating their family status (Chevalier & Beauvais, 1987). In addition to the link with Flabellidae and Fungiacyathidae outlined above, the present analyses imply a close relationship of Turbinoliidae with two caryophylliids – Trochocyathus rhombcolumna and Deltocyathus magnificus. Additional material is necessary to better understand the relationships within the turbinoliids, as only two species representing two genera are present in the phylogeny. To collect fresh turbinoliids is particularly challenging because they are among the smallest known scleractinians. The turbinoliids Cyathotrochus pileus and Tropidocyathus lessoni grouped with D. magnificus sharing a common ancestor with T. rhombcolumna. Morphological support for this grouping is, 420 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data however, lacking. Similarity of the CO1 sequences between Deltocyathus magnificus (four specimens from different collecting stations sequenced) and turbinoliids is difficult to explain although they do share some morphological characters (e.g. lamellar paliform lobes before all but last septal cycle forming a chevron arrangement [not fusing in Tropidocyathus but fusing in Deltocyathus and Cyathotrochus], corallum invested with soft tissue, well developed costae, and a papillose columella). All other Deltocyathus representatives sequenced in the present study grouped in a basal position in the “Robust” clade, and could represent a distinctive family once the other caryophylliid species have been separated into five distinct clades. 5.4.3 Dendrophylliidae. With nearly 170 species (Cairns, 2001), Dendrophylliidae is the third most speciose family of extant scleractinians and in the analyses was the only well-supported family with substantial representation of both shallow and deep-water species. Within the family, a clade comprising the deep-sea colonial species Enallopsammia rostrata and a solitary deep-sea Balanophyllia sp. diverged most deeply, followed by the shallow-water zooxanthellate colonial genus Turbinaria. Representatives of the azooxanthellate genera Dendrophyllia (identification needs to be re-evaluated), Tubastraea, and Balanophyllia, the first two of which are colonial and the last solitary, appear as most recently diverged. The topology is consistent with an azooxanthellate dendrophylliid ancestor, and the possibility of multiple gains or losses of the colonial state within the family. Dendrophylliids are a particularly interesting group and could be highly informative with respect to the evolution of coloniality and the symbiotic state. 5.4.4 Poritidae and Acroporidae. The families Poritidae and Acroporidae are the most speciose and diverse of shallow-water scleractinians, and are exclusively colonial and zooxanthellate. In agreement with Fukami et al. (2008), my analyses imply that the poritid genus Alveopora, the only poritid genus with septa not formed by 3 to 8 nearly vertical trabeculae, should be transferred to the Acroporidae (Fig. 5.2), as the single Alveopora sequence grouped with those from Astreopora explanata and Astreopora myriophthalma within the well-supported acroporid clade. 421 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data Alveopora also grouped within the acroporids in 16S rDNA phylogenies (Le Goff-Vitry et al., 2004). If Alveopora is transferred to acroporids, Poritidae becomes monophyletic, as the remaining poritid genera (Goniopora and Porites) form a well-supported clade. The molecular phylogeny (Fig. 5.2) implies a sister group relationship between dendrophylliids and poritids, the latter of which is one of the few families of zooxanthellate corals to have strong support in the present analyses. The common ancestry of Poritidae and Dendrophylliidae implied herein is consistent with previous molecular analyses based on 28S rDNA (Veron et al., 1996), 16S rDNA (Romano & Palumbi, 1997; Romano & Cairns, 2000), and the nuclear rDNA, CO1 and Cyt B (Fukami et al., 2008). The earliest record of poritids is from the Mid-Cretaceous (Wells, 1956), and for dendrophylliids the Early Cretaceous (Filkorn & Allor, 2004). Veron (1995) suggested that the (Late Cretaceous) Actinacididae might be ancestral to the poritids. However, based on macro and microstructures of the skeleton, Cairns (2001) advocated that the actinacidids were probably not the dendrophylliid ancestor. In common with previous molecular analyses (Romano & Cairns, 2000; Chen et al., 2002; Le Goff-Vitry et al., 2004; Fukami et al., 2008), the family Acroporidae was monophyletic in the CO1 analyses. Within the Acroporidae, Anacropora appears to be more related to Montipora, and Acropora to Isopora, which was recently elevated to genus level (Wallace et al., 2007). 5.4.5 Agariciidae. The family Agariciidae occupies a special position in my analyses, as the entire “Robust” coral clade branches from within a clade that captures the agariciids (excluding Pachyseris speciosa) together with the caryophylliid genus Dactylotrochus. The Caryophylliidae is not a valid family, its members are scattered throughout the phylogenetic tree (see below). There is morphological support for transferring Dactylotrochus to the Agariciidae – for example, the shared presence of highly developed septal menianae (chapter 6). Agariciids are shallow water, colonial corals. Whilst this transfer would make Dactylotrochus the only exclusively solitary (and azooxanthellate) extant member of the family, there are precedents from the Cretaceous; the fossil agariciids Vaughanoseris and Trochoseris were solitary. The latter is recorded from the Late Cretaceous and Paleocene of Saudi Arabia and Pakistan 422 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data respectively (Baron-Szabo et al., 2006), and could represent a genus related to Dactylotrochus. In my analyses, the agariciid clade formed by representatives of Gardineroseris, Pavona, and Agaricia was strongly supported, whereas the two Leptoseris species formed a sister clade with the “Robust” corals. A number of other recent analyses (Romano & Cairns, 2000; Cuif et al., 2003; Le Goff-Vitry et al., 2004; Kerr, 2005; Fukami et al., 2008) also imply monophyly of the Agariciidae. 5.4.6 Meandrinidae, Astrocoeniidae and Anthemiphylliidae. Unlike the situation with the “Complex” corals, where morphology and molecular data are broadly consistent in support of many families, in the case of “Robust” corals, the opposite is true. With the sole exception of the Pocilloporidae, every “Robust” family was para- or polyphyletic in my analyses. In the case of meandrinids, the Atlantic genera (Meandrina, Dichocoenia, Dendrogyra, and Eusmilia) formed a strongly supported clade, but the only non-Atlantic meandrinid that I was able to include in the present analysis (Ctenella chagius) grouped with the euphylliids (see below), challenging the monophyly of this small family. Clarifying the status of Meandrinidae will require data for additional Indo-Pacific genera; Gyrosmilia and Montigyra, both transferred to the family (Veron, 2000) are of particular interest. Only two members of the family Astrocoeniidae were included in the analyses, the Atlantic species Stephanocoenia michelinii and the Indo-Pacific species Stylocoeniella guentheri; the former fell into the “Complex” clade and the latter in the “Robust” clade. The fossil record implies an early origin for the family; astrocoeniid-like corals with styliform and vertically continuous columella from the Middle Triassic (Wells, 1956) are amongst the oldest scleractinian fossils yet found. The analysis supports the idea that Stylocoeniella is related to pocilloporids (Fukami et al., 2008): S. guentheri forms a strongly supported group with Pocillopora, Stylophora, Seriatopora, and Madracis, and this clade diverges near the base of the radiation of “Robust” corals (Fig. 5.2 - D). To date, no sequence data are available for Palauastrea, which was suggested to belong to astrocoeniids (Veron, 2000), and to pocilloporids by Yabe & Sugiyama (1941). 423 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data Although Anthemiphylliidae affinities are as yet unclear, the analyses support an early divergence of Anthemiphyllia patera costata in the “Robust” coral clade. Described to accommodate the genus Anthemiphyllia, which according to Vaughan (1907: 79) “had puzzled every student since its description”, this family is composed of seven species and two subspecies, all with free and solitary growth form, and lobate to laciniate septal edges. Of the eight Anthemiphyllia morphs, only A. patera patera is exclusively Atlantic, the seven other morphs occurring mainly in Pacific waters (with exception of A. dentata, which is recorded also in Indian Ocean waters (Alcock, 1902a). If the basal position of A. patera costata (and presumably A. patera patera) holds with other genetic markers, it may represent that the common anthemiphylliid ancestor was morphologically very close to the extant A. patera morphs, and probably inhabited the Tethys Sea 65 Mya. However, it is difficult to understand why Anthemiphyllia dentata did not group with A. p. costata, considering that all anthemiphylliids share skeletal micro-structural characters (Stolarski, personal communication). 5.4.7 Caryophylliidae. The family Caryophylliidae is the least cohesive of extant coral families, as it is represented in distinct clades in both the “Complex” and “Robust” parts of the tree. The affinity of Dactylotrochus cervicornis with agariciids, and that of Deltocyathus magnificus and Trochocyathus rhombcolumna with turbinoliids and other “Complex” corals have been discussed above. In addition, most members of the genus Deltocyathus form a distinct clade of uncertain affinity. One substantial grouping within Caryophylliidae comprises all of the Caryophyllia species, Stenocyathus vermiformis, Dasmosmilia cf. lymani, and Rhizosmilia robusta; support for association of Stephanocyathus spiniger with this clade is weak. Interestingly, the genus Stenocyathus, which is one of the two genera assigned to the recently proposed family Stenocyathidae, groups with strong statistical support with Caryophyllia grayi, C. lamellifera, and C. rugosa (also see Kitahara et al., 2010a [chapter 4]). This result corroborates the hypothesis that thecal pores originated independently in different scleractinian lineages (Stolarski, 2000), once S. vermiformis is grouping within the “Robust” corals, and Guynia annulata, another species that has pores groups within the “Complex” corals in the 16S rDNA phylogeny (Romano & Palumbi, 1996; Kitahara et al., unpublished data). As advocated by Stolarski (2000), this hypothesis suggests stability of the basic microstructural architecture of the 424 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data skeleton, and places the family Stenocyathidae in the superfamily Caryophyllioidea rather than Guynioidea. The clade formed by Caryophyllia diomedeae, Caryophyllia atlantica, and Dasmosmilia cf. lymani also received strong support regardless the method used, and is consistent with the hypothesis that Dasmosmilia is a sister genus of Caryophyllia (Kitahara et al., 2010a [chapter 4]). The last representative of the genus Caryophyllia, C. ralphae, groups with Rhizosmilia robusta. C. ralphae is one of the most distinctive of Caryophyllia species (Kitahara et al., 2010a [chapter 4]), and resembles three other species (C. capensis, C. paucipalata and C. eltaninae) in terms of the placement of paliform lobes (Cairns, 1995). Morphologically, C. ralphae is distinguished by its highly exsert septa and very deep fossa, but can be confused with R. robusta, both having about the same adult corallum size, septal symmetry and exsertness, colour, and fossa depth. The presence of concentric rings of partitioned chambers in the base cross section of R. robusta is one of the few morphological characters that distinguish it from C. ralphae. However, the CO1 data demonstrate that the morphological similarity of these two species reflects a close evolutionary relationship. According to Zibrowius & Gili (1990), C. capensis is not a true Caryophyllia, and Cairns (1995) suggested that if this species belongs to a different genus, C. ralphae should be placed with it. If the genetic relationship between C. ralphae and R. robusta stands, the presence of the concentric rings of partitioned chamber in the base cross section in the genus Rhizosmilia was acquired only recently from a solid-based ancestor. The placement of Stephanocyathus spiniger in the Stenocyathus/ Caryophyllia/Dasmosmilia/Rhizosmilia clade is unexpected, since the other two representatives of this genus, S. weberianus and S. coronatus group have quite different affinities on the basis of 16S rDNA sequence analysis (Kitahara et al., unpublished data). Based on the presence of 12-18 short basal tubercles in Stephanocyathus (Odontocyathus), 6 long costal spines corresponding to each first costae cycle in S. (Acinocyathus), and no tubercles or spines in S. (Stephanocyathus), the genus Stephanocyathus is divided into the above three subgenera. S. weberianus and S. coronatus belonging to S. (Odontocyathus) and S. spiniger to S. (Acinocyathus). If the segregation of Stephanocyathus subgenus is detected with one molecular marker (not 425 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data the case presented above, which is the comparison between 16S rDNA phylogeny for Odontocyathus (Kitahara et al., unpublished data), and CO1 phylogeny for the Acinocyathus), it may indicate that the subgenus should be elevated to genus status (belonging to different families). Their macro-morphological similarity (if the genetically distance between them is confirmed) could be an evolutionary throwback, such as phenotypic characters preserved in DNA reappearing through different lineages from the same ancestor. Another caryophylliid genus that needs re-evaluation regarding hierarchical status is the exclusively azooxanthellate Phyllangia. The basal position of this genus regarding almost all “Robust” shallow water corals can represent an azooxanthellate shallow- water ancestor for them (the genus Phyllangia is reported exclusively from waters shallower than 100 m [Cairns, 2009]). 5.4.8 Siderastreidae. Another family that has representatives within both major clades is the exclusively shallow water Siderastreidae. The genus Siderastrea (represented in the analysis by three Atlantic species: S. radians; S. siderea; and S. stellata, and by the Indo-Pacific S. savignyana) forms a well-supported clade within the “Complex” corals. Nonetheless, representatives of Coscinaraea and Psammocora form a clade within the “Robust” corals sharing the same common ancestor with the massive faviid genera Leptastrea and large solitary fungiids Heliofungia, Fungia and Herpolitha. Combined CO1 and Cyt-B analysis (Fukami et al., 2008) also recovered this clade, but nuclear phylogenies from the same study did not. The position of Oulastrea crispata within the “Robust” corals and its relationship to the “Robust” siderastreids and fungiids did not receive good statistical support from ML and BI. Using 16S rDNA sequences, Romano & Palumbi (1997) and Romano & Cairns (2000) also found that Coscinaraea, Psammocora, Fungia, and Leptastrea are closely related. Partial 5.8S and ITS2 sequences, and skeletal microstructure analysis clearly suggest that Psammocora and Coscinaraea are closer to fungiids than to siderastreids, however, both genera are not monophyletic (Benzoni et al., 2007). According to the same study, the genus Pseudosiderastrea grouped with the “Siderastrea” clade. 426 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data The “siderastreids” that clustered in the “Robust” coral clade are distinct from Siderastrea on the basis of both morphology (Pandolfi, 1992) and molecular data, and probably do not belong to this family, once the type genus of this family was established as Siderastrea (Vaughan & Wells, 1943). Forsman et al. (2005) also concluded that the Atlantic species of Siderastrea form a monophyletic group, and S. glynni (the only Eastern Pacific representative of this genus) also appears to be closed related to the Atlantic species. 5.4.9 Oculinidae. As in previous studies (Romano & Cairns, 2000; Le Goff-Vitry et al., 2004), the oculinids were polyphyletic in the analyses, with Galaxea falling into the “Complex” clade, and Madrepora, Oculina, and Cyathelia occupying distinct positions within the “Robust” clade. The strongly-supported grouping of Galaxea with the meandrinid Ctenella chagius and the euphyllids Euphyllia glabrescens, E. ancora, and E. divisa seen in my analyses support Fukami’s et al. (2008) suggestion that Galaxea and Ctenella should be transferred to the Euphylliidae. Le Goff-Vitry et al. (2004) suggested that the genus Madrepora should be elevated to family status; the poorly resolved position of M. oculata in my analysis is consistent with this, although the remaining four congeners (M. arbuscula, M. carolina, M. minutiseptum, and M. porcellana) need to be examined. In the present analysis, strong support was obtained for a clade containing Oculina and members of three other families - Cladocora, Solenastrea, and Astrangia – but it is unclear whether this clade has morphological support. The significance of the grouping of Cyathelia axillaris with a shallow-water massive faviid and a solitary azooxanthellate caryophylliid is also unclear. Representatives of Bathelia, Petrophyllia, Shizoculina, Sclerhelia, and Simplastrea have not been sequenced to date, and their position within the oculinids needs to be re- evaluated. 5.4.10 Other families. One of the most heterogeneous groups formed in my analysis is composed by five different families: Mussidae (Blastomussa wellsi); Euphylliidae (Physogyra lichtensteini and Plerogyra); Caryophylliidae (in part: Trochocyathus efateensis); Oculinidae (in part: C. axillaris); and Faviidae (Plesiastrea versipora). This clade is strongly supported by all phylogenetic methods and agrees with Fukami et al. 427 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data (2008) who, excluding T. efateensis, recovered the same clade. In fact, the presence of the solitary deep-water azooxanthellate Indo-Pacific species T. efateensis within this clade (otherwise all zooxanthellate and colonial) is difficult to explain and requires further investigation. On the basis of 16S rDNA analyses (Kitahara et al., unpublished data) T. efateensis groups with two other deep-water caryophylliids (Trochocyathus cepula and Tethocyathus virgatus). Kitahara et al. (2010a [chapter 4]) briefly discussed the relationship between the latter two genera. Most of the remaining species included in my phylogenetic tree are from exclusively zooxanthellate coral families, and the CO1 data imply that these species diverged relatively recently. These results are consistent with previously analyses (Cuif et al., 2003; Fukami et al., 2004; Fukami et al., 2008; Budd & Stolarski, 2009), which found that most of these coral families are polyphyletic – most strikingly, phylogenetics often splits Pacific and Atlantic representatives of the same genus or family (see Fukami et al., 2004). One of the most highly fragmented families in my analyses is Faviidae, which is split into ten different groups (Fig. 1 – D). As reported by Fukami et al. (2008), the Indo-Pacific faviids appear to be clearly distinct from their Atlantic counterparts, and the latter should probably be transferred to an Atlantic mussid clan/clade, with the following composition: Isophyllia spp. Mycetophyllia spp., Mussismilia spp., Diploria spp., Manicina spp., Colpophyllia spp., Scolymia cubensis, Favia fragum and F. leptophyllia (see also Nunes et al., 2008). According to the results presented herein and following Fukami et al. (2008), the Trachyphylliidae does not merit recognition at the family level and should be incorporated into the Indo-Pacific “faviid-pectinid-merulinid” clan/clade. Montastraea cavernosa did not group with its congeners, but rather diverged near the base of the “Robust” clade, and few conclusions can be drawn concerning the remaining faviids in my phylogeny. 5.5 CONCLUSIONS Maximum Likelihood and Bayesian analyses of the CO1 data set indicate that most of the exclusively zooxanthellate coral families are not monophyletic, and require morphological revision. By contrast, the majority of families consisting exclusively or 428 Chapter 5 A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data predominantly of azooxanthellate corals appears to be monophyletic. An important exception is the azooxanthellate family Caryophylliidae; here, special attention should be given to the genera Deltocyathus, Trochocyathus, and the heterogeneous group formed by Stephanocyathus, Vaughanella, Conotrochus, Paraconotrochus, Gen. nov. A sensu Stolarski (1996), and Ceratotrochus. Whereas the deepest dichotomy identified in previous studies was the “Complex/Robust” split, the analyses presented herein (the present chapter and chapter 8) also identified a deeply-diverging clade consisting of members of the exclusively azooxanthellate families Gardineriidae and Micrabaciidae. On the basis of the present analyses, these are the oldest scleractinian families with extant representatives; both represent evolutionary lineages likely to have co-existed with rugose corals but, unlike the latter, survived the Permian/Triassic mass-extinction event. The deep-sea holds important clues to anthozoan evolution, and overall, the phylogenetic reconstruction shows that the most basal extant scleractinians are azooxanthellate corals from deep water, not only in the case of gardineriids / micrabaciids, but also in relation to the “Robust” coral clade, and possibly within extant agariciids. Another conclusion can be drawn within the acquisition or loss of solitary/colonial state. Even though most of the groups apparently arouse from solitary life forms, the opposite was also detected (e.g. pocilloporids and M. oculata in relation to Caryophyllia, and euphylliids to D. cervicornis). Finally, the data suggests that the order Corallimorpharia had a common ancestor with the scleractinians and are therefore inconsistent with the “naked coral” hypothesis, which implies that corallimorphs are corals that have undergone skeleton loss. 429 430 This page is intended to be blank CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis (Moseley, 1881) to the Agariciidae (Anthozoa, Scleractinia) Dactylotrochus cervicornis (= Tridacophyllia cervicornis Moseley, 1881), which occurs in Indo-Pacific waters between 73 to 852 m, was originally described as an astraeid but was later transferred to the Caryophylliidae. This species, which is assumed to be solitary, has no stolons and only one elongated fossa, and is unique amongst azooxanthellate scleractinians in often displaying extremely long septate digitiform thecal extensions. Based on molecular phylogenetic analyses (partial mitochondrial CO1 and 16S rDNA, and partial nuclear 28S rDNA), and macro- and micro- morphological characteristics, I propose the transfer of D. cervicornis from the Caryophylliidae to the Agariciidae, making it the first extant, solitary, deep-water, azooxanthellate representative of the latter family. The basal position of D. cervicornis within agariciids strengthens the case for inclusion of fossil solitary species such as Trochoseris in this family and suggests that the anscestor of this predominantly colonial and zooxanthellate scleractinian family may have been solitary and azooxanthellate. CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae 6.1 INTRODUCTION Members of the coral family Agariciidae have a wide geographic distribution, commonly reported on all major shallow-water coral reefs. The family is defined by common morphology from level of the whole colony to that of septal microstructure (Wells, 1954; 1956; Nemenzo, 1955; Veron, 2000), and comprises a total of 47 extant species falling into seven genera (Veron, 2000; Glynn et al., 2001; Licuanan & Aliño, 2009); Agaricia and Helioseris are restricted to the western Atlantic; Pavona, Coeloseris, Gardineroseris and Pachyseris occur in the Indo-Pacific; and the genus Leptoseris contains both Indo-Pacific and Caribbean species. Without exception, extant agariciids are zooxanthellate and form massive or laminar colonies and, based on morphological similarity to extant corals, the same appears to hold for most, but not all, of the 27 fossil genera assigned to this family (Wells, 1956; Chevalier, 1961; Chevalier, 1968; Budd & McNeill, 1998; Baron-Szabo, 2002; Pandey & Fürsich, 2005; Pandey et al., 2007; Baron-Szabo, 2008). By contrast, two fossil genera (Trochoseris and Vaughanoseris, from the Middle and Upper Cretaceous respectively) are atypical in being solitary and most likely being also azooxanthellate. The (admittedly limited) available molecular data imply that, with the possible exception of Pachyseris (Fukami et al., 2008; Kitahara et al., 2010b [chater 5]), Agariciidae is a valid “Complex” coral family (Romano & Palumbi 1996; Romano & Cairns, 2000; Le Goff-Vitry et al., 2004; Kerr, 2005; Fukami et al., 2008; Barbeitos et al., 2010; Kitahara et al., 2010a [chapter 4]; b [chapter 5]), which in molecular phylogenetic analyses has as its sister group a clade comprising shallow-water acroporids and the poritid Alveopora sp. In contrast with most other scleractinian families whose members are predominantly azooxanthellate, Caryophylliidae appears not to be valid, members of this family being scattered across both “Complex” and “Robust” coral clades in molecular analyses (Kitahara et al., 2010b [chapter 5]). One implication of the broad survey carried out by Kitahara et al. (2010b [chapter 5]) is a close relationship between Dactylotrochus cervicornis, a solitary, deep-water coral until now classified as Caryophylliidae, and the family Agariciidae. This unexpected grouping is of particular interest as it suggests a link between the extant colonial shallow-water and solitary azooxanthellate agariciids in the fossil record. However, at 432 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae this time, the support for such a grouping was based on a single molecular marker, part of the mitochondrial CO1 gene. D. cervicornis occurs in Indo-Pacific waters between 73 to 852 m, and was originally described as astraeid (Tridacophyllia Moseley, 1881) but later transferred to the Caryophylliidae (see chapter 2). This monotypic genus is characterized morphologically by having a solitary, trochoid and attached corallum, with calicular edge flaring outward as four to eight thecal extensions, some of which bifurcate. Its wall is septothecate, with costae that are detectable only near the calicular edge, fainting towards the pedicel. The septal faces bear well-developed menianes, but pali and columella are absent. The transfer of Dactylotrochus to the caryophylliids and its position with this family (Wells, 1954: 470) were based on “the constancy of development of thecal extensions and the lack of prominent septal dentitions as in pectiniids”, and especially on the similarity of young stages to the “typical” caryophylliid genus Desmophyllum. In this chapter, the relationship between the caryophylliid Dactylotrochus and Agariciidae was confirmed using a range of other molecular markers and, in the light of strong molecular support for this relationship, supporting morphological criteria were sought and also identified. This approach illustrates the reciprocally informative and complementary nature of molecular and morphological approaches to coral systematics. Furthermore, the transfer of D. cervicornis to the Agariciidae makes it the first extant, azooxanthellate, deep-water genus/species in this family. The basal position of D. cervicornis in relation to all other extant Agariciidae included in the analysis, when considered together with the fossil agariciids from the Middle Cretaceous which were also solitary, support the idea that the ancestor of this predominantly colonial and zooxanthellate coral family was solitary and azooxanthellate. 6.2 MATERIALS AND METHODS 6.2.1 DNA PREPARATION, AMPLIFICATION AND SEQUENCE ANALYSES Shallow-water agariciids were collected by SCUBA diving from various sites at Princess Charlotte Bay – Australia, and identified by Dr John E. N. Veron. Deep-water solitary scleractinian D. cervicornis (144 specimens) were collected by French 433 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae expeditions around New Caledonian waters between depths of 215 and 852 m. A small thecal extension fragment of D. cervicornis was removed from the specimen collected at station Norfolk 2 DW 2135 and from it genomic DNA was extracted using DNeasy Tissue and Blood Kit (QIAGEN) following the manufacturer’s instructions. Polymerase Chain Reaction (PCR) amplification of mitochondrial (16S rDNA and CO1) and nuclear (28S rDNA) markers were carried out following Kitahara et al. (2010a [chapter 4]; b [chapter 5]) and Stolarski et al. (submitted [chapter 8]). Amplicons were purified using Mo-Bio Ultra Clean (PCR Clean Up) spin columns and submitted to direct sequencing at Macrogen (South Korea). For each marker analyzed herein, sequences from selected agariciids were aligned with at least one representative of each scleractinian family; in many cases, reference sequences were available in GenBank, but in others sequences were obtained in the present study. The alignments consisted of totals of 22 families for 16S rDNA, 21 for CO1, and 15 for 28S rDNA (Tab. 1). Sequences were initially aligned using ClustalW ver. 2 (Larkin et al., 2007) and manually edited using JalView version 8.0 (Clamp et al., 2004). Each alignment was tested to find the most appropriate models of nucleotide substitution by the hierarchical likelihood ratio test implemented in MrModeltest (Nylander, 2004). Phylogenetic analyses were performed using PhyML (Guindon & Gascuel, 2003) for maximum likelihood (ML) and MrBayes version 3.1.2 (Huelsenbeck & Ronquist, 2001) for Bayesian Inference (BI). The ML analyses were performed under the GTR model with a non-parametric Shimodaira-Hasegawa-like procedure and with 100 bootstrap replicates. For the BI, two runs each of 10 million generations were calculated for each marker with topologies saved at each 1000 generations. Average standard deviation of split frequencies between runs of each marker converged to or less than 0.01. The first 2500 saved topologies were discarded as burnin, and the remaining used to calculate the posterior probability. Table 6.1 – Family and GenBank accession numbers of each scleractinian representative included in the phylogenetic reconstruction. An asterisk denotes sequences sourced from GenBank. Two asterisks indicate previously family of D. cervicornis. Hash symbol indicate that the species position in its family is not resolved (see Fukami et al. 2008). Taxonomy Markers Family Genus Species CO1 16S rDNA 28S rDNA Acroporidae Acropora A. hemprichii - AF550359 - A. palmata AB441246 - - Isopora I. palifera AB441248 - - Agariciidae Agaricia A. agaricites AY451366 - - A. fragilis AY451368 - - A. humilis AB441219 - - 434 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae Table 6.1 – Continued. A. lamarcki AY451369 - - A. tenuifolia AY451372 - - A. undata - - EU262789 Gardineroseris G. planulata AB441218 - - Helioseris H. cucullata AB441220 - - Leptoseris L. incrustans - L76012 - L. sp. AY451373 - EU262806 Pachyseris P. speciosa # AB441222 - - Pavona P. cactus AB441216 - - P. varians - L76016 EU262847 Anthemiphylliidae Anthemiphyllia A. p. costata HM018604 - HQ439609 A. spinifera - HQ439685 - Astrocoeniidae Stephanocoenia S. michelinii AB441228 AF265581 - Caryophylliidae ** Caryophyllia C. lamellifera HM018616 - - C. inornata - AF265599 - C. smithii - - AF549216 Dactylotrochus D. cervicornis HM018624 HQ439697 HQ439630 Thalamophyllia T. gasti - AF265590 - Dendrophylliidae Astroides A. calycularis - - AF549248 Dendrophyllia D. alternata - AF550366 - D. sp. AB441239 - - Tubastraea T. micranthus - - AF549219 Turbinaria T. peltata AB441240 - - Euphylliidae Euphyllia E. ancora AB441204 AF265598 - Faviidae Cyphastrea C. ocellina - L76132 - Echinopora E. lamellosa # - L76003 - Favia F. fragum # AY451351 FFU40295 - F. stelligera # - - AF549223 Flabellidae Flabellum F. angulare - AF550363 - F. tuthilli HM018643 - HQ439664 Fungiacyathidae Fungiacyathus F. marenzelleri - EF589061 - F. turbinolioides HM018648 - HQ439679 Fungiidae Fungia F. fragilis - L75998 - Lobactis L. scutaria AB441224 - - Guyniidae Guynia G. annulata - AF265580 - Meandrinidae Dichocoenia D. stokesi AB117298 AF265607 - Meandrina M. brasiliensis AB11797 - - M. pectinata - - AF549234 Merulinidae Merulina M. scabricula # AB117284 L76014 - Mussidae Cynarina C. lacrymalis # AB117246 - - C. sp. # - AF265613 - Mussa M. angulosa # - - EU262869 Mussismilia M. braziliensis # AB117231 - - Oculinidae Galaxea G. fascicularis # AB441201 L76006 - Madrepora M. oculata # - HQ439760 HQ439680 Pectiniidae Echinophyllia E. aspera # - - AF549241 Pectinia P. alcicornis AB117385 L76017 - Pocilloporidae Pocillopora P. damicornis - L76019 - P. verrucosa AB441230 - AF549252 Poritidae Porites P. compressa - L76020 - P. porites DQ643837 - EU262878 Rhizangiidae Astrangia A. sp. NC008161 NC008161 - Siderastreidae Psammocora P. stellata # - L76021 - Siderastrea S. radians - - EU262861 S. stellata AB441213 - - Turbinoliidae Tropidocyathus T. labidus - AF265585 - T. lessoni HM018669 - HQ439683 6.2.2 Skeleton preparation and analysis Specimens illustrated in this chapter were subjected to various destructive analyses and the resulting thin sections and skeletal fragments attached to microscope stubs are housed at the Institute of Paleobiology, Polish Academy of Sciences, Warsaw (ZPAL), or at the School of Pharmacy and Molecular Sciences, James Cook University, 435 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae Townsville (JCU). Skeletons of agariciids and Dactylotrochus were selected and tissue was extracted from ethanol preserved specimens by removing the soft tissue by overnight immersion in 3% sodium hypochlorite (NaOCl) solution. Small pieces of dried skeleton were removed from the respective colony. Skeletons were rinsed in Milli-Q water and washed in an ultrasonic cleaner for 2 min. All specimens were studied with transmitted light microscope (TLM) and scanning electron microscope (SEM). Thin (ca. 30 µm thick) sections of various skeletal elements were observed and photographed with a Nikon Eclipse 80i TLM. Skeletal microarchitectural and microstructural features were visualized with Philips XL 20 or Jeol JSM5410LV SEM microscopes. Specimens were observed intact (septal surfaces), as broken but not etched skeletal samples, or as broken/polished and etched samples. Transverse or longitudinal polished or broken sections of septa were exposed for ca. 20 seconds etching in 0.1% formic acid solution, following Stolarski (2003). The etched samples were rinsed with distilled water and air-dried. Once dried, samples were mounted on stubs and sputter coated with gold or conductive platinum film. 6.3 RESULTS 6.3.1 MOLECULAR For each gene analyzed, the D. cervicornis sequence was aligned with sequences from representatives of most scleractinian families sourced from previously published studies (Tab. 6.1). Because in most cases the sequences for each marker were from different species/specimens, each gene was analysed separately rather than as a single concatenated sequence so as to avoid the assembly of “chimeras”. The final alignment of each gene resulted in three data matrixes of 514 positions for 16S rDNA, 595 positions for CO1, and 693 positions for the 28S rDNA, of which 218, 214, and 238 were variable, and 136, 121 and 182 were parsimony informative respectively. The average nucleotide composition values were 31% (T), 13.6% (C), 31.9% (A) and 23.5% (G) for 16S, 37.6% (T), 17.7% (C), 21.7% (A) and 22.9% (G) for CO1, and 22% (T), 26.6% (C), 17.5% (A) and 33.8% (G) for 28S. The base composition of these three genes was remarkably constant among agariciids and D. cervicornis, diverging less than 1% for each base. Alignment of the CO1 sequences did not require any substantial 436 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae insertion/deletions, however, as in previously studies (Romano & Palumbi, 1997; Romano & Cairns, 2000; Le Goff-Vitry et al., 2004; Kitahara et al., 2010a [chapter 4]) the alignment of 16S rDNA required an indel of nearly 120bp within representatives of the “Robust clade”. Interestingly, whilst the size of the 28S rDNA fragment generated was constant across all scleractinians analyzed, two small indels consisting of 4 (MGCT) and 2 (AA) base insertions in the first and second domain respectively were present in all of the sequences from agariciids and D. cervicornis. For each marker near identical topologies resulted from the application of both ML (using Shimodaira-Hasegawa test and bootstrap) and BI methods of phylogenetic analysis, and the trees did not differ significantly between markers (Fig. 6.1). Irrespective of the phylogenetic method applied, the “Complex” and the “Robust” coral clades were always recovered. As in the previous preliminary study (Kitahara et al., 2010b [chapter 5]), the “Complex” clade was formed by representatives of the following families: Acroporidae; Agariciidae (including D. cervicornis); Astrocoeniidae; Caryophylliidae* (Thalamophyllia gasti); Dendrophylliidae; Euphyllidae (Euphyllia ancora); Flabellidae; Fungiacyathidae; Guyniidae; Oculinidae* (Galaxea fascicularis); Poritidae; Siderastreidae*; and Turbinoliidae. The “Robust” clade comprised all other scleractinian families examined and representatives of those families above marked with an asterisk (*). In addition, there was strong statistical support in ML and BI analyses of both 16S rDNA and 28S rDNA sequences (and in BI analyses of CO1 sequences) for D. cervicornis clustering with all of the agariciids. However, the ML analysis of CO1 data differed slightly in the placement of two Leptoseris representatives. Given that all of the other analyses performed grouped Leptoseris within the clade composed of other agariciids and D. cervicornis, I believe the CO1 ML topology to be incorrect with respect to this fine detail. 6.3.2 MORPHOLOGICAL Macromorphology. – Dactylotrochus cervicornis is an intriguing deep-water scleractinian that has numerous unique morphological characters. All specimens examined to date are firmly attached to the substrate, and the vast majority (>150) have only one fossa (Fig. 6.2 – A, Fig. 6.3 – A). However, four “aberrant” specimens 437 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae collected from New Caledonian waters (Norfolk 2 station DW 2023) suggest a propensity of this genus for coloniality, as two or three interconnected fossae (and presumably mouths) are readily distinguished in each one of them. The corallum is attached by a robust pedicel (up to 15 mm in diameter) that expands into a thin, polycyclic, encrusting base (Fig. 6.2 – A, Fig. 6.3 – I). Sometimes larger specimens display a base almost twice as larger as the pedicel, indicating that this species has the ability to colonize regions that have strong currents. Lower corallum has thin transversal ridges encircling the base. Costae flat, usually detectable only near calicular edge, becoming faint towards pedicel. Each costa bears 2 or 3 small rounded granules. Shallow and narrow intercostal striae separate each adjacent costa. Figure 6.1 –Unrooted most likely trees derived from maximum likelihood analysis of partial 16S rDNA, partial CO1, and partial 28S rDNA nucleotide sequences. Values near each node indicate the ML Sh-like statistical support followed by bootstrap (100 replicate) analyses, and BI posterior probability (7500 topologies). An asterisk (*) in the CO1 reconstruction indicates discrepancy between the ML and BI (different branching from BI is indicated in red). Dark shaded area indicates Agariciidae clade and light shaded areas indicate the “Robust” coral clades. Above the pedicel, the theca and corresponding internal septa divide into several, elongate, tapered and sometimes bifurcating thecal extensions (Fig. 6.2 – A, B). Largest 438 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae thecal extensions originate on the plane of the lesser calicular diameter and often attain up to 20 mm in basal width. Slightly beyond their base, main thecal extensions bifurcate into two or more smaller extensions. Several other extensions (usually nonbifurcating) are oriented outward from calicular edge (see Cairns [1999]). Largest specimen examined (DW 2023) 27.7 x 19.1 mm in calicular diameter, 37.6 mm in height, and 15.1 x 14.2 mm in pedicel diameter. Septal symmetry difficult to determine. Larger coralla have up to 470 closely spaced septa, usually progressively narrowing in higher septal cycles and originating closer to calicular edge. Septal faces bear well-developed menianae oriented parallel to slightly oblique in relation to upper septal edge (Fig. 6.2 – C, D, E). Menianae edge always beaded (Fig. 6.3 – B, D). Fossa deep and narrow, columella always absent. All specimens examined have a white corallum. Figure 6.2 –Macro- and micromorphology of Dactylotrochus cervicornis (Moseley, 1881); ZPAL H.25/7-R-SCL251a, Loyalty Islands, 167º55,98'E/21º08,50'S, 380 m [MUSORSTOM 6, station DW 480]. (A) Lateral view of corallum. (B) Bifurcating calicular extension. (C) Distal view of septa showing well-developed menianae (arrows). (D) Broken calicular extension with continuous menianae visible on septal surfaces and their transverse sections (E, enlarged). 439 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae Figure 6.3 –Early ontogeny and microstructural features of Dactylotrochus cervicornis (Moseley, 1881); ZPAL H.25/7-R-SCL251a (B-E, G, H), and ZPAL H.25/7-R- SCL251b (A, F), Loyalty Islands, 167º55,98'E/ 21º08,50'S, 380 m [MUSORSTOM 6, DW 480]. (A) Juvenile specimen with scale-like (F, red arrows) organization of tectura. Scale-like deposits of tectura are visible in sections of the corallum base (H, red arrows) and they contrast with fibrous organization of thickening deposits of septa (C, D and E, blue arrows). (G) Distinct border between scale-like (red arrow) and fibrous deposits (blue arrow) indicates change from intracalicular to extracalicular (tectura) deposits. (B) Menianae are formed by fibers of septal thickening deposits that on the growing edge of menianae may form bead-like structures (D, enlarged). (I and J) Polycyclic corallum base (I, successive thecal rings marked with arrows) with initial (protothecal) wall formed as marginotheca (J, enlarged). 440 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae Micromorphology and microstructure. –The following micromorphological and microstructural characters are herein described and provide clues about the phylogenetic relationships of Dactylotrochus: (i) features of the corallum base (septa-wall relationship); (ii) skeleton microtexture and corresponding microstructure of thickening deposits (TD); and (iii) arrangement of septal rapid accretion deposits (RAD). Polished bases of coralla show polycyclic development. Initial theca (prototheca) is encircled with concentric thecal rings (Fig. 6.3 – I, J). Protothecal RAD form a zone (ca. 10-20µm thick in transverse sections) of closely spaced centers (Fig. 6.3 – J), which during ontogenetic development become continuous between corallum wall and septa, a pattern described as typical of marginotheca (Fig. 6.3 – J; see also Stolarski [1995]). The outer surface of juvenile coralla is covered with very small scale-like deposits (Fig. 6.3 – F). In contrast, the inner surface (including septa and inner sides of the wall) is usually smooth. In corallum transverse sections, scale-like organization of thickening deposits of the outer part of coralla is distinguishable from fibrous organization of thickening deposits of septa and inner part of the wall (Fig. 6.3 – E, G, H). In septal longitudinal sections, centers of RAD form continuous zone (Fig. 6.4 – F) but some additional centers occur at the menianae bases (Fig. 6.4 – C, E, F). In all examined sections, menianae shown only fibrous microstructure (Fig. 6.4 – C, E) that explains their transparency as viewed in stereoscopic microscope (all skeletal parts that contain RAD are semi-transparent). 6.4 DISCUSSION Recognizing evolutionary lineages (i.e. monophyletic groups) in a classification changes the emphasis from associating a taxon name with a set of characteristics to associating a name with a lineage (deQueiroz & Gauthier, 1992), which should mirror the species genealogy (Hennig, 1966; Mayr, 1969). Here, the adopted view is that classification should be based on phylogeny, with species grouped on the basis of their evolutionary relationships. This approach requires that only monophyletic groups be recognized as taxonomic entities. 441 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae Figure 6.4 –Microstructural organization of the skeleton of Dactylotrochus cervicornis (A, C, E, F) compared with selected representatives of Recent agariciids: Leptoseris (L. explanata) (B), Pavona (P. cactus) (D), and Gardinoseris (G. planulata) (G). In D. cervicornis and in all other agariciids, zone of Rapid Accretion Deposits (RAD) is situated in the middle part of septum (A, B, D, G) and consists of superimposed (sometimes slightly irregularly, C) centers of rapid accretion (yellow arrows in C, E, F). Septal faces in all agariciids and D. cervicornis bear regularly distributed, parallel lines of granules (Pavona, Gardineroseris) or/and menianae (Dactylotrochus, Leptoseris); white arrows in A, B, D, G (see also Figure 5). In Dactylotrochus menianae are exceptionally well developed (among Recent corals) and translucent in optical microscope. This optical feature is explained by microstructural organization: menianae are formed by fibers of thickening deposits (red arrows in E, F) and RAD (not transparent) usually occurs only at the base of bundles of fibers. 442 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae The systematic classification of scleractinian corals based on morphological characters represents a challenge in several ways. The paucity of morphological characters in addition to homology and homoplasy restricts the usefulness of morphological phylogenetics (Cairns, 2001; Budd et al., 2010). Such constrains pose major limitations to the development of a consistent phylogenetic classification system for the order. Despite this, to date, morphological characters have traditionally been the basis of classification schemes (Wells, 1956; Chevalier & Beauvais, 1987; Veron, 1995), and are still broadly used. More recently, however, molecular-based phylogenetic analyses have revolutionized our understanding of scleractinian evolution, resulting in substantially different evolutionary hypotheses when compared to the morphological schemes. Molecular phylogenetic principles have the potential to guide scleractinian taxonomy to classification schemes that better reflect the evolutionary history of the order. The investigation of clades identified in molecular analyses (e.g. Budd & Smith, 2005; Benzoni et al., 2007; Stefani et al., 2008; Budd & Stolarski, 2010) has led to the identification of key morphological characters that were previously overlooked. These studies point to the potential of integration of both approaches (i.e. molecular and morphological). This procedure has been called “reciprocal illumination” (Hennig, 1957), and the hope is that it will lead to robust hypotheses on the morphological / genetic evolution at all taxonomic ranks and shed light on the intraspecific phenotypic plasticity displayed by many representatives of the order. Inconsistencies between scleractinian morphological and molecular classifications have been most pronounced among families that are composed mainly of zooxanthellate representatives (Fukami et al., 2008). However, the Caryophylliidae, which is the second largest scleractinian family and is composed predominantly by azooxanthellate, deep-water species, appears to be a completely artificial grouping (Kitahara et al., 2010a [chapter 4]; 2010b [chapter 5]; Stolarski et al., submitted [chapter 8]). Representatives of this family are scattered in at least eight different clades across both “Complex” and “Robust” coral groups. In applying morphological and molecular phylogenetic approaches to confirm the taxonomic position of the genus Dactylotrochus in the family Agariciidae, this chapter represents a step towards resolving the taxonomic chaos surrounding the Caryophylliidae. 443 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae Of the seven extant genera assigned to Agariciidae on the basis of morphology, all (Agaricia, Gardineroseris, Helioseris, Leptoseris, Pachyseris and Pavona) but Coeloseris were included in at least one of the three phylogenetic reconstructions presented herein. As implied by previous studies (Fukami et al., 2008; Kitahara et al., 2010b [chapter 5]) the CO1 analyses suggest that Pachyseris speciosa (the only representative of this genus examined) is more closely related to “euphylliids” (Galaxea fascicularis and Euphyllia ancora) than to agariciids. In accordance to Dai & Horng (2009), Pachyseris should remain in the Agariciidae until additional morphological data are available to elucidate its grouping. Interestingly, the phylogeny based on 16S rDNA suggests that the azooxanthellate caryophylliid genus Thalamophyllia is also close related to agariciids, a trait previously found by Romano & Cairns (2000), and more recently by Barbeitos et al. (2010), the later using the first two domains of the 28S rDNA gene concatenated with partial 12S rDNA. Nonetheless, morphological support for Thalamophyllia in this position is still lacking as well. With the qualifications above, Dactylotrochus and all of the agariciid genera examined formed a well-supported clade irrespective of the genetic marker and method of analysis used (Fig. 6.1). In addition, Dactylotrochus shares a number of unique sequence indels with the agariciids and has similar base composition at the loci examined, supporting the transfer of this monotypic genus to agariciidae (Fig. 6.1). The basal position of Dactylotrochus in relation to other agariciids implied in the present study is of particular interest as it suggests a link between the extant colonial and fossil solitary agariciids, and suggests that predominantly colonial and zooxanthellate coral family had a solitary and azooxanthellate ancestor. Although the structural information has not been subjected to formal cladistic analysis, morphological characters provide additional support for grouping D. cervicornis with the Agariciidae. Although classified as a caryophylliid based on the constancy of thecal extension development, the lack of prominent septal dentitions (as in pectiniids), and similarity of young stages to those of the “typical” caryophylliid Desmophyllum (Wells, 1954), Dactylotrochus is unique among azooxanthellate corals in having long thecal extensions (see Cairns, 1999), a feature treated by many authors as “branches” (Moseley, 1881; Gardiner, 1899). The most striking feature linking D. cervicornis to living agariciids are the long menianae, which among modern scleractinians are only otherwise developed in some species of Leptoseris. In Leptoseris and Dactylotrochus, the initial development of menianae 444 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae involves fusion of a horizontal series of granulations (Fig. 6.3 – D). Such horizontal series of granulations are typically developed in various agariciids (Cuif et al., 2003), and in longitudinal sections of septa they are hardly distinguishable from menianae (Figs. 6.4, 6.5, 6.6). Furthermore, the scale-like organization of tectura and beaded septal margins are characters that D. cervicornis shares with many agariciid taxa (Fig. 6.6). One point of interest is that Coeloseris - the only extant agariciid genus for which molecular data are not yet available - lacks the three morphological characters mentioned above. Coeloseris differs from all other agariciids, as a result of septal face granules arranged perpendicular (not parallel) to septal edge (alternating in position within each septal face), its septal margin is sinuous and more lacerate. In addition, its tectura appears to be much more smooth than in other agariciids (Fig. 6.6) and the thin tabular dissepiments between septa (Fig. 6.6 – D4, D5) are a unique feature among extant agariciids. Figure 6.5 –Agariciid micromorphology. Leptoseris explanata (A) and Agaricia sp. early ontogeny (B). Menianae on growing edges may form bead-like structures (A2, white arrows) whereas the surface of the wall and septa shows scale-like texture (A2, A3). Juvenile Agaricia sp. (lateral [B1] and distal [B2] views) shows polycyclic corallum base (B3, B4). Successive thecal rings marked with dashed lines (B4). Initial (protothecal) wall formed as marginotheca (B5, arrows indicate junction of wall and septal zones of rapid accretion deposits). 445 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae Superficial morphological similarities between the early ontogenetic stages of Dactylotrochus and Desmophyllum have been regarded as support for Dactylotrochus within the Caryophylliidae. Although juvenile stages of Dactylotrochus (prior to the development of thecal extensions) show some similarity to juvenile Desmophyllum (i.e. lack of pali and columella), they also share many features with the initial/juvenile coralla of a broad range of corals. Characters such as the occurrence of marginothecal wall at initial stages, polycyclic bases and narrow zone with centers of rapid accretion are common in various scleractinian taxa (e.g. dendrophylliids, astrangiids, various traditional caryophylliids, agariciids; see Fig. 5B, [Durham, 1949]). Whereas these other features are common to juvenile coralla of many corals, in its early stages the Dactylotrochus corallum displays a number of distinct characters that are shared with traditional agariciids and some allied corals. Bead-like structures on the growing edges of menianae most likely reflect their “modular” foundations. Another striking, non-caryophylliine feature of Dactylotrochus are the scale-like deposits developed on the outer wall surface (Fig. 6.3 – F, G, H). Similar tiny scale-like structures do occur, however, in agariciids (Fig. 6.5 – A, Fig. 6.6) and are also common in taxa that are allied with agariciids in molecular analyses (e.g. acroporiids [Northdurf & Webb, 2006], some traditional oculinids [Galaxea; see Stolarski, 2003]). Taken together, a range of molecular, micromorphological and microstructural features support the affinity of Dactylotrochus with the agariciids. The transfer of D. cervicornis to the Agariciidae clarifies some of the uncertainly surrounding the family Caryophylliidae. As our ability to delineate monophyletic groups improves, and as additional morphological and/or genetic data become available, the composition of a group may change, but the name and its underlying evolutionary significance will probably remain stable. Accordingly, I propose the transfer of the genus Dactylotrochus and the species Dactylotrochus cervicornis to the family Agariciidae. 446 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae Figure 6.6 –Macro- and micromorphology of selected representatives of Recent agariciids. (A) Leptoseris gardineri, (B) Pavona decusata, (C) Gardineroseris planulata, (D) Coeloseris mayeri, (E) Agaricia undata, and (F) Helioseris cucullata. Different magnification views showing: large-scale organization of corallites or septal organization (subscripted with “1”); calicular view detail (subscripted with “2”); septal menianae or aligned rows of granules (subscripted with “3” – note the potential absence of the later in C. mayeri [indicated by ?]); and transverse or longitudinal view of septal menianae or granules (subscripted with “4”). Arrows indicate beaded septal edges (yellow arrows); menianae or aligned septal granules (white arrows); and microtexture of septal face (orange arrows). 447 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae Taxonomic Summary Family Agariciidae Gray, 1847 emended Solitary (ahermatypic and azooxanthellate) or colonial (hermatypic and zooxanthellate), attached. Colony shape branching, massive, columnar, encrusting or foliose, all formed mainly by intratentacular or circumoral budding. Wall septothecate or synapticulothecate, the later usually becoming solid or absent. Septa rarely porous, formed by a continuous middle rapid accretion zone flanked by perpendicular to slightly oblique bundles of fibers (thickening deposits). Septal margins usually beaded. Septa from colonial representatives directly confluent between centers, united by compound synapticulae. Septal faces have scale-like microtexture and bear rows of granules or menianes, both composed of RAD. Endothecal dissepiments mostly absent. Columella trabecular or absent. Extant genera belonging to the family Agariciidae Agaricia Lamarck, 1801 Type species: Madrepora undata Ellis & Solander, 1786 Species included: A. agaricites (Linnaeus, 1758); A. fragilis Dana, 1846; A. grahamae Wells, 1973; A. humilis Verrill, 1901; A. lamarcki Milne Edwards & Haime, 1851; A. tenuifolia Dana, 1846; A. undata (Ellis & Solander, 1786). (?) Coeloseris Vaughan, 1918 Type species: Coeloseris mayeri Vaughan, 1918 Species included: Coeloseris mayeri Vaughan, 1918. Dactylotrochus Wells, 1954 Type species: Tridacophyllia cervicornis Moseley, 1881 Species included: Dactylotrochus cervicornis (Moseley, 1881). Gardineroseris Scheer & Pillai, 1974 Type species: Gardineroseris ponderosa (Gardiner, 1905) Species included: Gardineroseris planulata (Dana, 1846). 448 CHAPTER 6 Reciprocal illumination between molecular phylogeny and morphological characters supports the transfer of Dactylotrochus cervicornis to the Agariciidae Helioseris Milne Edwards & Haime, 1849 Type species: Madrepora cucullata Ellis & Solander, 1786 Species included: H. cucullata (Ellis & Solander, 1786) Leptoseris Milne Edwards & Haime, 1849 Type species: Leptoseris fragilis Milne Edwards & Haime, 1849 Species included: L. amitoriensis Veron, 1990; L. cailleti (Duchassaing & Michelotti, 1864); L. explanata Yabe & Sugiyama, 1941; L. foliosa Dinesen, 1980; L. gardineri Van der Horst, 1921; L. hawaiiensis Vaughan, 1907; L. incrustans (Quelch, 1886); L. mycetoseroides Wells, 1954; L. papyracea (Dana, 1846); L. scabra Vaughan, 1907; L. solida (Quelch, 1886); L. striata Fenner & Veron, 2002; L. tenuis Van der Horst, 1921; L. tubulifera Vaughan, 1907; L. yabei (Pillai & Scheer, 1976). Pavona Lamarck, 1801 Type species: Madrepora cristata Ellis & Solander, 1786 Species included: P. bipartita Nemenzo, 1980; P. cactus (Forskål, 1775); P. chiriquiensis Glyn, Mate & Stemann, 2001; P. clavus (Dana, 1846); P. danai (Milne Edwards & Haime, 1860); P. decussata (Dana, 1846); P. diffluens Lamarck, 1816; P. divaricata Lamarck, 1816; P. duerdeni Vaughan, 1907; P. explanulata (Lamarck, 1816); P. frondifera Lamarck, 1816; P. gigantea Verrill, 1869; P. lata Dana, 1846; P. maldivensis (Gardiner, 1905); P. minuta Wells, 1954; P. varians Verrill, 1864; P. venosa (Ehrenberg, 1834); P. xarifae Scheer & Pillai, 1974. (?) Pachyseris Milne Edwards & Haime, 1849 Type species: Agaricia rugosa Lamarck, 1801 Species included: P. foliosa Veron, 1990; P. gemmae Nemenzo, 1955; P. rugosa (Lamarck, 1801); P. speciosa (Dana, 1846). 449 450 This page is intended to be blank CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank (Deltocyathiidae fam. nov.) (Cnidaria, Anthozoa, Scleractinia) Based on classical morphological taxonomy of nearly 1400 extant species, 27 Recent families are recognized within the order Scleractinia. However, over the last decade, molecular phylogenetic analyses have challenged the validity of most exclusively zooxanthellate families. Phenotypic plasticity, morphological convergence, hybridization, and especially the low number of characters pose major challenges in understanding the evolutionary history of the order when traditional diagnostic characters are used. On the other hand, recent molecular phylogenetic studies have demonstrated that most families primarily composed of azooxanthellate representatives are monophyletic, hence in this case classical taxonomic characters are more reliable. An exception to this general pattern, however, is the second largest scleractinian family, the Caryophylliidae, which molecular data (two mitochondrial markers) imply is invalid. The caryophylliid taxa surveyed to date scatter across at least 8 and 7 different clusters (based on cytochrome oxidase subunit 1 and 16S rDNA respectively) throughout the “Complex” and “Robust” coral clades in molecular phylogenies. As part of the process of resolving the true affinities of caryophylliids, on the basis of combined molecular (partial CO1 and 28S rDNA) and fine-scale morphological data, here I propose a new “Robust” scleractinian family (Deltocyathiidae fam. nov.) to accommodate the genus Deltocyathus. Whereas this family captures the full morphological diversity of the genus, one species, D. magnificus, is an outlier in terms of molecular data, and groups with the “Complex” coral family Turbinoliidae. This latter affinity is not supported by microstructural analysis, hence D. magnificus may be the first case of morphological convergence at the microstructural level among scleractinian corals. CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank 7.1 INTRODUCTION The most successful of all scleractinian families in adaptation to extremes of environment (Wells, 1956: 367 [Caryophylliina]) the Caryophylliidae is reported from Early Jurassic (Wells, 1956) to Recent times. Prolific in generic differentiation with 43 azooxanthellate genera and over 300 extant species (Cairns, 2009), representatives of this family are ubiquitous in all oceans, being reported from Antarctic (Cairns, 1982) to Arctic (Roberts et al. 2003) and ranging in depth from intertidal zones (e.g. Paracyathus darwinensis) to waters deeper than 5000 m (e.g. Deltocyathus parvulus). Although the vast majority of extant species of this family are azooxanthellate and inhabit waters deeper than 200 m, some rely on the symbiosis with dinoflagellates, and at least three species occur as both forms (Cairns et al., 1999). This family captures a wide spectrum of morphological diversity, accommodating small solitary forms less than 5 mm in calicular diameter (e.g. Caryophyllia aspera) to colonial species that can attain heights of several meters (e.g. Lophelia pertusa). The latter, together with Solenosmilia (another caryophylliid genus), fulfil critical ecological functions in deep-sea environments and are among the most important deep-water reef- builders on the planet (Rogers, 1999; Koslow et al., 2001; Costello et al., 2005; Roberts et al., 2009). Despite the ecological significance of some of the colonial species, the solitary forms are the most diverse “group” within caryophylliids totalling over 220 species, or nearly 75% of the azooxanthellate representatives of the family. Among these, 12 genera are exclusively unattached (lying free on a soft or unconsolidated substrate) and two genera contain species with both attached and free forms in adult stage (Cairns, 2002). Molecular phylogenetic analyses have challenged the validity of Caryophylliidae on the basis of analysis of both mitochondrial (Romano & Cairns, 2000; Le Goff-Vitry et al., 2004; Kitahara et al., 2010a [chapter 4]; 2010b [chapter 5]) and nuclear (Cuif et al., 2003; Barbeitos et al., 2010) markers. Although to date only relatively few representatives have been included in molecular analyses, the family “Caryophylliidae” form at least 8 different clusters that are spread across both the “Complex” and “Robust” coral clades. Among the caryophylliids surveyed to date, Deltocyathus is particularly interesting because of its phylogenetic position in preliminary analyses. With the sole exception of D. magnificus, all representatives of genus Deltocyathus 452 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank studied compose a well-supported clade that formed the most basal lineage of the “Robust” coral clade (Kitahara et al., 2010b [chapter 5]). In these molecular analyses, D. magnificus clustered with the “Complex” coral family Turbinoliidae, which is counterintuitive (Kitahara et al., 2010b [chapter 5]; Stolarski et al., submitted [chapter 8]). Partially reviewed on the basis of macromorphological characters and totalling 25 extant azooxanthellate species (Kitahara & Cairns, 2009 [chapter 2 in part]), the genus Deltocyathus is the third most speciose caryophylliid genus. With the earliest fossil record dating from the Paleocene (Goedert & Peckman, 2005) and now ubiquitous in all but polar oceans between depths from 44 to 5080 m, traditional macromorphological criteria (i.e. pali [P] before all but last cycle of septa, P3 fusing P2 forming chevrons [or deltas] near the columella, and papillose columella) are the basis for taxonomic assignment of this genus within caryophylliids. Here, based on additional molecular data, the family status of the genus Deltocyathus was confirmed and, in the light of molecular support for this re-ranking, additional supporting micromorphological characters were also identified. Nonetheless, notwithstanding the molecular marker or the phylogenetic reconstruction method employed, the enigmatic positioning of D. magnificus as a sister group of turbinoliids was retrieved. In addition, none of the previous morphological characters assigned to Deltocyathus genus level or the new micromorphological characters identified herein were able to shed light into this grouping. In addition to the proposal to elevate Deltocyathus to family level (Deltocyathiidae fam. nov.) within the “Robust” coral clade, the present study suggests that D. magnificus may be the first case of morphological convergence at the microstructural level among scleractinian corals. 7.2 MATERIAL AND METHODS 7.2.1 MORPHOLOGICAL Specimens analyzed in the present study were identified based on macromorphological characters following Cairns (1995; 1998; 1999; 2004) and Cairns & Zibrowius (1997). When covered by the polyp, tissue from one half-system was extracted using forceps 453 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank enabling the analysis of the skeleton. In an attempt to preserve the specimens illustrated in this chapter, only small pieces of dried skeleton (usually between 1/3 to 1/2) were subjected to destructive analyses. The remaining skeleton of each species are deposited at the Australian Commonwealth Scientific and Research Organization (CSIRO – Hobart), National Museum of Natural History (NMNH – Washington D.C.), or at the Muséum National d’Histoire Naturelle (MNHN – Paris). Complete tissue removing was achieved by overnight immersion in 3% sodium hypochlorite (NaOCl) solution. Skeletons were rinsed in Milli-Q water and washed in an ultrasonic cleaner for ca. 2 min. All specimens were studied with transmitted light microscope (TLM) and scanning electron microscope (SEM). Thin (ca. 30 µm thick) sections of various skeletal elements were observed and photographed with a Nikon Eclipse 80i TLM. Skeletal microarchitectural and microstructural features were visualized with Philips XL 20 or Jeol JSM5410LV SEM microscopes. Specimens were observed intact (septal surfaces), as broken but not etched skeletal samples, or as broken/polished and etched samples. Transverse or longitudinal polished or broken sections of septa were exposed for ca. 20 seconds etching in 0.1% formic acid solution, following Stolarski (2003). The etched samples were rinsed with distilled water and air- dried. Once dried, the samples were mounted on stubs and sputter coated with gold or conductive platinum film. Resulting thin sections and skeletal fragments attached to microscope stubs are housed at the Institute of Paleobiology (ZPAL – Warsaw) or at the Muséum National d’Histoire Naturelle (MNHN – Paris). 7.2.2 MOLECULAR Tissue was collected from whole mesenteries dissected out using forceps and washed in absolute ethanol. Genomic DNA was extracted using the DNeasy Tissue Kit (QIAGEN) following the manufacturer’s instructions. For each species the concentration of genomic DNA extracted was measured using a Nanodrop 1000 (Thermo Scientific), and an aliquot of the genomic DNA was diluted or concentrated to achieve the final concentration of 25ng/µl. Polymerase Chain Reaction (PCR) amplification of the mitochondrial (16s rDNA and CO1) and nuclear (28S rDNA) following Stolarski et al. (submitted), using the primers listed in table 7.1. 454 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank Table 7.1 –Primers used in the present study. Loci Primer Sequence Reference Amplicon Size 16S rDNA LP16SF 5’ -TTGACCGGTATGAATGGTGT Le Goff-Vitry et al. (2004) 280 to 420 bp LP16SR 5’ -TCCCCAGGGTAACTTTTATC CO1 LCO1 490 5’ -GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) 690 to 710 bp HCO2 198 5’ -TAAACTTCAGGGTGACCAAAAAATCA 28S rDNA 28S.F63sq 5’ -AATAAGCGGAGGAAAAGAAAC Medina et al. (2001) ~750 bp 28S.R635sq 5’ -GGTCCGTGTTTCAAGACGG Sequences were initially aligned using ClustalW ver. 2 (Larkin et al., 2007) and manually edited using JalView version 8.0 (Clamp et al., 2004). Poorly aligned positions in the 28S rDNA alignment were extracted using Gblocks (Castresana, 2000). The appropriate model of DNA substitution for each gene was determined as by hierarchical likelihood ratio test implemented in MrModeltest (Nylander, 2004). Two different approaches were tested using sequences determined here and others retrieved from GenBank (Table 7.2). The first approach was based on concatenated CO1 and 28S rDNA sequences and included a broad range of scleractinian representatives. This phylogenetic inference aimed to validate the position of the Deltocyathus clade within the order. The second approach included two phylogenetic reconstructions based on 16S rDNA (data not shown) and 28S rDNA. Phylogenetic analyses were performed using PhyML (Guindon & Gascuel, 2003) for Maximum Likelihood (ML) and MrBayes version 3.1.2 (Huelsenbeck & Ronquist, 2001) for Bayesian Inference (BI). ML analyses were performed under the GTR model with a non-parametric Shimodaira-Hasegawa-like (SH) procedure, as well as with 104 bootstrap replicates. For the BI, two independent runs each containing four Markov Monte Carlo (MCMC) chains proceeded for 10 million generations, with trees being sampled every 1000 generations. The first quarter of the 10000 saved topologies were discarded as burn-in for each MrBayes run, ensuring that −lnL had plateaued. In addition, average standard deviation of split frequencies between BI runs was less than 0.001. Remaining topologies were used to calculate the posterior probability. 455 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank Table 7.2 –Taxonomic information, sampling locations, voucher deposition, Genbank accession numbers, and references for mitochondrial cytochrome oxidase subunit 1 and 16S rDNA and nuclear 28S rDNA genes used in the present study. Asterisk denotes new sequences. Family Genus Species GenBank accession number (reference) CO1 28S Anthemiphyllidae Anthemiphyllia A. patera costata HM018604 (1) HQ439609 (6) Caryophylliidae Caryophyllia C. lamellifera HM018616 (1) HQ439616 (6) C. rugosa HM018618 (1) HQ439620 (6) Cladocora C. arbuscula AB117292 (2) AF549226 (7) Conotrochus C. funicolumna HM018621 (1) HQ439629 (6) Deltocyathus D. corrugatus - Not submitted yet (*) D. inusitatus HM018626 (1) Not submitted yet (*) D. magnificus HM018627 (1) HQ439634 (6) D. ornatus HM018628 (1) - D. rotulus HM018629 (1) - D. sarsi HM018630 (1) Not submitted yet (*) D. suluensis HM018631 (1) Not submitted yet (*) D. vaughani - Not submitted yet (*) Stenocyathus S. vermiformis HM018619 (1) HQ439681 (6) Stephanocyathus S. spiniger HM018665 (1) HQ439638 (6) Dendrophylliidae Balanophyllia B. cornu HM018605 (1) HQ439647 (6) Enallopsammia E. rostrata HM018632 (1) HQ439654 (6) Faviidae Caulastraea C. furcata AB117274 (2) AF549224 (7) Diploastrea D. heliopora AB117290 (2) AF549227 (7) Favia F. fragum AY451351 (3) EU262856 (8) F. stelligera AB117264 (2) AF549223 (7) Leptoria L. phrygia AB117273 (2) AF549228 (7) Manicina M. areolata AB117227 (2) AF549255 (7) Montastraea M. annularis AB117260 (2) AF549229 (7) M. curta AB117278 (2) AF549230 (7) M. franksi AP008976 (4) EU262849 (8) Flabellidae Flabellum F. lamellulosum HM018640 (1) HQ439661 (6) Javania J. fusca HM018652 (1) HQ439666 (6) Gardineriidae Gardineria G. hawaiiensis GQ868678 (1) GQ868673 (6) G. paradoxa GQ868682 (1) GQ868671 (6) Meandrinidae Dendrogyra D. cylindrus AB117299 (2) AF549249 (7) Dischocoenia D. stokesi AB117298 (2) EU262875 (8) Micrabaciidae Letepsammia L. formosissima GQ868685 (1) GQ868668 (6) Rhombopsammia R. niphada GQ868683 (1) GQ868674 (6) Mussidae Lobophyllia L. corymbosa AB117241 (2) AF549237 (7) Mussa M. angulosa AB117239 (2) EU262869 (8) Oculinidae Galaxea G. fascicularis AB441201 (5) AF263360 (7) Oculina O. diffusa AB117293 (2) AF549240 (7) Pectiniidae Echinophyllia E. aspera AB117252 (2) AF549241 (7) Pocilloporidae Pocillopora P. verrucosa AB441230 (5) AF549252 (7) Stylophora S. pistillata AB441231 (5) AF549253 (7) Poritidae Porites P. porites DQ643837 (5) EU262878 (8) Siderastreidae Siderastrea S. radians AB441212 (5) EU262861 (8) Turbinoliidae Cyathotrochus C. pileus HM018623 (1) HQ439682 (6) Tropidocyathus T. lessoni HM018669 (1) EU262782 (6) (1) - Kitahara et al. (2010b); (2) - Fukami et al. (2004); (3) - Shearer & Coffroth (2008); (4) – Fukami & Knowlton (2005); (5) - Fukami et al. (2008); (6) - Stolarski et al. (submitted); (7) - Cuif et al. (2003); (8) - Barbeitos et al. (2010); (*) - Present study. 7.3 RESULTS 7.3.1 MOLECULAR For Deltocyathus inusitatus, D. magnificus, D. sarsi, and D. suluensis, sequences were obtained for both CO1 and 28S rDNA. However, for some other species, data for one or other molecular marker could not be obtained despite the use of a number of different DNA polymerases and PCR protocols tested. These failures are most probably a 456 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank consequence of sample preservation conditions. For D. corrugatus and D. vaughani 28S rDNA only were obtained, whereas for D. ornatus and D. rotulus only CO1 data were obtained. In addition, attempts were made to amplify and sequence the (mitochondrial) 16S rDNA gene but these failed in all cases except that of D. magnificus (data not shown). For each gene analyzed, the sequences from Deltocyathus species were aligned with published data for representatives of most scleractinian families (Tab. 7.2). After removing indels from which no unambiguous alignment could be retrieved, the aligned first and second domains of the 28S rDNA gene total 620 bp in length with 247 variable sites, of which 184 (~ 29.6%) were phylogenetically informative. Conversely, sequences for the 5’ -end of the CO1 gene were unambiguously alignable within scleractinian corals; in this case the alignment was 595 bp, and of these 263 positions were variable and 224 (~ 37.6%) phylogenetically informative. In terms of base composition, D. magnificus differed significantly in comparison to all other Deltocyathus species at both CO1 and 28S rDNA loci (Tab. 7.3). Pairwise analysis of the CO1 and 28S rDNA sequences conducted using the Maximum Composite Likelihood method in MEGA ver. 4 (Tamura et al., 2007) confirmed that D. magnificus is genetically divergent once compared to all other Deltocyathus species (Tab. 7.3). Average distance comparison (Kimura 2 under gamma distribution) of the CO1 data indicates that all of the Deltocyathus species studied except D. magnificus are more closely related to “Robust” Scleractinia than to representative “Complex” or “Basal” corals (Table 7.3), but analysis of the 28S rDNA sequences implied a closer affinity of most Deltocyathus species with “Basal” Scleractinia. Nonetheless, this latter result is attributed to the basal position of the Deltocyathus clade within the “Robust” coral clade (see figure 7.1). Uniquely amongst Deltocyathus species studied, the sequences from D. magnificus were always closer to those of representative “Complex” corals in these comparisons. Phylogenetic analyses based on single genes recovered all of the Deltocyathus species except D. magnificus as a monophyletic group, and always placed D. magnificus among “Complex” corals; the latter position was also seen in phylogenies based on 16S rDNA data (not shown). However, the CO1 and 28S rDNA analyses differed with respect to the position of the Deltocyathus cluster; on the basis of CO1 data, Deltocyathus is basal within the “Robust”, whereas in 28S rDNA analyses Deltocyathus clustered with basal 457 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank Scleractinia. This latter position is most likely a long-branch attraction artefact due to nucleotide compositional biases; 28S rDNA analyses that exclude “Basal” scleractinians place, the Deltocyathus clade within “Robust” corals (data not shown). Further investigation is needed to resolve this long-branch attraction problem, but more extensive taxon sampling (“one of the most important determinants of accurate phylogenetic estimation”; Heath et al., 2008: 239) may clarify the matter. Table 7.3 –Mitochondrial CO1 and nuclear 28S rDNA nucleotide composition from all Deltocyathus representatives sequenced to date, estimates of evolutionary divergence between them, and their comparison to scleractinian clades (average distance [calculated based on Kimura2 evolutionary model under gamma distribution]). Evolutionary divergence results are based on the pairwise analysis using partial CO1 and first and second domains of the 28S rDNA. Analyses were conducted using the Maximum Composite Likelihood method in Mega4 (Tamura et al., 2004; 2007). All positions containing gaps and/or missing data were eliminated from the dataset. Gene Species Nucleotide composition (%) Divergence between Deltocyathus sequences Comparison within (x100) coral clades Average distance between clades (%) A T C G corrugatus D. inusitatus D. magnificus D. ornatus D. rotulus D. sarsi D. suluensis D. vaughani D. B C R 28S D. corrugatus 18.5 24.0 24.4 33.1 9.0 15.7 11.6 D. inusitatus 18.2 24.2 24.5 33.1 3 - 10 - - 1 0 2 5.4 11.8 8.1 D. magnificus 17.4 22.4 27.4 32.7 13 10 - - - 10 10 13 10.2 8.3 12.9 D. sarsi 18.4 23.9 24.8 32.9 3 1 10 - - - 1 3 5.5 11.8 8.3 D. suluensis 18.2 24.2 24.5 33.1 3 0 10 - - 1 - 2 5.4 11.6 8.1 D. vaughani 18.2 24.0 24.2 33.5 1 2 13 - - 3 2 - 8.6 15.5 11.0 CO1 D. inusitatus 21.8 37.1 16.8 24.2 - - 24 2 0 0 0 - 27.7 27.6 24.8 D. magnificus 21.2 35.6 19.2 24.0 - 24 - 24 25 24 24 - 12.5 5.4 27.0 D. ornatus 22.0 36.8 17.0 24.2 - 2 24 - 2 0 1 - 28.8 28.3 26.5 D. rotulus 22.0 37.1 16.8 24.0 - 0 25 2 - 0 1 - 28.0 27.9 25.1 D. sarsi 21.8 37.0 17.0 24.2 - 0 24 0 0 - 1 - 27.7 27.8 25.1 D. suluensis 21.7 37.3 16.6 24.4 - 0 24 1 1 - - 27.4 27.7 24.6 B = “Basal” scleractinian clade (sensu Kitahara et al., 2010b; Stolarski et al., submitted) C = “Complex” scleractinian clade R = “Robust” scleractinian clade S = Scleractinia (basal + complex + robust) To better understand the evolutionary position of Deltocyathus species, the CO1 and 28S rDNA sequences were concatenated and aligned with data for representatives of other families, resulting in a data matrix of 1215 bp that included 43 scleractinians (21 exclusively azooxanthellate) representing 35 genera belonging to 15 families (Table 7.2). ML (SH-like and bootstrap) analyses of this matrix returned Log-likelihood values of -10132.21. The Bayesian convergence diagnostic returned a potential scale reduction 458 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank factor between 1.000 and 1.003, and -10157.52 as the arithmetic mean of the best state likelihood values between both cold chains (two runs). Figure 7.1 –(A) Phylogenetic tree of Scleractinia using the 5’ – end of the Cytochrome oxidase subunit 1 (CO1) gene and the 1st and 2nd domains of the 28S rDNA with gardineriids and micrabaciids as outgroups. Numbers near nodes are ML SH-like values, ML bootstrap values (104 replicates), and the Bayesian posterior probabilities (percentages) respectively. Asterisks highlight the position of D. magnificus within “Complex” corals. (B) The Deltocyathus clade recovered using partial 28S rDNA. (C) The Deltocyathus clade recovered using partial CO1.In an effort to rule out contamination issues during DNA extraction and/or PCR reactions, 3 additional specimens of D. magnificus from different sampling locations had genomic DNA extracted and CO1 and 16S rDNA sequenced, resulting in identical sequences (both genes) to the ones previously used to infer the phylogenies. Following Kitahara et al. (2010b [chapter 5]) and Stolarski et al. (submitted [chapter 8]), representatives from the “Basal” scleractinian clade (Gardineriidae and Micrabaciidae) were used to root the phylogeny. Both ML and BI methods gave strong support for the two major clades (i.e. “Complex” and “Robust”) of Scleractinia implied by previous studies (Romano & Palumbi, 1996; 1997; Romano & Cairns, 2000; Chen et al., 2002; Cuif et al., 2003; Le Goff-Vitry et al., 2004; Barbeitos et al., 2010). However, the modest statistical support for the early split between these two clades seen here is 459 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank probably due to the tendency of CO1-based phylogenies to place the “Robust” corals as radiating from the “Complex” clade (see Fukami et al., 2008; Kitahara et al., 2010b [chapter 5]). In addition to D. magnificus, representatives of the (morphologically defined) families Siderastreidae, Oculinidae, Poritidae, Dendrophylliidae, Flabellidae, and Turbinoliidae compose the “Complex” clade. The “Robust” clade comprises all the other Deltocyathus species plus representatives of Anthemiphyllidae, Caryophylliidae, Stenocyathidae, Pocilloporidae, Oculinidae, Faviidae, Meandrinidae, Mussidae, and Pectiniidae. 7.3.2 MORPHOLOGICAL 7.3.2.1 Macromorphological characters Macromorphologically, all 25 extant species that belong to the genus Deltocyathus are characterized in having a solitary, discoidal to patellate corallum. With the exception of D. halianthus, adult representatives of this genus are unattached, probably living on soft (sand/mud) substrate. Costae are well developed at least near the calicular edge (Fig. 7.1, A5-I5 [light-blue arrows]), and are separated by intercostal spaces that bear a row of small pores (Fig. 7.1, A5-I5 [yellow arrows]). In some species (e.g. D. corrugatus) 6 to 12 costal spines extend beyond the calicular edge (Fig. 7.1, B1, D1, F1) that together with basal shape (flat to conical, rarely slightly concave) are purported to be strategies to improve corallum stability with respect to the substrate and currents. The vast majority of the species that do not have costal spines display a lanceted calicular edge, in which triangular to rectangular lancets (or apexes) correspond to costal projections beyond calicular edge (e.g. D. rotulus – Fig. 7.1, G1-2). Adult specimens usually have four or five septal cycles (48 to 96 septa), of which the primary and sometimes the secondary are independent, usually extending from columella to or beyond the calicular edge. The upper septal edge is straight to slightly sinuous. Axial septal edges are usually entire, however, those of last cycle (S4 or S5) are often lacerated. Lower axial edge from septa of the last cycle (S4 or S5) fuses to its flanking septa (S3 or S4) or respective pali (P3 or P4) near calicular edge. Septal faces bear rows of granules aligned perpendicular to upper septal edge, giving to some species a robust appearance. Well- 460 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank developed pali are present before all but last cycle of septa (D. vaughani is the only congener to have pali before all septal cycles). Pali usually well separated from their respective septa by deep and narrow notch, and displaying axial edges that fuse to adjacent lower cycle septal faces/pali forming the characteristic delta-shaped chevrons (e.g. Fig. 7.1 [red arrows]). In all septal systems, each pair of P3 always fuses to P2. Columella papillose composed from a few to several regular shaped rods usually arranged in an elliptical field. 7.3.2.2 Micromorphological and Microstructural characters At low/moderate magnifications (e.g. Fig. 7.2, subscripted with “2” and “3”) Deltocyathus skeletal surfaces are relatively smooth, but septal faces are covered with pointed granules aligned in rows, that occasionally fuse forming short irregular ridges perpendicular to septal edge (e.g. Fig. 7.2, B3). At higher magnification (Fig. 7.2, subscripted with “4”) however, most of the skeletal surfaces are covered with crystal clusters irregularly arranged, which usually are smaller than 2 µm in length. Crystal clusters are less prominent at the tips of septal granules. Overall, two main components are typically recognized in the skeleton of the sectioned Deltocyathus coralla: rapid accretion deposits (RAD) and thickening deposits (TD) (Fig. 7.3, B, F and Fig. 7.4, B, F, J). According to Stolarski (2003) and Brahmi et al. (2010), RAD are skeletal deposits enriched in organic components formed within well-differentiated regions of skeletal rapid accretion. On the other hand, TD are skeletal structures deposited outside the areas of rapid accretion (typically consisting of layers of fibers continuous with those of RAD) and are poorer in organic components. All Deltocyathus representatives examined herein have septothecate corallum wall (adult stage), composed of thickened outer parts of septa. Septotheca is distinguished in transverse sections of distal parts of coralla with rapid accretion deposits visible only in the narrow mid-septal zone (Fig. 7.3, A, B, E, F and Fig. 7.4, A, B, E, F, I, J) flanked with thickening deposits formed by successive layers of bundles of fibers. Rapid accretion deposits of trabeculothecal segments which are typical of ontogenetically earlier type of the wall are not recognizable at adult stage (see Stolarski 1995). 461 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank 462 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank Figure 7.3 –Skeletal microstructure of Deltocyathus suluensis (A-D) and D. magnificus (E-H) that based on molecular markers group with “Robust” and “Complex” scleractinian clades respectively (A, B, E, F - transverse sections; C, D, G, H - longitudinal sections across septa). In D. magnificus and other species of Deltocyathus (see also Fig. 7.4) rapid accretion deposits (RAD) are located in narrow mid-septal zone (A, B, E, F) and separated from each other ca. 50-100µm (D, H); layers of septal thickening deposits (TD) flank each RAD and are formed by successive layers of bundles of fibers. Reticulated pattern in C (yellow arrow) is an artefact resulted from uneven adherence of the skeletal slice to the glass. White arrows indicate RAD. Figure 7.2 –Calicular views of 9 adult Deltocyathus species (subscripted with “1”); close-up of last cycle septa fusing to its adjacent septa or pali (red arrows) and some showing lancets formed beyond calicular edge (subscripted with “2”); septal faces bearing well-developed aligned granules (green arrows) (subscripted with “3”); enlarged view of septal face composed of crystal clusters (subscripted with “4”); close- up of base near calicular edge showing well-developed granular costae (blue arrows) and porous intercostal spaces (yellow arrows). (A1-5) D. cameratus; (B1-5) D. corrugatus; (C1-5) D. crassiseptum; (D1-5) D. heteroclitus; (E1-5) D. inusitatus; (F1-5) D. ornatus; (G1-5) D. rotulus; (H1-5) D. suluensis; (I1-5) D. magnificus. 463 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank Figure 7.4 –Skeletal microstructure of Deltocyathus vaughani (A-D), D. rotulus (E-H), and D. sarsi (I-L) that based on molecular markers (CO1 and 28S rDNA) group with D. suluensis (Fig. 7.1) within “Robust” corals. All examined species show macromorphological and microstructural characteristics of Deltocyathus (see caption Fig. 7.3). White arrows mark RAD. In D. sarsi rapid accretion centers are slightly dispersed in mid-septa region, but distances between them agree with those observed in other Deltocyathus species. 464 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank In longitudinal sections of septa, RAD and TD are recognizable as alternations of darker and brighter components and RAD zones are distributed every ca. 50-100 µm (Fig. 7.3, D, H). In these thin-sections, boundaries between adjacent TD (developed around each RAD) are sharp, a feature traditionally described as trabecula (see Wells, 1956). 7.4 DISCUSSION Recent molecular phylogenetic analyses suggest that within the Scleractinia, most families composed mainly of azooxanthellate representatives are monophyletic, so in these cases classical and molecular taxonomies are consistent (Kitahara et al., 2010b [chapter 5]; Stolarski et al., submitted [chapter 8]). However, one exception to this is Caryophylliidae, the second most speciose scleractinian family, the validity of which has been challenged on the basis of analyses of both partial 16S rDNA (Romano & Cairns 2000; Le Goff-Vitry 2004) and partial CO1 (Kitahara et al., 2010b [chapter 5]) sequence data. Kitahara et al. (2010a [chapter 4]) suggested a monophyletic origin for the genus Caryophyllia after analyses of 16S rDNA data, but did not recover morphologically related members of the Caryophylliidae as a clade, suggesting once again a polyphyletic status for this family. Amongst the “Caryophylliid” clades recovered on the basis of molecular data, that comprising most representatives of the genus Deltocyathus is of particular interest as the position of this clade in preliminary analyses is consistent with the idea of a solitary azooxanthellate ancestor for the order (Stolarski et al., submitted). Here I show that, with the sole exception of D. magnificus, all of the Deltocyathus species examined form a monophyletic group with strong statistical support, and that with Anthemiphyllia patera costata the Deltocyathus clade forms a basal lineage amongst “Robust” scleractinians. On the other hand, irrespective of the locus or method of analysis used, D. magnificus always grouped with turbinoliids (Tropidocyathus lessoni and Cyathotrochus pileus) in the “Complex” coral clade. Doubled identification discarded the possibility of misidentification of the specimens sequenced. Mislabelling and contamination during extraction of genomic DNA and PCR amplification were ruled out once three additional specimens of D. magnificus from three different sampling 465 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank stations were sequenced and returned identical sequences (CO1 and 16S rDNA) as those specimens previously sequenced. The molecular characteristics of CO1 and 28S rDNA sequences obtained for members of the Deltocyathus clade are similar to those from typical “Robust” scleractinians published in previous studies. In contrast, the characteristics of sequences from D. magnificus are more like those of “Complex” clade representatives - the 16S rDNA is longer, and there are base composition biases in the CO1 and 28S rDNA sequences that resemble those seen in “Complex” corals (higher concentration cytosine and lower concentration of thymine). According to Lowenstam & Weiner (1989), the organic matrix-mediated biomineralization model links skeletal microstructural characteristics and molecular phylogenetic reconstructions. As such, organic matrices composed of complex assemblages of macromolecules may control organization of microstructural units, in a biochemically driven process where genetically controlled coral fibers guide calcification (Cuif & Dauphin, 2005). Following this hypothesis about genetic foundations of biomineralization activity (see also Wirshing & Baker, 2008), I assumed that at some level of hierarchical organization of the skeleton, morphological characters supporting intriguing molecular grouping of D. magnificus in relation to the rest of Deltocyathus representatives will be found. Such approach has proven to be successful in several previously published combined molecular-morphological studies that have shown that various fine-scale scleractinian morphological characters provide support for molecular-based clades (Cuif et al., 2003; Benzoni et al., 2007; 2010; Budd & Stolarski, 2009; 2010), where macromorphological characters had failed. Re-examination of all of the available material failed to identify fine-scale characters that correlate with the position of D. magnificus in relation to Deltocyathus implied by molecular analyses. Morphologically, D. magnificus is a typical member of the genus, not only in terms of macro- and micromorphology but also in all of the microstructural characteristics identified. All Deltocyathus representatives show rather simple microstructural organization of the skeleton (narrow rapid accretion zone; thickening deposits in a form of not differentiated bundles of fibers) that occur in many representatives of both – “Robust” and “Complex” corals (including turbinoliids). The only observation made that is unique to D. magnificus was the presence of soft tissue (edge zone) completely covering the skeleton, a trait not seen in any other congener examined (polyp terminate few millimetres beyond calicular edge), but interestingly 466 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank present in all turbinoliids. If the grouping with turbinoliids is confirmed, this would be the first case of morphological convergence at macro- and microstructural level among scleractinian corals. Nonetheless, more in-depth microstructural and biogeochemical studies are pending (similar as those carried out by Janiszewska et al. [2011] for micrabaciids) in order to find some skeleton-embedded features that may settle position of D. magnificus either among “Robust” or “Complex” corals. The position of the well-supported Deltocyathus clade as the most basal lineage within the “Robust” corals in the analyses of concatenated CO1 and 28S rDNA data and its genetic distance in relation to other Caryophylliidae representatives supports the proposal for its elevation to family rank. However, before additional in-depth microstructural and biogeochemical analyses are undertaken for Deltocyathus representatives (similar as those carried out by Janiszewska et al. [2011] for micrabaciids), in order to investigate if there is/are skeleton-embedded features that support the intriguing position of D. magnificus, the latter will be tentatively classified together with other Deltocyathus in the Deltocyathiidae fam. nov. Accordingly, below I propose the description of the new family, based on the original description of the genus Deltocyathus and subsequent information acquired herein. In addition, an identification key for all extant Deltocyathus species is proposed. Order Scleractinia “Robust” Scleractinian Group sensu Kitahara et al., 2010b Family Deltocyathiidae (fam. nov.) Diagnosis. –Solitary, discoidal to patellate, usually free in adult stage. Well-developed costae and intercostal pores present. Septa composed of rapid accretion deposits located in narrow mid-septal zone flanked by successive layers septal thickening deposits composed of bundles of fibers. Pali before all but last septal cycle; within each system the axial edges of each pair of P3 fuses to its common P2 near columella, forming characteristic chevrons (delta shaped). Pali may also be present before fourth septal cycle. Columella papillose. Genera included: Deltocyathus Milne Edwards & Haime, 1848 467 CHAPTER 7 Proposal for the elevation of the genus Deltocyathus to family rank Key to the Recent species belonging to Deltocyathus 1a Costal spines present ……………………………………………………………………………..…………... 2 1b Costal spines absent ……………………………………………………………………………..………….... 6 2a Six to eight costal spines; one granule per costa .………………………………………………………….…. 3 2b Twelve costal spines; more than one granule per costa ……………………………………………………… 4 3a All costae equal; corallum shaped as shallow bowl …………………..…………………………………...…. D. heteroclitus 3b Costae unequal; corallum patellate ……………………………………………………………………..……. D. calcar 4a S4-P3 junction below S3-P3 notch …………………………………………………………………..………. 5 4b S4-P3 junction at S3-P3 notch ……………………………………………………………………………….. D. corrugatus 5a P3>P1-2 ………………………………………………………………………………………………………. D. stella 5b All palar cycles equal in size ………………………………………………………………………………… D. ornatus 6a Adult corallum with 5 full cycles of septa (96) ……………………………………………………………… 7 6b Adult corallum with 4 cycles of septa or an incomplete 5th cycle (44-80) ………………………………….. 10 7a Corallum usually reproduce by fragmentation, showing a prominent scar ……..…………………………… D. sarsi 7b Corallum not reproduce by fragmentation ……………..…………………………………………………….. 8 8a Base flat to slightly concave ………………………………………………………...……………………….. [D. magnificus] 8b Base usually convex …………………………………………………………………….………………….… 9 9a First cycle of septa wider than secondaries ……………………………………………………………...…… D. suluensi 9b First and second septal cycles equal in width …………………………………………………..……………. D. rotulus 10a Corallum attached ……………………………………………………………………………..……………... D. halianthus 10b Corallum free ……………………………………………………………………………………………..….. 11 11a All costae extend from calicular edge to centre ………………………………………………………..…….. 12 11b C4 and/or C3 not reach the centre ……………………………………………………………………...…….. 13 12a C1-3>C4; base flat to hemispherical; S1 and S2 not thick …………………………………………………... D. moseleyi 12b All costae equal and bisected by a row of granules; base flat to convex; S1 and S2 thick ..………………… D. crassiseptum 13a Penultimate septal cycle wider than the last cycle …………………………………………………………… 14 13b Penultimate septal cycle equal or smaller than the last cycle ………………………………………………... 17 14a All costae equal in width ………………………………………………………………………………..…… 15 14b Costae not equal in width ………………………………………………………………………………...…... 16 15a Five cycles of septa present; all systems dimorphic …………………………………………………………. D. inusitatus 15b Four cycles of septa present; systems not dimorphic ……………………………………………………...…. D. cameratus 16a Shape of base flat ………………………………………………………………………………………..…… D. pourtalesi 16b Shape of base conical (apical angle: 80º - 120º) ……………………………………………………..………. D. italicus 17a Calicular margin jagged, S3 and adjacent S4 project as a triangular to rectangular lancets ………………… 18 17b Calicular margin not jagged ……………………………………………………………………………..…… 20 18a S3 highly exsert ………………………………………………………………………………………..……... D. andamanicus 18b All septa equally exsert or little difference ……………………………………………………………….….. 19 19a Paliform lobes elongated; columella spongy with low twisted processes ………………………………….... D. murrayi 19b No well defined pali; no true columella ………………………………………………………………...……. D. varians 20a Corallum strongly conical ……………………………………………………………………………..……... D. parvulus 20b Corallum flat to slightly conical ………………………………………………………………………..……. 21 21a P4 present …………………………………………………………………………..………………………… D. vaughani 21b P4 absent ……………………………………………………………………………..………………………. 22 22a Axial edges of S1, S2, and S3 sinuous………………………………………………...……………………… 23 22b First three septal cycles not sinuous ………………………………………………...………………………... 24 23a C3 and C4 do no reach centre of the base; S3>>S4 …………………………………...……………………... D. eccentricus 23b Only C4 do not reach centre of base; S3=S4 ………………………………………………………………… D. agassizii 24a Septal formula: S1-2>S3>S4>S5; when S5 present the fourth cycle septa is dimorphic ………………..…... D. taiwanicus 24b Septal formula: S1>S2>S3>S4; S4 not dimorphic …………………………………………………..………. D. philippinensis 468 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals Scleractinian corals first appeared in the fossil record in the mid-Triassic (ca. 240 Ma). From the outset, their skeletal morphology was highly diversified, implying a substantially deeper evolutionary origin. Here, using mitochondrial and nuclear markers, and fossil calibrated Bayesian relaxed molecular clock approach, I show that the divergence of the two major scleractinian clades, “Robust” and “Complex”, took place in Lower Devonian (ca. 415 Ma), almost 100 My earlier than previously thought. Surprisingly, two families of living deep-water corals, the Gardineriidae and Micrabaciidae, are found to have diverged before that and are therefore the most basal scleractinian lineages. These results are consistent with the hypothesis that scleractinians evolved from Paleozoic soft-bodied hexacorallians. Additionally, I conclude that earliest zooxanthellate coral lineages evolved from solitary, azooxanthellate ancestors, and support the theory that highly diverse colonial forms inhabiting shallow-waters are the result of the successful symbiosis between corals and unicellular dinoflagellates. CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals 8.1 INTRODUCTION The origin of modern reef-building corals is obscure. Scleractinians suddenly appeared in the Middle Triassic (ca. 240 Ma), represented by a wide diversity of solitary and colonial forms (Roniewicz, 1993; Veron, 1995; Stanley, 2003). From the level of colony integration (e.g. phaceloid, meandroid and thamnasteroid growth forms [Wells, 1956; Stanley, 2003]) to the microstructure organization within individual corallites (e.g., complex septal ornamentation and axial structures [Roniewicz, 1989]), the range of morphological variation in the Triassic fossils is comparable to that of modern scleractinians. In fossil specimens in which aragonite is preserved, coralla show at least four basic types of microstructural organization (Roniewicz, 1993). This extensive macro- and micro- morphological diversity seen in the Triassic scleractinians implies Palaeozoic evolutionary history for the order. Traditionally, it was hypothesised that scleractinians were descendants of late Paleozoic plerophylliine rugosan corals that survived the P/T boundary (Schindewolf, 1942; Cuif, 1977; Stolarski, 1996). However, this hypothesis implied changes in several highly conserved characters, such as septal insertion symmetry (serial in rugoses vs. cyclic in scleractinians) and skeleton mineralogy (Oliver, 1996). Currently, the prevailing scleractinian appearance scenario is that the Triassic scleractinians evolved from soft-bodied corallimorpharians through the gain of a calcified skeleton (Stanley & Fautin, 2001). Supporting this hypothesis are findings of Middle and Late Permian (ca. 265-255 Ma) “scleractiniamorphs” with hexameral septal symmetry and probably aragonitic skeleton (Numidiaphyllum, Houchnagocyathus). Both “scleractiniamorphs” are considered direct predecessors of lineages of some solitary/phaceloid Triassic corals (Ezaki, 1997; 1998; 2000). Much older evolutionary origin of Scleractinia is suggested by occurrence of Ordovician (ca. 450 Ma) kilbuchophyllid “scleractiniamorphs”, whose cyclic insertion pattern of septa is indistinguishable from modern corals (Scrutton, 1991; 1993). To date, the vast majority of scleractinian molecular evolutionary reconstructions were heavily based on zooxanthellate, shallow-water representatives (Romano & Palumbi, 1996; 470 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals 1997; Romano & Cairns, 2000; Le Goff-Vitry et al., 2004; Fukami et al., 2008). These molecular data showed that extant scleractinians are divided into two large groups known as Robusta and Complexa (Romano & Palumbi, 1996; Kerr, 2005), which diverged in the Late Carboniferous (ca. 300 Ma) (Romano & Palumbi, 1996), corroborating with a Late Palaeozoic origin of the order. Nonetheless, some of the azooxanthellate representatives included in these analyses suggested that modern deep-water, azooxanthellate species diverged at or close to the split between the two coral groups, implying that the evolutionary origin of scleractinians is best sought in deep-water (i.e., azooxanthellate) rather than shallow-water (primarily zooxanthellate) coral species. Most recently, analyses of the partial mitochondrial CO1 sequence of 234 scleractinians (including 65 deep-water, azooxanthellate species), suggested that members of Gardineriidae and Micrabaciidae compose a deeply diverging clade that may represent the oldest scleractinian lineage amongst modern corals (Kitahara et al., 2010b - Chapter 5). On the other hand, partial sequences of ribosomal 12S rDNA and 28S rDNA from 80 scleractinian species (19 representing exclusively azooxanthellate forms) suggested that most examined azooxanthellate, deep-water lineages originated from symbiotic, shallow-water ancestors (Barbeitos et al., 2010), implying repeated loss of coloniality and symbiosis amongst extant lineages. These conflicting interpretations of scleractinian coral ancestors that were based on different data sets stimulated a comprehensive phylogenetic analysis that complemented previous molecular data. Here, two different approaches were tested: (i) the first included representatives of all hexacorallian orders but Ceriantharia and was intended to validate the Scleractinia monophyly. For this purpose, four single gene phylogenies all rooted with Octocorallia were constructed; (ii) the second approach, used to access the time divergence between major scleractinian groups, was based on concatenated sequences of the ribosomal genes16S rDNA and 28S rDNA, and included a broad range of scleractinian representatives. 471 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals 8.2 MATERIALS AND METHODS 8.2.1 MATERIALS The present study was based on the examination of 123 lots of deep-sea azooxanthellate scleractinians collected from 87 stations from New Caledonia (French research expeditions Bathus 3, Bathus 4, Halipro 1, Norfolk 1 and Norfolk 2), and from Australia (Australian research expeditions SS 011997, SS 102005, SS 022007, and Tan0308). Additional specimens collected in Australian waters were provided for the present study by the Western Australian Museum (Appendix 8.1). 8.2.2 METHODS 8.2.2.1 DNA PREPARATION, AMPLIFICATION AND SEQUENCE ANALYSES For large specimens, whole mesenteries were dissected out (with forceps) prior to extraction, whereas for smaller specimens an entire system (including skeleton) was extracted and immersed in the lysis buffer. Genomic DNA was extracted using the DNeasy Tissue Kit (QIAGEN). DNA concentrations were determined using a Nanodrop 1000 (Thermo Scientific) prior to Polymerase Chain Reaction (PCR) amplification under the following conditions: (1) 16S rDNA - the primers developed by Le Goff-Vitry et al. (2004) (LP16SF 5’ - TTGACCGGTATGAATGGTGT and LP16SR 5’ -TCCCCAGGGTAACTT TTATC) were used to amplify a fragment whose size varied between 280 and 420 bp. Reactions were carried out in a total volume of 50 µl, and contained 0.2 mM dNTPs, 1.5 mM MgCl2, 1 mM of each primer, 1.5 units of Taq polymerase (Fisher Biotec – Australia) and 125 ng of template. The PCR protocol used was: an initial denaturation step (95ºC 472 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals for 5 min), then 35 cycles of 30 s at 94ºC, 30 s at 50ºC, and 45 s at 72ºC, followed by 10 min at 72ºC. (2) CO1 – the universal primers developed by Folmer et al. (1994) (LCO1 490 5’ - GGTCAACAAATCATAAAGATATTGG and HCO2 198 5’ -TAAACTTC AGGGTGACCAAAAAATCA) were used to amplify a fragment whose size varied between 690 and 710 bp. Reactions were carried out as described by Folmer et al.2: 95ºC for 1 min, then 35 cycles of 30 s at 95ºC, 30 s at 40ºC, and 90 s at 72ºC, followed by 10 min at 72ºC. (3) 12S rDNA – the primers developed by Chen and Yu (2000) (ANTMT12SF 5’- AGCCACACTTTCACTGAAACAAGG and ANTMT12SR 5’-GTTCCC YYWCYCTYACYATGTTACGAC) were used to amplify a fragment whose size varied between 800 and 920 bp. Reactions were carried out in 50 µl, with 0.2 mM dNTPs, 1.5 mM MgCl2, 1mM of each primer, 1.5 units of Taq polymerase (Fisher Biotec – Australia), and 125 ng of template. PCR conditions were: 95ºC for 4 min, followed by 4 cycles of 30 s at 94ºC, 60 s at 50ºC, 120 s at 72ºC, and 30 cycles of 30 s at 94ºC, 60 s at 55ºC, 120 s at 72ºC and then 4 min at 72ºC. (4) 28S rDNA – the primers developed by Medina et al. (2001) (28S.F63sq 5’- AATAAGCGGAGGAAAAGAAAC and 28S.R635sq 5’-GGTCCGTGTTTCA AGACGG) were used to amplify a fragment of approximately 750 bp. Reactions were carried out using the Advantage2 PCR kit (Clontech) with 100 ng of template, and following manufacturer’s protocol. PCR conditions were: 95ºC for 5 min, then 30 cycles of 30 s at 94ºC, 60 s at 54ºC, 90 s at 72ºC, followed by 5 min at 72ºC. When amplification reactions based on Taq polymerase did not yield product, amplification was carried out using the Clontech Advantage-2 Kit (with the same template and primer concentrations, and under the same PCR protocol). PCR reactions were performed using a Bio-Rad DNA engine (Peltier Thermal Cycler). PCR products were purified using Mo-Bio 473 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals Ultra Clean (PCR Clean Up) spin columns, and subjected to direct (Sanger) sequencing at Macrogen (South Korea). Two different approaches were tested using sequences determined here and others retrieved from GenBank (Appendix 8.1). The first approach included representatives of all hexacorallian orders but Ceriantharia and was intended to validate the Scleractinia monophyly. For this purpose, four single gene phylogenies all rooted with Octocorallia were constructed. The second approach, used herein for time divergence between scleractinian groups (Basal, Complex, and Robust groups) was based on concatenated sequences of the ribosomal genes 16S rDNA and 28S rDNA, and included a broad range of scleractinian representatives. Alignments for both approaches were performed for each gene separately using ClustalW2 (Larkin et al., 2007) and manually edited using JalView version 8.0 (Clamp et al., 2004). Final alignments were individually tested for substitution saturation (Xia et al., 2003) using DAMBE (Xia & Xie, 2001), and for each marker, appropriate models of nucleotide substitution were determined by the hierarchical likelihood ratio test implemented in MrModeltest (Nylander, 2004). To estimate divergence times for gardineriids/micrabaciids and other scleractinians, I applied a relaxed-clock (uncorrelated lognormal) Bayesian Markov chain Monte Carlo method as implemented in BEAST v1.4.8 (Drummond et al., 2002; 2006; Drummond & Rambaut, 2007). This method allows nucleotide substitution rates to vary between lineages and incorporates phylogenetic uncertainty by sampling phylogenies and parameter estimates in proportion to their posterior probability. Additionally, Yule process was chosen as tree prior, and the prior distribution of divergence of each calibrated node was set as normal with standard deviation of 3.5. Hierarchical likelihood ratio tests led to the adoption of the General Time Reversible model with a proportion of invariant sites and gamma distributed rate heterogeneity (GTR+I+Γ) as the most appropriate evolutionary model for the molecular clock analyses. One run of 10 million generations was calculated with topologies and other parameters saved at each 1000 generations. The first quarter of the 10000 saved topologies was discarded as burnin, and the remaining used to calculate posterior probabilities and node ages. Additionally, phylogenetic reconstruction from the same alignment was also calculated on PhyML (Guindon & Gascuel, 2003) under the SH- 474 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals like, Chi2, and Bootstrap (100 replicates), and MrBayes 3.1.2 (Huelsenbeck & Ronquist, 2001) in two MCMC runs of 10 million generations each, with topologies sampled every 1000 generations. Average standard deviation of split frequencies between runs was less than 0.01. The first quarter of the 10000 sampled topologies were discarded as burnin, and the remaining used to calculate posterior probabilities. For the calibration of the molecular clock, stringent constraints were applied based on fossils that can be unambiguously assigned to extant clades and whose unique skeletal characters can be unequivocally recognized in fossil coralla. 8.2.2.2 SKELETON PREPARATION AND ANALYSIS Preliminary selection of skeleton samples was performed using a Nikon SMZ800 stereoscopic zoom microscope. For standard SEM (Philips XL 20) measurements, polished and etched blocks of corals skeleton were used. Following published methods of preparation (Stolarski, 2003), the samples were polished with diamond powder, 1200 Grit and aluminium oxide (Buehler TOPOL) and then etched for 10 seconds in 0.1% formic acid. Trace element analyses were performed with the Cameca NanoSIMS N50 at the Muséum National d’Histoire Naturelle (Paris), following established procedures (Meibom et al., 2004; 2007). Briefly, septa were cut perpendicular to their growth direction, mounted in epoxy (Körapox©) and polished to a 0.25 µm finish using diamond paste. The samples were then gold-coated. Using a primary beam of O-, secondary ions of 24Mg+, 44Ca+ and 88Sr+ were sputtered from the sample surface and detected simultaneously (multicollection- mode) in electron-multipliers at a mass-resolving power of ~5000 (M/ΔM). At this mass- resolving power, the measured secondary ions are resolved from potential interferences. Data were obtained from a pre-sputtered surface as point analyses with the primary ions focused to a spot-size of ~3 micrometer and the primary beam was stepped across the sample surface in steps of 20 micrometers. The measured 24Mg/44Ca and 88Sr/44Ca ratios were calibrated against analyses of carbonate standards of known composition (OKA-C) 475 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals (Bice et al., 2005). The chemical variations recorded in the coral skeletons are much larger than both the internal and external reproducibility of the standards, which were less than <5% for Mg/Ca and <3% for Sr/Ca. 8.2.2.3 HISTOLOGICAL PREPARATION Ethanol preserved specimens were immersed in 20% (w/v) EDTA (pH 8) for two weeks at 4ºC for decalcification. The resulting material was then dehydrated (70%, 80%, 2 x 95%, and 3 x 100% ethanol washes each of 40 min) and taken through three xylene washes (each of 40 min) prior to embedding in paraffin and serial tissue sectioning. Sections (5µm) were stained using Harris’s haematoxylin and eosin or Alcian Blue/PAS. 8.3 RESULTS The substitution saturation results from each of the alignments pertaining to the first approach indicated little saturation for CO1 and 28S rDNA sequences (i.e. Iss. significantly lower than Iss.c), but higher levels of saturation for the 16S and 12S rDNAs (Iss. higher than Iss.c). Saturation related to mitochondrial ribosomal genes were induced by their respective fast evolving regions. This phenomenon was particularly evident because sequences from distant Anthozoa representatives were included in these alignments (e.g. Octocorallia). To improve the phylogenetic signal, the most rapidly evolving regions were excluded from the alignment, resulting in a sharply decrease in saturation levels. The final alignments used in the first approach consisted of 298 positions for the 16S rDNA, 599 positions for CO1, 631 positions for 12S rDNA, and 709 positions for the 28S rDNA. The final alignment that based the second approach contained concatenated 16S rDNA and 28S rDNA sequences (without excluding the fast evolving regions) from 121 scleractinians and 1 corallimorpharian, totalling 1334 bp. This alignment was also tested for substitution saturation, which indicated little saturation. 476 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals Based on the data sets from the first approach, phylogenetic Maximum Likelihood (ML) and Bayesian Inference (BI) analyses of mitochondrial (16s rDNA, CO1, and 12S rDNA), and nuclear (28S rDNA) markers, supported monophyly of Scleractinia and unequivocally place gardineriids and micrabaciids as the most basal lineage found hitherto among living Scleractinia (Fig. 8.1). Their sequences differ by an average of 22% and 24% (16S), 8% and 13.5% (12S), 12.3% and 12.8% (CO1), and 8.5% and 9.6% (28S) from “Complex” and 13% and 16.4% (16S), 17.8% and 21.5% (12S), 18.5% and 18.6% (CO1), and 7.6% and 8.7% (28S) from the “Robust” clades respectively. For the second approach, the Bayesian relaxed molecular-clock based on concatenated 16S rDNA and 28S rDNA was calibrated with oldest fossil records that are unambiguously assigned to extant genera/families and whose unique skeletal characters can be unequivocally recognized in fossil coralla. Nodes used for the calibration were: (A) the appearance of Caryophyllia (ca. 160 Ma), based on the Late Jurassic (Oxfordian) species C. simplex and C. suevica (Geyer, 1954; Lauxmann, 1991). Both species have well-developed “true” pali present in one crown before the penultimate cycle of septa, fascicular columella composed of several twisted laths and septothecal walls, characters which altogether occur only in fossil and extant representatives of this genus (Kitahara et al., 2010a - Chapter 4); (B) The divergence of the Dendrophylliidae (ca. 127 Ma), corresponding to the first occurrence of solitary Palaeopsammia (Barremian) (Wanner, 1902). The first appearance of colonial dendrophylliids (Blastozopsammia) in the Albian (ca. 100 Ma) (Filkorn & Allor, 2004) is consistent with the earlier origin of solitary genera. Skeletal synapomorphies of dendrophylliids include the Pourtalès plan of septal arrangement and the presence of a synapticulothecate wall (Cairns, 2001); and (C) the origin of Flabellum (ca. 77.5 Ma), based on the earliest known record of the genus (F. fresnoense) from the Late Cretaceous (Coniacian; early Maastrichtian) (Durham, 1947). Unequivocal Flabellum (F. anderssoni) fossils are also known from the Late Cretaceous (Campanian, Maastrichtian) of Seymour Island (Felix, 1909). Flabellum is clearly distinguishable based on the following unique combination of characters: the marginothecal wall is present throughout ontogeny, lack of pali/paliform lobes and scale-like microtexture of septa (sometimes preserved in the fossil record). Monophyly was enforced in the case of the dendrophylliids (calibration node B), but not for nodes A or C (see Fig. 8.6). Results from the relaxed molecular-clock, suggest 477 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals that the divergence of the gardineriids/micrabaciids lineage from other scleractinians took place in the Silurian (ca. 425 Ma), followed by the split of the two major scleractinian groups (Robusta and Complexa), between the Silurian and Devonian (ca. 415 Ma) (Fig. 8.6). Figure 8.1. –Molecular phylograms based on 16S rDNA (A), 12S rDNA (B), CO1 (C) and 28S rDNA (D) sequences. In each case, micrabaciid (highlighted purple) and gardineriid corals (highlighted green) are basal within the Scleractinia. Topologies were inferred by maximum likelihood, and numbers near branches leading to nodes represent the Bayesian posterior probabilities. Yellow shaded box indicates Complexa coral group, and orange indicates Robusta coral group. 478 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals Anatomically, micrabaciids and gardineriids show typical scleractinian polyp organization, consisting of a tubular body terminating in a mouth surrounded by tentacles. Pairs of mesenteries are hexamerally arranged, and the polyp’s oral and aboral tissues are composed of two cellular layers separated by a collagenous mesoglea. As many other deep-water species, micrabaciids and gardineriids have thicker mesoglea and mesogleal plates, and more abundant mucocytes in comparison to shallow-water zooxanthellate colonial forms (Fig. 8.2). Other histological features of both families fall within the broad range of characters observed among scleractinians (Wells, 1956). Figure. 8.2. –Anatomy of Gardineria, Letepsammia and other extant scleractinian corals. The figure compares Gardineria hawaiiensis (A–E), Letepsammia formosissima (F–J), Fungiacyathus margaretae (K–O), and Acropora millepora (P–U) at the levels of skeleton macromorphology (first column), anatomy (second column) and histology (columns 3–4) (S–U, courtesy of Dr. Tracy Ainsworth). Colour arrows indicate the following anatomical and histological details: black arrows, mouth/pharynx position on cross-sectioned polyps; gray arrows, septal position; pink arrows, spermaries, white arrows, calicoblastic ectoderm; yellow arrows, mesoglea; green arrows, mesogleal plates; red arrow, muscle fibers; dark blue arrows, zooxanthellae; light blue arrows, cnidae; orange arrows, mucocytes. Cnidae are shown on sections of tentacle acrospheres (E, J, O, U). Fungiacyathus margaretae and Acropora millepora were used as typical representatives of deep-water (azooxanthellate) and tropical shallow-water (zooxanthellate) Scleractinia respectively. 479 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals Morphologically, gardineriids and micrabaciids have skeleton aragonitic in mineralogy and display septa cyclic inserted (Fig. 8.3), both considered apomorphic traits used to distinguish scleractinians from other calcified anthozoans. However, other macro- and micro-morphological skeletal features found in micrabaciids and gardineriids are unique and differentiate them from all other living scleractinians. Figure 8.3. –Initial ontogenetic stages in Gardineria hawaiiensis (A, thin section of the corallum base) and Letepsammia formosissima (B, polished corallum base). The position of the six simultaneously inserted protosepta are indicated with white arrows. Gardineriids have very simple robust coralla (Fig. 8.4) whose most prominent feature is a thick epithecal wall formed by the margin of the polyp tissue that is confined to the intra- calicular region (Stolarski, 1996). An exclusive epithecal wall is an unusual feature among modern scleractinians but widespread among earliest solitary anthozoans, including many Triassic scleractinians, and also Paleozoic rugosans (Stolarski, 1996). The striking similarity of Gardineriidae representatives to rugose corals, heighten by occasional occurrence of unique rugosan-like longitudinal septal grooves on epitheca (Fig. 8.4), lead the original description of Gardineria as rugosan (Pourtalès, 1868; 1871). Later, based on the cyclic septal insertion and aragonite skeletal mineralogy, it was transferred to Scleractinia (Duncan, 1885). 480 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals Figure 8.4. –Skeletons of representatives of the modern, deep-water scleractinian families Gardineriidae (A, C, F, H - Gardineria hawaiiensis – Norfolk 2, stn. DW2063) and Micrabaciidae (B, D, E, G, I - Letepsammia formosissima – Norfolk 2, stn. DW2032). The cyclical insertion pattern of septa in gardineriids and micrabaciids is typical of Scleractinia (A, B), however, both taxa show several unique features that distinguish them from other modern corals and between themselves. In Gardineria, the outer part of the skeleton consists of unique to modern corals, thick epithecal wall (C). In contrast, synapticular wall of micrabaciids is highly porous (D). Unique features of modern micrabaciids are the multiple bifurcations of septa of the third order, straight and nonbifurcate septa of the first order (B), and thickening deposits (TD) composed of irregular meshwork of short fibres organized into small bundles (G, I). In contrast, TD of Gardineria consists of fibres bundles formed by sequential addition of micrometer-sized growth layers. Distal (A, B), proximal (D), and lateral (C, E) views are shown. Transverse polished and etched sections (F-I) of septa of G. hawaiiensis (F, H) and L. formosissima (G, I) with Rapid Accretion Deposits (RAD) zone surrounded by bundles of TD. Scale bar represents 1 cm unless otherwise indicated. 481 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals Microstructurally, a central line of well-organized rapid accretion centres and radiating bundles of fibres formed by sequential addition of micrometer-sized growth layers characterize Gardineria septa. Distinctively from most deep-water scleractinians, which display aragonite fibres in large bundles (e.g., Desmophyllum) or in complex patterns (e.g., Flabellum) (Fig. 8.5), Gardineria septal microstructures typically form smaller, vesicular units. By contrast, micrabaciids have a light, lace-like skeleton with perforated wall and septa, and their polyps (edge-zone) completely enclose the corallum (Fig. 8.7). However, opposed to all shallow- and sympatric deep-water corals so far described, the thickening deposits of micrabaciids are composed of meshwork of short and extremely thin (ca. 100- 300 nm) fibres that show variable crystallographic orientation (Fig. 8.4) (Janiszewska et al., 2010). Composition of skeletal trace elements of micrabaciids and gardineriids are consistent with other modern deep-water corals (Meibom et al., 2008), although the Sr/Ca ratios measured from Letepsammia are at the high end of the range: Letepsammia - Mg/Ca = 1-2 mmol/mol, Sr/Ca = 11.5-12.2 mmol/mol; Stephanophyllia - Mg/Ca = 2.5-3 mmol/mol, Sr/Ca = 10.3-11.2 mmol/mol; and Gardineria - Mg/Ca = 1.7-3.5 mmol/mol, Sr/Ca = 9.3-11.7 mmol/mol. 8.4 DISCUSSION To date, only two studies tried to estimate the divergence date between Robusta and Complexa. The first estimation was based on the comparison of the average 16S rDNA sequence differences between Complexa/Robusta and holometabolous insect orders. This comparison suggested that the appearance of corals took place at least 300 Ma (Romano & Palumbi, 1996; Romano & Cairns, 2000). However, recent divergence time analysis of the Holometabola origin is placed in the early Carboniferous (355 Ma), significantly older than in previous reconstructions (Wiegmann et al., 2009). The second was based on branch lengths and molecular clock of complete mitochondrial genomes and estimated that the scleractinian skeleton originated between 240 and 288 Ma (Medina et al., 2006). In the latter analyses, the corallimorpharians appeared more closely related to the Complexa, than the Complexa to the Robusta, suggesting that the scleractinian skeleton may be 482 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals evolutionary ephemeral. However, all subsequent molecular phylogenetic studies having larger datasets in number of species placed corallimorpharians as sister scleractinian group (Fukami et al., 2004; 2008; Kitahara et al., 2010b). Figure 8.5. – Microstructural features of Letepsammia, Gardineria and other extant scleractinian corals. The SEM micrographs shown are of etched polished surfaces of septa. In addition to differences in the distribution of Rapid Accretion Deposits (RAD), major differences can also be seen in the arrangement of the thickening deposits (TD). In Letepsammia formosissima (A) TDs are composed of an irregular meshwork of fibres bundles oriented sub-parallel to the surface, whereas in Gardineria hawaiiensis (B) bundles of fibres (TD) form smaller, vesicular units. In Desmophyllum dianthus (C), Caryophyllia cyathus (D) and Favia stelligera (G), TDs consist of bundles of fibres perpendicular to the skeletal surface (in the case of the zooxanthellate coral F. stelligera, these display high regularity, corresponding to daily growth increments). TDs in Flabellum (E), Galaxea (F), and Acropora (H) show micro-laminar organization corresponding to the scale-like micro- texture of their skeleton surfaces. 483 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals 484 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals The divergence of the basal scleractinian clade suggested herein (ca. 425 Ma) places the evolutionary root of the Scleractinia deeper in the Paleozoic and refute the hypothesis that scleractinians directly descended from plerophylline rugosans (Schindewolf, 1942; Cuif, 1977; Stolarski, 1996). The deep scleractinian origin implied herein, allied to the existence of Paleozoic “scleractiniamorphs” (Scrutton, 1991; 1993; Ezaki, 1997; 2000) supports the monophyly of the order, with an independent origin from a soft-bodied ancestor. Recently, corallimorpharians have been repeatedly placed as scleractinian sister group (Fukami et al., 2008; Kitahara et al., 2010b). Phylogenetically they are older and may represent the evolutionary precursors of scleractinians (Fukami et al., 2008). Modern corallimorpharians have scleractinian-like anatomy (Daly et al., 2003), but their fossil preservation is problematic (Stanley, 2003). Nonetheless, actiniarian fossils were recently reported as far back as the Lower Cambrian (Hou et al., 2005; Han et al., 2010). To date, most anthozoan Paleozoic fossils were described from shallow-water environments. In contrast, deep-water fauna from Paleozoic oceans (especially those from the vast Panthalassa) still poorly known, although increasingly evidences suggest that these regions harboured many invertebrate groups (Wilson, 1999; Uchman, 2004). Therefore, Paleozoic sediments containing scleractinians may simply not yet been found or are not preserved in the geologic record. Kilbuchophyllids were recovered because shallow-water fossiliferous deposits were transported to greater depth as the result of land-slides. Consequently, the actual knowledge on Paleozoic scleractinians might not be representative of the true diversity of the group at that time, providing strong motivation to search for scleractinian fossils in pre-Triassic sediments. Figure 8.6. –Cladogram of the Bayesian majority rule consensus (BMC) of mitochondrial (16S rDNA) and nuclear (28S rDNA) sequences from 121 scleractinian corals and 1 corallimorpharian. Numbers beside nodes represent Maximum Likelihood scores (SH, Chi2, and Bootstrap) and BMC (posterior probability). Branch colour defines each family/clade recovered. Micrabaciidae and Gardineriidae representatives form a Basal scleractinian group, followed by the split between the Complexa and Robusta. Gray box identify each calibrated node and their respectively earliest fossil dates. Filled circles (●) denote colonial and open circles (○) denote solitary taxa. Filled squares (■) denote zooxanthellate and open squares (□) denote azooxanthellate taxa. On the right, outlines of coralla (main - distal, and small - lateral/colony views) of typical representatives of sequenced scleractinian families. 485 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals Alternatively, another hypothesis for the fossil gap is that the skeletal formation in these early corals might have been an ephemeral trait (Stanley & Fautin, 2001; Stanley, 2003). In modern corals, ephemerally skeletons can be linked to variations in environmental parameters, such as increased pCO2 and water temperature (Buddemeier & Fautin, 1996; Stanley & Fautin, 2001; Fine & Tchernov, 2007). It is not clear if such changes happened in the past at the right time to explain the disappearance of basal scleractinians from the fossil record in the Paleozoic. Irrespective of their phylogenetic position, modern azooxanthellate corals occurring below the carbonate compensation depth (currently deeper than 4.5–5 km), such as Leptopenus and Fungiacyathus, have very fragile and thin skeletons of low density (Fig. 8.7). This prompt me to suggest that it is only a matter of time before modern deep-water Scleractinia without skeletons are discovered based on the application of molecular techniques. It was recently suggested that some azooxanthellate scleractinian lineages originated from symbiotic, shallow-water ancestors (Barbeitos et al., 2010). Although the results presented herein do not challenge such scenario, the global picture of evolution of the order is different. Our findings advocate that the earliest shallow-water scleractinian representatives evolved from solitary, azooxanthellate ancestors. Supporting this hypothesis is the solitary or quasi-colonial (phaceloid) growth forms of all known Paleozoic scleractiniamorphs, suggested based on macromorphology to lack symbiosis (Coates & Jackson, 1987; Cowen, 1988). In fact, taking into account the deep Paleozoic divergence of Scleractinia shown herein, the use of the term “scleractiniamorph” to describe Paleozoic corals with morphology similar to modern scleractinians is unjustified and they should be referred to as true scleractinians. Additionally, the rapid proliferation of scleractinian lineages in the Middle Triassic proceeding in concert with radiation of dinoflagellates (MacRae et al., 1996) has various lines of evidence. Some Triassic corals bear isotopic or biochemical signatures of algal symbiosis (Stanley, 1995; Muscatine et al., 2005), and Triassic photosymbiosis between corals and dinoflagellates evolved in response to oligotrophic conditions (Riedel, 1991; Stanley & Schootbrugge, 2009). Therefore, it is very likely that the origins of zooxanthellae symbiosis, resulting in new metabolic pathways (Gattuso et al., 1999) and enhanced calcification rates (Pearse & Muscatine, 1971), were the main factors 486 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals of the successful emergence of early Mesozoic scleractinians and their remarkable diversity driven by photoadaptation requirements. Figure 8.7. –Of known scleractinians, representatives of Leptopenus (A, B) and Fungiacyathus (C, D) occur at the greatest depths (reaching depths >5000 m), consequently developing fragile and thin skeletons of low density. The upper two images (A, B) are of a formaldehyde preserved specimen of Leptopenus, the bulk of the animal being composed of soft tissue (brown); the delicate skeleton (white) is deeply embedded within the polyp tissue. The two lower images (C, D) show the extremely thin, parchment-like skeleton of Fungiacyathus. Proximal views. The deep Paleozoic appearance estimation presented herein, substantially pushes back scleractinian origin (>110 Ma), but does not provide insights into ancestral morphology, once gardineriids and micrabaciids differ fundamentally in terms of gross morphology and microstructure. The deep sea undoubtedly holds further clues of the evolution of this ecologically and economically important group of animals, which form the natural 487 CHAPTER 8 An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals frameworks for the biologically most diverse shallow and deep-water ecosystems in Modern Ocean. 488 CHAPTER 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) This is the first description of a complete mitochondrial genome sequence of a deep-water, solitary, azooxanthellate scleractinian and, at 19,429 bp, is the largest mt genome so far identified in any scleractinian coral. The genome contains 13 protein-coding genes, 2 genes encoding ribosomal RNAs, and 2 tRNA genes. Intergenic spacers total almost 9.5% of the genome, but further analyses are needed for the identification of the control region. All of the genes in the Gardineria hawaiiensis mt genome are on the same DNA strand, and most features of this mt genome, including the majority of protein initiation codons and the arrangement of genes are most similar to those of other scleractinians. However, the A+T content is significantly lower, and the rDNAs, IGS and COX1 I intron are slightly larger than those previously published for other scleractinian corals. In addition, TTG appears to be used as a start codon (in the case of the ND6 gene), the first such useage in any hexacorallian. The protein-coding genes of G. hawaiiensis are more similar in size to those of corallimorpharians than to those of other scleractinians, and transcribe all 62 amino acids having phenylalanine and arginine as the most and least frequently transcribed amino acid respectively. Phylogenetic analysis of 44 complete hexacorallian mt genomes sourced from GenBank or made available for the present study support monophyly of both scleractinians and corallimorpharians, unambiguously placing these as sister groups. In addition the phylogenetic analyses support the basal position of G. hawaiiensis within the Scleractina, emphasizing the importance of deep-water scleractinians for understanding the evolutionary history of the order. Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) 9.1 INTRODUCTION The mitochondrial (mt) genomes of anthozoan, more specifically scleractinian corals, have a distinctive and conserved gene order (Medina et al., 2006) but are atypical in terms of the presence of only 2 tRNAs (cf. >20 in Bilateria) (Boore, 1999; Beagley et al., 1998), relatively loose packing of the genes (van Oppen et al., 2002) and an extremely low rate of evolution in comparison to that of other animals, including other marine invertebrates (van Oppen et al., 1999; Shearer et al., 2002; Huang et al., 2008). It has been suggested that the slow rate of evolution of anthozoan mt genomes might be due to DNA repair, the evidence for this being the presence of a gene encoding one component of the mismatch repair system (msh1) in the mt genomes of several octocorals (Beagley et al., 1995), but note that this gene is not present in the mt genomes of hexacorallians. Although the slow rate of mt evolution in scleractinians limit its usefulness for population genetics and species phylogeny (Shearer et al. 2002; Hellberg 2006), there have been a few recent studies making use of mt genes or intergenic spacers (IGS) (e.g. Fukami et al., 2004, 2008; Chen et al., 2008; Stefani et al., 2008), and mt genomes (Brugler & France, 2007) to resolve closely related species or detect population differentiation, To date, complete mt genome sequences have been determined for 28 anthozoans (see Chen et al., 2008), 17 of which are shallow-water scleractinians, but these have not been extensively used to understand broad scale patterns of evolution. One of the few such studies that have been published is highly controversial; Medina et al. (2006) implied that corallimorpharians are scleractinians that have undergone skeletal loss, whereas the monophyly of the Scleractinia has more general support (see Brugler & France, 2007; Fukami et al., 2008; Kitahara et al., 2010b [chapter 5 and 10]). The emerging consensus is that the majority of deep-water scleractinian families proposed by classical morphological taxonomy are monophyletic (Kitahara et al. 2010a, b), and that deep-water representatives will be critical for unravelling broader patterns of coral evolution (Stolarski et al. submitted). One of the most unexpected results of inclusion of deep-water representatives into molecular phylogenies was the segregation of the families Gardineriidae and Micrabaciidae as the oldest scleractinian lineage. 490 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) Gardineriidae is defined by volzeioids with rudimentary or absent endotheca, and is one of the smallest of scleractinian families. To date this family comprises only five genera, of which Gardineria and Stolarskicyathus are extant (Stolarski, 1996; Cairns, 2004), and Rodinosmilia, Kraterostrobilos (?), and Adkinsella are exclusively fossil (Stolarski, 1996). Although comprising a total of only 9 species (Cairns, 2009), the extant gardineriids have been the subject of particular interest. Due to its unusual skeleton macrostructural features, the first extant gardineriid was described as Haplophyllia paradoxa (=Gardineria paradoxa) and placed amongst the long-extinct rugose corals. Before its description, Pourtalès (1868: 139) quoted: “the singular coral next to be described strikes one at first sight by its resemblance to some of the members of the group of the Rugosa”. However, subsequent studies on septal organization (serial in rugose corals and cyclic in scleractinians [Lindström, 1877]), resulted in the transfer of Haplophyllia to the scleractinian family Turbinoliidae (Duncan, 1885), which later was transferred altogether with Duncania and Gardineria to flabellids (Vaughan & Wells, 1943). Both Haplophyllia and Duncania were synonymized as Gardineria, and based on skeletal architecture and microstructure, Stolarski (1996) has proposed a fossil living status and family rank for Gardineria (Gardineriidae), followed by the description of the second extant genus in the family (Stolarskicyathus) (Cairns, 2004). To provide additional perspectives on anthozoan evolution, the complete mt genome sequence of Gardineria hawaiiensis was determined. This is the first complete mt genome sequence for an exclusively deep-water scleractinian, and is the largest mt genome so far identified in this order (19,429 bp). Broad scale patterns of evolution within the Anthozoa were investigated based on the nucleotide sequences of all of the protein-coding genes. 9.2 MATERIAL AND METHODS 9.2.1 SAMPLE COLLECTION AND DNA EXTRACTION The scleractinian Gardineria hawaiiensis (specimen # MVK-100) was collected on 25 October 2003 from nearly 600 m depth on Introuvable Bank, New Caledonia (SW Pacific; 491 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) 24°40’S, 168°39’E) during Norfolk 2 expedition by R/V Alis using waren-dredge. Upon collection, the specimen was preserved in high-grade ethanol. Specimen identification followed Cairns (1995). Tissue extraction was based on whole mesenteries (dissected out using forceps), and total genomic DNA was extracted using the DNeasy Tissue Kit (QIAGEN) following the manufacturer’s instructions. The concentration of genomic DNA extracted was measured using a Nanodrop 1000 (Thermo Scientific), and an aliquot of the genomic DNA was diluted to achieve the final concentration of 25ng/ul. Portions of rnl, rns and cox1 were firstly amplified with universal primers LP16SF and LP16SR (Le Goff-Vitry et al., 2004), ANTMT12SF and ANTMT12SR (Chen & Yu, 2002), and LCO1490 and HCO2198 (Folmer et al., 1994) respectively, followed by the scleractinian universal primers CS-1 to CS-21 (Lin et al., in press) that covered the entire mt genome. To obtain sequence from regions that did not yield product using the universal primers, nineteen specific primers were developed based on G. hawaiiensis sequences retrieved using universal primers (Tab. 9.1). Polymerase Chain Reaction (PCR) were carried out using the Advantage2 polymerase kit (Clontech) under the conditions recommended by the manufacturer, in a Bio-Rad DNA engine (Peltier Thermal Cycler). PCR conditions were: 95ºC for 5 min, then 30 cycles of 30 s at 94ºC, 60 to 90s at 54 to 60ºC (depending on the primers annealing temperature), 90 s at 72ºC, followed by 5 min at 72ºC. Amplicons ranged in size between ~600 to 2110 bp depending on the primers, and were purified using Mo-Bio Ultra Clean (PCR Clean Up) spin columns, and submitted to direct Sanger sequencing by Macrogen (South Korea). Table 9.1 - Primer names and sequences used for the amplification/sequence of the mitochondrial genome of Gardineria hawaiiensis. The position and amplicon length of primers designed in the present study or the reference for previously published primers are provided. Position (bp) Length Primer Sequence (5’ to 3’) or (bp) Reference MVK-1F GCTGGTGGATCTACCGTCTC 2102-2121 749 MVK-1R GAATGTGGACTGGGGTCACT 2837-2851 MVK-2F TTATGTCCGCTGAGCCTTTT 5148-5167 1150 MVK-2R TTTTCACCATCCTCTCTCGG 6279-6298 MVK-3F CCGAGAGAGGATGGTGAAAA 6279-6298 784 MVK-3R AGCCCCCATAAACAACAGC 7045-7063 MVK-4F GTGGGGGAACTGGCTCTT 8792-8809 900 492 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) Table 9.1 - Continued MVK-4R TCAAACCACACCCAACTCAA 9673-9692 MVK-5F TTGAGTTGGGTGTGGTTTGA 9673-9692 2073 MVK-5R CGCCTATTCTCACTCCAACC 11728-11746 MVK-5bF GGCGACTGGGTTCCATGGTT 9941-9960 1200 MVK-5bR CTATTAAGTGCCACCCCTCAGCATCC 11116-11141 MVK-6F ATGCCCCTATTTGTGTGGTC 13963-13982 2115 MVK-6R AAAGGAGGGGAAAGATGGAC 16059-16078 MVK-6bF GCCCATTGGTTGATCGGGTTT 14561-14582 750 MVK-6bR TGCTTCTCAAGAACCAACGCCAATAC 15286-15311 MVK-7F AAGTGTGTTAGGCAGGGGAAT 17389-17408 * MVK-8F CTCTTTGGGGTGGTCTTTGG 18695-18714 664 MVK-8R CCGTCTGCTTTATTCCTCTACA 19338-19359 LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) 710 HCO2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994) ANTMT12SF AGCCACACTTTCACTGAAACAAGG Chen & Yu (2002) 920 ANTMT12SR GTTCCCYYWCYCTYACYATGTTACGAC Chen & Yu (2002) LP16SR TCCCCAGGGTAACTTTTATC Le Goff-Vitry et al. (2004) * CS-F1 AAGCCATGTTAGTTAATCGAGTG Lin et al. (in press) 984 CS-R1 GATCAACCCAATCGAAACTTCA Lin et al. (in press) CS-F2 CCATTGCTTATCACAGTAGCT Lin et al. (in press) 1175 CS-R2 TAATGCATGGACAAAAAGCACC Lin et al. (in press) CS-F3 CATGTAGAGGGGTCAAATAGTCC Lin et al. (in press) 1266 CS-R3 CCAGATGAAAGTGCACCTAA Lin et al. (in press) CS-F4 GTGGCATTAGGAAGTCTTTGT Lin et al. (in press) 1031 CS-R4 ATGGGCTAATTGCAACCATA Lin et al. (in press) CS-F5 TTTGGGTAAGTGGTTGGTT Lin et al. (in press) 1019 CS-R5 GAATTAGTCAAGGCGATCAGA Lin et al. (in press) CS-F6 TATGATCATCTTCATGGTGTCG Lin et al. (in press) 1220 CS-R6 GGGATCAATATGCCCTCAAA Lin et al. (in press) CS-F7 GGCTTTTGATTTAGAGGGACA Lin et al. (in press) 1123 CS-R7 CTGCCCCAAAACTAATTCGA Lin et al. (in press) CS-F8 TTATGTTGGGTGTTGTAGCTG Lin et al. (in press) 994 CS-R8 TCTGCTGGCACTTAATTTGACG Lin et al. (in press) CS-F9 GGACCACCTTGCTTATGATG Lin et al. (in press) 1164 CS-R9 GGATGACATAAAACAGTTCGCA Lin et al. (in press) CS-F10 GTCGTAACATAGTGAGGGTGA Lin et al. (in press) 1110 CS-R10 TCTTGCAAACCCAAGTGTCA Lin et al. (in press) CS-F11 CGAGTTGGTATTGGCATTTTG Lin et al. (in press) 1098 CS-R11 CGCAACCATAATAGCTAAACCA Lin et al. (in press) CS-F12 CCAGGGACGTTTTATGGTCA Lin et al. (in press) 1228 CS-R12 GACCCCGCACTTAAGAACAATA Lin et al. (in press) CS-F13 GGTAAAACAACCGGATCGAG Lin et al. (in press) 968 493 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) Table 9.1 - Continued CS-R13 ACTAAATTCCAAGAACCCTCATG Lin et al. (in press) CS-F14 ATGGGGTTTCCTTATTTAACAGG Lin et al. (in press) 726 CS-R14 TTGAAGGCTAACGGTCTACT Lin et al. (in press) CS-F15 CATGAGGGTTCTTGGAATTTAGT Lin et al. (in press) 1036 CS-R15 TAACATACTGAAGGCTGTACCG Lin et al. (in press) CS-F16 TTAGGTTAAAGTAGACCGTTAGCC Lin et al. (in press) 1018 CS-R16 ATCCGTTAAAAGCATGGTTATGG Lin et al. (in press) CS-F17 GGATGAACGGTTTATCCTCCT Lin et al. (in press) 1508 CS-R17 GCAGTAAAATATGCTCTTGTGTCC Lin et al. (in press) CS-F18 GGACACAAGAGCATATTTTACTG Lin et al. (in press) 976 CS-R18 CTACTTACGGAATCTCGTTTGA Lin et al. (in press) CS-F19 GTGAGTCATCGGGCTCATG Lin et al. (in press) 1065 CS-R19 ACAGTCTGTTCTACTACCAAGC Lin et al. (in press) CS-F20 GCTTGGTAGTAGAACAGACTGT Lin et al. (in press) 1013 CS-R20 AACATCGAGGTCGCAAACAT Lin et al. (in press) CS-F21 AAAGCGTGGTAACACAGCTT Lin et al. (in press) 1062 CS-R21 CAACTGTGCAGACTTTCCAA Lin et al. (in press) 9.2.2 SEQUENCE ANALYSIS AND ANNOTATION OF THE COMPLETE MITOCHONDRIAL GENOME Sequences were verified and assembled using Sequencher 4.8 (Gene Codes Corporation) and then analysed in Vector NTI 6.0 (InforMax, Invitrogen life science software). Examination of open reading frames (ORFs) and codon usage, as well as other DNA statistics were performed using Dual Organelle Genome Annotator (Wyman et al., 2004) and Sequence Manipulation Suite v.2 (Stothard, 2000). The identified protein coding and rDNAs genes were aligned to previously published scleractinian mitochondrial genes (e.g. van Oppen et al., 2002; Medina et al., 2006; Flot & Tillier, 2007; Chen et al., 2008) using ClustalW v. 2 (Larkin et al., 2007). Secondary structures were predicted using default search mode of Dual Organelle Genome Annotator (Wyman et al., 2004). Tandem repeat sections were searched in the two largest intergenic spacers (IGS-2 and IGS-12) using Tandem Repeat Finder (Benson, 1999). 494 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) Figure 9.1 - Map of primer locations used in the present study. Names in red indicate primers developed specifically for Gardineria hawaiiensis mt genome amplification/sequencing. Arrows indicate directions of primers (F = forward; R = reverse). 9.2.3 PHYLOGENETIC ANALYSIS Based on all 13 protein-coding genes from 44 hexacorallian mt genomes (Tab. 9.2) a series of phylogenetic analysis were carried out. Concatenated sequences (excluding start/stop codons) were aligned using ClustalW v. 2 (Larkin et al., 2007) and manually verified/edited using JalView v. 8.0 (Clamp et al., 2004). Final alignment total 11,298 bp and the most appropriate model of nucleotide substitution was determined by the hierarchical likelihood ratio test implemented in MrModeltest (Nylander, 2004). Phylogenetic analyses were performed using PhyML (Guidon & Gascuel, 2003) for maximum likelihood (ML) and MrBayes version 3.1.2 (Huelsenbeck & Ronquist, 2001) for Bayesian Inference (BI). The maximum likelihood analyses were performed under the GTR model with a non-parametric Shimodaira-Hasegawa-like procedure. For the Bayesian inference, two runs each of 10 million generations were calculated for each marker with topologies saved at each 1,000 generations, with the average standard deviation of split frequencies between runs of each marker converging to less than 0.01. The first quarter of the 10,000 saved topologies were discarded as burnin, and the remaining used to calculate posterior probabilities. 495 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) Table 9.2 - Classification and information for the 44 complete mitochondrial genomes analysed in the present study. Order Species GenBank # Reference Actiniaria Metridium senile NC000933 Beagley et al. (1995) Nematostella sp. NC008164 Beagley et al. (1995) Antipatharia Chrysopathes formosa DQ304771 Brugler & France (2007) Corallimorpharia Actinodiscus nummiformis - Chen unpublished data Amplexidiscus fenestrafer - Chen unpublished data Corallimorphus profundus - Chen unpublished data Corynactis californica - Chen unpublished data Discosoma sp. “1” NC008071 Medina et al. (2006) Discosoma sp. “2” NC008072 Medina et al. (2006) Pseudocorynactis sp. - Chen unpublished data Ricordea florida NC008159 Medina et al. (2006) Ricordea yuma - Chen unpublished data Rhodactis indosinensis - Chen unpublished data Rhodactis mussoides - Chen unpublished data Rhodactis sp. NC008158 Medina et al. (2006) Scleractinia Acropoara tenuis NC003522 van Oppen et al. (2002) Agaricia humilis NC008160 Medina et al. (2006) Alveopora sp. - Chen unpublished data Anacropora matthai NC006898 Tseng et al. (2005) Astrangia sp. NC008161 Medina et al. (2006) Astreopora explanata - Chen unpublished data Astreopora myriophthalma - Chen unpublished data Colpophyllia natans NC008162 Medina et al. (2006) Euphyllia ancora - Chen unpublished data Fungiacyathus stephanus - Chen unpublished data Gardineria hawaiinesis - Present study Goniopora columna - Chen unpublished data Isopora palifera - Chen unpublished data Isopora togianensis - Chen unpublished data Madracis mirabilis - Chen unpublished data Madrepora oculata - Chen unpublished data Montastraea annularis NC007224 Fukami & Knowlton (2005) Montastraea faveolata NC007226 Fukami & Knowlton (2005) Montastraea franksi NC007225 Fukami & Knowlton (2005) Montipora cactus NC006902 Tseng et al. (2005) Mussa angulosa NC008163 Medina et al. (2006) Pavona clavus NC008165 Medina et al. (2006) Pocillopora eydouxi NC009798 Flot & Tillier (2007) Polycyathus sp. - Chen unpublished data Porites okinawanesis - Chen unpublished data Porites porites NC008166 Medina et al. (2006) Seriatopora caliendrum EF633601 Chen et al. (2008) Seriatopora hystrix EF633600 Chen et al. (2008) Siderastrea radians NC008167 Medina et al. (2006) 496 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) 9.3 RESULTS AND DISCUSSION 9.3.1 ORGANIZATION AND GENE CONTENT At 19,429 bp, the mt genome of Gardineria hawaiiensis is the largest scleractinian mt genome determined to date. As is true for most hexacorallians (see Chen et al., 2008), the mt genome of Gardineria hawaiiensis contains 13 protein-coding genes, 2 rDNAs, and 2 tRNAs, and all of the genes are transcribed from the same strand (Fig. 9.2). The mt genome of G. hawaiiensis is intermediate in size between those of corallimorpharians (which are ~21 kb) and those of scleractinians (the mt genomes of Robust scleractinians are typically ~17 kb). The intermediate size of the mt genome is consistent with morphological (Stolarski, 1996) and molecular (Kitahara et al., 2010b [chapter 5 and 8]) data, which imply that gardineriids represent the most deeply diverging extant scleractinian lineage. Figure 9.2 - Mitochondrial gene map of the scleractinian Gardineria hawaiiensis. Arrow indicates the direction of transcription, and scaling is only approximated. Protein-coding, tRNA, and rDNA genes are abbreviated as in the text. Blank regions between genes represent intergenic spacers. The ND5 intron is indicated by the inside black curve. 497 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) Of the 13 protein-coding genes, 7 encode NADH dehydrogenase subunits (ND1-6, ND4L), 2 encode the subunits 6 and 8 of ATP synthase (ATP6 and ATP8), 1 encodes cytochrome b (COB), and 3 encode subunits of cytochrome oxidase (CO1-3). In addition, the G. hawaiiensis mt genome contains the transfer RNA genes associated with methionine (trnM) and tryptophan (trnW), and the small (rns) and large (rnl) subunit ribosomal DNA genes. Gene order is as in all other scleractinians (van Oppen et al., 2002; Fukami & Knowlton, 2005; Tseng et al., 2005; Medina et al., 2006; Flot & Tillier, 2007; Chen et al., 2008), but the rDNAs, IGS and CO1 I intron are slightly larger than those previously published for other scleractinian corals (Tab. 9.3). The ND5 gene is interrupted by an intron that contains 11 genes (Fig. 9.2). ND5 and CO1 group I intron, and IGSs total 380, 1,142 and 1,889 bp respectively. The ND4 and rns loci overlap by a single base and the ATP8 and CO1 overlap by 18 bp. Table 9.3 - Mitogenomic organization of Gardineria hawaiiensis. Region Position Length AT% Start/Stop IGS* (bp) codon ND5 (5’) 1-720 720 61.8 GTG/Donor TA 0 Group I intron (5’) 721-1002 282 61.7 - 0 ND1 1003-1983 981 60.3 ATG/TAA 70 (IGS-1) COB 2055-3251 1197 60.0 ATG/TAG 371 (IGS-2) ND2 3624-4721 1098 59.9 ATG/TAA 66 (IGS-3) ND6 4789-5403 615 63.4 TTG/TAG 22 (IGS-4) ATP6 5427-6125 699 63.1 ATG/TAA 77 (IGS-5) ND4 6204-7655 1452 63.5 GTG/TAG -1 rns 7654-9217 1564 56.9 - 125 (IGS-6) CO3 9344-10132 789 60.4 ATG/TAA 40 (IGS-7) CO2 10174-10911 738 60.2 ATG/TAG 160 (IGS-8) ND4L 11073-11372 300 64.0 GTG/TAA 16 (IGS-9) ND3 11390-11746 357 59.3 GTG/TAG 0 Group I intron (3’) 11747-11844 98 68.3 - 0 ND5 (3’) 11845-12960 1116 60.5 +1/TAG 103 (IGS-10) trn-W 13065-13134 70 45.7 - 35 (IGS-11) ATP8 13171-13434 264 69.7 ATG/TAA -18 CO1 13416-16140 1584 59.3 ATG/TAG 717 (IGS-12) trn-M 16859-16942 84 36.9 - 2 (IGS-13) rnl 16945-19344 2400 58.3 - In relation to NAD5 (5’) 85 (IGS-14) CO1 - intron 14310-15451 (?) 1142 61.2 - - * Intergenic spacers (IGS) refer to intergenic bases between the gene on the same line and the gene on the line underneath. The sense strand of the mt genome of G. hawaiiensis is composed of 23.6% A, 14.7% C, 25.2% G, and 36.1% T. However, at 59.7% the (A+T)-content is significantly lower than in 498 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) other scleractinians (e.g. Pocillopora damicornis [~70.2% - Chen et al., 2008], Astrangia sp. [68.3% - Medina et al., 2006]), but varies among different regions, ranging from 36.9% for trnM to 69.7% for ATP8. 9.3.2 CODON USAGE The 13 protein-coding genes in the mt genome of G. hawaiiensis comprise 3,945 codons (Fig. 9.3). All 62 amino acid codons are used, UUU (Phenylalanine) and CGC (Arginine) being the most and least frequently used codons respectively (Table 9.4). For most amino acids, codon use is strongly biased especially for those with T at the third position. The majority of anthozoan mt genes have ATG as start codon (van Oppen et al., 2002). In G. hawaiiensis 8 of the 13 protein coding genes use methionine (ATG) as translation initiation codon, while ND3-ND5 and ND4L use valine (GTG) and ND6 has a leucine (TTG). The use of GTG as start codon has been documented for other scleractinians (e.g. Acropora tenuis, Pocillopora damicornis, Seriatopora hystrix), but this is the first case of the use of a TTG start codon for any cnidarian. Leucine as start codon has been documented for prokaryotes (Blattner et al., 1997) and Porifera (Erpenbeck et al., 2006). Interestingly, for the sponge Amphimedon queenslandica TTG serves as start codon for ND6, as in G. hawaiiensis. Figure 9.3 - Overall codon use in protein-coding loci present in the mt genome of Gardineria hawaiiensis. 499 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) As in other cnidarians, all of the protein-coding genes in G. hawaiiensis have complete (TAG or TAA) stop codons but, unlike other scleractinians, TAG more frequently serves as stop codon in G. hawaiiensis (in other scleractinians TAA is more often used; e.g. Flot & Tillier, 2007). Table 9.4 - Total number of occurrences of each codon in the 13 protein-coding genes of Gardineria hawaiiensis. Protein coding genes aa codon NAD5 NAD1 COB NAD2 NAD6 ATP6 NAD4 CO3 CO2 NAD4L NAD3 ATP8 CO1 Ala GCG 10 7 0 6 6 3 9 2 5 5 2 1 9 GCA 4 2 2 2 3 1 1 2 2 1 0 0 6 GCT 16 15 9 19 7 6 14 8 6 3 1 0 18 GCC 13 5 4 7 3 4 7 3 2 0 1 1 4 Cys TGT 9 1 4 6 3 1 6 4 2 0 1 1 1 TGC 0 1 1 0 0 0 1 0 1 1 2 0 0 Asp GAT 10 4 7 4 4 3 7 3 11 1 1 1 14 GAC 4 0 2 0 1 1 2 0 3 0 1 1 2 Glu GAG 8 7 5 3 2 1 9 6 6 3 5 1 6 GAA 5 4 5 3 6 4 6 2 8 1 3 2 2 Phe TTT 40 26 36 23 21 22 46 24 13 5 16 6 43 TTC 9 0 4 1 1 0 3 5 2 0 3 0 4 Gly GGG 30 14 19 22 5 8 20 13 4 3 6 1 29 GGA 2 4 5 5 7 1 6 4 3 2 3 3 12 GGT 14 2 10 6 4 9 11 7 4 5 2 0 17 GGC 4 3 2 3 1 4 5 0 1 0 1 0 3 His CAT 10 2 7 4 2 5 7 9 4 1 0 0 13 CAC 4 2 3 1 0 1 2 2 2 0 0 4 3 Ile ATA 15 12 9 8 9 8 18 4 7 4 1 3 16 ATT 20 12 15 13 11 9 28 11 9 8 5 0 21 ATC 7 2 5 4 3 3 1 0 2 3 1 1 2 Lys AAG 6 3 4 3 1 1 3 2 2 0 0 7 2 AAA 12 6 4 8 2 3 12 1 5 2 2 5 7 Leu TTG 32 13 17 23 6 12 24 7 13 0 5 7 22 TTA 42 22 21 23 14 21 33 11 12 10 8 1 23 Leu CTG 3 2 6 2 2 1 2 3 1 1 2 1 1 CTA 10 3 2 2 3 1 4 3 1 0 0 2 6 CTT 8 6 8 12 2 2 13 1 1 6 2 0 10 CTC 2 2 2 1 1 3 2 2 0 0 1 3 2 Met ATG 17 11 8 7 8 9 12 5 6 5 1 1 22 Asn AAT 10 6 7 5 4 6 6 1 6 1 1 1 10 AAC 7 1 4 1 1 0 5 1 1 1 0 1 6 Pro CCG 5 5 6 2 0 2 4 0 4 0 2 0 5 CCA 2 2 4 1 0 1 3 1 1 0 1 1 7 CCT 9 7 9 5 4 4 11 4 3 0 2 1 8 CCC 3 1 6 3 3 2 0 5 3 0 1 1 5 Gln CAG 4 1 3 0 0 0 2 1 2 0 1 0 1 CAA 10 4 5 6 3 3 8 8 2 1 1 3 5 Arg AGG 6 1 0 1 1 3 2 1 1 0 0 0 0 AGA 4 3 3 4 2 1 5 2 3 3 0 1 4 Arg CGG 1 4 2 2 1 0 1 1 1 1 0 2 1 CGA 3 0 5 0 2 0 0 0 1 1 2 0 2 CGT 0 0 2 0 0 1 6 1 0 0 1 0 1 CGC 0 0 2 0 1 0 0 0 0 0 0 0 1 Ser AGT 7 10 5 13 2 4 6 9 2 0 1 2 8 AGC 3 0 3 1 0 0 1 1 2 0 1 0 1 Ser TCG 6 6 4 6 1 2 4 4 2 2 1 0 5 TCA 0 1 4 2 0 4 0 3 2 1 1 0 3 TCT 28 6 10 14 2 5 13 8 8 3 3 0 12 TCC 7 2 4 1 2 0 4 0 0 0 2 0 1 Thr ACG 6 0 1 3 0 2 2 1 0 0 0 2 9 ACA 7 3 2 4 3 5 6 0 5 3 0 1 4 ACT 17 5 8 5 3 4 10 11 3 0 0 3 15 ACC 3 3 2 1 1 1 3 2 1 0 1 0 3 Val GTG 13 11 15 11 2 8 12 7 6 4 2 1 13 GTA 8 7 8 5 2 5 4 3 7 0 0 0 7 GTT 29 18 13 18 10 6 21 19 12 1 7 6 17 GTC 13 5 4 5 5 8 2 2 3 1 3 0 7 Trp TGG 6 4 5 5 2 1 6 4 4 0 2 2 10 TGA 5 3 7 3 2 1 3 7 1 1 2 3 7 Tyr TAT 18 9 17 14 6 6 13 10 8 3 3 4 20 TAC 5 4 2 0 1 0 4 0 1 1 1 0 3 End TAG 1 0 1 0 1 0 1 0 1 0 1 0 1 TAA 0 1 0 1 0 1 0 1 0 1 0 1 0 500 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) 9.3.3 PROTEIN-CODING AND RNA GENES On general, the protein-coding genes of G. hawaiiensis are more similar in size to those of corallimorpharians (Tab. 9.5) than to those of other scleractinians. However, some exceptions to this are CO2, ND4 and ND5, which in G. hawaiiensis are smaller than in corallimorpharians and representatives of the scleractinian Complex clade. The G. hawaiiensis ATP8, COB and rns loci are larger than in any other anthozoan studied to date, the rns exceeding by more than 100 bp that of Zoanthus sp. The ND4 and ATP8 loci overlap with rns (1 bp) and CO1 (18 bp) respectively. Table 9.5 - Length of protein coding and the two ribosomal DNA genes (in nucleotides) of 9 Hexacorallia. Only partially sequenced genes are denoted by (+). Gene Hexacorallia Antipatharia Actiniaria Zoanthidea Corallimorpharia Scleractinia Basal Complex Robust Chrysopathes Metridium Zoanthus Rhodactis Discosoma Gardineria Acropora Montastraea Seriatopora formosa senile sp. sp. sp. hawaiiensis tenuis faveolata hystrix rnl 2588 2189 1765+ 2348 2342 2400 2261 1973 1904 rns 1168 1082 1441 1240 1068 1564 1176 903 916 CO1 1593 1593 1593 1581 1581 1584 1602 1578 1548 CO2 750 747 - 756 756 738 744 708 759 CO3 750 789 789 789 789 789 780 780 780 ND1 984 1005 - 984 984 981 948 948 978 ND2 1146 1158 1158 1098 1098 1098 1098 1287 1092 ND3 357 357 - 357 357 357 357 342 345 ND4 1476 1476 - 1413 1476 1452 1476 1440 1446 ND5 1851 1803 - 1839 1839 1836 1836 1815 1839 ND6 633 609 - 612 615 615 594 561 564 ATP6 714 690 699 699 699 699 699 678 678 ATP8 213 219 219 210 210 264 219 198 237 ND4L 300 300 300 300 300 300 300 300 300 COB 1143 1182 648+ 1161 1161 1197 1155 1140 1140 The boundaries of the G. hawaiiensis ribosomal RNA genes were deduced by comparison with data for other anthozoans and, with the exception of rnl of the antipatharian Chrysopathes formosa, these are the largest known anthozoan rRNA loci. As in most Scleractinia, only two transfer RNA genes were detected: trnM (methionine) and trnW (tryptophan). The putative secondary structures for these mt tRNAs of G. hawaiiensis are shown in figure 9.4. 501 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) Figure 9.4 - The 2 inferred tRNA genes folded into the typical cloverleaf structures. A - trnM and B - trnW. 9.3.4 NON-CODING REGIONS The mt genome of G. hawaiiensis has 14 intergenic spacers totalling 1,818 nucleotides, or almost 9.5% of the total size of the mt genome, with five of the 14 (IGS-2 (371 bp), IGS-6 (125 bp), IGS-8 (160 bp), IGS-10 (103 bp) and IGS-12 (717 bp)) accounting for >80% of these non-coding regions. van Oppen et al. (2002) argued that the IGS between rns and CO3 of the A. tenuis mt genome has several features characteristic of control regions of higher animals (i.e. repetitive sequences; conserved sequence blocks; and secondary structure associated with the initiation of heavy-strand replication). However, Brugler & France (2007) did not find any of these features in the mt genome of C. formosa concluding that this IGS is unlikely to represent a control region in Antipatharia. Interestingly, in the case of pocilloporids the IGR between ATP6 and ND4 may be the control region (Flot & Tillier, 2007; Chen et al., 2008), as it contains repeated elements and potential hairpin structures. In the case of the sponge A. queenslandica, the longest non-coding region of the 502 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) mt genome contains repeated sequences and resembles the control region of higher Metazoa (Erpenbeck et al. 2006). However, in the case of G. hawaiiensis, both non-coding regions larger than 200 bp contain neither repeated elements nor conserved motifs. However, the IGS-2 of G. hawaiiensis has a high degree of similarity to non-coding regions in some other scleractinians and corallimorpharians (data not shown). The expected (E) values in Blast analyses (Altschul et al., 1997) to non-coding regions within the mt genomes of Siderastrea radians, Ricordea florida, Rhodactis sp., and Porites porites ranged from 6e-63 to 6e-50 (ordered by similarity). However, further investigation is needed to find the most likely control region of the mt genome of G. hawaiiensis. 9.3.5 PHYLOGENETIC ANALYSIS A series of phylogenetic analysis were performed to verify the basal position of Gardineria hawaiiensis within scleractinians (Kitahara et al., 2010b - chapters 5 and 8) and to test the “naked coral” hypothesis (Stanley & Fautin, 2001; Medina et al., 2006). In total, 44 mitochondrial genomes were included in the analysis comprising all of the (23) hexacorallian mt genome sequences available via GenBank, as well as the mt genome of Gardineria hawaiiensis and 20 unpublished mt genomes (8 corallimorpharians and 12 scleractinians - provided by Dr. Chen, C. A.) (Tab. 9.2). The analysis included representatives of all hexacorallian orders, except Zoanthidea and Ceriantharia, for which complete data are not available at this time. Following Erpenbeck et al. (2006), Brugler & France (2007) and Kitahara et al. (2010b), representatives of the Actiniaria were used as outgroup. The final alignment consisted of 11,298 bp and did not include stop codons, IGS or ribosomal data. In the Bayesian analyses, both runs converged with less than 1 million generations having the average standard deviation of split frequencies of less than 0.015. Both Bayesian and Maximum Likelihood (ML) analyses produced a single unequivocal topology with all nodes fully supported (100%) and in which Antipatharia is basal in relation to corallimorpharians and scleractinians (Fig. 9.5), sharing a common ancestor with them. The position of C. formosa suggests that the acquisition of a proteinaceous skeleton 503 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) preceded the “invention” of an aragonitic skeleton by the scleractinians. In addition, both corallimorpharians and scleractinians comprise monophyletic groups, supporting the hypothesis of a single soft-bodied ancestor (chapters 5 and 8), but challenging the “naked coral” hypothesis (Stanley & Fautin, 2001; Medina et al., 2006). Figure 9.5 - Phylogeny reconstruction (Bayesian inference) based on all of the mt protein- coding genes (nucleotide sequences) of representative taxa. Colored boxes represent each one of the 4 hexacorallian orders examined (dark-blue = Actiniaria; light-blue = Antipatharia; green = Corallimorpharia; and yellow = Scleractinia). Vertical bars beside scleractinian representatives indicate species pertaining to the Basal, Complex and Robust clades. All nodes have 100% support from Bayesian inference and Maximum Likelihood (100 bootstrap), unless otherwise indicated. Interestingly, the most basal lineages in both corallimorpharians and scleractinians are composed of exclusively deep-water azooxanthellate taxa (i.e. Corallimorphus profundus and Gardineria hawaiiensis respectively). These results support the idea that extant shallow-water representatives of these orders had deep-water ancestors. In addition, following Kitahara et al. (2010b - chapter 5) and Stolarski et al. (submitted - chapter 8) the 504 Chapter 9 The complete mitochondrial genome of Gardineria hawaiiensis (Cnidaria, Anthozoa, Scleractinia) “Basal scleractinian clade” is fully supported irrespective of the phylogenetic reconstruction method applied, demonstrating that gardineriids are key species for the understanding of scleractinian evolution (Chapter 10). All other scleractinians surveyed fall within the Complex or Robust coral clades. Fungiacyathidae (1), Poritidae (4), Siderastreidae (1), Euphyllidae (1), Agariciidae (2), and Acroporidae (7) compose the Complex group, while Oculinidae (1), Pocilloporidae (4), Caryophylliidae (1), Rhizangiidae (1), Faviidae (4), and Mussidae (1) represent the Robust coral clade. However, Alveopora sp. and Colpophyllia natans have more affinities with Acroporidae and Mussidae respectively, than to their taxonomically based families (Poritidae and Faviidae). The paraphyletic status of both families was previously demonstrated by molecular phylogenetic reconstructions of the order (e.g. Fukami et al., 2008; Huang et al., 2009; Kitahara et al., 2010b [Chapter 5]). Further descriptions, comparisons, and utilization of complete mt genomes will improve our understanding on Anthozoa evolution, particularly once sampling includes additional deep-water representatives. The results presented here demonstrate the usefulness of mitochondrial sequence data for resolving relationships at the level of order and family, but further information (taxa) is needed to clarify the value of such approaches at taxonomic ranks below family. 505 506 This page is intended to be blank CHAPTER 10 Synthesis, major conclusions, and future directions The systematic classification of scleractinian corals based on morphological characters represents a challenge in several ways. Such challenges pose major limitations to the development of a consistent phylogenetic classification system for the order. Despite this, to date, morphological characters have traditionally been the basis of classification schemes, and are still broadly used. More recently, however, molecular- based phylogenetic analyses have revolutionized our understanding of scleractinian evolution, resulting in substantially different evolutionary hypotheses when compared to the morphological schemes. This thesis contributes to our knowledge of various aspects of the systematics and evolution of the scleractinian corals, and most importantly demonstrate that the deep-water representatives of this order undoubtedly holds further clues of the evolution of this ecologically and economically important group of animals, which form the natural frameworks for the biologically most diverse shallow and deep- water ecosystems in Modern Ocean. The results and hypotheses presented in this thesis enhance our understanding and raise new questions about the “real” diversity of deep- water scleractinian corals in the southern hemisphere, highlight the importance of underwater geomorphology for the occurrence of these anthozoans, underscore the reciprocally informative and complementary nature of molecular and morphological approaches to coral systematics, shed new light into the evolutionary origins of extant corals, and its implications for coral taxonomy. Ultimately and linking all chapters of the present thesis, below is provided a synthesis of the major results of each chapter, that altogether are the basis for my hypothesis that climate change was probably the driving force behind the colonization of deep-waters by azooxanthellate scleractinian corals more than 450 Mya. At last, a brief section on future directions for coming studies is also provided. CHAPTER 10 Synthesis, major conclusions, and future directions 10.1 OVERALL SUMMARY OF EACH CHAPTER 10.1.1 NEW CALEDONIAN AZOOXANTHELLATE CORALS Research on hard corals from the New Caledonian region has been primarily focused on shallow-water zooxanthellate species. In total size, the structures made by this scleractinian fauna form the second largest coral-reef site in the world (Mittermeier et al., 1996). However, although constituting one of the most sampled deep-water sites in the world, the species diversity of azooxanthellate corals below 100 m from this archipelago was largely unknown. Intending to demonstrate how diverse the azooxanthellate scleractinian fauna is within the New Caledonian Economic Exclusive Zone (EEZ), and how important this area is for the knowledge regarding the western Pacific azooxanthellate corals, the chapter 2 of the present thesis provides an extensive literature review that revealed the occurrence of 62 azooxanthellate species (excluding those not identified to species level) previously reported to this region. In addition, over 3,000 unstudied specimens collected during French expeditions between 1984 and 2004 were examined. Resulting from this collection, a total of 108 species of azooxanthellate Scleractinia are for the first time reported from this region. The descriptions of one new genus (Faustinotrochus) and eight new species are included in this chapter. For each of the 170 New Caledonian azooxanthellate scleractinian species, a complete junior synonym list, the type locality and type material, geographic and bathymetric distribution, new records, detailed description, and a brief discussion are provided. Starting from the premises that a taxonomic framework is essential to much of biology and that solid and reliable taxonomic information is essential for the interpretation of molecular phylogenies, the taxonomic review provided in chapter 2 is the basis for all other chapters of the present thesis. Apart from providing a framework for future studies dealing with this fauna, this chapter is of central importance for the present thesis because most of the sequences from deep-water representatives used to reconstruct the evolutionary history of the order (chapters 4, 5, 6, 7, 8, and 9) were obtained from them. In other words, it was of critical importance to know exactly from which species the molecular sequences were obtained and used to reconstruct the evolutionary history of the scleractinian corals. Additionally, illustrating the reciprocally informative and 508 CHAPTER 10 Synthesis, major conclusions, and future directions complementary nature of molecular and morphological approaches to coral systematics, following Kitahara et al. (2010b [chapter 5]) and Stolarski et al. (submitted [chapter 8]), the order of species descriptions in chapter 2 was arranged phylogenetically based on the results acquired from the molecular analysis. 10.1.2 NEW CALEDONIA AS A CENTRAL “HOT-SPOT” FOR AZOOXANTHELLATE SCLERACTINIANS In contrast to shallow-water zooxanthellate corals, to date only few studies have explored biogeographic patterns of azooxanthellate corals. Most of these studies had focused on Atlantic fauna (e.g. Cairns & Chapman, 2002; Dawson, 2002), which is the best-known region for deep-water scleractinians. Chapter 3 of the present thesis represents the first attempt to understand the zoogeographical affinities of the western Pacific azooxanthellate corals. In this chapter, all previous records of these organisms from the western Pacific were compiled, and were assigned to 8 geographical macroregions (i.e.: 1 - Japan; 2 - Philippines and Indonesia; 3 – Northern Australia; 4 – Australian eastern seamounts; 5 – New Caledonia; 6 – Vanuatu and Wallis and Futuna Islands; 7 – Southern Australia; and 8 – New Zealand). For this study, 438 azooxanthellate scleractinians, representing nearly 61% of all known species of this “ecological” coral group, were included in a cluster analysis which used the unweighted pair-group average method (UPGMA) followed by a non-metric multi-dimensional ordination (MDS). Diversity accumulation curves suggest that the most sampled regions (Japan, Philippines/Indonesia, and New Zealand) have well characterized azooxanthellate scleractinian faunas. As a consequence, the respective species observed, as well as species estimate curves approached a plateau in each case. On the other hand, the shape of the species richness estimate curves for the other western Pacific regions imply that significantly more species are likely to be reported once more sampling be undertaken. Interestingly, the accumulation curve analysis suggests that New Caledonia will have in excess of 275 azooxanthellate scleractinian species, or more than 100 species are yet to be reported. Furthermore, the north Australian region is predicted in the present chapter 509 CHAPTER 10 Synthesis, major conclusions, and future directions to reach a total number of 245 species, being followed by Philippines/Indonesian region (210 spp.), Vanuatu/Wallis and Futuna (160 spp.), Japan and New Zealand (about 150 spp. each), Australian eastern seamounts (120 spp.), and south Australian region with predicted number of species not exceeding 100. Moreover, results from chapter 3 demonstrate that the New Caledonia azooxanthellate coral fauna (170 spp.) lies in species diversity between the large tropical Philippines/Indonesian region (208 spp.), and the high latitudinal New Zealand (114 spp.) and Japanese (116 spp.) regions. The known diversity in New Caledonia region represents 24% of the extant species of the group, making it one of the richest regions in the world for these hexacorallians, and by far the most rich in the southern hemisphere. Even having a more diverse azooxanthellate coral fauna than most of the other 7 western Pacific regions examined in this chapter, the New Caledonia EEZ has a dramatically lower number of stations (178) if compared within the well- sampled Philippines/Indonesian region (> 640 stations), and also has a much smaller area. The UPGMA and MDS cluster analysis presented in this chapter indicate three well- resolved clusters among the 8 western Pacific regions. Among them, the New Caledonia grouped with Australia eastern seamounts, Vanuatu, Wallis and Futuna Islands, and with New Zealand. These results are consistent with the idea that underwater geomorphology is one of the key factors dictating the diversity of azooxanthellate deep- water corals. In addition, a brief discussion of New Caledonian azooxanthellate corals distribution in correlation with potential abiotic factors such bathymetry, and other oceanographic aspects is provided. Together, these results indicate that New Caledonia warrants the status of “hot-spot” in relation to this endangered (see Guinotte et al., 2006) deep-water coral community. 10.1.3 INVESTIGATING THE MONOPHYLY OF THE GENUS CARYOPHYLLIA The family Caryophylliidae Dana, 1846 is represented by 89 valid genera. Of those, 38 are only known as fossil records, with the oldest dating from the Jurassic (about 180 Mya). The other 51 Recent genera of this family are ubiquitous through all oceans of the world, being recorded from shallow (Cairns et al., 2005) to deep (Squires, 1959) 510 CHAPTER 10 Synthesis, major conclusions, and future directions waters, from coastal Antarctic (Cairns, 1982) to the Arctic Circle (Roberts et al., 2003). Within this family, the exclusively azooxanthellate genus Caryophyllia is common worldwide and consists of 66 Recent valid species, being the most diverse Recent genus of azooxanthellate corals. All representatives of this genus are solitary, including forms firmly attached to the substrate, such as Caryophyllia berteriana Duchassaing, 1870, and others, such as Caryophyllia ambrosia Alcock, 1898, that detach at an early stage to continue a free life form on soft bottoms (sand or mud). Apart from providing a complete historical literature review of this genus, chapter 4 of the present thesis is the first chapter to include molecular results. However, it also contains a substantial body of classical taxonomy including an examination and description of all 23 Caryophyllia representatives from New Caledonia and Australia, including 6 new species, and the first identification key to all extant species of this genus is suggested. At the time the paper arising from this chapter was published, no phylogenetic analysis had been performed for any caryophylliid genera, despite the fact that these constitute by far the most diverse family of azooxanthellate Scleractinia. However, previously published molecular studies (Romano & Palumbi, 1996; Romano & Cairns, 2000; Le Goff-Vitry et al., 2004; see also chapter 5, 6, 7, and 8) suggested that the family is polyphyletic, having representatives grouping with the two major scleractinian clades: the “Robust” and “Complex” corals. In this chapter, with the aim of testing the hypothesis that Caryophyllia is a valid genus, 16S rDNA sequences were obtained from 12 Caryophyllia species, 7 representatives of morphologically related caryophylliid genera, and 14 representatives of non-caryophyllid families. Particular attention was given to embracing in the analyses Caryophyllia representatives that capture most of the range of morphological variation within the genus. Based on maximum likelihood and Bayesian inference, the phylogenetic analyses recovered a strongly supported clade containing all twelve Caryophyllia species together with representatives of two morphologically similar caryophyllid genera: Crispatotrochus and Dasmosmilia. 10.1.4 A COMPREHENSIVE PHYLOGENETIC ANALYSIS OF THE SCLERACTINIA 511 CHAPTER 10 Synthesis, major conclusions, and future directions Traditionally, the inference of evolutionary relationships among corals has relied heavily on comparing extant and fossil material in terms of micro- and macromorphological skeletal characteristics, but this has resulted in several very different schemes (Wells, 1956; Alloiteau, 1957; Chevalier & Beauvais, 1987; Veron, 1995). Attempts to establish phylogenetic relationships within coral families based on skeletal characteristics have proved to be challenging, and as a consequence have been applied to date to only six of the 27 extant families. During the last two decades, however, there have been various attempts to infer coral phylogeny based on molecular sequence data independent of skeletal morphology. These studies suggested quite different evolutionary scenarios for scleractinians, particularly in terms of relationships between suborders and families (Romano & Palumbi, 1996; Romano & Cairns, 2000; Fukami et al., 2008). However, at the time the results arising from this chapter was published, solitary azooxanthellate representatives had rarely been included in such analyses, despite accounting for approximately a third of the extant scleractinian species (Cairns, 2007). In an attempt to address these sampling biases and resolve some of the taxonomic uncertainties, chapter 5 endeavored to undertake the most comprehensive molecular phylogenetic study of the Scleractinia to date. Molecular sequence data were obtained for a fragment of the mitochondrial cytochrome oxidase subunit 1 gene for 65 deep- water azooxanthellate scleractinian species (most of which are detailed described in chapters 2 and 4), representing 25 genera and 9 families. With the inclusion of 11 novel sequences from shallow water corals kindly provided by Dr. Hironobu Fukami (Kyoto University) and 156 additional sequences from GenBank, the dataset covered all of the scleractinian suborders, comprising a total of 234 species from 104 genera representing 25 of the 27 extant families. Database sequences for corallimorpharians (11 species), actiniarians (2 species), zoanthids (3 species), an antipatharian, and octocorals (4 species) were also included in the analyses, and the latter was used as outgroup. Whereas the deepest dichotomy identified in previous molecular studies was the “Complex” / “Robust” split, the analysis presented in this chapter (see also chapter 8) also identified a deeply-diverging clade consisting of members of the exclusively azooxanthellate families Gardineriidae and Micrabaciidae. On the basis of this analysis, these are the oldest scleractinian families with extant representatives; both represent 512 CHAPTER 10 Synthesis, major conclusions, and future directions evolutionary lineages likely to have co-existed with rugose corals but, unlike the latter, survived the Permian/Triassic mass-extinction event. In addition, exclusively deep- water species also occupied a basal position in relation to both “Complex” and “Robust” coral clades. Finally, the data suggest that the order Corallimorpharia and Scleractinia are distinct lineages and are, therefore, inconsistent with the “naked coral” hypothesis, which implies that corallimorphs are corals that have undergone skeleton loss. 10.1.5 THE FIRST RECENT DEEP-WATER AGARICIIDAE REPRESENTATIVE Adopting the view that classification should be based on phylogeny, with species grouped on the basis of their evolutionary relationships, and on the premise that molecular phylogenetic principles have the potential to guide scleractinian taxonomy to classification schemes that better reflect the evolutionary history of the order, in applying morphological and molecular phylogenetic approaches to investigate the taxonomic position of the genus Dactylotrochus in the family Agariciidae as shown in chapter 5, the chapter 6 of the present thesis represents a first step towards resolving the taxonomic chaos within the family Caryophylliidae. Members of the coral family Agariciidae have a wide geographic distribution and are commonly reported on all major shallow-water coral reefs. Without exception, extant agariciids are zooxanthellate and form massive or laminar colonies. However, two fossil genera (Trochoseris and Vaughanoseris) are atypical in being solitary and most likely also having been azooxanthellate. The available molecular data imply that, with the possible exception of Pachyseris (Fukami et al., 2008; Kitahara et al., 2010b [chapter 5]), Agariciidae is a valid “Complex” coral family (Romano & Palumbi 1996; Romano & Cairns, 2000; Le Goff-Vitry et al., 2004; Kerr, 2005; Fukami et al., 2008; Barbeitos et al., 2010; Kitahara et al., 2010a, b [chapters 4 and 5]). In contrast with most other scleractinian families whose members are predominantly azooxanthellate, according to the results from chapters 4 and 5, the family Caryophylliidae appears not to be valid. 513 CHAPTER 10 Synthesis, major conclusions, and future directions One implication of the broad survey carried out by Kitahara et al. (2010b) is a close relationship between Dactylotrochus cervicornis, a solitary, deep-water coral until now classified in the Caryophylliidae, and the family Agariciidae. This unexpected grouping is of particular interest as it suggests a link between the extant colonial shallow-water and solitary azooxanthellate agariciids in the fossil record. Illustrating the reciprocally informative and complementary nature of molecular and morphological approaches to coral systematics, a range of molecular markers (mitochondrial 16S rDNA and CO1, and nuclear 28S rDNA) and morphological characters (macro- and micromorphology, and microarchitecture) were used to better understand this intriguing grouping. In the light of strong molecular support for the relationship between D. cervicornis and agariciids, supporting morphological criteria were sought and also identified. On these bases, in this chapter I proposed the transfer of D. cervicornis to the Agariciidae, making it the first extant, azooxanthellate, deep-water genus/species of this family. Furthermore, when considered together with the fossil agariciids from the Middle Cretaceous which were also solitary, the basal position of D. cervicornis in relation to all other extant Agariciidae included in the analysis supports the idea that the ancestor of this predominantly colonial and zooxanthellate coral family was solitary and azooxanthellate. 10.1.6 ELEVATING DELTOCYATHUS TO FAMILY RANK Partially reviewed on the basis of macromorphological characters and totalling 25 extant azooxanthellate species (Kitahara & Cairns, 2009 [chapter 2 in part]), the genus Deltocyathus is the third most speciose caryophylliid genus. With the earliest fossil record dating from the Paleocene (Goedert & Peckman, 2005) and now ubiquitous in all but polar oceans between depths from 44 to 5080 m, traditional macromorphological criteria are the basis for taxonomic assignment of this genus within caryophylliids. Nonetheless, the caryophylliid taxa surveyed in the molecular analysis scatter across at least 8 and 7 different clusters (based on cytochrome oxidase subunit 1 - Kitahara et al., 514 CHAPTER 10 Synthesis, major conclusions, and future directions 2010b [chapter 5] and 16S rDNA respectively – in part Stolarski et al., submitted [chapter 8] respectively) throughout the “Complex” and “Robust” coral clades in molecular phylogenies. To better understand the evolutionary position of Deltocyathus species, the CO1 and 28S rDNA sequences were concatenated and aligned with data for representatives of other families, resulting in a data matrix of 1215 bp that included 43 scleractinians (21 exclusively azooxanthellate) representing 35 genera belonging to 15 families. As part of the process of resolving the true affinities of caryophylliids, on the basis of combined molecular and fine-scale morphological data, chapter 7 shows that, with the sole exception of Deltocyathus magnificus, all of the Deltocyathus species examined form a monophyletic group with strong statistical support. In addition, with Anthemiphyllia patera costata the Deltocyathus clade forms a basal lineage amongst “Robust” scleractinians. On the other hand, irrespective of the locus or method of analysis used, D. magnificus always grouped with turbinoliids (Tropidocyathus lessoni and Cyathotrochus pileus) in the “Complex” coral clade. The examination of all of the available material failed to identify macro or fine-scale morphological characters that correlate with the position of D. magnificus in relation to Deltocyathus implied by molecular analyses. Morphologically, D. magnificus is a typical member of the genus, not only in terms of macro- and micromorphology but also in all of the microstructural characteristics identified. The only observation made that is unique to D. magnificus was the presence of soft tissue (edge zone) completely covering the skeleton, a trait not seen in any other congener examined (polyp terminate few millimetres beyond calicular edge), but interestingly present in all turbinoliids. If the grouping with turbinoliids is confirmed, this would be the first case of morphological convergence at macro- and microstructural level among scleractinian corals. Nonetheless, more in-depth microstructural and biogeochemical studies are pending (similar as those carried out by Janiszewska et al. [2011] for micrabaciids) in order to find some skeleton-embedded features that may settle position of D. magnificus either among “Robust” or “Complex” corals. The position of the well-supported Deltocyathus clade as the most basal lineage within the “Robust” corals in the analyses of molecular data and its genetic distance in relation to other Caryophylliidae representatives supports the proposal for its elevation to family rank. However, before additional in-depth microstructural and biogeochemical analyses 515 CHAPTER 10 Synthesis, major conclusions, and future directions are undertaken for Deltocyathus representatives (similar as those carried out by Janiszewska et al. [2011] for micrabaciids), in order to investigate if there is/are skeleton-embedded features that support the intriguing position of D. magnificus, the latter will be tentatively classified together with other Deltocyathus in the Deltocyathiidae fam. nov. 10.1.7 THE ANCIENT EVOLUTIONARY ORIGINS OF MODERN SCLERACTINIANS Corals are the subject of intense public and, therefore, media interest, particularly at present because of their ecological importance, our economic dependence on them and the uncertain fate of coral reefs in the face of ever increasing anthropogenic challenges. Despite these facts, we know remarkably little about the evolutionary history of corals. The origin of modern reef-building corals is obscure. Scleractinians suddenly appeared in the Middle Triassic (ca. 240 Ma), represented by a wide diversity of solitary and colonial forms (Roniewicz, 1993; Veron, 1995; Stanley, 2003). From the level of colony integration (Wells, 1956; Stanley, 2003) to the microstructure organization within individual corallites (see Roniewicz, 1989), the range of morphological variation in the Triassic fossils is comparable to that of modern scleractinians. Additionally, in fossil specimens in which aragonite is preserved, the coralla show at least four basic types of microstructural organization (Roniewicz, 1993). The extensive macro- and micro-morphological diversity seen in the Triassic scleractinians implies a Palaeozoic evolutionary history for the order despite the apparent absence of fossil support for this. To date, molecular evolutionary studies of scleractinians have been heavily biased towards zooxanthellate, shallow-water representatives (Romano & Palumbi, 1996; 1997; Romano & Cairns, 2000; Le Goff-Vitry et al., 2004; Fukami et al., 2008), and deep-water corals have been largely ignored. In chapter 8, I was able to reconstruct the deep evolutionary history of corals, by including many deep-water species in phylogenetic analyses and dramatically expanding the molecular datasets available. Using a molecular clock calibrated against the fossil record, I propose not only that the divergence of the two major coral clades, the “Robust” and “Complex” corals, took place about much earlier than previously thought, but also that two families of deep-sea 516 CHAPTER 10 Synthesis, major conclusions, and future directions corals, the Gardineriidae and Micrabaciidae, diverged even earlier, pushing coral origins deep into the Paleozoic (ca. 450 Mya – Ordovician). In addition, the distinctive morphologies of these early-diverging (extant) corals suggest links with fossils previously assumed to be completely unrelated (commonly known as “scleractiniamorphs”) simply because they substantially pre-dated all known Scleractinia. This chapter is the culmination and condensation of much of my PhD thesis (see also item 10.2), and the results presented herein are consistent with the idea that modern corals evolved from Paleozoic soft-bodied ancestors and that modern colonial reef- building corals, which are dependent on symbionts, had solitary, non-symbiotic precursors. Another significant implication of the chapter 8 of the present thesis is the widening of the debate about the fate of corals in times of global climate change, since the results imply that during the last 450 My the scleractinian lineage has persisted through several episodes of dramatic climate change. 10.1.8 THE MTGENOME OF GARDINERIA HAWAIIENSIS Aiming to further investigate the intriguing position of gardineriids in molecular phylogenies, and also to test the “naked coral hypothesis”, chapter 9 of the present thesis focused on the obtaining the complete sequence of the complete mitochondrial (mt) genome of Gardineria hawaiiensis, its description and its comparison to all available scleractinian mt genome data, previously published or made available for the present thesis. This chapter represents the first description of a complete mt genome sequence of a deep-water, solitary, azooxanthellate scleractinian and, at 19,429 bp, the mt genome of Gardineria hawaiiensis is the largest so far identified in any scleractinian coral. As is true for most hexacorallians (see Chen et al., 2008), the mt genome of Gardineria hawaiiensis contains 13 protein-coding genes, 2 rDNAs, and 2 tRNAs, all of the genes being transcribed from the same strand. This genome is intermediate in size between those of corallimorpharians (which are ~21 kb) and those of scleractinians (the mt genomes of Robust scleractinians are typically ~17 kb). The intermediate size of the mt 517 CHAPTER 10 Synthesis, major conclusions, and future directions genome is consistent with morphological (Stolarski, 1996) and molecular (Kitahara et al., 2010b [chapter 5 and 8]) data, which imply that gardineriids represent the most deeply diverging extant scleractinian lineage. Using this dataset, a series of phylogenetic analysis were performed and included representatives of all hexacorallian orders, except Zoanthidea and Ceriantharia, from which complete data are not yet available. In total, 44 mt genomes were included in the analysis and, following Erpenbeck et al. (2006), Brugler & France (2007), Kitahara et al. (2010b [chapter 5]), and Stolarski et al. (submitted [chapter 8]) representatives of the Actiniaria were used as outgroup. Interestingly, both Bayesian and maximum likelihood analyses produced a single unequivocal topology with all nodes fully supported (100%) in which Antipatharia is basal in relation to corallimorpharians and scleractinians, sharing a common ancestor with them. The antipatharian position suggests that the acquisition of a proteinaceous skeleton preceded the “invention” of an aragonitic skeleton by the scleractinians. In addition, both corallimorpharians and scleractinians comprise monophyletic groups, supporting the hypothesis of a single soft-bodied ancestor (chapters 5 and 8), but challenging the “naked coral” hypothesis (Stanley & Fautin, 2001; Medina et al., 2006). Interestingly, the most basal lineages in both corallimorpharians and scleractinians are composed of exclusively deep-water azooxanthellate taxa (i.e. Corallimorphus profundus and Gardineria hawaiiensis respectively). These results support the idea that extant shallow-water representatives of these orders had deep-water ancestors hypothesized in chapters 5 and 8. In addition, following Kitahara et al. (2010b [chapter 5]) and Stolarski et al. (submitted [chapter 8]) the “Basal scleractinian clade” is fully supported irrespective of the phylogenetic reconstruction method applied, demonstrating that gardineriids are key species for the understanding of scleractinian evolution (see item 10.2). 10.2 MAJOR CONCLUSIONS With the intention of not only linking all of the thesis chapters but also putting these in context with respect to paleo-environmental conditions, (-temperature, -oceanography, 518 CHAPTER 10 Synthesis, major conclusions, and future directions etc), the major conclusion section of the present thesis (item 10.2.1) endeavours to widen the discussion of the fate of the order Scleractinia in the face of rapid global climate change. On the basis of the analyses presented, I hypothesize that the dramatic climate changes that occurred in the Ordovician may have been the driving force for the colonization of deep-waters by scleractinian corals. 10.2.1 WAS CLIMATE CHANGE THE DRIVING FORCE FOR DEEP-WATER COLONIZATION BY SCLERACTINIAN CORALS? Previous periods of global environmental changes have resulted in mass extinctions events (MEE) affecting all or most marine phyla (e.g. Alvarez et al., 1980; Jablonski, 1986; Stanley, 1988; 2001; McLaren & Goodfellow, 1990; Sepkowski, 1995; 2002; Hallam & Wignall, 1997; Cooper, 2001; 2002; Erwin, 2006). The synergistic and global impacts of atmospheric CO2 concentration, and sea level and temperature fluctuations have particularly influenced (Hallam, 1989; Yasuhara et al., 2008) and currently pose major threats to calcifying organisms such scleractinian corals (Veron, 2008; Kiessling & Simpson, 2010). Amongst the nearly 1500 known extant scleractinians (Cairns et al., 1999; Cairns, 2009) 50.7% are zooxanthellate and restricted to shallow-waters, 48.5% azooxanthellate and inhabit shallow and deep-waters (ubiquitous to all oceans), and only 0.7% are facultatively symbiotic (Cairns, 2007). Despite the rich fossil record especially for the zooxanthellate forms, the origin of the order is still a topic of great controversy (Romano & Palumbi, 1996; Stanley & Fautin, 2001; Medina et al., 2006; Budd et al., 2010). Comprehensive molecular analyses (Kitahara et al., 2010b; Stolarski et al., submitted) and consideration of the Paleozoic fossil record (Scrutton & Clarkson, 1991; Ezaki, 1997; 1998) indicate that the oldest scleractinian lineages were azooxanthellate and solitary and that the order probably had shallow-water origins but later “invaded” deep-waters. Aiming to add to the knowledge on how corals may respond to our rapidly changing world, here I show correlations between key events in coral evolution and major global scale changes that have occurred over the past 460 My. Based on this I hypothesize that global environmental change may have been a major driving force behind the colonization of deep environments by scleractinian corals. 519 CHAPTER 10 Synthesis, major conclusions, and future directions The sudden appearance of highly diversified forms of Scleractinia about 14 Ma after the Great Dying (Wells, 1956; Roniewicz & Morycowa, 1993; Veron, 1995; Stanley, 2003) and the occurrence of Paleozoic fossils that have no specific morphologies that deny scleractinian affinities (Scrutton & Clarkson 1991; Ezaki, 1998), suggest that the origins of this group, known as the most important shallow and deep-water reef builders of Modern oceans, are much deeper than previously thought. Paleozoic scleractinian fossil records are rare and disrupted, imposing a stumbling block on our knowledge on evolution of the order (Stanley & Fautin, 2001). Nonetheless, recent phylogenetic analyses imply that azooxanthellate (deep-water) representatives diverge from deep nodes in each of the three major scleractinian clades (“Basal, Complex and Robust”; Kitahara et al., 2010b [chapter 5]; Stolarski et al., submitted [chapter 8]), bridging the early (Kilbuchophyllia) and later (Numidiaphyllum and Houchangocyathus) Paleozoic scleractinian records and pointing to lower Paleozoic origins for the order. Arising from the above, there are two major scenarios for scleractinian evolution: either (i) skeleton formation is an ephemeral trait (Fautin & Lowenstein, 1994; Romano & Cairns, 2000) or (ii) Paleozoic sediments containing scleractinians may simply have not been found yet, or are not preserved in the geologic record (Ezaki, 1998). Under the former scenario, scleractinians may be able to undergo skeleton loss in the face of global environmental instability (Stanley & Fautin, 2001; Medina et al., 2006), severely compromising fossil preservation. Relatively small decreases in pH have negative impacts on calcification rates of some corals (Kleypas et al., 1999), but apparently do not affect some species (Rodolfo-Metalpa et al., 2010). In the case of Oculina patagonica prolonged growth under acid conditions resulted in complete skeleton dissolution, while the coral polyp sustained basic life functions (in aquaria) in an anemone-like form (Fine & Tchernov, 2007). Unfortunately, the identification of a “naked” scleractinian using classical approaches would be challenging, because only subtle anatomical differences separate actiniarians and corallimorpharians (e.g. cnidon composition [den Hartog, 1980; Dunn, 1981; Pires, 1997]), and the latter have been distinguished from scleractinians because they do not secrete a skeleton (Daly et al., 2003). If skeleton is an ephemeral trait, the identification of non-skeletonized scleractinians would require the application of molecular techniques, so the pre- Cambrian anemone-like fossils (Hou et al., 2005; Han et al., 2010) could potentially represent any of the three anthozoan orders. However, recent phylogenetic studies 520 CHAPTER 10 Synthesis, major conclusions, and future directions advocated that both scleractinians and corallimorpharians represent monophyletic sister groups (Fukami et al., 2008; Barbeitos et al., 2010; Kitahara et al., 2010b), with additional strikingly differences in mitochondrial (mt) gene order (Medina et al., 2006; Chen, A. C., personal communication) and mt-genome size (Chen, A. C., personal communication). Although skeleton ephemerally is not challenged herein, I will focus on the implications of the second scenario, which predicts that if preserved in the geologic record, and its concentration is not as low to elude detection, other Paleozoic scleractinians will be eventually found (Ezaki, 1998), most probably from deep-water strata. Consistent with such a scenario, Stolarski et al. (submitted) have advocated Ordovician origins for the Scleractinia and based on this timeline, it is possible to correlate major evolutionary events within the order and climate change at the global scale (Fig. 10.1). Such correlations are relevant to the discussion on how scleractinians may respond to anthropogenic based climate change, which is one of the most critical questions related to modern corals and coral reefs. All of the Paleozoic scleractinians known to date are thought to have inhabited shallow- waters and have been heterotrophic (i.e. azooxanthellate) (Scrutton & Clarkson, 1991; Ezaki, 1997; 1998). Interestingly, most of the Triassic corals were not reef-builders at first, and in fact, many of them resemble extant deep-water, solitary, azooxanthellate forms (Stolarski, 1996) (e.g. Triassic Margarophyllia and extant Gardineria). Unfortunately, the majority of Paleozoic marine strata studied so far originate from relatively shallow-water environments, especially from the Proto-, Paleo-, Tethys and adjacent seas. However, the vast Panthalassa Ocean, which comprised more than three quarters of the Earth’s deep-water environments, remains poorly known, largely because if not subducted under tectonic plates, most of its strata rest on deep-water what today is the Pacific Ocean. 521 CHAPTER 10 Synthesis, major conclusions, and future directions 522 CHAPTER 10 Synthesis, major conclusions, and future directions Figure 10.1 – A, modified from Kiessling & Simpson (2010) figures 2 and 3: (red line) changes (log-return) of global metazoan reef volume. Significant reef crisis are indicated by red dots. Numbers in brackets indicate [1] Late Devonian, [2] Permian- Triassic, [3] Triassic-Jurassic, [4] Early Jurassic, [5] Paleocene-Eocene; (black line) Changes (log-return) of marine animal genus diversity. The traditional big five Mass Extinction Events are indicated by black dots. Numbers in brackets indicate [1] Late Ordovician, [2] Late Devonian, [3] Permian-Triassic, [4] Triassic-Jurassic, [5] Cretaceous-Paleogene. B, modified from (B) Paleo-temperature and atmospheric CO2 estimates over the past 500 My. Blue line and numbers correspond to estimative of atmospheric CO2 concentrations (ppm) (Berner & Kothavala, 2001). Green line and numbers correspond to surface temperature estimative (ºC) (Veizer et al., 2000); C, modified from Stolarski et al. (submitted) Molecular clock estimation of Scleractinia evolution based on mitochondrial 16S rDNA and nuclear 28S rDNA. Each family is indicated by specific colour. Each taxonomically defined scleractinian family has its name indicated in its deepest branch, and clades that do not agree with classical taxonomy are indicated by “Family A” to “Family D”. Dashed clades indicate shallow- water zooxanthellate families/species. A plus (+) signal indicates a polyphyletic clade formed by Faviidae, Merulinidae, Mussidae, Pectiniidae and Euphyllidae. A circle (O) indicates the position of Dichocoenia stokesi within a clade formed by former Caryophylliidae representatives. Stars (★) indicate fossil records of Paleozoic scleractinias. Thick gray lines indicate the appearance and extinction of calcitic rugosans and tabulate corals. Each Erathem Era and respective System Period (following the International Stratigraphic Chart) is indicated in the bottom of figure C. Combining the earliest fossil records (Kilbuchophyllia spp.) and the results of relaxed molecular clock analyses (Stolarski et al., submitted) suggests that scleractinians first appeared in the middle Ordovician (ca. 460 Ma). This period was arguably the most important and sustained increase of marine biodiversity in the Earth’s history (Servais et al., 2009), and featured a staggering diversification of heavily skeletonized marine organisms (including corals [Scrutton, 1997]). Augmented nutrient concentrations boosted primary production in the oceans (Bambach, 1993; Miller, 1997), increasing dissolved oxygen concentrations, which in turn established more oversaturated calcite and aragonite subsurface waters (Trotter et al., 2008; Pruss et al., 2010). Despite atmospheric carbon dioxide levels up to 15 times present-day values (Berner & Kothavala, 2001), changes in carbonate saturation and nutrient increments combined with the presence of extremely large continental shelves due to high sea levels (Haq & Schutter, 2008) made possible the appearance of several groups of calcified anthozoans including the scleractinians and the rugosans. These two groups most likely independently arose from soft-bodied ancestors – an actiniarian and a zoanthid 523 CHAPTER 10 Synthesis, major conclusions, and future directions respectively (Oliver, 1996). Hence unlike rugosans, scleractinians developed skeletons that are composed of aragonite and have cyclic insertion of septa (Oliver, 1980). The transition between the Ordovician and the Silurian is marked by two close bursts of MEE caused by the development of extensive ice-caps, sharply decreases in global temperature, and sea level retreats (Berry & Boucot, 1973; Sutcliffe et al., 2000; Congreve, 2008; Finnegan et al., 2011). To some extent these events also promoted oxygenation and circulation in deep-waters (Cramer & Saltzman, 2007). During this period, many of the solitary, unattached and presumably non-symbiotic early scleractinians vanished from fossil record, while rugosans despite also undergoing heavy losses were able to spread and later resume diversification in shallow-waters (Hongzhen & Jianqiang, 1991). Here I hypothesize that some early scleractinians found refugia in deep-waters, as has been proposed for other marine groups (Jablonski et al., 1983; Sepkoski & Miller, 1985; Botther & Jablonski, 1988), “escaping” from unstable environmental conditions and progressive competition in shallow-waters. In fact, one of the families that compose the oldest extant scleractinian lineage known to date, the Micrabaciidae, have in the pattern of septal bifurcation a strikingly similarity with Ordovician kilbuchophyllids. Micrabaciids were suggested to adapt for deep-water environments increasing corallum/polyp size and decreasing skeleton robustness (Squires, 1967; Owens, 1984). Sheltered in deep-waters, the scleractinian “root” diverged into another lineage, which around the late Silurian and early Devonian genetically split into the two major scleractinian clades (Complex and Robust - morphological support still lacking). During that time Earth probably lacked any glaciers, and experienced marked sea-level rises, temperature increases, and declines in atmospheric CO2. Marine waters flooded large continental areas, providing good conditions for the development of reefs by calcitic corals and stromatoporoid sponges. Scleractinians were restricted to deep-waters, and interestingly, to date, both Complex and Robust clades have on solitary azooxanthellate “anthemiphylliids” their most basal genetic extant representatives. This proposition fits with the idea that evolutionary change may be most rapid in populations from habitats where there is some environmental stress associated with sufficient metabolic energy to allow adaptive changes (Parsons, 1991). 524 CHAPTER 10 Synthesis, major conclusions, and future directions In the late Devonian, the appearance of multi-storied forests (seizing pCO2) increased nutrient flux to epicontinental seaways (Algeo & Scheckler, 1998), resulting in shallow- water eutrophication that severely impacted the shallow-water rugosa/tabulata fauna. The evolution of trees is believed to have been one of the main factors leading to the late Devonian glaciation (Algeo & Scheckler, 1998), which also had profound impacts on metazoan reefs (Kiessling & Simpson, 2010). For example, rugose corals became virtually absent from most localities during the early Famennian, followed by a middle Famennian radiation (Poty, 1999). In contrast, nutrient input from pedogenesis associated with improved deep-water circulation from the glaciation period, once again boosted the diversification of deep-water azooxanthellate scleractinians. Interestingly, apart from gardineriids, other epithecated corals diverged from both Complex and Robust clades around late Devonian to middle Carboniferous, supporting that well- developed epitheca is an ancient trait among scleractinians (Roniewicz & Stolarski, 1999; 2001). With all landmasses forming the supercontinent Pangea, two reef crises were prominent events during the Permian (Kiessling & Simpson, 2010). The first occurred during the middle Permian and was suggested to be a consequence of volcanism. Interestingly, two scleractinians (Numidiaphyllum and Houchnagocyathus) considered to be direct predecessors of the order, were reported from shallow-water environments from around the same time, and probably lacked photosymbionts (Scrutton & Clarkson, 1991; Ezaki, 1997; 1998). However, by the end of this period, sharp rises in pCO2 and temperature triggered the most profound MEE, with strong evidence for ocean acidification (Knoll et al., 1996; 2007). During that time, around 96% of all marine species (including all rugosans and tabulates) went extinct (Benton, 2005; Kiessling & Simpson, 2010) creating new evolutionary opportunities for survivors. Nearly 14 My after the Great Dying, scleractinians suddenly re-appeared in the fossil record occupying the niches previously occupied by rugosans and tabulates. Most of the early Mesozoic scleractinians were probably azooxanthellate, although the advent of symbiosis with dinoflagellates around the middle Triassic promoted a fast diversification of shallow- water forms. Interestingly, the molecular data points to similar dates, with three solitary deep-water coral lineages evolving to colonial, zooxanthellate coral groups at the same point in time. To the extent that deep-water environments are viewed as refugia, the 525 CHAPTER 10 Synthesis, major conclusions, and future directions pattern seen in scleractinians is consistent with repopulation from refugia followed by diversification, especially once the competition nearshore sharply decreased. Although anoxic events have occurred in deep-waters during the Paleozoic, there is evidence that anoxia/euxinia in deep-waters was patchy (Meyer & Kump, 2008). In addition, deep-water scleractinians apparently consume much less oxygen than its shallow-water counterparts (see Mortensen et al., 2007) and many are well adapted to live in oxygen minimum layers (Rogers, 2000). Furthermore, there were no major decreases in the diversity of azooxanthellate scleractinians during the deep-sea global anoxic events in the Mesozoic (Simpson, C., personal communication). Nonetheless, according to Guinotte et al. (2006), human-induced changes in seawater chemistry will affect the Aragonite Saturation Horizon (ASH) depth, which will potentially affect all deep-sea bioherm-forming corals (Fautin et al., 2009) and many solitary forms. However, it is well established that some solitary corals are adapted to inhabit waters below the ASH (e.g. Fungiacyathus marenzelleri, Leptopenus antarcticus) and have been reported from waters deeper than 5000 m (Keller, 1976). Even acknowledging that the direct impact of anthropogenic driven climate change will be severe to most scleractinians, the hypothesis presented herein argues that some deep-water representatives of this group will probably be less severely impacted and that the group will persist as it did to all previous MEE and other oceanic chemistry/physical changes, in deep-water refugia (see Tittensor et al., 2010). 10.3 FUTURE DIRECTIONS Endeavouring to improve our understanding in scleractinian evolution as a lineage and as a system, some important future directions should be taken in consideration. Amongst these, the most obvious is the “species problem in corals” as foreshadowed by Boschma (1959) and nowadays made increasingly clear by the application of molecular techniques (e.g. Romano & Cairns, 2000; Le Goff-Vitry et al., 2004; Fukami et al., 2008; Kitahara et al., 2010a [chapter 4], 2010b [chapter 5]; Huang et al., 2011) – establishing a clear an unambiguous phylogeny must be one of the first challenges to be tackled. According to Cairns (2007) there are only 3 taxonomists actively working on deep-water scleractinians. Starting from the premises that a taxonomic framework is 526 CHAPTER 10 Synthesis, major conclusions, and future directions essential for much of biology (Wheeler, 2004), and that solid and reliable taxonomic information is essential for the interpretation of molecular phylogenies, significant financial investments should be made toward the formation of collections and encouragement of taxonomic efforts - especially those directed to deep-water corals. One of expected outcomes of such investments should be measurable – we should learn much more about the real diversity of scleractinian corals in deep-waters. This effort is justified by the central role of colonial scleractinians to the ecology of the dark regions of the oceans (see Roberts et al., 2009), and may also shed light on the importance of the much less understood solitary forms. In parallel to the above, and following on from work presented in this thesis, future phylogenic studies should not underestimate the importance of deep-water species to understanding the evolutionary history of the Scleractinia. At present this “ecological group” comprises about half of the known extant species of the Order (Cairns et al., 1999), but this is probably an underestimate, as few deep-water regions around the world have been extensively sampled/characterized (e.g. eastern coast of the United States; Norwegian region; New Zealand region, etc). To date, molecular phylogenetics has focussed heavily on mitochondrial and ribosomal markers, and whilst these have contributed greatly to our understanding of the phylogenetic relationships of many animal groups (see Halanych et al., 1995; Aguinaldo et al., 1997; Collins, 1998; Kim et al., 1999; Hassanin, 2006), including scleractinian corals (see Romano & Cairns, 2000; Fukami et al., 2008; Kitahara et al., 2010b [chapter 5]; Stolarski et al., submitted [chapter 8]), it is now clear that to achieve higher resolution and to be able to investigate all taxonomic levels of a group, multiple genetic markers are essential (see Pryer et al., 2001; Murphy et al., 2001; Regier et al., 2010). In the case of the order Scleractinia, a stumbling block to applying such multilocus phylogenetics is the paucity of single copy nuclear markers that are available. To address this requirement, advantage should be taken of the high-throughput technologies (e.g. next generation sequencing technologies such as those provided by Illumina and 454 sequencers) to provide transcriptome/genome data for a range of corals. The addition of transcriptomic sequences from deep-water corals to the existing dataset (transcriptome and/or genome) from a few shallow-water zooxanthellate species (e.g. Acropora digitifera – Shinzato et al., in press; Acropora millepora – Meyer et al., 2009 and Forêt et al., unpublished; Porites astroides Matz et al., unpublished data) will enable the development of a wide 527 CHAPTER 10 Synthesis, major conclusions, and future directions range of markers, which can potentially unravel the evolutionary history of this important Anthozoan order from sub-order to species level. These same high- throughput technologies (Illumina, 454) could be used (in a multiplex format) to collect phylogenetic data, an advantage of which is that the depth of coverage that they can provide, which would remove concerns related to sequencing errors. In addition, another fascinating possibility for the future is to further explore the reciprocally informative and complementary nature of molecular and morphological approaches to coral systematics, in exploring the genetic foundations of biomineralization activity (see also Wirshing & Baker, 2008). The organic matrix- mediated biomineralization model potentially links skeletal microstructural characteristics and phylogeny (Lowenstam & Weiner, 1989; Cuif & Dauphin, 2005), enabling a unification of molecular and morphological taxonomy. For this reason, it is important that future studies continue to integrate fine-scale morphological characters and molecular data (Cuif et al., 2003; Benzoni et al., 2007; 2010; Budd & Stolarski, 2009; 2010; see also chapters 6, 7, and 8). Apart from encouraging a new generation of taxonomists, molecular biologists, and paleontologists (as discussed above), the foment of multidisciplinary studies including taxonomy, molecular biology, paleontology and oceanography (as illustrated in the item 10.2.1), can hopefully shape the direction of future studies aspiring to improve our understanding of the evolution of the scleractinian lineage in times of major scientific interest, and intense public and media concern due the uncertain fate of coral reefs in the face of anthropogenic challenges. 528 References Adkins, J. F., Henderson, G. M., Wang, S. L., O’Shea, S. & Mokadem, F. 2004. Growth rates of deep sea scleractinia Desmophyllum cristigalli and Enallopsammia rostrata. Earth Planet Science Letters 227: 481–490. Agassiz, A. 1888. The cruises of the United States coast and geodetic survey steamer Blake in the Gulf of Mexico, in the Caribbean Sea, and along the Atlantic coast of the United States, from 1877 to 1880, vol. 2. Bulletin of the Museum of Comparative Zoology (Harvard) 15: 220 p. Alcock, A. W. 1893. On some newly-recorded corals from the Indian Seas. Journal of the Asiatic Society of Bengal 62(2): 138-149. Alcock, A. W. 1894. Natural history notes from H.M. Indian Marine Survey Steamer Investigator, series 2, number 15: On some new and rare corals from the deep waters of India. Journal of the Asiatic Society of Bengal 62(2): 186-188. Alcock, A. W. 1898. An account of the deep-sea Madreporaria collected by the Royal Indian Marine Survey Ship Investigator. Trustees of the Indian Museum, Calcutta. 29 p. Alcock, A. W. 1902a. Diagnoses and descriptions of new species of corals. Tijdschrift der Nederlandsche Dierkundige Vereeniging 7(2): 89–115. Alcock, A. W. 1902b. Further diagnosis and descriptions of new species of corals. Tijdschrift der Nederlandsche Dierkundige Vereeniging 2(7): 116-123. Alcock, A. W. 1902c. Report on the deep-sea Madreporaria of the Siboga-Expedition. Siboga-Expeditie 16a: 52p. Algeo, T. J. & Scheckler, S. E. 1998. Terrestrial-marine teleconnections in the Devonian: links between the evolution of land plants, weathering processes, and marine anoxic events. Philosophical Transactions of the Royal Society of London B 353: 113-130. Alloiteau, J. 1952. Madréporaires post-paléozoiques. In: Piveteau, J. (ed.) Traité de Paléontologie Tome I, Masson, Paris. pp. 539-684. Alloiteau, J. 1957. Contribution a la Systématiqye des Madréporaires Fossiles. Tome I. Centre National de la Recherche Scientifique, Paris. pp.13-50. Almy, C. C. & Carrion-Torres, C. 1963. Shallow-water stony corals of Puerto Rico. Caribbean Journal of Science 3: 133-162. Altschul S. F., Madden T. L., Schaffer A. A., Zhang J. H., Zhang Z., Miller W. & Lipman D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389–3402. Álvarez-Pérez, G., Busquets, P. Ben de Mol, Sandoval, N., Canals, M. & Casamor, J. 2005. Deep-water coral occurrences in the Strait of Gibraltar. In: Freiwald, A. & Roberts, J. M. (eds.) Cold-water Corals and Ecosystems. Springer-Verlag, Berlin, Heielberg. pp. 207-221. References Austin, W. C. 1985. An Annotated Checklist of Marine Invertebrates in the Cold Temperate Northeast Pacific, 1: 218 p. Khoyatari: Khoyatan Marine Laboratory, British Columbia. Bambach, R. K. 1993. Seafood through time: changes in biomass, energetics, and productivity in the marine ecosystem. Paleobiology 19:372–97. Barbeitos, M., Romano, S. & Lasker, H. R. 2010. Repeated loss of coloniality and symbiosis in scleractinian corals. Proceedings of the National Academy of Science 26(107): 11877-11882. Barnes, D. J. & Chalker, B. E. 1990. Calcification and photosynthesis in reef-building corals and algae. pp. 109-131. In: Coral Reefs. Ecosystems of the World. Volume 25. Elsevier. Baron-Szabo, R. C. 2002. Scleractinian corals of the Cretaceous. A guide to Cretaceous forms with descriptions, illustrations, and remarks on their taxonomic position. 539 pp, 142, pls, 86 text-figs (Knoxville, Baron-Szabo). Baron-Szabo, R. C. 2008. Corals of the K/T-boundary: Scleractinian corals of the suborders Dendrophylliina, Caryophylliina, Fungiina, Microsolenina, and Stylinina. Zootaxa 1952: 1-244. Baron-Szabo, R. C., Schafhauser, A., Götz. S. & Stinnesbeck, W. 2006. Scleractinian corals from the Cardenas Formation (Maastrichtian), San Luis Potosí, Mexico. Journal of Paleontology 80(6): 1033-1046. Barraclough, T. G. & S. Nee. 2001. Phylogenetics and speciation. Tree 16: 391–399. Bassett-Smith, P. W. 1890. Report on the corals from the Tizard and Macclesfield banks, China Sea. Annals and Magazine of Natural History series 6, 35(6): 353- 374, 443-458. Bayer, F. M. & Grasshoff, M. 1997. Riisea and riisei Duchassaing & Michelotti, 1860 (Cnidaria, Anthozoa): proposed conservation as the correct original spellings of generic and specific names based on the surname Riise. Bulletin of Zoological Nomenclature 54: 11-13. Beagley, C. T., J. L. Macfarlane, G. Pont-Kingdon, R. Okimoto, N. A. Okada, And D. R. Wolstenholme. 1995. Mitochondrial genomes of Anthozoa (Cnidaria). Pp. 149– 153. In: Palmieri et al. (eds.) Progress in cell research. Elsevier, Amsterdam. Beagley, C. T., Okimoto, R. & Wolstenholme, D. R. 1998. The mitochondrial genome of the sea anemone Metridium senile (Cnidaria): introns, a paucity of tRNA genes, a near-standard genetic code. Genetics 148:1091-1108. Benson, G. 1999. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Reearch 27: 573-580. Benton, M. J. 2005. When Life Nearly Died: The Greatest Mass Extinction of All Time. Thames & Hudson. Benzoni, F., Stefani, F., Stolarski, J., Pichon, M., Mitta, G. & Galli, P. 2007. Debating phylogenetic relationships of the scleractinian Psammocora: molecular and morphological evidences. Contributions to Zoology 76: 35-54. 530 References Benzoni, F., Stefani, F., Pichon, M. & Galli, P. 2010. The name game: morpho- molecular species boundaries in the genus Psammocora (Cnidaria, Scleractinia). Zoological Journal of the Linnean Society 160: 421-456. Berner, R. A. & Kothavala, Z. 2001. Geocarb III: a revised model of atmospheric CO2 over Phanerozoic time. American Journal of Science 301: 182-204. Berntson, E. A., France, S. C. & Mullineaux, L. S. 1999. Phylogenetic relationships within the class Anthozoa (Phylum Cnidaria) based on nuclear 18S rDNA sequences. Molecular Phylogenetics and Evolution 13: 417-433. Berry, W. B. N. & Boucot, A. J. 1973. Glacio-eustatic control of Late Ordovician-Early Silurian platform sedimentation and faunal changes. Bulletin of the Geological Society of America 84: 275-284. Best, M. B. 1970. Étude systématique et écologique des madréporaires de la région de Banyuls-sur-Mer (Pyrénées-Orientales). Vie et Milieu ser. A, part 2, 20: 293- 325. Best, M. B. & Hoeksema, B. W. 1987. New observations on scleractinian corals from Indonesia: 1. Free-living species belonging to the Faviina. Zoologische Mededelingen 61(27): 387-403. Betterton, C. 1981. A guide to the hard corals of Peninsular Malaysia (excluding the genus Acropora). Malaysian Nature Journal 34: 171-336. Beurois, J. 1975. Etude écologique et halieutique des fonds de pêche et des espèces d'interêt commercial (langoustes et poissons) des Îlies Saint-Paul et Amsterdam (Ocean Indien). Rep. 37. Comité National des Recherches Antarctiques, Paris. 91 pp. Bice, K.L., Layne, G.D., & Dahl, K. 2005. Application of secondary ion mass spectrometry to the determination of Mg/Ca in rare, delicate, or altered planktonic foraminifera: examples from the Holocene, Paleogene, and Cretaceous. Geochemistry Geophysics Geosystems 6: Q12P07. Blattner, F. R., Plunkett, G. 3rd., Bloch, C. A. et al. 1997. The complete genome sequence of Escherichia coli K-12. Science 277(5331): 1453-62. Boore, J. L. 1999. Animal mitochondrial genomes. Nucleic Acids Research 27: 1767- 1780. Boschma, H. 1923. The madreporaria of the Siboga expedition, part 4: Fungia patella. Siboga-Expeditie 16d: 20 p. Boschma, H. 1951. Deling bij Tubastrea. Verslag van de Gewone Vergaderingen der Wisen Natuurkundige Afdeeling der Koninklijke Akademie van Wetenschappen te Amsterdam 60(5): 44-46. Boschma, H. 1953. On specimens of the coral genus Tubastraea, with notes on phenomena of sission. Studies on the fauna of Curaçao and other Caribbean Islands 4(18): 109-119. Boschma, H. 1959. The species problem in corals. Proceedings of the 15th International Congress of Zoology Section 3(41): 1-2. Boshoff, P. H. 1981. An annotated checklist of southern African Scleractinia. South African Association for Marine Biological Research, Oceanographic Research Institute, Durban, Investigational Report 49: 1-45. 531 References Bottjer, D. J. & Jablonski, D. 1988. Paleoenvironmental patterns in the evolution of post-Paleozoic benthic marine invertebrates. Palaios 3: 540-560. Bouchon, C. & Laborel, J. 1986. Les peuplements coralliens des cotes de la Martinique. Annales de l’Institut Océanographique (Paris) 62: 199-237. Bourcier, M. & Zibrowius, H. 1973. Les boues rouges déversées dans le canyon de la Cassidaigne (région de Marseille). Observations en soucoupe plongeante SP350 (juin 1971) et résultats de dragages. Téthys 4(4): 811-843. Bourne, G. C. 1903. Some new and rare corals from Funifuti. Journal of the Linnean Society of London (Zoology) 29: 26-37. Bourne, G. C. 1905. Report on the solitary corals collected by Professor Herdman, at Ceylon, in 1902. Ceylon Pearl Oyster Fisheries, Supplementary Reports 29: 187-242. Bouvier, E. L. 1895. Les commensalisme chez certains polypes madréporaires. Annales Des Sciences Naturelles (Zool., ser. 7) 20: 1-32. Brahmi, C., Meibom, A., Smith, D. C., Stolarski, J., Auzoux-Bordenave, S., Nouet, J., Doumenc, D., Djediat, C. & Domart-Coulon, I. 2010. Skeletal growth, ultrastructure and composition of the azooxanthellate scleractinian coral Balanophyllia regia. Coral Reefs 29: 175-189. Bridge, D., Cunningham, C. W., Schierwater, B., DeSalle, R. & Buss, L. W. 1992. Class-level relationships in the phylum Cnidaria: evidence from mitochondrial genome structure. Evolution 89: 8750-8753. Bridge, D., Cunningham, C. W., deSalle, R. & Buss, L. W. 1995. Class-level relationships in the phylum Cnidaria: Molecular and morphological evidence. Molecular Biology and Evolution 12: 679-689. Broch, H. 1927. The Folden-fiord. Coelenterata. 2. Corals. Tromsø museums skrifter 1(12): 7-8. Broderip, W. J. 1828. Description of Caryophyllia smithii n. sp. Zoological Journal 3: 485-486. Brook, F. J. 1982. The scleractinian coral fauna of Rakitu Island, north-eastern New Zealand. Tane 28: 163-173. Brugler, M. R. & France, S. C. 2007. The complete mitochondrial genome of the black coral Chrysopathes formosa (Cnidaria:Anthozoa:Antipatharia) supports classification of antipatharians within the subclass Hexacorallia. Molecular Phylogenetics and Evolution 42: 776-788. Brunelli, G. & Bini, G. 1934. Ricerche comparative sulle pesche profonde di diversi mari italiani. Bolletino di pesca, di piscicoltura e di idrobiologia 10(6): 733-734. Budd, A. F. & McNeill, D. F. 1998. Zooxanthellate Scleractinian corals from the Bowden Shell Bed, SE Jamaica. Contributions to Tertiary and Quaternary Geology 35: 49-65. Budd, A. F. & Smith, N. D. 2005. Diversification of a new Atlantic clade of scleractinian reef corals: insights from phylogenetic analysis of morphologic and molecular data. Paleontological Society Papers 11: 103-28. 532 References Budd, A. F. & Stolarski, J. 2009. Searching for new morphological characters in the systematics of scleractinian reef corals: comparison of septal teeth and granules between Atlantic and Pacific Mussidae. Acta Zoologica (Stockholm) 90: 142- 165. Budd, A. F. & Stolarski, J. 2010. Corallite wall and septal microstructure in scleractinian reef corals: Comparison of molecular clades within the family Faviidae. Journal of Morphology 272(1): 66-88. Budd, A. F., Romano, S. L., Smith, N. D. & Barbeitos, M. S. 2010. Rethinking the phylogeny of scleractinian corals: a review of morphological and molecular data. Integrative and Comparative Biology. DOI: 10.1093/icb/icq062. Buddemeier, R. W. & Fautin, D. G. 1996. Global CO2 and evolution among the Scleractinia. Bulletin de l'Institut Océanographique, Monaco special number 14(4): 33-38. Burgess, S. N. & Babcock, R. C. 2005. Reproductive ecology of three reef-forming deep-sea corals in the New Zealand region. In: Freiwald, A. & Roberts, J. M. (eds.) Cold-water corals and ecosystems. Springer, Berlin, Germany. Pp. 701- 713. Bythell, J. C. 1986. A Guide to the Identification of the Living Corals (Scleractinia) of Southern California. Occasional Papers of the San Diego Society of Natural History 16: 40 p. Cairns, S. D. 1977a. A review of the Recent species of Balanophyllia in the western Atlantic, with description of four new species. Proceeding of the Biological Society of Washington 90(1): 132-148. Cairns, S. D. 1977b. A revision of the Recent species of Stephanocyathus (Anthozoa: Scleractinia) in the western Atlantic, with descriptions of two new species. Bulletin of Marine Science 27(4): 729-739. Cairns, S. D. 1978. New genus and species of ahermatypic coral (Scleractinia) from the western Atlantic. Proceeding of the Biological Society of Washington 91(1): 216-221. Cairns, S. D. 1979. The deep-water Scleractinia of the Caribbean and adjacent waters. Studies on the Fauna of Curaçao and other Caribbean Islands 57(180): 341 pp. Cairns, S. D. 1981. Marine flora and fauna of the northeastern United States. NOAA Technical Report, NMFS Circular 438: 14 pp. Cairns, S. D. 1982. Antarctic and Subantarctic Scleractinia. Antarctic Research Series 34(1): 74 pp. Cairns, S. D. 1984. New records of ahermatypic corals (Scleractinia) from the Hawaiian and Line Islands. Occasional Papers of the Bernice Pauahi Bishop Museum 25(10): 1–30. Cairns, S. D. 1989a. A revision of the ahermatypic Scleractinia of the Philippine islands and adjacent waters. Part 1. Fungiacyathidae, Micrabaciidae, Turbinoliinae, Guyniidae, and Flabellidae. Smithsonian Contributions to Zoology 486: 136 pp. Cairns, S. D. 1989b. Discriminant analysis of Indo-West Pacific Flabellum. Memoirs of the Association of Australasian Paleontologists 8: 61-68. 533 References Cairns, S. D. 1991a. A revision of the ahermatypic Scleractinia of the Galápagos and Cocos Islands. Smithsonian Contributions to Zoology 504: 44 pp. Cairns, S. D. 1991b. Catalog of the type specimens of stony corals (Milleporidae, Stylasteridae, Scleractinia) in the National Museum of Natural History, Smithsonian Institution. Smithsonian Contributions to Zoology 514: 59 pp. Cairns, S. D. 1994. Scleractinia of the temperate North Pacific. Smithsonian Contributions to Zoology 557: 150 pp. Cairns, S. D. 1995. The marine fauna of New Zealand: Scleractinia (Cnidaria Anthozoa). New Zealand Oceanographic Institute Memoir 103: 210 pp. Cairns, S. D. 1997. A Generic Revision and Phylogenetic Analysis of the Turbinoliidae (Cnidaria: Scleractinia). Smithsonian Contributions to Zoology 591: 55 pp. Cairns, S. D. 1998. Azooxanthellate Scleractinia (Cnidaria: Anthozoa) of western Australia. Records of the Western Australian Museum 18: 361–417. Cairns, S. D. 1999. Cnidaria Anthozoa: deep-water azooxanthellate Scleractinia from Vanuatu, and Wallis and Futuna Islands. Mémoires du Muséum National d‘Histoire Naturelle 180: 31-167. Cairns, S. D. 2000. A revision of the shallow-water azooxanthellate Scleractinia of the western Atlantic. Studies on the Natural History of the Caribbean Region 75: 1- 215. Cairns, S. D. 2001. A Generic Revision and Phylogenetic Analysis of the Dendrophylliidae (Cnidaria: Scleractinia). Smithsonian Contributions to Zoology 615: 75 pp. Cairns, S. D. 2002. Caryophylliidae Dana 1846. Version 28 October 2002. [updated at http://tolweb.org/Caryophylliidae/19023/2002.10.28 in The Tree of Life Web Project, http://tolweb.org/, accessed at 10 April 2009]. Cairns, S. D. 2004a. The Azooxanthellate Scleractinia (Coelenterata: Anthozoa) of Australia. Records of the Australian Museum 56: 259-329. Cairns, S. D. 2004b. A new shallow-water species of Javania (Scleractinia: Flabellidae) from Indonesia. Raffles Bulletin of Zoology 52: 7-10. Cairns, S. D. 2006. New records of azooxanthellate Scleractinia from the Hawaiian Islands. Occasional Paper of the Bernice P Bishop Museum 87: 45–53. Cairns, S. D. 2007. Deep-sea corals: An overview with special reference to diversity and distribution of deep-water scleractinian corals. Bulletin of Marine Science 81: 311-322. Cairns, S. D. 2009. Online appendix: Phylogenetic list of 711 valid Recent azooxanthellate scleractinian species, with their junior synonyms and depth ranges. In: Roberts, J. M., Wheeler, A., Freiwald, A., Cairns, S.D. (eds.) Cold water corals: The Biology and Geology of Deep-sea Corals Habitats. Cambridge University Press. Cairns, S. D. & Stanley, G. D. 1982. Ahermatypic coral banks: living and fossil counterparts. Proceedings of the 4th International Coral Reef Symposium 1: 611–618. 534 References Cairns, S. D., de Hartog, C. & Arneson, C. 1986. Class Anthozoa (Corals, Anemones). In: Sterrer, W. & Sterrer, C. S. (eds.) Marine Fauna and Flora of Bermuda. A Systematic Guide to the Identification of Marine Organisms. John Willey & Sons, New York. pp. 159-194. Cairns, S. D., Calder, D. R., Brinckmann-Voss, A., Castro, C. B., Pugh, P. R., Cutress, C. E., Jaap, W. C., Fautin, D. G., Larson, R. J., Harbison, G. R., Arai, M.N. & Opresko, D. M. 1991. Common and Scientific Names of Aquatic Invertebrates from the United States and Canada: Cnidaria and Ctenophora. American Fisheries Society Special Publication 22: 75 pp. Cairns, S. D. & Parker, S. A. 1992. Review of the Recent Scleractinia of South Australia, Victoria, and Tasmania. Records of the South Australian Museum (Monograph Series) 3:1-82. Cairns, S. D. & Keller, N. B. 1993. New taxa distributional records of azooxanthellate Scleractinia (Cnidaria, Anthozoa) from the tropical southwest Indian Ocean, with comments on their zoogeography and ecology. Annals of the South African Museum 103(5): 213–292. Cairns, S. D. & Zibrowius, H. 1997. Cnidaria Anthozoa: azooxanthellate Scleractinia from the Philippines and Indonesian regions. Mémoires du Muséum National d’Histoire Naturelle (Paris) 172: 27-243. Cairns, S. D., Hoeksema, B. W & van der Land, J. 1999. Appendix: List of Extant Stony Corals. Atoll Research Bulletin 459: 13-46. Cairns, S. D & Chapman, R. E. 2002. Biogeographic affinities of the North Atlantic deep-water Scleractinia. In: Willison, J. H. M. (ed.) Proceedings of the First International Symposium of Deep-Sea Corals. Ecology Action Centre and Nova Scotia Museum, Halifax. p 30-57. Cairns, S. D., Häussermann, V. & Försterra, G. 2005. A review of the Scleractinia (Cnidaria: Anthozoa) of Chile, with the description of two new species. Zootaxa 1018: 15-46. Caldwell, R. 2008. Introduction to Cnidaria. Museum of Paleontology - University of California. University of California, Berkley. Carlgren, O. 1945. Polypdyr (Coelenterata). III. Koraldyr. Danmarks fauna 51: 168 pp. Castañares, L. G. & Soto, L. A. 1982. Estudios sobre los corales ahermatípicos de la costa noreste de Yucatán Mexico. Parte 1: Sinopsis taxonómica de 38 especies (Cnidaria: Anthozoa: Scleractinia). Anales Instituto de Ciencias del Mar y Limnología de la Universidad Autónoma de México 9(1): 295-334. Castresana, J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution 17: 540-552. Cecchini, C. 1914. Su due nuovi Turbinolidae del Mediterraneo (diagnosi preliminary). Monitore Zoologico Italiano 25: 151-152. Cecchini, C. 1917. Gli Alcionari e i Madreporari roccolti nel Mediterraneo dalla R. N. Archivio Zoologico Italiano 1(IX): 10 pp. Chardon, D. & Chevillotte, V. 2006. Morphotectonic evolution of the New Caledonia ridge (Pacific Southwest) from post-obduction tectonosedimentary record. Tectonophysics 420: 473-491. 535 References Chen, C. A., Odorico, D. M., Ten Louis, M., Veron, J. E. N. & Miller, D. J. 1995. Systematic relationships within the Anthozoa (Cnidaria Anthozoa) using the 5′- end of the 28S rDNA. Molecular Phylogenetics and Evolution 4(2): 175-183. Chen, C. A. & Yu, J.-K. 2000. Universal primers for amplification of mitochondrial small subunit ribosomal RNA-encoding gene in scleractinian corals. Marine Biotechnology 2: 146-153. Chen, C. A., Wallace, C. C. & Wolstenholme, J. 2002. Analysis of the mitochondrial 12S rDNA gene supports a two-clade hypothesis of the evolutionary history of scleractinian corals. Molecular Phylogenetics and Evolution 23: 137-149. Chen, C., Chiou, C. H., Dai, C. -F. & Chen, C. A. 2008. Unique Mitogenomic Features in the Scleractinian Family Pocilloporidae (Scleractinia: Astrocoeniina). Marine Biotechnology 10: 538-553. Chen, C., Dai, C. -F., Plathong, S., Chiou, C. -Y. & Chen, C. A. 2008. The complete mitochondrial genomes of needle corals, Seriatopora spp. (Scleractinian; Pocilloporidae): an idiosyncratic atp8, duplicated trnW gene, and hypervariable regions used to determine species phylogenies and recently diverged populations. Molecular Phylogenetics and Evolution 46: 19–33. Chevalier, J. P. 1961. Recherches sur les Madréporaries et les formations récifals miocènes de la Mediterranée occidentale. Memoirs of the Geological Society of France 93: 1–562. Chevalier, J. P. 1966. Contribution a I'etude des Madreporaires des cotes occidentales de l'Afrique tropicale (2e partie). Bulletin de I'lnstitut Fondamental d'Afrique Noire (I.F.A.N.), series A, 28(4): 1356-1405. Chevalier, J. P. 1968. Expédition française sur les récifs coralliens de la Nouvelle Calédonie. Èditions de la Fondation Singer Polignac l(3): 1-155. Chevalier, J. P. 1971. Les Scleractiniaires de la Melanésie Francaise, Part 1. Expedition Francaise sur les Récifes Coralliens de la Nouvelle-Calédonie 5: 307 pp. Chevalier, J. P. & Beauvais, L. 1987. Order des Scléractiniaires. In: Grassé, P. P. (ed.) Traité de Zoologie tome III, fasc. 3. Masson, Paris. Clamp, M., Cuff, J., Searle, S. M. & Barton, G. J. 2004. The Jalview Java Alignment Editor. Bioinformatics 20: 426-427. Clarke, K. R. & Gorley, R. N. 2006. PRIMER v6: User Manual/Tutorial. PRIMER-E, Plymouth. Coates, A. G. & Jackson, J. B. C. 1987. Clonal Growth, Algal Symbiosis, and Reef Formation by Corals. Paleobiology 13(4): 363-378. Colin, P. I. 1978. Caribbean reef invertebrates and plants. T.H.F. Publications, Neptune City, 512 pp. Congreve, C. R. 2008. The End Ordovician; an ice age in the middle of a greenhouse. In: Elewa, A. M. (ed.) Mass Extinction. Springer Berlin Heidelberg. Cortés, J. 1997. Biodiversidad marina de Costa Rica: Filo Cnidaria. Revista de Biologia Tropical 44/45(3/1): 323-334. Costello, M., McCrea, M., Freiwald, A., Lundälv, T., Jonsson, L., Bett, B., Weering, T., Haas, H., Roberts, J. M. & Allen, D.. 2005. Role of cold-water Lophelia pertusa 536 References coral reefs as fish habitat in the NE Atlantic, p. 771-805. In: Freiwald, A. & Roberts, J. M. (eds.). Cold-water corals and ecosystems. Springer, Berlin, Heidelberg. Cowen, R. 1988. The Role of Algal Symbiosis in Reefs through Time. Palaios 3(2): 221-227. 13 13 Cramer, B. D. & Saltzman, M. R. 2007. Early Silurian paired δ Ccarb and δ Corg analyses from the Creed, J. C. 2006. Two invasive alien azooxanthellate corals, Tubastraea coccinea and Tubastraea tagusensis, dominate the native zooxanthellate Mussismilia hispida in Brazil. Coral Reefs 25: 350. Crossland, C. 1952. Madreporaria, Hydrocorallinae, Heliopora and Tubipora. Great Barrier Reef Expedition 1928-29: Scientific Reports 6(3): 85-257. Cuif, J. P. 1973. Recherches sur les Madréporaires du Trias. I. Famille Stylophyllidae. Bulletin du Muséum National d'Histoire Naturelle, Sciences de la Terre 17 (for 1972), 2: 11-291. Cuif, J. P. 1975. Caracteres morphologiques, microstructuraux et systématiques des Pachythecalidae nouvelle famille de Madréporaires Triassiques. Géobios 8: 157- 180. Cuif, J. P. 1976. Recherches sur les Madréporaires du Trias. Formes cério-méandroides et thamnastérioides du Trias des Alpes et du Taurus sud-anatolien. Bulletin du Muséum National d'Histoire Naturelle, Sciences de la Terre 53: 65-195. Cuif, J. P. 1977. Arguments pour une relation phylétique entre les Madréporaires paléozoïques et ceux du Trias. Implications systématiques de l'analyse microstructurale des Madréporaires triasiques. Mémoires de la Société Géologique de France, n.s., 56(129): 1-54. Cuif, J. P., Lecointre, G., Perrin, C., Tillier, A. & Tillier, S. 2003. Patterns of septal biomineralization in Scleractinia compared with their 28S rRNA phylogeny: a dual approach for a new taxonomic framework. Zoologica Scripta 5(32): 459- 473. Cuif, J. P. & Dauphin, Y. 2005. The environment recording unit in coral skeletons—a synthesis of structural and chemical evidences for a biochemically driven, stepping-growth process in fibers. Biogeosciences 2: 61–73. D'Elia, C. F. & Wiebe, W. J. 1990. Biogeochemical nutrient cycles in coral-reef ecosystems. In: Dubinksy, Z. (ed.) Ecosystems of the World, Vol. 25: Coral Reefs. Elsevier Press, Amsterdam. Pp. 49-74. Dai, C. F. & Horng, S. 2009. Scleractinia fauna of Taiwan I. The complex group. Taipei, Taiwan: National Taiwan University Press. Daly, M., Lipscomb, D. L. & Allard, M. W. 2002. A simple test: evaluating explanations for the relative simplicity of the Edwardsiidae (Cnidaria: Anthozoa). Evolution 56(3): 502-510. Daly, M., Fautin, D. G. & Cappola, V. A. 2003. Systematics of the Hexacorallia (Cnidaria: Anthozoa). Zoological Journal of the Linnean Society 139: 419-437. Dana, J. D. 1846. Zoophytes. United States Exploring Expedition during the Years 1838-1842 under the Command of Charles Wilkes 7: vi + 740 pp. 537 References Dana, J. D. 1872. Corals and Coral Islands. Dodd & Mead, New York. Davies, P. S. 1984. The role of zooxanthellae in the nutritional energy requirements of Pocillapora eydouxi. Coral Reefs 2: 181-186. Dawson, E. W. 1979. Catalogue of type and figured specimens in the New Zealand Oceanographic Institute. Memoir of the New Zealand Oceanographic Institute 76: 110 pp. Dawson, E. W. 1992. The Coelenterata from New Zealand region: a handlist for curators, students, and ecologists. Occasional Papers of the Hutton Foundation 1: 1-68. Dawson, J. P. 2002. Biogeography of azooxanthellate corals in the Caribbean and surrounding areas. Coral Reefs 21: 27-40. DeFelice, R. C., Minton, D. & Godwin, L. S. 2002. Records of shallow-water marine invertebrates from French Frigate Shoals, Northwestern Hawaiian Islands, with a note on non-indigenous species. Report to the U.S. Fish and Wildlife Service. Bishop Museum, Hawaii Biological Survey. Bishop Museum Technical Report No. 23. Dennant, J. 1899. Description of two species of corals from the Australian Tertiaries, 1. Transactions and Proceedings and Report of the Royal Society of South Australia 23: 112-122. Dennant, J. 1904. Recent corals from the South Australian and Victorian coasts. Transactions and Proceedings and Report of the Royal Society of South Australia 28: 1-11. Dennant, J. 1906. Madreporaria from the Australian and New Zealand coasts. Transactions of the Royal Society of South Australia 30: 151–165. deQueiroz, K. & Gauthier, J. 1992. Phylogenetic taxonomy. Annual Review of Ecology and Systematics 23: 449-480. Dimond, J. & Carrington, E. 2008. Symbiosis regulation in a facultatively symbiotic temperate coral: zooxanthellae division and expulsion. Coral Reefs 27: 601-604. Ditlev, H. 1980. A field-guide to the reef-building corals of the Indo-Pacific. Dr. W. Backhuys Publ., Rotterdam & Scandinavian Sci. Press Ltd., Klampenborg. Döderlein, L. 1913. Die Steinkorallen aus dem Golf von Neapel. Mitteilumgen aus der Zoologischen Station zu Neapel 21(5): 105-152. Dower, J. F. & Perry, R. I. 2001. High abundance of larval rockfish over Cobb Seamount, an isolated seamount in the Northeast Pacific. Fisheries Oceanography 10: 268-374. Drew, E. A. 1972. The biology and physiology of alga-invertebrate symbioses. II. The density of symbiotic algal cells in a number of hermatypic hard corals and alcyonarians from various depths. Journal of Experimental Marine Biology and Ecology 9: 71-75. Drummond, A. J., Ho, S. Y. W., Phillips, M. J. & Rambaut, A. 2006. Relaxed Phylogenetics and Dating with Confidence. PLoS Biology 4: e88. Drummond, A. J. & Rambaut, A. 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7: 214. 538 References Duchassaing, P. 1850. Animaux radiaires des Antilles. Paris. Duchassaing, P. 1870 Revue des Zoophytes et des Spongiaires des Antilles. Paris. Duchassaing, P. & Michelotti, J. 1860. Mémoire sur les Coralliaires des Antilles. Mémoires de l’Académie des Sciences de Turin 19(2): 279-365. Duchassaing, P. & Michelotti, J. 1864. Supplément au mémoire sur les Coralliaires des Antilles. Memorie della Reale Accademia Scienze di Torino 23(2): 97-206. Duerden, J. E. 1898. On the relations of certain Stichodactylinae to the Madreporaria. Journal of the Linnean Society of London 172(26): 635-653. Duncan, P. M. 1865. A description of some fossil corals from the South Australian Tertiaries. Annals and Magazine of Natural History 3(16): 182-187. Duncan, P. M. 1872. On the structure and affinities of Guynia annulata Dunc., with remarks upon the persistence of Paleozoic types of Madreporaria. Philosophical Transactions of the Royal Society of London 162: 29-40. Duncan, P. M. 1873. A description of the Madreporaria dredged up during the expeditions of H. M. S. Porcupine in 1869 and 1870, part 1. Transactions of the Zoological Society of London 8(5): 303-344. Duncan, P. M. 1876. Notices of some deep-sea and littoral corals from the Atlantic Ocean, Caribbean, Indian, New-Zealand, Persian Gulf, and Japanese &c. seas. Proceeding of the Zoological Society of London 1876: 428-442. Duncan, P. M. 1878. A description of the Madreporaria dredged up during the expedition of H.M.S. Porcupine in 1869 and 1870. Part 2. Transactions of the Zoological Society of London 10(6): 235-249. Duncan, P. M. 1883. Remarks on an essay by Prof. G. Lindström, entitled Contribution to the actinology of the Atlantic Ocean, and a reply to some of his criticisms. Annals and Magazine of Natural History 12(5): 72. Duncan, P. M. 1885. A reviosion of the families and genera of Sclerodermic Zoantharia, Ed & H, or Madreporaria (M. Rugosa excepted). Journal of the Linnaean Society (Zoology) 18: 1-204. Duncan, P. M. 1889. On the Madreporaria of the Mergui Archipelago collected for the trustees of the Indian Museum, Calcutta, by Dr. John Anderson, F.R.S., Superintendent of the Museum. Journal of the Linnean Society of London 21: 1- 19. Dunn, D. F. 1981. The clownfish sea anemones: Stichodactlyidae (Coelenterata: Actiniaria) and other sea anemones symbiotic with pomacentrid fishes. Transactions of the American Philosophical Society 71: 3-115. Durham, J. W. 1947. Corals from the Gulf of California and the North Pacific coast of America. Memoirs of the Geological Society of America 20: 68 pp. Durham, J. W. 1949. Ontogenetic Stages of Some Simple Corals. University of California Publications in Geological Sciences 28(6): 137-172. Durham, J. W. 1962. Corals from the Galápagos and Cocos Islands. Proceedings of the California Academy of Sciences (series 4) 32(2): 41-56. Durham, J. W. 1966. Coelenterates, especially Stony Corals, from the Galápagos and Cocos Islands. In: Bowman (ed.) The Galápagos. Proceedings of the Symposium 539 References of the Galápagos International Scientific Project. Berkeley: University of California Press. pp. 123-135. Durham, J. W. & Barnard, J. L. 1952. Stony corals of the Eastern Pacific collected by the Velero III and Velero IV. Allan Hancock Pacific Expedition 16(1): 110 pp. Eguchi, M. 1934. Eupsammidae, a Family of the so-called Deep Sea Coral. Journal of the Geological Society of Japan 41(489): 365-369. [in Japanese] Eguchi, M. 1938. On Some Deep-Sea Corals. Transactions of the Biological Society of Manchuria l(3): 62-65. [in Japanese] Eguchi, M. 1941. On Some Simple Corals from Mindoro Island, Philippines. Journal of the Geological Society of Japan 48(575): 414-417. [In Japanese with English abstract] Eguchi, M. 1942. Recent and Fossil Corals of the Family Oculinidae from Japan. Journal of the Geological Society of Japan 49(583): 139-146. [in Japanese] Eguchi, M. 1965. Scleractinia. In: Uchida, K. & Uchida, T. (eds.) New illustrated encyclopedia of the fauna of Japan 1. Hokuruyu-kan, Tokyo. pp. 270–296. Eguchi, M. 1968. The hydrocorals and scleractinian corals of Sagami Bay collected by his Majesty the Emperor of Japan. Maruzen Co., Ltd., Tokyo. xv + 221 p. Eguchi, M. & Miyawaki, T. 1975. Systematic study of the scleractinian corals of Kushimoto and its vicinity. Bulletin of Marine Parks Research Station 1(1): 47- 62. Ehrenberg, C. G. 1834. Beiträge zur Physiologischen Kenntniss der Corallenthiere im allgemeinen und bseonders des Rothen Meeres. Abhandlungen der Königlichen Academie der Wissenschaften zu Berlin 1832: 225-380. Erhardt, H. 1974. Liste der scleractinien Korallen der Bahía Concha bei Santa Marta, Atlantikkü ste Kolumbien. Senkenbergiana Biologica 55: 399-407. Erhardt, H. & Meinel, W. 1975. Wachstumsuntersuchungen an vier verschiedenen Scleractinien Korallenarten in der Bahia de Santa Marta und der Ensenada Chengue an der kolumbianischen Atlantikste. Phillippia 11: 322-327. Erpenbeck, D., Hooper, J. N. A. & Wörheide, G. 2006. CO1 phylogenies in diploblasts and the 'Barcoding of Life'—are we sequencing a suboptimal partition? Molecular Ecology. Notes 6: 550–553. Esper, E. J. C. 1791. Der Pflanzenthiere in Ubbildungen nach der Natur. vol. 1. Nürnberg. 320 pp. Esper, E. J. C. 1794. Fortsetzungen der Pflanzenthiere. vol. 1, parts 1-2. Nürnberg. pp. 1-64. Esper, E. J. C. 1795. Fortsetzungen der Pflanzenthiere. vol. 1, parts 3-4. Nürnberg. pp. 65-115. Ezaki, Y. 1997. The Permian coral Numidiaphyllum: new insights into anthozoan phylogeny and Triassic scleractinian origins. Palaeontology 40: 1-14. Ezaki, Y. 1998. Paleozoic Scleratinia: Progenitors or Extinct Experiments? Paleobiology 24(2): 227-234. 540 References Ezaki, Y. 2000. Palaeoecological and phylogentic implications of a new scleractinian genus from Permian sponge reefs, SouthChina. Palaeontology 43: 199-217. Faustino, L. A. 1927. Recent Madreporaria of the Philippine Islands. Monographs, Philippine Bureau of Science 22: 1–310. Fautin, D. G. & Lowenstein, J. M. 1994. Phylogenetic relationships among scleractinians, actiniarians, and corallimorpharians (Coelenterata: Anthozoa). Proceedings of the Seventh International Coral Reef Symposium 2: 665-670. Fautin, D. G., Guinotte, J. M. & Orr, J. C. 2009. Comparative depth distribution of corallimorpharinas and scleractinians (Cnidaria: Anthozoa). Marine Ecology Progress Series 397: 63-70. Felix, J. P. 1909. Über die fossilen Korallen der Snow Hill-Insel und der Seymour-Insel. Wissenschaftliche Ergebnisse der Schwedischen Südpolar-Expedition 1901– 1903 3:1–15 Felix, J. P. 1927. Anthozoa Miocaenica. In: Deiner, C. (ed.) Fossilium Catalogus, I. Animalia, W. Junk, Berlin. Pp. 297-488. Fenner, D. 1993. Species distinctions among several Caribbean stony corals. Bulletin of Marine Science 3(53): 1099-1116. Fenner, D. 2001. Biogeography of three Caribbean corals (Scleractinia) and the invasion of Tubastraea coccinea into the Gulf of Mexico. Bulletin of Marine Science 3(69): 1175-1189. Fenner, D. 2005. Corals of Hawai’i. Mutual Publishing, Honolulu, 144 pp. Filkorn, H. F. & Allor, J. P. 2004. A new early cretaceous coral (Anthozoa; Scleractinia; Dendrophylliina) and its evolutionary significance. Journal of Paleontology 78(3): 501-512. Fine, M. & Tchernov, D. 2007. Scleractinian coral species survive and recover from decalcification. Science 315: 1811. Finnegan, S., Bergmann, K., Eiler, J. M., Jones, D. S., et al. 2011. The Magnitude and Duration of Late Ordovician–Early Silurian Glaciation. Science 27: DOI:10.1126/science.1199325. Fisk, D. A. 1981. Sediment shedding and particulate feeding in two free-living, sediment-dwelling corals (Heteropsammia cochlea and Heterocyathus aequicostatus) at Wistari Reef Great Barrier Reef. In: Proceedings of the Fourth International Coral Reef Symposium, Manila. pp 21-26. Fisk, D. A. 1983. Free-living corals: distributions according to plant cover, sediments, hydrodynamics, depth and biological factors. Marine Biology 74: 287-294. Flint, H. C., Waller, R. G. & Tyler, P. A. 2007. Reproductive ecology of Fungiacyathus marenzelleri from 4100m depth in the northeast Pacific Ocean. Marine Biology 151: 843-849. Flot, J. F. & Tillier, S. 2007. The mitochondrial genome of Pocillopora (Cnidaria: Scleractinia) contains two variable regions: the putative D-loop and a novel ORF of unknown function. Gene 401: 80-87. 541 References Folkeson, F. 1919. Results of Dr. E. Mjöbergs Swedish scientific expeditions to Australia 1910-1913. XXII. Madreporaria. Kungliga Svenska Vetenskapsakademiens Handlingar 59(1): 23 pp. Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Bioloogy and Biotechnology 3: 294- 297. Forsman, Z. H., Guzman, H. M., Chen, A. C., Fox, G. E. & Wellington, G. M. 2005. An ITS region phylogeny of Siderastrea (Cnidaria: ANthozoa): is S. glynni endangered or introduced? Coral Reefs 24: 343-347. Fosshagen, A. & Høisaeter, T. 1992. The second Norwegian record of the deep-water coral, Desmophyllum cristagalli Milne Edwards & Haime, 1848 (Cnidaria: Scleractinia). Sarsia 77: 291-292. Fowler, G. H. 1888. The anatomy of the Madreporaria: IV. Quarterly Journal of Microscopical Science 28: 413-430. France, S. C., Rosel, P. E., Agenbroad, J. E., Mullineaux, L. S. & Kocher, T. D. 1996. DNA sequence variation of mitochondrial large-subunit rRNA provides support for a two subclass organization of the Anthozoa (Cnidaria). Molecular Marine Biology and Biotechnology 5: 15-28. Fricke, H. W. & Schuhmacher, H. 1983. The Depth Limits of Red Sea Stony Corals: An Ecophysiological Problem (A Deep Diving Survey by Submersible). Marine Ecology 4(2): 163-194. Fukami, H., Budd, A. F., Paulay, G., Sole-Cava, A., Chen, C. A., Iwao, K. & Knowlton, N. 2004. Conventional taxonomy obscures deep divergence between Pacific and Atlantic corals. Nature 427: 832-835. Fukami, H. & Knowlton, N. 2005. Analysis of complete mitochondrial DNA sequences of three members of the Montastraea annularis species complex (Cnidaria, Anthozoa, Scleractinia). Coral Reefs 24: 410-417. Fukami, H., Chen, C. A., Budd, A. F., Collins, A., Wallace, C., Chuang, Y. Y., Chen, C., Dai, C. F., Iwao, K., Sheppard, C. & Knowlton, N. 2008. Mitochondrial and nuclear genes suggest that stony corals are monophyletic but most families of stony corals are not (Order Scleractinia, Class Anthozoa, Phylum Cnidaria). PLoS One 3: e3222. Gardiner, J. S. 1899. On the solitary corals, collected by Dr. A. Willey. Zoological Results based on Material from New Britain, New Guinea, Loyalty Islands and Elsewhere 2: 161-180. Gardiner, J. S. 1900. On the anatomy of a supposed new species of Coenopsammia from Lifu. In: Willey, A. (ed.) Zoological results based on material from New Britain, NewGuinea, Loyalty Islands and elsewhere collected during the years 1895-1896 and 1897. Cambridge University Press. Gardiner, J. S. 1904. The turbinolid corals of South Africa, with notes on their anatomy and variation. Marine Investigations of South Africa 3(4): 97-129. Gardiner, J. S. 1905. Madreporaria. Parts III and IV: Fungida and Turbinolidae. Fauna and Geography of the Maldive and Laccadive Archipelagoes 2(Supplement 1): 933-957. 542 References Gardiner, J. S. 1913. The corals of the Scottish national Antarctic Expedition. Transactions of the Royal Society of Edinburgh 49(3): 687-689. Gardiner, J. S. 1929. Part IV. Madreporaria. (b) Turbinolidae and Eupsammidae. British Antarctic Terra Nova Expedition, 1910. Natural History Reports (Zoology) 5: 121-130. Gardiner, J. S. 1939. Madreporarian corals, with an account of variation in Caryophyllia. Discovery Reports 18: 323-338. Gardiner, J. S. & Waugh, P. 1938. The flabellid and turbinolid corals. The John Murray Expedition 1933-34. Scientific Reports 5(7): 167–202. Gardiner, J. S. & Waugh, P. 1939. Madreporaria excluding the Flabellidae and Turbinolidae. Scientific Reports of the John Murray Expedition 1933-34 6(5): 225-242. Gast, C. J., van der Lilley, A. K., Ager, D. & Thompson, I. P. 2005. Island size and bacterial diversity in an archipelago of engineering machines. Environmental Microbiology 7:1220-1226. Gattuso, J. P., Allemand, D. & Frankignoulle, M. 1999. Photosynthesis and calcification at cellular, organismal and community levels in coral reefs: A review on interactions and control by carbonate chemistry. American Zoologist 39: 160- 183. Genin, A., Dayton, P. K., Lonsdale, P. F. & Spiess, F. N. 1986. Corals on seamount peaks provide evidence of current acceleration over deep-sea topography. Nature 322: 59-61. Georgi, D. T. 1979. Modal properties of Antarctic intermediate water in the south-east Pacific and the south Atlantic. Journal of Physical Oceanography 9: 456-468. Gerth, H. 1921. Anthozoa. In: Martin, K. (ed.) Die Fossilen von Java, Sammlungen des Geologischen Reichs-Museums in Leiden 19(2-3): 387-445. Geyer, O. F. 1954. Die oberjurassische Korallenfauna von Württemberg. Palaeontographica, A 104: 121-220. Gili, J. 1982. Fauna de Cnidaris de les Illes Medes. Ketres, Barcelona. Glynn, P. W., Maté J. L. & Stemann, T. A. 2001. Pavona chiriquiensis, a new species of zooxanthellate scleractinian coral (Cnidaria: Anthozoa: Agariciidae) from the eastern tropical Pacific. Bulletin of the Biological Society of Washington 10: 210-225. Goedert J. & Peckman J. 2005. Corals from deepwater methane-seep deposits in Paleogene strata of Western Oregon and Washington, U.S.A. pp. 27-40. In: Frelwald A. & Murray Roberts J. (eds). Cold-Water Corals and Ecosystems. Erlangen Earth Conference Series. Springer, Berlin, Heidelberg. Goffredo, S., Radeti, J., Airi, V. & Zaccanti, F. 2005. Sexual reproduction of the solitary sunset cup coral Leptopsammia pruvoti (Scleractinia: Dendrophylliidae) in the Mediterranean. 1. Morphological aspects of the gametogenesis and ontogenesis. Marine Biology 147: 485-495. González-Romero, S., Reyes-Bonilla, H. & Cairns, S. D. 2008. Range extensions of three species of the family Caryophylliidae (Scleractinia) in the eastern Pacific Ocean. JMBA2-Biodiversity Records (online): 1-2. 543 References Goreau, T. F. 1959. The ecology of Jamaican coral reefs I. Species composition and Zonation. Ecology 40(1): 67-90. Goreau, T. F. & Wells, J. W. 1967. The Shallow-Water Scleractinia of Jamaica: Revised list of Species and Their Vertical Distribution Range. Bulletin of Marine Science 17(2): 442-453. Gourret, P. 1906. Lophohelia prolifera, Amphihelia rostrata, Amphihelia oculata. In: Marion, A. F. (ed.) Étude des Coelentérés atlantiques recueillis par la Commission de dragages de l’aviso le Travailleur Durant les campagnes 1880 et 1881. Expéditions scientifiques du Travailleur et du Talisman pendant les années 1880, 1881, 1882, 1883. pp. 121-122. Grace, R. V. & Grace, A. B. 1976. Benthic communities west of Great Mercury Island, north-eastern New Zealand. Tane 22: 85-99. Grandcolas, P., Murienne, J., Robillard, T., Desutter-Grandcolas, L., Jourdan, H., Guilbert, E. & Deharveng, L. 2008. New Caledonia: a very old Darwinian island? Philosophical Transactions of the Royal Society B 363: 3309-3317. Gravier, C. 1914a. Sur une espèce nouvelle de Madréporaire (Desmophyllum antarcticum). Bulletin Muséum d’Histoire Naturelle (Paris) 20: 236-238. Gravier, C. 1914b. Madréporaires. Deuxième Expédition Antarctique Française. (1908- 1910). Sciences Naturelles: Documents scientifiques. Masson, Paris. pp. 119- 133. Gravier, C. 1915. Note préliminaire sur les Madréporaires receuillés au cours des croisières de la Princesse-Alice et de l’Hirondelle, de 1893 à 1913 inclusivement. Bulletin de l’Institut Océanographique (Monaco) 304(12): 22 pp. Gravier, C. 1920. Madreporaires provenant des campagnes des yachts Princesse-Alice et Hirondelle II (1893-1913). Resultats des Campagnes Scientifiques Accomplies sur son Yacht par Albert I, Prince Souverain de Monaco 55: 123 pp. Griffith, J. K. & Fromont, J. 1998. A catalogue of Recent Cnidaria type specimens in the Western Australian Museum of Natural Science, Perth. Records of the Western Australian Museum 19: 223-239. Grygier, M. J. 1983. Introcorna conjugans n. gen. n. sp., parasitic in a Japanese ahermatypic coral. Senckenbergiana Biologica 63: 419-426. Grygier, M. J. 1985. Lauridae: taxonomy and morphology of ascothoracid crustacean parasites of zoanthids. Bulletin of Marine Science 2(36): 278-303. Grygier, M. J. 1991. Additions to the Ascothoracidan Fauna of Australia and South-east Asia (Crustacea, Maxillopoda): Synagogidae (part), Lauridae and Petrarcidae. Records of the Australian Museum 43: 1-46. Grygier, M. J. & Cairns, S. D. 1996. Suspected neoplasms in deep-sea corals (Scleractinia: Oculinidae: Madrepora spp.) reinterpreted as galls caused by Petrarca madreporae n. sp. (Crustacea; Ascothoracida: Petrarcidae). Diseases of Aquatic Organisms 24: 61-69. Grygier, M. J. & Newman, W. A. 1985. Motility and calcareous parts in extant and fossil Acrothoracica (Crustacea: Cirripedia), based primarily upon new species burrowing in the deep-sea scleractinian coral Enallopsammia. Transactions of the San Diego Society of Natural History 21: 1-22. 544 References Guerriero, A., D’Ambrosio, M., Zibrowius, H. & Pietra, F. 1995. Novel cholic-acid- type sterones of Deltocyathus magnificus, a deep-water scleractinian coral from the Loyalty Islands, SW Pacific. Helvetica Chimica Acta 79: 982-988. Guindon, S. & Gascuel, O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52(5): 696-704. Guinotte, J. M., Orr, J., Cairns, S. D., Freiwald, A., Morgan, L. & George, R. 2006. Will human induced changes in seawater chemistry alter the distribution of deep-sea scleractinian corals? Frontiers in Ecology and the Environment 4: 141- 146. Hall-Spencer, J., allain, V. & Fosså, J. H. 2002. Trawling damage to Northeast Atlantic ancient coral reefs. Proceedings of the Royal Society of London 269: 507-511. Hallam, A. 1989. The case for sea-level change as a dominant causal factor in mass extinction of marine invertebrates. Philosophical Transactions of the Royal Society of London B 325: 437-455. Hammer, O., Harper, D. A. T. & Ryan, P. D. 2001. PAST: Palaeontological Statistics software package for education and data analysis. Palaeo Electronica 4: 1-9. Hammer, O. & Harper, D. A. T. 2006. Paleontological data analysis. Blackwell Publishing Han, J., Kubota, S., Uchida, H. O., Stanley, G. D. Jr., Yao, X., et al. 2010. Tiny Sea Anemone from the Lower Cambrian of China. PLoS ONE 5(10): e13276. Haq, B. U. & Schutter, S. R. 2008. A chronology of Paleozoic sea-level changes. Science 322: 64-68. Harrison, R. 1911. Some Madreporaria from the Persian Gulf. Proceedings of the Zoological Society of London 1911: 1018-1037. Harrison, R. M. & Poole, M. 1909a. Marine fauna from the Kerimba Archipelago, Portuguese East Africa, collected by Jas. J. Simpson, M.A., B.Sc., and R. N. Rudmose-Brown, BSc., University of Aberdeen: Madreporaria. Proceedings of the Zoological Society of London 61: 913-917. Harrison, R. M. & Poole, M. 1909b. Marine fauna from the Mergui Archipelago, Lower Burma, collected by Jas J. Simpson, M.A., B.Sc, and R. N. Rudmose-Brown, B.Sc., University of Aberdeen: Madreporaria. Proceedings of the Zoological Society of London 3: 897-912. Hartog, J. C. den. 1980. Caribbean shallow water Corallimorpharia. Zoologische Verhandelingen Leiden 176: 3-83. Hayward, B. W., Grace, R. V. & McCallum, J. 1985. Soft bottom macrobenthos and sediments off the Broken Islands, northern New Zealand. Tane 31: 85-103. Heath, T. A., Hedtke, S. M. & Hillis, D. M. 2008. Taxon sampling and the accuracy of phylogenetic analyses. Journal of Systematics and Evolution 46: 239-251. Hellberg, M., 2006. No variation and low synonymous substitution rates in coral mtDNA despite high nuclear variation. BMC Evolutionary Biology 6: 24. Hennig, W. 1957. Systematik und Phylogenese. In: Hannemann, H.-J. (ed.) Bericht über die Hundertjahrfeier der Deutschen Entomologischen Gesellschaft Belin. Akademie Verlag, Berlin. pp. 50-71. 545 References Hennig, W. 1966. Phylogenetic Systematics. (English Translation). Urbana: University of Illinios Press. Hickson, S. J. 1907. The Alcyonaria, Antipatharia, and Madreporaria collected by the Huxley from the north side of the Bay of Biscay in August, 1906. Journal of the Marine Biological Association of the United Kingdon 1(8): 6-14. Hickson, S. J. 1910. On a new octoradiate coral, Pyrophyllia inflata (new genus and species). Memoirs and Proceedings of the Manchester Literary and Philosophical Society 54(12): 1-7. Hodgson, G. & Carpenter, K. 1995. Scleractinian Corals of Kuwait. Pacific Science 49(3): 227-246. Hoeksema, B. W. 1989. Taxonomy, phylogeny and biogeography of mushroom corals (Scleractinia: Fungiidae). Zoologische Verhandenlingen 254: 1-295. Hoeksema, B. W. 1991. Evolution of body size in mushroom corals (Scleractinia: Fungiidae) and its ecomorphological consequences. Netherlands Journal of Zoology 41: 122-139. Hoeksema, B. W. 1993. Phenotypic corallum variability in Recent mobile reef corals. Courier Forschungs-Institut Senckenberg 164: 263-272. Hoeksema, B. W. & Best, M. B. 1991. New Observations on Scleractinian Corals from Indonesia, 2: Sipunculan-Associated Species Belonging to the Genera Heterocyathus and Heteropsammia. Zoologische Mededelingen 65(16): 221- 245. Hoffmeister, J. E. 1925. Some corals from American Samoa and the Fiji Islands. Papers from the Department of Marine Biology of the Carnegie Institution of Washington XXII: 1-90. Hoffmeister, J. E. 1933. Report on the deep-sea corals obtained by F.I.S. Endeavour on the coasts of New South Wales, Victoria, South Australia and Tasmania. Zoological and Biological Results of the Fishing Experiments carried out by F.I.S. “Endeavour” 1909–14 6(1): 16 pp. Hongzhen, W. & Jianqiang, C. 1991. Late Ordovician and early Silurian rugose coral biogeography and world reconstruction of palaeocontinents. Palaeogeography, Palaeoclimatology, Palaeoecology 86 (1-2): 3-21. Horst, C. J. van der 1921. The Madreporaria of the Siboga Expedition. Part II. Madreporaria Fungida. Siboga-Expeditie 16b: 53-98. Horst, C. J. van der 1922. The Madreporaria of the Siboga Expedition. Part III: Eupsammidae. Siboga-Expeditie 16c: 45-75. Horst, C. J. van der 1926. Madreporaria Eupsammidae. Transactions of the Linnean Society of London (Series 2, Zoology) 19(1): 43-53. Horst, C. J. van der 1927. Eupsammid Corals from South Africa. Union of South Africa Fisheries and Marine Biological Survey Report 5 (special reports) 1, 2: 1-7. Horst, J. C. van. 1931. Some solitary corals from the Indian Museum. Records of the Indian Museum 33(1): 3-12. Hou, X. G., Stanley, G. D., Zhao, J. & Ma, X. Y. 2005. Cambrian anemones with preserved soft tissue from the Chengjiang biota, China. Lethaia 38: 193-203. 546 References Howchin, W. 1909. Notes on the discovery of a large mass of living coral in Gulf St. Vincent, with bibliographical references to the Recent corals of South Australia. Transactions and Proceedings and Report of the Royal Society of South Australia 33: 242-252. Hu, C. H. 1987. Unusual fossil corals from Hengchun Peninsula, southern Taiwan. Memories of the Geological Society of China 8: 31-48. Hu, C. H. 1988. Some solitary fossil corals and paleoecology of the Tunghsaio and Lungkang formations of Miaoli region, northern Taiwan. Proceedings of the Geological Society of China 31: 140-153. Huang, D., Meier, R., Todd, P. A. & Chou, L. M. 2008. Slow mitochondrial COI sequence evolution at the base of the metazoan tree and its implications for DNA barcoding. Journal of Molecular Evolution 66: 167-174. Huang, D., Meier, R., Todd, P. A. & Chou, L. M. 2009. More evidence for pervasive paraphyly in scleractinian corals: systematic study of southeast Asian Faviidae (Cnidaria; Scleractinia) based on molecular and morphological data. Molecular Phylogenetics and Evolution 55: 102-116. Hubbard, R. H. & Wells, J. W. 1986. Ahermatipic shallow-water scleractinian corals of Trinidad. Studies on the Fauna of Curaçao 68: 121-147. Huelsenbeck, J. P. & Ronquist, F. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics Applications Note 17: 754-755. Humman, P. 1993. Reef coral identification: Florida Caribbean Bahamas, including marine plants. New World Publications, Inc., Jacksonville. 239 pp. Hurbalek, Z. 1982. Coefficients of association and similarity based on binary (presence- absence) data: An evaluation. Biological Reviews 57: 669-689. Hutton, F. W. 1904. Index Faunae Novae Zealandiae. Dulau & Co., London. 372 pp. Jablonski, D. 1986. Causes and consequences of mass extinctions: a comparative approach. In: Elliott, D. K. (ed.) Dynamics of Extinction. Wiley, New York. pp. 183-229. Jablonski, D., Sepkoski, J. J., Bottjer, D. J. & Sheehan, P. M. 1983. Onshore-Offshore patterns in the evolution of Phanerozoic shelf communities. Science 222: 1123- 1125. Janiszewska, K., Stolarski, J., Benzerara, K., Meibom, A., Mazur, M., Kitahara, M. V. & Cairns, S. D. 2011. A unique skeletal microstructure of the deep-sea micrabaciid scleractinian corals. Journal of Morphology 231(2): 191-203. Johnson, K. G. 1998. A phylogenetic test of accelerated turnover in Neogene Caribbean brain corals. Palaeontology 41: 1247-68. Joubin, L. 1922. Distribution géographique de quelques coraux abyssaux dans les mers occidentales européenes. Comptes Rendus Hebdomadaires des Séances de l'Académie des Sciences (Paris) 175: 930-933. Joubin, L. 1928. Dendrophyllia ramea. Dendrophyllia cornigera. Desmophyllum cristagalli. Desmophyllum fasciculatum. Caryophyllia smithii. Caryophyllia clavus. Madracis pharensis. Astroides calicularis. Balanophyllia verrucaria. Faune et flore de la Méditerranée. 547 References Joubin, L. 1929. Paracyathus pulchellus. Amphelia oculata. Lophelia prolifera. Faune et flore de la Méditerranée. Jourdan, E. 1895. Zoanthaires provenant des campagnes du yacht l’Hirondelle (Golfe de Gascogne, Açores, Terre-Neuve). Résultats des Campagnes scientifiques du Prince Albert Ier de Monaco 8: 36 pp. Jungersen, H. F. E. 1916.Alcyonarian and Madreporarian corals in the Museum of Bergen, collected by the Fram-Expedition 1898-1902 and by the Michael Sars 1900-1906. Bergens Museums aarbok 1915-1916 2,6: 44 pp. Kawaguti, S. & Nakagama, T. 1973. Population densities of zooxanthellae in the reef corals. Biological Journal of Okayama University 16: 67-71. Kayal, E. & Lavrov, D. V. 2008. The mitochondrial genome of Hydra oligactis (Cnidaria, Hydrozoa) sheds new light on animal mtDNA evolution and cnidarian phylogeny. Gene 410: 177-186. Keith, M. L. & Weber, J. N. 1970. Vital effects on the carbonate isotopic composition of reef communities. In: Tongiori, E. (ed.) Stable isotopes in oceanographic studies and paleotemperatures. pp. 267-284. Keller, N. B. 1975. Ahermatypic Madreporarian Corals of the Caribbean Sea and Gulf of Mexico. Trudy Instituta Okeanologii 100: 174-187. [in Russian] Keller, N. B. 1976. The deep-sea madreporarian corals of the genus Fungiacyathus from the Kuril-Kamchatka, Aleutian trenches and other regions of world ocean. Trudy Instituta Okeanologii 99: 31-44. [in Russian] Keller, N. B. 1981a. Interspecies variability of Caryophyllia (Madreporaria) in connection with their environment. Trudy Instituta Okeanologii 115: 14–25. Keller, N. B. 1981b. The solitary madreporarian corals. In: Kuznetsov, A. P. & Mironov, A. N. (eds.) Benthos of the Submarine Mountains Marcus-Necker and Adjacent Pacific Regions. P. P. Shirshov Institute of Oceanology, Moscow. Keller, N. B. 1982. Some new data on madreporarian corals of the genus Deltocyathus. Trudy Instituta Okeanologii 117: 47-58. Keller, N. B. 1998. Spatial distribution of the azooxanthellate Scleractinia (Cnidaria, Anthozoa). Oceanology 38: 206-210. Kent, W. S. 1871. On some new and little-known species of madrepores, or stony corals, in the British Museum. Proceedings of the Zoological Society of London 1871: 275-286. Kent, W. S. 1893. The Great Barrier Reef of Australia; its Products and Potentialities. Pp. xvii+387, 64 pls. London. Kerby, T. & Hall-Spencer, J. M. 2007. Arctic coral reefs, an undiscovered environment. Catalyst, Secondary Science Review 18: 14-16. Kerr, A. M. 2005. Molecular and morphological supertree of stony corals (Anthozoa: Scleractinia) using matrix representation parsimony. Biological Reviews 80: 1- 16. Kiessling, W. & Simpson, C. 2010. On the potential for ocean acidification to be a general cause of ancient reef crises. Global Change Biology 17(1): 56-67. 548 References Kikuchi, T. 1968. Fauna and Flora of the Sea around the Amakusa Marine Biological Laboratory, Part 7: Zoantharia, Coelenterata. Contributions from the Amakusa Marine Biological Laboratory (Kyushu University) 207: 26 pp. Kitahara, M. V. 2006. Novas ocorrências de corais azooxantelados (Anthozoa, Scleractinia) na plataforma e talude continental do sul do Brasil. Biotemas 19(3): 55-63. Kitahara, M. V. 2007. Species richness and distribution of azooxanthellate Scleractinia in Brazil. Bulletin of Marine Science 81(3): 497-518. Kitahara, M. V. & S. D. Cairns. 2005. Monohedotrochus capitolii, a new genus and species of solitary azooxanthellate coral (Scleractinia, Caryophylliidae) from southern Brazil. Zoologische Mededelingen 79 (3): 117–123. Kitahara, M. V. and Cairns, S. D. 2008. New records of the genus Crispatotrochus (Scleractinia; Caryophylliidae) from New Caledonia, with description of a new species. Zootaxa 1940: 59-68. Kitahara, M. V., Horn Filho, N. O. & Abreu, J. G. N. 2008. Utilização de registros de corais de profundidade (Cnidaria, Scleractinia) para prever a localização e mapear tipos de substratos na plataforma e talude continental do sul do Brasil. Papéis Avulsos de Zoologia (São Paulo) 48: 11-18. Kitahara, M. V. & Cairns, S. D. 2009. Revision of the genus Deltocyathus (Cnidaria, Scleractinia), with a description of a new species from New Caledonia. Zoosystema 31(2): 233-249. Kitahara, M. V., Cairns, S. D. & Miller, D. J. 2010a. Monophyletic origin of the Caryophyllia (Scleractinia; Caryophylliidae), with description of six new species. Systematics and Biodiversity 8: 91-118. Kitahara, M. V., Cairns, S. D., Stolarski, J., Blair, D. & Miller, D. J. 2010b. A comprehensive phylogenetic analysis of the Scleractinia (Cnidaria, Anthozoa) based on mitochondrial CO1 sequence data. Plos One 5: e11490. Knoll, A. H., Bambach, R. K., Canfield, D. E. & Grotzinger, J. P. 1996. Comparative earth history and Late Permian mass extinction. Science 273: 452-457. Knoll, A. H., Bambach, R. K., Payne, J. L., Pruss, S. & Fischer, W. W. 2007. Paleophysiology and end-Permian mass extinction. Earth and Planetary Science Letters 256: 295-313. Kock, G. von. 1889. Über Caryophyllia rugosa Moseley. Morphological Jahrbuch 15(1): 10-20. Koslow, J. A. & Gowlett-Holmes, K. 1998. The Seamount Fauna off Southern Tasmania: Benthic Communities, their Conservation and Impacts of Trawling. Hobart: CSIRO Marine Research. Tasmania. Koslow, J. A., Gowlett-Holmes, K., Lowry, J. K., O'Hara, T., Poore, G. C. B. & Williams, A. 2001. Seamount benthic macrofauna off southern Tasmania: community structure and impacts of trawling. Marine Ecology Progress Series 213: 111-125. Kozloff, E. N. 1987. Marine Invertebrates of the Pacific Northwest. 511 pp. Seattle: University of Washington Press. 549 References Kuhlmann, D. H. H. 2006. Die Steinkorallensammlung im Naturhistorichen Museum in Rudolstadt (Thuringen) nebst okologischen Benerkungen. Rudolstadter Naturhistorische Schriften 13: 37-113. Laborel, J. 1970. Madréporaires et hydrocoralliaires récifaux des côtes brésiliennes. Résultats Scientifique des Campagnes de la Calypso 9: 171-229. Lacaze-Duthiers, H. 1897. Faune de Golfed du Lion. Coralliaires Zoanthaires Scclérodermés (deuxième mémoire). Archives de Zoologie Expérimentale et Générale 3(5): 249 pp. Lam, K., Morton, B. & Hodgson, P. 2008. Ahermatypic corals (Scleractinia: Dendrophylliidae, Oculinidae and Rhizangiidae) recorded from submarine caves in Hong Kong. Journal of Natural History 42(9): 729-747. Land, L. S., Lang, J. C. & Barnes, D. J. 1977. On the stable carbon and oxygen isotopic composition of some shallow water, ahermatypic, scleractinian coral skeletons. Geochimica et Cosmochimica Acta 41(1): 169-172. Lang, J. C. 1974. Biological zonation at the base of a reef. American Scientist 62: 272- 298. Larkin, M. A., Blackshields, G., Brown, N. P., et al. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948. Lattig, P. & Cairns, S. D. 2000. A new species of Tethocyathus (Cnidaria: Anthozoa: Scleractinia: Caryophylliidae), a transisthmian azooxanthellate species. Proceedings of the Biological Society of Washington 3(113): 590-595. Latypov, Y. A. 1990. Scleractinia corals from Vietnam, Part 1: Thamnasteriidae, Astrocoeniidae, Pocilloporidae, Dendrophylliidae. Hayka, Moscow. 81pp. [In Russian] Lauxmann, U. 1991. Revision der oberjurassichen Korallen von Württemberg (SW- Deutschland), exclusive Fungiina. Palaeontolographica A 219: 107-175. Le Goff-Vitry, M. C., Pybus, O. G. & Rogers, A. D. 2004. Genetic structure of the deep-sea coral Lophelia pertusa in the North East Atlantic revealed by microsatellites and ITS sequences. Molecular Ecology 13(3): 537-549. Le Goff-Vitry, M. C., Rogers, A. D. & Baglow, D. 2004. A deep-sea slant on the molecular phylogeny of the Scleractinia. Molecular Phylogenetics and Evolution 30: 167-177. Lesson, R. -P. 1829. Voyage autour du monde sur LaCoquille, pendant les années 1822, 1823. 1824, et 1825, Zoology 2(2): Zoophytes. A. Bertrand, Paris. Lewis, J. B. 1965. A Preliminary Description of Some Marine Benthic Communities from Barbados, West Indies. Canadian Journal of Zoology 43: 1049-1074. Licuanan, W. Y. & Aliño, P. M. 2009. Leptoseris kalayaanensis (Scleractinia: Agariidae), a new coral species from the Philipines. The Raffles Bulletin of Zoology 57: 1-4. Lin, M-F., Luzon, K. S., Licuanan, W. Y., Ablan-Lagman, C. M. & Chen, A. C. in press. Seventy-four universal primers for characterizing the complete mitochondrial genomes of scleractinian corals (Cnidaria; Anthozoa). Zoological Studies. 550 References Lindner, A., Cairns, S. D. & Cunningham, C. W. 2008. From offshore to onshore: multiple origins of shallow-water corals from deep-sea ancestors. PLoS ONE 3(6): e2429. Lindström, G. 1877. Contributions to the actinology of the Atlantic Ocean. Kongliga svenska Vetenskaps-Akademiens Handlingar 14(6): 1-26. Lindström, G. 1884. A reply to the remarks of Prof. Duncan on a paper entitled Contributions to the Actinology of the Atlantic Ocean. Annals and Magazine of Natural History 13(5): 74 pp. Linnaeus, C. 1758. Systema Naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Edition decima, reformata. Laurentius Salvius: Holmiae. ii, 824 pp. Livingston, H. D. & Thompson, G. 1971. Trace element concentrations in some modern corals. Limnology and Oceanography 16(5): 786-796. Lowenstein, J. M. 1985. Radioimmunoassay and molecular phylogeny. Bioassays 2: 60- 62. Lowenstam, H. A. & Weiner, S. 1989. On Biomineralization. 9. Chordata. Oxford University Press, Oxford. MacNae, W. & Kalk, M. 1958. A natural history of Inhaca Island, Mozambique. Witwatersrand Univ. Press, Johannesburg. i-iv, 163 pp. MacRae, R. A., Fensome, R. A. & Williams, G. L. 1996. Fossil dinoflagellate diversity, originations, and extinctions and their significance. Canadian Journal of Botany 74: 1687-1694. Manning, R. B. 1991. Crustacea Brachyura: Cecidocarcinus zibrowii, a new deep-water crab (Cryptochiridae) from New Caledonia. Résultats des Campagnes MUSORSTOM 9: 515-520. Maragos, J. E. 1977. Order Scleractinia, Stony Corals. In: Devaney, D. M. & Eldredge, L. G. (eds.) Reef and shore fauna of Hawaii, Section 1: Protozoa through Ctenophora. Bishop Museum Press, Honolulu, Hawaii. p. 159-241. Marenzeller, E. von 1888a. Ueber das Wachsthum der Gattung Flabellum Lesson. Zoologische Jahrbücher 1(3): 25-50. Marenzeller, E. von 1888b. Ueber einige japanische Turbinoliiden. Annalen des Kaiserlich–Königlichen Naturhistorischen Hofmuseums Wien 3: 15-22. Marenzeller, E. von 1904a. Steinkorallen. Wissenschaftliche Ergebnisse der Deutschen Tiefsee-Expedition auf dem Dampfer Valdivia 1898-1899 7(3): 261-318. Marenzeller, E. von 1904b. Reports on dredging operations of the west coast of central America and Galápagos...by the U.S. Fish Commission Steamer Albatross during 1891: Steinkorallen und Hydro-Korallen. Bulletin of the Museum of Comparative Zoology 43(2): 75-87. Marenzeller, E. von 1907a. Expeditionen S.M. Schiff "Piola" in das Rote Meer, nördliche und südliche Hälfte 1895/96-1897/98, Zoologische Ergebnisse 24: Über den Septennachwuchs der Eupsamminen E. H. Denkschrifien der Kaiserlichen Akademie der Wissenschaften 80: 1-12. 551 References Marenzeller, E. von 1907b. Expeditionen S.M. Schiff "Piola" in das Rote Meer, nördliche und südliche Hälfte 1895/96-1897/98, Zoologische Ergebnisse 25: Tiefseekorallen. Denkschrifien der Kaiserlichen Akademie der Wissenschaften 80: 13-25. Marion, A. F. 1906. Étude des Coelentérés atlantiques recueillis par la Commission de dragages de l’aviso de Travailleur Durant les capagnes 1880 et 1881 (Oeuvres posthumes de A. F. Marion reunites par Paul Gourret). Expéditions scientifiques du Travailleur et du Talisman pendant les années 1880-1883. p. 103-151. Mayr, E. 1969. The biological meaning of species. Biological Journal of the Linnean Society 1(3): 311-320. McCartney, M. S. 1977. Subantarctic Mode Water: A voyage of discovery, supplement to Deep-Sea Res. In: Angel, M. (ed.) George Deacon 70th Anniversary Volume. Peargon Press. p 103-119. McLoughlin, S. 2001. The breakup history of Gondwana and its impact on pre- Cenozoic floristic provincialism. Australian Journal of Botany 49: 271-300. Medina, M., Collins, A. G., Silberman, J. D. & Sogin, M. L. 2001. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA. Proceedings of the National Academy of Science 98(18): 9707-9712. Medina, M., Collins, A. G., Takaoka, T. L., Kuehl, J. V. & Boore, J. L. 2006. Naked corals: skeleton loss in Scleractinia. Proceedings of the National Academy of Science 103(24): 96-100. Meibom, A., Cuif, J. P., Hillion, F., Constantz, B. R., Juillet-Leclerc, A., Dauphin, Y., Watanabe, T. & Dunbar, R. B. 2004. Distribution of magnesium in coral skeleton. Geophysical Research Letters 31: L23306. Meibom, A., Mostefaoui, S., Cuif, J. P., Dauphin, Y., Houlbreque, F., Dunbar, R. & Constantz, B. 2007. Biological forcing controls the chemistry of reef-building coral exoskeleton. Geophysical Research Letters 34: L02601. Meibom, A., Cuif, J. P., Mostefaoui, S., Dauphin, Y., Houlbreque, F., Meibom, K. & Dunbar, R. 2008. Compositional variations at ultra-structure length-scales in coral skeleton. Geochimica et Cosmochimica Acta 72: 1555-1569. Messing, C. G. 1987. To the deep reef and beyond. Deep Ocean Society, Miami. Meyer, K. M. & Kump, L. R. 2008. Oceanic euxinia in Earth history: causes and consequences. Annual Review of Earth and Planetary Sciences 36: 251-288. Midcontinent of North America: Implications for paleoceanography and paleoclimate. Palaeogeography, Palaeclimatology, Palaeoecology 256: 195-203. Miller, A. I. 1997. Dissecting global diversity patterns: examples from the Ordovician Radiation. Annual Review of Ecology and Systematics 28: 85-104. Miller, K., Williams, A., Rowden, A. A. Knowles, C. & Dunshea, G. 2010. Conflicting estimates of connectivity among deep-sea coral populations. Marine Ecology 31(Suppl. 1): 1-14. Milne Edwards, H. & Haime, J. 1848a. Recherches sur les Polypiers, deuxième mémoire: Monographie des Turbinolides. Annales des Sciences Naturelles (Zoologie) 3(9): 211-344. 552 References Milne Edwards, H. & Haime, J. 1848b. Recherches sur les Polypiers, troisième mémoire: Monographie des Eupsammides. Annales des Sciences Naturelles (Zoologie) 3(10): 65-114. Milne Edwards, H. & Haime, J. 1848c. Recherches sur les Polypiers, quatrième mémoire (part 1): Monographie des Astréides. Annales des Sciences Naturelles, Zoologie 3(10): 209-320. Milne Edwards, H. & Haime, J. 1849. Recherches sur les Polypiers, quatrième mémoire (part 3): Monographie des Astréides. Annales des Sciences Naturelles (Zoologie) 3(12): 95-197. Milne Edwards, H. & Haime, J. 1850a. Recherches sur les polypiers, 5, Monographie des Oculinides. Annales des Sciences Naturelles (Zoologie) 3(13): 63-110. Milne Edwards, H. & Haime, J. 1850b. A monograph on the British fossil Corals. LXXXV + 322 p. Palaeontological Society, London. Milne Edwards, H. & Haime, J. 1857. Classification et description des Zoantharies Sclérodermés de la section des Madréporaires Apores. Histoire Naturelle des Coralliaires ou Polypes proprement dits 2. Roret, Paris. 633 pp. Mittermeier, R. A., Werner, T.B. & Lees, A. 1996. New Caledonia - A conservation imperative for an ancient land. Oryx 30: 104-112. Mori, K. 1987. Intraspecific morphological variations in a Pleistocene solitary coral, Caryophyllia (Premocyathus) compressa Yabe & Eguchi. Journal of Paleontology 61(1): 21-31. Mortensen, L. B., Mortensen, P. B. Armsworthy, S. & Jackson, D. 2007. Field observations of Flabellum spp. And laboratory study of the behavior and respiration of Flabellum alabastrum. Bulletin of Marine Science 81(3): 543-552. Mortimer, N., Hoernle, K., Hauff, F., Palin, J. M., Dunlap, W. J., Werner, R. & Faure, K. 2006. New constraints on the age and evolution of the Wishbone Ridge, southwest Pacific Cretaceous microplates, and Zealandia-West Antarctica breakup. Geology 34:185-188. Morton, J. E. & Miller, M. 1968. The New Zealand seashore. Collins, London. Moseley, H. N. 1876. Preliminary report to professor Wyville Thomson, F.R.S., director of the civilian staff, on the true corals dredged up by H.M.S. Challenger in deep water between the dates Dec. 30th, 1870, and August 31st, 1975. Proceedings of the Royal Society 24: 544-569. Moseley, H. N. 1877. On the coloring matters of various animals, and especially of deep-sea forms dredged by H.M.S. Challenger. Quarterly Journal of Microscopical Science 17(65): 1-23. Moseley, H. N. 1880. Description of a new species of simple coral. Proceedings of the Zoological Society of London 1880: 41-42. Moseley, H. N. 1881. Report on certain hydroid, alcyonarian, and madreporarian corals procured during the voyage H. M. S. Challenger, in the years 1873-1876. Report on the Scientific Results of the Voyage of H. M. S. Challenger during the years 1873-79, Zoology 2: 248 pp. Muscatine, L., Goiran, C., Land, L., Jaubert, J., Cuif, J. P. & Allemand, D. 2005. Stable isotopes (δ13C and δ15N) of organic matrix from coral skeleton. Proceedings of 553 References the National Academy of Sciences of the United States of America 102(5): 1525- 1530. Neall, V. E. & Trewick, S. A. 2008. The age and origin of the Pacific Islands: a geological overview. Philosophical Transactions of the Royal Society B 363: 3293-3308. Nemenzo, F. 1955. Systematic studies on Philippine shallow water scleractinians: I. Suborder Fungiida. Natural and Applied Science Bulletin 15: 3-84. Nemenzo, F. 1960. Systematic Studies on Philippine Shallow Water Scleractinians, IV: Suborder Dendrophylliida. Natural and Applied Science Bulletin 18(1): 21 pp. Nishihira, M . 1988. Field guide to hermatypic corals of Japan. Tokai University Press. [in Japanese] Nishihira, M. & Poung-In, S. 1989. Distribution and population structure of a free- living coral, Diaseris fragilis, at Khang Khao Island in the Gulf of Thailand. Galaxea 8: 271-282. Nobre, A. 1931. Contribuições para o estudo dos Coelenterados de Portugal. Instituto de Zoologia da Universidade do Porto, Porto. 82 pp. Nordgård, O. 1929. Faunistic notes on marine evertebrates VI. On the distribution of some Madreporarian corals in Northern Norway. Kongelige Norske Videnskabers selskab forhandlinger 28(2): 102-105. Nothdurft, L. D. & Webb, G. 2007. Microstructure of common reef- building coral genera Acropora, Pocillopora, Goniastrea and Porites: Constraints on spatial resolution in geochemical sampling. Facies 53: 1-26. Nunes, F., Fukami, H., Vollmer, S. V., Norris, R. D. & Knowlton, N. 2008. Re- evaluation of the systematics of the endemic corals of Brazil by molecular data. Coral Reefs 27: 423-432. Nylander, J. A. A. 2004. MrModeltest 2.0. Program distributed by the author. Evolutionary Biology Centre, Uppsala University. Ogawa, K. 2006. Scleractinian corals of the Sagami Sea. Memories of the National Science Museum (Tokyo) 40: 103-112. [in Japanese] Ogawa, K. & Takahashi, K. 1993. A Revision of Japanese Ahermatypic Corals around the Coastal Region with a Guide to Identification, I: Genus Tubastraea. Nankiseibatu (The Nanki Biological Society) 35(2): 95-109. [In Japanese] Ogawa, K. & Takahashi, K. 1995. A Revision of Japanese ahermatypic corals around the coastal region with a guide to identification-II. Genus Dendrophyllia. Nankiseibutu (The Nanki Biological Society) 35(14): 15-33. [In Japanese] Olivares, M. A. 1971. Estudio taxonómico de algunos Madreporarios del golfo de Cariaco, Sucre, Venezuela. Boletín del Instituto Oceanográfico Universidade de Oriente 2(10): 73-78. Oliver, W. A. Jr. 1980. The relationship of the scleractinian corals to the rugose corals. Paleobiology 6: 146-160. Oliver, W. A. Jr. 1996. Origins and relationships of Paleozoic coral groups and the origin of the Scleractinia. Pp. 107-134. In: Stanley, G. D. J. (ed.) Paleobiology and Biology of Corals. The Paleontological Society, Columbus, Ohio. 554 References Omura, A. 1983. Uranium-series ages of some solitary corals from the Riuku Limestone on the Kikai-jima, Riuku Islands. Transactions and Proceedings of the Palaeontological Society of Japan n.s. 130: 117-122. Orejas, C., Gori, A., Lo Iacono, C., Puig, P., Gili, J. M. & Dale, M. R. T. 2009. Cold- water corals in the Cap de Creus canyon, northwestern Mediterranean: spatial distribution, density and anthropogenic impact. Marine Ecology Progress Series 397: 37-51. Ortmann, A. 1888. Studien über Systematik und geographische Verbreitung der Stein- korallen. Zoologische Jahrbücher 3: 143-188. Owens, J. M. 1984. Evolutionary trends in the Micrabaciidae: an argument in favor of preadaptation. Geologos 11(1): 87-93. Owens, J. M. 1986a. Rhombopsammia, a new genus of the family Micrabaciidae. Proceedings of the Biological Society of Washington 99(2): 248-256. Owens, J. M. 1986b. On the elevation of Stephanophyllia subgenus Letepsammia to generic rank. Proceedings of the Biological Society of Washington 99(3): 486- 188. Owens, J. M. 1994. Letepsammia franki, a new species of deep-sea coral (Coelenterate: Scleractinia: Micrabaciidae). Proceedings of the Biological Society of Washington 107(4): 586-590. Pandey, D. K. & Fursich, F. T. 2005. Jurassic corals from southern Tunisia. Zitteliana A 45: 3-34. Pandey, D. K., Fursich, F. T., Baron-Szabo, R. & Wilmsen, M. 2007. Lower Cretaceous corals from the Koppeh Dagh, NE-Iran. Zitteliana A 47: 3-52. Pandolfi, J. 1992. Successive isolation rather than evolutionary centres for the origination of Indo-Pacific reef corals. Journal of Biogeography 92: 593-609. Parker, R. H. 1964. Zoogeography and Ecology of some Macroinvertebrates. Particularly Mollusks, in the Gulf of California and the Continental Slope off Mexico. Videnskabelige Meddelelser fra Dansk Naturhistorisk Forening 126: 178 pp. Parsons, P. A. 1991. Evolutionary rates: stress and species boundaries. Annual Review of Ecology and Systematics 22: 1-18. Paula, A. F. & Creed, J. C. 2004. Two species of the coral Tubastraea (Cnidaria: Scleractinia) in Brazil: a case of accidental introduction. Bulletin of Marine Science 74: 175-183. Pax, F. 1932. Die Antipatharien und Madreporarien des arktischen Gebietes. Fauna Arctica 3(6): 267-280. Pax, F. & Müller, I. 1962. Die Anthozoenfauna der Adria. Fauna et Flora Adriatica 3: 343 pp. Pearse, V. B. & Muscatine, L. 1971. Role of symbiotic algae (zooxanthellae) in coral calcification. Biological Bulletin 141: 350-363. Pérez-Vivar, T. L., Bonilla, H. R. & Padilla, C. 2006. Corales pétreos (Scleractinia) de las Islas Marías, Pacífico de México. Ciencias Marinas 32(2): 259-270. 555 References Pfaff, R. 1969. Las Scleractinia y Milleporina de las Islas del Rosario. Mitteilungen aus dem Instituto Colombo-Alemán de Investigaciones Científicas de Punta de Betín 3: 17-24. Pichon, M. 1964. Contribution à l’étude de la repartition des Madréporaires sur le récif du Tuléar, Madagascar. Recueil Travaux Stat Mar d’Endoume-Marseille fasc hors série suppl 2: 79-203. Pichon, M. 1974. Free living scleractinian coral communities in the coral reefs of Madagascar. In: Proceedings of the 2nd International Coral Reef Symposium Brisbane 2: 173-181. Pichon, M. 1978. Recherches sur les peuplements a dominance d'anthozoaires dans les recifs coralliens de Tulear (Madagascar). Atoll Research Bulletin 222: 445 pp. Pichon, M. 2007. Scleractinia of New Caledonia: check list of reef dwelling species. In: Payri, C.E. & Richer de Forges, B. (eds.) Compendium of marine species of New Caledonia, Doc. Sci. Tech. II7, seconde édition, IRD Nouméa. pp. 149- 157. Pillai, C. S. G. 1972. Stony corals of the seas around India. Proceedings of the First International Symposium on Corals and Coral Reefs: 191-216. Pillai, C. S. G. 1983. Structure and generic diversity of recent Scleractinia of India. Journal of the Marine Biological Association of India 25: 78-90. Pillai, S. C. G. 1986. Recent corals from the southeast coast of India. In: James, P. S. B. R. (ed.) Recent advances in marine biology. Today and Tomorrow's Printers & Publishers, New Delhi. pp. 107-198. Pillai, C. S. G. & Scheer, G. 1974. On a collection of Scleractinia from the Strait of Malacca. Proceedings of the 2nd International Coral Reef Symposium, Brisbane 1: 445-464. Pillai, C. S. G. & Scheer, G. 1976. Report on the stony corals from the Maldive Archipelago. Zoologica 126: 83 pp. Piñón, G. C. 1999. Biogeografía de los corales ahermatípicos (Anthozoa, Scleractinia) en el Pacífico oriental. Thesis, Universidad Antónoma de Baja California Sur, La Paz. Piola, A. R. & Georgi, D. T. 1982. Circumpolar properties of Antarctic Intermediate Water and Subantarctic Mode Water. Deep-Sea Research 29: 687-71. Pires, D. O. 1997. Cnidae of Scleractinia. Proceedings of the Biological Society of Washington 110: 167-185. Pires, D. O. 2007. The azooxanthellate coral fauna of Brazil. In: George, R. Y. & Cairns, S. D. (eds.) Conservation and adaptive management of seamount and deep-sea coral ecosystems. Rosenstiel School of Marine and Atmospheric Science, University of Miami. Miami. pp. 265-272. Plusquellec, Y., Webb, G. E. & Hoeksema, B. W. 1999. Automobility in Tabulata, Rugosa, and extant Scleractinian analogues: Stratigraphic and paleogeographic distribution of Paleozoic mobile corals. Journal of Paleontology 73(6): 985- 1001. Porter, J. W. 1972. Ecology and species diversity of corals reefs on opposite sides of the Isthmus of Panama. In: Jones, M. L. (ed.) The Panamic biota: some observations 556 References prior to a sea-level canal. Bulletin of the Biological Society of Washington 2: 89- 116. Poty, E. 1999. Famennian and Tournaisian recoveries of shallow water Rugosa following late Frasnian and late Strunian major crises, southern Belgium and surrounding areas, Hunan (South China) and the Omolon region (NE Siberia). Palaeogeography, Palaeoclimatology, Palaeoecology 154 (1-2): 11-26. Pourtalès, L. F. de 1868. Contributions to the fauna of the Gulf Stream at great depths. Bulletin of the Museum of Comparative Zoology (Harvard) 1(7): 121-141. Pourtalès, L. F. de 1871. Deep-sea corals. Illustrated Catalogue of the Museum of Comparative Zoology 4: 93 pp. Pourtalès, L. F. de 1874. Zoological results of the Hassler expedition. Deep-sea corals. Illustrated Catalogue of the Museum of Comparative Zoology 8: 33-49. Pourtalès, L. F. de 1878. Report on the results of dredging, under the supervision of Alexander Agassiz, in the Gulf of Mexico, by the U.S. Coast Survey Steamer Blake. Bulletin of the Museum of Comparative Zoology (Harvard) 5(9): 197-212. Pourtalès, L. F. de 1880. Reports on the results of dredgings, under the supervision of Alexander Agassiz, in the Caribbean Sea, 1878-1879, by the U.S. Coast Survey Steamer Blake. Bulletin of the Museum of Comparative Zoology (Harvard) 6(4): 95-120. Prahl, H. von 1987. Corales Ahermatípicos colectados en el Pacífico Colombiano. Revista de Biologia Tropical 35(2): 227-232. Prahl, H. von & Erhardt, H. 1985. Colombia, corales y arrecifes coralinos. Universidad del Valle, Bogota, Colombia. 295 pp. Prahl, H. von & Erhardt, H. 1989. Lista Annotada de Corales Ahermatípicos de Colombia. In: Ciencias del Mar, VI Seminario Nacional, Memórias. pp. 539- 556. Pratt, E. M. 1900. Anatomy of Neohelia porcelana Moseley. Willey's Zoological Results 5: 591-602. Pruss, S. B., Finnegan, S., Fischer, W. W. & Knoll, A. H. 2010. Carbonates in skeleton- poor seas: New insights from Cambrian and Ordovician strata of Laurentia. Palaios 25: 73 -84. Pruvot, G. & Racovitza, E. G. 1895. Matériaux pour la faune des Annélides de Banyuls. Archives de Zoologie Expérimentale et Générale 3(3): 339-492. Quelch, J. J. 1886. Report on the reef corals collected by H.M.S. Challenger during the years 1873-1876. Report on the scientific results of the voyage of H.M.S. Challenger during the years 1873-1876 3(16): 203 pp. Quoy, J. R. C. & Gaimard, J. P. 1833. Voyage de découvertes de l’Astrolabe execute par ordre du Roi, pendant les années 1826-1827-1828-1829, sous le commandement de M. J. Dumont d’Urville, Zoologie. Tastu (Paris) 4: 390 pp. Ralph, P. M. 1948. Some New Zealand corals. New Zealand Science Review 6(6): 107- 110. Ralph, P. M. & Squires, D. F. 1962. The extant scleractinian corals of New Zealand. Zoological Publications from Victoria University of Wellington 29: 19 pp. 557 References Randall, R. H. 2003. An annotated checklist of hydrozoan and scleractinian corals collected from Guam and other Mariana Islands. Micronesia 35-36: 121-137. Reed, J. K. 2002. Deep-water Oculina coral reefs of Florida: biology, impacts, and management. Hydrobiologia 471: 43-44. Rehberg, H. 1892. Neue und wenig bekannte Korallen. Abhandlungen aus dem Gebiete der naturwissenschftlichen Verein in Hamburg 12(1): 50 pp. Reyes, J. O., Santodomingo, N., Garcia, A., Borrero-Pérez, G., Navas, G. R., Navas, G., Mejía-Ladino, L. M. & Bermúdez, A. 2005. Southern Caribbean azooanthellate coral communities off Colombia. In: Freiwald, A. & Murray Roberts, J. (eds.) Cold-Water Corals and Ecosystems. Springer, Heidelberg. Reyes, J., Santodomingo, N. & Cairns, S. D. 2009. Caryophylliidae (Scleractinia) from the Colombian Caribbean. Zootaxa 2262: 1-39. Rezak, R., Bright, T. J. & McGrail, D. W. 1985. Reefs and Banks of the Northwestern Gulf of Mexico: Their Geological, Biological, and Physical Dynamics. John Wiley and Sons, New York. Richer de Forges, B. 2000. Les Fonds Meubles de Nouvelle-Calédonie. Etudes et thèses. Vol. 2. ORSTOM. Riedel, P. 1991. Korallen in der Trias der Tethys: stratigraphische reichweiten, Diversitätsmuster, entwicklungstrends und Bedeutung als Rifforganismen. Mitteilungen der Gesellschaft fur Geologie und Bergbaustudenten in Österreich 37: 97-118. Riemann-Zürneck, K. & Iken, K. 2003. Corallimorphus profundus in shallow Antarctic habitats: Bionomics, histology, and systematics (Cnidaria: Hexacorallia). Zoologische Verhandenlingen 345: 367-386. Roberts, J. M., Long, D., Wilson, J. B., Mortensen, P. B. & Gage, J. D. 2003. The cold- water coral Lophelia pertusa (Scleractinia) and enigmatic seabed mounds along the northeast Atlantic margin: are they related? Marine Pollution Bulletin 46: 7- 20. Roberts, J.M., Wheeler, A. & Freiwald, A. 2006. Reefs of the deep: the biology and geology of cold-water coral ecosystems. Science 312: 543-547. Roberts, J. M., Wheeler, A. J., Freiwald, A. & Cairns, S. D. 2009. Cold-water corals: the biology and geology of deep-sea coral habitats. Cambridge University Press, Cambridge. xvi + 334 pp. Rodolfo-Metalpa, R., Martin, S., Ferrier-Pages, C., Gattuso, J. P. Response of the temperate coral Cladocora caespitosa to mid- and long-term exposure to pCO sub and temperature levels projected for the year 2100 AD. Biogeosciences 7 (1): 289-300. Rogers, A. D. 1994. The biology of seamounts. Advances in Marine Biology 30: 305- 350. Rogers, A. D. 1999. The biology of Lophelia pertusa (Linnaeus, 1758) and other deep- water reef-forming corals and impacts from human activities. Hydrobiologia 84: 315-406. Rogers, A. D. 2000. The role of the oceanic oxygen minima in generating biodiversity in the deep sea. Deep-Sea Research II 47: 119-148. 558 References Romano, S. L. & Palumbi, S. R. 1996. Evolution of scleractinian corals inferred from molecular systematics. Science 271: 640–642. Romano, S. L. & Palumbi, S. R. 1997. Molecular evolution of a portion of the mitochondrial 16S ribosomal gene region in scleractinian corals. Journal of Molecular Evolution 45: 397-411. Romano, S. L. & Cairns, S. D. 2000. Molecular phylogenetic hypotheses for the evolution of scleractinian corals. Bulletin of Marine Science 67(3): 1043-1068. Roniewicz, E. 1984. Microstructural evidence of the distichophylliid affinity of the Caryophylliina (Scleractinia). Palaeontographica Americana 54:515–518. Roniewicz, E. 1989. Triassic scleractinian corals of the Zlambach Beds, northern Calcareous Alps, Austria. Osterreichische Akademie der Wissenschaften, Wien 126: 1-152. Roniewicz, E. & Morycowa, E. 1989. Triassic scleractinia and the Triassic/Liassic boundary. Memoirs of the Association of Australasian Palaeontologists 8: 347- 354. Roniewicz, E. & Morycowa, E. 1993. Evolution of the Scleractinia in the light of microstructural data. Courier Forschungsinstitut Senckenberg 164: 233-240. Roniewicz, E. & Stolarski, J. 1999. Evolutionary trends in the epithecate scleractinian corals. Acta Palaeontologica Polonica 44: 131-166. Roniewicz, E. & Stolarski, J. 2001. Triassic roots of the amphiastraeid scleractinian corals. Journal of Paleontology 75: 34-45. Ronquist, F. & Huelsenbeck, J. P. 2003. MrBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572-1574. Roos, P. J. 1971. The shallow-water stony corals of the Netherlands Antilles. Studies on the fauna of Curaçao and other Caribbean Islands 130(37): 108 pp. Rosen, B. R. 1971. Principal features of reef coral ecology in shallow water environments Mahe, Seychelles. In: Stoddart, D.R. & Yonge, M. Sir (eds.) Regional variation in Indian Ocean Coral reefs pp. 163-184. London, Academic press. Rosen, B. R. 1979. Checklist of recent coral records for Aldabra (Indian Ocean). Atoll Research Bulletin 233: l-24. Rosen, B. R. 1981. The tropical high diversity enigma-the corals'-eye view. In: Greenwood, P. H. & Forey, P. L. (eds.) Chance, change and challenge: the evolving biosphere. Cambridge University Press, London. Pp. 103–129. Ross, R. J. 1964. The distribution of reef corals in Curacao. Studies on the fauna of Curaçao 20: 1-51. Rossi, L. 1958. Res Ligusticae XCIX. Revisione Critica dei Madreporarii del mar Ligure. Doriana 76(2): 19 pp. Rossi, L. 1961. Études sur le seuil Siculo-Tunisien. 6. Madréporaires. Campagne de la Calypso. Annales de l’Institut Océanographique (Paris) 39: 33-48. Roule, L. 1896. Coelentérés. Annales de l’Université de Lyon 2(26): 299-323. 559 References Sakakura, K. 1935. Les Hétérocyathes fossiles de la Prefecture de Tiba, Japon. Journal of the Geological Society of Japan 42: 182-191. [in Japanese] Sammarco, P. W., Porter, S. A. & Cairns, S. D. 2010. A new coral species introduced into the Atlantic Ocean - Tubastraea micranthus (Ehrenberg 1834) (Cnidaria, Anthozoa, Scleractinia): An invasive threat? Aquatic Invasions 5(2): 131-140. Saville-Kent, W. 1870. Observations on the Madreporaria or stony corals taken in the late expedition of the yatch Norma, off the coast of Spain and Portugal. Annales and Magazine of Natural History 6(4): 459-461. Scatterday, J. 1974. Reefs and associated coral assemblages off Bonaire, Netherlands Antilles, and their bearing on Pleistocene and Recent reef models. In: Proceedings of the 2nd International Symposium on Coral Reefs, vol. 2, Great Barrier Reef Committee, Brisbane, Australia. p. 85-106. Scheer, G. 1990. Die von E. J. C. Esper 1788-1809 beschriebenen Anthozoa (Cnidaria), Part IV: Scleractinia. Senkenbergiana Biologica 71: 369-414, 423-429. Scheer, G. & Pillai, C. S. G. 1974. Report on the Scleractinia from the Nicobar Islands. Zoologica 122: 75 pp. Scheer, G. & Pillai, C. S. G. 1983. Report on the Stony Corals from the Red Sea. Zoologica 133: 198 pp. Schindewolf, O. H. 1942. Zur Kenntnis der Polycoelien und Plerophyllen. Eine Studie über den Bau der "Tetrakorallen" und ihre Beziehungen zu den Madreporarien. Abhandlungen des Reichsamts für Bodenforschung, Neue Folge 204: 1-324. Schindewolf, O. H. 1958. Würmer und Korallen als Synöken. Zur Kenntnis der Systeme Aspidosiphon /Heterocyathus und Hicetes/Pleurodictyum. Akademie der Wissenschaften und der Literatur. Abhandlungen der mathematisch−naturwissenschaftlichen Klasse Mainz 1958(6): 259-327. Schröder-Ritzrau, A., Freiwald, A. & Mangini, A. 2005. U/Th-dating of deep-water corals from the eastern North Atlantic and the western Mediterranean Sea. In: Freiwald, A. & Roberts, J. M. (eds.) Cold-water corals and ecosystems. Heidelberg, Germany: Springer Verlag. Schuchert, P. 1993. Phylogenetic analysis of the Cnidaria. Zeitschrift fuer zoologische Systematik und Evolutionsforschung 31:161-173. Schuhmacher, H. 1984. Reef-building properties of Tubastraea micranthus (Scleractinia, Dendrophylliidae), a coral without zooxanthellae. Marine Ecology Progress Series 20: 93-99. Scrutton, C. T. 1993. New Kilbuchophyllid corals from the Ordovician of the Southern Uplands, Scotland. Courier Forschungsinstitut Senckenberg 164: 153-158. Scrutton, C. T. 1997. The Palaeozoic corals, I: origins and relationships. Proceedings of the Yorkshire Geological Society 51: 177-208. Scrutton, C. T. & Clarkson, E. N. K. 1991. A new scleractinian-like coral from the Ordovician of the southern uplands, Scotland. Palaeontology 34: 179-194. Searles, A. G. 1956. An illustrated key to Malayan hard corals. The Malayan Nature Journal 11(1-2): 26 pp. 560 References Semper, C. 1872. Ueber Generatioswechel bei Steinkorallen und über das M. Edwards’sche Wachsthumsgesetz der Polypen. Zeitschrift für Wissenschaftliche Zoologie 22(2): 235–280. Sepkoski, J. J, Jr. & Miller, A. I. 1985, Evolutionary faunas and the distribution of Paleozoic benthic marine communities in space and time. In: Valentine, J. (ed.) Phanerozoic Diversity Patterns: Profiles in Macroevolution: Princeton, New Jersey: Princeton University Press. Pp. 153-180. Servais, T., Harper, D. A. T., Munnecke, A., Owen, A. W. & Sheehan, P. M. 2009. Understanding the great Ordovician biodiversification event (GOBE): influences of paleogeography, paleoclimate, or paleoecology. GSA Today 19(4): 4-10. Shearer, T. L., van Oppen, M. J. H., Romano, S. L. & Wörheide, G. 2002. Slow mitochondrial DNA sequence evolution in the Anthozoa (Cnidaria). Molecular Ecology 11: 2475-2487. Shearer, T. L. & Coffroth, M. A. 2008. Dna Barcoding: Barcoding corals: limited by interspecific divergence, not intraspecific variation. Molecular Ecology Resources 8: 247-255. Shepherd, S.A. & Veron, J.E.N. 1982. Stony corals (Order Scleractinia or Madreporaria). In: Shepherd, S. A. & Thomas, I. M. (ed.) Marine Invertebrates of Southern Australia. Part 1. Adelaide: Govt. Printer. pp. 169-178. Sieg, J. & Zibrowius, H. 1989. Association of the tube inhabiting tanaidacean, Bifidia scleractinicola gen. nov., sp. nov., with bathyal scleractinians off New Caledonia (Crustacea Tanaidacea - Cnidaria Scleractinia). Mésogée 48: 189-199. Smith, F. G. W. 1971. Atlantic reef corals. University of Miami Press, Florida. Soest, R. W. M. van 1979. A catalogue of the coelenterate type specimens of the Zoological Museum of Amsterdam. 4. Gorgonacea, Actiniaria, Scleractinia. Beaufortia 29(353): 81-126. Sokolov, S. & Rintoul, R. 2000. Circulation and water masses of the southwest Pacific: WOCE Section P11, Papua New Guinea to Tasmania. Journal of Marine Research 58: 223-268 Song, J. L. 1982. A Study of the Classification of the Korean Anthozoa, 7: Scleractinia (Hexacorallia). Korean Journal of Zoology 25(3): 131-148. Song, J. L. 1991. A Systematic Study on the Korean Anthozoa, 12: Order Scleractinia. The Korean Journal of Systematic Zoology 7(l): 127-150. Song, J. L. 2000. Cnidaria 2: Anthozoa. Korea Institute of Bioscience and Biotechnology. 332 pp. Song, J. L. & Won, J. H. 1997. Systematic relationship of the anthozoan orders based on the partial nuclear 18S rDNA sequences. Korean Journal of Biological Sciences 1: 43-52. Sorauf, J. E. & Jell, J. S. 1977. Structure and incremental growth in the ahermatypic coral Desmophyllum cristagalli from the North Atlantic. Palaeontology 20(1): 1-19. Spengler, L. 1781. Beskrivelse over et ganske besynderligt Corall-product, hvilket man, indtil dets Sloegt noermere bestemmes, kunde kalde en Snekke-Madrepore 561 References (Madrepora cochlea). Nye Saml. Danske Videnskebernes Selskab Skrifter 1: 240–248. Squires, D. F. 1958. The Cretaceous and Tertiary corals of New Zealand. New Zealand Geological Survey, Paleontology Bulletin 29: 107 pp. Squires, D. F. 1959a. Deep-sea corals collected by the Lamont Geological Observatory. 1) Atlantic Corals. American Museum Novitates 165: 1-42. Squires, D. F. 1959b. Rsults of the Puritan-American museum of natural history expedition to western Mexico. 7. Corals and coral reefs in the Gulf of California. Bulletin of the American Museum of Natural History 118(7): 367-431. Squires, D. F. 1960. Additional rhizangiid corals from the Wanganui Series. New Zealand Journal of Geology and Geophysics 3(1): 1-7. Squires, D. F. 1961. Deep sea corals collected by the Lamont Geological Observatory. 2. Scotia Sea corals. American Museum Novitates 2046: 48 pp. Squires, D. F. 1964. New stony corals (Scleractinia) from northeastern New Zealand. Records of the Auckland Institute and Museum 6(1): 9 p. Squires, D. F. 1966. Port Phillip Survey 1957–1963. Scleractinia. Memoirs of the National Museum, Melbourne 27: 167-174. Squires, D. F. 1967. The Evolution of the Deep-Sea Coral Family Micrabaciidae. Studies in Tropical Oceanography 5: 502-510. Squires, D. F. 1969. Distribution of selected groups of marine invertebrates in waters south of 35ºS latitude: Scleractinia. Antarctic Map Folio Series 11: 15-18. Squires, D. F. & Ralph, P. M. 1965. A new scleractinian coral of the genus Flabellum from New Zealand with a new record of Stephanocyathus. Proceedings of the Biological Society of Washington 78: 259-264. Squires, D. F. & Keyes, I. W. 1967. The marine fauna of New Zealand: scleractinian corals. New Zealand Oceanographic Institute Memoir 43: 46 pp. Stanley, G. D. 2003. The evolution of modern corals and their early history. Earth Science Review 60: 195-225. Stanley, G. D. 2006. Photosymbiosis and the evolution of modern coral reefs. Science 312: 857-858. Stanley, G. D. & Swart, P. K. 1995. Evolution of the coral-zooxanthellae symbiosis during the Triassic: A geochemical approach. Paleobiology 21: 179-199. Stanley, G. D. Jr. & Fautin, D. G. 2001. The origin of modern corals. Science 291: 1913-1914. Stanley, G. D. & Schootbrugge, B. Van de. 2009. The evolution of the coral-algal symbiosis. In: Coral Bleaching: Patterns, Processes, Causes and Consequences. van Oppen, M. & Lough, J. (eds.). Ecological Studies 205. Springer. Berlin- Heidelberg. pp. 7-20. Stefani, F., Benzoni, F., Pichon, M., Mitta G. & Galli, P. 2008. Genetic and morphometric evidence for unresolved species boundaries in the coral genus Psammocora (Cnidaria; Scleractinia), Hydrobiologia 596: 153-172. 562 References Stehli, F. G. & Wells, J. W. 1971. Diversity and age patterns in hermatypic corals. Systematic Zoology 20: 115-126. Steiner, S. C. C. 2003. Stony corals and reefs of Dominica. Atoll Research Bulletin 498: 1-15. Stephens, J. 1909. Alcyonarian and Madreporarian corals of the Irish coasts, with description of a new species of Stachyodes by Prof. S. J. Hickson, F. R. S. Scientific investigations (Fisheries Ireland) 1907(5): 28 pp. Stephenson, W. & Wells, J. W. 1956. The corals of the Low Isles, Queensland. University of Queensland Papers (Department of Zoology) 1(4): 59 pp. Stokes, L. & Broderip, W. J. 1828. Description of Caryophyllia smithii n. sp. Zoological Journal 33: 485-486. Stolarski, J. 1995. Ontogenetic development of the thecal structures in Caryophylliinae scleractinian corals. Acta Palaeontologica Polonica 40(1): 19-44. Stolarski, J. 1996. Gardineria - a scleractinian living fossil. Acta Palaeontologica Polonica 41: 339-367. Stolarski, J. 2000. Origin and phylogeny of Guyniidae (Scleractinia) in the light of microstructural data. Lethaia 33: 13-38. Stolarski, J. 2003. 3-Dimensional micro- and nanostructural characteristics of the scleractinian corals skeleton: a biocalcification proxy. Acta Palaeontologica Polonica 48: 497-530. Stolarski, J. & Roniewicz, E. 2001. Towards a new synthesis of evolutionary relationships and classification of Scleractinia. Journal of Paleontology 75: 1090-1108. Stolarski, J., Zibrowius, H. & Löser, H. 2001. Panchronism of the sipunculid- scleractinian symbiosis. Acta Palaeontologica Polonica 46: 309-330. Stolarski, J., Kitahara, M. V., Miller, D. J., Cairns, S. D., Mazur, M. & Meibom, A. An ancient evolutionary origin of Scleractinia revealed by azooxanthellate corals. Submitted PNAS. Stothard, P. 2000. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques 28: 1102-1104. Stranks, T. N. 1993. Catalogue of Recent Cnidaria type specimens in the Museum of Victoria. Occasional Papers from the Museum of Victoria 6: 1-26. Studer, T. 1881. Ueber Knospung u. Theilung bei Madreporarien. Mittheilungen der naturforschenden Gesellschaft in Bern 1880: 3-14. Sutcliffe, O. E., Dowdeswell, J. A., Whittington, R. J., Theron, J. N. & Craig, J. 2000. Calibrating the Late Ordovician glaciation and mass extinction by the eccentricity cycles of Earth's orbit Geology 28: 967-970. Tachikawa, H. 2005. Azooxanthellate Scleractinia (Hexacorallia, Anthozoa, Cnidria) collected from Otsuki, Kochi Prefecture, Japan. Kuroshio Biosphere 2: 1-27. Tachikawa, H. 2008. New records of azooxanthellate Scleractinia, Labyrinthocyathus limatulus (Squires) and Dactylotrochus cervicornis (Moseley) (Cnidaria: Anthozoa: Scleractinia: Caryophylliidae) from Japan. Natural History Research 1(10): 9-14. 563 References Talmadge, R. R. 1972. Notes on some west coast corals. Of sea and shore 3(2): 81-82. Tamura, K., Nei, M. & Kumar, S. 2004. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proceedings of the National Academy of Sciences (USA) 101: 11030-11035. Tamura, K., Dudley, J., Nei, M. & Kumar, S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599. Tenison-Woods, J. E. 1879a. On a new species of Psammoseris. Proceeding of the Linnaen Society of New South Wales 3: 8-11. Tenison-Woods, J. E. 1879b. On some new extratropical corals. Proceeding of the Linnaen Society of New South Wales 3: 131-135. Tenison-Woods, J. E. 1880. On Heteropsammia michelinii, of Edwards and Haime. Proceedings of the Linnean Society of New South Wales 4: 293-300. Tenison–Woods, J. E. 1878. On the extratropical corals of Australia. Proceedings of the Linnaean Society of New South Wales 2: 292-341. Thomson, J. A. 1931. Alcyonarians and solitary corals from the Michael Sars North- Atlantic deep-sea expedition 1910. Report on the scientific results of the Michael Sars North-Atlantic deep-sea expedition 1910 5(2): 10 pp. Tittensor, D. P., Baco, A. R., Hall-Spencer, J. M., Orr, J. C. & Rogers, A. D. 2010. Seamounts as refugia from ocean acidification for cold-water stony corals. Marine Ecology 31: 212-225. Tizard, R. N., Moseley, H. N., Buchanan, J. Y. & Murray, J. 1885. Narrative: Report on the scientific results of the voyage of the H.M.S. Challenger during the years 1873-76 1(2): 510-1100. Tribble, G. W. & Randall. R. H. 1986. A description of the high-latilude shallow water coral communities of Miyake-jima, Japan. Coral Reefs 4: 151-159. Trotter, J. A., Williams, I. S., Barnes, C. R., Lecuyer, C., & Nicoll, R.S. 2008. Did cooling oceans trigger Ordovician biodiversification? Evidence from conodont thermometry. Science 321: 550-554. Tseng, C. C., Wallace, C. C. & Chen, C. A. 2005. Mitogenomic analysis of Montipora cactus and Anacropora matthai (Cnidaria; Scleractinia; Acroporidae) indicates an unequal rate of mitochondrial evolution among Acroporidae corals. Coral Reefs 24: 502-508. Tyler, P. A. & Zibrowius, H. 1992. Submersible observations of the invertebrate fauna on the continental slide southwest of Ireland (NE Atlantic Ocean). Oceanologica Acta 2(15): 211-226. Uchman, A. 2004. Phanerozoic history of deep-sea trace fossils. Geological Society, London, Special Publications 228: 125-139. Umbgrove, J. H. F. 1938. Corals from an elevated marl of Talaud (East Indies). Zoologische Mededelingen 20: 263–274. Umbgrove, J. H. F. 1946. Corals from the Upper Kalibeng beds (Upper Pliocene of Java). Koninklijke nederlandsche Akademie van Wetenschappen, Proceedings of the Section of Sciences 49: 87-93. 564 References Umbgrove, J. H. F. 1950. Corals from the Putjangan beds (Lower Pleistocene) of Java. Journal of Paleontology 24(6): 637–651. Utinomi, H. 1956. Invertebrate Fauna of the Intertidal Zone of the Tokara Islands, XIV: Stony Corals and Hydrocorals. Bulletin of the Mun. Museum of Natural History 10: 37-44. Utinomi, H. 1965. A revised list of scleractinian corals from the southwest coast of Shikoku in the collections of the Ehime University and the Ehime Prefectural Museum, Matuyama. Publications of the Seto Marine Biological Laboratory 13(3): 243-261. Utinomi, H. 1971. Scleractinian Corals from Kamae Bay, Oita Prefecture, Northeast of Kyushu, Japan. Publications of the Seto Marine Biological Laboratory 19(4): 203-229. van Oppen, M. J. H. 1999. Atypically low rate of cytochrome b evolution in the scleractinian coral genus Acropora. Proceeding of the Royal Society B 266: 179-183. van Oppen, M. J., Catmull, J., McDonald, B. J., Hislop, N. R., Hagerman, P. J. & Miller, D. J. 2002. The mitochondrial genome of Acropora tenuis (Cnidaria; Scleractinia) contains a large group I intron and a candidate control region. Journal of Molecular Evolution 55: 1-13. Vaughan, T. W. 1900. The Eocene and Lower Oligocene Coral Faunas of the United States, with Descriptions of a Few Doubtfully Cretaceous Species. Monographs of the United States Geological Survey 39: 263 pp. Vaughan, T. W. 1905. A critical review of the literature on the simple genera of the Madreporaria Fungida, with a tentative classification. Proceedings of the United States National Museum 28(1401): 371-424. Vaughan, T. W. 1906. Reports on the scientific results of the expedition to the eastern tropical Pacific ... by the U.S. Fish Commission Steamer Albatross from October, 1904, to March, 1905. 6. Madreporaria. Bulletin of the Museum of Comparative Zoology Harvard 50(3): 61-72. Vaughan, T. W. 1906. Reports on the scientific results of the expedition to the eastern tropical Pacific ... by the U.S. Fish Commission Steamer Albatross from October, 1904, to March, 1905. Part 6: Madreporaria. Bulletin of the Museum of Comparative Zoology Harvard 50(3): 61-72. Vaughan, T. W. 1907. Recent Madreporaria of the Hawaiian Islands and Laysan. Bulletin of the United States National Museum 59: 427 pp. Vaughan, T. W. 1907. Recent Madreporaria of the Hawaiian Islands and Laysan. Bulletin of the United States National Museum 59: 427 pp. Vaughan, T. W. 1918. Some shoal-water corals from Murray Island (Australia), Cocos- Keeling Islands, and Fanning Island. Papers from the Department of Marine Biology of the Carnegie Institution of Washington 9 (213): 49-234. Vaughan, T. W. 1919. Fossil corals from Central America, Cuba, and Porto Rico, with an account of the American Tertiary, Pleistocene, and Recent coral reefs. Bulletin of the United States National Museum 103: vi + 189-524. 565 References Vaughan, T. W. & Wells, J. W. 1943. Revision of the suborders, families and genera of the Scleractinia. Special Papers of the Geological Society of America 44: 1-363. Veevers, J. J. & Li, Z. X. 1991. Review of seafloor spreading around Australia. II. Marine magnetic anomaly modeling. Australian Journal of Earth Science 38: 391-408. Veizer, J., Godderis, Y. & François, L. M. 2000. Evidence for decoupling of atmospheric CO2 and global climate during the Phanerozoic eon. Nature 408: 698-701. Veron, J. E. N. 1986. Corals of Australia and the Indo-Pacific. Pp. xii+644, many unnumbered figs. North Ryde [Sydney]: Angus & Robertson. Veron, J. E. N. 1995. Corals in space and time: biogeography and evolution of the Scleractinia. Cornell University Press, Ithaca, N.Y. 321 p. Veron, J. E. N. 2000. Corals of the World. Volume 2. Pp. viii+429, numerous figs. Townsville: Australian Institute of Marine Science. Veron, J. E. N. 2008. Mass extinctions and ocean acidification: biological constraints on geological dilemmas. Corals Reefs 27: 459-472. Veron, J. E. N. & Pichon, M. 1980. Scleractinia of Eastern Australia. Part 3. Australian Institute of Marine Science Monograph Series 4: 422 pp. Veron, J. E. N., Odorico, D. M., Chen, C. A. & Miller, D. J. 1986. Reassessing Evolutionary Relationships of Scleractinian Corals. Coral Reefs 15: 1-9. Veron, J. E. N. & Marsh, L. 1988. Hermatypic corals of Western Australia: records and annotated species list. Records of the Western Australian Museum Supplement 29: 136 pp. Veron, J. E. N., Odorico, D. M., Chen, C. A. & Miller, D. J. 1996. Reassessing evolutionary relationships of scleractinian corals. Coral Reefs 15: 1-9. Verrill, A. E. 1864. List of the Polyps and Corals sent by the Museum of Comparative Zoology to other Institutions in Exchange, with Annotations. Bulletin of the Museum of Comparative Zoology Harvard 1(3): 29-60. Verrill, A. E. 1866. Synopsis of the polyps and corals of the North Pacific Exploring Expedition, ... with descriptions of some additional species from the west coast of North America. Part III. Madreporaria. Proceedings of the Essex Institute 5: 17-50. Verrill, A. E. 1869. On New and Imperfectly Known Echinoderms and Corals. Proceedings of the Boston Society of Natural History 12: 381-396. Verrill, A. E. 1870. Notes on Radiata in the Museum of Yale College, Number 6: Review of the Corals and Polyps of the West Coast of America. Transactions of the Connecticut Academy of Arts and Sciences 1: 503-558. Verrill, A. E. 1882. Notice of the remarkable marine fauna occupying the outer banks off the southern coast of New England. Nº5. American Journal of Science 23(3): 309-316. Verrill, A. E. 1883. Reports on the Anthozoa, and on some additional species dredged by the "Blake" in 1877-1879, and by the U. S. Fish Commission Steamer "Fish 566 References Hawk" in 1880-82. Bulletin of the Museum of Comparative Zoology Harvard 1(11): 1-72. Verrill, A. E. 1885. Notice of the Remarkable Fauna Occupying the Outer Banks off the Southern Coast of New England, number 11. American Journal of Science 3 (29/170): 149-157. Verrill, A. E. 1908. Distribution and variations of the deep-sea stony corals from off the coast of the United States. Science 27: 494. Viada, S. T. & Cairns, S. D. 1987. Range extensions of ahermatypic Scleractinia in the Gulf of Mexico. Northeast Gulf Science 2(9): 131-134. Wallace, C. C. 1999. Staghorn Corals of the World: A Revision of the Genus Acropora. Melbourne, Australia: CSIRO Publishing. Wallace, C. C., Chen, C. A. C., Fukami, H. & Muir, P. R. 2007. Recognition of separate genera within Acropora based on new morphological, reproductive, genetic evidence from A. togianensis, elevation of the subgenus Isopora Studer, 1878 to genus (Scleractinia: Astrocoeniidae; Acroporidae). Coral Reefs 26: 231-239. Waller, R. G. 2005. Deep Water Scleractinians: Current knowledge of reproductive processes. Pp. 691-700 In: Freiwald, A. & Roberts, J. M. (eds.) Cold-water Corals and Ecosystems. Springer, Heidelberg. Waller, R. G. & Tyler, P. A. 2005. The reproductive biology of two deep-sea, reef- building scleractinians from the NE Atlantic Ocean. Coral Reefs 24(3): 514-522. Wanner, J. 1902. Die fauna der obersten weissen Kreide der libyschen Wüste. Palaeontographica 30(2): 91-151. Wells, J. W. 1936. The nomenclature and type species of some genera of recent and fossil corals. American Journal of Science 182: 97-134. Wells, J. W. 1947. Coral studies. Part III. Three new Cretaceous corals from Texas and Alabama. Part IV: A new species of Phyllangia from the Florida Miocene. Part V: A new Coenocyathus from florida. Bulletins of American Paleontology 31: 163-176. Wells, J. W. 1954. Recent corals of the Marshall Islands: Bikini and nearby atolls, Part 2: Oceanography (Biology). Geological Survey Professional Paper 260-I: 382- 486. Wells, J. W. 1956. Scleractinia. In: Moore, R. C. (ed.) Treatise on Invertebrate Paleontology, Part F. Coelenterata pp. F328-F444. Geological Society of America, Lawrence Wells, J. W. 1958. Scleractinian corals. B.A.N.Z.A.R.E. Reports (Series B) 6(11): 257- 275. Wells, J. W. 1961. Notes on Indo-Pacific scleractinian corals. Part 3. A new reef coral from New Caledonia. Pacific Science XV: 189-191. Wells, J. W. 1964. Ahermatypic corals from Queensland. Papers from the Departament of Zoology, University of Queensland 2: 107-121. Wells, J. W. 1969. The formation of dissepiments in zoantharian corals. In: Stratigraphy and Palaeontology—essays in Honour of Dorothy Hill. pp. 17–26. Australian National University Press, Canberra. 567 References Wells, J. W. 1972. Some Shallow Water Ahermatypic Corals from Bermuda. Postilla 156: 10 pp. Wells, J. W. 1973a. New and old corals from Jamaica. Bulletin of Marine Science 23(1): 16–55. Wells, J. W. 1973b. Guynia annulata in Jamaica. Bulletin of Marine Science 23(1): 59- 63. Wells, J. W. 1983. Annotated list of the scleractinian corals of the Galápagos. In: Glynn, P. W. and Wellington, G. M. (eds.) Corals and Coral Reefs of the Galápagos Islands, pp. 212–291, 21 pls. Berkeley: University of California Press. Wells, J. W. 1984. Notes on the Indo-Pacific scleractinian corals. Part 10. Late Pleistocene ahermatypic corals from Vanuatu. Pacific Science 38(3): 205-219. Wells, J. W. & Lang, J. C. 1973. Systematic list of Jamaican shallow-water Scleractinia. Bulletin of Marine Science 23: 55-58. Wheeler, Q. D. 2004. Taxonomic triage and the poverty of phylogeny. Philosophical Transactions of the Royal Society of London B, 359: 571-583. Wheeler, Q. D., Raven, P. H. & Wilson, E. O. 2004. Taxonomy: Impediment or expedient? Science 305: 285. Wiegmann, B. M., Trautwein, M. D., Kim, J., Cassel, B. K., Bertone, M., et al. 2009. Single-copy nuclear genes resolve the phylogeny of the holometabolous insects. BMC Biology 7: 34. Wijsman-Best, M. 1970. A new species of Polycyathus Duncan, 1876 from New Caledonia and a new records of P. senegalensis Chevalier, 1966 (Madreporaria). Beaufortia 17(227): 79-84. Wijsman-Best, M., Faure, G. & Pichon, M. 1980. Contribution to the knowledge of the stony corals from the Seychelles and Eastern Africa. Revue de Zoologie Africaine 94: 600-627. Williams, G. C. 1986. What are corals? Sagittarius 1(2): 11-15. Wilson, E. C. 1990. The Tropical Colonial Stony Coral Tuhastrea coccinea at Cabo San Lucas, Mexico. Bulletin of the Southern California Academy of Sciences 89(3): 137-138. Wilson, G. D. F. 1999. Some of the deep-sea fauna is ancient. Crustaceana 72(8): 1019- 1030. Wirshing, H. H. & Baker, A. C. 2008. Coral systematics inferred from the gene galaxin: Exploring phylogenetic relationships using a putative determinant of skeletal morphology. Proceedings of the 11th International Coral Reef Symposium, Ft. Lauderdale, Florida, 7-11 July 2008. Session number 26. p. 1401- 1405. Wood, E. M. 1983. Corals of the word. T.F.H. Publications Inc., Neptune City. 256 pp. Wyman, S. K., Jansen, R. K. & Boore, J. L. 2004. Automatic annotation of organellar genomes with DOGMA. Bioinformatics 20(17): 3252-3255. Wyrtki, K. 1960. The surface circulation in the Coral and Tasman seas. Division of Fisheries Oceanographic Technical paper nº8, CSIRO, Australia 44 pp. 568 References Xia, X. H. & Xie, Z. 2001. DAMBE: Data analysis in molecular biology and evolution. Journal of Hereditary 92: 371-373. Xia, X. H., Xie, Z., Salemi, M., Chen, L. & Wang, Y. 2003. An index of substitution saturation and its application. Molecular Phylogenetics and Evolution 26: 1-7. Yabe, H. & Eguchi, M. 1932a. A New Species of Endopachys, Endopachys japonicum, from a Younger Cenozoic Deposit of Japan. Japanese Journal of Geology and Geography 10(1-2): 11-17. Yabe, H. & Eguchi, M. 1932b. Deep-water corals from the Riukiu limestone of Kikai- jima, Riukiu Islands. Proceeding of the Imperial Academy (Japan) 8(9): 442- 445. Yabe, H. & Eguchi, M. 1932c. Notes on a Fossil Turbinolian Coral, Odontocyathus japonicus nov. sp., from Segoe, near Tokaoka-machi, province of Hyuga. Japanese Journal of Geology and Geography 9(3-4): 149-152. Yabe, H. & Eguchi, M. 1932d. Some Recent and fossil corals of the genus Stephanophyllia H. Michelin from Japan. Scientific Reports of Tohoku Imperial University, series 2 (Geology) 15(2): 55-63. Yabe, H. & Eguchi, M. 1932e. A study of the Recent deep-water coral fauna of Japan. Proceedings of the Imperial Academy of Japan 8(8): 387-390. Yabe, H. & Eguchi, M. 1934a. On some specific names of corals. Animal and Plant 111(11): 2026. Yabe, H. & Eguchi, M. 1934b. Probable generic identity of Stephanophyllia Michelin and Micrabacia M. Edwards and J. Haime. Proceedings of the Imperial Academy of Japan 10(5): 278-281. Yabe, H. & Eguchi, M. 1937. Notes on Deltocyathus and Discotrochus from Japan. The Scientific Reports of the Tôhoku Imperial University, Sendai, Japan, series 2 (Geology) 19(1): 127-147. Yabe, H. & Eguchi, M. 1941a. On Two Species of Simple Corals from Kagoshima-ken, Kyushu. Journal of the Geological Society of Japan 575(48): 418-420. Yabe, H. & Eguchi, M. 1941b. Corals of Toyama Bay. Bulletin of the Biogeographical Society of Japan 12(1): 102-104. Yabe, H. & Eguchi, M. 1941c. Simple Corals from Sumagui Formation, the Philippine Islands. Proceedings of the Imperial Academy of Japan 17(6): 210-215. Yabe, H . & Eguchi, M. 1941d. On some simple corals from the Neogene of Java. Proceedings of the Imperial Academy of Japan 17: 269-273. Yabe, H. & Eguchi, M. 1942a. Fossil and Recent Flabellum from Japan. The Scientific Reports of the Tôhoku Imperial University, Sendai, Japan, series 2 (Geology) 22(2): 87-103. Yabe, H. & Eguchi, M. 1942b. Fossil and Recent Simple Corals from Japan. Scientific Reports of the Tohoku Imperial University, series 2 (Geology) 22(2): 105-178. Yabe, H. & Eguchi, M. 1946. Generic Identity of Notocyathus Tenison-Wood and Citharocyathus Alcock. Proceedings of the Imperial Academy of Japan 22(l): 6- 8. 569 References Yabe, H. & Sugiyama, 1936. Some Deep-Water Corals from the Palao Islands. Proceedings of the Imperial Academy of Japan 12(10): 146-249. Yabe, H. & Sugiyama, T. 1941. Recent reef building corals from Japan and the South Sea Islands under the Japanese Mandate II, Science Reports Tohoku Imp. University, Sendal, Japan, 3rd ser. (Geology). Special vol. II. pp. 67-91. Yasuhara, M., Cronin, T. M., deMenocal, P.B., Okahashi, H. & Linsley, B. K. 2008. Abrupt climate change and collapse of deep-sea ecosystems. Proceedings of the National Academy of Science 105(5): 1556-1560. Zans, V. A. 1959. Recent Stony corals of Jamaica. Geonotes 2: 27-36. Zibrowius, H. 1969. Note préliminaire sur la presence à Marseille de quatre Madréporaires peu connus: Desmophyllum fasciculatum (Risso, 1826), Guynia annulata (Duncan, 1872), Stenocyathus vermiformis (Pourtalès, 1868) et Conotrochus magnaghii (Cecchini, 1914). Bulletin de la Société zoologique de France 93(2): 325-330. Zibrowius, H. 1971. Remarques sur la faune sessile des grottes sous-marines et de l’étage bathyal en Méditerranée. Rapports et process-verbaux des reunions – Commission Internationale pour l’Exploration scientifique de la Mer Méditerranée 20(3): 243-245. Zibrowius, H. 1973. Revision des espèces actuelles du genre Enallopsammia Michelotti, 1871, et description de E. marenzelleri, nouvelle espèces bathyle à large distribution: Ocean Indien et Atlantique Central (Madreporaria, Dendrophylliidae). Beaufortia 21(276): 37-54. Zibrowius, H. 1974a. Caryophyllia sarsiae n. sp. And other Recent deep-water Caryophyllia (Scleractinia) previously referred to little-known fossil species (C. arcuata, C. cylindracea). Journal of the Biological Association of the United Kingdom 54: 769-784. Zibrowius, H. 1974b. Scleractiniaires des Iles Saint Paul et Amsterdam (Sud de l’Ocean Indien). Tethys 5(4): 747-777. Zibrowius, H. 1974c. Redescription of Sclerhelia hirtella from Saint Helena, South Atlantic, and remarks on Indo-Pacific species erroneously referred to the same genus (Scleractinia). Journal of Natural History 8: 563-575. Zibrowius, H. 1974d. Révision du genre Javania et considératios générales sur les Flabellidae (Scléractiniaires). Bulletin de l’Institute Océanographique, Monaco, 71(1429): 48 p. Zibrowius, H. 1978. Les Scléractiniaires des grottes sous-marines en Méditerranée et dans l’Atlantique nord-oriental (Portugal, Madère, Canaries, Açores). Pubblicazioni della Stazione Zoologica di Napoli 40 (2): 516-545. Zibrowius, H. 1979. Résultats scientifiques des Campagnes de la Calypso en Méditerranée nord-orientale (1955, 1956, 1960, 1964). 7: Scléractiniaires. Masson. Zibrowius, H. 1980. Les Scléractiniaires de la Méditeranée et de I‘Atlantique nord- oriental. Mémoires de I‘Institut Océanographique, Monaco 11, 284 p. Zibrowius, H. 1985. Asexual reproduction by bud-shedding in shallow- water Balanophyllia of the tropical Indo-Pacific (Cnidaria; Scleractinia; 570 References Dendrophylliidae). Proceedings of the Fifth International Coral Reef Congress, Tahiti 5: 233i238. Zibrowius, H. 1988. Lês coraux Stylasteridae et Scleractinia. In: Guille, A. and Ramos, J. M.: Lês rapports dês campagnes à la mer MD 55/ Brésil à bord du “Marion Dufresne” 6 mai–2 juin 1987. Terres Australes et Antarctiques Françaises, pp. 132–136. Zibrowius, H., Southward, E. C. & Day, J. H. 1975. New Observations on a Little- Known Species of Lumbrineris (Polychaeta) Living on Various Cnidarians, with Notes on Its Recent and Fossil Scleractinian Hosts. Journal of the Marine Biological Association of the United Kingdom 55: 83-108. Zibrowius, H. & Saldanha, L. 1976. Sclératiniaires récoltés en plongée au Portugal et dans les archipels de Madère et des Açores. Boletim da Sociedade Portuguesa de Ciencias Naturais 16: 91-114. Zibrowius, H. & Grieshaber, A. 1977. Scléractiniaires de l’Adriatique. Téthys 7(4): 375- 384. Zibrowius, H. & Grygier, M. J. 1985. Diversity and range of Scleractinian coral hosts of Ascothoracida (Crustacea: Maxillopoda). Annales de l’Institut Océanographique, Paris, new series 61(2): 115–138. Zibrowius, H. & Gili, J. M. 1990. Deep-Water Scleractinia (Cnidaria: Anthozoa) from Namibia, South Africa, and Walvis Ridge, Southeastern Atlantic. Scientia Marina 54(1): 19-46. Zibrowius, H. & Taviani, M. 2005. Remarkable sessile fauna associated with deep coral and other calcareous substrates in the Strait of Sicily, Mediterranean Sea. In: Freiwald, A. & Murray Roberts, J. (eds.) Cold-Water Corals and Ecosystems. Springer, Heidelberg. Zlatarski, V. N. 1982. Description systématique. In: Zlatarski, V. N. & Estalella, N. M. (eds.) Les Scléractiniaires de Cuba. l’Academie Bulgare des Sciences, Sophia. Zlatarski, V. N. & Estalella, N. M. 1980. Scleractinia of Cuba with data on the constituent organisms. Bulgarian Academy of Science, Sophia. [in Bulgarian] Zou, R. 1988. Studies on the deep-water Scleractinia from South China Sea. 2 Record and narration of species as well as time-spacial distributional characteristics. Tropical Oceanology 7(1): 74-83. Zou, R., Meng, Z . & Guan, X. 1988. Ecological analyses of deep sea Scleractinian on the continental shelf of the northern South China Sea. South China Sea Institute of Oceanology, Academia Sinica, Selected Oceanic Works 1: 193-199. Zupanovic, S. 1969. Prilog izucavanju bentosje faune Jabucke kotline. Thalassia Jugoslavica 5: 477-493. 571 572 This page is intended to be blank Appendix 4.1 –Species of Caryophyllia (chronological description ordered, *records for New Caledonia, @ records for Australia) with their respective junior synonyms, corallum attachment (A – attached; F – free), distribution (1 – Western North Pacific; 2 – Eastern North Pacific; 3 – Western South Pacific; 4 – Eastern South Pacific; 5 – Western North Atlantic; 6 – Eastern North Atlantic; 7 – Western South Atlantic; 8 – Eastern South Atlantic; 9 – Indian Ocean; 10 – Central Indo-Pacific), and depth range. A or F Distribution Depth Caryophyllia species and Author Junior Synonyms 1 2 3 4 5 6 7 8 9 10 range (m) C. cyathus (Ellis & Solander, 1786) Madrepora calendula Hermann, 1782 A X 70-300 Madrepora anthophyllum Esper, 1791 C. smithii Stokes & Broderip, 1828 Turbinolia borealis Fleming, 1828 A X X 40-400 C. clavus Scacchi, 1835 Cyathina turbinata Philippi, 1836 C. pseudoturbinolia Michelin, 1841 Paracyathus taxilianus Gosse, 1860 Paracyathus thulensis Gosse, 1860 Paracyathus pteropus Gosse, 1860 C. smithii var. castanea Goose, 1860 C. smithii var. esmeralda Gosse, 1860 C. smithii var. clara Gosse, 1860 C. clavus var. elongata Duncan, 1873 C. clavus var. exserta Duncan, 1873 C. clavus var. epithecata Duncan, 1873 Paracyathus monilis Duncan, 1878 C. grayi*@ (M. Edwards & Haime, 1848) A or F X X X X X 37-360 C. berteriana Duchassaing, 1850 C. formosa Pourtalès, 1867 A X X 91-1033 C. spinigera Kent, 1871 F X 127-347 C. calveri Duncan, 1873 Cyathina pezita Ehrenberg, 1834 A X X 91-340 C. electrica Milne Edwards, 1881 C. atlantica@ (Duncan, 1873) C. laevicostata Moseley, 1881 A X X X X X X 298-2165 ?C. panda Alcock, 1902 C. alcocki Vaughan, 1907 ?C. pacifica Keller, 1981 C. abyssorum Duncan, 1873 C. inskipi Duncan, 1873 A X 732-2000 C. vermiformis Duncan, 1873 C. seguenzae Duncan, 1873 F X 1000-1400 C. antillarum Pourtalès, 1874 A X 150-730 C. polygona Pourtalès, 1878 A X 700-1817 C. inornata (Duncan, 1878) Coenocyathus giesbrechti Doderlein, 1913 A X X 0-100 Coenocyathus dohrni Doderlein, 1913 C. lamellifera*@ Moseley, 1881 A X X X 89-1152 C. profunda Moseley, 1881 A X X X 35-1116 C. paucipalata Moseley, 1881 A X 714-843 573 Appendix 4.1 - Continued C. rugosa*@ Moseley, 1881 C. paraoctopali Yabe & Eguchi, 1942 A X X X X X X 71-581 C. transversalis@ Moseley, 1881 A X X 210-397 C. dentata (Moseley, 1881) A or F X X 90-263 C. spinicarens (Moseley, 1881) F X X 222-750 C. japonica Marenzeller, 1888 A X X 77-1680 C. ephyala Alcock, 1891 A X X 420 C. cinticulata* (Alcock, 1898) A X X 384 C. paradoxa Alcock, 1898 A X 786 C. ambrosia ambrosia Alcock, 1898 C. scillaemorpha Alcock, 1894 F X X X X X X X 311-1230 C. arnoldi Vaughan, 1900 A X X 40-656 C. quadragenaria* Alcock, 1902 C. scobinosa decapali Yabe & Eguchi, 1942 A X X X X X X 54-1669 C. scobinosa*@ Alcock, 1902 C. cultrifera Alcock, 1902 F X X X X X 296-2450 ?C. sp. B sensu Seig & Zibrowius, 1989 C. diomedeae*@ Marenzeller, 1904 A X X X X X X X X X 225-2200 C. antarctica Marenzeller, 1904 A Antarctic/Subantarctic 87-1435 C. planilamellata@ Dennant, 1906 F X X X 128-1220 C. octopali* Vaughan, 1907 C. octopali var. incerta Vaughan, 1907 A X X 457-627 C. hawaiiensis* Vaughan, 1907 A X X X X X 85-650 C. grandis@ Gardiner & Waugh, 1938 F X X X X X 183-596 C. mabahithi Gardiner & Waugh, 1938 F Antarctic/Subantarctic X 278-1022 C. sewelli Gardiner & Waugh, 1938 F X 366 C. alaskensis Vaughan, 1941 C. sp. A sensu Cairns, 1994 A X X 102-399 C. jogashimaensis Eguchi, 1968 A X 52-98 C. sarsiae Zibrowius, 1974 C. sp. sensu Zibrowius, 1974 A X 520-2200 C. horologium Cairns, 1977 A 55-175 C. corrugata Cairns, 1979 A X 183-380 C. barbadensis Cairns, 1979 A X 129-249 C. zopyros Cairns, 1979 A X 73-618 C. ambrosia caribbeana Cairns, 1979 F X X 183-1646 C. alberti Zibrowius, 1980 A X 76-506 C. foresti Zibrowius, 1980 A X 155-950 C. eltaninae Cairns, 1982 A Antarctic/Subantarctic 101-814 C. squiresi Cairns, 1982 C. sp. A sensu Squires, 1969 F X 406-659 C. marmorea Cairns, 1984 A X X 331-500 C. quangdongensis Zou, 1984 F X 167-179 C. zanzibarensis Zou, 1984 C. compressus Gardiner &Waugh, 1938 A or F X 238-302 C. balaenacea Zibrowius & Gili, 1990 A X 882-1112 C. valdiviae Zibrowius & Gili, 1990 F X 882-2670 C. perculta Cairns, 1991 A X 54-316 C. solida Cairns, 1991 A X 373-488 C. ralphae* Cairns, 1995 A X X 315-360 C. secta Cairns & Zibrowius, 1997 A X X 220-366 C. crosnieri* Cairns & Zibrowius, 1997 C. elongata Cairns in Cairns & Keller, 1993 A X X X X X 133-1050 C. octonaria Cairns & Zibrowius, 1997 A X X X 182-622 C. cornulum Cairns & Zibrowius, 1997 F X 1525-2603 574 Appendix 4.1 - Continued C. karubarica Cairns & Zibrowius, 1997 F X 389-477 C. unicristata*@ Cairns & Zibrowius, 1997 F X X X 251-477 C. stellula Cairns, 1998 C. epithecata of Gardiner, 1904 A or F X 166-420 C. decamera Cairns, 1998 F X X 124-263 C. abrupta* Cairns, 1999 A X X 300-650 C. crypta Cairns, 2000 A X 12-291 C. huinayensis Cairns, Haussermann & A X X 16-256 Forsterra, 2005 C. laevigata sp nov* A X 410-1032 C. versicolorata sp nov* A X 215-708 C. concreta sp nov* A X 215-570 C. aspera sp. nov.* A X 400 C. oblonga sp nov* A X 670-1005 C. sp A* A X 416-433 C. tangaroae sp nov* A X 810-1000 575 Appendix 4.2 –Station list. Expedition Station Lat (S) Long (E) Depth (m) Date New Caledonia Bathus 2 DW 734 23º00.48’ 166º51.50 354-775 13/05/1993 Bathus 3 DW 781 23º53.86’ 169º46.27’ 625 25/11/1993 Bathus 3 DW 783 23º56.80’ 169º46.80’ 617 25/11/1993 Bathus 3 DW 784 23º56.12’ 169º46.14’ 611 25/11/1993 Bathus 3 DW 786 23º54.46’ 169º49.15’ 699 25/11/1993 Bathus 3 CP 833 23º02.75’ 166º58.23’ 441-444 30/11/1993 Bathus 3 CP 842 23º05.00’ 166º47.81’ 830 01/12/1993 Bathus 4 DW 882 22º02.43’ 165º56.42’ 250-350 01/08/1994 Bathus 4 CP 889 21º00.83’ 164º27.34’ 416-433 02/08/1994 Bathus 4 DW 893 21º01.70’ 164º27.23’ 600-620 02/08/1994 Bathus 4 DW 894 20º15.77’ 163º52.03’ 245-268 03/08/1994 Bathus 4 DW 902 19º00.84’ 163º14.83’ 341-351 04/08/1994 Bathus 4 DW 903 18º59.93’ 163º13.55’ 386-400 04/08/1994 Bathus 4 CP 905 19º02.45’ 163º15.65’ 294-296 04/08/1994 Bathus 4 DW 914 18º48.79’ 163º15.23’ 600-616 05/08/1994 Bathus 4 DW 918 18º49.02’ 163º15.80’ 613-647 06/08/1994 Bathus 4 DW 933 19º06.66’ 163º29.28’ 212-220 08/08/1994 Bathus 4 DW 945 20º12.10’ 164º33.65’ 530-620 09/08/1994 Bathus 4 CP 947 20º33.72’ 164º57.72’ 470-490 10/08/1994 PrFo ? 22º33.62’ 166º25.97’ ? 12/09/1994 Norfolk 1 DW 1652 23º26.1’ 167º50.3’ 290-378 19/06/2001 Norfolk 2 DW 2023 23º27’ 167º51’ 282-297 21/10/2003 Norfolk 2 DW 2024 23º28’ 167º51’ 370-371 21/10/2003 Norfolk 2 DW 2025 23º27’ 167º51’ 410-443 21/10/2003 Norfolk 2 DW 2037 23º40’ 167º41’ 517-570 22/10/2003 Norfolk 2 DW 2038 23º42’ 168º10’ 290-330 23/10/2003 Norfolk 2 DW 2046 23º44’ 168º01’ 785-810 23/10/2003 Norfolk 2 DW 2047 23º43’ 168º02’ 759-807 23/10/2003 Norfolk 2 DW 2053 23º40’ 168º16’ 670-708 24/10/2003 Norfolk 2 DW 2058 24º40’ 168º40’ 591-1032 25/10/2003 Norfolk 2 DW 2063 24º41’ 168º40’ 624-724 25/10/2003 Norfolk 2 DW 2065 25º16’ 168º56’ 750-800 26/10/2003 Norfolk 2 DW 2066 25º17’ 168º55’ 834-870 26/10/2003 Norfolk 2 DW 2068 25º20’ 168º57’ 680-980 26/10/2003 Norfolk 2 DW 2069 25º20’ 168º58’ 795-852 26/10/2003 Norfolk 2 DW 2070 25º23’ 168º57’ 630-1150 26/10/2003 Norfolk 2 DW 2072 25º21’ 168º57’ 1000-1005 26/10/2003 Norfolk 2 DW 2074 25º24’ 168º20’ 623-691 26/10/2003 Norfolk 2 DW 2075 25º23’ 168º20’ 650-1000 27/10/2003 Norfolk 2 DW 2078 25º21’ 168º19’ 654-877 27/10/2003 Norfolk 2 DW 2086 24º56’ 168º22’ 707-777 28/10/2003 Norfolk 2 DW 2091 24º45’ 168º06’ 600-896 29/10/2003 Norfolk 2 DW 2092 24º45’ 168º07’ 320-345 29/10/2003 Norfolk 2 DW 2095 24º46’ 168º10’ 283-310 29/10/2003 Norfolk 2 DW 2100 23º54’ 167º44’ 675-709 30/10/2003 Norfolk 2 DW 2102 23º56’ 167º44’ 700-715 30/10/2003 Norfolk 2 DW 2103 23º57’ 167º44’ 717-737 30/10/2003 Norfolk 2 DW 2104 23º58’ 167º43’ 700-752 30/10/2003 Norfolk 2 DW 2107 23º53’ 167º41’ 742-820 30/10/2003 Norfolk 2 DW 2109 23º47’ 168º17’ 422-495 31/10/2003 Norfolk 2 DW 2112 23º44’ 168º18’ 640-1434 31/10/2003 Norfolk 2 DW 2113 23º45’ 168º18’ 888-966 31/10/2003 Norfolk 2 DW 2117 23º24’ 168º00’ 400 01/11/2003 Norfolk 2 DW 2125 23º17’ 168º14’ 275-348 02/11/2003 Norfolk 2 DW 2133 23º01’ 168º18’ 215-270 03/11/2003 Norfolk 2 DW 2140 22º60’ 168º22’ 270-350 03/11/2003 576 Appendix 4.2 - Continued Expedition Station Lat (S) Long (E) Depth (m) Date Norfolk 2 DW 2150 22º43’ 167º16’ 245-300 05/11/2003 Norfolk 2 DW 2156 22º54’ 167º15’ 468-500 05/11/2003 Halipro I CH 78 ? ? ? 1994 Australia SS011997 17 44º16'54'' 147º24'54'' 1786 24/01/2001 SS011997 22 44º24'18'' 147º19'24'' 336 26/01/2001 SS011997 57 44º10'30'' 146º59'18'' 881 30/01/2001 SS011997 67 44º23'36'' 147º08'48'' 1614 02/02/2001 SS011997 70 44º23'36'' 147º08'48'' 1712 02/02/2001 SS102005 20 35º22'54'' 117º12'11'' 419-460 23/11/2005 SS102005 40 35º13'38'' 118º35'38'' 398-554 25/11/2005 SS102005 44 35º26'03'' 118º21'00'' 900-915 26/11/2005 SS102005 95 28º29'22'' 113º25'08'' 416-431 05/12/2005 SS102005 105 27º08'01'' 112º45'04'' 405-414 06/12/2005 SS102005 113 25º55'40'' 112º14'35'' 404-407 07/12/2005 SS102005 115 25º55'47'' 112º40'48'' 120 08/12/2005 SS102005 139 22º51'01'' 113º30'40'' 100 10/12/2005 SS102005 150 22º00'14'' 113º40'44'' 983-1010 11/12/2005 SS102005 153 21º59'10'' 113º49'12'' 165-166 12/12/2005 SS102005 171 21º00'23'' 114º22'52'' 399-411 14/12/2005 SS102005 172 21º00'24'' 114º22'52'' 399-408 14/12/2005 SS022007 21 44º14'26'' 147º07'08'' 1200 02/04/2007 SS022007 32 44º02'30'' 146º18'42'' 410-450 04/04/2007 SS022007 36 44º14'42'' 146º09'51'' 1120-1350 05/04/2007 SS022007 37 44º14'39'' 146º09'54'' 1120-1380 0 5/04/2007 SS022007 41 44º03'57'' 146º14'02'' 800-880 05/04/2007 SS022007 50 44º12'04'' 146º11'57'' 1050-1230 6/04/2007 SS022007 66 43º51'41'' 150º25'43'' 800-880 04/2007 Norfanz 24 28º32'38'' 167º24'38'' 111-115 15/05/2003 Norfanz 50 29º07’44’’ 158º35’26’’ 505-900 21/05/2003 Norfanz 51 29º08'12'' 159º00'41'' 810-1000 21/05/2003 Norfanz 55 29º07'52'' 159º00'16'' 292-330 21/05/2003 Norfanz 57 29º07'51'' 159º00'15'' 300 21/05/2003 577 Appendix 4.3 –Scleractinian species sequenced for 16S rDNA (* or retrieved from Genebank), including station, length, accession number, and reference. Family Genus Species Station Museum Voucher Length Genbank Reference (bp) Acc. No. Acroporidae Isopora I. palifera* - - 536 AF265593 Romano & Cairns, 2000 Agariciidae Pavona P. varians* - - 536 L76016 Romano & Palumbi, 1996 Caryophylliidae Caryophyllia C. ambrosia* - - 273 AF550362 Le Goff-Vitry et al., 2004 C. atlantica SS022007 / stn.50-50 TMAG-K3827 303 FJ788113 Present study C. diomedeae Norfolk 2 / stn.DW 2106 - 302 FJ788114 Present study SS022007 / stn.066-014 TMAG-K3825 302 FJ788115 Present study SS022007 / stn.041-27 TMAG-K3824 300 FJ788116 Present study C. grandis - WAM Z13094 293 FJ788117 Present study SS102005 / stn.171-33 WAM Z21467 293 FJ788118 Present study C. grayi SS102005 / stn.1??-47 - 301 FJ788119 Present study C. inornata* - - 420 AF265599 Romano & Cairns, 2000 C. lamellifera Norfanz 0308/ stn.24 AM-G.17615 301 FJ788120 Present study C. planilamellata SS102005 / stn.020-008 WAM Z21464 301 FJ788121 Present study SS102005 / stn.040-13 WAM Z21465 301 FJ788122 Present study C. rugosa Norfanz 0308/ stn.57 AM-G.17617 300 FJ788123 Present study C. scobinosa SS102005 / stn.150-08 WAM Z21468 293 FJ788124 Present study C. transversalis - WAM Z13144 293 FJ788125 Present study - WAM Z13144 293 FJ788126 Present study C. unicristata - WAM Z13142 293 FJ788127 Present study SS102005 / stn.171-02 WAM Z21474 293 FJ788128 Present study SS102005 / stn.172-08 WAM Z21475 293 FJ788129 Present study Dasmosmilia D. lymani SS022007 / stn.008-012 - 293 FJ788130 Present study Crispatotrochus C. rugosus* - - 419 AF265600 Romano & Cairns, 2000 Paracyathus P. pulchellus* - - 408 AF265063 Romano & Cairns, 2000 578 Appendix 4.3 - Continued Family Genus Species Station Museum Voucher Length Genbank Reference (bp) Acc. No. Polycyathus P. muellerae* - - 361 AF265606 Romano & Cairns, 2000 Rhizosmilia R. maculata* - - 408 AF265602 Romano & Cairns, 2000 Tethocyathus T. virgatus Norfolk 2 / stn.DW 2057 - 290 FJ788131 Present study Trochocyathus T. efateensis Norfolk 2 / stn.DW 2132 - 290 FJ788132 Present study Dendrophylliidae Tubastraea T. coccinea* - - 562 L76022 Romano & Palumbi, 1996 Faviidae Caulastrea C. furcata* - - 409 L75997 Romano & Palumbi, 1996 Flabellidae Flabellum F. impensum* - - 563 AF265582 Romano & Cairns, 2000 Fungiacyathidae Fungiacyathus F. marenzelleri* - - 563 L76004 Romano & Palumbi, 1996 Fungiidae Fungia F. scutaria* - - 412 L76005 Romano & Palumbi, 1996 Merulinidae Hydnophora H. rigida* - - 409 L76009 Romano & Palumbi, 1996 Mussidae Lobophyllia L. hemprichii* - - 410 L76013 Romano & Palumbi, 1996 Pectiniidae Pectinia P. alcicornis* - - 409 L76017 Romano & Palumbi, 1996 Pocilloporidae Pocillopora P. damicornis* - - 425 L76019 Romano & Palumbi, 1996 Poritidae Porites P. compressa* - - 562 L76020 Romano & Palumbi, 1996 Siderastreidae Psammocora P. stellata* - - 412 L76021 Romano & Palumbi, 1996 Turbinoliidae Tropidocyathus T. labidus* - - 562 AF265585 Romano & Cairns, 2000 579 Appendix 5.1 –Species of Scleractinia sequenced for CO1, including station, location of skeletal voucher, and accession number. Traditional taxonomy Collection locality Location Accession Order Scleractinia OR of voucher Number Family Genus Species Reference Gardineriidae Gardineria G. hawaiiensis 1 JCU GQ868678 G. paradoxa 1 JCU GQ868682 Micrabaciidae Letepsammia L. formosissima 1 JCU GQ868685 Rhombopsammia R. niphada 1 JCU GQ868683 Dendrophylliidae Balanophyllia B. cornu SS 102005 stn. 140-16 JCU HM018605 B. sp. nov. SS 102005 stn. 115-48 JCU HM018612 B. sp. A Norfolk 1 stn. DW 1651 JCU HM018606 B. desmophyllioides Norfolk 2 stn. DW 2119 JCU HM018607 B. sp. C Norfolk 1 stn. DW 1651 JCU HM018608 B. sp. D Norfolk 2 stn. CP 2141 JCU HM018609 B. sp. E Norfolk 2 stn. DW 2057 JCU HM018610 B. sp. F SS 102005 stn. 096 JCU HM018611 Enallopsammia E. rostrata Norfolk 2 stn. DW 2075 JCU HM018632 Turbinoliidae Cyathotrochus C. pileus Norfolk 2 stn. DW 2137 JCU HM018623 Tropidocyathus T. lessoni SS (blank label) JCU HM018669 Fungiacyathidae Fungiacyathus F. fragilis SS 102005 stn. 121-036 JCU HM018645 F. p. pacificus SS 022007 stn. 009-036 JCU HM018646 F. stephanus SS 102005 stn. 149 - 019 JCU HM018647 F. turbinolioides SS 022007 stn. 007-015 JCU HM018648 Flabellidae Flabellum F. apertum SS 022007 stn. 050-024 JCU HM018635 F. arcuatile Norfolk 2 stn. DW 2132 JCU HM018636 F. deludens SS 022007 stn. 008-009 JCU HM018638 F. folkesoni SS 102005 stn. 171-033 JCU HM018639 F. lamellulosum SS 102005 stn. 171-033 JCU HM018640 F. lowekeyesi SS 022007 stn. 041-27 JCU HM018641 F. cf. magnificum SS 102005 stn. 172-051 JCU HM018637 F. sp. SS 102005 stn. 017-039 JCU HM018642 F. tuthilli SS 102005 stn. 033-008 JCU HM018643 F. vaughani SS 102005 stn. 130-009 JCU HM018644 Javania J. exserta Norfolk 2 stn. DW 2162 JCU HM018651 J. fusca Norfolk 2 stn. DW 2064 JCU HM018652 J. lamprotichum SS 022007 stn. 016-015 JCU HM018653 J. sp. nov. Norfolk 2 stn. CH2115 JCU HM018654 Truncatoflabellum T. australiensis SS 102005 stn. 170-086 JCU HM018670 T. candeanum SS 102005 stn. 115-49 JCU HM018671 T. macroeschara SS 102005 stn. 141-015 JCU HM018672 T. sp. A Norfolk 2 stn. DW 2137 JCU HM018673 T. sp. B SS 102005 stn. 034-056 JCU HM018674 Placotrochides P. scaphula SS 022007 stn. 007-014 JCU HM018661 Anthemiphylliidae Anthemiphyllia A. dentata SS 102005 stn. 004-067 JCU HM018603 A. patera costata Norfolk 2 stn. DW 2075 JCU HM018604 Caryophylliidae Caryophyllia C. atlantica SS 022007 stn. 050-050 JCU HM018613 C. diomedeae SS 022007 stn. 041-27 JCU HM018614 C. grayi SS 102005 stn. 1??-47 JCU HM018615 C. lamellifera TAN 0308/24 JCU HM018616 C. ralphae Norfolk 2 stn. DW 2135 JCU HM018617 C. rugosa TAN 0308/57 JCU HM018618 Conotrochus C. funicolumna SS 022007 stn. 006-056 JCU HM018621 Dasmosmilia D. cf. lymani SS 102005 stn. 25-014 JCU HM018625 Dactylotrochus D. cervicornis Norfolk 2 stn. DW 2135 JCU HM018624 Deltocyathus D. inusitatus Norfolk 2 stn. DW 2157 JCU HM018626 D. magnificus SS 102005 stn. 016-012? JCU HM018627 D. ornatus Norfolk 2 stn. DW 2136 JCU HM018628 D. rotulus SS 102005 stn. 25 JCU HM018629 D. sarsi SS 102005 stn. 85-14 JCU HM018630 D. suluensis SS 102005 stn. 171-11 JCU HM018631 Gen. nov. sp. nov. Norfolk 2 stn. DW 2035 JCU HM018649 Phyllangia P. papuensis SS 102005 stn. 091-044 JCU HM018660 Rhizosmilia R. robusta Norfolk 2 stn. DW 2135 JCU HM018664 Stephanocyathus S. spiniger Norfolk 2 stn. CP 2142 JCU HM018665 Trochocyathus T. efateensis Norfolk 2 stn. DW 2132 JCU HM018667 T. rhombcolumna Norfolk 2 stn. DW 2157 JCU HM018668 Unidentified sp. B Norfolk 2 stn. DW 2135 JCU HM018620 Stenocyathidae Stenocyathus S. vermiformis SS damaged label JCU HM018619 Oculinidae Madrepora M. oculata Norfolk 2 stn. CP 2142 JCU HM018659 Cyathelia C. axillaris** ? KU HM018622 Pocilloporidae Madracis M. asanoi** ? KU HM018656 M. sp. 1** ? KU HM018657 580 Appendix 5.1 - Continued Traditional taxonomy Collection locality Location Accession Order Scleractinia OR of voucher Number Family Genus Species Reference M. sp. 2** ? KU HM018658 Fungiidae Heliofungia H. sp. ** ? KU HM018650 Faviidae Leptastrea L. transversa** ? KU HM018655 Platygyra P. sinensis** ? KU HM018662 Favia F. lizardensis** ? KU HM018633 F. truncatus** ? KU HM018634 Euphylliidae Plerogyra P. sp. ** ? KU HM018663 Mussidae Symphyllia S. valenciennesii** ? KU HM018666 Sequences from GenBank Faviidae Barabattoia B. amicorum 2 AB441193 Caulastraea C. furcata 4 AB117274 C. echinulata 7 FJ345414 Cladocora C. arbuscula 4 AB117292 Colpophyllia C. natans 4 AB117228 Cyphastrea C. serailia 4 AB117257 C. chalcidicum 4 AB117259 C. microphthalma 7 FJ345416 Diploria D. strigosa 4 AB117225 D. clivosa 4 AB117226 D. labyrinthiformis 4 AB117224 Diploastrea D. heliopora 4 AB117290 Echinopora E. pacificus 4 AB117261 E. gemmacea 4 AB117263 E. lamellosa 7 FJ345419 Favia F. pallida 4 AB117265 F. speciosa 2 AB441194 F. favus 4 AB117267 F. stelligera 4 AB117264 F. leptophylla 4 AB117229 F. fragum 8 AY451351 F. danae 7 FJ345423 F. helianthoides 9 EU371667 F. matthaii 9 EU371671 F. rotumana 7 FJ345428 F. maxima 7 FJ345426 Favites F. halicora 4 AB117268 F. chinensis 4 AB117269 F. paraflexuosa 9 EU371694 F. abdita 9 EU371687 F. complanata 9 EU371692 Goniastrea G. aspera 4 AB117271 G. pectinata 4 AB117270 G. deformis 2 AB441195 G. retiformis 9 EU371701 G. australiensis 7 FJ345431 G. edwardsi 9 EU371697 G. favulus 9 EU371698 G. palauensis 9 EU371699 Leptastrea L. pruinosa 2 AB441196 L. purpurea 9 EU371702 Leptoria L. irregularis 4 AB117272 L. phrygia 4 AB117273 Manicina M. areolata 4 AB117227 Montastraea M. curta 4 AB117278 M. annularis complex 4 AB117260 M. magnistellata 4 AB117279 M. cavernosa 8 AY451356 M. valenciennesi 4 AB117280 M. faveolata 8 AY451357 M. franksi 10 AP008976 Oulastrea O. crispata 2 AB441197 Oulophyllia O. crispa 4 AB117275 O. bennettae 4 AB117277 Platygyra P. daedalea 4 AB117281 P. lamellina 4 AB117282 P. pini 9 EU371722 Plesiastrea P. versipora 3 AB289561 Solenastrea S. bournoni 4 AB117291 Trachyphylliidae Trachyphyllia T. geoffroyi 4 AB117287 Merulinidae Scapophyllia S. cylindrica 2 AB441198 Merulina M. ampliata 4 AB117283 581 Appendix 5.1 - Continued Traditional taxonomy Collection locality Location Accession Order Scleractinia OR of voucher Number Family Genus Species Reference M. scabricula 4 AB117284 Hydnophora H. exesa 4 AB117285 H. grandis 4 AB117286 Pectiniidae Echinophyllia E. echinoporoides 4 AB117254 E. aspera 4 AB117252 E. orpheensis 4 AB117253 Pectinia P. alcicornis 4 AB117385 P. paeonia 4 AB117386 Mycedium M. elephantotus 4 AB117387 Oxypora O. lacera 4 AB117255 Mussidae Lobophyllia L. corymbosa 4 AB117241 L. hemprichii 4 AB117240 L. pachysepta 4 AB117242 Symphyllia S. agaricia 4 AB117243 S. radians 4 AB117245 S. recta 4 AB117244 Scolymia S. vitiensis 4 AB117247 S. cubensis 4 AB117237 Cynarina C. lacrymalis 4 AB117246 Acanthastrea A. echinata 4 AB117249 A. rotundata 4 AB117251 A. hillae 2 AB441199 Mycetophyllia M. danaana 4 AB117323 M. aliciae 4 AB117235 Isophyllia I. sinuosa 4 AB117238 Mussa M. angulosa 4 AB117239 Mussismilia M. braziliensis 4 AB117231 M. harttii 4 AB117232 M. hispida 4 AB117233 Micromussa M. amakusensis 2 AB441200 Blastomussa B. wellsi 3 AB289563 Oculinidae Oculina O. diffusa 4 AB117293 O. sp. 8 AY451365 Galaxea G. fascicularis 2 AB441201 Euphylliidae Physogyra P. lichtensteini 3 AB289562 Euphyllia E. divisa 2 AB441203 E. glabrescens 2 AB441206 E. ancora 2 AB441204 Meandrinidae Meandrina M. meandrites 4 AB117295 M. brasiliensis 4 AB11797 Dendrogyra D. cylindrus 4 AB117299 Dichocoenia D. stokesi 4 AB117298 Eusmilia E. fastigiata 4 AB117294 E. sp. 8 AY451345 Ctenella C. chagius 2 AB441208 Siderastreidae Psammocora P. contigua 2 AB441209 Coscinaraea C. columna 2 AB441210 Siderastrea S. siderea 2 AB441211 S. radians 2 AB441212 S. stellata 2 AB441213 S. savignyana 2 AB441214 Agariciidae Pavona P. cactus 2 AB441216 Gardineroseris G. planulata 2 AB441218 Agaricia A. humilis 2 AB441219 A. agaricites 8 AY451366 A. tenuifolia 8 AY451372 A. fragilis 8 AY451368 A. lamarcki 8 AY451369 Leptoseris L. cucullata 2 AB441220 L. sp. 8 AY451373 Pachyseris P. speciosa 2 AB441222 Fungiidae Herpolitha H. limax 2 AB441223 Fungia F. scutaria 2 AB441224 Astrocoeniidae Stylocoeniella S. guentheri 2 AB441225 Stephanocoenia S. michelinii 2 AB441228 Pocilloporidae Madracis M. auretenra 2 AB441226 Pocillopora P. verrucosa 2 AB441230 Stylophora S. pistillata 2 AB441231 Seriatopora S. sp. 2 AB441232 S. hystrix 2 AB441234 Dendrophylliidae Tubastraea T. coccinea 2 AB441235 582 Appendix 5.1 - Continued Traditional taxonomy Collection locality Location Accession Order Scleractinia OR of voucher Number Family Genus Species Reference T. aurea 2 AB441237 Balanophyllia B. elegans 15 DQ445805 Dendrophyllia D. sp. 2 AB441239 Turbinaria T. peltata 2 AB441240 Poritidae Goniopora G. sp. 2 AB441241 Porites P. astreoides 2 AB441242 P. lutea 2 AB441243 P. branneri 8 AY451380 P. divaricata 8 AY451381 P. furcata 8 AY451382 P. porites 11 DQ643837 Alveopora A. sp. 2 AB441245 Rhizangiidae Astrangia A. sp. 11 NC008161 Fungiacyathidae Fungiacyathus F. sp. 2 AB441255 Acroporidae Acropora A. tenuis 5 AF338425 A. palmata 2 AB441246 A. cervicornis 8 AY451340 Isopora I. brueggemanni 2 AB441247 I. palifera 2 AB441248 I. togianensis 2 AB441249 Anacropora A. matthai 2 AB441250 A. forbesi 2 AB441251 Montipora M. cactus 2 AB441252 Astreopora A. myriophthalma 2 AB441253 A. explanata 2 AB441254 Outgroups Order Genus species Corallimorpharia Corynactis C. californica 2 AB441256 Pseudocorynactis P. sp. 2 AB441258 Ricordia R. florida 2 AB441260 R. yuma 2 AB441261 Rhodactis R. mussoides 2 AB441263 R. indosinensis 2 AB441264 R. sp. 2 AB441265 Actinodiscus A. nummiformis 2 AB441266 Amplexidiscus A. fenestrafer 2 AB441267 Discosoma D. carlgreni 2 AB441268 D. sp. 2 AB441269 Antipatharia Cirripathes C. sp. 2 AB441271 Actiniaria Anemonia A. sp. 2 AB441274 Stichodactyla S. sp. 2 AB441275 Zoanthidea Zoanthus Z. sp. 2 AB441276 Z. kuroshio 12 AB252668 Sphenopus S. marsupialis 2 AB441277 Octocorallia Acanella A. eburnea 13 EF672731 Keratoisidinae K. sp. 14 EF622534 Briaerum B. asbestinum 11 DQ640649 Pseudopterogorgia P. bipinnata 11 DQ640646 Abbreviations JCU – James Cook University, Townsville – Australia. KU – Kyoto University, Kyoto – Japan. SS and TAN - Collected by the Australia's Commonwealth Scientific and Industrial Research Organisation (CSIRO) in Australian waters. Bathus and Norfolk - Collected by the Institut de recherche pour le Développement (irD, formerly OrsTOM) and Muséum national d’Histoire naturelle (MNHN) in New Caledonian waters. Symbols * – Sequences retrieved from GenBank. ** – Sequences provided by Dr. Hironobu Fukami, Kyoto University (KU) – Japan. References 1 – Stolarski et al. (in preparation) 583 2 – Fukami H, Chen CA, Budd AF, Collins A, et al. (11 authors) (2008) Mitochondrial and nuclear genes suggest that stony corals are monophyletic but most families of stony corals are not (Order Scleractinia, Class Anthozoa, Phylum Cnidaria). PLoS One 3:e3222. 3 – Fukami H, Chen CA, Chiou CY, Knowlton N (2007) Novel group I introns encoding a putative homing endonuclease in the mitochondrial cox1 gene of scleractinian corals. J Mol Evol 64: 591-600. 4 – Fukami H, Budd AF, Paulay G, Sole-Cava A, Chen CA, et al. (2004) Conventional taxonomy obscures deep divergence between Pacific and Atlantic corals. Nature 427: 832-835. 5 – van Oppen MJH, Catmull J, McDonald BJ, Hislop NR, Hagerman PJ, et al. (2002) The mitochondrial genome of Acropora tenuis (Cnidaria; Scleractinia) contains a large group I intron and a candidate control region. J Mol Evol 55: 1-13. 6 – Beagley CT, Okimoto R, Wolstenholme DR (1998) The mitochondrial genome of the sea anemone Metridium senile (Cnidaria): Introns, a paucity of tRNA genes, and a near-standard genetic code. Genetics 148: 1091-1108. 7 – Huang D, Meier R, Todd PA, Chou LM (2009) More evidence for pervasive paraphyly in scleractinian corals: systematic study of Southeast Asian Faviidae (Cnidaria; Scleractinia) based on molecular and morphological data. Mol Phylogenet Evol 50(1): 102-116. 8 – Shearer TL, Coffroth MA (2008) Barcoding corals: limited by interspecific divergence, not intraspecific variation. Mol Ecol Resour 8(2): 247-255. 9 – Huang D, Meier R, Todd PA, Chou LM (2008) Slow mitochondrial CO1 sequence evolution at the base of the metazoan tree and its implications for DNA barcoding. J Mol Evol 66(2): 167-174. 10 – Fukami H, Knowlton N (2005) Analysis of complete mitochondrial DNA sequences of three members of the Montastraea annularis coral species complex (Cnidaria, Anthozoa, Scleractinia). Coral Reefs 24(3): 410-417. 11 – Medina M, Collins AG, Takaoka TL, Kuehl JV, Boore JL (2006) Naked corals: skeleton loss in Scleractinia. Proc Natl Acad Sci U S A 103(24): 9096-9100. 12 – Reimer JD, Takishita K, Ono S, Tsukahara J, Maruyama T (2007) Molecular evidence suggesting interspecific hybridization in Zoanthus spp. (Anthozoa: Hexacorallia). Zool Sci 24(4): 346-359. 13 – van der Ham JL, Brugler MR, France SC (2009) Exploring the utility of an indel-rich, mitochondrial intergenic region as a molecular barcode for bamboo corals (Octocorallia: Isididae). Mar Genomics 2: 183-192. 14 – Brugler MR, France SC (2008) The mitochondrial genome of a deep-sea bamboo coral (Cnidaria, Anthozoa, Octocorallia, Isididae): genome structure and putative origins of replication are not conserved among octocorals. J Mol Evol 67(2): 125-136. 15 – Hellberg ME (2006) No variation and low synonymous substitution rates in coral mtDNA despite high nuclear variation. BMC Evol Biol 6(1): 24. 584 Appendix 8.1 -Details for scleractinian specimens examined in the present study including GenBank accession data. Species name and GenBank accession numbers for sequences determined in the present study are underlined. Whenever possible, multiple samples of each species from different collection stations were sequenced and the resulting consensus sequences used in the analyses. Skeletal Specimens sequenced and Taxonomy Station details Expedition Station voucher GenBank Accession numbers Family / Species location Lat (S) Long (E) Depth (m) 12S rRNA 16S rRNA COX1 28S rRNA SCLERACTINIA Acroporiidae Acropora brueggemanni ------AF333048 - - - Acropora cervicornis ------AY451340 - Acropora cuneata ------AF333049 - - - Acropora cytherea ------AF333054 L75995 - - Acropora digitifera ------AF333051 - - - Acropora hyacinthus ------AF333053 - - - Acropora hemprichii ------AF550359 - - Acropora muricata ------AF333052 - - - Acropora palifera ------AF333047 AF265593 - - Acropora palmata ------AB441246 - Acropora togianensis ------AF333050 - - - Anacropora forbesi ------AB441251 - Anacropora matthai ------AB441250 - Anacropora sp. ------AF333046 L75992 - - Montipora aequituberculata ------AF333045 - - - Montipora cactus ------AB441252 - Montipora capitata ------L76015 - - Agariciidae Agaricia humilis ------AB441219 - Agaricia undata ------EU262789 Leptoseris cucullata ------AB441220 - Leptoseris sp. ------AY451373 EU262806 Pavona frondifera ------AF333055 - - - Pavona varians ------L76016 - EU262847 Anthemiphylliidae Anthemiphyllia patera costata Norfolk 2 DW2080 JCU 25º20’ 168º19’ 764-816 - - - HQ439609 Anthemiphyllia patera costata Norfolk 2 DW2080 JCU 25º20’ 168º19’ 764-816 - - - - Anthemiphyllia patera costata Norfolk 2 DW2080 JCU 25º20’ 168º19’ 764-816 - HQ439684 - - Anthemiphyllia spinifera ------AF265596 - EU262852 Anthemiphyllia spinifera Norfolk 2 DW2142 JCU 23º01’ 168º17’ 550 - HQ439685 - HQ439610 Anthemiphyllia dentata SS102005 006-049 CSIRO 31º36’31’’ 114º58’19’’ 329-370 - HQ439686 - - Anthemiphyllia dentata Norfolk 2 DW2147 JCU 22º50’ 167º16’ 496 - - - HQ439611 Astrocoeniidae Stephanocoenia michelinii ------AF265581 - EU262865 585 Appendix 8.1 - Continued Skeletal Specimens sequenced and Taxonomy Station details Expedition Station voucher GenBank Accession numbers Family / Species location Lat (S) Long (E) Depth (m) 12S rRNA 16S rRNA COX1 28S rRNA Caryophylliidae Caryophyllia atlantica SS022007 050-050 CSIRO 44º12’4’’ 146º11’56’’ 1050-1230 - FJ788113 - HQ439612 Caryophyllia diomedeae Norfolk 2 DW2106 JCU 23º54’ 167º42’ 685-757 - FJ788114 - - Caryophyllia diomedeae SS022007 066-014 CSIRO 43º51’40’’ 150º25’42’’ 800-1000 - FJ788115 - HQ439613 Caryophyllia grandis - Z13094 WAM - - - - FJ788117 - HQ439614 Caryophyllia grandis SS102005 171-033 CSIRO 21º00’22’’ 114º22’51’’ 399-411 - FJ788118 - - Caryophyllia grayi SS102005 1??-47 CSIRO - - - - FJ788119 - HQ439615 Caryophyllia inornata ------AF265599 - EU262777 Caryophyllia lamellifera Norfanz0308 24 CSIRO 28º32’38’’ 167º24’37’’ 111-115 - FJ788120 HM018616 HQ439616 Caryophyllia planilamellata SS102005 20-008 CSIRO 35º22’54’’ 117º12’10’’ 419-460 - FJ788121 - HQ439617 Caryophyllia planilamellata SS102005 040-13 CSIRO 35º13’38’’ 118º35’38’’ 398-554 - FJ788122 - - Caryophyllia quadragenaria Norfolk 2 DW2159 JCU 22º41’ 167º12’ 300-305 - HQ439687 - HQ439618 Caryophyllia ralphae Norfolk 2 DW2136 JCU 23º01’ 168º23’ 402-410 - HQ439688 - HQ439619 Caryophyllia rugosa Norfanz0308 57 CSIRO 29º07’50’’ 159º00’15’’ 300 - FJ788123 HM018618 HQ439620 Caryophyllia scobinosa SS102005 150-08 CSIRO 22º00’13’’ 113º40’44’’ 983-1010 - FJ788124 - HQ439621 Caryophyllia smithii ------AF549216 Caryophyllia transversalis - Z13144 WAM - - - - FJ788126 - HQ439622 Caryophyllia transversalis Z13144 WAM FJ788125 Caryophyllia unicristata - Z13142 WAM - - - - FJ788127 - - Caryophyllia unicristata SS102005 171-02 CSIRO 21º00’22’’ 114º22’51’’ 399-411 - FJ788128 - HQ439623 Caryophyllia unicristata SS102005 172-08 CSIRO 21º00’24’’ 114º22’51’’ 399-408 - FJ788129 - - Caryophyllia versicolorata Norfolk 2 DW2035 JCU 23º40’ 167º40’ 515-540 - HQ439689 - - Caryophyllia versicolorata Norfolk 2 DW2036 JCU 23º38’ 167º39’ 571-610 - HQ439690 - HQ439624 Caryophylliidae sp. A SS102005 017-034 CSIRO 35º04’10’’ 115º20’09’’ 378-379 - HQ439691 - HQ439625 Caryophylliidae sp. B SS102005 096 CSIRO 27º48’28’’ 113º17’49’’ 112-123 - HQ439692 - HQ439626 Caryophylliidae Gen. nov. sp. nov Bathus 4 DW923 JCU 18º51.51’ 163º24.17’ 470-502 - - - HQ439627 Caryophylliidae Gen. nov. sp. nov Norfolk 2 DW2035 JCU 23º40’ 167º40’ 515-540 - HQ439693 - - Caryophylliidae Gen. nov. sp. nov Norfolk 2 DW2035 JCU 23º40’ 167º40’ 515-540 - HQ439694 HQ439628 Ceratotrochus magnaghii ------AF265597 - EU262879 Cladocora caespitosa ------AF265612 - EU262802 Conotrochus funicolumna SS022007 006-056 CSIRO 43º59’29’’ 147º32’46’’ 370-410 - HQ439695 - HQ439629 Conotrochus funicolumna Norfolk 2 DW2035 JCU 23º40’ 167º40’ 515-540 - HQ439696 - - Crispatotrochus rugosus ------AF265600 - EU262860 Dactylotrochus cervicornis Norfolk 2 DW2135 JCU 23º02’ 168º21’ 295-330 - HQ439697 - HQ439630 Dasmosmilia lymani A SS102005 149-019 CSIRO 22º03’34’’ 113º43’44’’ 658-754 - HQ439766 - HQ439631 Dasmosmilia lymani B SS102005 25-014 CSIRO 35º21’52’’ 118º18’25’’ 398-407 - HQ439767 - HQ439632 Dasmosmilia lymani C SS022007 008-012 CSIRO 31º40’50’’ 114º50’45’’ 669-683 - HQ439768 - HQ439633 Deltocyathus magnificus SS102005 128-07 CSIRO 23º59’06’’ 112º32’42’’ 398-402 - HQ439769 - HQ439634 Deltocyathus magnificus SS102005 016-012 CSIRO 34º00’39’’ 114º26’34’’ 467-490 - HQ439770 - - Deltocyathus magnificus SS102005 68-011 CSIRO 31º59’32’’ 115º10’58’’ 478-508 - HQ439771 - - Deltocyathus magnificus SS102005 013 CSIRO 33º00’30’’ 114º34’15’’ 414-421 - HQ439772 - - 586 Appendix 8.1 - Continued Skeletal Specimens sequenced and Taxonomy Station details Expedition Station voucher GenBank Accession numbers Family / Species location Lat (S) Long (E) Depth (m) 12S rRNA 16S rRNA COX1 28S rRNA Desmophyllum dianthus SS011997 022 CSIRO 44º21’ 147º15’ ? - GQ868694 - - Desmophyllum dianthus Norfolk 2 DW2132 JCU 23º17’ 168º14’ 405-455 GQ868667 GQ868690 - - Desmophyllum dianthus Norfolk 2 DW2142 JCU 23º01’ 168º17’ 550 GQ868666 - - GQ868676 Paracyathus pulchellus ------AF265603 - EU262820 Phyllangia mouchezii ------AF265605 - EU262798 Phyllangia papuensis SS102005 091-44 CSIRO 28º59’19’’ 113º47’02’’ 180-183 - HQ439773 - HQ439669 Polycyathus muellerae ------AF265606 - EU262790 Rhizosmilia maculata ------AF265602 - EU262796 Rhizosmilia robusta Norfolk 2 DW2135 JCU 23º02’ 168º21’ 295-330 - HQ439698 - HQ439635 Rhizosmilia sagamiensis Norfolk 2 DW2135 JCU 23º02’ 168º21’ 295-330 - HQ439699 - HQ439636 Stephanocyathus coronatus Halipro 1 CP854 JCU 22º05.03’ 166º38.34’ 650-780 - HQ439700 - - Stephanocyathus coronatus Halipro 1 CP854 JCU 22º05.03’ 166º38.34’ 650-780 - HQ439701 - HQ439637 Stephanocyathus spiniger Norfolk 2 DW2137 JCU 23º01’ 168º23’ 547-560 - - - HQ439638 Stephanocyathus spiniger ------HM015359 - - Stephanocyathus weberianus ------AF265594 - EU262795 Tethocyathus virgatus Norfolk 2 DW2057 JCU 24º40’ 168º39’ 555-565 - FJ788131 - HQ439639 Tethocyathus virgatus Norfolk 2 DW2084 JCU 24º52’ 168º22’ 586-730 - HQ439702 - - Thalamophyllia gasti ------AF265590 - EU262788 Trochocyathus efateensis Norfolk 2 DW2132 JCU 23º17’ 168º14’ 405-455 - FJ788132 - HQ439640 Trochocyathus rhombcolumna A Norfolk 2 DW2157 JCU 22º56’ 167º19’ 553-575 - HQ439703 - HQ439641 Trochocyathus rhombcolumna B Norfolk 2 DW2132 JCU 23º17’ 168º14’ 405-455 - HQ439704 - HQ439642 Vaughanella concinna Norfolk 2 DW2075 JCU 25º23’ 168º20’ 650-1000 - HQ439705 - HQ439643 Vaughanella concinna Norfolk 2 DW2075 JCU 25º23’ 168º20’ 650-1000 - HQ439706 - - Vaughanella concinna Norfolk 2 DW2106 JCU 23º54’ 167º42’ 685-757 - HQ439707 - HQ439644 Vaughanella sp. 1 Norfolk 2 DW2080 JCU 25º20’ 168º19’ 764-816 - HQ439708 - HQ439645 Dendrophylliidae Astroides calycularis ------AF549248 Balanophyllia cf. dentata SS102005 096 CSIRO 27º48’28’’ 113º17’49’’ 112-123 - HQ439709 - HQ439646 Balanophyllia cornu SS102005 140-16 CSIRO 22º37’03’’ 113º29’02’’ 355-382 - HQ439710 - HQ439647 Balanophyllia desmophyllioides SS102005 140-12 CSIRO 22º37’03’’ 113º29’02’’ 355-382 - HQ439711 - - Balanophyllia desmophyllioides Norfolk 2 DW2119 JCU 23º23’ 168º02’ 300 - - - HQ439648 Balanophyllia gigas Norfolk 2 CP2141 JCU 23º01’ 168º20’ 92-100 - HQ439712 - HQ439649 Balanophyllia regia ------AF265587 - EU262813 Balanophyllia sp. 1 Norfolk 2 DW2057 JCU 24º40’ 168º39’ 555-565 - HQ439713 - HQ439650 Balanophyllia sp. 2 SS102005 115-48 CSIRO 25º55’46’’ 112º40’48’’ 120 - HQ439714 - HQ439651 Balanophyllia sp. 3 SS102005 110-044 CSIRO 27º03’07’’ 113º04’51’’ 106 - HQ439715 - HQ439652 Balanophyllia sp. 4 Norfolk 2 DW2132 JCU 23º17’ 168º14’ 405-455 - HQ439716 - HQ439653 Cladopsammia gracilis ------AF265588 - EU262774 Enallopsammia rostrata Norfolk 2 DW2075 JCU 25º23’ 168º20’ 650-1000 - HQ439718 - - Enallopsammia rostrata Norfolk 2 DW2075 JCU 25º23’ 168º20’ 650-1000 - - - HQ439654 Enallopsammia rostrata Norfolk 2 CP2121 JCU 23º23’ 168º00’ 486-514 - HQ439717 - - 587 Appendix 8.1 - Continued Skeletal Specimens sequenced and Taxonomy Station details Expedition Station voucher GenBank Accession numbers Family / Species location Lat (S) Long (E) Depth (m) 12S rRNA 16S rRNA COX1 28S rRNA Endopachys grayi Norfolk 2 DW2159 JCU 22º41’ 167º12’ 300-305 - HQ439719 - HQ439655 Leptopsammia pruvoti ------AF265579 - EU262851 Tubastraea aurea ------AF333064 - - - Tubastraea coccinea ------L76022 AB441235 EU262864 Tubastraea micranthus ------AF549219 Turbinaria mesenterina ------AF333063 - - - Turbinaria peltata ------L76023 AB441240 EU262799 Euphylliidae Catalaphyllia jardinei ------L76000 - EU262874 Faviidae Caulastrea furcata ------L75997 AB117274 AF549224 Echinopora lamellosa ------L76003 - EU262773 Favia fragum ------FFU40295 AY451351 EU262856 Favia stelligera ------AF549223 Favites abdita ------AF333060 - - - Leptoria phrygia ------L76011 - AF549228 Montastraea annularis ------AF549229 Montastraea curta ------AF549230 Montastraea franksi ------AP008976 - Montastraea sp. ------AF265610 - EU262794 Montastraea valenciennesi ------AF333061 - - - Oulastrea crispata ------AF333062 - - - Platygyra daedalea ------AF549231 Platygyra pini ------EU371722 - Platygyra sp. ------AF265611 - - Flabellidae Flabellum apertum SS022007 050-024 CSIRO 44º12’04’’ 146º11’56’’ 1050-1230 - HQ439720 - HQ439656 Flabellum arcuatile Norfolk 2 DW2132 JCU 23º17’ 168º14’ 405-455 - HQ439721 - HQ439657 Flabellum arcuatile Norfolk 2 DW2132 JCU 23º17’ 168º14’ 405-455 - HQ439722 - - Flabellum cf. magnificum SS102005 172-051 CSIRO 21º00’24’’ 114º22’51’’ 399-408 - HQ439723 - HQ439658 Flabellum deludens SS022007 008-009 CSIRO 31º40’50’’ 114º50’45’’ 669-683 - HQ439724 - HQ439659 Flabellum folkesoni - Z13161 WAM - - - - HQ439725 - - Flabellum folkesoni SS102005 171-033 CSIRO 21º00’22’’ 114º22’51’’ 399-411 - - - HQ439660 Flabellum lamellulosum SS102005 171-033 CSIRO 21º00’22’’ 114º22’51’’ 399-411 - HQ439726 - HQ439661 Flabellum lamellulosum SS102005 122-017 CSIRO 24º33’7’’ 112º15’07’’ 396-404 - HQ439727 - - Flabellum lowekeseyi SS022007 041-27 CSIRO 44º03’56’’ 146º14’02’’ 800-880 - HQ439728 - - Flabellum lowekeseyi SS022007 059-036 CSIRO 44º04’09’’ 147º25’24’’ 810-1020 - HQ439729 - HQ439662 Flabellum lowekeseyi SS022007 008-009 CSIRO 44º01’50’’ 147º34’46’’ 830-1030 - HQ439730 - - Flabellum lowekeseyi SS022007 008-009 CSIRO 44º01’50’’ 147º34’46’’ 830-1030 - HQ439731 - - Flabellum magnificum - Z13223 WAM - - - - HQ439732 - HQ439663 Flabellum tuthilli SS102005 034-056 CSIRO 35º12’48’’ 118º39’03’’ 408-431 - HQ439733 - HQ439664 588 Appendix 8.1 - Continued Skeletal Specimens sequenced and Taxonomy Station details Expedition Station voucher GenBank Accession numbers Family / Species location Lat (S) Long (E) Depth (m) 12S rRNA 16S rRNA COX1 28S rRNA Flabellum tuthilli SS102005 033-008 CSIRO 35º11’26’’ 118º38’41’’ 147-157 - HQ439734 HM018643 - Flabellum vaughani SS102005 130-009 CSIRO 23º59’11’’ 112º32’02’’ 411 - HQ439735 - HQ439665 Flabellum vaughani ? ? CSIRO - - - - HQ439736 - - Javania fusca Norfolk 2 DW2064 JCU 25º17’ 168º56’ 609-691 - HQ439737 - - Javania fusca Norfolk 2 DW2064 JCU 25º17’ 168º56’ 609-691 - HQ439738 - HQ439666 Javania fusca Norfolk 2 DW2106 JCU 23º54’ 167º42’ 685-757 - HQ439739 - - Javania lamprotichum SS022007 059-036 CSIRO 44º04’09’’ 147º25’24’’ 810-1020 - HQ439740 - - Javania lamprotichum SS022007 016-015 CSIRO 44º19’32’’ 147º10’30’’ 1100-1160 - HQ439741 - HQ439667 Javania lamprotichum SS022007 041-027 CSIRO 44º03’56’’ 146º14’02’’ 800-880 - HQ439742 - - Javania sp. Norfolk 2 CH2115 JCU 23º45’ 168º17’ 377-401 - HQ439743 - HQ439668 Placotrochides scaphula SS022007 007-014 CSIRO 44º01’50’’ 147º34’48’’ 840-1030 - HQ439744 - HQ439670 Placotrochides scaphula SS022007 008-012 CSIRO 44º01’50’’ 147º34’46’’ 830-1030 - HQ439745 - - Truncatoflabellum australiensis - Z13194 WAM - - - - HQ439746 - HQ439671 Truncatoflabellum australiensis - Z13194 WAM - - - - HQ439747 - - Truncatoflabellum australiensis SS102005 170-086 CSIRO 20º59’04’’ 114º54’25’’ 100-101 - HQ439748 - - Truncatoflabellum candeanum SS102005 146-32 CSIRO 22º04’46’’ 113º47’45’’ 201-206 - HQ439749 - HQ439672 Truncatoflabellum candeanum SS102005 153-25 CSIRO 21º59’10’’ 113º49’11’’ 165-166 - HQ439750 - - Truncatoflabellum candeanum SS102005 096-017 CSIRO 27º48’28’’ 113º17’49’’ 112-123 - HQ439751 - - Truncatoflabellum formosum Norfolk 2 DW2137 JCU 23º01’ 168º23’ 547-560 - HQ439752 - HQ439673 Truncatoflabellum formosum Norfolk 2 DW2127 JCU 23º16’ 168º15’ 379-381 - - - HQ439674 Fungiacyathidae Fungiacyathus fragilis SS102005 121-036 CSIRO 24º33’32’’ 112º15’28’’ 368-388 - HQ439753 - HQ439675 Fungiacyathus marenzelleri ------EF589061 - EU262862 Fungiacyathus pusillus pacificus SS022007 009-036 CSIRO 44º09’14’’ 147º07’39’’ 800-920 - HQ439754 - HQ439676 Fungiacyathus pusillus pacificus SS022007 007-015 CSIRO 44º01’50’’ 147º34’48’’ 840-1030 - HQ439755 - - Fungiacyathus pusillus pacificus Norfolk 2 DW2106 JCU 23º54’ 167º42’ 685-757 - HQ439756 - - Fungiacyathus pusillus pacificus Norfolk 2 DW2106 JCU 23º54’ 167º42’ 685-757 - HQ439757 - HQ439677 Fungiacyathus stephanus SS102005 149-019 CSIRO 22º03’34’’ 113º43’44’’ 658-754 - HQ439758 - HQ439678 Fungiacyathus turbinolioides SS022007 008-010 CSIRO 44º01’50’’ 147º34’46’’ 830-1030 - - - HQ439679 Fungiacyathus turbinolioides SS022007 007-015 CSIRO 44º01’50’’ 147º34’48’’ 840-1030 - HQ439759 - - Fungiidae Fungia scutaria ------L76005 - EU262881 Zoopilus echinatus ------L76024 - EU262870 Gardineriidae Gardineria hawaiiensis Bathus 4 DW947 JCU 20º33.72’ 164º57.72’ 470-490 - - - GQ868673 Gardineria hawaiiensis Norfolk 2 DW2057 JCU 24º40’ 168º39’ 555-565 GQ868660 GQ868701 GQ868678 - Gardineria hawaiiensis Norfolk 2 DW2060 JCU 24º40’ 168º39’ 582-600 GQ868657 GQ868702 GQ868677 - Gardineria hawaiiensis Norfolk 2 DW2084 JCU 24º52’ 168º22’ 586-730 GQ868658 GQ868699 GQ868679 - Gardineria hawaiiensis Norfolk 2 DW2126 JCU 23º16’ 168º14’ 385-550 GQ868659 GQ868687 GQ868680 - Gardineria paradoxa Bathus 3 DW784 JCU 23º56.12’ 169º46.14’ 611 - GQ868698 GQ868682 - Gardineria paradoxa Norfolk 2 DW2084 JCU 24º52’ 168º22’ 586-730 GQ868656 GQ868700 GQ868681 GQ868671 589 Appendix 8.1 - Continued Skeletal Specimens sequenced and Taxonomy Station details Expedition Station voucher GenBank Accession numbers Family / Species location Lat (S) Long (E) Depth (m) 12S rRNA 16S rRNA COX1 28S rRNA Gardineria sp. Norfolk 2 DW2136 JCU 23º01’ 168º23’ 402-410 - GQ868686 - GQ868675 Guyniidae Guynia annulata ------AF265580 - AF549233 Meandrinidae Dichocoenia stokesi ------AF265607 - EU262875 Meandrina meandrites ------AB117295 - Merulinidae Hydnophora exesa ------AF333059 - - - Hydnophora grandis ------AB117286 - Hydnophora rigida ------L76009 - EU262858 Merulina ampliata ------AF333058 - - - Merulina scabricula ------L76014 AB117284 - Micrabaciidae Letepsammia formosissima SS102005 006-050 CSIRO 31º36’ 114º58’ 329 GQ868665 GQ868691 - GQ868668 Letepsammia formosissima SS102005 025-020 CSIRO 35º21’ 118º18’ 398 GQ868663 GQ868697 GQ868685 GQ868672 Letepsammia formosissima SS102005 034-055 CSIRO 35º12’ 118º39’ 431 GQ868664 GQ868696 GQ868684 GQ868670 Letepsammia formosissima SS102005 044-066 CSIRO 35º26’ 118º20’ 900 GQ868662 GQ868692 - GQ868669 Letepsammia sp. Norfolk 1 DW1651 JCU 23º27.3’ 167º50.4’ 276-350 - GQ868688 - - Rhombopsammia niphada SS102005 150-008 CSIRO 22º00’ 113º40’ 983 GQ868661 GQ868695 - - Rhombopsammia niphada SS102005 160-016 CSIRO 21º56’ 113º43’ 1050 - GQ868693 GQ868683 GQ868674 Stephanophyllia complicata Bathus 4 CP922 JCU 18º48.04’ 163º18.58’ 600 - GQ868689 - HQ439608 Mussidae Lobophyllia hemprichii ------L76013 - EU262833 Oculinidae Galaxea fascicularis ------L76006 AB441201 AF263360 Madrepora oculata Norfolk 2 DW2142 JCU 23º01’ 168º17’ 550 - HQ439760 HM018659 HQ439680 Madrepora oculata Norfolk 2 DW2142 JCU 23º01’ 168º17’ 550 - HQ439761 - - Oculina patagonica ------AF265601 - EU262842 Pectiniidae Echinophyllia orpheensis ------AF333065 - - - Mycendium elephantotus ------AF333057 - AB117387 - Mycendium sp. ------AF265608 - EU262816 Pocilloporidae Madracis mirabilis ------NC011160 - EU262806 Pocillopora damicornis ------AF333043 L76019 - EU262867 Pocillopora meandrina ------L76018 - EU262803 Pocillopora verrucosa ------AB441230 - Stylophora pistillata ------NC011162 - AF549253 Poritidae Porites compressa ------L76020 - EU262814 Porites lobata ------AF550372 - - 590 Appendix 8.1 - Continued Skeletal Specimens sequenced and Taxonomy Station details Expedition Station voucher GenBank Accession numbers Family / Species location Lat (S) Long (E) Depth (m) 12S rRNA 16S rRNA COX1 28S rRNA Porites porites ------DQ643837 EU262878 Siderastreidae Coscinaraea sp. ------L76001 - EU262826 Siderastrea radians ------EU262861 Stenocyathidae Stenocyathus vermiformis Norfolk 2 DW2073 JCU 25º24’ 168º19’ 609 - HQ439762 - - Stenocyathus vermiformis ? ? CSIRO - - - - HQ439763 - HQ439681 Turbinoliidae Cyathotrochus pileus Norfolk 2 DW2137 JCU 23º01’ 168º23’ 547-560 - HQ439764 - HQ439682 Notocyathus sp. ------AF265584 - EU262782 Tropidocyathus lessoni ? ? CSIRO - - - - HQ439765 - HQ439683 OUTGROUPS Actiniaria Actinia sulcata ------AF549250 Anemonia sp. ------AB441274 - Anthosactis pearseae ------EU190751 EU190798 - EU190841 Hormosoma scotti ------EU190733 - - EU190822 Phellia gausapata ------EU190790 - - Stichodactyla sp. ------AB441275 - Stomphia didemon ------EU190749 EU190795 - - Antipatharia Antipathes galapagensis ------AY026365 Chrysopathes formosa ------DQ304771 DQ304771 - - Cirripathes sp. ------AB441271 - Corallimorpharia Corynactis viridis ------EU262836 Rhodactis mussoides ------AF177049 - - - Rhodactis rhodostoma ------EF589054 - - Rhodactis sp. ------AB441265 - Ricordea florida ------EF589057 - EU262882 Octocorallia Acanella eburnea ------EF672731 - EF672731 - Acanthogorgia sp. ------FJ642927 Keratoisis sp. ------AY351666 - - Zoanthidea Corallizoanthus tsukaharai ------EU035626 - - Savalia savaglia ------DQ825686 - - - Zoanthus kuroshio ------AB252668 - CSIRO – Australia's Commonwealth Scientific and Industrial Research Organisation (Hobart, Australia). JCU – James Cook University (Townsville, Australia). WAM – Western Australian Museum (Perth, Australia) 591