The Function of Inosine-5'-Monophosphate

The Function of Inosine-5’-Monophosphate Dehydrogenase’s Bateman Domain in

Escherichia coli

Masters Thesis

Presented to

The Faculty of the Graduate School of Arts and Sciences Brandeis University Department of Biochemistry Lizbeth Hedstrom, Advisor

In Partial Fulfillment Of the Requirements for the Degree

Master of Science in Biochemistry

Sabrina Gay McDonnell

May 2018

Sabrina Gay McDonnell

Acknowledgements

I am grateful for the support and guidance I have received from Prof. Lizbeth Hedstrom.

She allowed me to join her lab at the beginning of my sophomore year and has continuously pushed me to think more critically about my project and better understand the work we have completed.

Daniel Kats and Dr. Devi Gollapalli were my mentors when I started working in the

Hedstrom lab. Together they taught me all of the fundamental techniques I needed to conduct research. When I struggled with a specific aspect of my research they helped talk through the problem and constantly pushed me to accomplish my goals. Everyone in the Hedstrom Lab supported me by giving feedback after group presentations and helped me whenever I had questions. I would especially like to thank Minjia Zhang, Ann Lawson, and Shibin Chacko.

Thank you also to the Lovett Lab, specifically Vincent Sutera for assisting me in the creation of new E. coli strains and permitting me to use the Lovett Lab E. coli strain library.

Thank you to the Division of Science Summer Undergraduate Research Fellowship and the M.R.

Bauer Fellows program for funding my summer research endeavors and providing me a platform to share my work with the scientific community at Brandeis University.

Lastly, I would like to thank my family and friends for assisting and supporting me through my three years of undergraduate research. Specifically, I’d like to thank Miriam Hood,

Lena El-Teha, Ashley Klein, Jourdan Paige, Terry McDonnell, Matt McDonnell and Matthew

McDonnell.

Molecular graphics and analyses were performed with the UCSF Chimera package from the Resource for Biocomputing, Visualization, and Informatics at the University of California,

San Francisco (supported by NIGMS P41-GM103311).

iii

Abstract

The Function of Inosine-5’-Monophosphate Dehydrogenase’s Bateman Domain in Escherichia coli

A thesis presented to the Department of Biochemistry

Graduate School of Arts and Sciences Brandeis University Waltham, Massachusetts

By Sabrina Gay McDonnell

Inosine 5’-monophosphate dehydrogenase (IMPDH) catalyzes the rate-limiting conversion of inosine 5’-monophosphate (IMP) to xanthosine 5’-monophosphate (XMP) in the de novo purine biosynthesis pathway. Overexpression of the protein is linked to the proliferation of diseased cells, and inhibitors of IMPDH have been used as anticancer, antiviral, and immunosuppressive treatments. IMPDH is a tetramer and each monomer has two domains: a catalytic domain and a Bateman domain. The function of the Bateman domain is currently unknown. The enzyme remains catalytically active when the Bateman domain is replaced with a short peptide scar (ΔCBS). Mutations in the Bateman domain of human IMPDH 1 have been linked to hereditary diseases including retinitis pigmentosa. Understanding the function of the Bateman domain in E. coli will shed light on IMPDH’s extracatalytic functions. I constructed E. coli strains that can endogenously express Strep-II tagged IMPDH and IMPDHΔCBS and used affinity purification to test for the presence of binding partners. E. coli cells were harvested during exponential growth and incubated with formaldehyde to chemically cross-link protein- protein and protein-nucleotide interactions prior to lysis. Western blots of IMPDH and IMPDHΔCBS from cross-linked lysates revealed cross-link dependent band shifts that corresponded with the molecular weight of their respective dimer, trimer, and tetramer. There was also a cross-link dependent shift of the wild-type IMPDH monomer that was absent in the IMPDHΔCBS sample, which indicates that the shift was dependent on an interaction with the Bateman domain. Mass spectrometry was inconclusive for determining a protein-binding partner for the Bateman domain, but both the WT tagged and ΔCBS tagged samples contained GMP reductase (GMPR) and adenosine deaminase. Additional research is required to identify the function of these interactions and the molecule(s) that interact with the Bateman domain.

Table of Contents

Acknowledgments………………………………………………………………………………..iii

Abstract…………………………………………………………………………………………...iv

List of tables……………………………………………………………………………………....vi

List of figures………………………………………………………………………………….....vii

Introduction………………………………………………………………………………………..1

Materials and methods…………………………………………………………………………….7

Results…………………………………………………………………………………………....18

Discussion………………………………………………………………………………………..31

Appendix I: Common methods…………………………………………………………………..34

Appendix II: Mass spectrometry data….………………………………………………………...40

Appendix III: Materials…………………………………………………………………………..53

References………………………………………………………………………………………..55

List of Tables

1. Strains……………………………………………………………………………………..7

2. Primers…………………………………………………………………………………….8

3. Plasmids…………………………………………………………………………………...9

4. Concentrations of media additives………………………………………………………...9

5. Mass spectrometry top hits………………………………………………………………27

6. PCR components…………………………………………………………………………35

7. Thermocycler settings for PCR………………………………………………………...... 35

8. SDS-PAGE recipe………………………………………………………………………..36

9. Complete mass spectrometry data…………………………………………………….....40

List of Figures

1. E. coli De novo and salvage pathways of purine biosynthesis……………………………2

2. Bacterial IMPDH homotetramer…………………………………………………………..3

3. Predicted structure of E. coli IMPDH monomer……………………………………….....4

4. λ Red Recombineering System for creating chromosomal mutations…………………...11

5. Tag extension to create ΔCBS tagged strain……………………………………………..12

6. Purification on Strep-Tactin column……………………………………………………..15

7. Western blots confirming the expression of tagged and untagged IMPDH and

IMPDHΔCBS………………………………………………………………………………19

8. Growth curves comparing mutant strains to E. coli parent strain………………………..20

9. Luciferase ATP assay…………………………………………………………………....21

10. Western blot from Strep-II tagged IMPDH purification reveals no interaction with RNA

polymerase β or Ribosome………………………………………………………………22

11. Western blot from formaldehyde cross-linking of WT tagged lysate...………………….24

12. Western blot from formaldehyde cross-linking of ΔCBS tagged lysate…………………25

13. Western blot with formaldehyde cross-linked lysates…………………………………...26

14. Coomassie-stained SDS-PAGE gel containing elution samples from parent, WT tagged,

and ΔCBS tagged………………………………………………………………………...30

vii

Introduction

Inosine 5’-monophosphate dehydrogenase (IMPDH) converts inosine 5’-monophosphate

(IMP) to xanthosine 5’-monophosphate (XMP) as a part of the de novo purine biosynthesis pathway. IMP is a precursor to both adenine and guanine nucleotides and its conversion to XMP by IMPDH is the first committed and rate-limiting step in the biosynthesis of guanosine 5’- monophosphate (GMP). XMP is converted to GMP by GMP synthetase (GMPS). Inhibition of

IMPDH results in a depletion of guanine nucleotide pools.

The de novo guanine nucleotide synthesis pathway containing IMPDH and GMPS is found in nearly all organisms with the exception of certain protozoan parasites including Giardia lamblia and Trichomonas vaginalis (1,2) and some bacteria. Guanine nucleotides can be produced by salvage pathways in many organisms using phosphoribosyltransferases, nucleoside kinases, or a combination of the two as shown in Figure 1 (3). The rate of nucleotide production by the de novo pathway compared to that of the salvage pathways determines whether or not a given organism or tissue will be susceptible to IMPDH inhibitors. For example, the salvage pathways of E. coli are unable to sustain growth in minimal media when the gene encoding

IMPDH, guaB, is deleted from the chromosome. In order to grow in minimal media, the ΔguaB strain must be supplemented with GMP precursors such as xanthosine or guanosine.

Guanine nucleotides are vital for many cellular functions including DNA replication, transcription, translation, and as a cofactor for G-proteins. IMPDH is overexpressed in tissues such as tumors because of the high demand for guanine nucleotides in rapidly proliferating cells

(4). As a result, inhibitors of IMPDH have been used as anticancer, antiviral, and immunosuppression treatments (5). IMPDH is also required for many microbial pathogens to cause an infection, which suggests that IMPDH inhibitors could be used as antimicrobials (6).

NH2 N N

N N O HO O NH OH HO O OH OH O O O OH N P P P O O O O Pyrimidines Adenosine 5'-triphosphate HO HO OH

NH2 prs uridine N N N N O O O HO O P HO HO O HN N deoD HN N N N HO OH OH H2N N H2N N O O OH O H P P HO O HO guanine O O O OH OH HO P Adenosine 5'-diphosphate O O HO OH P guanosine O OH

gpt NH2 PRPP gsk N N

N N O O HO O OH N P HN HO OH O N H2N N Adenosine 5'-monophosphate O HO OH O OH P HO purB O guanosine 5'-monophosphate OH GMPR guaC O HO NH OH OH

O N N guaA N N N N

GMPS purA IMPDH N N N N N HO N O guaB O O HO apt HO HO OH O O O OH O OH P P P HO HO HO HO OH O OH O adenylosuccinate inosine 5'-monophosphate xanthosine 5'-monophosphate

gpt gsk O H NH2 OH hpt N NH2 HN H N N N N N N O N N H deoD N N N N N N add Xanthine O O adenine HO HO OH OH HO HO OH Adenosine Inosine deoD deoD N N OH H HO N N N N O N HO N OH Hypoxanthine HO Xanthosine Figure 1: E. coli De novo and salvage pathways of purine biosynthesis. IMP is highlighted in blue and XMP in green. The genes shown correspond to the following enzymes: purA, adenylosuccinate synthetase; purB, adenylosuccinate lyase; guaB, IMP dehydrogenase; guaA, GMP synthetase; deoD, purine nucleoside phosphorylase; hpt, hypoxanthine-guanine phosphoribosyltransferase; gpt, xanthine phosphoribosyltransferase; gsk, guanosine-inosine kinase; apt, adenine phosphoribosyltransferase; add, adenosine deaminase; guaC, GMP reductase; prs, PRPP synthetase (7,8).

Figure 2: Bacterial IMPDH homotetramer. The tetramer structure of IMPDH from Streptococcus pyogenes (PDB:1ZFJ). IMP is shown bound in the active site as yellow spheres. Each monomer is highlighted in a different color. This crystal structure is one of the few IMPDH crystals with an ordered Bateman domain. The dashed lines represent the flap region of the catalytic domain, which is highly dynamic and disordered in all crystal structures of IMPDH. Molecular graphics were created using the UCSF Chimera package from the Resource for Biocomputing, Visualization, and Informatics at the University of California, San Francisco (9).

IMPDH is a homotetramer (Figure 2) and each monomer has two domains: a catalytic domain and Bateman domain. The Bateman domain (also referred to as the Bateman module) is about 120 residues long and is comprised of two repeats of cystathionine β-synthase (CBS)

domains (10,11). CBS domains are present on numerous proteins with different functions

(12,13). Some proteins containing Bateman domains bind both guanine and adenine nucleotides, and in certain cases, nucleotide binding alters activity (14,15). However, the role of the IMPDH

Bateman domain is currently unknown. IMPDH’s catalytic activity is not changed either in vitro or in vivo when the Bateman domain is replaced with a short amino acid scar (ΔCBS) (16,17).

Mutations in the CBS domain of human IMPDH 1 have been linked to hereditary diseases including retinitis pigmentosa (18-21). Understanding the function of the CBS domain in E. coli will shed light on IMPDH’s extracatalytic functions.

Figure 3: Predicted structure of E. coli IMPDH monomer. A model of E. coli IMPDH was generated with the Chimera software using a published S. pyogenes IMPDH structure as a reference (PDB: 1ZFJ (9,22)). The two CBS domain replicates are shown in blue and green, and the catalytic domain is shown in purple.

IMPDH has shown numerous extracatalytic activities in various organisms including direct protein-protein and protein-nucleic acid interactions. IMPDHs from Tritrichomonas foetus, E. coli, yeast, and humans all bind single-stranded DNA both in vivo and in vitro (23).

Mutations of the CBS domain, which are associated with retinitis pigmentosa, disrupt human

IMPDH 1’s ability to bind nucleic acids (18,20,23). This observation signifies that IMPDH interacts with nucleic acids via the Bateman domain. Human IMPDH 1 also associates with the polyribosome by way of the Bateman domain (24). Proteomic analysis of yeast revealed that

IMPDH interacts with transcription factors, translation factors, and other regulatory proteins (25-

27). Additionally, in Drosophila, IMPDH binds to specific CT-rich sites on DNA and acts as a transcription factor, regulating the expression of genes important for cell proliferation (28).

Increased understanding of IMPDH’s regulatory functions will allow for a better understanding of retinal degradation and other diseases associated with mutations of the CBS domain.

The Markham laboratory constructed and characterized an E. coli K-12 strain that endogenously expresses IMPDHΔCBS. Curiously, high concentrations of both inosine and adenosine inhibited the growth of this ΔCBS strain (29). Inosine toxicity was rescued by suppression of the genes required to convert IMP to AMP (29). The mutant strain had a 1.8 fold increase in ATP concentrations compared to the parent strain, BW25113, under normal growth conditions (30). Together these results indicate that the Bateman domain may regulate nucleotide pools in E. coli, though the mechanism is unknown. Interestingly, the BW25113 strain used by the Markham laboratory contains numerous mutations absent in the parent strain, MG1655, used in the following experiments (31).

Preliminary results from the Hedstrom laboratory suggest that E. coli IMPDH interacts with both RNA polymerase and the ribosome (32,33). Lysates from Wild-type and ΔguaB E. coli

strains were purified on IMP Sepharose columns and the elutions from these columns were analyzed using 2D Native gels, SDS-PAGE, and Western blots. The interactions were not disrupted in the presence of an endonuclease, suggesting that there is a direct protein-protein interaction rather than one mediated by an oligonucleotide (32). The interactions were also not disrupted following the addition of various transcription and translation inhibitors, but a gyrase inhibitor resulted in a decreased association with RNA polymerase (32). Additionally, increased extracellular concentrations of guanine led to a decrease in IMPDH-ribosome interactions. The

IMPDHΔCBS continued to interact with the ribosome, but no longer interacted with RNA polymerase (32). These results suggest that RNA polymerase interacts with the Bateman domain and ribosome interacts with the catalytic domain. Furthermore, acetylation of the Bateman domain disrupted the interaction with RNA polymerase (33).

There is significant evidence showing IMPDH interacts with both nucleotides and proteins and may assist in regulating nucleotide biosynthesis. I hypothesize that IMPDH regulates guanine synthesis by either interacting directly with other proteins in the purine biosynthesis pathway or regulating the expression of these proteins. Here I have continued the work of Daniel Kats by creating chromosomal mutations of E. coli IMPDH (34). I have created chromosomally Strep-II tagged IMPDH in order to purify endogenous protein and identify possible binding partners.

Materials and Methods

Strain Genotype or Description Origin or Reference MG1655 (Parent) F- rph-1 Bachmann (1972) STL6428 MG1655 with pKD46 Datsenko and Wanner (2000) - - BL21 (DE3) ΔguaB F ompT gal dcm lon hsdSB(r B MacPherson et al. (2010) - m B) λ (DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]) + S [malB ]K-12 (λ ) BL21 (DE3) ΔguaB BL21 (DE3) ΔguaB with pHS Hedstrom laboratory pHS 17 17 ΔguaB guaB::RFT kan F- rph-1 Datsanko and Wanner (2000) collection, plate 59, row A, column 4 B199 (WT tagged) F- rph-1 guaB with N-terminal This Study 6xHis and C-terminal StrepII B299 F- rph-1 guaB with N-terminal This Study 6xHis B399 F- rph-1 guaB with C-terminal This Study StrepII MGΔCBS (ΔCBS) F- rph-1 guaB ΔCBS This Study DB399 (ΔCBS F- rph-1 guaB ΔCBS with C- This Study tagged) terminal StrepII Table 1: E. coli strains used or created for the following experiments.

Primer Sequence (5’ è 3’) guaB con1 GAACTAAAACTTGTTGCCCATGCTG guaB con2 TTACGACTTCAACCTGCGCGTAG guaB seq1 AACCGTTTGATTCAGGCGACTAA guaB seq2 AGTCACGAATTTGTGCTTCTGTCAC NTFP2 GAACGTAAACCGAACGCCTG CTRP ACGTTGCAGTACACCTTCTGAG KI guaB pet28a 5’ ATCGGTTACGCTCTGTATAATGCCG KI guaB pet28a 3’ AGATAATATAAATCGCCCGACATGAAGTC guaB_ncr_KI ATCGCCCGACATGAAGTCGGGCGAAGAGAATCAGGAGCCCAGA CGGTAGTTCG guaP_guaB TATTAACCACTCTGGTCGAGATATTGCCCATGCTACGTATCGCTA AAGAAGCTCTGACG Mid_dCBS_5 GTTGCAGTGCGGTTAAAG Mid_dCBS_3 CCAGTCACGATACGAGTTG guaB His 5’ P1 CAGCAGCCATCATCATCATCATCACAGCAGCGGCATGCTACGTA TCGCTAAAGAAGCTC guaB His 5’ P2 TATTAACCACTCTGGTCGAGATATTGCCCATGGGCAGCAGCCATC ATCATCATCATCA guaB His 5’ P3 ATCGGTTACGCTCTGTATAATGCCGCGGCAATATTTATTAACCAC TCTGGTCGAGAT guaB pET28a 5’ TGGTGCCTCGTGGTAGCCATCTGGTCGAGATATCGGTTACGCTCT P4 GTATAATGCCG guaB StrepII 3’ CTCTTTTCGAACTGCGGGTGGCTCCAACCTGCGGAGCCCAGACG GTAGTTCGGGGAC guaB pET28a 3’ GGGCGAAGAGAATCATGCGCTCTTTTCGAACTGCGGGTGGCTCC P2 AACCTG guaB pET28a 3’ AATATAAATCGCCCGACATGAAGTCGGGCGAAGAGAATCATGCG P3 CTCTTT guaB pET28a 3’ CTCAGCTTCCTTTCGGGCTTTGTTAGATAATATAAATCGCCCGAC P4 ATGAAGTC Table 2: Primer names and sequences used for the following experiments.

Plasmid Parent/Source Resistance Description pKD46 (Datsenko and Ampicillin Contains the λ Red phage system Wanner, 2000) pET28a Novagen Kanamycin Used to store guaB for knocking into E. coli pHS 17 Ampicillin H6ST- guaB ΔCBS pPB100 Kats Thesis Kanamycin pET28a backbone with an insert of the end of the gua promoter, guaB (N-terminal 6His tag and C-terminal StrepII tag), and a portion of the non-coding region between guaB and guaA Table 3: Plasmids used in the following experiments.

Supplement Abbreviation Final Concentration

Ampicillin amp 100 µg/ml

Kanamycin kan 60 µg/ml

Arabinose ara 0.2%

Table 4: Concentrations of media supplements. All stock solutions were filter sterilized using a 0.2 µm syringe filter. Creation of ΔCBS Chromosomal Mutant

To create the MGΔCBS strain, I started by designing two primers, one that annealed to the 3’ end of the gua promoter and the beginning of the guaB gene (guaP_guaB), and one that annealed to the end of the guaB gene and the beginning of the non-coding region between guaB and guaA (guaB_ncr_KI). The positions of the gua promoter and the guaB and guaA genes can be seen in Figure 5. These primers were used in a PCR with pHS17 as the template. The guaB gene encoded on pHS17 replaces residues 93 to 214, which comprise the Bateman domain, with a single Tyrosine. The PCR product was confirmed on a 1% agarose gel, and then purified using the Promega PCR clean up kit.

While I constructed my PCR fragment, I electroporated 500 ng of pKD46 into ΔguaB E. coli cells. Following electroporation, the cells were placed in 1 ml of LB and incubated at 30°C for 1 h (pKD46 is a temperature-sensitive plasmid, meaning at temperatures above 30°C the plasmid will be expelled from the bacteria). 200 µl of the recovered cells were plated on an LB- amp plate and allowed to grow overnight at 30°C. The following morning one of the two-dozen colonies was harvested and added to 50 ml of LB-amp. The culture was placed in a 30°C shaking incubator. The growth of the culture was monitored by measuring the OD600 every 20 minutes.

When the absorbance reached about 0.5, 20% arabinose was added to a final concentration of

0.2%. The cells continued to grow for an additional 2 h in order to allow expression of the lambda red recombineering (recombination-mediated genetic engineering) system. The cells were then harvested by centrifugation at 5,000g for 20 min. The supernatant was discarded and the cells were resuspended in 1 ml of sterile 1 mM HEPES (pH 7.0). The harvesting process was repeated and then the cells were washed with 250 µl of sterile 7% DMSO. The cells were spun down a third time, resuspended in 150 µl of sterile 7% DMSO, and immediately put on ice.

5 µl of the PCR product was electroporated into 45 µl of the electrocompetent

ΔguaBpKD46 cells. The electroporated cells were added to 1 ml of LB ara and allowed to recover at 30°C for 1 h. The culture was then left at room temperature overnight in order to provide the lambda red system sufficient time to insert the ΔCBS fragment onto the chromosome. The next day 200 µl of the culture was plated on an M9 minimal media plate and allowed to grow for at least 24 h at 30°C. Multiple colonies were harvested from the minimal media plate and replated on fresh minimal media plates. The freshly plated cells were grown at

42°C to knockout the pKD46 plasmid. Figure 4 shows a complete break down of the creation of chromosomal mutants using the lambda red system.

Antibiotic Resistance/ Antibiotic Resistance/ Mutant Gene Mutant Gene

PCR to Obtain PCR to Obtain Insert Fragment Insert Fragment Regions Homologous Regions Homologous to Chromosome to Chromosome

Transform Transform with Transform with Transform withpKD46 withFragment pKD46 Fragment

Grow in 0.2% Grow at Grow in 0.2%Arabanose Grow 42at °C Arabanose 42°C

Figure 4: λ Red Recombineering System for creating chromosomal mutations. PCR using primers containing 25-40 bases homologous to the regions on either side of the gene to be removed is used to create a fragment containing the gene to be inserted on the chromosome. The pKD46 plasmid, which contains the necessary recombinase genes and the PCR product are both transformed into the E. coli and the cells are grown in arabinose to activate expression of the recombinase genes. The PCR product is then inserted into the chromosome and the cells are grown at 42° C to remove the pKD46 plasmid (35).

Removal of the pKD46 plasmid and insertion of the new gene was confirmed by plating colonies separately on LB-kan and LB-amp plates. If the cells grew on LB-kan plates, the gene had not properly replaced the FRT:Kan:FRT region on the chromosome of the ΔguaB cells. If the cells grew on LB-amp plates, the pKD46 plasmid had not been knocked out and the cells needed to be replated and grown for additional time at 42°C. Once it was confirmed that the cells no longer contained any antibiotic resistance genes, the colonies were sequenced. The guaB_con1 and guaB_con2 primers were used to conduct colony PCR. The PCR products were

sent for sequencing using three primers: guaB_seq1, guaB_seq2, and CTRP. After the sequences were confirmed, freezer stocks containing 40% glycerol were made and stored at -80°C.

guaB pET28a 5’ P4 xseA guaBΔCBS guaA gua promoter Non-coding

guaPBA NHisCStrepII 3’

guaBΔCBS

guaBΔCBS gua promoter Strep-II Tag Non-coding

Figure 5: Tag extension to create ΔCBS tagged strain. A single colony PCR was used to amplify the guaB gene, and then three sequential PCRs were performed to extend the Strep-II on the C terminus end of the gene. Regions homologous to the chromosome were also extended on either end so the modified gene could be inserted into the chromosome using the lambda red system shown in Figure 4.

Creation of ΔCBS Tagged Strain

To create the tagged guaBΔCBS gene, I conducted four consecutive PCRs to amplify the gene, extend the Strep-II tag on the C-terminus, and extend the regions that overlapped with the promoter and non-coding regions on the 5’ and 3’ ends of the gene respectively. The first PCR was a colony PCR using the ΔCBS strain. The product from the final PCR was electroporated into ΔguaBpKD46 cells and the insertion process was then identical to the process used to create the ΔCBS strain.

Creation of WT Tagged

To create the tagged wild-type guaB gene, I ran a single PCR using the pB100 plasmid as a template and the guaP_guaB and KI guaB pet28a 3’ primers. The PCR product was electroporated into ΔguaBpKD46 cells and the recombination process followed the steps highlighted in Figure 4.

Tag Confirmation

Overnight cultures (5 ml) of parent, WT tagged, ΔCBS tagged, and ΔguaB strains in minimal media were made. The cells were harvested via centrifugation for 10 min at 5,000g. The supernatant was discarded and the cells were resuspended in 1X SDS-PAGE loading buffer. The samples were boiled at 100°C for 15 min. Before loading the samples on a 10% gel, the samples were spun for 5 min at 12,000g to pellet the DNA and other cell debris. The samples were run in duplicate so one set could be probed with an E. coli IMPDH antibody and the other could be probed with a Strep-II tag antibody. After the gel was run the proteins were transferred to a membrane, incubated with primary and secondary antibodies, scanned, and analyzed as described in the Appendix.

Growth Rate

Cultures (2 ml) of parent, WT tagged, ΔCBS, and ΔCBS tagged strains were made in M9 minimal media and grown at 37°C overnight. Serial dilutions of the overnights were made in 2X

M9 minimal media in order to obtain 2 ml of cells at a final concentration of about 102 cells per ml. Filter sterilized solutions of 2 mM adenosine and 2 mM inosine were made. Each strain of E. coli was grown under 3 different conditions: M9 minimal media, M9 minimal media with 1mM adenosine, and M9 minimal media with 1mM inosine. All conditions were run in triplicate on a

treated 96 well plate. The OD600 of each well was measured every 15 min for 22 h in order to monitor cell growth. Control wells containing no cells were used to normalize the data.

Purification

Overnight cultures (3 ml) were made of parent, WT tagged, and ΔCBS tagged strains in minimal media. 1 ml from each overnight culture was used to inoculate a 1 L culture for each strain. The cells were harvested by centrifugation for 20 min at 5,000g once the cells had reached an OD600 between 0.4 and 0.6. The cell pellets were resuspended in 5 ml lysis buffer (1 mg/ml lysozyme, protease inhibitor, 100 mM Tris, 150 mM NaCl, 1 mM EDTA, 0.05% Anapo X-100,

10% glycerol, pH 8) and placed in a 37°C water bath for 30 min to activate the lysozyme. The cells were then sonicated for a total of 8 minutes (4X: 30 sec on, 1 min 30 sec off) and the crude lysate was centrifuged for 20 min at 15,000g.

Strep-Tactin® Superflow® 50% suspension (1 ml) was added to Poly-Prep

Chromatography Column and equilibrated by running 5 ml of 1X Strep-Tactin Column buffer

(10X Strep-Tactin Column Buffer: 1 M Tris, 1.5 M NaCl, 10 mM EDTA, pH 8) through the column. After the column was equilibrated with column buffer, the clarified lysate was added to the column and allowed to incubate for 30 min. The lysate was then slowly passed through the column followed by 3 column volumes of Wash Buffer 1 (100 mM Tris, 150 mM NaCl, 1 mM

EDTA, 0.05% Anapo X-100, 10% glycerol, pH 8), 4 column volumes of Wash Buffer 2 (100 mM Tris, 150 mM NaCl, 1 mM EDTA, 10% glycerol, pH 8), and 3 column volumes of Wash

Buffer 3 (100 mM Tris, 150 mM NaCl, 1 mM EDTA, pH 8). Samples of each step were saved for subsequent analysis by SDS-PAGE. The protein was then eluded off the column using 3 column volumes of Elution buffer (100 mM Tris, 150 mM NaCl, 5 mM desthiobiotin, pH 8).

The column was then washed with 3 ml of 0.5 M NaOH and excess 1X Strep-Tactin

Column Buffer to knock off any proteins that had bound non-specifically to the resin. The column was then regenerated by washing the column with 10 column volumes of regeneration buffer (100 mM Tris, 150 mM NaCl, 1 mM HABA, pH 8). The resin turned a bright red when fully regenerated. After regenerating the column, additional 1X Strep-Tactin column buffer was added to remove the HABA. The resin was stored in 1X Strep-Tactin column buffer at 4°C.

Step 6: Step1: Add additional Buffer Load Lysate to return Columns origninal color

Step1: Step1: Strep-Tactin Wash Column to Wash with buffer remove non-specific to remove HABA Purification Cycle proteins

Step1: Step1: Wash with HABA to remove Elude with Desthiobiotin bound Desthiobiotin

O OH OH N H C N O 3 NH O HO N 2-(4-Hydroxyphenylazo)benzoic acid H HABA Desthiobiotin

Tagged IMPDH Untagged Proteins from Lysate Figure 6: Purification on Strep-Tactin column. Diagram showing the complete purification and regeneration process used to purify Strep-II tagged IMPDH.

Formaldehyde Optimization

Initially, 2% formaldehyde in PBS, pH 8, was added to cultures and allowed to incubate at 37°C for 30 min. During optimization, formaldehyde concentrations ranging from 0.5%-2% were used. It was determined that 0.5% formaldehyde in PBS, pH 8, resulted in the highest protein yields after purification of cell lysates on Strep-Tactin columns. Rather than harvesting cells at 5,000g, cells were harvested at 10,000g to reduce the harvesting time and minimize cellular changes before cross-linking. The incubation time for crosslinking was also reduced from 30 min at 37°C to 10 min at room temperature. Additionally, 2.5 M Tris, pH 8, was used to quench the cross-linking experiment. The Tris solution was added to a final concentration of 250 mM and allowed to quench the cross-linking reaction for 30 min before harvesting the cross- linked cells by centrifugation at 5,000g for 20 min.

Mass Spectrometry

Samples intended for mass spectrometry were boiled in SDS loading buffer for 15 min at

100°C to break down the cross-linker and fully denature the proteins. The samples were then loaded onto a 10% gel. The gel was run at 100V until the samples had migrated about a centimeter down into the resolving gel. The gel was then stained with coomassie blue silver as described in Appendix I. The lanes were then cut out of the gel and submerged in filter-sterilized ddH2O. The samples were then sent to the Taplin Laboratory at Harvard University where the samples underwent trypsin digest and analysis.

ATP Assay

In order to determine relative ATP concentrations of the different E. coli strains, the

Bactiter-Glo assay kit from Promega was used. Overnight cultures (3 ml) of parent, WT tagged,

ΔCBS, and ΔCBS tagged strains were made in M9 minimal media. The following morning 10 µl

of each overnight was added to 2 ml of fresh M9 minimal media and allowed to grow for an additional 3 h. The OD600 of each culture was measured to determine the cell density. The

8 cultures were then diluted to an OD600 of 1, which is equivalent to 8×10 cells/ml. Each culture was then serially diluted 4 times to obtain cell densities of about 107, 106, 105, and 104 cells/ml.

100 µl of each dilution was added to a 96 well plate followed by 100 µl of the Bactiter Glo reagent. The plate was put into the plate reader, shaken for 30 seconds, allowed to stand for 5 minutes and then the luminescence was measured. The experiment was run in triplicate.

Results

Creation of Chromosomal Mutants

In order to better understand the function of the CBS domain, I constructed three strains of E. coli that I could compare to the parent strain, MG1655. The first strain was a chromosomal deletion of the CBS domain (ΔCBS). I designed new primers which I used to amplify the gene and then used the PCR product to conduct a chromosomal insertion using the lambda red recombineering system described by Datsenkso and Wanner (35). The second strain was B399

(WT tagged), which endogenously expresses a Strep-II tag on the C-terminus of wild-type

IMPDH. The B399 strain was made using the pB100 plasmid, which contains the guaB gene with an N terminus His tag and a C terminus Strep-II tag. The third strain was DB399 (ΔCBS tagged), which endogenously expresses a Strep-II tag on the C-terminus of IMPDHΔCBS. The

DB399 strain was made using the pHS17 plasmid as a template and conducting sequential PCRs to extend the C-terminus tag.

Tag Confirmation

Once I verified the sequences of my newly constructed strains, I confirmed that the protein and tags were all being expressed properly. Figure 7 shows the result of the western blots using both anti-Strep-II tag and anti-E. coli IMPDH antibodies. The results indicate that the new strains express the Strep-II tag and the proteins run at the expected molecular weight.

CBS Tagged CBS Tagged CBS Tagged CBS Tagged ΔguaB Parent Δ WT Tagged WT Double Tag ΔguaB Parent Δ WT Tagged WT Double Tag ΔguaB Parent Δ WT Tagged WT Double Tag ΔguaB Parent Δ WT Tagged WT Double Tag

50 kDaè50 kD aè 50 kDaè50 kD aè

37kDaè37kD aè 37kDaè37kD aè

Figure 7: Western blots confirming the expression of tagged and untagged IMPDH and IMPDHΔCBS. The western blots confirm that the IMPDH and tags of the various strains were expressed properly. Parent refers to wild-type IMPDH from the parent strain, WT tagged refers to the Strep-II tagged wild-type IMPDH, and ΔCBS tagged refers to the Strep-II tagged IMPDHΔCBS.

Bateman Domain Deletion does not Affect Growth

Growth rate experiments were run to determine if the ΔCBS strains displayed the same adenosine and inosine toxicity described by the Markham laboratory (29). I conducted three side by side experiments to monitor the growth of the strains under different conditions: M9 minimal media, M9 minimal media with 1 mM adenosine, and M9 minimal media supplemented with 1 mM inosine. Figure 8A shows that in minimal media there is no significant difference between the growth rate of the parent strain and the WT tagged strain, which indicates that the Strep-II tag does not affect growth. The ΔCBS strain also has the same growth rate as the parent strain, which supports previous research that IMPDHΔCBS remains catalytically active in vivo (16).

Figure 8: Growth curves comparing mutant strains to E. coli parent strain. (A) M9 Minimal Media (B) M9 Minimal media with 1 mM adenosine (C) M9 Minimal Media with 1 mM inosine

Figures 8B and 8C shows that neither the addition of adenosine nor inosine affects the growth of any of the E. coli K-12 strains. These results contradict those of Markham and his colleagues

(29).

ATP Concentration Comparison

The Markam laboratory reported that under normal growth conditions the ΔCBS strain had a 1.8 fold greater ATP concentration during exponential growth compared to the parent strain, BW25113. In contrast, Figure 9 shows no discernable difference in ATP levels between the four strains of E.coli I used. These results suggest that differences in the genetic backgrounds of the parent strains, BW25113 and MG1655, may be the cause of the difference in growth rates and ATP concentrations.

Relative ATP Concentrations

100000

10000

1000 Parent ΔCBS 100

Luminescence WT Tagged ΔCBS Tagged 10

1 1000000 100000 10000 1000 Cell/well

Figure 9: Luciferase ATP assay. Overnight cultures were diluted and allowed to reach exponential growth before being serially diluted. Bactiter Glo reagent was added to the diluted cells. The reagent breaks down cells and reacts with ATP generating a luminescence signal. Luminescence readings were measured on a plate reader. Each sample was measured in triplicate and the error bars show the standard deviation for the replicates.

Purification of Strep-Tactin Column

WT Strep-II tagged IMPDH E. coli cells were harvested during exponential growth. The

cells were lysed and purified on a Strep-Tactin column, and fractions were collected during the

wash and elution. A Western blot was then run containing samples from each step of the

purification process and probed with anti-RNA polymerase β, anti-30S ribosomal protein S3, and

anti-Strep-II tag antibodies in order to confirm the interactions previously observed (32,33).

Washes Elutions LY FT 1 2 3 4 5 6 1 2 3 4 5 6

Figure 10: Western blot from Strep-II tagged IMPDH purification reveals no interaction with RNA polymerase β or Ribosome. The results indicate that RNA polymerase β and the 30S ribosomal protein S3 bind non-specifically to the Strep-Tactin column and therefore slowly come off the column during the wash steps. Ly = lysate, FT = Flow through.

Preliminary results from purifications on an IMP Sepharose column showed that the two

proteins eluded concurrently with IMPDH. Figure 10 shows that the tagged IMPDH binds well

to the column as it is absent in the flow through and washes. Both RNA polymerase and

ribosome are present in large quantities in the lysate and flow through, and in decreasing

quantities in the washes. RNA polymerase and ribosome are also present in the first four elution

fractions whereas IMPDH is only present in the last four elution fractions. The observed results indicate that RNA polymerase and ribosome bind non-specifically to Strep-Tact® Superflow® resin. Like the IMP Sepharose beads, Strep-Tactin® Superflow® is a Sepharose based resin.

These findings suggest that both RNA polymerase and ribosome bind non-specifically to

Sepharose based resins. In addition to the Western blot to probe for RNA polymerase and ribosome, SDS-PAGE gels were used to analyze purification samples. No additional bands were visualized using coomassie or silver staining. Any interactions with IMPDH were not stable enough to withstand lysis and purification on the Strep-Tactin column.

Formaldehyde Crosslinking

I chose to cross-link the E. coli cells prior to lysis to stabilize possible IMPDH interactions. I chose formaldehyde for these experiments because it is a relatively inexpensive and easy to use reagent that would cross-link both protein-protein and protein-nucleotide interactions (36,37).

Figure 11 shows a Western blot probed with an anti-Strep-II tag antibody containing formaldehyde cross-linked samples from the purification of WT tagged cell lysate on a Strep-

Tactin column. In addition to the monomer band, which is slightly greater than 50 kDa, numerous high molecular weight bands are observed in the cross-linked elution. Three of the observed bands run at the molecular weight expected for the dimer, trimer, and tetramer respectively. There are also additional bands in between the polymers which may represent heterocomplexes containing IMPDH and various other proteins. The high molecular weight bands are hard to distinguish because without further analysis the composition of the bands cannot be determined. In addition to the large complexes, there are two easily visualized bands in between the monomer and dimer. I have labeled these bands as +5 kDa band and +20 kDa band.

These two bands are of particular interest because each could represent a different small protein

or oligonucleotide bound to the monomer. Ly Ly FT W1 W2 W3 E E - + - - - - - +

~ 200 kDa Tetramer

~ 150 kDa Trimer ~ 100 kDa Dimer

+20 kDa Band

+5 kDa Band

~ 50 kDa Monomer

Figure 11: Western blot from formaldehyde cross-linking of WT tagged lysate The results show a shift in the monomer band as well as the formation of oligomers. Ly = lysate, FT = Flow through, W = wash, and E = Elution.

Figure 12 shows a Western blot probed with an anti-Strep-II tag antibody containing

formaldehyde cross-linked samples from the purification of ΔCBS tagged cell lysate on a Strep-

Tactin column. Unlike the WT tagged elution, the ΔCBS tagged elution appears to only show 4

distinct bands. These bands are consistent with the molecular weights expected for the monomer,

dimer, trimer, and tetramer respectively. There does appear to be a slight separation in the trimer

band, which could represent a heterocomplex. Neither the +5 kDa or +20 kDa bands are

observed in the ΔCBS tagged elution indicating that the interactions that caused these bands are

CBS dependent.

Ly Ly FT W1 W2 W3 E E - + - - - - - +

~ 160 kDa Tetramer

~ 120 kDa Trimer ~ 80 kDa Dimer

~ 40 kDa Monomer

Figure 12: Western blot from formaldehyde cross-linking of ΔCBS tagged lysate The results show the formation of a number of different oligomers. Ly = lysate, FT = Flow through, W = wash, and E = Elution.

Since the WT tagged IMPDH contains a Strep-II tag, the +5 and +20 kDa bands could

have been caused by cross-linking either an oligonucleotide or protein to the Strep-II tag. In

order to determine whether or not the band shift was tag dependent, I repeated the cross-linking

experiment with the parent strain. Figure 13 shows a Western blot probed with an anti-E. coli

IMPDH antibody containing lysates from chemically cross-linked parent, WT tagged, ΔCBS,

and ΔCBS tagged cells. The +5 kDa band is present in both the tagged and untagged wild-type

IMPDH samples suggesting that it is not tag dependent. The +20 kDa band is only partially

visible in the WT tagged sample and not present in the parent sample. This band may not be

visible because it is a Step-II tag dependent interaction or because the amount of the complex

was below the detection limit.

WT ΔCBS

tagged[ Parent[ tagged[ Δ[ CBS

- + - + - + - +

Figure 13: Western blot with formaldehyde cross-linked lysates. The results show that the shifted monomer is not dependent on the Strep-II tag.

Mass Spectrometry Results

In order to identify any proteins interacting with IMPDH, I conducted 3 purifications on

Strep-Tactin columns with the two Strep-II tag strains, WT tagged and ΔCBS tagged, and the parent strain as a negative control. All of the samples were chemically cross-linked using formaldehyde prior to lysis and purification. The elutions from these purifications were concentrated, boiled to break up the cross-links, and sent for analysis by mass spectrometry. A total of 787 different proteins were detected in the three samples. Fifteen proteins were detected solely in the WT tagged sample. Fifty-seven were detected in both the WT and ΔCBS but absent in the negative control, and eleven proteins were detected in both the parent and WT samples and absent from the ΔCBS sample. The lower limit for protein detection via mass spectrometry was an intensity of 103. Table 5 lists proteins that had ≥ 2 unique peptide sequences identified, intensities ≥ 104, and sequence coverage of ≥ 15%. Proteins that were identified only in the negative control were ignored.

Gene Protein Product MW Parent WT Tagged ΔCBS Tagged Name (kDa) Unique Total Unique Total Unique Total Peptides Peptides Peptides Peptides Peptides Peptides Inosine-5'-monophosphate 51.96/ guaB dehydrogenase 39.5 13 24 57 2260 47 1700 guaC GMP reductase 37.36 0 0 19 71 27 118 add Adenosine deaminase 36.34 0 0 4 5 7 8 Ribosome maturation rimM factor RimM 20.59 0 0 2 2 3 3 rpsL 30S ribosomal protein S12 13.73 0 0 2 2 2 2 rpsP 30S ribosomal protein S16 9.18 0 0 2 2 0 0 Transcriptional regulatory rcsB protein RcsB 23.66 0 0 2 2 4 5 Table 5: Mass spectrometry results showing the amounts of IMPDH and possible protein binding partners from chemically cross-linked samples purified on a Strep-Tactin column. The parent strain was cross-linked and purified as a negative control. Unique peptides refer to the unique peptide fragments detected, and total peptides refer to the total number of peptide fragments detected in each sample that correspond to each protein.

Table 5 shows that the total number of unique peptides and total peptides which

correspond to IMPDH was much greater than any other protein detected by an order of 10. The

number of unique peptides identified in the ΔCBS tagged sample was ten peptides lower than the

WT tagged because the missing peptide sequences correspond to the Bateman domain. The

sequence coverage was 84.8% for WT tagged and 78.3% for ΔCBS. The signal intensity for both

WT and ΔCBS tagged was 1010 compared to an intensity of 106 for the negative control.

In addition to the amounts of IMPDH, Table 5 shows the number of peptides detected

from hit proteins that were absent from the negative control. GMPR was detected in the highest

quantity with 42% sequence coverage and detection intensity of 107. Adenosine deaminase was

the second highest hit with an intensity of 106 for ΔCBS tagged and 105 for WT tagged. Both

GMPR and adenosine deaminase are in the purine metabolism pathway shown in Figure 1 and

have molecular weights close to 40 kDa making them too large to be the cause of the +5 and +20

kDa bands. The other four hit proteins had lower signal intensities, between 104 and 105, and are all required for either transcription or translation. Five of the hit proteins were detected in the

ΔCBS tagged sample, indicating that the Bateman domain is not required for these protein- protein interactions. The 30S ribosomal protein S16 was absent in the ΔCBS tagged sample suggesting that it could be a Bateman domain mediated interaction. The S16 ribosomal protein is a 5-10 kDa protein meaning the interaction between it and IMPDH could cause the monomer +5 kDa band observed on the Western blot. However, since the signal intensity from the mass spectrometry was relatively low, and other ribosomal proteins were found in all three samples

(see Appendix II), it might be a false positive.

In addition to the proteins shown in Table 5, there were numerous proteins detected at high signal intensities in all three samples. These proteins are shown in Appendix II. Most of the proteins that bound to the column were associated either with the acetyl-CoA carboxylase complex (a biotin-dependent complex) or involved in transcription or translation. Strep-Tactin is a streptavidin analog and the natural ligand of streptavidin is Biotin. Therefore it makes sense that biotin associated complexes such as the acetyl-CoA carboxylase complex would bind non- specifically to the Strep-Tactin beads. The high amounts of RNA polymerase, elongation factors, and ribosomal proteins suggest that these proteins may either be binding to the Strep-Tactin protein or the Sepharose resin. This would explain why RNA polymerase and ribosome were both detected in purifications on IMP Sepharose beads and were only slowly washed off the column.

Testing for Oligonucleotides

Since IMPDH binds single-stranded DNA, I tested if either the +5 or +20 kDa bands were caused by the monomer binding an oligonucleotide. I added Benzonase, a genetically engineered endonuclease that can degrade both single-stranded and double-stranded DNA and

RNA (38), to the samples to break down any oligonucleotides in the sample. I had to leave the cross-linker intact prior to adding the nuclease since breaking up the cross-linker would prevent subsequent analysis by coomassie stained SDS-PAGE. Using coomassie stained gel allowed for the visualization of all proteins in the sample. Figure 14 shows an edited scanned image of an

SDS-PAGE gel from the benzonase experiment. The shifted band was not perturbed by the addition of the benzonase.

In addition to the shifted band, it is possible to see the 50, 100, 150, and 200 kDa bands of the IMPDH monomer, dimer, trimer and tetramer respectively. Similarly, in the ΔCBS tagged sample the 40, 80, 120, and 160 kDa bands consistent with the molecular weight expected for the monomer, dimer, trimer, and tetramer respectively are visible. There is a ~40 kDa band present in both ΔCBS and WT tagged samples. The band intensity is greatest in the lanes where the cross-linker has been disrupted, suggesting it might have been cross-linked with IMPDH or another protein in the sample. Based on the molecular weight and results from the mass spectrometry analysis, this band could either be GMPR or adenosine deaminase. Preliminary results from the Hedstrom Laboratory had identified GMPR in elution samples from purifications on IMP Sepharose beads, however, these results had been ignored since GMPR binds to IMP (32).

ΔCBS WT

tagged[ tagged[ Parent[

- - + - - + - - + - + + - + + - + +

+10 kDa Band

+5 kDa Band

GMPR or Adenosine deaminase?

Benzonase

Figure 14: Coomassie stained SDS-PAGE gel containing elution samples from parent, WT tagged, and ΔCBS tagged. The gel shows that the addition of Benzonase does not disrupt the shifted band.

I ran an additional experiment where I boiled the parent, WT tagged, and ΔCBS tagged

cross-linked samples to break down the cross-linker and subsequently added proteinase K. I

allowed the samples to incubate with the proteinase K for 1 h at room temperature and then ran

the samples on an agarose gel. The agarose gel contained no visible nucleic acids. A more

sensitive method may be needed to identify any possible oligonucleotides that bind to IMPDH.

Discussion

The Bateman domain of IMPDH has been widely studied and found to bind DNA, guanine nucleotides, adenine nucleotides, and various proteins, but the function is still unknown.

Previous research by the Markham laboratory indicated that the Bateman domain regulated purine nucleotide pools, however, I was unable to reproduce these results. Neither the tagged mutant nor untagged mutant displayed any sensitivity to adenosine or inosine. Nor did the strains display a marked increase in ATP concentrations. It is likely that the BW25113 strain used by the Markham laboratory contains mutations that coupled with the deletion of the CBS domain resulted in sensitivity to specific nucleosides. The BW25113 E. coli was not completely sequenced until 2014, which was after the Markham laboratory published their findings. The sequencing revealed numerous, previously unknown, point mutations in the genome compared to

MG1655 (31). An analysis of these point mutations may help explain the phenotypic differences in ΔCBS strains created here and the strain created by the Markham laboratory.

The results of the purification of tagged IMPDH and IMPDHΔCBS on a Strep-Tactin column indicate that both RNA polymerase and ribosome bind non-specifically to Sepharose beads. Both RNA polymerase and ribosome came down in the elutions of both the tagged and untagged samples as well as in elutions from purifications conducted on IMP Sepharose columns

(32,33). The high rate of non-specific binding observed during purifications on the Strep-Tactin column have made it difficult to determine which proteins interact directly with IMPDH and which proteins only interact with the column resin. It may be possible to pre-incubate the column with BSA in order to prevent non-specific protein binding during subsequent purifications.

The existence of cross-linker dependent bands suggests the IMPDH interacts with either a small protein or small oligonucleotide or forms a specific CBS domain dependent conformation.

The identity of possible binding partners is currently unknown. Mass spectrometry analysis of purified protein samples showed only one protein specific to the WT tagged sample of the correct molecular weight, about 9 kDa, but it is likely a false positive. Perhaps the shifted band is not caused by a protein-protein interaction with IMPDH. The addition of benzonase nuclease failed to perturb the shifted band, but this may have been caused by either the crosslinker blocking the enzyme from digesting the phosphodiester backbone or the formation of a stable folded structure like that of a tRNA molecule.

The mass spectrometry results did show that IMPDH interacts with GMPR and adenosine deaminase most likely through a direct protein-protein interaction with the catalytic domain.

These enzymes may interact in order to regulate the production of guanine nucleotides under different physiological conditions. GMPR catalyzes the conversion of GMP to IMP leading to a decrease in the guanine nucleotide pool and adenosine deaminase catalyzes the reaction of adenosine to inosine leading to an increase in the guanine nucleotide pool (Figure 1). IMPDH may interact with these two proteins to help maintain balanced levels of both adenine and guanine nucleotides. Understanding the relationship between these enzymes will help identify previously unknown regulatory functions of IMPDH.

Future Experiments

Additional experiments are required to identify the interactors with IMPDH. Both WT and ΔCBS tagged cultures should be regrown, cross-linked, and purified. The proteinase K experiment should be repeated with the elution samples, but a phenol-chloroform extraction should be used to isolate any RNA or DNA in the samples prior to running an agarose gel. If any

oligonucleotides are found in the samples sequences should be obtained. The nucleotide sequences could help determine if IMPDH acts as a repressor, activator, or another kind of regulator.

Concurrent experiments should be run in which tRNA inhibitors or other translation inhibitors are added to E. coli growths prior to harvesting and chemical cross-linking. The addition of different types of inhibitors could prevent the formation of heterocomplexes with

IMPDH and allow for the identification of novel regulatory pathways. Identifying the regulatory function of E. coli IMPDH could provide vital information in the creation of novel drugs for the treatment of IMPDH dependent diseases such as retinitis pigmentosa.

I also propose separately knocking out the guaC and add genes in both the wild-type and

ΔCBS E.coli strains. A phenotypic screen could be conducted with these mutants to help understand the function of the interaction between IMPDH and GMPR. It may also be useful to harvest the cells at different time points to determine if the interactions occur only during exponential growth or also during the lag and stationary phases. Daniel Kats identified numerous residues within the catalytic domain that could be sites of protein-protein interactions (29). It would be interesting to create the various mutants he proposed in order to disrupt the interaction with GMPR and adenosine deaminase and identify the precise location of the interactions.

Appendix I: Common Methods

Rich Media: 10 g Tryptone, 5 g Yeast Extract, and 10 g NaCl were dissolved in 1 L ddH2O and autoclaved for an hour.

M9 Minimal Media:

Stock Solutions

5X M9 Salts: 240 mM Na2HPO47H2O, 110 mM KH2PO4, 45mM NaCl, and 95 mM NH4Cl

20% Glucose

10% Casamino Acids

1 M MgSO4

0.1 M CaCl2

1 mg/ml ThiamineHCl

All stock solutions were filter sterilized and autoclaved with the exception of the 1 mg/ml

ThiamineHCl solution, which was only filter sterilized.

Minimal Media: 1X M9 Salts, 0.4% glucose, 0.2% casamino acids, 2 mM MgSO4, 100 µM

CaCl2, 1 µg/ml ThiamineHCl

Agar Plates

For rich media plates, 15 g/L was added prior to autoclaving. After autoclaving, the flasks were allowed to cool for 25 minutes. Antibiotics were added at this point. The mixture was quickly shaken to distribute the antibiotic and then poured into sterile petri dishes.

Approximately 30-35 ml of media was added to each plate.

For minimal media plates, 15 g of agar was added to 757 ml of ddH2O and autoclaved.

After allowing the mixture to cool for 15 min the other components of the media were added

using sterile serological pipettes. The solution was shaken to properly mix all of the components and then poured into sterile petri dishes.

Once the agar set the plates were turned upside down and left at room temperate for 24 hours for plates without antibiotics and for 48 hours for plates with antibiotics at which point the plates were wrapped and stored at 4°C.

Colony PCR Protocol

Single colonies were harvested from an agar plate using a sterile toothpick and submerged in a PCR tube containing 10 µl sterile nuclease-free H2O. The PCR tube was closed and microwaved on high for 45 s. Once the cells were lysed the rest of the PCR components were added.

Amount Component 10 µl 5X Phusion HF Buffer 2.5 µL Dimethyl Sulfide (DMSO) 1 µl 10 mM deoxynucleotide mix 1 µl 10 µM Forward Primer 1 µl 10 µM Reverse Primer 10 ng Template DNA or 1 colony in 10µl sterile nuclease-free H2O 0.5 µl Phusion Hot Start II DNA Polymerase to 50 µl H2O Table 8: PCR Components

The mixture was then placed in the thermocycler and programmed according to table 9.

Step Time Temperature 1 50 s 98°C 2 10 s 98°C 3 30 s Annealing Temperature (dependent on primer sequence) 4 30 s/kb 72°C 5 Go to step #2 29 times 6 2 min 72°C 7 Forever 4°C Table 9: Thermocycler settings for PCR

Agarose Gel

Agarose gel was made using a solution of 1X TAE buffer and concentrations of agarose

LE varying from 0.8 – 1.5% depending on the size of the PCR fragment. The agarose was melted by microwaving the solution for 30 s intervals. Once the agarose was completely melted the solution was allowed to cool for about 15 min at which point 5 µl of 10 mg/ml ethidium bromide was added per 100 ml of solution. The gel was then poured into a gel cast and allowed to solidify completely.

Electroporation

Electrocompetent cells and DNA were both placed on ice to thaw. 45 µl of cells and 5 µl of DNA were combined in a sterile eppendorf and left on ice for 5 minutes. The mixture was then transferred to an electroporation cuvette with a 2 mm gap. The electroporator was set to 200

W and 2.5 V. The cuvette was inserted into the electroporator and shocked for 1-2 s. The mixture was then flushed out of the cuvette using 1ml of room temperature LB. The cells were then allowed to recover for an hour at either 30°C of 37°C. 200 µl of the recovered cells were then plated on the proper agar plate and grown overnight.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)

SDS-PAGE gels were used for the analysis of cell lysates and fractions from protein purifications. 10% gels (1mm thick) were made using the following recipe shown in table #.

10% Separating Gel 6% Stacking Gel Volume Component Volume Component

3.15 ml ddH2O 2.6 ml ddH2O 2.67 ml 30% Acrylamide 1 ml 30% Acrylamide 2 ml 1.5M Tris, pH 8.8 1.25 ml 0.5M Tris, pH 6.8 80 ul 10% SDS 50 ul 10% SDS 80 ul 10% APS 50 ul 10% APS 8 ul TEMED 5 ul TEMED Table 10: SDS-PAGE Recipe

TEMED was added immediately before pouring each portion of the gel. After the resolving gel was poured, 1-butanol was gently added in an even layer across the top of the gel to remove any bubbles that had formed. After allowing the resolving gel to solidify the butanol was removed and washed out with water. Excess water was removed using a kimwipe. The stacking gel was then added on top and either a 10 or 15 well comb was inserted immediately. The gels were then allowed to finish solidifying. Gels were stored wrapped in damp paper towels and aluminum foil at 4°C.

Gels were run in 1X SDS-PAGE buffer (10X: 250 mM Tris base, 2 M glycine, and 1%

SDS) until the dye in the loading buffer had completely run off the gel. 10% gels were run at 100

V for 15-20 min or until the dye had entered into the resolving gel and 200 V until the dye had run off. Pre-purchased gradient gels were run at 75 V for 30 min and then 125 V until completion.

Western Blots

Prior to transfer samples were run on an SDS-PAGE gel. While the gel ran, four pieces of filter paper and a membrane were cut down to size and shaken in methanol for 15 minutes. The methanol was then removed. Two pieces of filter paper were submerged in Tris-CAPS Anode buffer (1X Tris-CAPS (10X Tris-CAPS buffer: 600 mM Tris, 400 mM CAPS, pH 9.6), 15% methanol, pH 9.6), two were submerged in Tris-CAPS Cathode buffer (1X Tris-CAPS, 0.1%

SDS, pH 9.6), and the membrane was submerged in Tris-CAPS Transfer buffer (1X Tris-CAPS,

0.05% SDS, pH 9.6). All buffers were stored at 4°C.

Once the gel finished, the components were layered as follows in the semi-dry transfer apparatus: filter paper in cathode buffer, gel, membrane, and filter paper in anode buffer. In between each layer additional buffer was added. A test tube was rolled over the top filter paper to

remove any bubbles between layers. The apparatus was then closed and run for 45 min – 1 h at

15V.

After completing the transfer, the gel was placed in coomassie Blue silver and the membrane was transferred to a 50ml conical tube containing 10 ml of 5% dry milk in 1X TBS- tween (1X TBS (10X TBS Buffer: 500 mM Tris, 1.5 M NaCl, pH 7.4), 0.1% Tween-20, pH 7.4).

The membrane was placed so that the protein side faced inward. The membrane was set on a tumbler for 1hr to allow the milk to block non-specific proteins. The milk solution was then removed and replaced with 5 ml of fresh 5% milk in TBS-tween containing a 1:1000 or 1:500 dilution of the primary antibody. The membrane was allowed to incubate with the primary body for an hour at room temperature or overnight at 4°C. After incubation with the primary antibody, the membrane was washed 3 times with 1X TBS-tween. Each wash step lasted 5 min. A 1:4000 dilution of the secondary antibody in 5% dry milk in 1X TBS-tween was then added to the membrane and incubated on a tumbler for 1 h at room temperature. The membrane was then washed again with 1X TBS-tween for three 5 min intervals. After the membrane was washed it was scanned, rinsed with water, dried overnight, and stored.

Coomassie Blue Silver

376 ml of 85% Phosphoric acid was added to 1.7 L ddH2O. 200 g of aluminum sulfate octadecahydrate was then stirred into the solution and allowed to dissolve completely. 800 mg of

Coomassie G250 (Brilliant Blue) was then added and allowed to stir for at least 2 hours. 400 ml of 190 proof EtOH was then slowly added to the stirring mixture. Once all the EtOH was added the total volume was adjusted to 4 L.

After SDS-PAGE gels were run they were fixed in 5% phosphoric acid for 30 min.

Following the fixing step, the Blue Silver stain was added. The gel was placed on an orbital

shaker overnight. The next day the stain was removed and replaced with 5% phosphoric acid.

The gel de-stained in phosphoric acid for 30 min and then rinsed for a day or two in ddH2O. A

Kimwipe was added to the water to help absorb excess dye.

Drying Gels

2 cellulose membranes were placed in a flat shallow container containing 50 ml of gel dry buffer (1.14L H2O, 60 ml Glycerol (4% v/v), and 300 ml ethanol (20% v/v)). The container was placed on an orbital shaker and allowed to agitate for 20 min. The gel was placed in a separate container containing gel dry buffer. One half of a frame was placed on the DryEase assembly rack. A wet cellulose membrane was placed on the frame followed by the gel. The gel was placed carefully on the membrane to prevent any bubbles from forming. The second membrane and top frame were then placed on top of the assembly. Clips were used to secure the membranes and gel and the gel was allowed to dry overnight.

Appendix II: Complete Mass Spectrometry Data

CBS CBS WT WT Δ Type

- Type

- CBS tagged CBS CBS tagged CBS Δ

Gene Symbol Gene MWT(kDa) Wild Unique Wild Total tagged WT Unique WTtagged Total Unique Total Wild SumIntensity Type SumIntensity tagged SumIntensity tagged guaB 51.96 13 24 57 2260 47 1700 2.00E+06 2.60E+10 1.80E+10 accB 16.68 10 371 10 274 8 261 5.30E+09 9.40E+08 9.70E+08 tufB 43.29 26 146 35 272 39 386 3.50E+08 1.00E+09 1.90E+09 fusA 77.53 30 59 36 95 48 178 3.30E+07 2.80E+07 1.60E+08 aceF 66.07 32 59 30 86 35 95 1.30E+07 2.60E+07 3.40E+07 guac 37.36 0 0 19 71 27 118 NF 1.20E+07 4.70E+07 dnaK 69.07 43 93 38 70 40 88 2.20E+07 1.40E+07 3.30E+07 aceE 99.61 33 54 46 69 51 111 5.50E+07 3.40E+07 6.20E+07 gapA 35.51 17 37 23 67 32 131 1.30E+07 2.30E+07 1.20E+08 adhE 96.1 25 34 30 54 45 132 3.70E+06 6.40E+06 8.30E+07 rpsA 61.12 25 39 31 49 39 73 5.30E+06 8.20E+06 2.40E+07 mopA 57.29 23 34 27 48 43 122 4.40E+06 9.00E+06 6.00E+07 rpoB 150.6 41 46 38 46 52 63 5.70E+06 4.60E+06 1.60E+07 accC 49.29 28 115 21 40 26 43 1.10E+08 2.10E+07 3.10E+07 rpoC 155.06 44 50 37 40 56 63 4.40E+06 4.00E+06 2.80E+07 purL 141.15 22 22 31 38 42 60 1.60E+06 5.80E+06 1.50E+07 purH 57.31 15 20 20 36 39 76 1.80E+06 1.10E+07 4.20E+07 carB 117.82 30 44 25 30 39 52 4.60E+06 4.50E+06 1.50E+07 cysK 34.47 17 23 18 29 23 63 3.30E+06 4.60E+06 3.70E+07 tsf 30.4 16 28 16 29 22 61 9.70E+06 1.40E+07 3.50E+07 lpdA 50.66 17 20 21 29 22 31 3.10E+06 1.10E+07 1.60E+07 glnA 51.87 19 30 17 29 21 41 4.00E+06 4.90E+06 1.50E+07 pykF 50.68 18 21 19 27 33 74 1.90E+06 6.50E+06 3.10E+07 tig 48.22 20 25 21 26 31 47 2.90E+06 3.90E+06 1.30E+07 rplN 13.53 5 30 7 25 6 26 7.10E+06 1.20E+07 1.60E+07 eno 45.63 19 27 16 24 18 38 3.80E+06 7.60E+06 2.90E+07 glyS 76.74 13 14 17 23 29 34 4.10E+05 1.50E+06 4.80E+06 acnB 93.43 15 19 18 23 26 31 9.80E+05 1.50E+06 4.00E+06 pgk 41.09 11 15 14 22 22 47 3.70E+06 6.50E+06 3.50E+07 gnd 51.45 20 24 20 22 26 31 2.60E+06 3.90E+06 2.00E+07 fabB 42.59 10 11 13 22 17 33 2.30E+06 1.20E+07 1.70E+07 alaS 95.94 22 29 17 22 32 46 8.30E+06 2.00E+06 7.00E+06 sucA 105.03 20 26 19 22 23 26 2.40E+06 2.00E+06 3.90E+06 pflB 85.3 20 22 20 21 44 58 2.00E+06 2.00E+06 3.30E+07 rpsC 25.97 10 20 11 21 13 38 1.10E+07 9.70E+06 3.20E+07 purA 47.32 14 16 16 21 23 35 2.70E+06 5.00E+06 1.70E+07 infB 97.22 21 21 19 21 22 28 2.00E+06 1.90E+06 4.90E+06 rplE 20.29 14 19 14 20 13 29 4.70E+06 6.00E+06 1.50E+07 pta 77.16 12 14 13 20 29 47 1.00E+06 1.80E+06 9.80E+06 gltB 167.18 32 35 19 20 34 37 2.50E+06 1.00E+06 5.40E+06 sucC 41.37 13 13 14 20 16 18 1.30E+06 3.10E+06 4.40E+06 lepA 66.47 11 11 15 20 17 30 8.80E+05 1.50E+06 4.10E+06 rpsG 17.59 8 10 11 19 14 26 2.00E+06 4.80E+06 9.80E+06 ptsI 63.49 13 16 16 19 27 38 1.00E+06 2.60E+06 7.60E+06 pnp 77.07 18 19 17 19 24 28 1.30E+06 1.20E+06 4.40E+06 lon 87.38 16 17 17 19 28 32 9.90E+05 1.10E+06 4.10E+06 pyrB 34.39 11 24 11 18 20 37 2.50E+07 9.00E+06 4.60E+07 glyA 45.29 10 22 11 18 17 46 1.90E+06 4.60E+06 3.20E+07 trpE 57.55 11 14 14 18 26 43 3.10E+06 6.50E+06 2.50E+07 rho 46.97 14 14 16 18 24 40 9.40E+05 1.40E+06 1.70E+07 icdA 45.74 20 27 13 18 24 44 4.00E+06 3.20E+06 1.40E+07 atpD 50.29 16 19 17 18 24 28 1.20E+06 1.60E+06 6.00E+06 rpsB 26.73 10 13 12 17 14 26 2.60E+06 3.90E+06 1.30E+07

rplK 14.87 5 13 5 17 5 17 1.90E+06 2.80E+06 5.70E+06 rplF 18.89 12 19 11 16 11 18 6.90E+06 5.10E+06 1.00E+07 rpoA 36.49 12 14 12 16 16 26 2.60E+06 3.30E+06 9.00E+06 rpsD 23.45 11 22 10 15 11 32 6.00E+06 6.10E+06 2.60E+07 trpD 56.86 6 8 14 15 17 25 5.80E+05 2.30E+06 1.20E+07 guaA 58.63 9 9 14 15 25 29 6.10E+05 1.90E+06 9.30E+06 typA 67.31 8 8 11 15 17 25 1.50E+06 3.10E+06 7.30E+06 sucB 44.01 8 11 12 15 16 19 9.70E+05 1.20E+06 4.70E+06 atpA 55.19 14 14 14 15 19 22 6.60E+05 1.30E+06 3.90E+06 pyrI 17.11 11 23 8 14 14 45 7.20E+06 2.70E+06 3.80E+07 rplB 29.84 10 13 9 14 11 20 2.90E+06 3.30E+06 6.00E+06 iscS 45.06 12 13 13 14 16 22 9.30E+05 1.40E+06 5.60E+06 proS 63.56 9 9 12 14 21 27 4.00E+05 6.90E+05 3.20E+06 rplA 24.71 11 13 11 13 16 21 5.10E+06 5.90E+06 1.90E+07 clpX 46.33 9 10 11 13 18 22 4.50E+05 7.30E+05 5.00E+06 mdh 32.32 9 9 11 13 15 19 6.30E+05 1.40E+06 4.90E+06 talB 35.18 14 19 11 13 15 22 1.30E+06 1.50E+06 4.00E+06 rpsE 17.59 7 10 11 13 11 12 1.90E+06 1.40E+06 3.80E+06 fabi 27.88 9 12 9 13 16 29 1.80E+06 1.70E+06 3.70E+06 metG 76.21 18 19 13 13 18 19 7.70E+05 1.00E+06 3.00E+06 purF 56.47 7 7 12 13 14 18 2.20E+05 6.30E+05 2.40E+06 phet 87.31 13 13 12 12 18 19 5.70E+05 1.30E+06 3.90E+06 aspS 65.8 10 11 11 12 16 17 2.60E+05 9.00E+05 2.50E+06 thrS 73.97 15 20 10 12 12 19 2.80E+06 1.60E+07 2.40E+06 serS 48.38 10 10 9 12 16 19 3.50E+05 1.10E+06 2.20E+06 accA 35.22 19 39 10 12 10 10 1.50E+07 1.40E+06 1.80E+06 thrA 89.06 23 26 12 12 13 15 1.10E+07 6.80E+05 1.80E+06 carA 41.4 5 5 10 11 11 13 6.10E+05 1.40E+06 4.90E+06 purT 42.4 5 5 10 11 10 13 3.40E+05 2.10E+06 4.40E+06 iles 104.3 12 13 11 11 22 29 7.10E+05 4.90E+05 3.20E+06 clpB 91.67 13 13 11 11 20 21 4.40E+05 8.60E+05 2.40E+06 purC 26.98 6 8 9 10 14 18 1.30E+06 1.90E+06 7.50E+06 ahpC 20.75 6 7 7 10 10 22 6.30E+05 1.20E+06 7.40E+06 ompA 37.16 11 12 8 10 12 21 2.10E+06 3.60E+06 6.70E+06 prsA 34.2 11 11 9 10 15 16 1.20E+06 2.20E+06 5.90E+06 gpmA 28.54 5 5 8 10 10 13 6.00E+05 1.20E+06 4.90E+06 gyrA 96.93 24 25 10 10 17 25 1.30E+06 5.80E+05 3.00E+06 dead 72.51 9 9 10 10 14 14 3.00E+05 4.60E+05 1.50E+06 rpiA 22.85 3 4 2 10 4 10 1.30E+05 2.10E+05 5.30E+05 suhB 29.15 5 6 5 9 9 16 2.50E+05 5.60E+05 2.10E+07 ppc 99.01 11 12 9 9 26 30 5.80E+05 1.70E+06 7.20E+06 trpA 28.68 8 10 7 9 8 15 6.70E+05 1.40E+06 6.90E+06 rplD 22.07 9 12 6 9 8 14 1.80E+06 3.10E+06 6.60E+06 trpB 42.94 4 4 7 9 9 15 3.30E+05 8.60E+05 5.20E+06 trpC 49.3 9 10 7 9 10 13 9.30E+05 2.50E+06 5.10E+06 asnS 52.54 9 9 9 9 14 16 9.10E+05 1.20E+06 4.60E+06 lysS 57.57 9 9 9 9 17 18 1.10E+06 7.90E+05 4.50E+06 sucD 29.76 5 5 6 9 7 9 8.20E+05 1.70E+06 3.50E+06 cysI 63.95 7 7 9 9 15 16 2.70E+05 4.40E+05 2.70E+06 metK 41.93 4 4 8 9 10 13 2.30E+05 6.80E+05 2.40E+06 valS 108.08 15 16 9 9 17 19 4.70E+05 4.80E+05 2.30E+06 dapD 29.87 10 12 9 9 10 11 8.50E+05 6.90E+05 1.90E+06 polA 103.15 15 15 9 9 13 13 4.70E+05 1.00E+06 1.80E+06 accD 33.3 12 29 7 9 6 7 1.20E+07 1.30E+06 1.40E+06 fumA 60.26 5 5 9 9 11 12 2.90E+05 6.40E+05 1.40E+06 glyQ 34.69 3 4 7 9 6 10 2.00E+05 6.50E+05 1.10E+06 fabF 43.02 6 8 6 9 7 7 4.00E+05 5.60E+05 9.90E+05 fabG 25.56 6 6 9 9 8 8 3.50E+05 6.80E+05 8.20E+05 nusA 54.84 8 8 8 8 14 15 1.00E+06 5.70E+05 5.70E+06 rpsI 14.85 5 10 6 8 6 16 2.10E+06 1.50E+06 4.60E+06 gcvP 104.25 8 8 8 8 19 20 7.50E+05 1.00E+06 4.40E+06 purM 36.85 3 3 7 8 7 8 3.60E+05 1.80E+06 3.30E+06 rplM 16.01 7 9 6 8 6 7 1.40E+06 1.10E+06 3.20E+06 ahpF 56.14 7 7 7 8 18 19 1.90E+05 5.10E+05 2.90E+06 cysJ 66.23 3 3 7 8 15 15 2.10E+05 6.40E+05 2.80E+06 tktA 72.14 8 12 7 8 15 22 8.00E+05 5.40E+05 2.70E+06

gltA 47.98 6 6 7 8 8 10 4.20E+05 1.20E+06 2.40E+06 ribH 16.15 3 3 7 8 10 15 1.10E+05 6.40E+05 2.40E+06 ychF 39.63 7 8 7 8 9 10 4.60E+05 9.20E+05 2.20E+06 pgi 61.51 12 13 8 8 16 17 3.20E+05 3.40E+05 2.10E+06 dps 22.1 9 9 8 8 11 11 5.60E+05 6.10E+05 1.80E+06 glnS 63.45 8 8 8 8 10 13 2.70E+05 5.30E+05 1.70E+06 asnA 36.63 5 5 7 8 7 7 3.30E+05 6.80E+05 1.40E+06 aspC 43.57 9 9 8 8 10 10 3.50E+05 5.80E+05 9.50E+05 cheA 71.3 9 9 1 7 0 0 2.70E+05 1.40E+05 NF mreB 36.93 10 16 7 7 10 20 7.90E+05 1.20E+06 6.60E+06 rpsJ 11.73 5 5 6 7 6 9 1.30E+06 2.60E+06 6.20E+06 upp 22.52 7 8 6 7 11 14 3.90E+05 6.00E+05 5.90E+06 aceA 47.49 15 20 7 7 11 13 4.80E+06 1.30E+06 3.10E+06 rplI 15.76 7 7 7 7 6 6 8.50E+05 3.30E+06 2.90E+06 ackA 43.26 5 5 7 7 11 15 2.00E+05 4.30E+05 2.70E+06 glmS 66.82 9 10 7 7 19 24 4.00E+05 3.20E+05 2.50E+06 rpsK 13.84 5 6 4 7 5 7 1.30E+06 1.10E+06 2.20E+06 frr 20.63 6 7 6 7 9 12 5.90E+05 1.20E+06 2.10E+06 nrdA 85.66 6 6 7 7 12 13 1.50E+05 5.90E+05 1.60E+06 gyrB 89.89 11 12 7 7 16 17 4.10E+05 3.80E+05 1.40E+06 htpG 71.38 10 12 5 7 9 11 3.80E+05 4.40E+05 1.30E+06 miaB 53.64 5 5 7 7 9 10 2.70E+05 5.00E+05 1.30E+06 metE 84.6 4 5 6 7 7 8 1.10E+05 1.60E+05 4.60E+05 luxS 19.43 1 1 6 7 4 4 5.30E+04 3.90E+05 3.40E+05 pepD 52.89 4 4 6 6 5 5 8.00E+04 1.10E+07 1.50E+07 rplO 14.96 8 13 5 6 7 12 7.70E+06 2.90E+06 1.10E+07 rpsM 13.09 5 7 4 6 5 8 2.30E+06 3.00E+06 4.90E+06 kdsA 30.81 6 7 5 6 6 8 1.40E+06 1.10E+06 2.30E+06 leuS 97.27 10 11 5 6 11 14 4.70E+05 3.80E+05 2.20E+06 gpmM 56.16 6 6 6 6 12 14 2.80E+05 3.20E+05 1.80E+06 trpS 37.41 3 3 5 6 7 8 1.10E+05 3.60E+05 1.50E+06 rnb 72.39 6 6 6 6 13 13 2.00E+05 3.80E+05 1.30E+06 gltX 53.77 5 5 5 6 8 8 9.30E+04 4.30E+05 1.10E+06 bcp 17.62 3 3 5 6 5 5 1.90E+05 8.80E+05 1.00E+06 nuoG 100.41 4 4 6 6 8 9 1.00E+05 5.80E+05 9.30E+05 topA 97.32 6 7 5 6 9 13 1.40E+05 1.40E+05 5.80E+05 nfsB 23.98 3 4 2 6 3 8 1.00E+05 9.00E+04 2.70E+05 fbaA 39.18 5 19 4 5 8 16 1.30E+06 1.40E+06 2.10E+07 cysN 52.51 5 5 4 5 9 11 2.20E+05 5.30E+05 4.10E+06 pfkA 34.82 5 5 5 5 14 18 8.00E+05 4.40E+05 3.70E+06 pykA 51.34 9 11 5 5 11 13 3.80E+05 2.50E+05 2.70E+06 fabA 18.98 4 5 5 5 7 10 5.40E+05 1.10E+06 2.60E+06 dapA 31.26 5 5 5 5 5 6 2.30E+05 5.80E+05 2.60E+06 pyrG 60.34 5 6 5 5 11 13 3.30E+05 5.00E+05 2.50E+06 add 36.34 0 0 4 5 7 8 NF 6.10E+05 1.80E+06 rplQ 14.36 4 5 4 5 3 4 6.90E+05 8.20E+05 1.40E+06 pck 59.59 3 3 5 5 11 11 7.10E+04 3.00E+05 1.30E+06 yjjK 62.38 8 8 5 5 11 11 3.10E+05 3.30E+05 1.20E+06 purD 45.93 3 3 5 5 5 5 1.70E+05 6.50E+05 1.00E+06 fklB 22.2 2 4 3 5 5 10 3.60E+05 3.20E+05 9.90E+05 rfae 51 4 4 5 5 9 9 8.60E+04 2.50E+05 9.20E+05 proB 39.03 5 5 4 5 10 10 1.20E+05 1.20E+05 8.50E+05 ftsZ 40.3 7 8 5 5 13 16 2.90E+05 1.40E+05 8.40E+05 prfC 59.54 3 3 5 5 8 8 5.70E+04 2.00E+05 8.20E+05 ompX 18.59 5 5 5 5 4 4 2.10E+05 5.70E+05 7.50E+05 der 54.97 3 3 5 5 8 9 7.90E+04 1.60E+05 6.10E+05 speA 73.84 1 1 4 5 6 6 3.10E+04 1.90E+05 5.80E+05 yfiF 37.79 5 5 5 5 6 6 1.10E+05 2.20E+05 5.70E+05 rpsF 15.18 4 4 2 5 4 7 2.60E+05 3.40E+05 4.80E+05 eda 22.27 4 4 5 5 5 5 1.40E+05 2.00E+05 4.40E+05 ompF 39.33 7 11 2 5 5 11 6.80E+05 1.30E+05 3.20E+05 murC 53.56 0 0 3 4 0 0 NF 7.60E+04 NF rplJ 17.7 4 7 4 4 4 7 2.10E+06 2.10E+06 8.60E+06 lipA 36.05 6 7 4 4 5 6 1.00E+06 9.90E+05 3.20E+06 hemL 45.38 7 9 4 4 8 9 6.50E+05 8.10E+05 3.10E+06 rplT 13.49 4 6 2 4 2 4 5.00E+05 1.50E+06 3.00E+06

rplL 12.29 3 4 4 4 3 4 3.30E+05 9.90E+05 2.80E+06 rplC 22.23 5 6 4 4 6 7 4.50E+05 7.60E+05 2.20E+06 rfad 34.87 10 11 4 4 11 11 5.80E+05 3.70E+05 1.90E+06 nadE 30.63 3 3 4 4 9 9 8.60E+04 2.20E+05 1.70E+06 phes 36.78 9 9 4 4 8 9 2.90E+05 4.10E+05 1.50E+06 rpmB 9 2 2 2 4 2 4 2.90E+05 5.30E+05 1.40E+06 rpsU 8.49 2 3 3 4 6 10 2.30E+05 4.90E+05 1.30E+06 fabH 33.49 4 4 4 4 6 7 2.10E+05 5.00E+05 1.20E+06 deoD 25.92 1 1 4 4 5 5 4.60E+04 2.80E+05 1.10E+06 fabZ 17.02 5 5 4 4 5 5 3.80E+05 6.70E+05 1.00E+06 yhgF 85 8 8 4 4 11 12 2.00E+05 2.30E+05 1.00E+06 ybeZ 40.63 7 7 4 4 8 8 2.60E+05 2.50E+05 9.60E+05 slyD 20.84 2 3 4 4 5 6 1.80E+05 3.90E+05 9.60E+05 sodB 21.25 4 4 4 4 6 6 2.60E+05 3.70E+05 9.40E+05 pyrH 25.95 3 4 4 4 6 7 2.90E+05 1.90E+05 9.20E+05 crr 18.24 4 4 4 4 6 6 2.10E+05 3.50E+05 8.70E+05 secA 101.93 8 8 4 4 9 9 1.30E+05 5.80E+04 8.50E+05 hslU 49.55 5 5 4 4 6 7 1.50E+05 2.10E+05 7.20E+05 rplV 12.22 4 4 4 4 4 5 3.00E+05 3.10E+05 7.00E+05 asnB 62.61 5 5 3 4 7 8 2.40E+05 9.20E+04 6.40E+05 tyrS 47.48 1 1 4 4 4 4 8.00E+04 3.20E+05 6.10E+05 prfB 32.86 5 6 4 4 5 5 1.70E+05 2.90E+05 5.90E+05 cspC 7.4 3 3 3 4 3 4 1.10E+05 3.50E+05 5.90E+05 sdhA 64.38 5 6 4 4 7 9 1.00E+05 1.60E+05 5.10E+05 rplP 15.27 2 3 4 4 3 3 4.90E+05 7.30E+05 5.00E+05 stpA 15.35 3 3 4 4 4 4 7.10E+04 2.80E+05 4.90E+05 pepA 54.84 3 3 4 4 4 4 8.20E+04 2.00E+05 4.80E+05 gcpE 40.66 3 3 4 4 7 8 6.40E+04 1.20E+05 4.60E+05 yfgB 43.06 0 0 4 4 5 5 NF 1.90E+05 4.10E+05 panB 28.13 2 2 4 4 3 4 1.60E+05 2.70E+05 3.70E+05 trxA 15.98 4 4 3 4 4 4 4.00E+05 1.60E+05 3.50E+05 metH 136.05 11 11 4 4 9 9 3.30E+05 7.30E+04 3.50E+05 aceB 60.25 4 5 4 4 2 2 7.50E+05 2.20E+05 3.30E+05 thiI 54.93 0 0 4 4 4 4 NF 1.80E+05 3.10E+05 minD 29.6 3 3 4 4 3 3 9.50E+04 3.70E+05 2.70E+05 ddlA 39.32 2 2 4 4 4 4 6.40E+04 2.30E+05 2.60E+05 mfd 129.94 6 7 4 4 4 4 1.50E+05 1.10E+05 2.10E+05 yajQ 18.33 3 3 4 4 2 2 1.60E+05 2.20E+05 1.90E+05 pyrD 36.79 2 2 4 4 2 2 7.10E+04 1.30E+05 1.20E+05 dacA 44.42 6 6 3 3 0 0 1.10E+05 1.20E+05 NF purU 31.9 1 1 3 3 0 0 6.40E+04 6.60E+05 NF mopB 10.38 3 4 3 3 2 3 6.30E+05 1.50E+06 4.60E+06 ppa 19.72 2 2 3 3 8 14 2.50E+05 5.10E+05 3.50E+06 ompC 41.23 6 9 2 3 4 10 8.10E+05 1.00E+06 2.60E+06 rplS 13.13 4 6 2 3 2 4 1.70E+06 9.60E+05 2.40E+06 proQ 25.88 6 6 3 3 5 5 1.70E+05 2.20E+05 1.90E+06 serA 44.18 5 5 3 3 6 7 3.40E+05 3.20E+05 1.70E+06 adk 23.53 7 7 3 3 8 8 5.00E+05 4.60E+05 1.60E+06 purB 51.51 8 8 3 3 7 8 5.70E+05 3.30E+05 1.50E+06 serC 39.75 4 4 3 3 8 8 2.40E+05 2.20E+05 1.50E+06 katG 79.98 9 9 3 3 14 16 3.00E+05 1.00E+05 1.40E+06 mtn 24.34 3 3 2 3 5 8 1.60E+05 8.20E+04 1.20E+06 infC 16.63 3 4 3 3 3 5 3.30E+05 3.00E+05 1.10E+06 hisS 47 4 4 3 3 7 7 2.60E+05 3.30E+05 1.00E+06 aroH 38.69 3 3 3 3 3 3 2.50E+05 4.30E+05 1.00E+06 pncB 45.9 1 1 3 3 4 4 2.80E+04 8.70E+04 9.90E+05 fbaB 40.91 3 4 3 3 5 5 1.30E+05 3.70E+05 9.20E+05 recA 37.95 6 6 3 3 5 6 4.40E+05 3.00E+05 8.30E+05 purK 39.47 3 3 3 3 4 4 9.30E+04 2.30E+05 7.10E+05 gpt 16.96 2 2 3 3 3 4 9.10E+04 1.60E+05 7.10E+05 selD 36.65 3 3 3 3 6 7 1.60E+05 1.40E+05 7.00E+05 pyrC 38.8 4 4 2 3 7 7 8.40E+05 2.10E+05 6.90E+05 zwf 55.67 4 4 3 3 7 7 8.00E+04 1.60E+05 6.80E+05 arcA 27.27 1 1 3 3 5 6 5.40E+04 2.00E+05 6.60E+05 mrp 39.91 0 0 2 3 4 4 NF 1.30E+05 6.30E+05 cysS 52.15 6 6 3 3 6 6 1.80E+05 2.10E+05 6.20E+05

nusG 20.53 6 6 3 3 5 6 2.80E+05 1.30E+05 5.60E+05 folE 24.81 5 5 3 3 4 4 2.30E+05 2.20E+05 5.60E+05 glmM 47.47 0 0 2 3 7 7 NF 9.90E+04 5.50E+05 yfiD 14.26 4 4 3 3 4 6 6.20E+05 1.20E+05 5.50E+05 trxB 34.56 4 4 3 3 9 9 2.70E+05 8.60E+04 5.50E+05 lpxA 28.06 4 4 3 3 4 4 2.20E+05 1.80E+05 5.40E+05 yccW 44.34 1 1 3 3 4 4 1.70E+04 4.00E+05 5.40E+05 lpcA 20.8 3 3 3 3 5 5 2.10E+05 1.30E+05 5.00E+05 kbl 43.12 2 2 3 3 5 5 7.20E+04 1.70E+05 5.00E+05 mukB 170.11 7 7 3 3 9 9 1.40E+05 7.30E+04 4.90E+05 bglA 55.2 2 2 3 3 4 4 4.40E+04 1.40E+05 4.90E+05 rpsH 14.12 3 3 3 3 4 4 1.60E+05 2.40E+05 4.80E+05 gcvT 40.12 4 4 3 3 4 4 2.90E+05 2.00E+05 4.70E+05 galF 32.81 3 3 3 3 4 4 4.30E+04 5.10E+04 4.50E+05 asd 40.01 3 3 3 3 3 3 1.80E+05 1.30E+05 4.40E+05 yeiP 21.52 2 2 3 3 3 3 4.20E+04 2.20E+05 4.30E+05 ptsP 83.67 0 0 3 3 7 8 NF 8.50E+04 4.20E+05 ompR 27.34 3 3 3 3 3 3 9.80E+04 1.50E+05 4.00E+05 ffh 49.76 5 5 3 3 7 7 1.50E+05 1.20E+05 3.90E+05 pgm 58.34 2 3 3 3 5 5 5.50E+04 9.10E+04 3.00E+05 rpsS 10.42 1 1 3 3 3 3 7.40E+04 1.30E+05 2.90E+05 ygfZ 36.21 4 5 3 3 4 4 1.90E+05 1.40E+05 2.80E+05 pdxB 41.29 3 3 2 3 3 3 1.10E+05 7.90E+04 2.80E+05 cyoA 34.87 3 3 3 3 3 3 5.50E+04 8.80E+04 2.60E+05 fabD 32.36 3 3 3 3 4 5 6.50E+04 8.60E+04 2.50E+05 panC 31.56 1 1 3 3 4 4 1.90E+04 9.10E+04 2.50E+05 yifE 13.13 1 1 3 3 4 4 1.20E+04 9.00E+04 2.40E+05 yfbQ 45.49 1 1 3 3 2 2 3.70E+04 1.60E+05 2.30E+05 dhaM 51.56 4 4 3 3 4 4 9.50E+05 9.80E+04 2.20E+05 map 29.31 4 5 3 3 2 2 1.40E+05 1.70E+05 2.00E+05 atpF 17.24 1 1 2 3 2 2 9.40E+03 3.40E+04 1.40E+05 rffA 41.89 0 0 3 3 4 4 NF 5.10E+04 1.20E+05 metQ 29.41 3 3 3 3 3 3 3.70E+04 4.60E+04 1.10E+05 cfa 43.88 1 1 3 3 2 2 2.20E+04 5.70E+04 7.90E+04 aldA 52.25 4 5 3 3 2 2 4.00E+04 1.00E+05 5.00E+04 yceD 19.3 3 3 3 3 1 1 5.60E+04 6.20E+04 4.00E+04 trmJ 27.03 0 0 2 2 0 0 NF 1.10E+05 NF rpsP 9.18 0 0 2 2 0 0 NF 8.80E+04 NF tolC 53.74 0 0 2 2 0 0 NF 3.40E+04 NF evgA 22.68 0 0 1 2 0 0 NF 2.90E+04 NF tdh 37.26 2 2 2 2 0 0 1.00E+05 2.10E+05 NF tpx 17.82 3 3 2 2 5 8 5.00E+05 4.30E+05 2.50E+06 tdcE 85.92 2 3 2 2 2 2 4.70E+05 3.00E+05 2.20E+06 pfkB 32.59 0 0 2 2 3 3 NF 1.80E+06 2.10E+06 hupA 9.53 1 1 2 2 2 2 7.20E+05 6.20E+05 1.70E+06 ssb 18.96 3 3 2 2 2 2 4.00E+05 3.60E+05 1.50E+06 clpA 84.15 11 11 2 2 7 7 4.10E+05 3.60E+04 1.40E+06 efp 20.58 2 2 2 2 2 3 1.30E+05 4.00E+05 1.30E+06 gatZ 46.95 2 2 2 2 8 8 1.20E+05 1.40E+05 1.30E+06 metL 88.84 4 4 2 2 8 8 3.80E+04 3.80E+04 9.80E+05 codA 48.29 0 0 2 2 4 4 NF 7.80E+04 7.50E+05 sspA 24.29 4 4 2 2 3 3 2.20E+05 2.30E+05 7.40E+05 rffD 45.8 0 0 2 2 2 2 NF 5.50E+05 6.50E+05 mnmG 69.48 3 3 2 2 7 7 7.00E+04 6.30E+04 6.10E+05 pepN 98.86 3 3 2 2 7 7 1.90E+05 7.80E+04 5.60E+05 grpE 21.8 4 6 1 2 2 4 4.20E+05 2.00E+05 5.00E+05 gntY 20.93 4 4 2 2 2 3 1.40E+05 1.00E+05 4.90E+05 argS 64.64 8 8 2 2 4 4 1.90E+05 1.30E+05 4.80E+05 dnaJ 41.02 2 2 2 2 5 5 6.50E+04 6.30E+04 4.20E+05 rpsQ 9.7 1 1 1 2 1 1 2.00E+05 4.90E+05 4.00E+05 tgt 42.57 0 0 2 2 6 7 NF 5.70E+04 3.90E+05 pheA 43.06 2 3 2 2 5 5 2.50E+04 6.90E+04 3.90E+05 hns 15.53 5 6 2 2 3 4 2.70E+05 1.20E+05 3.70E+05 folX 14.07 2 2 2 2 3 3 1.10E+05 1.10E+05 3.70E+05 dadA 47.6 6 6 2 2 5 5 1.80E+05 6.30E+04 3.60E+05 pal 18.8 2 2 2 2 2 2 1.40E+05 1.80E+05 3.60E+05

fur 16.78 2 2 2 2 3 3 9.80E+04 1.40E+05 3.60E+05 rpoD 70.18 6 6 2 2 8 11 1.30E+05 8.10E+04 3.40E+05 frmA 39.32 2 2 2 2 3 3 4.70E+04 6.50E+04 3.40E+05 rlmL 78.76 0 0 2 2 6 6 NF 5.20E+04 3.30E+05 prlC 77.12 0 0 2 2 8 8 NF 3.80E+04 3.30E+05 thrC 47.06 5 5 2 2 4 4 1.70E+05 1.20E+05 3.10E+05 lrp 18.88 2 2 2 2 2 2 1.40E+05 1.20E+05 3.00E+05 srmB 49.87 4 4 2 2 3 3 9.20E+04 4.40E+04 2.90E+05 galU 32.92 2 2 2 2 4 4 6.40E+04 9.70E+04 2.90E+05 ompT 35.53 5 5 2 2 2 2 2.30E+05 1.10E+05 2.70E+05 rimM 20.59 0 0 2 2 3 3 NF 1.20E+05 2.60E+05 menB 31.61 1 1 2 2 4 4 1.50E+04 6.40E+04 2.60E+05 rpsL 13.73 0 0 2 2 2 2 NF 8.90E+04 2.40E+05 degP 49.31 1 1 2 2 4 4 4.10E+04 4.60E+04 2.40E+05 bioB 38.64 2 2 2 2 5 5 2.60E+04 4.50E+04 2.40E+05 sdaB 48.69 0 0 2 2 2 2 NF 5.80E+05 2.20E+05 rplY 10.69 4 4 2 2 2 2 8.10E+04 1.10E+05 2.20E+05 fnr 27.95 2 2 2 2 2 2 3.90E+04 1.40E+05 2.20E+05 aroA 46.19 1 1 2 2 4 4 1.90E+04 4.50E+04 2.20E+05 ghrB 35.37 5 6 2 2 4 4 1.90E+05 6.80E+04 2.10E+05 ycaO 65.61 2 2 1 2 2 2 6.70E+04 6.70E+04 2.10E+05 gshA 58.23 2 2 2 2 3 3 3.20E+04 1.20E+04 2.10E+05 manX 35.07 4 4 2 2 1 1 1.10E+05 8.20E+04 1.90E+05 rcsB 23.66 0 0 2 2 4 5 NF 2.20E+04 1.50E+05 dfp 43.4 0 0 2 2 4 5 NF 1.60E+04 1.50E+05 dapB 28.75 2 2 2 2 2 2 7.40E+04 7.20E+04 1.50E+05 iciA 33.45 2 2 2 2 3 3 3.20E+04 5.70E+04 1.50E+05 hemB 35.6 2 2 2 2 2 2 3.20E+04 3.80E+04 1.50E+05 fdx 12.35 1 1 2 2 1 1 2.60E+04 9.30E+04 1.50E+05 atpG 31.56 2 2 2 2 3 3 2.40E+04 7.40E+04 1.50E+05 greA 17.63 1 1 2 2 3 3 2.10E+03 5.90E+04 1.40E+05 nadB 60.25 0 0 2 2 2 2 NF 9.60E+04 1.30E+05 uvrA 103.82 6 7 2 2 3 3 1.00E+05 4.90E+04 1.30E+05 ibpA 15.76 1 1 2 2 3 3 1.80E+04 3.80E+04 1.20E+05 bfr 18.48 1 1 2 2 2 2 1.70E+04 2.80E+04 1.20E+05 rdgC 33.97 2 2 2 2 2 2 4.80E+04 6.80E+04 1.10E+05 kdgR 30 2 2 2 2 2 2 3.40E+04 7.90E+04 1.10E+05 rnr 92.1 2 2 2 2 2 2 2.20E+04 4.10E+04 9.80E+04 folD 30.94 1 1 2 2 2 2 4.50E+04 1.10E+05 9.60E+04 ydhQ 42.79 0 0 2 2 2 2 NF 6.60E+04 9.50E+04 elbB 23.04 0 0 1 2 2 2 NF 6.60E+04 9.20E+04 hslO 32.71 3 3 2 2 1 1 6.30E+04 9.80E+04 8.80E+04 ybgK 34.45 2 2 2 2 1 1 1.30E+05 9.90E+04 8.50E+04 yajL 20.78 2 2 2 2 2 2 3.30E+04 5.70E+04 8.50E+04 yhes 71.8 1 1 2 2 2 2 1.40E+04 3.50E+04 7.80E+04 mukF 50.58 1 1 2 2 2 2 6.30E+03 2.80E+05 7.80E+04 pps 87.37 5 6 1 2 2 2 8.90E+04 2.90E+04 7.60E+04 pssA 52.77 4 4 2 2 2 2 4.10E+04 3.90E+04 6.40E+04 speB 33.55 1 1 2 2 2 2 4.40E+04 8.50E+04 5.60E+04 ydjN 48.68 1 1 2 2 2 2 2.80E+04 3.40E+04 5.60E+04 yead 32.63 1 1 2 2 1 2 4.10E+03 3.30E+04 5.00E+04 gsk 48.42 0 0 2 2 2 2 NF 2.40E+04 4.10E+04 mukE 25.94 1 1 1 2 2 2 5.40E+03 2.30E+04 4.10E+04 hfq 11.16 0 0 1 2 1 1 NF 5.00E+04 3.80E+04 ybeD 9.82 2 2 2 2 1 1 2.50E+04 4.30E+04 1.60E+04 yfgl 41.86 2 2 1 2 1 1 2.40E+04 1.30E+04 1.40E+04 potG 41.98 0 0 1 1 0 0 NF 2.00E+05 NF livJ 39.05 0 0 1 1 0 0 NF 1.10E+05 NF bolA 11.99 0 0 1 1 0 0 NF 7.40E+04 NF ispH 34.71 0 0 1 1 0 0 NF 4.10E+04 NF tnaA 53.38 0 0 1 1 0 0 NF 3.20E+04 NF yphG 123.75 0 0 1 1 0 0 NF 3.10E+04 NF yggl 12.81 0 0 1 1 0 0 NF 1.80E+04 NF bioA 47.2 0 0 1 1 0 0 NF 1.70E+04 NF msrA 23.36 0 0 1 1 0 0 NF 1.50E+04 NF rep 77.05 0 0 1 1 0 0 NF 1.40E+04 NF

ybgJ 24.03 1 1 1 1 0 0 1.90E+05 3.80E+04 NF fdhE 34.7 2 2 1 1 0 0 3.20E+04 3.20E+04 NF ybgI 26.88 1 1 1 1 0 0 2.20E+04 4.20E+04 NF nagB 29.76 1 1 1 1 0 0 1.90E+04 3.80E+04 NF rluC 36.01 1 1 1 1 0 0 8.80E+03 2.30E+04 NF agaR 29.55 1 1 1 1 0 0 8.40E+03 9.20E+03 NF rpe 24.54 1 1 1 1 0 0 4.20E+03 3.30E+04 NF wrbA 20.83 4 4 1 1 2 2 1.20E+05 2.30E+04 6.90E+06 frdA 65.95 0 0 1 1 3 3 NF 1.00E+04 2.30E+06 tpiA 26.95 2 2 1 1 5 6 6.40E+04 7.80E+04 1.70E+06 crp 23.63 5 5 1 1 5 5 4.30E+05 1.80E+05 1.60E+06 rplU 11.56 3 3 1 1 2 3 3.30E+05 7.90E+05 1.50E+06 osmC 15.08 1 1 1 1 3 3 6.40E+03 2.30E+04 1.30E+06 yadA 41.05 0 0 1 1 2 2 NF 2.00E+04 1.10E+06 nuoF 49.28 2 2 1 1 3 3 3.60E+05 6.60E+05 1.10E+06 rpsR 8.98 1 1 1 1 3 3 1.40E+05 1.20E+05 1.00E+06 rhlB 47.1 1 1 1 1 5 5 1.00E+04 2.70E+04 8.80E+05 yeex 12.77 1 1 1 1 3 3 2.40E+04 9.80E+04 7.00E+05 kbaZ 47.19 1 1 1 1 1 1 5.40E+04 1.40E+05 6.40E+05 purE 17.77 2 2 1 1 4 5 8.40E+04 1.10E+05 5.50E+05 udp 27.27 5 5 1 1 6 7 1.20E+05 5.40E+04 5.20E+05 sodA 23.11 4 7 1 1 4 6 3.00E+05 1.50E+05 4.60E+05 can 25.12 3 4 1 1 3 3 1.70E+05 8.60E+04 4.50E+05 nirB 93.08 0 0 1 1 5 5 NF 1.40E+04 4.20E+05 parC 83.76 3 3 1 1 4 4 6.90E+04 7.20E+04 4.10E+05 tkt1 72.9 0 0 1 1 1 1 NF 1.30E+05 3.90E+05 yegQ 51.15 3 4 1 1 4 4 3.90E+04 4.20E+04 3.90E+05 ndh 47.3 2 2 1 1 6 6 3.10E+04 5.60E+04 3.70E+05 katE 84.13 3 3 1 1 6 7 4.60E+04 9.60E+03 3.40E+05 hslV 19.08 2 2 1 1 1 1 1.50E+05 1.10E+05 3.20E+05 mutS 95.27 4 4 1 1 4 4 6.60E+04 3.30E+04 3.20E+05 nmpC 39.59 1 1 1 1 1 2 2.20E+05 1.00E+05 3.10E+05 aroG 37.97 2 2 1 1 4 4 5.70E+04 6.00E+04 3.10E+05 prmB 35.05 2 2 1 1 5 5 1.10E+05 1.00E+05 2.80E+05 yacF 28.26 1 1 1 1 2 3 3.80E+05 3.40E+04 2.70E+05 parE 70.21 1 1 1 1 3 3 1.40E+04 2.50E+04 2.70E+05 oppF 37.19 5 5 1 1 5 5 1.00E+05 1.20E+04 2.60E+05 ybbN 31.75 0 0 1 1 2 2 NF 1.60E+04 2.50E+05 crl 15.6 2 2 1 1 1 1 1.10E+05 1.80E+05 2.40E+05 ygdH 50.93 0 0 1 1 5 5 NF 2.50E+04 2.30E+05 purR 38.14 7 7 1 1 2 2 4.40E+05 4.90E+04 2.30E+05 hisB 40.24 2 2 1 1 3 3 3.90E+04 5.00E+04 2.30E+05 glnB 12.42 3 3 1 1 1 1 1.80E+06 1.10E+05 2.20E+05 hscA 65.6 2 2 1 1 3 3 3.80E+04 3.10E+04 2.20E+05 udk 24.34 0 0 1 1 3 3 NF 4.20E+04 2.00E+05 proA 44.5 2 2 1 1 3 3 2.50E+04 3.00E+04 2.00E+05 yheO 26.8 0 0 1 1 2 2 NF 6.50E+04 1.90E+05 hisG 33.34 1 1 1 1 2 2 1.90E+04 2.10E+04 1.90E+05 ppk 80.37 4 4 1 1 4 4 5.70E+05 2.40E+04 1.80E+05 nagD 27.15 2 3 1 1 3 3 6.50E+04 7.20E+04 1.80E+05 maeA 63.12 1 1 1 1 6 6 2.20E+04 2.80E+04 1.80E+05 cysC 22.32 0 0 1 1 1 1 NF 3.30E+04 1.70E+05 selB 68.81 0 0 1 1 3 3 NF 2.30E+04 1.70E+05 gadA 52.65 0 0 1 1 2 2 NF 1.50E+04 1.60E+05 deoB 44.39 5 5 1 1 3 3 2.80E+05 7.10E+04 1.60E+05 sthA 51.54 0 0 1 1 3 3 NF 2.60E+04 1.50E+05 fre 26.23 3 3 1 1 1 1 1.40E+05 5.20E+04 1.50E+05 putA 143.72 6 6 1 1 4 4 8.00E+04 1.40E+05 1.50E+05 pepB 46.2 3 3 1 1 3 3 4.10E+04 3.00E+04 1.40E+05 gatA 16.89 0 0 1 1 1 1 NF 2.90E+04 1.30E+05 lysU 57.8 0 0 1 1 3 3 NF 1.60E+04 1.30E+05 yajC 11.88 2 2 1 1 1 1 3.60E+04 4.10E+04 1.30E+05 yhdH 34.64 1 1 1 1 1 1 2.20E+04 2.60E+04 1.30E+05 dxs 67.59 1 1 1 1 2 2 3.90E+03 2.10E+04 1.30E+05 ubiE 28.09 2 2 1 1 2 2 3.60E+04 1.60E+04 1.20E+05 fbp 36.81 1 1 1 1 2 2 2.30E+04 3.40E+04 1.20E+05

gsp 70.46 1 1 1 1 2 3 7.10E+03 3.00E+04 1.20E+05 mscS 30.85 0 0 1 1 1 1 NF 2.20E+04 1.10E+05 murA 44.79 1 1 1 1 2 2 2.70E+04 4.60E+04 1.10E+05 glmU 49.14 1 1 1 1 2 2 1.40E+04 1.20E+04 1.10E+05 fruR 37.98 1 1 1 1 2 2 8.30E+03 2.30E+04 1.10E+05 cpxR 26.28 0 0 1 1 1 1 NF 4.30E+04 1.00E+05 pth 21.07 1 1 1 1 2 2 7.90E+04 3.10E+04 1.00E+05 ybiC 38.75 1 1 1 1 3 4 2.70E+04 3.30E+04 1.00E+05 tldD 51.33 1 1 1 1 2 2 6.70E+03 1.80E+04 1.00E+05 nrdB 43.47 1 1 1 1 1 1 5.10E+03 1.30E+04 1.00E+05 dapE 41.23 0 0 1 1 1 1 NF 2.80E+04 9.90E+04 fdoG 112.51 5 5 1 1 3 3 6.90E+04 4.30E+04 9.90E+04 yajO 36.35 0 0 1 1 2 2 NF 2.40E+04 9.30E+04 ybbU 29.25 2 2 1 1 1 1 4.20E+04 4.00E+04 9.20E+04 ghrA 35.37 3 3 1 1 2 2 2.90E+04 1.70E+04 9.20E+04 iscA 11.55 0 0 1 1 1 1 NF 6.50E+04 8.80E+04 ygiF 48.55 1 1 1 1 2 2 1.50E+04 2.50E+04 8.80E+04 yfcZ 10.31 0 0 1 1 1 1 NF 2.90E+04 8.70E+04 ppiC 10.23 1 1 1 1 1 1 7.00E+03 5.90E+04 8.60E+04 moaB 18.65 2 2 1 1 1 1 7.10E+04 5.80E+04 8.00E+04 rsmC 37.62 1 1 1 1 1 1 1.80E+04 2.10E+04 7.70E+04 pcnB 52.46 1 1 1 1 2 2 1.60E+04 1.20E+04 7.70E+04 ydcP 74.18 0 0 1 1 2 2 NF 3.80E+04 7.50E+04 ftsE 24.42 4 4 1 1 1 1 4.10E+04 5.90E+04 7.50E+04 rsuA 25.85 1 1 1 1 2 2 3.90E+04 1.70E+04 7.50E+04 yjeE 16.84 0 0 1 1 1 1 NF 3.50E+04 7.00E+04 leuA 57.25 0 0 1 1 1 1 NF 5.30E+04 6.80E+04 cysA 41.04 1 1 1 1 2 3 1.10E+04 5.80E+03 6.70E+04 thyA 30.46 0 0 1 1 1 1 NF 3.70E+04 6.30E+04 rluD 37.09 2 2 1 1 3 4 1.80E+04 9.80E+03 5.80E+04 dksA 17.52 1 1 1 1 1 1 4.30E+04 4.60E+04 5.60E+04 murE 53.27 0 0 1 1 1 1 NF 2.50E+04 5.50E+04 apt 19.85 2 3 1 1 1 1 3.20E+04 2.70E+04 5.50E+04 kdsC 20 1 1 1 1 1 1 1.60E+04 2.70E+04 5.40E+04 lpp 8.32 2 2 1 1 1 1 3.40E+04 2.50E+04 5.10E+04 uvrB 76.2 0 0 1 1 2 2 NF 3.70E+04 4.80E+04 lpxC 33.93 0 0 1 1 1 1 NF 2.30E+04 4.80E+04 yghU 32.3 0 0 1 1 1 1 NF 8.00E+03 4.80E+04 yciO 23.2 1 1 1 1 1 1 6.90E+03 2.90E+04 4.70E+04 yqhD 42.06 1 1 1 1 1 1 1.40E+04 1.30E+04 4.40E+04 yiiD 37.07 0 0 1 1 1 1 NF 2.10E+04 4.20E+04 pdxJ 26.36 1 1 1 1 1 1 1.30E+04 2.60E+04 4.20E+04 yjiA 35.71 2 2 1 1 2 2 2.90E+04 4.30E+04 4.00E+04 ycdX 26.82 1 1 1 1 1 1 2.00E+04 1.40E+04 4.00E+04 yhaJ 33.21 0 0 1 1 1 1 NF 2.10E+04 3.80E+04 iscR 17.33 0 0 1 1 2 2 NF 1.60E+04 3.50E+04 nagC 44.51 3 3 1 1 1 1 2.90E+04 1.50E+04 3.50E+04 yggX 10.93 0 0 1 1 1 1 NF 4.70E+04 3.40E+04 mtr 44.34 0 0 1 1 1 1 NF 1.60E+04 3.40E+04 hflK 45.53 3 3 1 1 2 2 2.80E+04 2.00E+04 3.30E+04 ilvC 54.03 3 3 1 1 1 1 5.70E+04 1.50E+04 3.20E+04 yadG 34.66 1 1 1 1 1 1 9.00E+03 1.60E+04 2.80E+04 hflB 70.66 5 5 1 1 1 1 6.70E+04 9.90E+03 2.00E+04 prlA 48.48 1 1 1 1 1 1 4.40E+03 1.30E+04 1.90E+04 entC 42.9 1 1 0 0 0 0 6.50E+06 NF NF ycgR 27.85 6 7 0 0 0 0 6.50E+05 NF NF fliC 60.9 8 10 0 0 0 0 6.10E+05 NF NF pepQ 50.16 4 4 0 0 0 0 1.50E+05 NF NF ydiJ 113.18 2 3 0 0 0 0 1.50E+05 NF NF tolB 45.93 4 4 0 0 0 0 9.70E+04 NF NF thrB 33.56 3 3 0 0 0 0 8.40E+04 NF NF ydfG 27.23 2 2 0 0 0 0 7.90E+04 NF NF cysB 36.13 3 3 0 0 0 0 7.80E+04 NF NF fliZ 21.54 2 2 0 0 0 0 7.70E+04 NF NF glnK 12.25 4 4 0 0 0 0 7.60E+04 NF NF rbfA 15.14 3 3 0 0 0 0 7.50E+04 NF NF

ndk 15.43 3 3 0 0 0 0 7.30E+04 NF NF rpsO 10.26 1 1 0 0 0 0 7.00E+04 NF NF oppA 60.95 2 2 0 0 0 0 6.60E+04 NF NF flgE 41.9 3 3 0 0 0 0 6.50E+04 NF NF fumC 50.38 2 2 0 0 0 0 6.00E+04 NF NF tar 59.9 4 4 0 0 0 0 5.90E+04 NF NF tsr 60.23 2 3 0 0 0 0 5.10E+04 NF NF cheW 18.07 2 2 0 0 0 0 5.10E+04 NF NF gabT 45.65 3 3 0 0 0 0 4.10E+04 NF NF yfex 33.06 3 3 0 0 0 0 4.10E+04 NF NF fliM 37.84 1 1 0 0 0 0 4.00E+04 NF NF pdxY 31.33 3 3 0 0 0 0 3.70E+04 NF NF smpB 18.26 1 1 0 0 0 0 3.40E+04 NF NF narL 23.91 1 1 0 0 0 0 3.30E+04 NF NF yncE 38.62 2 2 0 0 0 0 3.20E+04 NF NF acnA 97.7 3 3 0 0 0 0 3.10E+04 NF NF yhjH 29.53 1 1 0 0 0 0 3.10E+04 NF NF ppx 58.1 2 2 0 0 0 0 3.00E+04 NF NF cheB 37.4 1 1 0 0 0 0 3.00E+04 NF NF mipA 27.81 1 1 0 0 0 0 3.00E+04 NF NF fliN 14.77 1 1 0 0 0 0 3.00E+04 NF NF ydiA 31.19 2 2 0 0 0 0 2.80E+04 NF NF gshB 35.59 1 1 0 0 0 0 2.70E+04 NF NF tyrB 43.51 2 2 0 0 0 0 2.60E+04 NF NF ycac 22.42 1 1 0 0 0 0 2.50E+04 NF NF fliA 27.5 3 3 0 0 0 0 2.40E+04 NF NF yfdZ 46.22 2 2 0 0 0 0 2.40E+04 NF NF emrR 20.55 1 1 0 0 0 0 2.40E+04 NF NF rnc 25.53 1 1 0 0 0 0 2.30E+04 NF NF fliG 36.75 2 2 0 0 0 0 2.20E+04 NF NF ybjI 30.2 2 2 0 0 0 0 2.20E+04 NF NF yaaA 29.55 1 1 0 0 0 0 2.20E+04 NF NF yadR 12.09 1 1 0 0 0 0 2.20E+04 NF NF artP 27 1 1 0 0 0 0 2.20E+04 NF NF glnG 52.23 1 1 0 0 0 0 2.10E+04 NF NF ydjA 20.05 1 1 0 0 0 0 2.00E+04 NF NF fliI 49.28 1 1 0 0 0 0 2.00E+04 NF NF trmI 27.32 1 1 0 0 0 0 2.00E+04 NF NF ydhF 33.62 2 2 0 0 0 0 1.90E+04 NF NF epd 37.31 1 1 0 0 0 0 1.90E+04 NF NF fhlA 78.44 1 1 0 0 0 0 1.90E+04 NF NF dapF 30.19 1 1 0 0 0 0 1.80E+04 NF NF pntB 48.69 1 1 0 0 0 0 1.70E+04 NF NF yrbF 29.08 1 1 0 0 0 0 1.70E+04 NF NF nadA 38.13 1 1 0 0 0 0 1.60E+04 NF NF ispB 35.21 1 1 0 0 0 0 1.60E+04 NF NF ytjC 24 2 3 0 0 0 0 1.40E+04 NF NF uvrY 23.85 1 1 0 0 0 0 1.40E+04 NF NF yahK 38 1 1 0 0 0 0 1.40E+04 NF NF yjgB 36.41 1 1 0 0 0 0 1.40E+04 NF NF tyrA 41.96 1 1 0 0 0 0 1.30E+04 NF NF ybiS 33.28 2 2 0 0 0 0 1.20E+04 NF NF cmk 24.73 1 1 0 0 0 0 1.20E+04 NF NF yhbG 26.78 1 1 0 0 0 0 1.20E+04 NF NF prmA 31.86 1 1 0 0 0 0 1.10E+04 NF NF acrA 42.14 1 1 0 0 0 0 1.10E+04 NF NF lolD 25.44 1 1 0 0 0 0 1.10E+04 NF NF yeaG 74.43 1 1 0 0 0 0 1.10E+04 NF NF ydiU 54.45 1 1 0 0 0 0 1.10E+04 NF NF gntK 17.93 1 1 0 0 0 0 1.00E+04 NF NF ydcF 29.6 1 1 0 0 0 0 1.00E+04 NF NF pgl 36.28 1 1 0 0 0 0 1.00E+04 NF NF ftsJ 23.32 1 1 0 0 0 0 9.90E+03 NF NF LF82_613 50.74 1 1 0 0 0 0 9.40E+03 NF NF yegD 49.23 1 1 0 0 0 0 9.40E+03 NF NF ushA 60.88 1 1 0 0 0 0 9.10E+03 NF NF

ilvE 34.07 1 1 0 0 0 0 8.90E+03 NF NF sseA 30.83 1 1 0 0 0 0 8.30E+03 NF NF secB 17.28 1 1 0 0 0 0 8.20E+03 NF NF ycfH 29.79 1 1 0 0 0 0 7.90E+03 NF NF gabD 51.77 1 1 0 0 0 0 7.60E+03 NF NF secD 66.56 1 1 0 0 0 0 7.50E+03 NF NF serB 35.08 1 1 0 0 0 0 7.50E+03 NF NF ptsN 17.95 1 1 0 0 0 0 7.40E+03 NF NF obgE 43.23 1 1 0 0 0 0 7.30E+03 NF NF yebR 20.25 1 1 0 0 0 0 7.00E+03 NF NF glpR 28.09 1 1 0 0 0 0 6.90E+03 NF NF cyaA 97.68 1 1 0 0 0 0 6.80E+03 NF NF gpsA 36.34 1 1 0 0 0 0 6.40E+03 NF NF btuE 20.41 1 1 0 0 0 0 6.20E+03 NF NF prfA 40.49 1 1 0 0 0 0 6.00E+03 NF NF rpiR 32.34 1 1 0 0 0 0 5.70E+03 NF NF yedD 15.15 1 1 0 0 0 0 5.60E+03 NF NF glnH 27.17 1 1 0 0 0 0 4.90E+03 NF NF entE 59.03 1 1 0 0 0 0 4.80E+03 NF NF yigA 26.65 1 1 0 0 0 0 4.80E+03 NF NF spoT 79.31 1 1 0 0 0 0 4.70E+03 NF NF trmA 41.91 1 1 0 0 0 0 4.70E+03 NF NF pstB 29.01 1 1 0 0 0 0 4.60E+03 NF NF mraW 34.88 1 1 0 0 0 0 4.30E+03 NF NF mdaB 21.91 1 1 0 0 0 0 4.20E+03 NF NF ydaM 46.46 1 1 0 0 0 0 3.60E+03 NF NF hinT 13.26 1 1 0 0 0 0 3.40E+03 NF NF miaA 35.04 1 1 0 0 0 0 3.10E+03 NF NF cycA 51.63 1 1 0 0 0 0 1.70E+03 NF NF tyrR 57.63 0 0 0 0 2 2 NF NF 1.00E+06 malP 90.45 3 3 0 0 10 10 5.70E+04 NF 7.40E+05 aspA 52.32 0 0 0 0 9 10 NF NF 7.30E+05 cysD 35.18 5 5 0 0 6 6 2.50E+05 NF 7.10E+05 maeB 82.37 5 5 0 0 8 9 1.30E+05 NF 5.70E+05 ugd 43.52 0 0 0 0 1 1 NF NF 4.80E+05 cysH 27.96 2 2 0 0 4 5 4.50E+04 NF 4.60E+05 ftn 19.41 1 1 0 0 4 5 2.80E+04 NF 4.60E+05 glcB 80.4 2 2 0 0 1 1 4.90E+04 NF 4.50E+05 def 19.32 0 0 0 0 1 1 NF NF 3.70E+05 hepA 109.73 6 6 0 0 5 5 1.80E+05 NF 3.70E+05 pmbA 48.33 7 7 0 0 5 5 2.50E+05 NF 3.60E+05 fadR 26.95 1 1 0 0 1 1 4.40E+04 NF 3.40E+05 yjgF 13.6 0 0 0 0 4 4 NF NF 3.10E+05 clpP 23.17 0 0 0 0 4 4 NF NF 2.80E+05 ldhA 36.5 0 0 0 0 1 1 NF NF 2.80E+05 ftsA 45.3 0 0 0 0 3 3 NF NF 2.70E+05 gatY 30.98 2 2 0 0 2 2 1.80E+04 NF 2.60E+05 rpmA 9.12 0 0 0 0 2 2 NF NF 2.40E+05 folP 30.6 0 0 0 0 2 2 NF NF 2.40E+05 oppD 37.14 0 0 0 0 1 1 NF NF 2.40E+05 phoP 25.52 2 2 0 0 3 3 5.50E+04 NF 2.20E+05 hpt 20.1 1 1 0 0 3 3 1.10E+04 NF 2.10E+05 gor 48.71 0 0 0 0 5 5 NF NF 2.00E+05 uvrD 82.02 0 0 0 0 2 2 NF NF 2.00E+05 ligA 73.6 1 1 0 0 3 3 1.80E+04 NF 2.00E+05 rne 118.3 4 4 0 0 4 4 9.20E+04 NF 1.90E+05 xthA 30.92 0 0 0 0 4 4 NF NF 1.80E+05 glpX 35.83 0 0 0 0 3 3 NF NF 1.80E+05 gltD 52.06 3 3 0 0 1 1 1.50E+05 NF 1.80E+05 yidA 29.76 5 5 0 0 3 3 1.10E+05 NF 1.80E+05 relA 83.82 3 3 0 0 2 2 2.70E+04 NF 1.80E+05 speE 32.29 0 0 0 0 1 1 NF NF 1.70E+05 gdhA 48.54 6 7 0 0 3 3 2.10E+05 NF 1.70E+05 yceA 39.71 2 2 0 0 2 2 9.60E+04 NF 1.60E+05 infA 8.24 2 2 0 0 1 1 7.10E+04 NF 1.60E+05 mpl 49.85 0 0 0 0 4 4 NF NF 1.50E+05

iscU 13.83 0 0 0 0 1 1 NF NF 1.50E+05 ygbN 46.8 0 0 0 0 1 1 NF NF 1.40E+05 yciT 27.56 3 3 0 0 2 2 6.80E+04 NF 1.40E+05 kdsD 35.17 1 1 0 0 2 2 2.70E+04 NF 1.40E+05 ybiT 59.82 0 0 0 0 2 2 NF NF 1.30E+05 edd 64.62 1 1 0 0 2 2 1.70E+04 NF 1.30E+05 aroF 38.79 1 1 0 0 1 1 1.10E+04 NF 1.30E+05 manA 42.69 0 0 0 0 4 4 NF NF 1.20E+05 yigB 27.1 0 0 0 0 3 3 NF NF 1.20E+05 rluB 32.71 0 0 0 0 3 3 NF NF 1.20E+05 proC 28.2 0 0 0 0 2 2 NF NF 1.20E+05 yebC 26.42 1 1 0 0 2 7 4.00E+04 NF 1.20E+05 yliG 49.55 1 1 0 0 3 3 1.30E+04 NF 1.20E+05 hemE 39.21 0 0 0 0 3 3 NF NF 1.10E+05 dadX 38.83 0 0 0 0 2 2 NF NF 1.10E+05 argG 49.88 0 0 0 0 2 2 NF NF 1.10E+05 nusB 15.68 0 0 0 0 2 2 NF NF 1.10E+05 yicC 33.18 0 0 0 0 2 2 NF NF 1.00E+05 ydbK 128.75 0 0 0 0 2 2 NF NF 1.00E+05 rumA 48.03 0 0 0 0 1 2 NF NF 1.00E+05 aroC 39.26 0 0 0 0 1 1 NF NF 1.00E+05 dnaA 52.52 1 1 0 0 3 3 2.80E+04 NF 1.00E+05 nfrA 111.3 0 0 0 0 1 1 NF NF 9.90E+04 deoC 27.72 0 0 0 0 2 2 NF NF 9.60E+04 cysE 29.3 0 0 0 0 1 1 NF NF 9.50E+04 ltae 36.5 2 2 0 0 2 2 3.90E+04 NF 9.50E+04 pepT 44.88 1 1 0 0 2 2 2.40E+04 NF 9.50E+04 yhbY 10.78 0 0 0 0 2 2 NF NF 9.40E+04 ilvB 60.38 0 0 0 0 2 2 NF NF 9.00E+04 tas 38.48 1 1 0 0 1 1 1.70E+04 NF 8.90E+04 yeen 25.85 0 0 0 0 2 2 NF NF 8.70E+04 yhhX 38.73 0 0 0 0 2 2 NF NF 8.60E+04 era 33.77 0 0 0 0 3 3 NF NF 8.50E+04 yfaY 44.1 0 0 0 0 2 2 NF NF 8.50E+04 folC 45.44 0 0 0 0 3 3 NF NF 8.40E+04 otsA 53.49 0 0 0 0 2 2 NF NF 8.20E+04 ispA 32.16 2 2 0 0 1 1 1.50E+04 NF 8.10E+04 tsx 33.6 0 0 0 0 2 2 NF NF 7.80E+04 ygcF 25.01 0 0 0 0 2 2 NF NF 7.80E+04 potA 43.04 1 1 0 0 2 2 6.50E+03 NF 7.80E+04 glgC 49.51 2 2 0 0 2 2 2.40E+04 NF 7.60E+04 mqo 60.18 0 0 0 0 2 2 NF NF 7.40E+04 cspE 7.46 2 2 0 0 1 1 5.90E+04 NF 7.30E+04 pabA 20.77 0 0 0 0 1 1 NF NF 7.20E+04 uvrC 68.15 0 0 0 0 2 2 NF NF 7.10E+04 dcp 77.54 0 0 0 0 2 2 NF NF 7.10E+04 ygdE 41.85 1 1 0 0 1 2 1.90E+04 NF 7.00E+04 dnaX 71.06 0 0 0 0 2 2 NF NF 6.90E+04 ftsY 54.59 0 0 0 0 2 3 NF NF 6.80E+04 ribE 23.43 0 0 0 0 2 2 NF NF 6.70E+04 truD 39.11 0 0 0 0 2 2 NF NF 6.70E+04 dnaN 40.56 2 2 0 0 1 1 3.60E+04 NF 6.60E+04 rffE 42.19 0 0 0 0 1 1 NF NF 6.50E+04 queC 25.44 1 1 0 0 1 1 7.60E+03 NF 6.50E+04 hisF 28.44 0 0 0 0 1 1 NF NF 6.30E+04 entB 32.59 0 0 0 0 1 1 NF NF 6.20E+04 rplX 11.34 1 1 0 0 2 2 1.30E+05 NF 6.20E+04 yfbU 19.52 3 3 0 0 1 1 1.60E+05 NF 5.90E+04 yceH 24.07 0 0 0 0 1 1 NF NF 5.70E+04 ybhA 30.21 0 0 0 0 2 2 NF NF 5.60E+04 ddlB 32.85 1 1 0 0 1 1 2.40E+04 NF 5.60E+04 rpoZ 10.23 0 0 0 0 1 1 NF NF 5.50E+04 ycfP 21.21 0 0 0 0 1 1 NF NF 5.40E+04 fmt 34.19 0 0 0 0 1 1 NF NF 5.20E+04 gpp 54.89 0 0 0 0 2 2 NF NF 5.10E+04 avtA 46.68 0 0 0 0 1 1 NF NF 5.10E+04

rlmB 26.54 0 0 0 0 1 1 NF NF 5.10E+04 ptsG 50.64 0 0 0 0 2 2 NF NF 5.00E+04 ruvB 37.15 0 0 0 0 1 1 NF NF 5.00E+04 aroK 19.53 2 2 0 0 2 2 3.80E+04 NF 5.00E+04 fucU 15.45 0 0 0 0 1 1 NF NF 4.90E+04 yjgA 21.36 1 1 0 0 1 1 1.50E+04 NF 4.80E+04 yeeZ 29.68 1 1 0 0 2 2 2.20E+04 NF 4.70E+04 qor 35.18 0 0 0 0 2 2 NF NF 4.60E+04 fumB 60.08 0 0 0 0 1 1 NF NF 4.60E+04 yqjI 23.4 0 0 0 0 1 1 NF NF 4.60E+04 prkB 32.31 1 1 0 0 1 1 1.50E+04 NF 4.60E+04 cmoB 37 0 0 0 0 2 2 NF NF 4.50E+04 yidC 61.5 0 0 0 0 1 1 NF NF 4.40E+04 nrdD 80.02 0 0 0 0 1 1 NF NF 4.30E+04 nuoB 25.04 0 0 0 0 1 1 NF NF 4.30E+04 kdsB 27.6 0 0 0 0 2 2 NF NF 4.20E+04 dut 16.15 0 0 0 0 1 1 NF NF 4.20E+04 rsgA 39.21 0 0 0 0 1 1 NF NF 4.10E+04 ycbL 23.71 0 0 0 0 1 1 NF NF 4.10E+04 yecO 27.77 0 0 0 0 1 1 NF NF 4.00E+04 hemF 34.28 0 0 0 0 1 1 NF NF 3.90E+04 yggW 42.53 0 0 0 0 1 1 NF NF 3.80E+04 leuC 49.85 0 0 0 0 1 1 NF NF 3.70E+04 speD 30.43 0 0 0 0 1 1 NF NF 3.60E+04 yeaK 17.84 0 0 0 0 1 1 NF NF 3.60E+04 gldA 38.69 0 0 0 0 1 1 NF NF 3.60E+04 metJ 12.13 0 0 0 0 1 1 NF NF 3.60E+04 pdxK 30.83 0 0 0 0 1 1 NF NF 3.30E+04 tesB 31.93 0 0 0 0 1 1 NF NF 3.30E+04 yigl 29.69 1 1 0 0 1 1 6.30E+03 NF 3.30E+04 yfbT 23.04 1 1 0 0 2 2 6.20E+03 NF 3.30E+04 rpsT 9.68 0 0 0 0 1 1 NF NF 3.20E+04 gmk 23.58 0 0 0 0 1 1 NF NF 3.00E+04 rarA 49.6 0 0 0 0 1 1 NF NF 2.90E+04 murB 37.83 0 0 0 0 1 1 NF NF 2.90E+04 mog 21.22 0 0 0 0 1 1 NF NF 2.90E+04 trmD 28.4 0 0 0 0 2 2 NF NF 2.80E+04 dnaB 52.36 1 1 0 0 1 1 6.60E+03 NF 2.80E+04 hybC 62.42 0 0 0 0 1 1 NF NF 2.70E+04 topB 73.28 0 0 0 0 1 1 NF NF 2.70E+04 rpoN 53.96 0 0 0 0 1 1 NF NF 2.60E+04 yaeT 90.5 5 6 0 0 1 1 9.70E+04 NF 2.60E+04 selA 50.66 0 0 0 0 1 1 NF NF 2.50E+04 poxB 62 0 0 0 0 1 1 NF NF 2.40E+04 slyB 15.62 0 0 0 0 1 1 NF NF 2.30E+04 talA 35.64 0 0 0 0 1 1 NF NF 2.10E+04 narH 58.04 0 0 0 0 1 1 NF NF 2.00E+04 yral 31.44 0 0 0 0 1 1 NF NF 2.00E+04 lplA 37.86 0 0 0 0 1 1 NF NF 2.00E+04 entF 141.83 0 0 0 0 1 1 NF NF 2.00E+04 ybeA 17.33 0 0 0 0 1 1 NF NF 1.90E+04 rlmG 42.29 0 0 0 0 1 1 NF NF 1.90E+04 eutB 49.37 0 0 0 0 1 1 NF NF 1.90E+04 ttcA 35.46 0 0 0 0 1 1 NF NF 1.80E+04 hchA 31.22 1 1 0 0 1 1 1.10E+04 NF 1.80E+04 LF82_089 122.09 0 0 0 0 1 1 NF NF 1.70E+04 nudE 21.08 0 0 0 0 1 1 NF NF 1.60E+04 metN 37.84 1 1 0 0 1 1 1.30E+04 NF 1.60E+04 pepP 49.75 2 2 0 0 1 1 1.70E+05 NF 1.50E+04 hrpA 148.9 1 1 0 0 1 1 1.00E+04 NF 1.30E+04 glgP 93.14 0 0 0 0 1 1 NF NF 1.20E+04 ubiD 55.52 1 1 0 0 1 1 8.20E+03 NF 1.20E+04 pdhR 29.41 0 0 0 0 1 1 NF NF 1.10E+04 ydiE 7.1 0 0 0 0 1 1 NF NF 1.10E+04 grxA 9.66 1 1 0 0 1 1 4.40E+04 NF 1.10E+04 aroB 38.83 0 0 0 0 1 1 NF NF 9.80E+03

yaeH 15.09 0 0 0 0 1 1 NF NF 9.80E+03 sdaA 48.88 0 0 0 0 1 1 NF NF 9.60E+03 leuB 39.51 0 0 0 0 1 1 NF NF 9.00E+03 metC 43.17 0 0 0 0 1 1 NF NF 8.30E+03 tktB 73.01 0 0 0 0 1 1 NF NF 6.30E+03 ksgA 30.32 0 0 0 0 1 1 NF NF 6.10E+03 amn 58.27 0 0 0 0 1 1 NF NF 6.00E+03 rtcA 35.97 0 0 0 0 1 1 NF NF 0.00E+00 Table 6: Complete Mass Spectrometry Data, Nf = Not found.

Appendix III: Materials

0.2 am Syringe Filter (VWR, 28145-477) 10 ml Syringe (Fisher Scientific, B302995) 30% acrylamids (National Diagnostics, EC-890) 4-20% Tris-Glycine Gels (Invitrogen, XP04200BOX) Acetic Acid (Fisher Scientific, A38212) Agarose LE (BioExcell, A-1701) Aluminium Sulfate Octadecahydrate (Fisher Scientific, AC123680010) Amicon Ultra 0.5 mL filter 3K (Fisher Scientific, UFC500324) Ammonium chloride (Fluka, 09700) Ampicillin (Amresco, 0339-25G) Anti-Mouse Secondary Antibody (Li-Cor, 926- 32213) Anti-Rabbit Secondary Antibody (Li-Cor, 926-32213) Anti-Ribosome Antibody (Santa Cruz Biotech (b subunit: 8RB13, b0 subunit: NT73) BacTiter Glow Microbial Cell Viability Assay (Promega, G8230) Bacto Agar (BD, 214010) Bacto Casamino Acids (Difco, 0230-01-1) Bacto Yeast Extract (BD, 212750) Benzonase Nuclease (Sigma Aldrich, E1014-25ku) Black 96 well plate (Fisher Scientific, 12-566-72) Calcium Chloride (Fluka, 21079) CAPS (Fisher Scientific, AC17262-1000) Centrifuge Tubes (Genesee Scientific) Coomassie Brilliant Blue G-250, MP BiomedicalsTM (Fisher Scientific, 808274) Deoxynucleotides (New England BioLabs, N0447S) Desthiobiotin (Sigma Aldrich, D1411-500mg) Dextrose (Fisher Chemicals, D16-3) Disposable plastic cuvettes (Fisher Scientific, 14-955-127) DMSO (Thermo Scientific, F-515) Dry Milk (Stop and Shop, 6 88267 07113 3) DryEase® Mini Cellophane (Life Technologies, NC2380) DryEase™ Mini-Gel Drying System (Invitrogen, NI2387) E. coli anti-IMPDH rabbit antibody (21st Century Biochemical, P2752) Electroporation Cuvettes 2mm Gap (Fisher Scientific, FB102) Eppendorf Tubes (Genesee Scientific) Ethanol (Fisher Scientific, B2801) Ethidium Bromide (Sigma Chemical Company, E-7637) Ethylenediamine Tetraacetic Acid, Disodium Salt Dihydrate (Fisher Scientific, S311-500) EZ-10 Spin Column Plasmid DNA miniprep Kit (Bio Basic, BS414-100Preps) Falcon™ Polystyrene Microplates (Fisher Scientific, 08-772-53) Gel Loading Tips (Genesee Scientific, 14-101) Glycerol (Sigma Aldrich, G6279-4L) HABA (MP Biomedicals, 02101912)

Hydrochloric Acid (Fisher Scientific, A144212) Kanamycin Sulfate (Fisher Scientific, BP906-5) Lysozyme, Chicken Egg White (EMD Millipore, 4403-1GM) Magnesium Sulfate Heptahydrate (Sigma-Aldrich, M7774-1KG) Methanol (Fisher Scientific, A452-4) NWSHPQFEK Antibody, pAb, Rabbit (GenScript USA, A00626-40) O-Phosphoric Acid, 85% (Fisher Scientific, A242-212) Olympus Ergonomic Pipet tips (Genesee Scientific) Parafilm (VWR, 470152-246) Paraformaldehyde (Sigma Aldrich, 158127) PCR Tubes (USA Scientific, 1402-4700) pH meter (Thermo Scientific: unit, ORION 2 STAR; probe, ORION 81038N filling solution, ROSS ORION 810007; pH 4 standard, SB98-1; pH 7 standard, VWR 34170-130; pH 10 standard, SN116-500; storage buffer, ORION 910001) Pierce™ Protease Inhibitor Mini Tablets, EDTA Free (Fisher Scientific, 88666) Phusion HF buffer (Thermo Scientific, F-518) Phusion Hot Start II (Thermo Scientific, F-549S) Pipette Filter Tips (VWR) Poly-Prep Chromatography Columns (BioRad, 7311550) Potassium Phosphate Dibasic Anhydrous (Fisher Scientific, p290-500) Primers (IDTDNA) Proteinase K (New England Biolabs, P8107S) Purified anti-E.coli RNA Polymerase β antibody (Biolegend, 663905) PVDF membrane (Amersham, 10600023) Semi-Dry Transfer Apparatus (Thermo Scientific, OWL HEP-1) Serological Pipets (WorldWide Life Science and Genesee Scientific) Silver Nitrate (Sigma Aldrich, 209139-25g) Sodium Chloride (Fisher, S271-10) Sodium Dodecyl Sulfate (Fisher Scientific, BP166-500) Sodium Hydroxide (Fisher Sci- entific, BP359-212) Sodium Phosphate Dibasic Heptahydrate (Acros, AC206515000) Steriflip® 50 ml vacuum filtration system with 0.22µm filter (Millipore, SCGP00525) Sterile H2O (Fisher BioReagents, EC 231-791-2) Strep-Tactin® Superflow® 50% suspension ( IBA, NC0020850) Thermal Cycler (Bio-Rad, S1000) Tris base (Acros Organics, 140500100) Tryptone (Fisher Scientific, BP1421- 500) Tween R 20 (Sigma Aldrich, P1379-1L) VWR® Disposable Pipetting Reservoirs 25ml (VWR, 89094-662) Western Blotting Filter Paper (Thermo Scientific, pi-88600) Wizard® SV Gel and PCR Clean-up System (VWR, A9282)

References

1. Morrison, H. G., McArthur, A. G., Gillin, F. D., Aley, S. B., Adam, R. D., Olsen, G. J., Best, A. A., Cande, W. Z., Chen, F., Cipriano, M. J., Davids, B. J., Dawson, S. C., Elmendorf, H. G., Hehl, A. B., Holder, M. E., Huse, S. M., Kim, U. U., Lasek- Nesselquist, E., Manning, G., Nigam, A., Nixon, J. E., Palm, D., Passamaneck, N. E., Prabhu, A., Reich, C. I., Reiner, D. S., Samuelson, J., Svard, S. G., and Sogin, M. L. (2007) Genomic minimalism in the early diverging intestinal parasite Giardia lamblia. Science 317, 1921-1926 2. Carlton, J. M., Hirt, R. P., Silva, J. C., Delcher, A. L., Schatz, M., Zhao, Q., Wortman, J. R., Bidwell, S. L., Alsmark, U. C., Besteiro, S., Sicheritz-Ponten, T., Noel, C. J., Dacks, J. B., Foster, P. G., Simillion, C., Van de Peer, Y., Miranda-Saavedra, D., Barton, G. J., Westrop, G. D., Müller, S., Dessi, D., Fiori, P. L., Ren, Q., Paulsen, I., Zhang, H., Bastida-Corcuera, F. D., Simoes-Barbosa, A., Brown, M. T., Hayes, R. D., Mukherjee, M., Okumura, C. Y., Schneider, R., Smith, A. J., Vanacova, S., Villalvazo, M., Haas, B. J., Pertea, M., Feldblyum, T. V., Utterback, T. R., Shu, C. L., Osoegawa, K., de Jong, P. J., Hrdy, I., Horvathova, L., Zubacova, Z., Dolezal, P., Malik, S. B., Logsdon, J. M., Henze, K., Gupta, A., Wang, C. C., Dunne, R. L., Upcroft, J. A., Upcroft, P., White, O., Salzberg, S. L., Tang, P., Chiu, C. H., Lee, Y. S., Embley, T. M., Coombs, G. H., Mottram, J. C., Tachezy, J., Fraser-Liggett, C. M., and Johnson, P. J. (2007) Draft genome sequence of the sexually transmitted pathogen Trichomonas vaginalis. Science 315, 207-212 3. Bzowska, A., Kulikowska, E., and Shugar, D. (2000) Purine nucleoside phosphorylases: properties, functions, and clinical aspects. Pharmacol Ther 88, 349-425 4. Jackson, R. C., Weber, G., and Morris, H. P. (1975) IMP dehydrogenase, an enzyme linked with proliferation and malignancy. Nature 256, 331-333 5. Ratcliffe, A. J. (2006) Inosine 5'-monophosphate dehydrogenase inhibitors for the treatment of autoimmune diseases. Curr Opin Drug Discov Devel 9, 595-605 6. Hedstrom, L., Liechti, G., Goldberg, J. B., and Gollapalli, D. R. (2011) The antibiotic potential of prokaryotic IMP dehydrogenase inhibitors. Curr Med Chem 18, 1909-1918 7. Kanehisa, M., and Goto, S. (2000) KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res 28, 27-30 8. Kanehisa, M., Goto, S., Sato, Y., Kawashima, M., Furumichi, M., and Tanabe, M. (2014) Data, information, knowledge and principle: back to metabolism in KEGG. Nucleic Acids Res 42, D199-205 9. Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng, E. C., and Ferrin, T. E. (2004) UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem 25, 1605-1612 10. Bateman, A. (1997) The structure of a domain common to archaebacteria and the homocystinuria disease protein. Trends Biochem Sci 22, 12-13 11. Ignoul, S., and Eggermont, J. (2005) CBS domains: structure, function, and pathology in human proteins. Am J Physiol Cell Physiol 289, C1369-1378 12. Baykov, A. A., Tuominen, H. K., and Lahti, R. (2011) The CBS domain: a protein module with an emerging prominent role in regulation. ACS Chem Biol 6, 1156-1163

13. Estévez, R., Pusch, M., Ferrer-Costa, C., Orozco, M., and Jentsch, T. J. (2004) Functional and structural conservation of CBS domains from CLC chloride channels. J Physiol 557, 363-378 14. Scott, J. W., Hawley, S. A., Green, K. A., Anis, M., Stewart, G., Scullion, G. A., Norman, D. G., and Hardie, D. G. (2004) CBS domains form energy-sensing modules whose binding of adenosine ligands is disrupted by disease mutations. J Clin Invest 113, 274-284 15. Buey, R. M., Ledesma-Amaro, R., Velázquez-Campoy, A., Balsera, M., Chagoyen, M., de Pereda, J. M., and Revuelta, J. L. (2015) Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases. Nat Commun 6, 8923 16. Nimmesgern, E., Black, J., Futer, O., Fulghum, J. R., Chambers, S. P., Brummel, C. L., Raybuck, S. A., and Sintchak, M. D. (1999) Biochemical analysis of the modular enzyme inosine 5'-monophosphate dehydrogenase. Protein Expr Purif 17, 282-289 17. Gan, L., Petsko, G. A., and Hedstrom, L. (2002) Crystal structure of a ternary complex of Tritrichomonas foetus inosine 5'-monophosphate dehydrogenase: NAD+ orients the active site loop for catalysis. Biochemistry 41, 13309-13317 18. Mortimer, S. E., and Hedstrom, L. (2005) Autosomal dominant retinitis pigmentosa mutations in inosine 5'-monophosphate dehydrogenase type I disrupt nucleic acid binding. Biochem J 390, 41-47 19. Bowne, S. J., Sullivan, L. S., Blanton, S. H., Cepko, C. L., Blackshaw, S., Birch, D. G., Hughbanks-Wheaton, D., Heckenlively, J. R., and Daiger, S. P. (2002) Mutations in the inosine monophosphate dehydrogenase 1 gene (IMPDH1) cause the RP10 form of autosomal dominant retinitis pigmentosa. Hum Mol Genet 11, 559-568 20. Bowne, S. J., Sullivan, L. S., Mortimer, S. E., Hedstrom, L., Zhu, J., Spellicy, C. J., Gire, A. I., Hughbanks-Wheaton, D., Birch, D. G., Lewis, R. A., Heckenlively, J. R., and Daiger, S. P. (2006) Spectrum and frequency of mutations in IMPDH1 associated with autosomal dominant retinitis pigmentosa and leber congenital amaurosis. Invest Ophthalmol Vis Sci 47, 34-42 21. Kennan, A., Aherne, A., Palfi, A., Humphries, M., McKee, A., Stitt, A., Simpson, D. A., Demtroder, K., Orntoft, T., Ayuso, C., Kenna, P. F., Farrar, G. J., and Humphries, P. (2002) Identification of an IMPDH1 mutation in autosomal dominant retinitis pigmentosa (RP10) revealed following comparative microarray analysis of transcripts derived from retinas of wild-type and Rho(-/-) mice. Hum Mol Genet 11, 547-557 22. Zhang, R., Evans, G., Rotella, F. J., Westbrook, E. M., Beno, D., Huberman, E., Joachimiak, A., and Collart, F. R. (1999) Characteristics and crystal structure of bacterial inosine-5'-monophosphate dehydrogenase. Biochemistry 38, 4691-4700 23. McLean, J. E., Hamaguchi, N., Belenky, P., Mortimer, S. E., Stanton, M., and Hedstrom, L. (2004) Inosine 5'-monophosphate dehydrogenase binds nucleic acids in vitro and in vivo. Biochem J 379, 243-251 24. Mortimer, S. E., Xu, D., McGrew, D., Hamaguchi, N., Lim, H. C., Bowne, S. J., Daiger, S. P., and Hedstrom, L. (2008) IMP dehydrogenase type 1 associates with polyribosomes translating rhodopsin mRNA. J Biol Chem 283, 36354-36360 25. Ho, Y., Gruhler, A., Heilbut, A., Bader, G. D., Moore, L., Adams, S. L., Millar, A., Taylor, P., Bennett, K., Boutilier, K., Yang, L., Wolting, C., Donaldson, I., Schandorff, S., Shewnarane, J., Vo, M., Taggart, J., Goudreault, M., Muskat, B., Alfarano, C., Dewar,

D., Lin, Z., Michalickova, K., Willems, A. R., Sassi, H., Nielsen, P. A., Rasmussen, K. J., Andersen, J. R., Johansen, L. E., Hansen, L. H., Jespersen, H., Podtelejnikov, A., Nielsen, E., Crawford, J., Poulsen, V., Sørensen, B. D., Matthiesen, J., Hendrickson, R. C., Gleeson, F., Pawson, T., Moran, M. F., Durocher, D., Mann, M., Hogue, C. W., Figeys, D., and Tyers, M. (2002) Systematic identification of protein complexes in Saccharomyces cerevisiae by mass spectrometry. Nature 415, 180-183 26. Krogan, N. J., Peng, W. T., Cagney, G., Robinson, M. D., Haw, R., Zhong, G., Guo, X., Zhang, X., Canadien, V., Richards, D. P., Beattie, B. K., Lalev, A., Zhang, W., Davierwala, A. P., Mnaimneh, S., Starostine, A., Tikuisis, A. P., Grigull, J., Datta, N., Bray, J. E., Hughes, T. R., Emili, A., and Greenblatt, J. F. (2004) High-definition macromolecular composition of yeast RNA-processing complexes. Mol Cell 13, 225-239 27. Uetz, P., Giot, L., Cagney, G., Mansfield, T. A., Judson, R. S., Knight, J. R., Lockshon, D., Narayan, V., Srinivasan, M., Pochart, P., Qureshi-Emili, A., Li, Y., Godwin, B., Conover, D., Kalbfleisch, T., Vijayadamodar, G., Yang, M., Johnston, M., Fields, S., and Rothberg, J. M. (2000) A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae. Nature 403, 623-627 28. Kozhevnikova, E. N., van der Knaap, J. A., Pindyurin, A. V., Ozgur, Z., van Ijcken, W. F., Moshkin, Y. M., and Verrijzer, C. P. (2012) Metabolic enzyme IMPDH is also a transcription factor regulated by cellular state. Mol Cell 47, 133-139 29. Pimkin, M., Pimkina, J., and Markham, G. D. (2009) A regulatory role of the Bateman domain of IMP dehydrogenase in adenylate nucleotide biosynthesis. J Biol Chem 284, 7960-7969 30. Pimkin, M., and Markham, G. D. (2008) The CBS subdomain of inosine 5'- monophosphate dehydrogenase regulates purine nucleotide turnover. Mol Microbiol 68, 342-359 31. Grenier, F., Matteau, D., Baby, V., and Rodrigue, S. (2014) Complete Genome Sequence of Escherichia coli BW25113. Genome Announc 2 32. Dang, Y. (2014) IMPDH forms complexes with RNA polymerase and ribosome. Master's Thesis, Department of Chemistry, Brandeis University 33. Wang, X. (2014) Lysine acetylation and moonlighting functions of IMP dehydrogenase CBS domain. Senior Honor's Thesis, Department of Biology, Brandeis University 34. Kats, D. (2016) Inosine 5’-monophosphate dehydrogenase: A collection of mysterious binding sites and regulation. Senior Honor's Thesis, Bachelor of Science, Brandeis University 35. Datsenko, K. A., and Wanner, B. L. (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97, 6640-6645 36. Hoffman, E. A., Frey, B. L., Smith, L. M., and Auble, D. T. (2015) Formaldehyde crosslinking: a tool for the study of chromatin complexes. J Biol Chem 290, 26404-26411 37. Sutherland, B. W., Toews, J., and Kast, J. (2008) Utility of formaldehyde cross-linking and mass spectrometry in the study of protein-protein interactions. J Mass Spectrom 43, 699-715 38. Eaves, G. N., and Jeffries, C. D. (1963) Isolation and Properties of an Exocellular Nuclease of Serratia Marcescens. J Bacteriol 85, 273-278