University of Florida Thesis Or Dissertation Formatting

AAA ATPASE CDC48A AND ITS ASSOCIATION WITH UBIQUITIN-LIKE SAMP1 AND DNA REPAIR IN ARCHAEA

SWATHI DANTULURI

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2018

I dedicate this to my family and friends for their endless love, support and company.Everybody who has taken the time and energy to teach me everything small or big.

ACKNOWLEDGMENTS

During my graduate career at the University of Florida, there are many people to whom I will be eternally indebted to for supporting and advising me along the way.

Firstly, I would like to thank my advisor, Dr. Julie A. Maupin-Furlow for providing me the opportunity to work under her guidance as well as for all her help, advice, support, and encouragement throughout my time in her lab. I would also like to thank my committee members Dr. Sixue Chen, Dr.Tony Romeo and Dr. Nemat.O.Keyhani for their constructive advice and guidance.

I must also express my gratitude to all the past and current Maupin lab members with whom I developed a warm and friendly working relationship over time, especially

Dr. Nathaniel Hepowit who patiently taught me all the lab techniques, Dr. Xian Fu, Dr.

Lana J. McMillan, Dr. Shiyun Cao, Dr. Sungmin Hwang, Zachary Adams, Cuper

Ramirez, Paula Mondragon, and Jou Chin Chan. I also would like to thank all the undergraduate researchers in our lab for their dedication: Shae Marguiles, Sonam

Parag, Gayathri Srinivasan, and Whinkie Leung. I am grateful to our collaborator, Dr.

Thorsten Allers, for his generous contribution of strains to our lab and the field in general.

I express deep gratitude to my family, especially to my parents, Dantuluri Satya

Chandra Subrahmanya Varma, Dantuluri Kamala Devi and sister Dantuluri Sanjana

Varma, for their unconditional love and support. Last but not the least I would like to thank Rahul Babu Koneru for his time, company and feeding me while I wrote my dissertation.

TABLE OF CONTENTS

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES ...... 8

LIST OF FIGURES ...... 9

LIST OF ABBREVIATIONS ...... 11

ABSTRACT ...... 13

CHAPTER

1 LITERATURE REVIEW ...... 15

Introduction ...... 15 Cdc48 ...... 16 Structure Of Cdc48 ...... 17 Cdc48 Mediated Nucleotide Hydrolysis ...... 18 Surface only model ...... 19 D2 in-D2 out model ...... 20 Cdc48 Interacting Proteins ...... 21 Cdc48 Role In Cellular Processes ...... 22 Cdc48 In Protein Quality Control ...... 22 Other Cellular Processes...... 22 RecJ Exonucleases ...... 23 RecJ Characterized So Far ...... 24 E. coli RecJ ...... 24 Thermus thermophilus RecJ ...... 25 Deinococcus radiodurans RecJ ...... 26 Archaeal RecJ ...... 27 RNase J ...... 27 Objectives ...... 31

2 MATERIALS AND METHODS ...... 34

Chemicals, Strains and Growth Conditions ...... 34 Chemicals and Reagents ...... 34 Strains, Media and Conditions For Growth Assay ...... 34 DNA Manipulation ...... 34 Cloning ...... 34 DNA Electrophoresis ...... 35 Site-Directed Mutagenesis ...... 35 SDS-PAGE ...... 35

3 ROLE OF CDC48A IN ARCHAEAL DNA REPAIR ...... 39

Introduction ...... 39 Materials and Methods Used In This Study ...... 40 Purification Of SAMP1 ...... 40 Cell Lysate For SAMP1 Pull-Down Assay ...... 41 Coupling Of SAMP1 To Amine Reactive Beads ...... 42 SAMP1 Pull-Down Assay ...... 43 Mass Spectrometry ...... 43 Partner Protein Pull-Down Assays ...... 45 RNase J1 pull down assay ...... 45 RecJ 4 pull-down assay ...... 46 Cdc48A Pulldown Assay for Identification Of Protein Partners...... 46 Strep resin enrichment of Cdc48A ...... 46 Nickel column enrichment of Cdc48A ...... 47 Construction Of Substrate Trap Mutant Of Cdc48A ...... 47 qRT-PCR Analysis ...... 48 Growth Curves ...... 49 Results ...... 49 Cdc48A Forms An Apparent Complex With DNA Repair/Replication Proteins That Binds Ubiquitin-Like SAMP1 ...... 49 Partner Proteins Of Cdc48A, RecJ4 and RNase J1 ...... 50 The (QQ) Mutant Of Cdc48A Potentially Traps Protein Partners Due To Its Decreased Ability To Hydrolyze ATP ...... 51 DBeQ, A Cdc48-Specific Chemical Inhibitor, Slightly Impairs The Growth and Considerably Impairs The Pigmentation Of H. volcanii ...... 51 Mutation of cdc48a Renders H. volcanii Cells Sensitive To DNA Damage and Mutation of samp1 Renders Cells Resistant To DNA damage ...... 52 Transcript Levels Of cdc48a , recj and rnj1 Are Increased During Conditions Of DNA Damage ...... 53

4 BIOCHEMICAL CHARACTERIZATION OF CDC48 IN ARCHAEA ...... 75

Introduction ...... 75 Materials and Methods...... 76 Modelling and Alignment Of Cdc48A ...... 76 Cloning, Culture and Purification Of Cdc48A From H. volcanii ...... 76 Construction and Purification Of Substrate Trap Mutant Of Cdc48A ...... 78 ATPase Hydrolysis Activity Assay ...... 79 Peptide Hydrolysis Assay ...... 80 Results ...... 82 Cdc48A Is A Structural Homolog Of Eukaryotic Cdc48 With A Conservation In Key Amino Acid Residues ...... 82 Cdc48A Was Purified As A Homo Multimeric Complex ...... 82 Catalytic Activity Of Cdc48A Was Influenced By pH and Conserved Glutamate Residues In Walker B Motif ...... 83 Cdc48A Does Not Activate The 20S Proteasome Mediated Cleavage Of The Substrate Suc-LLVY-AMC ...... 83

5 SUMMARY CONCLUSIONS AND FUTURE DIRECTIONS ...... 94

Summary and Conclusion ...... 94 Future Directions ...... 98

LIST OF REFERENCES ...... 101

BIOGRAPHICAL SKETCH ...... 114

LIST OF TABLES

Table page 2-1 Plasmids and strains used in this study ...... 37

2-2 Primers used in this study ...... 38

3-1 Partner proteins identified from Strep-Cdc48A pull down ...... 70

3-2 H. volcanii Cdc48a-SAMP1 interactome detected by LC-MS/MS analysis ...... 71

3-3 Cdc48 protein partners/substrates of DNA repair in eukaryotes and their archaeal homologs ...... 74

4-1 Comparison of Vmax and Km values of AAA-ATPases...... 93

LIST OF FIGURES

Figure page 1-1 Cdc48 an ATP fueled molecular motor...... 33

3-1 Cdc48A forms an apparent thiol-sensitive complex with RecJ3/4 and RNase J1 homologs that associates with ubiquitin-like SAMP1 ...... 54

3-2 Cdc48A copurifies with its gene neighbor HVO_2381 (unknown function UPF0272 protein), Cdc48D (HVO_1907), and deoxyhypusine synthase (DHS)(HVO_2297) ...... 55

3-3 RNase J1, RecJ3 and Cdc48A copurify with RecJ4 from H. volcanii when supplemented with γATP ...... 56

3-4 RecJ4, RecJ3 and Cdc48A co-purify with RNase J1...... 57

3-5 cdc48a, rnj1 and recJ3 transcript levels are increased several-fold by treatment of cells with a DNA damaging agent ...... 58

3-6 Ectopic expression of Cdc48A promotes hypertolerance to UV stress ...... 59

3-7 Ectopic expression of Cdc48A promotes hypertolerance to DNA damage ...... 60

3-8 An H. volcanii Δsamp1 mutant (HM1041) shows resistance to phleomycin induced DNA damage...... 61

3-9 Chemical inhibitor of Cdc48-type ATPases slightly impairs growth and considerably impairs pigmentation of H. volcanii...... 62

3-10 Cdc48A substrate trap mutant QQ shows a noticeably different copurification profile ...... 63

3-11 Gene homologs of cdc48a and rada/b are in genomic synteny in Archaea ...... 64

3-12 Cdc48A and identification of potential partner and substrate proteins ...... 65

3-13 Proposed model of the role of Cdc48A from H. volcanii in DNA damage repair ...... 66

3-14 Structural model of HvRecJ3 compared to x-ray crystal structure of the active site of the Thermus thermophilus RecJ exonuclease ...... 67

3-15 Structural model of HvRecJ4 compared to x-ray crystal structure of the active site of the Thermus thermophilus RecJ exonuclease ...... 68

3-16 Structural model of H. volcanii RNase J compared to x-ray crystal structure of the active site of the B. subtilis RNase J1 ...... 69

4-1 Cdc48A is a structural homolog of well characterized mammalian Cdc48 (PDB:5C19) ...... 85

4-2 Cdc48A from H. volcanii shows conservation of key residues with other AAA ATPases ...... 86

4-3 The N-His6 tagged Cdc48A protein purification from H. volcanii ...... 87

4-4 Cdc48A was purified as a multimeric complex...... 88

4-5 Cdc48A ATPase activity as a function of temperature...... 89

4-6 Effect of pH on the ATPase activity of Cdc48A...... 90

4-7 Substrate trap His6-Cdc48A(QQ) variant of Cdc48A shows decreased ATP hydrolysis activity...... 91

4-8 Cdc48A does not show any increase in proteasome mediated SUC-LLVY tetrapeptide hydrolysis ...... 92

LIST OF ABBREVIATIONS

AAA+ ATPase associated with diverse cellular activities

AFM Atomic Force Microscopy

AMC 7-Amino-4-Methylcoumarin

ATPγS Adenosine-5'-(γ-thio)-triphosphate tetralithium salt

Cm Chloramphenicol

CMG Cdc45, Mcm2–7, GINS

Cryo-EM Cryo electron microscopy

DBeQ N2,N4-bis(phenylmethyl)-2,4-quinazolinediamine

DBeQ N2,N4-dibenzylquinazoline-2,4-diamine

DHS Deoxyhypusine synthase

DSB Double-strand breaks dTMP deoxythymidine monophosphate

ER Endoplasmic reticulum

ERAD Endoplasmic-reticulum-associated protein degradation

GAN GINS associated nuclease

GINS go-ichi-ni-san

HbYX Hb-Hydrophobic residue / Y-Tyrosine / X-is any residue

Km Kanamycin

LB Leuria Bertani

MAD Mitochondria associated protein degradation

MMS Methyl Methane sulfonate

Nv Novobiocin

PAN Proteasome Associated Nucleotidase

PQC Protein Quality Control

SAXS Small-angle X-Ray scattering

SDS Sodium Dodecyl Sulphate

SRH Second Region of Homology

SSB Single-strand DNA-binding protein

T.acidophilum Thermoplasma acidophilum

TCEP Tris (2-carboxyethyl) phosphine

VAT VCP like ATPase in Thermoplasma

VCP Valosin Containing Protein precursor

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

AAA ATPASE CDC48A AND ITS ASSOCIATION WITH UBIQUITIN-LIKE SAMP1 AND DNA REPAIR IN ARCHAEA

Swathi Dantuluri

December 2018

Chair: Julie Maupin-Furlow Major: Microbiology and Cell Science

Cdc48-type AAA+ ATPases convert chemical energy from the hydrolysis of ATP into the mechanical energy needed to unfold proteins and dislodge proteins from complexes. The conserved Walker B residues (Glu290 Glu563) are important for ATP hydrolysis. Cdc48 functions in DNA repair, but the mechanism is not fully understood in eukaryotes nor studied in archaea. Here we provide the first evidence that Cdc48 functions in DNA repair in archaea based on study of Cdc48A from Haloferax volcanii.

Mutation of cdc48a is found to render cells hypersensitive to the DNA damaging agents phleomycin and UV light. Cdc48A is shown to co-purify with RecJ-domain (RecJ3 and

RecJ4) and RNase J1 homologs in an apparent thiol sensitive complex that binds the oxidative stress-responsive, ubiquitin-like SAMP1 in the presence of ATP. Affinity tag swapping provides further support for the association of Cdc48A with components of

DNA replication/repair. Cdc48A is also found to physically interact with UPF0272 family protein HVO_2381 (encoded by a gene neighbor of cdc48a), Cdc48D (a related

ATPase) and deoxyhypusine synthase (DHS), the latter of which is known to function in

hypusination of initiation factor 5A (eIF5A) to resolve ribosomal stalling. Cdc48A RNase

J1 and RecJ3 transcript levels are also shown to increase several-fold after treatment with the DNA damaging agent phleomycin. Thus, archaeal Cdc48A is a AAA-ATPase that is physically and genetically associated with DNA replication/repair pathways.

CHAPTER 1 LITERATURE REVIEW

Introduction

In 1977 Carl Woese altered one of the major dogmas of biology by proposing that there are in fact three divisions of life (1). Archaea, which were previously thought to be extremophilic bacteria, was the new division that was added to the previously established domains bacteria and eukaryotes (2) .Since then studies have been carried out to understand cellular mechanisms in archaea. Archaea are now known to survive in a diverse range of environments, ranging from hot water vents, human gut microbiota to salt water lakes (3). Inorder to maintain their genomic integrity, which is key to survival and fitness of an organism, archaea had to develop DNA repair mechanisms, which are predicted to be a unique chimera of eukaryotic and bacteria DNA repair mechanisms

(4). A majority of archaea live in extreme environments and are subjected to a significant amount of DNA damage (5). The mechanisms of DNA repair are not well understood in archaea. Advances in the field of archaeal DNA repair have been made in the last few years by sequencing of archaeal genomes. With recent advances in genomics, coupled with biochemical and structural studies in archaea, insights into the individual DNA repair proteins and the role they play in DNA repair pathways in archaea have been achieved.

Based on DNA repair systems studied in model archaea from Halophiles

(Halobacterium salinarum, Haloferax volcanii), Methanogens e.g (Methanothermobacter thermautotrophicus), Sulfolabales and Thermococcales, Archaea are predicted to have chimeric DNA repair pathways (4). Genomic surveys from the model archaea identified enzymes involved in aspects of base excision repair (BER), nucleotide excision repair

(NER), mismatch repair (MMR) and homologus recombination (HR). The enzymes that are identified in DNA repair so far are predominantly nucleases, DNA polymerases, helicases and DNA remodeling ATPases (4). Of the enzymes identified in the different

DNA repair pathways in archaea some are bacteria like (MutS, MutL, UvrA, UvrB, UvrC and RecJ) (4) some are eukaryotic like (Mre11-Rad50, EndoMS, XPB, XPD, XPF,

Bax1, RPA) (6) and they are also some that are only unique to archaea (crenarchaeal system for exchange of DNA: CedA and CedB) (7).

Very little is known about DNA damage repair regulation in archaea. Ubiquitin and Ub-like proteins in association with Cdc48 are reported to regulate DNA damage responses in eukaryotes.by extracting chromatin/DNA bound proteins. Removal of bound proteins from damaged DNA is necessary for recruitment of DNA repair machinery resulting in efficient DNA damage repair (8). Ubiquitin modified substrates are remodeled by ATPase activity of Cdc48 (9). Small archaeal modifier proteins

(SAMP) are archaeal homologs of ubiquitin (10). Homologs of eukaryotic Cdc48 are also distributed across archaea. The role of SAMP and archaeal Cdc48 in regulating

DNA damage response in archaea and the mechanism of the regulation is an area that requires further exploration.

Cdc48

Cdc48 is an abundant cytosolic ATPase which is highly conserved from archaea to eukaryotes (11, 12). This ATPase is referred to as Cdc48 in Saccharomyces cerevisiae, p97 in mammals due to the 97 kDa size or VCP (valosin containing protein precursor) (13). In Drosophila, It is referred to as TER ATPase (transitional endoplasmic reticulum ATPase) due to its localization on the surface of the endoplasmic reticulum

(14) and CDC-48 in Caenorhabditis elegans (15). In this literature review, unless otherwise mentioned, Cdc48 refers to all of the eukaryotic homologs of Cdc48. The only homolog of Cdc48 to be studied so far in archaea is referred to as VAT (VCP like

ATPase in Thermoplasma) from a hyperthermophilic archaeon Thermoplasma acidophilum (16). Cdc48 belongs to an AAA+ ATPase super-family of proteins (ATPase associated with diverse cellular activities). The members of this superfamily share a conservation in amino acid residues but exhibit functional diversity (17). Members of this family are reported to be involved in energy dependent remodeling of their macromolecular substrates (16).

Structure Of Cdc48

The eukaryotic Cdc48 protein and its homologs are reported to form a homohexameric ring structure (18-20). The individual monomers, also referred to as protomers, are made up of an N-terminal domain, N-D1 linker, D1-domain, D1-D2 linker, D2 domain and a C-terminal domain. Structurally, the N-terminal domain of

Cdc48 is observed to interact with a majority of its partner proteins (17). However, the

C-terminal domain of the Cdc48 is also reported to interact with certain partner proteins

(21, 22). D1 and D2 domains are the ATPase domains, they are involved in nucleotide binding and hydrolysis (23). The D1 and D2 ATP hydrolytic domains contain conserved

Walker A motif, Walker B motif, arginine finger residues (R359 and R635) and a second region of homology (SRH) (24). The Walker A motif [P-loop, G(x)4GKT, x is any residue] serves in nucleotide binding, while the Walker B motif (hhhhDE, h represents hydrophobic residues) facilitates hydrolysis of ATP (17). The Conserved arginine finger residues promote hydrolysis of ATP through its interaction with the Ɣ- phosphate of ATP

(25). The second region of homology (SRH) is necessary for efficient hydrolysis of ATP

(17, 22). The C-terminal of certain Cdc48 homologs have a HbYX (Hb refers to hydrophobic, Y is tyrosine, X is any residue) motif . The HbYX motif is also found in the

19S regulatory subunits of the proteasome in eukaryotes and Proteasome Associated

Nucleotidase (PAN) in archaea , both of which dock with the α subunit of the 20S core particle of the proteasome (26). Based on the reported role of HbYX motif containing proteins (PAN, Rpt1-6 of the 19S proteasome) and a study where in Cdc48 from hyperthermophilic archaeon T. acidophilum with conserved HbYX motif was demonstrated to collaborate with the proteasome in peptide hydrolysis. The C terminal

HbYX is suggested to be involved in interacting with 20S subunit of the proteasome, facilitating hydrolysis of peptides through gate opening. Gate opening of the 20S subunit of the proteasome results in enhanced translocation and cleavage of the substrate proteins (26).

Cdc48 Mediated Nucleotide Hydrolysis

Cdc48 and its homologs exhibit an indispensable ATP hydrolysis activity in all the cellular functions (proteasomal mediated degradation, regulation of gene expression, chromatin remodeling, autophagy etc) that it is reported to be involved in so far (17).

Cdc48 assembles into a homohexameric ring structure, where its six monomers are arranged around the central pore (21). The D1 and the D2 domains form a stacked ring and the N-terminal domain is laterally placed on the top of the D1 domain (24). The hexamerization of Cdc48 is dependent upon ATP and the D1 domain .The rate of hexamerzation is dependent on the concentration of nucleotides bound to the D1 domain (27). By utilizing ATPase domain specific inhibitors and site directed mutations in the ATPase domains of Cdc48 the D2 domain of Cdc48 is reported to be predominantly involved in ATP hydrolysis, where as the D1 domain contributes to a

lesser extent (30%) to its total ATPase activity (22) and is pre-bound to ADP (28). The order of binding and hydrolysis of nucleotides to the D1 and D2 domains is still not clear; however, rotation of the N-D1 and D2 rings upon nucleotide hydrolysis have been consistently reported in multiple studies (17, 29, 30). Reduction in the axial opening of the D2 ring is another conformational change reported upon the release of the phosphate group after nucleotide hydrolysis. The N-terminal domain also is suggested to be ordered after the release of phosphate group, however the N-terminal domain structure of Cdc48 can only be clearly visualized in the ADP bound state and the structure resolution is low in Cdc48 alone and the ATP bound form of Cdc48 (31). All of the studies carried out so far agree that hydrolysis of ATP results in conformational changes in the hexameric structure of Cdc48. The disagreement lies in the precise mechanism behind these conformational changes and the ability to transform chemical energy (ATP hydrolysis) into a force sufficient to remodel its substrates. To understand the mechanism behind the conformational change that facilitates protein remodeling, studies have been conducted on the eukaryotic homologs of Cdc48, using structure based techniques like X-Ray crystollagraphy, Cryo-EM, high speed Atomic Force

Microscopy (AFM) (30), Small-angle X-Ray scattering (SAXS) (17, 32). From these structural studies two models emerge 1) Surface only model 2) D2 in D2 out model.

Identification and characterization of a Cdc48 homologue, VAT in archaea led to identification of a previously unreported split ring confirmation which generates force for the substrate protein to be threaded through the D1 ring.

Surface only model

The surface only model posits that the conformational changes in the N-terminal domain along with that of D1 and D2 that accrue upon ATP hydrolysis are sufficient to

remodel (extract and segregate) the substrate protein. This protein remodeling of substrate occurs on the surface of the N domain of the homohexameric ring of Cdc48 due to conformational changes with in the domain (30, 33-35). The domain movements in D1 and D2 have been reported reproducibly by multiple studies at a high resolution; however the movement of N domain is reported at a low resolution due to the inherent flexibility of this domain (17). Thus the surface only model , while still a probability is not a certainity.

D2 in-D2 out model

The D2 in D2 out model proposes that the protein substrates enter into the

Cdc48 hexamer through the proximal end of the D2 pore and are threaded out through the distal end of the D2 pore. This model is based on the reported opening and closing of the D2 pore.The change in diameter of the axial D2 pore coupled with inter domain rotation of the D1 and D2 rings as a result of ATP hydrolysis, act as a force generator to thread a substrate protein (31, 32). Mechanism of threading substrates through its central pore is reported in other AAA+ATPases like ClpA and ClpX, which provides the basis for the threading model as a possibility in Cdc48 (17).

Based on the studies in VAT of the T. acidophilum VAT (36), a split-ring like conformation is reported for ths archaeal Cdc48 homolog in place of the traditional inter domain rotation reported in the eukaryotic homologues of Cdc48. Split-ring like confirmation is a result of distortion of the central ring around which the VAT monomers assemble upon hydrolysis of ATP. The distortion of the central pore in VAT due to nucleotide hydrolysis results in a force necessary to thread substrate proteins through its central pore (17, 36). The conserved residues (KYYG) interacting with protein substrates are found in the D1 ring of VAT. The residues are also conserved in other

AAA+ ATPase’s like Clpx, ClpA that are known to unfold substrates through threading mechanism. It is suggested that the archaeal homolog of the eukaryotic Cdc48:VAT remodels its substrates by threading its through the central pore (37). Based on the available literature and experimental evidence, it is possible that eukaryotic Cdc48 homologs may have evolved into a surface only model due to loss of the conserved aromatic residues in their D1 ring.

Cdc48 Interacting Proteins

The role of Cdc48 in multiple metabolic pathways (protein degradation, gene expression regulation, autophagy and DNA repair) is due to its ability to interact with multiple partner proteins (17). Thus, at any given time in a cell, Cdc48 could be found in complex with different partner proteins, contributing to different cellular processes.

Interacting protein partners of Cdc48 can be characterized into adaptor proteins and cofactors (38-40).The adaptor proteins link the Cdc48 to a specific substrate protein in a particular cellular location (41), the cofactors are essentially enzymes (glycanases, ubiquitin ligases and deubiquitinases) which alter the posttranslational modifiers found on the substrate proteins of Cdc48 (17). The majority of the partner proteins of Cdc48 are found to interact with the N-terminal domain of Cdc48 with the exception of (Ufd3,

Peptide N Glycosidase) reported to interact with the C-terminal domain of Cdc48.(42,

43). Analyzing the sequences of partner proteins of Cdc48 led to the identification of motifs necessary for Cdc48 binding. Motifs responsible for binding the N-terminal of

Cdc48 are UBX (44), UBX like, VIM (45), VBM and SHP (46). The motifs reported to involved in the C-terminal binding are PUL and PUB (38, 39).

Cdc48 Role In Cellular Processes

Cdc48 In Protein Quality Control

A well documented role of Cdc48 is in the protein quality control (PQC) pathways like endoplasmic reticulum (ER) associated protein degradation (ERAD) (47), mitochondria associated protein degradation (MAD) (48, 49) and degradation of nascent polypeptides from a stalled ribosome (mRNA surveillance) (17, 50, 51). Cdc48 participates in different cellular protein quality control pathways due to its ability to facilitate degradataion of aberrant ubiquitylated or sumolyated proteins by either releasing them from cellular structures (ER, mitochondria) or from large protein complexes (stalled ribosome).The ubiquitylated/sumolyated protein substrates extracted by Cdc48 from endoplasmic reticulum (ER), mitochondria and stalled ribosome are degraded by the proteasome (17). However, Cdc48 also extracts transcription factors from the membrane of the ER and subsequently transports these transcription factors into the nucleus where they regulate gene expression (52). Cdc48 is also reported to be involved in lysososome mediated degradation of unfolded protein substrates; however, the mechanism for this remains unclear (17, 53).

Other Cellular Processes

Cdc48 can also release ubiquitinated substrate proteins from the chromatin. The

Cdc48 extracted chromatin substrates vary in their function ranging from RNA polymerase (RNA Pol II) (50), DNA polymerase (54, 55), Cdc45-Mcm-GINS (CMG) helicase (56), proteins involved in DNA damage response (DDB2, XPC, Rad52 and

Ku70/80) (17, 57, 58). Identification of the polymerases and DNA repair proteins as substrates suggest that Cdc48 is also invoved in processes of the DNA damage response process. The substrates of Cdc48 extracted from chromatin are found to be

modified by ubiquitin or SUMO (Figure 1-1) (58). Some of the extracted substrates are recycled (59) while the others undergo proteasomal degradation. Based on the identification of interacting proteins with Cdc48 like endosome-associated antigen

(EEA1), clathirin and caveolin, Cdc48 is also suggested to be involved in receptor mediated endocytosis too (17, 60, 61).

RecJ Exonucleases

Orthologs of RecJ are found in eubacteria and archaea (62). RecJ is reported to be involved in excision of bases in the RecFOR pathway (63) and Methyl directed mismatched repair (MMR) of DNA damage response (64, 65). RecJ deletion mutants in

Escherchia coli exhibit a sensitivity to UV radiation, suggesting its role in UV induced

DNA repair (66). RecJ exonucleases show specificity to single stranded nucleotides and are metal ion dependent. The RecJ and RecJ like proteins belong to the superfamily of

DHH phosphodiesterases and are divided into four families. Family 1 constitutes the prokaryotic RecJ proteins (67) and eukaryotic Cdc45 protein (68). Family 2 contains nanoRNases (Nrn) that speciﬁcally degrade short single-stranded (ss) RNA molecule

(69). Family 3 contains proteins that degrade the nucleotide derivatives, this includes eukaryotic Prune (70) exopolyphosphatase of Saccharomyces cereviseae PPX1 (71) and prokaryotic family II inorganic pyrophosphatase (72). Family 4 contains HAN nuclease, which is a fused protein specific to archaea, these proteins contain an N- terminal domain and the C-terminal DHH phosphodiesterase domain (73). Bacterial Rec

J domain proteins are well studied with high resolution crystal structure’s now available for (Thermus thermophilus, Deinococcus radiodurans) PDB:2ZXP, PDB:5F54 (74, 75).

Based on the available structures of bacterial RecJ a conserved domain organization is observed. The N terminus of RecJ has a conserved DHH domain followed by DHHA1

domain. A long helix interconnects the DHH and DHHA1 domains and together this constitutes the N terminal catalytic core of the protein. The C terminus contains an OB- fold which is comprised of 5 beta strands interspersed by an alpha helix. The C terminal

OB-fold domain is important in binding to the nucleotides which are substrates for exonucleases. The RecJ from E. coli, T. thermophilus and D. radiodurans are well studied, with extensive biochemical and structure data available for them, thus providing insight into their mechanism.

RecJ Characterized So Far

E. coli RecJ

The E.coli RecJ (ecRecJ) is an exonuclease with a specificity for single stranded

DNA (76). The exonuclease activity of ecRecJ is divalent metal ion dependent (Mg+2)

(77). Exoribonuclease activity is observed from 5’-3’ and phosphorylation of 5’ of the ssDNA is not found to be necessary for the processivity of ecRecJ (62). A minimum of seven nucleotides in the substrate DNA are required for the exonuclease activity of ecRecJ (62). The ecRecJ exonuclease participates in the RecFOR pathway of homologous recombination to repair double stranded DNA breaks (78). In the Rec FOR pathway, ecRecJ shows enhanced processivity when combined with single stranded binding protein (SSB) and RecQ helicases. The ecRecJ also acts on double stranded

DNA when supplemented with the RecQ helicase. RecQ unwinds the dsDNA to be processed by the RecJ (67) for the downstream strand invasion events in the homologous recombination pathway. The ecRecJ is also shown to facilitate the strand invasion process catalyzed by RecA, by degrading nucleotides in the displaced strand, which is a common step in Rec FOR and RecBCD pathways of homologous recombination (79). Amongst the conserved residues predicted to be involved in the

active site of RecJ , mutation of D83, D160 and D236 residues abolished the nuclease activity. On a phenotypic level the E.coli carrying these RecJ mutations in the conserved

Asp residues are sensitive to UV radiation, providing further evidence of the possible role of RecJ in DNA damage repair (80). In the presence of a wildtype genomic copy of ecRecJ, when the aspartate (D83, 160 and 236) mutants were expressed ectopically on inducible plasmids, manifested as a dominant negative phenotype exhibiting sensitivity to UV damage and suggesting that the conserved Asp residues are necessary for RecJ function (76).

Thermus thermophilus RecJ

Solving the crystal structure of T. thermophilus RecJ (ttRecJ) at a resolution of

3.2 A° led to the identification of its active site, metal ion preference, and DNA binding residues Asp 82 and His 161 were identified as candidates for activation of a water molecule for the nucleophilic attack on the phosphodiester bond. The active site residues identified to be involved in coordinating the divalent metal ion (Mn+2) were Asp

84, Asp 136, His 160, and Asp 221, which are conserved in ecRecJ (76). Through mutational analysis of the ecRecJ activity, the four active site residues (Asp84, Asp136,

Asp 221 and His160) were found to be necessary for exonuclease activity of the RecJ

(76). The DNA binding site is identified to be a narrow groove located above the active site of ttRecJ (11 A° wide, 15 A°deep, and 23 A° long). The space constraint produced by the groove is the reason behind specificity of the ttRecJ nuclease to single stranded

DNA, as it is restrictive for interaction with double stranded DNA. The highly conserved residues surrounding the groove (Arg110, Arg277, Arg310, Arg350, Arg370, Asn273,

Asn307, and Gln311) interact with the phosphate back bone of the DNA.Through the studies conducted so far, seperate regions for DNA binding and exonuclease activity

have been identified, and the reason that nuclease inactive mutants of ttRecJ can still bind to substrate DNA is understood (77).

Deinococcus radiodurans RecJ

Complete deletion of recJ could not be achieved in Deinococcus radiodurans suggesting that this protein is essential for survival of the organism (81). The depletion of D. radiodurans RecJ (drRecJ) resulted in sensitivity to UV and IR radiation and oxidative damage induced by H202, supporting its role in DNA damage response (82).

The drRecJ protein exhibits specificity to single stranded DNA in a 5’-3’ direction (82).

Based on the crystal structures of drRecJ in complex with deoxythymidine monophosphate(dTMP, ssDNA and C terminus of single stranded DNA binding protein

(SSB), insights into both the structure and function of prokaryotic RecJ proteins have been obtained (83). In the drRecJ a two metal ion active site was reported. Both Mg+2 and Mn+2 are capable of activating RecJ, however activity with Mn+2 is significantly greater (84). The drRecJ was only found to be active on 5’-phosphorylated ssDNA substrates like ttRecJ and ecRecJ. A phosphate-binding pocket comprising of residues

R109, S371 and R373 above the active site determines the 5´-3´ polarity of drRecJ. The key amino acids responsible for DNA binding of drRecJ are identified to be Arg280,

Arg313, Arg314 and Lys353, which are found in the α-helices and shown to form a helical gateway for translocating DNA to the active site. Tyr114 and Tyr80 interact with the +1 DNA base of the substrate DNA in the active site, and substitution of deoxyribose with ribose in the substrate clashes with the Tyr114 mediated RecJ interaction, explaining the specificity of RecJ to DNA substrates. The OB-fold domain was found to be necessary for interaction with ssDNA substrates, and mutational analysis of the conserved residues (Tyr496 and Trp 517) in the OB-fold reduces the acitivity of RecJ on

5’ssDNA overhangs. The C-terminal domain of drRecJ was found to be critical for interacting with the C-terminal domain of its partner protein SSB (Single Stranded DNA

Binding protein). This interaction is found to be important in resecting the single 5’ ssDNA, and is confirmed by mutating the C-terminal residues (Tyr 575) of the RecJ and

C-terminal of the SSB which is shown to abolish the nuclease activity of Rec J (84).

Archaeal RecJ

RecJ1 and RecJ2 are reported fromMethanocaldococcus janschii. The DHH and the DHHA1 domains are conserved, the OB2 fold is not conserved in these archaeal

RecJ proteins. The RecJ1 shows 5’-3’ exonuclease activity on ssDNA and ssRNA (85) .

RecJ2 shows 3’-5’ exonuclease activity on ssRNA (85). RecJ protein from archaeon

Thermococcus kodakaraensis (tkRecJ) functions as an exonuclease and member of the

DNA replication machinery complex known as (GAN) GINS (go-ichi-ni-san) associated nuclease (86), tkRecJ shows conservation with the bacterial RecJ in the active site residues; however, it also shows similarity to eukaryotic Cdc45. Eukaryotic Cdc45 is a

RecJ like protein which has MCM-GINS interacting domain; however, residues for nuclease activity are not conserved. (68) The MCM-GINS interacting domain is absent in bacterial RecJ, but found in archael RecJ (tkRecJ) suggesting that archael RecJ is a hybrid of both eukaryotic RecJ and bacterial RecJ.

RNase J

RNase J proteins are ribonucleases, that belong to the β-CASP (named for metallo-β-lactamase, CPSF, Artemis, SnmI, Pso2) family of metallo-β-lactamases which includes both RNases and DNases (87). Orthologues of RNase J are found in bacteria, archaea and plant chloroplasts (88). RNase J proteins are involved in 5’-end maturation of 16S rRNA and 23S rRNA (89). RNase J forms a complex with RNA helicase RhpA in

Helicobacter pylori, forming a minimal yet efficient mRNA degrading complex involved in mRNA turnover (89) (90). The discovery of RNase J was initiated by the sequencing of the Bacillus subtilis genome (91), and the inability to find any sequence homologs of

RNase E, which is a ribonuclease that mediates mRNA decay in E. coli (92). In B subtilis which is a gram positive bacterium, RNase J along with two other ribonucleases

RNase Y and RNase III are identified to be involved in mRNA turnover (89). RNase J is the first reported bacterial RNase to posess a dual role in acting as both a endoribonuclease and exoribonuclease (93). Before the discovery of bacterial RNase J, the endo/exo nuclease activity of RNases was a distinguishing feature specific to only eukaryotic RNases. However recently reported RNase J protein homologs in archaea from Methanocaldococcus janschii and Methanolobus psychrophilus do not exhibit dual function. RNase J homolog from M. psychrophilus shows exoribonuclease activity alone

(94) and, of the three RNase J homologs reported from M. janschii (mjRNase) mjRNase

J1 and J3 are exonucleases while mjRNase J2 is an endonuclease (95). Of the two

RNase J paralogs (RNase J1, RNase J2) identified from B. subtilis, RNase J1 shows both exo and endonuclease activity, decreased exonuclease and predominantly endonuclease activity is seen in RNase J2 (88). The exonuclease activity of RNaseJ is

5’-3’ with a preference to 5’ monophosphorylated and 5’ hydroxylated single stranded

RNA substrates, however weak exonuclease activity is observed on 5’ triphosphorylated

RNA substrates in bacterial RNAse J homologs in Staphylococcu aureus (96) and

Mycobacterium smegmatis (89) and in the archaea Methanocaldococcus janschii and

M. psychrophilus (95) . Single stranded RNA has been identified as an RNase J substrate; however, homologs in B. subtilis show a weak activity on single stranded

DNA substrates. RNase J proteins from extremophilic bacteria Deinococcus radiodurans (87) and methanogenic archaea are also shown to process single stranded

DNA substrates (94) suggesting their potential role in DNA repair pathways. RNase J proteins act as a homodimer on the substrate RNA (95) with the exceptions reported in

B.subtilis, Staphylococcus aureus (97) and Streptococcus mutans (98). The latter enzymes act as heterodimers, which is formed by dimerization of the RNase J1 and

RNase J2 paralogs that actively cleave the RNA substrates (88). The bacterial RNase J homologs contain three globular domains referred to as the β-lactamase core, followed by a β-CASP core and a C-terminal domain connected by an a-helix to the β-lactamase core. The C-terminal domain is unique to RNase J proteins and its not seen in any other members of β-CASP family (99). The cleft formed between the β-lactamase core and the β-CASP serves as an active site for the nuclease activity of the RNase J, the C- terminal domain is speculated to be involved in dimerization and in stabilizing the active site of the RNase J (99). The archael RNase J homologs also posess the signature β- lactamase core and β-CASP domains found in bacterial RNase J, however the C- terminal domain of the bacterial RNase J is replaced by short insertion loops known as loop1 and loop2 (95).

Crystal structures of bacterial RNase J homologs have been solved in Thermus thermophilus (PDB:3BK1, PDB:3BK2, PDB:3T3N and PDB:3T3O) (99) Deinococcus radiodurans (PDB:4XWT, PDB:4XWW) (87), Streptomyces coelicolor (PDB:5A0T,

PDB:5A0V) (100) and from the archaeon Methanolobus psychrophilus (PDB: 5HAA,

PDB:5HAB) (87). The crystal structures of RNase J provide insights into its structure 1) active site 2) phosphate binding pocket 3) residues binding to DNA bases, which help

us in understanding it’s function. The active site of the enzyme is situated in the cleft formed between β-lactamase core and β-CASP domain (100). Five conserved histidine

(His) residues and two aspartate (Asp) residues along with a water molecule coordinate two Zn+2 ions in an octahedral manner (99). Two metal ion catalysis, mediated by divalent Zn+2 ions is observed in the active sites of all the reported crystal structures of RNase J so far. However, RNase J protein remains active in D. radiodurans (87) and

S. coelicolor (100) by substituting Zn+2 with Mn+2 or Mg+2. In the crystal structure of D. radiodurans RNase J, Mn+2 is shown to bind at the dimerization interface and stabilize the dimerization, which is essential for its nuclease activity of RNase J (101). A single active site is reported in all the crystal structures of RNase J. Bacterial RNase J possess both exo and endonuclease activity and mutating the conserved residues in the active sites of T. thermophilus RNase J abolishes its endo and exonuclease activity.

Based on the structural and biochemical data from the T. thermophilus RNase J, a single active site is thought to be involved in the dual activity of the RNase J enzyme, suggesting the possibility that RNase J switches from endo-to exonucleolytic mode on the same RNA substrate (99). A conserved phosphate binding pocket was identified close to the active site (87, 99, 101), where the phosphate and the base moiety of the substrate RNA nucleotide are both located in this pocket. The spatial organization of the phosphate binding pocket in bacterial RNase J homologs can accommodate a 5’ monophosphorylated base, whereas the pocket is restrictive for a 5’ end triphosphorylated base, contributing to the preference of RNase J for the

5’monophosphoylated RNA substrate for it’s 5’-3’ exonuclease activity.(99). The phosphate binding pocket serves as a sensor for the 5’ end of the substrate RNA. The

5’ monophosphorylated and 5’ hydroxylated RNA substrates, both of which can be accommodated in the phosphate binding pocket, are processed by the exonuclease activity of RNase J (100). The 5’ triphosphorylated RNA substrates, which cannot be accommodated into the binding pocket, are subject to endonuclease activity by the bacterial RNase J (100).Thus the phosphate binding pocket serves as a 5’ sensor of the

RNA substrate, which enables the RNase J enzyme to switch from exoribonuclease activity to endoribonuclease activity (100). Lower exonuclease activity is reported on 5’- triphosphorylated substrates activity when compared to 5’-monophosphorylated substrates in the archaeal homolog of RNase J (95). Examination of phosphate binding site in the crystal structure of M. psychrophilus RNase J reveals that in the phosphate binding pocket the monophosphate of the nucleotide co-ordinates three water molecules (95). This observation suggests the possibility of accommodating 5’ triphosphorylated nucleotides in the phosphate binding pocket (95). A negatively charged exit tunnel has been identified for evacuation of the cleaved nucleotide in 5’-3’ exonuclease mode (101). The amino acids of the RNase J enzyme predominantly make contacts with the sugarphosphate backbone of the RNA, which could be the reason that

RNase J homologs are not reported to exhibit any substrate sequence specificity.

Objectives

Homologs of Cdc48 are not well characterized in archaea. The VAT from T. acidophilum is the only archaeal homolog of Cdc48 to be purified and biochemically characterized. Homologs of Cdc48 are widely distributed across archaea, however due to no known substrate of archaeal Cdc48 a role in a cellular process has not been assigned to archaeal Cdc48 yet. The objectives of this study are 1) Examine the role of

Cdc48A complex formation with SAMP1, RecJ3, RecJ4 , RNase J1 in an apparent DNA

damage response using biochemistry, genetics and bioinformatics tools. 2) To purify and characterize Cdc48A from H. volcanii and identify residues which are necessary for its ATPase activity through bioinformatics and biochemical studies.

Figure 1-1. Cdc48 an ATP fueled molecular motor. a) The domain organization of Cdc48 homologs where the N terminal is utilized in binding partner proteins, D1 and D2 are the ATP hydrolysis domains and the C-terminal is predicted to interact with the proteasome. b) Hexamerzation of the monomers of Cdc48 occurs. In the hexamers the N-terminal domains are stacked on top of the D1 and D2 rings.c) The mechanism of substrate remodeling by Cdc48. Substrate proteins are post-translationally modified by ubiquitin or SUMO, adaptor proteins bind to modified substrates and recruit Cdc48 to remodel the substrate protein by utilizing energy generated from hydrolysis of ATP. Figure is modified from (23).

CHAPTER 2 MATERIALS AND METHODS

Chemicals, Strains and Growth Conditions

Chemicals and Reagents

Phleomycin was purchased from Invivogen (ant-ph-1,San Diego, CA). ATPƔS was purchased from (Cat .no. 4080,Tocris, Bristol, United Kingdom). Restriction enzymes, T4 DNA ligase, Phusion DNA polymerase and Taq polymerase were from

New England Biolabs (Ipswich, MA). Desalted oligonucleotides were ordered from

Integrated DNA Technologies (Coralville, IA). Other biochemicals were obtained from

Sigma-Aldrich (St. Louis, MO), and organic and inorganic analytical-grade chemicals were obtained from Fisher Scientific (Atlanta, GA).

Strains, Media and Conditions For Growth Assay

Strains used in this study are summarized in Table 2-1. Escherichia coli GM2163 was used for replication of plasmid DNA prior to transformation into H. volcanii according to standard methods (102). E. coli strains were grown at 37°C in Luria-Bertani

(LB) medium supplemented with ampicillin (Amp, 0.1 mg·mL−1). H. volcanii strains were grown at 42°C in ATCC974 complex medium supplemented with novobiocin (Nv, 0.2

µg·mL−1).

DNA Manipulation

Cloning

Escherichia coli - H. volcanii shuttle plasmids were constructed by cloning and are listed in Table 2-1. Polymerase chain reaction (PCR) was used to amplify target genes with Phusion® High Fidelity DNA Polymerase (New England Biolabs, Ipswich,

MA) and the positive clones were screened by PCR using Taq DNA Polymerase (New

England Biolabs, Ipswich, MA). Primers used in this study are listed in Table 2-2. PCR- amplified products were digested by selected restriction endonucleases as recommended by supplier (New England Biolabs, Ipswich, MA), purified by MinElute

PCR Purification Kit (Qiagen), and ligated into plasmid vectors by T4 DNA ligase (New

England Biolabs, Ipswich, MA) according to manufacturer’s protocols. The ligated DNA

(PCR, Vector) was routinely transformed into E. coli TOP10 and GM2163 chemically competent cells (103).

DNA Electrophoresis

DNA product generated by PCR and plasmids were analyzed by electrophoresis

(100 V, 25 min) using 0.8% (w/v) agarose gels. In order to detect the PCR products, ethidium bromide (0.25 μg∙mL-1) was added to TAE buffer (40 mM Tris acetate, 2 mM

EDTA, pH 8.5). Hi-Lo DNA molecular weight marker served as a standard (Minnesota

Molecular, Minneapolis, MN). Mini visionary imaging system (FOTODYNE, Hartland,

WI) was used for visualization.

Site-Directed Mutagenesis

Site-directed mutagenesis (SDM) was performed using Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA) based on manufacturer protocols.

Appropriate plasmids isolated from E. coli TOP10 were used as the template for PCR with SDM forward and reverse primer pairs. Primers used in SDM are listed in Table 2-

SDS-PAGE

H. volcanii strains were grown in ATCC974 with Novobiocin (Nv 0.1 µg/mL) medium to a stationary-phase (OD600nm 2.5 in 3 mL of ATCC974 in 13 × 100 mm tubes).

The cells were pelleted by centrifugation (14,500 × g, 2 min at room temperature). Cell

pellets were boiled in reducing 2X SDS buffer (2% w/v SDS, 10% v/v glycerol, 5% v/v β- mercaptoethanol, 0.002% w/v bromphenol blue and 62.5 mM Tris–HCl, pH 6.8).

Proteins were separated by 10-12% SDS-PAGE and transferred to Hybond-P polyvinylidene fluoride (PVDF) membranes (0.45 µicrons GE Healthcare Bio-Sciences,

Piscataway, NJ) at 4°C for 2.5 h at 90 V by tank blot. Anti-His6 Westernblotts were performed using HRP-Conjugated His6 antibody (Proteintech, HRP-66005) at 1:5000 dilution.

Table 2-1. Plasmids and strains used in this study. Strains or Genotype and/or Descriptiona Ref. or plasmid Source Strains: E. coli – – + Top10 F recA1 endA1 hsdR17(rK mK ) supE44 thi-1 gyrA relA1 Invitrogen GM2163 F- ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 New mcrA dcm-6 hisG4 rfbD1 rpsL 136 dam13 ::Tn9 xylA5 mtl-1 England thi-1 mcrB1 hsdR2 Biolabs H. volcanii H26 DS70 ΔpyrE2 (104) H164 ∆pyrE2 ∆trpA leuB-Ag1 bgaHa-Bb This study H1999 H164 Δcdc48A This study NH03 H26 Δsamp1 Δsamp2 Δsamp3 ΔubaA (105) HM H26 Δsamp1 NN2 H26 Δcdc48b (106) NN3 H26 Δcdc48c (106) GZ132 H26 ΔpanA1 ΔpanB2 (106) YW1007 H26 flag-samp1 S85R (105)

H1209 H26 ΔhdrB pitANph Δmrr (107) HM1041 H26 Δsamp1 (hvo_2619) (108)

Plasmids: r r pJAM1400 Ap ;Nv : pJAM809 with P2rrn-cdc48A-strepII This study r r pJAM1401 Ap ;Nv : pJAM809 with P2rrn-cdc48A(QE)-strepII This study r r pJAM1403 Ap ;Nv : pJAM809 with P2rrn- cdc48A(QQ)-strepII This study r r pJAM1404 Ap ;Nv : pJAM202 with P2rrn- cdc48A This study r r pJAM1405 Ap ;Nv : pJAM809 with P2rrn-recJ4-strepII This study r r pJAM1406 Ap ;Nv : pJAM809 with P2rrn-rnj-strepII This study r r pJAM1407 Ap ;Nv : pJAM809 with P2rrn-recJ3-strepII This study pJAM1131 Kmr; pET24b with flag-his6-samp1 (109) r r pJAM941 Ap ; Nv ; pJAM939 with P2rrn-flag-samp3 (10) r r pJAM947 Ap ; Nv ; pJAM939 with P2rrn-flag-samp1 (10) r r pJAM949 Ap ; Nv ; pJAM939 with P2rrn-flag-samp2 (10) r r pJAM1409 Ap ;Nv : pJAM503with P2rrn- N-His-6-Cdc48A This study r r pJAM1410 Ap ;Nv : Pjam202with P2rrn- Cdc48A This study r r QQ pJAM1411 Ap ;Nv : pJAM503with P2rrn- N-His-6-Cdc48A This study pJAM202c Apr;Nvr: Haloferax. volcanii-E. coli shuttle vector (108) a-strepII, encodes C-terminal StrepII tag; flag- and flag-his6-, encode N-terminal Flag- and FlagHis6- tags, respectively; QE, E290Q; QQ, E290Q,E563Q cdc48A, hvo_2380; samp1, hvo_2619; samp2, hvo_0202; samp3, hvo_2177; rnj, hvo_2724; recJ4, hvo_2889; recJ3, hvo_1018; P2rrn, ribosomal RNA P2 promoter of Halobacterium salinarium; Apr (ampicillin), Nvr (novobiocin) and Kmr (kanamycin) resistance.

Table 2-2. Primers used in this study. Primer name Primer sequence (5’-3’) This study Rpl10FW 5’GATTACGAACCCGGCGTACA3’ qRT- PCR Rpl10RV 5’GGCGAATCTGCACTTCCTCT3’ qRT-PCR 2380RTFW-1 5’TCAAGAAACTGGGCATCGAG3’ qRT-PCR 2380RTRV-1 5’AGAAGAAACTCGCCGAAGTC3’ qRT-PCR 2724RTFW-2 5’GCTCACCAGAACCTGAAAG3’ qRT-PCR 2724RTRV-2 5’ACTCCACCAGCTGAATCAT3’ qRT-PCR 2889RTFW-2 5’GGTCAGCTACTGGGAGAACT3’ qRT-PCR 2889RTRV-2 5’GCTTGTCCTGATACGACTGG3’ cloning 2380_BamHI_up 5’AAGGATCCGTGGTACTGGTGCTGATG3’ cloning 2380_HindIII_dn 5’CCAAGCTTCAAAATCATCACCGACCTC3’ cloning 2380_NdeI 5’CGACGGCCATATGAACGAAGTCCAACTCGAAGTGG cloning CGAAAGC3’ 2380_stop_BamHI 5’TATGGATCCTTACTGGAAGCCGATGCGGCCGCCGT cloning C3’ 2380_KO_invR 5’GGCGGCCGGCGTTCTGCG3’ cloning 2380_KO_invF 5’GATTACCTCGCGGGGATGCTGATACCTGTGAGAGG cloning 3’ 2380_NspI 5’GGCCATACATGTCCAACGAAGTCCAACTCGAAGTG cloning GCGAAAGC3’ HVO_2724_Nde1 5’TCTCATATGGAAATCGAAATCGCAACCATAGGC3’ cloning HVO_2724 Kpn 1 5’ATAGGTACCCTCCACCAGCTGAATCATGTTGC3’ cloning HVO_1018 Nde1 5’TATCATATGAGCGACGAGCACGCCGGGGATTCC3’ cloning HVO_1018 Kpn1rv 5’TATGGTACCGCCGTCGTCGACAGCTCTTCGTCGAT cloning GTCGGCT TCGGCCATCTTCTCG3’ HVO 30 bp upstream 5’ATAAGCTTAATCTCCCCTGAGCGTTTTT3’ cloning 2889 HVO 30 bp 5’TAGGATCCGACTCCGTCTCGGTCTCG3’ cloning downstream 2889 HVO 2889 Nde1 5’ATTCATATGGATTGGATTACGCACGAGGAAGAC3’ cloning HVO 2889 KpnI 5’TTGGTACCAAACTGCTCGGCGGCGGCGTC3’ cloning HVO_2380 BlpRv with 5’AGCTGAGCTTACTGGAAGCCGATGCGG3’ cloning stop HVO_2380QEfw 5’CATCATCTTCATCGACCAGCTCGATTCCATCGC3’ SDM HVO_2380QErv 5’GCGATGGAATCGAGCTGGTCGATGAAGATGATG3’ SDM HVO_2380EQfw 5’TCATCTTCTTCGACCAGCTCGACGCGCTC3’ SDM HVO_2380EQrv 5’GAGCGCGTCGAGCTGGTCGAAGAAGATGA3’ SDM aSDM, site directed mutagenesis.

CHAPTER 3 ROLE OF CDC48A IN ARCHAEAL DNA REPAIR

Introduction

Cdc48 is a AAA-ATPase (17) which is reported to be involved in a wide variety of cellular processes (110). For example, its function in facilitating proteasomal mediated degradation of substrates which are misfolded in the outer membrane of the endoplasmic reticulum (ER) (24), mitochondria (111) and damaged mitochondria itself

(112). Cdc48 is reported to be involved in regulation of gene expression (52, 113, 114).

Abberant nascent polypeptides on a stalled ribosome are degraded by Cdc48, thus playing an important role in ribosome associated degradation (RAD) of nascent polypeptides (51, 115). There has been mounting evidence for the role of Cdc48 in extracting proteins from chromatin bound complexes facilitating, the regulation of DNA replication and repair by Cdc48 (17). Cdc48 mediated extraction of Ubiquitin modified

Rpb1 from the chromatin was demonstrated in S. cerevisiae, where the Rpb1 subunit of

RNA polymerase II was found to accumulate on the chromatin in UV treated cells (50).

DNA repair proteins such as DDB2 (57), Ku70/80 (55), DNA Polymerases (54) and DNA bound proteins such as polycomb protein L3MBTL1 were also identified to be substrates of Cdc48, suggesting the role of Cdc48 in DNA repair patways in eukaryotes

(116).

Several homologs of AAA-ATPase have been identified, but a role in a cellular process is not assigned yet. In archaea, the Cdc48 homolog characterized from

Thermoplasma acidophilum, referred to as VAT was biochemically demonstrated to be involved in ATP hydrolysis mediated unfolding of synthetic substrate proteins (117).

However, the cellular role of VAT in T. acidophilum has not been identified as a

physiological substrate or a partner protein remain yet to be identified. Proteasome activating nucleotidase (PAN), which is also a AAA-ATPase involved in proteasomal mediated degradation of substrates, has been studied in Haloferax volcanii (109),

Methanococcus janaschii (118), and Halobacterium salinarium (119). However, a physiological substrate of PAN has also not been identified although a previous study in

H. volcanii suggested that Ub-like SAMP1 modification is necessary for substrate identification byPAN (109).

Materials and Methods Used In This Study

Purification Of SAMP1

Escherichia coli Rosetta (DE3)-pJAM1131 was used for purification of Flag-His6-

SAMP1. The strain was freshly transformed with inoculated into LB medium (10 g NaCl,

10 g tryptone, 5 g yeast in 1 liter water) supplemented with Km (kanamycin,50 µg/mL) and Cm (chloramphenicol 30 µg/mL) (500 mL medium per 2.8-L Fernbach flask). Cells were cultured at 25 °C (200 rpm). Isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 0.4 mM at exponential phase (OD600 0.4-0.6 units).

After 8 h induction with IPTG at 25°C, cells were harvested by centrifugation (3000 × g for 10 min, at 4ᵒC). Cells were washed in ice-chilled low salt buffer (20 mM HEPES, pH

7.5, 150 mM NaCl), centrifuged and stored as pellets at -80°C until used. cells (3 g wet weight per 1.6 L culture) were resuspended in 12 mL lysis buffer (20 mM HEPES, pH

7.5, 150 mM NaCl, 40 mM imidazole, 4 µg∙mL-1 DNase, 1 mM PMSF) and lysed thrice using a French press (2,000 psi). An equal volume of dilution buffer (20 mM HEPES, 4

M NaCl, pH 7.5) was added to the lysate and mixed by inverting the tube 2-3 times. Cell lysate was clarified by centrifugation (9,200 x g twice for 10-20 min, at 4°C) and filtration

(0.2 µm, cellulose acetate membrane, Fisher). The protein sample was applied to a His

Trap HP column (5 mL, GE Healthcare 17525501) pre-equilibrated in buffer (20 mM

HEPES, pH 7.5, 2 M NaCl, 40 mM imidazole) and washed with 10 column volumes of the same buffer. The Flag-His6-SAMP1 protein was eluted using 500 mM imidazole in

20 mM HEPES, 2M NaCl, and pH 7.5. The eluate was concentrated to a final volume of

7 mg per 0.5 mL using a Amicon Ultracel-3 centrifugal filters (3 MWCO, regenerated cellulose, Millipore Sigma UFC800324) and applied to Superdex 75 HR 10/30 column

(FPLC, GE Healthcare) equilibrated with HEPES high salt buffer (20 mM HEPES, 2 M

-1 NaCl, pH 7.5) at a flow rate of 0.2 mL∙min . Fractions of eluted protein were collected every 0.5 mL. Flag-His6-SAMP1 fractions of 0.65 mg per 0.5 mL were pooled and stored at 4ᵒC.

Cell Lysate For SAMP1 Pull-Down Assay

Haloferax volcanii NH02-pJAM957 (∆samp1-3 ∆ubaA expressing UbaA-StrepII ectopic) was grown in ATCC974 medium supplemented with novobiocin (Nv 0.2 µg/mL) with 100 mM DMSO to stationary phase at 42°C (2 x 1-L culture in 2.8-l Fernbach flask,

200 rpm). Cells were harvested by centrifugation (3,000 x g, 10 min at 4°C) and stored as pellets (3 g wet weight) at -20°C until use. On the day of the pull-down assay, the H. volcanii cell pellets were resuspended in 15 mL ice cold high salt PBS buffer (0.1 M sodium phosphate buffer, pH 7.5, 2 M NaCl, 1 mM DTT, 1 mM PMSF, 4 µg∙mL-1

DNase) by pipetting gently in and out with a 1 mL pipettor. Cells were lysed by french press (twice at 2,000 psi), and the cell lysate was clarified by centrifugation (16,264 x g,

20 min at 4°C). The supernatant from the centrifuged cell lysate was transferred carefully into a fresh tube without disturbing the pelleted cell debris. The cell-free extract was concentrated to a final volume of 3 mL and total protein concentration of 25 mg by dialysis against PEG 8000, where the cell free extract was packed in SnakeSkin

Dialysis Tubing (3.5 K MWCO, 22 mmThermo Scientific, 68035) and incubated at 4°C in a container filled with 150 g of PEG 8000. The cell free extract was concentrated to final volume of 3 mL, after which it was dialyzed against high salt PBS buffer (2 M NaCl, 0.1

M sodium phosphate, 0.2 mM DTT, pH 7.2) at 4°C. Immediately prior to pull-down assay, the cell-free extract was supplemented with 5 mM ATP.

Coupling Of SAMP1 To Amine Reactive Beads

Flag-His-SAMP1 was coupled to aldehyde-activated agarose beads (AminoLink plus Resin 20501, Thermo Fisher Scientific) by reductive amination at room temperature according to supplier (Thermo Fisher Scientific) with the following modifications. Immediately prior to coupling, Flag-His-SAMP1 (15-20 mg total protein estimated by standard BCA assay) was dialyzed twice against high salt PBS buffer (2 M

NaCl, 0.1 M sodium phosphate, pH 7.2) at 4ᵒC. Likewise, the AminoLink Plus Resin (2 mL) was equilibrated by adding 3 resin-bed volumes of high salt PBS buffer at room temperature. The Flag-His6-SAMP1 sample was added to the column resin. Coupling was initiated by addition of 40 µL of 5 M NaCNBH3 in 1 M NaOH , and the sample was rocked overnight at room temperature. After overnight coupling, the resin was allowed to settle to the bottom of the tube by gravity, and the input buffer was collected as flowthrough. The remaining active sites were blocked by using 4 mL quenching buffer for each wash (high salt PBS buffer and supplemented with 40 µL of 5 M NaCNBH3 in 1

M NaOH). Sample was gently rocked at room temperature for 30 min. The column was washed with 10 mL (5 resin-bed volumes) of wash solution (high salt PBS buffer) to remove the non-coupled protein and unreactive cyanoborhydride. In each case, the resin was allowed to settle down by gravity, and the wash was removed as flowthrough.

SAMP1 Pull-Down Assay

The amino link column beads coupled with Flag-His6-SAMP1 were equilibrated with 3 column volumes (6 mL) of high salt PBS buffer. The cell free extract of H. volcanii at 6.7 mg/mL (15-20 mg total) was applied to the column and incubated for 4 h with rocking at 4ºC per each 2 mL application. The column was washed with 40 mL high salt

PBS buffer (the flow through was collected by centrifuging the column at 5000x g) at room temperature for 2 minutes. Proteins bound to the column were eluted by addition of 8 mL of 0.1 M glycine-HCl buffer at pH 2.5 and collected as 1 mL fractions in tubes with 50 µL neutralization buffer (1M Tris-HCl, pH 8.5). Protein (30 µL) eluted from the first collection tube was separated by 10% reducing SDS-PAGE and visualized by staining with SYPRO Ruby. Similar to Flag-His6-SAMP1 BSA was coupled to the amino link beads and used as a negative control to analyze proteins in the cell lysate that bind non-specifically to the amino-link column. Regions of the gel with protein bands uniquely eluted from Flag-His6-SAMP1 (vs. BSA) beads were targeted for identification using a mass spectrometry (MS)-based approach as described below.

Mass Spectrometry

Proteins were separated by 10% reducing SDS-PAGE, visualized by staining with Bio-Safe Coomassie (Bio-Rad), destained in double deionized water, and excised in gel slices. Proteins were treated in gel with 45 mM dithiothreitol (DTT) and 100 mM 2- chloroacteamide (CAA). To minimize CAA carryover prior to trypsin digest, liquid was removed from the treated gel pieces and samples were washed with 25 mM ammonium bicarbonate buffer (pH > 7.9), dehyrated by treatment with acetonitrile, and treated by centrifugal evaporation (SpeedVac) to complete dryness. Samples were treated with trypsin (1 µg per 50 µg protein) at 37ºC for 15 h. Tryptic peptides were injected onto a

capillary trap (LC Packings PepMap) and desalted for 5 min with 0.1% vol/vol formic acid at a flow rate of 3 µL∙min-1 prior to loading onto an LC packing C18 Pep Map nanoflow high performance liquid chromatography (HPLC) column. The elution gradient of the HPLC column started at 3% solvent A (0.1% vol/vol formic acid, 3% vol/vol acetonitrile, and 96.9% v/v H2O), 97% solvent B (0.1% vol/vol formic acid, 96.9% vol/vol acetonitrile, and 3% vol/vol H2O) and finished at 60% solvent A, 40% solvent B using a flow rate of 300 µL∙min-1 for 30 min. LC-MS/MS analysis of the eluting fractions was carried out on an LTQ Orbitrap XL mass spectrometer (ThermoFisher Scientific, West

Palm Beach, FL). Full MS scans were acquired with a resolution of 60,000 in the

Orbitrap from m/z 300–2000. The ten most intense ions were fragmented by collision induced dissociation (CID). Raw data were analyzed using Mascot (Matrix Science,

London, UK; version 2.2.2) against the H. volcanii proteome (UP000008243,Uniprot) and target decoy databases with the latter including a set of reversed sequences generated by Mascot. Mascot was searched with a fragment ion mass tolerance of 0.8

Da and a parent ion tolerance of 15 ppm. Carbamidomethylation of Cys was indicated as a fixed modification while deamidation of Asn and Gln, oxidation of Met, and isopeptide linkage to Gly-Gly- were specified as variable modifications. Scaffold

(Proteome Software Inc., Portland, OR) was used to validate MS/MS based peptide and protein identifications, where protein probabilities were assigned by the Protein Prophet algorithm and peptide probabilities were assigned by the Peptide Prophet algorithm

(120, 121). Protein identities were based on a threshold of 99.9% probability and < 0.1%

False Discovery Rate (FDR).

Partner Protein Pull-Down Assays

RNase J1 pull down assay

H. volcanii H26-pJAM1406 was used for purification of RNase J1 fused to a C- terminal StrepII tag (RNase J1-StrepII ). H. volcanii H26-pJAM202c served as the empty vector control. The strains were inoculated into culture tubes containing 4 mL ATCC974 medium supplemented with novobiocin (Nv, 0.2 µg/mL) from the ATCC+Nv plates inoculated from -80°C freezer stocks. The 4 mL seed cultures were subcultured twice to log phase. The seed cultures at log phase (0.6-0.8 O.D 600nm) were inoculated into 800 mL ATCC+Nv (2.8 L Fernbach flask) supplemented with 100 mM DMSO. Cells were cultured at 42°C (200 rpm) to stationary phase for approximately 3 days. At stationary phase (OD 600nm of 2.5), the cells were harvested by centrifugation (3000× g for 10-20 min, at 4ᵒC) and washed in ice-chilled buffer (50 mM Tris-Cl, pH 7.5, 2 M NaCl). Cells were stored as pellets at -80°C until used. Cells (3 g wet weight) were resuspended in

12 mL lysis buffer [50 mM Tris-Cl, pH 7.5, 2 M NaCl, 1 mM DTT, 4 µg∙mL-1 DNase, 0.5 mM MnCl2, 4.5 mM MgCl2 and EDTA free protease inhibitor mini tablets (Pierce)] and lysed thrice by French press (2,000 psi). Cell lysate was clarified by centrifugation

(9,200 x g twice for 10 min, at 4°C) and filtration (0.2 µm, cellulose acetate membrane,

Fisher). Cell lysate was dialyzed twice (SnakeSkinTM dialysis Tubing,3.5K MWCO, 22 mm Thermo Scientific 68035) for 2 h at 4ºC each time against 4-L buffer A ( 50 mM Tris-

Cl, pH 7.5, 2 M NaCl, 1 mM DTT, 0.5 mM MnCl2, 4.5 mM MgCl2) and supplemented with 0.1 mM γATP (adenosine 5′-[γ-thio]triphosphate tetralithium salt, Tocris 4080).

Whole cell lysate from French press was applied to Strep-Tactin 250 µL of Superflow

Plus resin (2 mL, Qiagen 30002) pre-equilibrated in buffer A and washed with 20 column volumes of the same buffer. RNase J1-StrepII was eluted using an equal

volume (250 µL) of 2 x SDS reducing buffer and boiling the Strep-Tactin resin for 6 min.

Samples were centrifuged at 14,549 x g (10 min at 21°C). Proteins, in the supernatant solution, were separated by 10% reducing SDS-PAGE. Unique protein bands found in the RNase J1 pulldown (H26-pJAM1406) where Strep tagged RNase J protein was used as a bait, were excised and analyzed by LC-MS/MS. Equivalent regions of the gel were similarly analyzed from the empty vector control (H26-pJAM202c).

RecJ 4 pull-down assay

The RecJ 4 pull-down assay was performed similarly to that of RNase J1 with the following exceptions. H. volcanii-pJAM1405 was used for purification of RecJ4 with a C- terminal StrepII (RecJ4-StrepII). Cell lysate was dialyzed twice for 2 h each time against

4-L buffer A (50 mM Tris-Cl, pH 7.6, 2 M NaCl, 1 mM DTT,10 mM MgCl2). After dialysis the cell material was supplemented 0.1 mM γATP. Protein sample was applied to a

Strep-Tactin Superflow Plus resin (Qiagen) pre-equilibrated in buffer A and washed with the same buffer. Proteins were eluted, separated and identified in a similar fashion as mentioned in the RNase J1 pulldown assay.

Cdc48A Pulldown Assay for Identification Of Protein Partners

Strep resin enrichment of Cdc48A

The Cdc48A pull-down assay was performed similar to that of RNase J1 with the following exceptions. H. volcanii-pJAM1400 was used for purification of Cdc48A with a

C-terminal StrepII (Cdc48A-StrepII). Cell lysate was dialyzed twice for 2 h each time against 4-L buffer A (50 mM Tris-Cl, pH 7.6, 2 M NaCl, 1 mM DTT, 10 mM MgCl2) supplemented with 0.1 mM ATP after dialysis. Protein sample was applied to a Strep-

Tactin Superflow Plus resin (Qiagen) pre-equilibrated in buffer A and washed with the same buffer.

Nickel column enrichment of Cdc48A

H. volcanii H26-pJAM1409 was used for purification of Cdc48A with an N terminal His6 tag (His6-Cdc48A). Cells were washed in ice-chilled buffer (10 mM sodium phosphate buffer, pH 7.6, 2 M NaCl) prior to storing as pellets at -80°C. The lysis buffer was composed of 10 mM sodium phosphate buffer, pH 7.6, 2 M NaCl, 40 mM imidazole, 4 µg∙mL-1 DNase, protease inhibitor tablet, 1 mM DTT, 1 mM ATP and 5 mM

MgCl2. Protein samples were applied to a His Trap HP column (5 mL, GE Healthcare) pre-equilibrated in the lysis buffer (minus the protease inhibitor and DNase) and washed with this same buffer. The His6-Cdc48A protein was eluted by supplementing the equilibration buffer with 500 mM imidazole into 1 mL fractions. The column eluates (15

µL ) were boiled for 6 min in an equal volume of 2 x SDS reducing buffer and centrifuged (14,549 x g for 10 min at 25°C). Proteins, in the supernatant, were separated by 10% reducing SDS-PAGE. Unique protein bands were excised and analyzed by LC-MS/MS. Parallel regions of the gel corresponding to the empty vector control were similarly analyzed.

Construction Of Substrate Trap Mutant Of Cdc48A

The conserved Glu (E 290,563 ) residues in the AAA ATPase domains (D1 and

D2) of Cdc48A were mutated to Gln (Q) generating a QQ variant pJAM1411 (Cdc48A

E290Q, E563Q ). Site-directed mutagenesis (SDM) was performed according to Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA) protocols. Plasmid pJAM1409 (N-His6-Cdc48A) was isolated from E. coli TOP10 and used as the template for PCR with SDM forward and reverse primer pairs. Primer sequences used

(HVO_2380 QE fw, HVO_2380 QE rv, HVO_2380 EQ fw, HVO_2380 EQ rv) in SDM are listed in Table2-2.

qRT-PCR Analysis

H. volcanii H26 was streaked for isolation from -80°C 20% glycerol stocks on to

ATCC974 plates. Isolated colonies were inoculated into 4 mL ATCC974 liquid cultures and grown to log phase (OD 600nm 0.6) (13x100 mm culture tubes). Cultures were subsequently distributed into two tubes.(2mL per 13x100 mm culture tubes) and cells were treated with phleomycin (3 mg·mL-1) or mock control for 1 h. Total RNA was isolated from the 2 mL of cells (treatment and mock control) by use of an RNeasy minikit according to the suppliers instructions (Qiagen, 74104). DNA was removed from the RNA by using a Turbo DNA-free kit according to the recommendations of the supplier (Invitrogen, AM2239). Samples were analyzed to ensure the level of contaminating DNA after Turbo DNase digestion was below the limit of detection by

PCR. The integrity of the RNA was determined by 2.0 % (wt/vol) agarose gel electrophoresis. RNA (125 ng per reaction) was analyzed by one-step quantitative reverse transcriptase PCR (qRT-PCR) using the QuantiTect SYBR green RT-PCR kit following the protocol of the supplier (Qiagen). One-step qRT-PCR was performed under conditions of 50°C for 30 min, 95°C for 15 min, and 40 cycles of 94°C for 15 s,

51°C for 30 s, and 72°C for 30 s, followed by determination of the melting curve by using a CFX96 real-time C1000 thermal cycler (Bio-Rad). A single peak revealed by melting curve analysis indicated a single product. mRNA levels were normalized to the internal standard rpl10, encoding the 50S ribosomal protein L10 (HVO_2756). A standard curve was generated following the manufacturer’s protocol. Genomic DNA served as the template to test different primer pairs for PCR efficiency. Experiments were performed in triplicate. qRT-PCR and data analysis was done using Livak method (122).

Growth Curves

H. volcanii strains were grown in 4 mL ATCC974 medium to log phase (OD600nm of 0.4 to 0.6) and subcultured to a starting OD600nm of 0.02 for growth assays in 50 mL

Erylnmeyer ribbed flasks. Once the cells reached log phase (OD600nm of 0.6 to 0.8), the cultures were treated with the Cdc48 inhibitor N2,N4-bis(phenylmethyl)-2,4- quinazolinediamine (11 μM DBeQ) (177355-84-9, Cayman Chemical) or the mock control (100% ethanol, solvent to dissolve DBeQ) and growth was monitored by measuring OD600nm every four hours in the log phase and every 8 hours in the stationary phase for 60 hours. DBeQ was dissolved in 100% ethanol (5 mg·mL-1 or 14 mM). All growth assay experiments were performed at least in triplicate, and the means

± standard deviations (SD) were calculated.

Results

Cdc48A Forms An Apparent Complex With DNA Repair/Replication Proteins That Binds Ubiquitin-Like SAMP1

To determine the proteins that may bind ubiquitin-like protein modifiers, we performed pull-down experiments using SAMP1 (vs. BSA) as bait. SAMP1 was chosen, as it is an H. volcanii ubiquitin-like modifier associated with oxidative stress (123).

SAMP1 was purified, immobilized by covalent linkage to agarose beads and incubated with the cell lysate of H. volcanii NH03-pJAM957 (Δsamp1-3 ΔubaA mutant ectopically expressing the E1-like UbaA) that was spiked with ATP. SAMP1-bound proteins were eluted from the beads and separated by non-reducing SDS-PAGE (Figure 3-1). A unique band at 260 kDa was detected and analyzed by LC-MS/MS and found to be a thiol-sensitive complex of Cdc48A, RNase J1 (HVO_2724), RecJ3 (HVO_1018) and

RecJ4 (HVO_2889). A band at 55 kDa was similarly found to be unique and analyzed

by LC-MS/MS. This later band was found to be RecJ3. Cdc48/p97 is known to interact with and control the fate of ubiquitylated proteins in eukaryotes (40, 124). Here we find an apparent thiol-sensitive complex of Cdc48A, ubiquitin-like SAMP1 and homologs of

RNase J1 and RecJ3/4 (Figure 3-1).

Partner Proteins Of Cdc48A, RecJ4 and RNase J1

To further investigate the interaction of Cdc48A and its partner proteins, we expressed RecJ4, RNAse J1, Cdc48A with epitope tags and purified proteins from H. volcanii by affinity chromatography. Enrichment fractions similarly purified from the H. volcanii parent strain carrying the empty vector served as a control. The epitope tagged enrichment fractions were separated by reducing SDS-PAGE. Protein bands found unique to the strains that expressed Cdc48A, RecJ4 and RNase J1 were observed between 50 - 100 kDa. These bands were excised and analyzed by LC-MS/MS. RecJ4 was found to co-purify with the RNase J1 and RecJ3 among other proteins (Figure 3-3)

(Table 3-2). Interestingly, Cdc48A was only detected in the enrichment fractions of

RecJ4 when the cell lysate was supplemented with γATP (Table3-2). RNase J1 associated proteins were found to be RecJ4, RecJ3 and RpoA2 (Figure 3-2) (Table 3-

2). The Strep-tagged Cdc48A was found to copurify with RNAse J1, RecJ4, RecJ3 and

RpoA1. These results support the synthesis of a Cdc48A: DNA repair complex in archaea. The His6 tagged Cdc48A was also found to associate with deoxyhypusine synthase (DHS), an enzyme that functions in hypusination of the target lysine residue of initiation factor 5A, eIF5A, to resolve ribosomal stalling (Figure 3-2) (125), which could be considered important to coordinate with DNA replication/repair (126). Likewise,

Cdc48D was identified as Cdc48A protein partner and considered essential for growth based on previous study (107), thus, associating it with DNA replication; likewise,

HVO_2381, while of unknown function, is encoded as a gene neighbor of cdc48a

(Figure.3-2).

The (QQ) Mutant Of Cdc48A Potentially Traps Protein Partners Due To Its Decreased Ability To Hydrolyze ATP

Cdc48A wildtype and the substrate trap mutant QQ (E290Q, E563Q) were ectopically expressed in H. volcanii strain H1209, which is a pitA Nph replacement strain. In this strain pitA from H. volcanii is replaced by the ortholog from Natronomonas pharaonis. The latter lacks the histidine-rich linker region found in H. volcanii PitA and does not copurify with His-tagged recombinant proteins. The Cdc48A proteins from these cultures were similarly enriched by Ni-chromatography. The column enrichments from the wildtype and QQ elutions were (2.75µg) separated equally by reducing SDS PAGE gel with 2X SDS loading buffer. The purification profile of the mutant and the wild type were found to differ considerably in terms of the size of their partner proteins (Figure 3-

10). A visible increase in partner protein copurification was observed in the QQ mutant enrichment when compared to that of the wildtype. The increase in copurification of proteins with QQ mutant may be attributed to its substrate trapping ability.

DBeQ, A Cdc48-Specific Chemical Inhibitor, Slightly Impairs The Growth and Considerably Impairs The Pigmentation Of H. volcanii

N2,N4-bis(phenylmethyl)-2,4-quinazolinediamine or DBeQ is a D2 domain specific and reversible, small molecule inhibitor of human p97 (127), a Cdc48 homolog that shares amino acid identity with H. volcanii Cdc48A (56%, 297/532; 297 of its 532 amino acid residues), Cdc48B (57%, 318/562), Cdc48C (48%, 268/559), and Cdc48D

(39%, 86/218). Thus, we examined the impact DBeQ may have on the growth of H. volcanii cells. DBeQ was found to perturb the growth of H. volcanii and to have a major impact on production of the reddish color of the cells (Figure.3-9) attributed to

carotenoid pigments in the cell membrane. Based on previous study, a similar reduction in pigment levels is observed when the Ser/Thr phosphorylation sites of the α1 subunit of 20S proteasomes are modified to S58A and T147A in this organism.Based on the slight growth and significant impairment of pigmentation when cells are exposed to

Cdc48/AAA-ATPase inhibitor, Cdc48 in H. volcanii may be involved in cell division and carotenoid biosynthesis pathways.

Mutation of cdc48a Renders H. volcanii Cells Sensitive To DNA Damage and Mutation of samp1 Renders Cells Resistant To DNA damage

The cdc48a gene homologs were found to be in genomic synteny with radA/B genes in archaea and a close homolog of the eukaryotic Cdc48 (Figure 3-11). Thus, we predict that Cdc48A is important in the DNA damage response of archaea. To examine this possibility, a mutant strain of cdc48a was generated by homologous recombination and used to examine the role of Cdc48A in the DNA damage response. Stress tests were performed on (H164) parent strain, H1999 (H164 with Δcdc48a), H1999- pJAM1410 (Δcdc48a:cdc48a), and H1999-pJAM 202c.( Δcdc48a:empty vector) .The strains were exposed to UV at dosage ranges of (0, 50, 75, 80, 85 100 J/M2) and phleomycin a radio mimetic drug which induces random double stranded breaks, at concentration ranges tested were (0, 0.5, 0.75, 1, 1.5 mg/mL.). The parent (H164) was found to survive slightly better than that of Δcdc48a mutant (H1999). By contrast, the complementation strain Δcdc48a:cdc48a( H1999-pJAM 1410 ) where Cdc48A was over expressed from a strong P2 promoter in trans showed significant resistance to both UV and phleomycin treatments (Figure 3-6 and Figure 3-7). This resistance growth phenotype of the strain expressing Cdc48A from the P2 promoter strengthens the suggestion that Cdc48A is involved in DNA repair pathways, which are important for cell

survival. The mutant strain of samp1 (HM1041) cells present a considerably higher resistance to phleomycin induced DNA damage compared to its parent strain (H26)

(Figure 3-8). The resistance to DNA damage observed in the Δsamp1 strain is thought to be due to increase in samp2 and samp3 which are Ub-like proteins found in H. volcanii.

Transcript Levels Of cdc48a , recj and rnj1 Are Increased During Conditions Of DNA Damage

To determine if Cdc48A is expressed during conditions of DNA repair, cdc48a transcript levels were analyzed after treatment of H26 wild type cells with the DNA damaging agent phleomycin (3 mg/mL) (compared to a mock control). The ribosomal protein 10 gene (rpl10) served as an internal control as its transcript levels were not perturbed by these conditions. From this approach, the transcript levels of cdc48a, rnj1

(RNase J1) and recJ3 were found to be upregulated several-fold by the phleomycin treatment (3.4, 2.7 and 2.68 -fold, respectively; p < 0.05) (Figure 3-5). The transcript levels of recJ4 were also significantly upregulated, but to a lesser extent (1.2-fold, p <

0.05) than those of cdc48a recj3 and rnj1.

Average 1 2 Theoretical Spectrum Coverage Locus tag Mr (kDa) Count (% total) kDa HVO_2380 Cdc48a 82 23 23% 250 * 150 HVO_2889 RecJ4 79 16 27% HVO_1018 RecJ3 70 7 12% 100 HVO_2724 RNase J1 50 67 54% 75

50 * HVO_2724 RNase J1 50 111 60%

Figure 3-1. Cdc48A forms an apparent thiol-sensitive complex with RecJ3/4 and RNase J1 homologs that associates with ubiquitin-like SAMP1. Left, non-reducing SDS-PAGE gel of proteins derived from cell lysate of triplicate cultures of H. volcanii NH02-pJAM957 incubated with ATP that bound beads decorated with BSA (control, lane 1) and SAMP1 (lane 2). The gel was stained with SYPRO Ruby and the regions in lane 1 and 2 indicated by an asterisk (*) were excised and compared by LC-MS/MS analysis. Right, Average total spectrum count and percent coverage of proteins from two independent experiments identified at > 99.99% probability and a false discovery rate (FDR) of < 0.1 %. The 55 kDa band was only excised and analyzed in one of two independent experiments. Proteins were not identified in the BSA control.

Figure 3-2. Cdc48A copurifies with its gene neighbor HVO_2381 (unknown function UPF0272 protein), Cdc48D (HVO_1907), and deoxyhypusine synthase (DHS)(HVO_2297). N-terminal His6-tagged Cdc48A was ectopically expressed from pJAM1409 in H. volcanii H1209 and purified by Ni2+- chromatography. H1209 carrying an empty vector (pJAM202c) served as a control. Left panel-protein fractions were separated by reducing SDS-PAGE. Unique bands were excised (as indicated by brackets) and analyzed by LC- MS/MS. Right panel-proteins identified in the sample at FDR < 0.01% and Mascot score > 60 are listed (none were identified in the control). Cdc48A was detected in all three regions of the gel but was most abundant at 80-100 kDa as indicated.

Figure 3-3. RNase J1, RecJ3 and Cdc48A copurify with RecJ4 from H. volcanii when supplemented with γATP. RecJ4 was ectopically expressed with a C-terminal StrepII tag (RecJ4-StrepII) from plasmid pJAM1405 in H. volcanii H26. RecJ4-StrepII and its protein partners were enriched by Strep-Tactin chromatography. H26 carrying an empty vector (pJAM202c) served as the control. Protein fractions were separated by reducing SDS-PAGE: H26- pJAM1405 (lane 1) and H26-pJAM202c (lane 2). Unique bands were excised (as indicated by the brackets) and analyzed by LC-MS/MS. Left panel is the gel image of RecJ4 pull down with empty vector. Proteins identified in the sample at FDR < 0.01% and protein threshold > 99 % probability are listed. Average of two independent experiments of two biological replicates. For details, see Table 3-2 and Methods.

Figure 3-4. RecJ4, RecJ3 and Cdc48A co-purify with RNase J1. RNase J1 was ectopically expressed with a C-terminal StrepII tag in H. volcanii H26- pJAM1406 and purified by StrepTactin chromatography. H26 carrying an empty vector (pJAM202c) served as a control. Protein fractions were separated by reducing SDS-PAGE: H26-pJAM1406 (lane 2) and H26- pJAM202c (lane 1). Unique bands were excised (as indicated by brackets) and analyzed by LC-MS/MS. Proteins identified in the sample at an FDR < 0.01% and a protein threshold of > 99 % probability are listed. For details, see Table. 3-2.

4.5

4.0 *

3.5 * 3.0 *

2.5 3.4

geneexpression 2.0 2.7 * 1.5 2.68

1.0 1.24 Normalized 0.5

0.0 rnj1 recj4 cdc48a recj3

Figure 3-5. cdc48a, rnj1 and recJ3 transcript levels are increased several-fold by treatment of cells with a DNA damaging agent. Normalized expression of cdc48a (Cdc48A, HVO_2380), rnj1 (RNase J1, HVO_2724) recJ4 (RecJ4, HVO_2889) and recJ3 ( RecJ3, HVO_1018) genes after treatment with phleomycin relative to the mock control. mRNA levels were determined by qRT-PCR and normalized to the transcript level of the internal standard rpl10 (see methods for details). Data represent mean results. Error bars represent SEM from 2 independent experiments and three technical replicates (*p< 0.05 determined by two-tailed, unpaired Student’s t test; N=4 for HVO_2380,N=5 for HVO_1018 and N = 6 for HVO_2724 and HVO_2889).

UV dosage in J/M2

0 20 40 60 80 100 120 1.0E+00

1.0E-01

1.0E-02

1.0E-03

Fraction Fraction of Cell Survival 1.0E-04

1.0E-05 Parent Δcdc48a

Δcdc48a:complement Δcdc48a:empty vector

Figure 3-6. Ectopic expression of Cdc48A promotes hypertolerance to UV stress. The ectopic expression of Cdc48A in trans from a strong promoter in pJAM1410 in a Δcdc48a (H1999) background exhibits a hyper resistance phenotype when subjected to UV dosage (0, 50, 75, 80, 85 100 J/M2). The Δcdc48a mutant (H1999) shows a growth defect when compared to its parent (H164). In each case average and SEM of N=3 independent experiments are shown.

Phleomycin concentration mg/ml 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.0E+00

1.0E-01

1.0E-02 Fraction Fraction ofSurvival Cell

1.0E-03

1.0E-04 parent Δcdc48a

Figure 3-7. Ectopic expression of Cdc48A promotes hypertolerance to DNA damage. The ectopic expression of Cdc48A in trans from a strong promoter in pJAM1410 in a Δcdc48a (H1999) background exhibits a hyper resistance phenotype when subjected to phleomycin (0, 0.5, 0.75, 1 , 1.5 mg/mL ). The Δcdc48a mutant (H1999) shows a growth defect when compared to its parent (H164). In each case average and SEM of N=6 independent experiments are shown.

Phleomycin concentration mg/ml 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.0E+00

1.0E-01

1.0E-02

1.0E-03 Fraction of Cell Survival Cell of Fraction

1.0E-04 H26 ΔS1

Figure 3-8. An H. volcanii Δsamp1 mutant (HM1041) shows resistance to phleomycin induced DNA damage .The Δsamp1 strain exhibits a resistance to DNA damage chemically induced by a radiomimetic drug phleomycin. SEM of N=4 independent experiments are shown.

Figure 3-9. Chemical inhibitor of Cdc48-type ATPases slightly impairs growth and considerably impairs pigmentation of H. volcanii. H. volcanii wildtype (H26) cells were inoculated from log phase into ATCC 974 medium (200 rpm, 50 mL culture in 250 mL baffled flasks). Cells were treated with the Cdc48 inhibitor N2,N4-bis(phenylmethyl)-2,4-quinazolinediamine (11 μM DBeQ) (○) or the mock control (●) at 14 h as indicated by down-arrow. Growth curves and pigmentation after 60 h growth are presented on left and right, respectively. Results have been experimentally reproduced at least in triplicate.

Figure 3-10. Cdc48A substrate trap mutant QQ shows a noticeably different copurification profile. The substrate trap QQ variant of Cdc48A and wild type were ectopically expressed with a N-His6 tag from H1209. The Ni-column enrichment of wildtype and QQ variant of Cdc48A (represented by a bracket) using equal amount of cell material (2.75 µg) showed a different copurification profile. The proteins that copurify with QQ variant migrate between 60kDa to 75 kDa (represented by an arrow). The wildtype Cdc48A has proteins that predominantly copurify at 75kDa to 100 kDa (represented by a triangle).

Figure 3-11. Gene homologs of cdc48a and rada/b are in genomic synteny in Archaea. The synteny was observed in species of haloarchaea and methanogens with representative examples depicted above. Homologs of CBS domain proteins predicted to bind adenosyl group ligands such as AMP, ATP and S-AdoMet and proteins of unknown function from orthologous groups arCOG03142 and arCOG02701 are also conserved in this region. Archaea, such as Acidilobus saccharovorans, have cdc48A homologs in genomic synteny with 20S proteasome beta subunit genes.

Figure 3-12. Cdc48A and identification of potential partner and substrate proteins. Cdc48A is found to interact with Ub like SAMP1, RecJ4, RecJ3, RNase J1, and homologs of RNA polymerase subunit’s RpoA1 and RpoA2. The predicted role of RecJ and RNase J homolog in prokaryotes and reported role of yeast Cdc48 in remodeling stalled RNA polymerase complex suggests that the complex of proteins identified in this interactome are involved in a DNA damage response. The origin of the arrow points to the bait protein and the arrow head points to the partner proteins that were copurified in the experiment.

RNase J

Figure-3-13. Proposed model of the role of Cdc48A from H. volcanii in DNA damage repair. Cdc48A and SAMP1 associate with RpoA1subunit of stalled RNA polymerase. The RecJ3 protein process the damaged DNA and the RecJ4 protein functions as a scaffold for complex assembly. RNase J like protein degrades the nascent mRNA. The posttranslation modification of RpoA1, the partner proteins that recruit Cdc48A to RpoA1 and the fate of RpoA1 are the questions that remain to be answered.

Figure 3-14. Structural model of HvRecJ3 compared to x-ray crystal structure of the active site of the Thermus thermophilus RecJ exonuclease. The 3D structural model of HvRecJ 3 was generated by Phyre2-based homology modeling and compared to the x-ray crystal structure of Thermus thermophilus RecJ exonuclease (PDB: 1IR6 chain A). Active site residues that coordinate the catalytic Mn2+ ion are shown and colors of the ribbon diagrams for the proteins are indicated by cyan for H. volcanii RecJ3 model and blue for T. thermophilus RecJ exonuclease.

Figure 3-15. Structural model of HvRecJ4 compared to x-ray crystal structure of the active site of the Thermus thermophilus RecJ exonuclease. The 3D structural model of HvRecJ 4 was generated by Phyre2-based homology modeling and compared to the x-ray crystal structure of Thermus thermophilus RecJ exonuclease (PDB: 1IR6 chain A). Active site residues that coordinate the catalytic Mn2+ ion are shown and colors of the ribbon diagrams for the proteins are indicated as green for H. volcanii RecJ4 model and blue for T. thermophilus RecJ exonuclease.Only a single aspartic acid residue (Asp386) is conserved in Hv RecJ4.

Figure 3-16. Structural model of H. volcanii RNase J compared to x-ray crystal structure of the active site of the B. subtilis RNase J1. The 3D structural model of Hv RNase J was generated by Phyre2-based homology modeling and compared to the x-ray crystal structure of B. subtilis RNase J (PDB: 3ZQ4). Active site residues that coordinate the catalytic Mn2+ ion are shown and colors of the ribbon diagrams for the proteins are indicated.as cyan for H. volcanii RNase J1 and purple for T. thermophilus RNase J1. (Residues are numbered according to H. volcanii RNase J1).

Table 3-1. Partner proteins identified from Strep-Cdc48A pull down Homolog Gene locus tag Deduced Mr Ratio of total unique Coverage% description (kDa) spectral count(sample/control)

Cdc48A HVO_2380 82 43.45 43,47

RecJ4 HVO_2889 79 4 4

RpoA1 HVO_0349 109 4,3 4,5

Table 3-2. H. volcanii Cdc48a-SAMP1 interactome detected by LC-MS/MS analysis. Protein Locus tag Bait Strain for Theoretical Observed Spectral count Observed detected by Description purification Mr (kDa) Mr (kDa) ratio (Sample: coverage MS control) (%)

HVO_2889 RecJ4 RecJ4-StrepII (in trans) H26-pJAM1405 79 100 4.0 81 HVO_1018 RecJ3 RecJ4-StrepII (in trans) H26-pJAM1405 70 100 1.8 51 HVO_2380 Cdc48A RecJ4-StrepII (in trans) H26-pJAM1405 82 100 4.8 59 HVO_2889 RecJ4 RecJ4-StrepII (in trans) H26-pJAM1405 79 75-100 30.5 93 HVO_2889 RecJ4 RecJ4-StrepII (in trans) H26-pJAM1405 79 75-100 + 6.2 39 250 HVO_2724 RNaseJ1 RecJ4-StrepII (in trans) H26-pJAM1405 50 75-100 5.5 57 HVO_2724 RNaseJ1 RecJ4-StrepII (in trans) H26-pJAM1405 50 75-100 + 3.8 73 250 HVO_1018 RecJ3 RecJ4-StrepII (in trans) H26-pJAM1405 70 75-100 81.0 74 HVO_1018 RecJ3 RecJ4-StrepII (in trans) H26-pJAM1405 70 75-100 + 19.5 62 250 HVO_2380 Cdc48A RecJ4-StrepII (in trans) H26-pJAM1405 82 75-100 + 6.5 29 250 HVO_2380 Cdc48A Flag-His-SAMP1 (purified) NH03-pJAM957 82 250 37.0 56 HVO_2380 Cdc48A Flag-His-SAMP1 (purified) NH03-pJAM957 82 250 9.0 13 HVO_2724 RNaseJ1 Flag-His-SAMP1 (purified) NH03-pJAM957 50 250 31.0 48 HVO_2724 RNaseJ1 Flag-His-SAMP1 (purified) NH03-pJAM957 50 250 103.0 60 HVO_2724 RNaseJ1 Flag-His-SAMP1 (purified) NH03-pJAM957 50 50 111.0 60

Table 3-2 Continued Protein Locus tag Bait Strain for Theoretical Mr Observed Mr Spectral count Observed detected by MS Description purification (kDa) (kDa) ratio (Sample: coverage (%) control) HVO_2889 RecJ4 Flag-His-SAMP1 (purified) NH03-pJAM957 79 250 17.0 28 HVO_2889 RecJ4 Flag-His-SAMP1 (purified) NH03-pJAM957 79 250 14.0 26 HVO_1018 RecJ3 Flag-His-SAMP1 (purified) NH03-pJAM957 70 250 6.0 10 HVO_1018 RecJ3 Flag-His-SAMP1 (purified) NH03-pJAM957 70 250 8.0 14 HVO_2380 Cdc48A Flag-SAMP1 (in trans)1 H26-pJAM947 82 n.a. 14.0 25 HVO_2380 Cdc48A Flag-SAMP1 (in trans)1 H26-pJAM947 82 n.a. 16.0 11 HVO_2380 Cdc48A Flag-SAMP1 (in trans)1 HM1096-pJAM947 82 n.a. 4.0 8 HVO_2380 Cdc48A Flag-SAMP1 (in trans)1 HM1096-pJAM947 82 n.a. 5.0 29 HVO_2889 RecJ4 Flag-SAMP1 (in trans)1 HM1052-pJAM947 79 n.a. 4.0 7 HVO_2889 RecJ4 Flag-SAMP1 (in trans)1 HM1052-pJAM947 79 n.a. 3.0 12 HVO_2889 RecJ4 Flag-SAMP1 (in trans)1 H26-pJAM947 79 n.a. 5.0 8 HVO_2889 RecJ4 Flag-SAMP1 (in trans)1 H26-pJAM947 79 n.a. 6.0 4 HVO_2724 RNaseJ1 Flag-SAMP1 (in trans)1 HM1052-pJAM947 50 n.a. 3.0 24 HVO_2724 RNaseJ1 Flag-SAMP1 (in trans)1 HM1052-pJAM947 50 n.a. 8.0 20 HVO_2724 RNaseJ1 Flag-SAMP1 (in trans)1 H26-pJAM947 50 n.a. 2.0 20 HVO_2724 RNaseJ1 Flag-SAMP1 (in trans)1 H26-pJAM947 50 n.a. 6.0 6 HVO_0349 RpoA1 Flag-SAMP1 (in trans)1 H26-pJAM947 109 n.a. HVO_2619 SAMP1 Flag-SAMP1 (in trans)1 All strains- pJAM947 HVO_2380 Cdc48A Cdc48A-StrepII (in trans) H26-pJAM1400 82 75-100 11.0 39

Table 3-2 Continued Protein Locus tag Bait Strain for Theoretical Observed Spectral count Observed detected by Description purification Mr (kDa) Mr (kDa) ratio (Sample: coverage MS control) (%)

HVO_2889 RecJ4 Cdc48A-StrepII (in trans) H26-pJAM1400 79 75-100 4.0 4 HVO_0349 RpoA1 Cdc48A-StrepII (in trans) H26-pJAM1400 109 75-100 4.0 4 HVO_0349 RpoA1 Cdc48A QQ-StrepII (in H26-pJAM1403 109 75-100 3.0 5 trans) HVO_2380 Cdc48A* Cdc48A QQ-StrepII (in H26-pJAM1403 109 75-100 trans) HVO_2724 RNAseJ1 RNAseJ1-StrepII bait H26-Pjam1406 50 50 202.0 32 HVO_2889 RecJ4 RNAseJ1-StrepII bait H26-Pjam1406 79 75-100 132 44 HVO_1018 RecJ3 RNAseJ1-StrepII bait H26-Pjam1406 70 75-100 5.0 8 HVO_0350 RpoA2 RNAseJ1-StrepII bait H26-Pjam1406 46 50 9.0 21 1Flag-SAMP1 (in trans) data based on previous study (123).

Table 3-3. Cdc48 protein partners/substrates of DNA repair in eukaryotes and their archaeal homologs. Cdc48/p97 protein partner/ Orthologous Archaeal homologs Ref. substrate of DNA repair* group(s) (H. volcanii) L3MBTL1; histone H4-K20 IPR016858 None (116) methyltransferase (Q22795) Rad52 (P06778) IPR004585 None (58) DNA-PK; DNA activated protein KOG0891; None (128) kinase EC:2.7.11.1 (P78527) COG5032 DDB2 (Q92466); DNA damage IPR001680 WD40 repeat proteins (57) recognition subunit (none) XPC (Q01831); DNA damage COG5535 None (57) recognition subunit CSB or ERCC-6; Cockayne syndrome group A and B proteins; COG0553 Helicase, SNF2/RAD54 (129) ATP-dependent helicase involved IPR000330 family (HVO_A0078) in DNA excision repair [EC:3.6.4.-] Rpb1 or RPO21; RNA polymerase RPA′ (HVO_0349) COG0086 (50) II largest subunit (P04050) RPA″ (HVO_0350) CDT1; Cell division cycle protein IPR014939 None (130) Rad25/UvrB (HVO_A0441, WRNp; Werner protein of the IPR004589 HVO_2269, HVO_0029, (131) RecQ helicase family (Q14191) IPR006935 HVO_1598, HVO_1723, HVO_1736) Mcm7; DNA replication licensing factor (P33993) [indirect evidence IPR031327 MCM (HVO_0220) (132) for binding Cdc48/p97; associated with replisome disassembly] *UniProt numbers included for some of the examples; HVO_ gene locus tag numbers included for apparent H. volcanii homologs.

CHAPTER 4 BIOCHEMICAL CHARACTERIZATION OF CDC48 IN ARCHAEA

Introduction

Cdc48A in Haloferax volcanii is a structural homolog of eukaryotic Cdc48 which is a AAA-ATPase (17). The domains responsible for ATP hydrolysis in AAA-ATPases are D1 and D2 domains (133), and they are conserved in the Cdc48A from H. volcanii.

The motifs responsible for ATP binding are Walker A, and that for ATP hydrolysis are

Walker B (12); which are conserved in Cdc48A. The Cdc48A from H. volcanii has a conserved C- terminal Hb[Y/F]X motif (where Hb refers to hydrophobic and X refers to any residue). The Hb[Y/F]X is conserved in AAA-ATPases that are demonstrated to associate with the proteasome and facilitate efficient hydrolysis of the substrate proteins by docking and opening of the gate of the 20S coreparticle which results in substrate entry and degradation (134). Proteasome activating nucleotidase (PAN) is the only characterized AAA-ATPase from the model archaeon H. volcanii so far.(109, 135, 136).

The PAN associates to form a dodecamer and hydrolyzes ATP in a salt dependent manner (109). The PAN is also shown to recognize and interact with Ub-like SAMP1 modified substrate proteins (109). In this study we aim to characterize Cdc48A, the universal AAA-ATPase in archaea; some archaea do not encode PAN homologs. To date, only one archaeal homolog of eukaryotic Cdc48 has been characterized and it is from the archaeon Thermoplasma acidophilum (117). This lack of biochemical information is a limitation in comprehensive understanding of the role of Cdc48 like proteins in archaea. In this study we aim to characterize a homolog of Cdc48; Cdc48A from the model organism H. volcanii in terms of oligomerization, factors necessary for

ATP hydrolysis, identification of residues that are responsible for ATP hydrolysis and determine its ability to stimulate the degradation of proteasomal substrate.

Materials and Methods

Modelling and Alignment Of Cdc48A

The 3D structure of Cdc48A was modelled by submitting its amino acid sequence

GI 490143273 to the Phyre2 protein folding recognition server (137). Sequence alignment was done using Clustal omega online sequence alignment tool (138) and edited using BioEdit biological sequence alignment editor version 7.05. GenBank ID’s of the amino acid sequences of Cdc48A and its homologs used for sequence alignment GI

1431189 (yeast), GI 7415 (human), GI 26952 (mouse) and GI 1916752 (Thermoplasma acidophilum).

Cloning, Culture and Purification Of Cdc48A From H. volcanii

The primers used in amplifying Cdc48A are NdeI HVO_2380 forward primer and

BlpI HVO_2380 reverse primer as indicated in Table 2-2. Genomic DNA (H26) was used as a template for amplification of Cdc48A. Genomic DNA extractions for the template of PCR reactions were done by spooling technique (Halohandbook). The PCR product of 2.24 Kb size amplified from genomic DNA was ligated into NdeI and BlpI sites of pJAM 503. Plasmid DNA was extracted by QIAprep Spin Miniprep kit (Qiagen,

Valencia, CA). The HVO_2380 gene was cloned into the pJAM503 vector to generate a pJAM1409 plasmid for expressing the Cdc48A gene with an N-His6-tag linked with a thrombin cleavage site. The PCR reactions were optimized according to standard methods using an iCycler (BioRad Laboratories). Phusion DNA high fidelity polymerase was used for cloning and Taq DNA polymerase was used for screening clones with

Cdc48A insertions. DNA fragments were separated by 0.8-2% (w/v) agarose gel

electrophoresis (90 V, 30 min) in TAE buffer [40 mM Tris, 20 mM acetic acid, 1 mM ethylenediaminetetraacetic acid (EDTA), pH 8.0]. Ethidium bromide was used for gel staining at a concentration of 0.25 μg∙mL-1. A Mini visionary imaging system

(FOTODYNE, Hartland, WI) was used for visualizing the gels. Hi-Lo DNA molecular weight markers (Minnesota Molecular, Minneapolis, MN) were used as a reference for comparison of the size of the DNA. The DNA fragments were isolated directly from PCR by MinElute PCR purification (Qiagen) or from 0.8 % (w/v) SeaKem GTG agarose (FMC

Bioproducts, Rockland, ME) gels in TAE buffer at pH 8.0 using the QIAquick gel extraction kit (Qiagen) as needed. The fidelity of DNA plasmid constructs was verified by Sanger DNA Sequencing .(Eton Bioscience Inc., NC).

The Cdc48A (HVO_2380) was ectopically expressed with N terminal His6 tag

(His6-.Cdc48A) from a strong P2 promoter using plasmid pJAM1409 in H. volcanii pitA replacement strain H1209 to avoid His rich PitA contamination during nickel column chromatography.The replacement strain H1209 is constructed by replacing His rich H. volcanii pitA with Natronomonas pharonis pitA. H. volcanii (H1209-pJAM 1409) was cultured in ATCC974 medium supplemented with novobiocin (0.2 µg/mL Nv) at 42°C and grown to stationary phase (OD600nm 2.5-3.0) (4 x 800-mL cultures in 2.8-liter

Fernbach flasks) . Cells were harvested by centrifugation (10-15 min at 9,200 × g and

25°C ). Cell pellets were resuspended in 18 mL of sodium phosphate buffer [10 mM sodium phosphate, pH 7.6, 2 M NaCl, 4 µg∙mL-1 DNase, 40 mM imidazole and 1 minitablet protease inhibitor cocktail (Roche- 05892791001) per 10 mL buffer. Cells were lysed by passage through a French Press (three times at 2,000 psi). Whole cell lysate was clarified by centrifugation (30 min at 9,200 × g and 4°C) and sequential

filtration using 0.8 µm and 0.2 µm cellulose acetate filters (Thermo Scientific Nalgene).

Clarified cell lysate was applied to a HisTrap HP column (5 mL, 17-141 5248-01, GE

Healthcare) pre-equilibrated and washed in 40 mL of sodium posphate buffer supplemented with 40 mM imidazole, 1 mM ATP, and 5 mM MgCl2.

Fractions containing His6-Cdc48A were eluted in sodium phosphate buffer supplemented with 500 mM imidazole, 1 mM ATP, and 5 mM MgCl2. The His6-Cdc48A was further purified by size exclusion chromatography (SEC) in which protein at a concentration of 700 µg/mL (500 µL) was applied at a flow rate of 0.3 mL·min-1 to a

Superose 6 10/300 GL column (GE 149 Healthcare) equilibrated in HEPES buffer (50 mM HEPES, 2M NaCl, 1 mM ATP, 5 mM MgCl2 supplemented with freshly made 1 mM

DTT). The purity of Cdc48A (33 µg/mL) from the SEC column was assessed by reducing SDS-PAGE and LC MS/MS.

Construction and Purification Of Substrate Trap Mutant Of Cdc48A

A Cdc48A variant was constructed by mutating the conserved Glu (E 290,563 ) residues in the Walker B motifs of the AAA ATPase D1 and D2 domains. The conserved

Glu (E) residues in the D1 and D2 domains of Cdc48A were mutated to Gln (Q)

QQ generating a His6-Cdc48A variant (Cdc48A E290Q, E563Q). Site-directed mutagenesis (SDM) was performed according to Q5 site-directed mutagenesis kit (New

England Biolabs, Ipswich, MA) protocols. Plasmid pJAM1409 (N-His6-Cdc48A) was isolated from E. coli TOP10 and used as the template for PCR with SDM forward and reverse primer pairs. Primer sequences (HVO_2380 QE fw, HVO_2380 QE rv,

HVO_2380 EQ fw, HVO_2380 EQ rv) used in SDM are listed in Table2-2. The His6-

Cdc48AQQ variant was expressed ectopically from plasmid pJAM 1411 in H1209 strain of H.volcanii and enriched by Ni-column chromatography using methods as described

previously for the His6-Cdc48A Ni-column purification. The Ni column enriched Cdc48A and Cdc48AQQ were dialysed in high salt HEPES buffer (50 mM HEPES, 2M NaCl, 1 mM ATP, 5 mM MgCl2 supplemented with freshly made 1 mM DTT) using columns from the mini dialysis kit with membrane cutoff 1 kDa (80648375, GE Healthcare). Protein concentrations were measured using BCA assay using BSA as standards.

ATPase Hydrolysis Activity Assay

Hydrolysis of adenosine triphosphate (ATP) by Cdc48A was determined by the Pi released, as detected by malachite green assay (139). Reagents were prepared in nanopure water (Barnstead/Thermolyne Nanopure lab water system) to minimize Pi.

Unless otherwise noted, the standard reactions were in high-salt buffer (2M NaCl and

50 mM HEPES, 1mM DTT, 20 mM MgCl2, pH 7.6) with ATP as the substrate at a concentration of 0.8 mM. To determine the Km and Vmax of Cdc48A, the ATP concentrations were 0.5 mM, 1 mM, 1.5 mM, 2 mM and 2.5 mM. Reaction mixtures (200

µL total) contained 0.165 µg of pure Cdc8A for specific activity, 0.1 µg of pure Cdc48A for Km and Vmax measurements, 0.03 µg of pure Cdc48A with 0.5M ATP for optimum temperature (using 25ºC, 37ºC, 47ºC and 61ºC to determine the optimum), 0.165 µg of pure Cdc48A for optimum MgCl2 concentration (based on 1 mM, 10 mM, 20 mM, 25 mM and 30 mM MgCl2) and 0.0825 µg of pure Cdc48A for optimum pH (using buffers at pH

6, 7.18, 8.25, 9.37 and 10). The Ni column enrichments of His6-Cdc48A and His6-

Cdc48A QQ variant dialysed against high salt HEPES buffer were used in the assay to compare enzyme activity. The total protein concentration of 0.5 µg of the Cdc48A and

Cdc48AQQ Ni column enrichment were used in the malachite assay to compare the ATP hydrolysis activity. Cdc48 reactions were initiated by addition of ATP and were incubated for 10 min at 42°C unless otherwise noted. To rule out non-specific hydrolysis

of ATP and/or Pi contamination of the enzyme preparation, the ATP and Cdc48A were incubated separately at the same conditions indicated above. After incubation, the reaction mixture (200 µL) was stopped by addition of 50 µL of color reagent to determine the Pi levels released by ATP hydrolysis. The color reagent was prepared by mixing: 2.5 mL of 14% (w/v) (NH4)2MoO4 and 0.2 mL of 11% (v/v) Tween 20 in 10 mL of a solution containing 1.67 mL conc. sulfuric acid, 8.33 mL nanopure H2O, and 12.22 mg malachite green. The formation of (MG +) (H2PMo12 O40) (where MG + represents ionized malachite green) was monitored at A650nm (BioTek, Synergy HTEX Multi-Mode reader). Phosphate standards were made by dissolving KH2PO4 ( Fisher, P285-500 ) in molecular biology grade water to a concentration of 0.1 mM and then diluting the stock to 50 µM, 25 µM, 10 µM, 7.5 µM and 5 µM KH2PO4. The standards (200 µL) were mixed with 50 µL of the color reagent, and the absorbance was measured immediately at

A650nm. The (NH4)2MoO4 was freshly prepared while the other individual components of the color reagent were stored at room temperature. The color reagent mixture once prepared was used within 12 h. All reactions were performed in atleast triplicate and experimental replicate. The values presented are averages and the error bars are a measure of SEM. The protein concentrations of Cdc48A were measured by reducing agent compatible BCA kit (Pierce, 23250) using BSA as the standard.

Peptide Hydrolysis Assay

Peptide hydrolyzing activity of the 20S proteasome with or without Cdc48A were assayed by fluorimetric measurement of the release of 7-amino-4-methylcoumarin from

Suc-Leu-Leu-Val-Tyr-AMC peptide substrate (Enzo Life Sciences) at 45°C for 25 minutes (one reading per minute). The assay mixture of the total volume (0.15 mL) contained 20S proteasome 10 µg), Cdc48A (0.165 µg) of freshly thawed stock of

concentration 33 µg/mL from -80°C and 150 µg of fluorigenic substrate (5mg/mL, 100 %

DMSO stock) in high salt buffer (50 mM Tris-HCl, 2M NaCl) supplemented with 1 mM

ATP and 20 mM MgCl2 (pH 7.2). The blanks were set up by incubating substrate alone to eliminate fluorescence from autohydrolysis of the substrate and any peptidases in the reagents used. Standards for the peptide hydrolysis assay were prepared from amino-4- methylcoumarin (AMC) (Sigma, A9891). A stock solution of 100 mM was made by measuring out 8.8 grams in 0.5 mL of 100% DMSO. The 100mM stock of AMC was serially diluted to 1 mM (10 µL 100mM AMC stock in 990 µL water) and 10 µM final concentration in molecular biology grade water dH2O (10 µL 1mM AMC stock in 990 µL water). AMC Standards were prepared from the 10 µM AMC stock by further diluting them in dH2O to the following concentrations 0 nM, 0.25 nM, 0.5 nM, 1.0 nM, 1.25 nM ,

1.5 nM, 2.0 nM and 4.0 nM. All the stocks were made in Eppendorf tubes covered with aluminium foil to avoid light from interfering with fluorescence of the AMC. The stock solutions and dilutions were made fresh on the day of the assay as the half life of AMC in DMSO at room temperature is 30 minutes. A total volume of 150 µL for each standard and reaction was used to measure fluorescence at λ excitation 360 nm and λ emission 460nm at 45°C in dark Costar 96-well black clear bottom plates ( Daigger scientific,

EF86610A3603). To plot the standard curve fluorescence was measured in triplicate for each concentration of standard. The protein concentration reported in the peptide hydrolysis assay was determined by the bicinchoninic acid method and reducing agent compatible BCA kit (Pierce, 23250 ) using bovine serum albumin as the standard.

Results

Cdc48A Is A Structural Homolog Of Eukaryotic Cdc48 With A Conservation In Key Amino Acid Residues

Cdc48A structure was modelled by phyre2 720 of the 736 amino acids residues

(97%) were modelled to an accuracy of >90% using Cdc48 from the archaeaon

T.acidophilum (PDB :5G4G,VAT) and other homologs of eukaryotic Cdc48s as a template. When the structure was overlaid with the monomeric structure of the mammalian Cdc48 (PDB: 5C19). The N-terminal domain, N-D1 linker and D1-ATPase of Cdc48A overlaid closely with that of the mammalian Cdc48 (Figure 4-1).Conservation of key residues in Cdc48A was seen on aligning the amino acid sequence from Cdc48A

(H. volcanii) to that of the its homologs from yeast (S. cerivisae), humans (H. sapiens), mouse (M. musculus) and archaeon (T. acidophilum). Cdc48A consists of N- terminal domain, D1 and D2 ATP hydrolysis domain and a C-terminal HbYX motif (H- hydrophobic residue, X-any residue). The amino acid residue K in the Walker A motif and the amino acid E residue in the Walker B motif were well conserved in the Cdc48A and its eukaryotic and archaeal homologs (Figure 4-2).

Cdc48A Was Purified As A Homo Multimeric Complex

Cdc48A was expressed with an N-His6 tag and purified from H. volcanii using a two column purification approach. The Cdc48A in initial Ni-column enrichment, when visualized on a 10% reducing SDS gel was found to migrate at MW≈100kDa as compared to its theoretical MW 83.4 kDa. The Proteins that copurified with Cdc48A upon Ni-column enrichment migrated predominantly between 50-75 kDa (Figure 4-3).

The Ni-column enrichment fractions were further purified by Superose 6 column chromatography to estimate the size of Cdc48A. The Cdc48A from this SEC column

eluted at a volume (Ve) of 8.1 mL which was lesser than the elution volume (Ve) of Blue dextran standard (Mw 2000 kDa) which eluted at 8.48 mL (Figure 4-4a). Thus Cdc48A is purified potentially as a large multimeric complex or as an aggregate (theoretical Mw is 83.4kDa, multimeric complex of >24 monomers). The elution from SEC column was identified as Cdc48A by the LC-MS/MS (Figure 4-4 b).

Catalytic Activity Of Cdc48A Was Influenced By pH and Conserved Glutamate Residues In Walker B Motif

The N-His6 Cdc48A purified from Ni column and SEC column was found to be catalytically active in hydrolyzing ATP. The specific activity of Cdc48A 4.35 µ moles min-

1 -1 mg , Km for ATP hydrolysis was 0.80 mM ATP and Vmax of Cdc48A enzyme was found to be, 6.89 µmoles of Pi min-1 mg-1. Cdc48A was found to be active between

25°C-61°C (Figure 4-5). The enzyme was optimally active at a neutral pH 7.2 and a loss in activity above pH 8.0 was found. A 50% loss in enzyme activity of Cdc48A was

QQ observed at pH 10.0 (Figure 4-6). The His6-Cdc48A variant of Cdc48A, which was constructed by mutating the conserved Walker B Glu (E 290,563) residues to Gln (Q

290,563 ) residues showed a 61.8% decrease in its ability to hydrolyze ATP when compared to that of its wild type.Cdc48A (Figure 4-7).

Cdc48A Does Not Activate The 20S Proteasome Mediated Cleavage Of The Substrate Suc-LLVY-AMC

The fluorigenic Suc-LLVY-Amc was used as a substrate to measure the peptide hydrolysis activity of the 20S proteasome from H volcanii. The tetrapeptide hydrolysis was measured by the fluorescence of Amc released from the cleavage of the substrate peptide. Cdc48A does not activate the peptide hydrolysis of the 20S proteasome in the case of Suc-LLVY-Amc substrate. Which suggests that Cdc48A mediated activation of

proteasomal substrate degradation may not be necessary for simple and small peptide substrates such as tetrapeptide Suc-LLVY-AMC (Figure 4-8).

Figure 4-1. Cdc48A is a structural homolog of well characterized mammalian Cdc48 (PDB:5C19). The hexameric structure of mammalian Cdc48 is represented on the left. The six subunits are represented in different colors. To the right Cdc48A structure is modelled in Phyre2 where it utilized VAT a Cdc48 homolog in T.acidophilum (PDB:5G4G ) as the template. The 3D model of Cdc48A overlays closely with that of the monomer of the mammalian Cdc48 (PDB: 5C19) in the N-terminal domain, N-D1 linker and the D1 ATPase domain.

Figure 4-2. Cdc48A from H. volcanii shows conservation of key residues with other AAA ATPases. The residues involved in ATP binding in the Walker A motif and ATP hydrolysis in the Walker B motif of the D1 and D2 domains are conserved in Cdc48A, eukaryotic Cdc48 protein and in the archaeon T. acidophilum referred to as VAT in the sequence alignment.

Figure 4-3. The N-His6 tagged Cdc48A protein purification from H. volcanii. (Left panel) Protein (5 µg) was separated by 10% reducing SDS-PAGE and stained with Coomasie blue. His6 -tagged Cdc48A migrated at ≈100kDa (estimated MW 83.4 kDa). The proteins that enrich with Cdc48A were estimated to be between 50 -75 kDa. (Right panel) Immunoblot of Ni-His6-tagged Cdc48A using anti His6 antibody.

Figure 4-4. Cdc48A was purified as a multimeric complex.The Ni column enriched fractions of Cdc48A were subjected to Size Exclusion Chromatography (SEC). To estimate its size standards Blue dextran (2000 kDa), thyroglobulin (660 kDa), ferretin (474 kDa) and alcohol dehydrogenase (141 kDa) were run on the SEC column. Based on the elution profile of Cdc48A in panel A it forms a multimeric complex. The SEC eluted multimeric complex of Cdc48A was identified to be pure by LC-MS/MS analysis.The LC-MS/MS peptide coverage is represented by green highlight in the Cdc48A protein sequence in panel b.

120

100

% Relative activity activity Relative % 40

0 0 10 20 30 40 50 60 70 Temperature °C

Figure 4-5. Cdc48A ATPase activity as a function of temperature. ATPase activity of Cdc48A was measured by the release of inorganic phosphate at different temperatures 25 ºC, 37 ºC, 47 ºC, and 61 ºC.

120

100

40 Relative Activity Relative Activity % 20

0 5 7 9 11 pH

Figure 4-6. Effect of pH on the ATPase activity of Cdc48A. ATPase activity of Cdc48A was measured by the release of inorganic phosphate at different pH of the assay buffer (pH 6, 7.18, 8.25, 9.37 and 10).

120

100 100

40 38.1 Relative Activity Relative Activity %

0 Cdc48A (QQ) mutant Cdc48A

Figure 4-7. Substrate trap His6-Cdc48A(QQ) variant of Cdc48A shows decreased ATP hydrolysis activity. His6-Cdc48A(QQ) variant and wildtype Cdc48A were ectopically expressed from H1209 strain and enriched by Ni-column.The ATP hydrolysis of His6-Cdc48A(QQ) variant and wildtype Cdc48A were measured using malachite green assay. The substrate trap mutant His6-Cdc48A(QQ) shows 61.8% decrease in ATP hydrolysis activity. %Relativity on the Y-axis is relative to that of the wildtype. Average and SEM of N=3 independent experments is shown.

Suc-LLVY-AMC peptide hydrolysis

2.5

1.5

0.5

Pico Pico mol/min/mg of20S proteasome 0 Cdc48A+Proteasome Proteasome

Figure 4-8. Cdc48A does not show any increase in proteasome mediated SUC-LLVY tetrapeptide hydrolysis. Facilitation of peptide hydrolyzing capability of Cdc48A was quantified using peptide hydrolyzing colorimetric assay where 7- amino-4-methylcoumarine(AMC) release from the synthetic peptide was measured. Cleavage of fluorescent tetra peptide Suc-LLVY-AMC (150 µg ) by 20S proteasome purified from H. volcanii (10 μg) and 20S proteasome supplemented with or without Cdc48A (0.165 μg) were performed at 45°C and assayed by changes in fluorescence (excitation 380nm;emission 460nm). Cdc48A did not activate the proteasome mediated peptide clevage. Values represented in the graph are means and error bars are SEM from 3 technical replicates of 3 independent experiments.

Table 4-1. Comparison of Vmax and Km values of AAA-ATPases Protein name Organism Vmax Km Refrence -1 -1 nmol min mg ( µM ATP ) Cdc48A H. volcanii 6890 800 This study p97 X. laevis 720 nd (140) Cdc48 S. cerevisiae n.d 550 (141) Hamster Ovary 67 650 (142) NSF AAA-D2 6 110 (143) AAA-D1 257 43300 (143) Vps4p S. cerevisiae 448 nd (144) Vhs4p S. cerevisiae 7 5 (145) SUG1 (Rpt6p) Rat liver 7 35 (146) 26S proteasome Rabbit 19 15 (147) reticulocytes 19S (RP) Rabbit 34 30 (147) reticulocytes ARC R. erythropolis 268 200 (148) ClpA E. coli 5000 210 (149) ClpB E. coli 50-100 1100 (150) ClpX E. coli 500 500 (151) FtsH E. coli 230-549 80-83 (152) Hv PAN H. volcanii 7.8 438 μM ± 30 (109) VAT T.acidophilum 350 2590 (117, 153, 154) Mj PAN M.jannaschii 3500 497 (118)

Nd, not determined

CHAPTER 5 SUMMARY CONCLUSIONS AND FUTURE DIRECTIONS

Summary and Conclusion

This study reveals archaeal Cdc48A and its partner proteins identified in this study are associated with oxidative stress and DNA damage based on several lines of evidence. 1) Repeated identification of the interactome (Cdc48A, SAMP1, RecJ3/4,

RNase J and RNA Pol homologs) when cells are grown in mild oxidizing conditions 2)

Genomic synteny of homologs of Cdc48A in archaea.with DNA repair proteins and predicted role of archaeal RecJ3/4 in DNA repair 3) The significant increase in transcript levels of cdc48a, recj3 and rnj1 and modest increase in recj4.when subjected to DNA damage 4) Phenotypes observed in Δcdc48a and Δsamp1 mutants.when subjected to

DNA damage.

The partner proteins of Cdc48A were initially identified when Ub-like SAMP1 was used as a bait to pull down a complex of Cdc48A, RecJ like proteins and RNase J in an

ATP dependent fashion under mild oxidizing conditions (Figure 3-1). Reciprocal tagging of the proteins under mild oxidizing conditions led to the repeated identification of the complex (Cdc48A, RecJ3, RecJ4, and RNase J) as well as the RNA polymerase subunits RpoA1 and RpoA2 thus providing strong indication of complex formation

(Figure 3-3, 3-4,3-12, Table 3-1 and Table 3-2). A previous study in H. volcanii also reports increased abundance of Cdc48A in response to treatment with oxidizing agent.

Oxidation is known to induce DNA damage (155). SAMP1 was shown to be responsive to both mild and strong oxidizing agents in previous studies (123, 155). SAMP1 is also previously shown to associate with RNA Pol subunits (RpoA1, RpoA2) and proteins involved in archaeal DNA repair like Rad50 and RadA when subjected to oxidative

stress (123). RecJ3 protein identified in the interactome is a homolog of bacterial RecJ demonstrated to be involved in DNA repair pathways in bacteria (62). The active site residues necessary for nuclease activity are conserved between bacterial RecJ and

RecJ3 identified in this study (Figure 3-14). RecJ3 levels in H. volcanii were reported to be increased in response to oxidative stress in a previous study (155). RecJ4 protein identified in the interactome is predicted to be a catalytically inactive protein due to lack of conserved residues with bacterial RecJ (Figure 3-15). RecJ4 in this study is thought to act as a scaffold and mediate complex formation due to the presence of an insertion loop. The insertion loop observed in RecJ4 is similar to that found in RecJ like Cdc45 which interacts with partner proteins to form CMG complex (Cdc45-Mcm-Gins) (86).

RNase J which is also a component of the interactome is predicted to be a homolog of bacterial RNase J1 (Figure 3-16) which is a ribonuclease.(93). RNase J was shown to associate with RpoA2 (RNA polymerase subunit) in this study (Figure 3-3). Based on its conservation of active site residues with the bacterial ribonuclease and association with

RpoA2 in an oxidizing environment, RNase J is predicted to degrade nascent mRNA transcripts that are produced by RNA polymerase. Based on the evidence from this study, which is supported by observations made from the above mentioned studies we suggest that the interactome of (Cdc48A, SAMP1, RecJ3/4 and RNase J1) is formed in response to oxidative stress.

Cdc48A is found in genomic synteny with RadA/B. Cdc48A in haloarchaea and methanogenic archaea cluster with RadA/RadB proteins (Figure 3-11). RadA/RadB are reported to be involved in DNA repair in archaea.(156). Genes cluster together in certain cases to regulate their co-transcription and to contribute proteins for the

formation of a complex, which is involved in a pathway. The co-clustering of Cdc48A in this case with RadA/RadB in halophilic and methanogenic archaea suggests that

Cdc48A might be involved in a DNA repair pathway.

Increase in transcript levels of cdc48a, recj3/4 and rnj1 are observed in this study when cells are subjected to DNA damage by phleomycin (Figure 3-5). Phleomycin introduces random breaks in DNA by intercalating the DNA strands (157). The transcript levels of recJ like genes were also increased in Halobacterium species when cells were subjected to UV mediated damage (158). Based on the increase in gene expression of cdc48a, recj3/4, rnj1 when subjected to DNA damage this study suggests that the expression of these genes is necessary for DNA damage response.

The Δcdc48a strain is slightly sensitive to DNA damage induced by phleomycin and UV when compared to its parent. The ectopic expression of Cdc48A from a strong constitutive promoter leads to a resistance to DNA damage (UV, Phleomycin) (Figure 3-

6, 3-7). The data suggests that Cdc48A is important for cells to cope with DNA damage.

The Δsamp1 mutant was shown to be highly resistant against phleomycin induced DNA breaks in this study (Figure 3-8). This study hypothesizes that when subjected to severe

DNA damage the samp1 gene expression in the Δsamp1 mutant can be compensated by over expression of samp2 or samp3. The rationale behind the ability of SAMP2 and

SAMP3 to compensate for SAMP1 which are all homologs of ubiquitin, is that residues involved in interaction of ubiquitin with its protein partners are conserved in its archaeal homologs SAMP1, SAMP2 and SAMP3 (Ub-Ile44, SAMP1-L60, SAMP2-L44 and

SAMP3-L65) (10, 159).

Based on the experimental evidence obtained in this study and the reported role of

Cdc48 and its homologs involvement in DNA repair from previous studies (9, 50), this study proposes a model of the role of the complex (Cdc48A, SAMP1, RecJ3/4, RNase

J1 and RNA polymerase subunits) formed in H. volcanii. When H. volcanii cells are subjected to DNA damage transcribing RNA polymerase is potentially stalled upon encountering damaged DNA template. To overcome this hurdle, RpoA1, a subunit of

RNA polymerase, is proposed to be extracted by Cdc48A in association with Ubiquitin like SAMP1. The DNA in the exposed chromatin can be processed by RecJ3 which is predicted to be an active nuclease preparing the DNA template for DNA repair pathways. The RecJ4 is predicted to be involved in assembling the component proteins of the complex. The mRNA from the stalled RNA polymerase is proposed to be degraded by RNase J which can be reused for mRNA synthesis (Figure 3-12).

Cdc48A is an active AAA-ATPase and residues important for ATP hydrolysis are identified in this study. The biochemical characterization of Cdc48A from H. volcanii provides evidence that it purifies as a homoligomeric complex (Figure 4-4) which is highly active in hydrolyzing ATP (Table 4-1). The enzyme activity is dependent on temperature and pH. Optimal ATPase activity of Cdc48A was observed at 42°C (Figure

4-6) which is also the optimal growth temperature of H. volcanii. The highest activity of the enzyme was reported at pH 7.2 (Figure 4-6). The conserved Glu290 and Glu536 of

Cdc48A are important for the ATP hydrolysis activity. The QQ mutant of Cdc48A shows a 61.8% decrease in activity (Figure 4-7) when compared to that of its wildtype. The

Cdc48AQQ mutant is engineered by substituting conserved glutamic acid residues to glutamine in the Walker B motifs of D1 and D2 domains of Cdc48A (E290Q, E563Q)

(Figure 4-2). The conserved Glu residue in mammalian Cdc48 is shown to contribute to the overall stability of the nucleotide binding pocket and replacement of this with a Gln residue perturbs the hydrolysis of the bound nucleotide (160). The presence of residual

QQ activity observed in the ectopically expressed His6Cdc48A purified from H. volcanii is suggested to be due to the presence of Cdc48A expressed from the genome. The Ni- column purified Cdc48AQQ is a mixture of wildtype Cdc48A expressed from the genome and the His6 tagged Cdc48A expressed ectopically.

Cdc48A does not activate the proteasome mediated hydrolysis of the synthetic substrate tested in this study. The C-terminal of the hexameric Cdc48 was shown to interact with the 20S particle of the proteasome to facilitate gate opening resulting in the enhanced cleavage of substrate peptide (161). The 20S proteasome was shown to actively cleave Suc-LLVY-AMC peptide in a previous study in H. volcanii as it is a relatively small tetrapeptide (162), however insulin chain B and β-caesin are shown to be barely cleaved by the 20S proteasome in the same study. The insulin chain B and β- caesin were thought to aggregate in the high salt buffers used in the study, which can make them inaccessible to be processed by the 20S proteasome. The insulin chain B and β-caesin are ideal candidates to be tested in this study as the Cdc48A with its robust ATPase activity can remodel these aggregated substrates, making them accessible to be processed by the 20S proteasome.

Future Directions

Identification of substrates of Cdc48A and posttranslational modification of substrates necessary to recruit Cdc48A to facilitate DNA repair is necessary to identify the role of Cdc48A in DNA repair in H. volcanii . Both the substrate and the posttranslational modification responsible can be identified by using the His6 tagged

QQ QQ Cdc48A ;as a bait. The His6 tagged Cdc48A will be expressed in the Δcdc48a background to eliminate wildtype Cdc48A which decreases the chance of trapping

QQ QQ substrates. The cells ectopically expressing Cdc48A (Δcdc48a:His6Cdc48A ) are subjected to DNA damaging agent [phleomycin or methyl methane sulfonate (MMS)] and enriched for proteins that associate with His6Cdc48A using Ni-column affinity purification approach.

For further Characterization of the Cdc48A enzyme, obtaining uniform oligomeric state of Cdc48A is important for Electron Microscopy and other structure visualization techniques. Cdc48 homologs are shown to purify as hexamers or dodecamers. The multioligomeric form in which Cdc48A purifies in this study is likely due the disulfide bridges formed between Cys674 residues of the Cdc48A monomers. Substituting the purification buffers with Ni-column compatible reducing agent TCEP (tris(2- carboxyethyl)phosphine) and adding glycerol to the purification buffers will be steps taken to minimize any unnatural oligomerization. Further characterization of the purified

Cdc48A enzyme at different salt concentrations to see if the enzyme is active at a lower salt concentration is important. Presence of enzyme activity at a lower salt concentration confers the archaeal molecular chaperones like Cdc48A with theraupetic potential in neurodegenerative diseases caused by aggregation or misfolded proteins

(163). To test if eukaryotic Cdc48 inhibitors like DBeQ (164) are effective in abolishing the ATPase activity of Cdc48A in vitro is another future direction. This study reports that

DBeQ has an in vivo effect on cell growth and color (Figure 3-9) supplementing this finding with in vitro analysis of the effect of DBeQ on Cdc48A will help us to demonstrate the importance of Cdc48A in the physiology of H. volcanii. Mutations in

eukaryotic Cdc48 are identified in several genetic diseases and cancers; hence, Cdc48 is a target for drugs and therapeutics which includes inhibitors, gene therapy vectors etc

(17). Cdc48A from H. volcanii with its similarity in domain architecture and conservation of residues involved in nucleotide binding and hydrolysis has a potential to be a candidate in the preliminary drug screens to test candidate drugs.

100

LIST OF REFERENCES

1. Woese CR & Fox GE (1977) Phylogenetic structure of the prokaryotic domain: the primary kingdoms. Proc Natl Acad Sci U S A 74(11):5088-5090.

2. Magrum LJ, Luehrsen KR, & Woese CR (1978) Are extreme halophiles actually "bacteria"? J Mol Evol 11(1):1-8.

3. Adam PS, Borrel G, Brochier-Armanet C, & Gribaldo S (2017) The growing tree of Archaea: new perspectives on their diversity, evolution and ecology. ISME J 11(11):2407-2425.

4. White MF & Allers T (2018) DNA repair in the archaea-an emerging picture. FEMS Microbiol Rev 42(4):514-526.

5. Rampelotto PH (2013) Extremophiles and extreme environments. Life (Basel) 3(3):482-485.

6. Kelman Z & White MF (2005) Archaeal DNA replication and repair. Curr Opin Microbiol 8(6):669-676.

7. van Wolferen M, Wagner A, van der Does C, & Albers SV (2016) The archaeal Ced system imports DNA. Proc Natl Acad Sci U S A 113(9):2496-2501.

8. Jackson SP & Durocher D (2013) Regulation of DNA damage responses by ubiquitin and SUMO. Mol Cell 49(5):795-807.

9. Torrecilla I, Oehler J, & Ramadan K (2017) The role of ubiquitin-dependent segregase p97 (VCP or Cdc48) in chromatin dynamics after DNA double strand breaks. Philos Trans R Soc Lond B Biol Sci 372(1731).

10. Humbard MA, et al. (2010) Ubiquitin-like small archaeal modifier proteins (SAMPs) in Haloferax volcanii. Nature 463(7277):54-60.

11. Moir D, Stewart SE, Osmond BC, & Botstein D (1982) Cold-sensitive cell- division-cycle mutants of yeast: isolation, properties, and pseudoreversion studies. Genetics 100(4):547-563.

12. Wendler P, Ciniawsky S, Kock M, & Kube S (2012) Structure and function of the AAA+ nucleotide binding pocket. Biochim Biophys Acta 1823(1):2-14.

13. Koller KJ & Brownstein MJ (1987) Use of a cDNA clone to identify a supposed precursor protein containing valosin. Nature 325(6104):542-545.

14. Zhang L, Ashendel CL, Becker GW, & Morre DJ (1994) Isolation and characterization of the principal ATPase associated with transitional endoplasmic reticulum of rat liver. J Cell Biol 127(6 Pt 2):1871-1883.

101

15. Mouysset J, Kähler C, & Hoppe T (2006) A conserved role of Caenorhabditis elegans CDC-48 in ER-associated protein degradation. J Struct Biol 156(1):41- 49.

16. Zhang SH, Liu J, Kobayashi R, & Tonks NK (1999) Identification of the cell cycle regulator VCP (p97/CDC48) as a substrate of the band 4.1-related protein- tyrosine phosphatase PTPH1. J Biol Chem 274(25):17806-17812.

17. Ye Y, Tang WK, Zhang T, & Xia D (2017) A Mighty "Protein Extractor" of the Cell: Structure and Function of the p97/CDC48 ATPase. Front Mol Biosci 4:39.

18. Peters JM, Walsh MJ, & Franke WW (1990) An abundant and ubiquitous homo- oligomeric ring-shaped ATPase particle related to the putative vesicle fusion proteins Sec18p and NSF. EMBO J 9(6):1757-1767.

19. Rouiller I, Butel VM, Latterich M, Milligan RA, & Wilson-Kubalek EM (2000) A major conformational change in p97 AAA ATPase upon ATP binding. Mol Cell 6(6):1485-1490.

20. Rancour DM, Park S, Knight SD, & Bednarek SY (2004) Plant UBX domain- containing protein 1, PUX1, regulates the oligomeric structure and activity of arabidopsis CDC48. J Biol Chem 279(52):54264-54274.

21. Stolz A, Hilt W, Buchberger A, & Wolf DH (2011) Cdc48: a power machine in protein degradation. Trends Biochem Sci 36(10):515-523.

22. Ogura T & Wilkinson AJ (2001) AAA+ superfamily ATPases: common structure-- diverse function. Genes Cells 6(7):575-597.

23. Bodnar N & Rapoport T (2017) Toward an understanding of the Cdc48/p97 ATPase. F1000Res 6:1318.

24. Wolf DH & Stolz A (2012) The Cdc48 machine in endoplasmic reticulum associated protein degradation. Biochim Biophys Acta 1823(1):117-124.

25. Nishikori S, Esaki M, Yamanaka K, Sugimoto S, & Ogura T (2011) Positive cooperativity of the p97 AAA ATPase is critical for essential functions. J Biol Chem 286(18):15815-15820.

26. Barthelme D, Chen JZ, Grabenstatter J, Baker TA, & Sauer RT (2014) Architecture and assembly of the archaeal Cdc48*20S proteasome. Proc Natl Acad Sci U S A 111(17):E1687-1694.

27. Wang Q, Song C, & Li CC (2003) Hexamerization of p97-VCP is promoted by ATP binding to the D1 domain and required for ATPase and biological activities. Biochem Biophys Res Commun 300(2):253-260.

102

28. Song C, Wang Q, & Li CC (2003) ATPase activity of p97-valosin-containing protein (VCP). D2 mediates the major enzyme activity, and D1 contributes to the heat-induced activity. J Biol Chem 278(6):3648-3655.

29. Yeung HO, et al. (2014) Inter-ring rotations of AAA ATPase p97 revealed by electron cryomicroscopy. Open Biol 4:130142.

30. Noi K, et al. (2013) High-speed atomic force microscopic observation of ATP- dependent rotation of the AAA+ chaperone p97. Structure 21(11):1992-2002.

31. Rouiller I, et al. (2002) Conformational changes of the multifunction p97 AAA ATPase during its ATPase cycle. Nat Struct Biol 9(12):950-957.

32. Pye VE, et al. (2006) Going through the motions: the ATPase cycle of p97. J Struct Biol 156(1):12-28.

33. Zhang X, et al. (2000) Structure of the AAA ATPase p97. Mol Cell 6(6):1473- 1484.

34. Davies JM, Tsuruta H, May AP, & Weis WI (2005) Conformational changes of p97 during nucleotide hydrolysis determined by small-angle X-Ray scattering. Structure 13(2):183-195.

35. Banerjee S, et al. (2016) 2.3 Å resolution cryo-EM structure of human p97 and mechanism of allosteric inhibition. Science 351(6275):871-875.

36. Huang R, et al. (2016) Unfolding the mechanism of the AAA+ unfoldase VAT by a combined cryo-EM, solution NMR study. Proc Natl Acad Sci U S A 113(29):E4190-4199.

37. Rothballer A, Tzvetkov N, & Zwickl P (2007) Mutations in p97/VCP induce unfolding activity. FEBS Lett 581(6):1197-1201.

38. Rumpf S & Jentsch S (2006) Functional division of substrate processing cofactors of the ubiquitin-selective Cdc48 chaperone. Mol Cell 21(2):261-269.

39. Jentsch S & Rumpf S (2007) Cdc48 (p97): a "molecular gearbox" in the ubiquitin pathway? Trends Biochem Sci 32(1):6-11.

40. Meyer H, Bug M, & Bremer S (2012) Emerging functions of the VCP/p97 AAA- ATPase in the ubiquitin system. Nat Cell Biol 14(2):117-123.

41. Baek GH, et al. (2013) Cdc48: a swiss army knife of cell biology. J Amino Acids 2013:183421.

42. Zhao G, et al. (2007) Studies on peptide:N-glycanase-p97 interaction suggest that p97 phosphorylation modulates endoplasmic reticulum-associated degradation. Proc Natl Acad Sci U S A 104(21):8785-8790.

103

43. Li G, Zhao G, Schindelin H, & Lennarz WJ (2008) Tyrosine phosphorylation of ATPase p97 regulates its activity during ERAD. Biochem Biophys Res Commun 375(2):247-251.

44. Schuberth C & Buchberger A (2008) UBX domain proteins: major regulators of the AAA ATPase Cdc48/p97. Cell Mol Life Sci 65(15):2360-2371.

45. Stapf C, Cartwright E, Bycroft M, Hofmann K, & Buchberger A (2011) The general definition of the p97/valosin-containing protein (VCP)-interacting motif (VIM) delineates a new family of p97 cofactors. J Biol Chem 286(44):38670- 38678.

46. Bruderer RM, Brasseur C, & Meyer HH (2004) The AAA ATPase p97/VCP interacts with its alternative co-factors, Ufd1-Npl4 and p47, through a common bipartite binding mechanism. J Biol Chem 279(48):49609-49616.

47. Smith MH, Ploegh HL, & Weissman JS (2011) Road to ruin: targeting proteins for degradation in the endoplasmic reticulum. Science 334(6059):1086-1090.

48. Fang L, et al. (2015) Mitochondrial function in neuronal cells depends on p97/VCP/Cdc48-mediated quality control. Front Cell Neurosci 9:16.

49. Hemion C, Flammer J, & Neutzner A (2014) Quality control of oxidatively damaged mitochondrial proteins is mediated by p97 and the proteasome. Free Radic Biol Med 75:121-128.

50. Verma R, Oania R, Fang R, Smith GT, & Deshaies RJ (2011) Cdc48/p97 mediates UV-dependent turnover of RNA Pol II. Mol Cell 41(1):82-92.

51. Defenouillère Q, et al. (2013) Cdc48-associated complex bound to 60S particles is required for the clearance of aberrant translation products. Proc Natl Acad Sci U S A 110(13):5046-5051.

52. Rape M, et al. (2001) Mobilization of processed, membrane-tethered SPT23 transcription factor by CDC48(UFD1/NPL4), a ubiquitin-selective chaperone. Cell 107(5):667-677.

53. Papadopoulos C, et al. (2017) VCP/p97 cooperates with YOD1, UBXD1 and PLAA to drive clearance of ruptured lysosomes by autophagy. EMBO J 36(2):135-150.

54. Mosbech A, et al. (2012) DVC1 (C1orf124) is a DNA damage-targeting p97 adaptor that promotes ubiquitin-dependent responses to replication blocks. Nat Struct Mol Biol 19(11):1084-1092.

55. van den Boom J, et al. (2016) VCP/p97 Extracts Sterically Trapped Ku70/80 Rings from DNA in Double-Strand Break Repair. Mol Cell 64(1):189-198.

104

56. Maric M, Maculins T, De Piccoli G, & Labib K (2014) Cdc48 and a ubiquitin ligase drive disassembly of the CMG helicase at the end of DNA replication. Science 346(6208):1253596.

57. Puumalainen MR, et al. (2014) Chromatin retention of DNA damage sensors DDB2 and XPC through loss of p97 segregase causes genotoxicity. Nat Commun 5:3695.

58. Bergink S, et al. (2013) Role of Cdc48/p97 as a SUMO-targeted segregase curbing Rad51-Rad52 interaction. Nat Cell Biol 15(5):526-532.

59. Vaz B, Halder S, & Ramadan K (2013) Role of p97/VCP (Cdc48) in genome stability. Front Genet 4:60.

60. Bug M & Meyer H (2012) Expanding into new markets--VCP/p97 in endocytosis and autophagy. J Struct Biol 179(2):78-82.

61. Kirchner P, Bug M, & Meyer H (2013) Ubiquitination of the N-terminal region of caveolin-1 regulates endosomal sorting by the VCP/p97 AAA-ATPase. J Biol Chem 288(10):7363-7372.

62. Han ES, et al. (2006) RecJ exonuclease: substrates, products and interaction with SSB. Nucleic Acids Res 34(4):1084-1091.

63. Viswanathan M & Lovett ST (1998) Single-strand DNA-specific exonucleases in Escherichia coli. Roles in repair and mutation avoidance. Genetics 149(1):7-16.

64. Burdett V, Baitinger C, Viswanathan M, Lovett ST, & Modrich P (2001) In vivo requirement for RecJ, ExoVII, ExoI, and ExoX in methyl-directed mismatch repair. Proc Natl Acad Sci U S A 98(12):6765-6770.

65. Hill SA (2000) Neisseria gonorrhoeae recJ mutants show defects in recombinational repair of alkylated bases and UV-induced pyrimidine dimers. Mol Gen Genet 264(3):268-275.

66. Estévez Castro CF, Serment-Guerrero JH, & Fuentes JL (2018) Influence of uvrA, recJ and recN gene mutations on nucleoid reorganization in UV-treated Escherichia coli cells. FEMS Microbiol Lett 365(11).

67. Morimatsu K & Kowalczykowski SC (2014) RecQ helicase and RecJ nuclease provide complementary functions to resect DNA for homologous recombination. Proc Natl Acad Sci U S A 111(48):E5133-5142.

68. Li MJ, et al. (2017) The crystal structure of Pyrococcus furiosus RecJ implicates it as an ancestor of eukaryotic Cdc45. Nucleic Acids Res 45(21):12551-12564.

69. Schmier BJ, Nelersa CM, & Malhotra A (2017) Structural Basis for the Bidirectional Activity of Bacillus nanoRNase NrnA. Sci Rep 7(1):11085.

105

70. D'Angelo A, et al. (2004) Prune cAMP phosphodiesterase binds nm23-H1 and promotes cancer metastasis. Cancer Cell 5(2):137-149.

71. Wurst H & Kornberg A (1994) A soluble exopolyphosphatase of Saccharomyces cerevisiae. Purification and characterization. J Biol Chem 269(15):10996-11001.

72. Gajadeera CS, Zhang X, Wei Y, & Tsodikov OV (2015) Structure of inorganic pyrophosphatase from Staphylococcus aureus reveals conformational flexibility of the active site. J Struct Biol 189(2):81-86.

73. Feng L, et al. (2018) The trimeric Hef-associated nuclease HAN is a 3'→5' exonuclease and is probably involved in DNA repair. Nucleic Acids Res 46(17):9027-9043.

74. Cheng K, et al. (2016) Structural basis for DNA 5 -end resection by RecJ. Elife 5:e14294.

75. Wakamatsu T, et al. (2010) Structure of RecJ exonuclease defines its specificity for single-stranded DNA. J Biol Chem 285(13):9762-9769.

76. Sutera VA, Jr., Han ES, Rajman LA, & Lovett ST (1999) Mutational analysis of the RecJ exonuclease of Escherichia coli: identification of phosphoesterase motifs. J Bacteriol 181(19):6098-6102.

77. Yamagata A, Kakuta Y, Masui R, & Fukuyama K (2002) The crystal structure of exonuclease RecJ bound to Mn2+ ion suggests how its characteristic motifs are involved in exonuclease activity. Proc Natl Acad Sci U S A 99(9):5908-5912.

78. Ivancic-Bace I, Salaj-Smic E, & Brcic-Kostic K (2005) Effects of recJ, recQ, and recFOR mutations on recombination in nuclease-deficient recB recD double mutants of Escherichia coli. J Bacteriol 187(4):1350-1356.

79. Corrette-Bennett SE & Lovett ST (1995) Enhancement of RecA strand-transfer activity by the RecJ exonuclease of Escherichia coli. J Biol Chem 270(12):6881- 6885.

80. Lovett ST & Clark AJ (1984) Genetic analysis of the recJ gene of Escherichia coli K-12. J Bacteriol 157(1):190-196.

81. Cao Z, Mueller CW, & Julin DA (2010) Analysis of the recJ gene and protein from Deinococcus radiodurans. DNA Repair (Amst) 9(1):66-75.

82. Jiao J, et al. (2012) Function and biochemical characterization of RecJ in Deinococcus radiodurans. DNA Repair (Amst) 11(4):349-356.

83. Sharma V, et al. (2016) Oxidative stress at low levels can induce clustered DNA lesions leading to NHEJ mediated mutations. Oncotarget 7(18):25377-25390.

106

84. Cheng K, et al. (2016) Structural basis for DNA 5´-end resection by RecJ. Elife 5:e14294.

85. Yi GS, et al. (2017) Two Archaeal RecJ Nucleases from Methanocaldococcus jannaschii Show Reverse Hydrolysis Polarity: Implication to Their Unique Function in Archaea. Genes (Basel) 8(9).

86. Oyama T, et al. (2016) Atomic structure of an archaeal GAN suggests its dual roles as an exonuclease in DNA repair and a CMG component in DNA replication. Nucleic Acids Res 44(19):9505-9517.

87. Zhao Y, et al. (2015) Structural insights into catalysis and dimerization enhanced exonuclease activity of RNase J. Nucleic Acids Res 43(11):5550-5559.

88. Even S, et al. (2005) Ribonucleases J1 and J2: two novel endoribonucleases in B.subtilis with functional homology to E.coli RNase E. Nucleic Acids Res 33(7):2141-2152.

89. Madhugiri R & Evguenieva-Hackenberg E (2009) RNase J is involved in the 5'- end maturation of 16S rRNA and 23S rRNA in Sinorhizobium meliloti. FEBS Lett 583(14):2339-2342.

90. Mathy N, et al. (2007) 5'-to-3' exoribonuclease activity in bacteria: role of RNase J1 in rRNA maturation and 5' stability of mRNA. Cell 129(4):681-692.

91. Kunst F, et al. (1997) The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390(6657):249-256.

92. Koslover DJ, et al. (2008) The crystal structure of the Escherichia coli RNase E apoprotein and a mechanism for RNA degradation. Structure 16(8):1238-1244.

93. Condon C (2010) What is the role of RNase J in mRNA turnover? RNA Biol 7(3):316-321.

94. Levy S, Portnoy V, Admon J, & Schuster G (2011) Distinct activities of several RNase J proteins in methanogenic archaea. RNA Biol 8(6):1073-1083.

95. Zheng X, Feng N, Li D, Dong X, & Li J (2017) New molecular insights into an archaeal RNase J reveal a conserved processive exoribonucleolysis mechanism of the RNase J family. Mol Microbiol 106(3):351-366.

96. Hausmann S, et al. (2017) Both exo- and endo-nucleolytic activities of RNase J1 from Staphylococcus aureus are manganese dependent and active on triphosphorylated 5'-ends. RNA Biol 14(10):1431-1443.

97. Linder P, Lemeille S, & Redder P (2014) Transcriptome-wide analyses of 5'-ends in RNase J mutants of a gram-positive pathogen reveal a role in RNA maturation, regulation and degradation. PLoS Genet 10(2):e1004207.

107

98. Chen X, Liu N, Khajotia S, Qi F, & Merritt J (2015) RNases J1 and J2 are critical pleiotropic regulators in Streptococcus mutans. Microbiology 161(Pt 4):797-806.

99. Li de la Sierra-Gallay I, Zig L, Jamalli A, & Putzer H (2008) Structural insights into the dual activity of RNase J. Nat Struct Mol Biol 15(2):206-212.

100. Pei XY, Bralley P, Jones GH, & Luisi BF (2015) Linkage of catalysis and 5' end recognition in ribonuclease RNase J. Nucleic Acids Res 43(16):8066-8076.

101. Dorléans A, et al. (2011) Molecular basis for the recognition and cleavage of RNA by the bifunctional 5'-3' exo/endoribonuclease RNase J. Structure 19(9):1252-1261.

102. Cline SW, Lam WL, Charlebois RL, Schalkwyk LC, & Doolittle WF (1989) Transformation methods for halophilic archaebacteria. Can J Microbiol 35(1):148- 152.

103. Green R & Rogers EJ (2013) Transformation of chemically competent E. coli. Methods Enzymol 529:329-336.

104. Allers T, Ngo HP, Mevarech M, & Lloyd RG (2004) Development of additional selectable markers for the halophilic archaeon Haloferax volcanii based on the leuB and trpA genes. Appl Environ Microbiol 70(2):943-953.

105. Hepowit NL, et al. (2016) Mechanistic insight into protein modification and sulfur mobilization activities of noncanonical E1 and associated ubiquitin-like proteins of Archaea. FEBS J 283(19):3567-3586.

106. Fu X, et al. (2016) Ubiquitin-Like Proteasome System Represents a Eukaryotic- Like Pathway for Targeted Proteolysis in Archaea. MBio 7(3).

107. Allers T, Barak S, Liddell S, Wardell K, & Mevarech M (2010) Improved strains and plasmid vectors for conditional overexpression of His-tagged proteins in Haloferax volcanii. Appl Environ Microbiol 76(6):1759-1769.

108. Miranda HV, et al. (2011) E1- and ubiquitin-like proteins provide a direct link between protein conjugation and sulfur transfer in archaea. Proc Natl Acad Sci U S A 108(11):4417-4422.

109. Prunetti L, et al. (2014) Structural and biochemical properties of an extreme 'salt- loving' proteasome activating nucleotidase from the archaeon Haloferax volcanii. Extremophiles 18(2):283-293.

110. Ye Y, Meyer HH, & Rapoport TA (2001) The AAA ATPase Cdc48/p97 and its partners transport proteins from the ER into the cytosol. Nature 414(6864):652- 656.

108

111. Wu X, Li L, & Jiang H (2016) Doa1 targets ubiquitinated substrates for mitochondria-associated degradation. J Cell Biol 213(1):49-63.

112. Tanaka A, et al. (2010) Proteasome and p97 mediate mitophagy and degradation of mitofusins induced by Parkin. J Cell Biol 191(7):1367-1380.

113. Radhakrishnan SK, den Besten W, & Deshaies RJ (2014) p97-dependent retrotranslocation and proteolytic processing govern formation of active Nrf1 upon proteasome inhibition. Elife 3:e01856.

114. Shcherbik N & Haines DS (2007) Cdc48p(Npl4p/Ufd1p) binds and segregates membrane-anchored/tethered complexes via a polyubiquitin signal present on the anchors. Mol Cell 25(3):385-397.

115. Verma R, Oania RS, Kolawa NJ, & Deshaies RJ (2013) Cdc48/p97 promotes degradation of aberrant nascent polypeptides bound to the ribosome. Elife 2:e00308.

116. Acs K, et al. (2011) The AAA-ATPase VCP/p97 promotes 53BP1 recruitment by removing L3MBTL1 from DNA double-strand breaks. Nat Struct Mol Biol 18(12):1345-1350.

117. Pamnani V, et al. (1997) Cloning, sequencing and expression of VAT, a CDC48/p97 ATPase homologue from the archaeon Thermoplasma acidophilum. FEBS Lett 404(2-3):263-268.

118. Wilson HL, Ou MS, Aldrich HC, & Maupin-Furlow J (2000) Biochemical and physical properties of the Methanococcus jannaschii 20S proteasome and PAN, a homolog of the ATPase (Rpt) subunits of the eucaryal 26S proteasome. J Bacteriol 182(6):1680-1692.

119. Chamieh H, Marty V, Guetta D, Perollier A, & Franzetti B (2012) Stress regulation of the PAN-proteasome system in the extreme halophilic archaeon Halobacterium. Extremophiles 16(2):215-225.

120. Keller A, Nesvizhskii AI, Kolker E, & Aebersold R (2002) Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Anal Chem 74(20):5383-5392.

121. Nesvizhskii AI, Keller A, Kolker E, & Aebersold R (2003) A statistical model for identifying proteins by tandem mass spectrometry. Anal Chem 75(17):4646- 4658.

122. Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402-408.

109

123. Dantuluri S, et al. (2016) Proteome targets of ubiquitin-like samp1ylation are associated with sulfur metabolism and oxidative stress in Haloferax volcanii. Proteomics 16(7):1100-1110.

124. Dargemont C & Ossareh-Nazari B (2012) Cdc48/p97, a key actor in the interplay between autophagy and ubiquitin/proteasome catabolic pathways. Biochim Biophys Acta 1823(1):138-144.

125. Lassak J, Wilson DN, & Jung K (2016) Stall no more at polyproline stretches with the translation elongation factors EF-P and IF-5A. Mol Microbiol 99(2):219-235.

126. Edenberg ER, Downey M, & Toczyski D (2014) Polymerase stalling during replication, transcription and translation. Curr Biol 24(10):R445-452.

127. Chou TF & Deshaies RJ (2011) Development of p97 AAA ATPase inhibitors. Autophagy 7(9):1091-1092.

128. Jiang N, et al. (2013) Valosin-containing protein regulates the proteasome- mediated degradation of DNA-PKcs in glioma cells. Cell Death Dis 4:e647.

129. He J, Zhu Q, Wani G, Sharma N, & Wani AA (2016) Valosin-containing Protein (VCP)/p97 Segregase Mediates Proteolytic Processing of Cockayne Syndrome Group B (CSB) in Damaged Chromatin. J Biol Chem 291(14):7396-7408.

130. Raman M, Havens CG, Walter JC, & Harper JW (2011) A genome-wide screen identifies p97 as an essential regulator of DNA damage-dependent CDT1 destruction. Mol Cell 44(1):72-84.

131. Partridge JJ, Lopreiato JO, Jr., Latterich M, & Indig FE (2003) DNA damage modulates nucleolar interaction of the Werner protein with the AAA ATPase p97/VCP. Mol Biol Cell 14(10):4221-4229.

132. Moreno SP, Bailey R, Campion N, Herron S, & Gambus A (2014) Polyubiquitylation drives replisome disassembly at the termination of DNA replication. Science 346(6208):477-481.

133. Yedidi RS, Wendler P, & Enenkel C (2017) AAA-ATPases in Protein Degradation. Front Mol Biosci 4:42.

134. Kusmierczyk AR, Kunjappu MJ, Kim RY, & Hochstrasser M (2011) A conserved 20S proteasome assembly factor requires a C-terminal HbYX motif for proteasomal precursor binding. Nat Struct Mol Biol 18(5):622-629.

135. Kirkland PA, Gil MA, Karadzic IM, & Maupin-Furlow JA (2008) Genetic and proteomic analyses of a proteasome-activating nucleotidase A mutant of the haloarchaeon Haloferax volcanii. J Bacteriol 190(1):193-205.

110

136. Kirkland PA & Maupin-Furlow JA (2009) Stabilization of an archaeal DNA-sliding clamp protein, PCNA, by proteasome-activating nucleotidase gene knockout in Haloferax volcanii. FEMS Microbiol Lett 294(1):32-36.

137. Kelley LA, Mezulis S, Yates CM, Wass MN, & Sternberg MJ (2015) The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc 10(6):845- 858.

138. Sievers F, et al. (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7:539.

139. Itaya K & Ui M (1966) A new micromethod for the colorimetric determination of inorganic phosphate. Clin Chim Acta 14(3):361-366.

140. Peters JM, et al. (1992) Ubiquitous soluble Mg(2+)-ATPase complex. A structural study. J Mol Biol 223(2):557-571.

141. Fröhlich KU, Fries HW, Peters JM, & Mecke D (1995) The ATPase activity of purified CDC48p from Saccharomyces cerevisiae shows complex dependence on ATP-, ADP-, and NADH-concentrations and is completely inhibited by NEM. Biochim Biophys Acta 1253(1):25-32.

142. Tagaya M, Wilson DW, Brunner M, Arango N, & Rothman JE (1993) Domain structure of an N-ethylmaleimide-sensitive fusion protein involved in vesicular transport. J Biol Chem 268(4):2662-2666.

143. Morgan A, Dimaline R, & Burgoyne RD (1994) The ATPase activity of N- ethylmaleimide-sensitive fusion protein (NSF) is regulated by soluble NSF attachment proteins. J Biol Chem 269(47):29347-29350.

144. Babst M, Sato TK, Banta LM, & Emr SD (1997) Endosomal transport function in yeast requires a novel AAA-type ATPase, Vps4p. EMBO J 16(8):1820-1831.

145. Lucero HA, Chojnicki EW, Mandiyan S, Nelson H, & Nelson N (1995) Cloning and expression of a yeast gene encoding a protein with ATPase activity and high identity to the subunit 4 of the human 26 S protease. J Biol Chem 270(16):9178- 9184.

146. Makino Y, et al. (1997) SUG1, a component of the 26 S proteasome, is an ATPase stimulated by specific RNAs. J Biol Chem 272(37):23201-23205.

147. Hoffman L & Rechsteiner M (1996) Nucleotidase activities of the 26 S proteasome and its regulatory complex. J Biol Chem 271(51):32538-32545.

148. Wolf S, et al. (1998) Characterization of ARC, a divergent member of the AAA ATPase family from Rhodococcus erythropolis. J Mol Biol 277(1):13-25.

111

149. Hwang BJ, Woo KM, Goldberg AL, & Chung CH (1988) Protease Ti, a new ATP- dependent protease in Escherichia coli, contains protein-activated ATPase and proteolytic functions in distinct subunits. J Biol Chem 263(18):8727-8734.

150. Woo KM, Kim KI, Goldberg AL, Ha DB, & Chung CH (1992) The heat-shock protein ClpB in Escherichia coli is a protein-activated ATPase. J Biol Chem 267(28):20429-20434.

151. Wawrzynow A, et al. (1995) The ClpX heat-shock protein of Escherichia coli, the ATP-dependent substrate specificity component of the ClpP-ClpX protease, is a novel molecular chaperone. EMBO J 14(9):1867-1877.

152. Tomoyasu T, et al. (1995) Escherichia coli FtsH is a membrane-bound, ATP- dependent protease which degrades the heat-shock transcription factor sigma 32. EMBO J 14(11):2551-2560.

153. Jeon SJ, Fujiwara S, Takagi M, & Imanaka T (1999) Pk-cdcA encodes a CDC48/VCP homolog in the hyperthermophilic archaeon Pyrococcus kodakaraensis KOD1: transcriptional and enzymatic characterization. Mol Gen Genet 262(3):559-567.

154. Gerega A, et al. (2005) VAT, the thermoplasma homolog of mammalian p97/VCP, is an N domain-regulated protein unfoldase. J Biol Chem 280(52):42856-42862.

155. McMillan LJ, et al. (2018) Multiplex quantitative SILAC for analysis of archaeal proteomes: a case study of oxidative stress responses. Environ Microbiol 20(1):385-401.

156. Guy CP, et al. (2006) Interactions of RadB, a DNA repair protein in archaea, with DNA and ATP. J Mol Biol 358(1):46-56.

157. Sleigh MJ (1976) The mechanism of DNA breakage by phleomycin in vitro. Nucleic Acids Res 3(4):891-901.

158. McCready S, et al. (2005) UV irradiation induces homologous recombination genes in the model archaeon, Halobacterium sp. NRC-1. Saline Systems 1:3.

159. Miranda HV, et al. (2014) Archaeal ubiquitin-like SAMP3 is isopeptide-linked to proteins via a UbaA-dependent mechanism. Mol Cell Proteomics 13(1):220-239.

160. Orelle C, Dalmas O, Gros P, Di Pietro A, & Jault JM (2003) The conserved glutamate residue adjacent to the Walker-B motif is the catalytic base for ATP hydrolysis in the ATP-binding cassette transporter BmrA. J Biol Chem 278(47):47002-47008.

161. Barthelme D & Sauer RT (2012) Identification of the Cdc48•20S proteasome as an ancient AAA+ proteolytic machine. Science 337(6096):843-846.

112

162. Wilson HL, Aldrich HC, & Maupin-Furlow J (1999) Halophilic 20S proteasomes of the archaeon Haloferax volcanii: purification, characterization, and gene sequence analysis. J Bacteriol 181(18):5814-5824.

163. Brooks C, et al. (2018) Archaeal Unfoldase Counteracts Protein Misfolding Retinopathy in Mice. J Neurosci 38(33):7248-7254.

164. Chou TF, et al. (2011) Reversible inhibitor of p97, DBeQ, impairs both ubiquitin- dependent and autophagic protein clearance pathways. Proc Natl Acad Sci U S A 108(12):4834-4839.

113

BIOGRAPHICAL SKETCH

Swathi Dantuluri was born to Dantuluri Satya Chandra Subramanya Varma and

Dantuluri kamala Devi in 1990. Her birth place was Kakinada, a small town on the east coast of southern India. She later moved to Hyderabad a metropolis and technical hub, completed her schooling there. She moved farther down south for her university studies, attended Vellore Institute of Technology from 2008-2013 and graduated with a master’s in biotechnology. She was a decent but not exceptional student academics wise. She however enjoyed biology classes since high school which led to the choice of life science as her majors in university and an eventualy move to the United States of

America for graduate school. She enjoyed reading fiction, she believed that it can transport a person across the globe and can also take one back and forth in time effortlessly. She enjoyed watching movies especially with her father, preferably comedies irrespective of what language they were made in. She aspired to travel with family and friends, however she believed that there is no place like home. She pursued her PhD under the guidance and mentorship of Dr. Julie Maupin-Furlow at University of

Florida, where she studied the role of Cdc48A a AAA+ ATPase in DNA damage response in halophilic archaeon Haloferax volcanii. Through the course of her graduate career along with experimental skills, she acquired important life skills like cooking and cleaning and made friends for a lifetime. Inorder to expand on the skill sets she acquired through her graduate training she plans to pursue a post doctoral training program. She wants to eventually return to her home country India, and apply her training to solve relevant and prevelant problems like nutrition and disease. Also wants to provide guidance in the form of teaching, management or mentorship to those who are younger and in need.

114