Asymmetric Recognition of Nucleobase Features by DNA Polymerases Written by Travis John Lund Has Been Approved for the Department of Chemistry and Biochemistry

Home , Nucleobase, Nucleoside triphosphate

Asymmetric Recognition of Nucleobase

Features by DNA Polymerases

Travis John Lund

B.S., George Fox University, 2006

A dissertation submitted to the faculty of

The Graduate School of the University of Colorado

in partial fulfillment of the requirements for the degree of

Doctor of Philosophy

Department of Chemistry and Biochemistry

2013

This dissertation entitled: Asymmetric Recognition of Nucleobase Features by DNA Polymerases written by Travis John Lund has been approved for the Department of Chemistry and Biochemistry

______

Dr. Robert Kuchta

______

Dr. Jennifer Kugel

Date: ______

The final copy of this dissertation has been examined by the signatories, and we find that both the content and the form meet acceptable presentation standards of scholarly work in the above mentioned discipline.

Lund, Travis John (Ph.D., Biochemistry)

Asymmetric Recognition of Nucleobase Features by DNA Polymerases

Dissertation directed by Professor Robert Kuchta

This work describes an investigation into the recognition of nucleobase features by several

DNA polymerases. I used of a series of pyrimidine analogues modified at O2, N-3, and N4/O4 to determine how the Klenow fragment of DNA polymerase I, an A family polymerase, and two B family DNA polymerases, human DNA polymerase  and herpes simplex virus I DNA polymerase, choose whether or not to polymerize pyrimidine dNTPs. Removal of these heteroatoms generally impaired polymerization, with the effects varying from mild to severe.

Removing O2 of a pyrimidine dNTP vastly decreased incorporation by these enzymes and also compromised fidelity in the case of C analogues, while removing O2 from the templating base had more modest effects. Removing the Watson-Crick hydrogen bonding groups of N-3 and

N4/O4 greatly impaired polymerization, both of the resulting dNTP analogues as well as polymerization of natural dNTPs opposite these pyrimidine analogues when present in the template strand. Removing O2 from a pyrimidine at the primer 3’-terminus also prohibited extension of the primer. Importantly, these studies indicate that DNA polymerases recognize bases extremely asymmetrically, both in terms of whether they are a purine or pyrimidine and whether they are in the template or are the incoming dNTP. I also describe initial work on the synthesis of a novel dibasic analogue incorporating chemical features whose importance has been demonstrated in this work. These features include the presence of minor groove hydrogen bond acceptors to facilitate extension past the analogue upon its incorporation, as well as the

Watson-Crick hydrogen bonding groups of an A:T pair, since we have seen that the removal or modification of these groups has unpredictable, but often detrimental, effects upon efficient nucleobase incorporation by polymerases.

iii

CONTENTS

I. Introduction and Literature Review...... 1

DNA Replication ...... 1

DNA Polymerase Families ...... 2

Structures of DNA Polymerases ...... 4

Common Mechanisms in DNA Polymerases ...... 8

Nucleobase Features Affecting Efficient Incorporation by DNA Polymerases ...... 10

Novel Base Pairs ...... 19

Conclusion ...... 21

II. B Family DNA Polymerases Asymmetrically Recognize Pyrimidines and Purines ...... 22

Introduction ...... 22

Experimental Procedures ...... 24

Results ...... 26

Role of Watson-Crick hydrogen bonding groups ...... 27

Role of the minor groove hydrogen bond acceptor on a pyrimidine dNTP ...... 30

Role of the minor groove hydrogen bond acceptor on a templating base ...... 34

Discussion and Conclusions ...... 36

III. Pyrimidine Features Play Essential but Asymmetric Roles during Incorporation by Klenow Fragment...... 41

Introduction ...... 41

Experimental Procedures ...... 43

Results ...... 46

Role of O2, N-3, and N4/O4 in incoming pyrimidine triphosphates ...... 47

Role of O2 and N4/O4 in templating pyrimidines ...... 49

Role of the Watson-Crick hydrogen bond between O2 of C and N2 of G ...... 50

Role of O2 in primer extension ...... 51

Discussion and Conclusions ...... 52

IV. Synthesis of a Novel Dibasic Nucleoside Analogue ...... 59

Introduction ...... 59

Design of a Novel Dibasic Nucleoside Analogue...... 61

Synthesis Results and Discussion ...... 63

Future Steps ...... 67

V. Summary and Future Directions ...... 69

Summary of Findings ...... 69

Asymmetry within Polymerase Families ...... 70

Mutagenesis of Key Active Site Residues ...... 72

Design of Novel Base Pairs and Polymerase Inhibitors ...... 73

VI. Bibliography ...... 76

LIST OF TABLES

II. B Family DNA Polymerases Asymmetrically Recognize Pyrimidines and Purines ...... 22

2.1 Natural Base Incorporation ...... 28

2.2 Effects of Watson-Crick Hydrogen Bonding Groups ...... 29

2.3 Effects of O2 in dTTP ...... 32

2.4 Effects of O2 in dCTP ...... 32

2.5 Effects of O2 in the Template...... 34

2.6 Effects of Removing N-3 from a Templating dA ...... 36

III. Pyrimidine Features Play Essential but Asymmetric Roles During Incorporation by Klenow Fragment ...... 41

3.1 DNA Primer-Templates ...... 47

3.2 Pyrimidine Triphosphate Incorporation ...... 48

3.3 Incorporation Against Template Pyrimidines ...... 50

3.4 Incorporation of Purine Analogue Hypoxanthine ...... 51

LIST OF FIGURES

I. Introduction and Literature Review ...... 1

1.1 Structures of A, B, X, Y, and RT family polymerases ...... 6

1.2 Surface of the closed and open complexes of Klentaq1 ...... 8

1.3 The two-metal ion nucleotidyl transfer mechanism of DNA polymerases ...... 10

1.4 Chemical structures and electrostatic potentials of thymine and 2,4-difluorotoluene ...... 11

1.5 Sample nucleobase analogues with removed or modified Watson-Crick hydrogen bonding features ...... 13

1.6 Thymine shape mimics with substituents of varying size ...... 14

1.7 Sample nucleobase analogues lacking shape and hydrogen bonding complementarity ....15

1.8 Purine analogues utilized to probe the roles of specific chemical features of the natural purine nucleobases ...... 17

1.9 Unnatural base pairs currently used in in vitro systems ...... 20

II. B Family DNA Polymerases Asymmetrically Recognize Pyrimidines and Purines ...... 22

2.1 Structures, names, and abbreviations of analogue bases used ...... 27

2.2 Configuration of major and minor grooves in relation to a T:A base pair ...... 31

III. Pyrimidine Features Play Essential but Asymmetric Roles During Incorporation by Klenow Fragment ...... 41

3.1 Structures, names, and abbreviations of analogue bases used ...... 46

IV. Synthesis of a Novel Dibasic Nucleoside Analogue ...... 59

4.1 Chemical and space-filling structures of dPTP and abasic nucleosides X and ϕ ...... 60

4.2 Structure of proposed dibasic (A:T) 2'-deoxyriboside triphosphate ...... 62

4.3 Proposed synthesis of dibasic (A:T) 2'-deoxyriboside triphosphate ...... 63

4.4 Analysis of synthesis step 1 ...... 65

4.5 Modified synthesis of dibasic (A:T) 2'-deoxyriboside triphosphate ...... 66

vii

I. Introduction

DNA REPLICATION

DNA replication is a complex process that is critical for cellular survival and proliferation.

The same basic features of the replication scheme are found repeatedly across the domains of life.

Universal components include DNA helicases, which unwind the DNA helix at the replication fork; single-stranded binding proteins, which bind to ssDNA and protect DNA from degradation and/or prevent reannealing after helicase activity; topoisomerases and gyrases, which relieve

DNA supercoiling and strain; primases, which provide the primer for DNA polymerases to work from; and DNA polymerases, which are responsible for the synthesis of a daughter DNA strand from the template DNA.

Despite the complexity of these cellular DNA replication processes, and despite the fact that the genomes of most organisms are millions or billions of base pairs in length, the overall error rates for genome replication are remarkably low. Three discrete processes contribute to the accuracy of replication. First, replicative DNA polymerases typically exhibit relatively low error frequencies of 10-3 to 10-6 errors per nucleotide inserted.1 Second, misincorporation events decrease the rate of elongation significantly, thereby allowing 3'-5' exonucleolytic proofreading to occur and decreasing the error rate by 100-fold or so. Finally, postreplicative repair enzymes reduce the overall error frequency to roughly 10-9 errors per nucleotide inserted.2 The remainder of this work will focus on the first step of this process, examining which characteristics of DNA polymerases and nucleobases lead to efficient incorporation of correct nucleotide triphosphates.

DNA POLYMERASE FAMILIES

DNA polymerases are commonly grouped into families based on sequence homologies3–5 and analyses of crystal structures.6 The A and B families have been the most thoroughly characterized, followed by the X, Y, and RT families; comparatively less is known about the C and D polymerase families.7

Key A family polymerases include the eukaryotic polymerases pol γ and pol θ, the prokaryotic pol I, and the bacteriophage T3, T5, and T7 polymerases. These polymerases are typically further categorized as replicative or repair enzymes. The bacteriophage T3, T5, and T7 polymerases, as well as pol γ, the sole mitochondrial polymerase, are primarily replicative polymerases. During replication, these polymerases display relatively high fidelity and achieve enhanced processivity via coordination with accessory subunits or associated proteins. Pol I, on the other hand, primarily functions as a repair enzyme. Pol I was the first polymerase identified8 and has been well studied in organisms including Escherichia coli, Thermus aquaticus, and

Bacillus stearothermophilus. Pol I enzymes are involved in Okazaki fragment processing and nucleotide excision repair, and function via three important enzymatic activities: 5'-3' DNA- dependent DNA polymerase activity, catalyzing the inclusion of new bases complementary to the template strand; 3'-5' exonuclease activity, for the rapid excision of any incorrect newly added bases; and 5'-3' exonuclease activity, for the removal of RNA primers encountered during

Okazaki fragment processing.7,9 The structural foundation for these activities will be discussed below. Pol θ activity has been less thoroughly characterized than Pol I, though it appears to be involved in the repair of interstrand crosslinks and related forms of DNA damage.10

B family polymerases include the eukaryotic polymerases α, δ, and ε, the prokaryotic polymerase II, the archaeal BI and BII polymerases, the T4, T6, and RB69 bacteriophage

2 polymerases, and polymerases from virus families including adenoviruses and herpes simplex viruses. The B family polymerases are typically involved in accurate, processive DNA replication via strong exonuclease activity and associated processivity factors. Among the eukaryotic polymerases, pol α is responsible for the initial extension of primase-synthesized

RNA primers in all new DNA strands.9 Unusually for a B family polymerase, pol α typically exhibits low processivity and moderate fidelity, and it lacks 3’-5’ exonuclease activity; the incorporation of an incorrect dNTP likely results in the dissociation of pol α. Subsequently, the highly processive, accurate, 3'-5' exonuclease-containing B family polymerases pol δ and ε take over and complete the majority of lagging and leading strand synthesis, respectively. 9,11–13

The C and D families have been less well characterized than many of the other polymerase families. The C family polymerases consist only of the replicative prokaryotic polymerase Pol III, the primary enzyme responsible for DNA replication in bacteria. It is highly processive, and its

3’-5’ exonuclease activity contributes to its high fidelity.9,14 Structural evidence suggests that the

C family may in fact be related to, or a subset of, the X family of polymerases.15 The D family polymerases are found in the Euryarchaeota subdivision of archaea. Although not well characterized, they also appear to be replicative polymerases with 3’-5’ exonuclease activity.16

X family polymerases is class of polymerases highly divergent from the A/B/Y

"superfamily" polymerases which include the eukaryotic polymerases β, μ, λ, σ, and terminal deoxynucleotidyl transferase (TdT), and yeast pol IV.15 These enzymes are all utilized in DNA repair or specialized (non-replicative) processes. Pol β is well known for its involvement in the base excision repair pathway, the pathway responsible for repairing abasic sites and alkylated or oxidized bases.17 Pol μ and λ are utilized in non-homologous end-joining, a process by which double-stranded breaks are rejoined.18,19 Pol σ is involved in sister chromatid cohesion.20 TdT is

3 a specialized polymerase responsible for promotion of immunological diversity in lymphoid tissue via non-templated addition of nucleotides to double-strand breaks.21 Yeast pol IV is involved in nonhomologous end joining (NHEJ) of DNA during double-strand break repair.22

The Y family is a newly identified family of polymerases that recognize and bypass different classes of physical DNA damage that would typically stall the high fidelity, highly selective replicative polymerases. Examples include prokaryotic pol IV and pol V, and eukaryotic pol ζ, η, κ, and ι. The Y family polymerases typically have low fidelity, low processivity, and lack a 3’-5’ proofreading exonuclease.23–27

Finally, the reverse transcriptase (RT) family consists of eukaryotic telomerases and retrotransposons, and viral reverse transcriptases, including HIV-1 and HIV-2 and MULV RTs.

Their key feature is their ability to convert an RNA template into a DNA daughter strand. In the case of retroviral RTs, the template is a single stranded viral RNA genome, while in eukaryotic telomerase the template is an integral RNA component.28–30

STRUCTURES OF DNA POLYMERASES

To date, crystal structures of one or more A, B, X, Y, and RT family polymerases have been solved, some bound with DNA, dNTP, and/or pyrophosphate. The overall shape of polymerases across the families is that of a right hand, with subdomains labeled as fingers, palm, and thumb (Figure 1.1).7 Although sequences differ, particularly in the fingers and thumb domains, this structural homology is remarkably universal.31–36 The palm subdomain is located at the junction of the fingers and thumb subdomains, and always contains the polymerase active site with its catalytically essential amino acid residues, which are often structurally superimposable across polymerase families. The fingers subdomain is involved with nucleotide

4 recognition and binding, while the thumb subdomain is involved with binding of the DNA substrate. 31–36

The first polymerase crystal structure to be solved was that of the Klenow fragment of the

A family polymerase pol I.37 The Klenow fragment is an important proteolytic digest of DNA pol I which lacks the domain responsible for the 5'-3' exonuclease activity in pol I, while retaining its 5'-3' polymerization activity and 3'-5' exonuclease activity.38 The polymerase domain was revealed via the crystal structure to be a 400 amino acid C-terminal domain in the right hand configuration already described, with the palm, fingers, and thumb of the polymerase domain forming a cleft 25-35 Å deep and 20-24 Å wide. The 3'-5' exonuclease is located in a separate 200 amino acid N-terminal domain roughly in the area of wrist, relative to the right hand architecture.37 This general structure has been confirmed in other A family polymerases, including T7 DNA polymerase,31 Taq DNA polymerase,39 the Klenow fragment of Taq

(Klentaq),34 and the Bacillus stearothermophilus DNA pol I fragment (BF),35 even when in some cases (eg., Taq and BF) the 3'-5' exonuclease is inactivated due to the mutation of key catalytic residues.

A number of B family polymerase crystal structures have also been solved, including the bacteriophage RB69 polymerase and a number of archaeal polymerases.33,40–44 These exhibit the same right hand architecture previously described, including fingers and thumb domains surrounding a palm domain with the catalytically active residues forming the polymerase active site. In addition, these polymerases contain a 3'-5' exonuclease domain and an RNA-binding N- terminal domain which, together with the right hand domains, form a circular structure with a central cavity.7

Figure 1.1. Structures of A, B, X, Y, and RT family polymerases. The fingers, palm and thumb subdomains are colored gold, red, and green, respectively. The structures shown are: (A) apo Klentaq1, with the 3'-5' vestigial exonuclease domain in silver; (B) apo RB69 DNA polymerase, with the 3'-5' exonuclease domain and the N- terminal domain in grey and silver, respectively; (X) apo pol β DNA polumerase, with the lyase domain in grey; (Y) Dpo4 DNA polymerase, with the little finger subdomain in silver; (RT) the p66 subunit of reverse transcriptase, with the RNAseH and connection subdomains in grey and silver, respectively.7

Several X family polymerase crystal structures have been solved, most notable being the small mammalian polymerase pol β. Although it appears that the X family polymerases evolved separately from the other DNA polymerase families and exhibit little sequence homology with the others, they exhibit the a similar right hand conformation of the other structures, with finger and thumb domains surrounding the catalytically active palm domain.45,46 Pol β has been solved in a wide variety of contexts, including as an active ternary complex, in the presence of DNA, and as a ternary complex with an incoming nucleotide in position near a DNA lesion.45,47,48

A large number of Y family polymerase crystal structures have been solved, including

DinB pol and Dpo4 pol from Sulfolobus solfataricus, pol η from Saccharomyces cerevisiae, and human pol ι.44,49–55 In addition to the standard right hand with fingers, thumb, and palm subdomains, and additional little finger or polymerase associated domain (PAD) subdomain is observed, linked to the thumb domain but physically located next to the fingers subdomain. Also, the finger and thumb subdomains are smaller than in the other polymerase families, leading to a more open and solvent-accessible active site.

Finally, several RT family polymerase crystal structures have been solved, including those of MULV,56 HIV-1,57–59 and HIV-2;60 in particular, a large variety of HIV-1 reverse transcriptase crystal structures are available, including of unliganded reverse transcriptase,57–59 NNRTI-bound reverse transcriptase,61–66 reverse transcriptase in complex with nucleic acid substrates,67–72 and reverse transcriptase in a ternary complex with primer-template DNA and nucleotide.68 In addition to the same right hand architecture observed previously, viral reverse transcriptases contain an RNAseH domain used to cleave viral RNA during DNA synthesis.

COMMON MECHANISMS IN DNA POLYMERASES

Certain conformational changes associated with the replication process are also identifiable across polymerase families, particularly in A and B family polymerases. Binding of an incoming dNTP is associated with the adoption of a “closed” conformation, in which the helices of the fingers subdomain rotate towards the palm to cover the nucleotide binding site. This results in the formation of a hydrophobic pocket of amino acid residues around the base and ribose portions of the incoming dNTP, while a hydrophilic pocket forms around the triphosphate portion of the dNTP. Taken together, the conformational changes stabilize the closed conformation, restrict the possible conformations of the incoming triphosphate, and facilitate phosphodiester bond formation between the 3’ primer hydroxyl group and the α-phosphate of the incoming dNTP.31,34,35,40,45,73,74 (Figure 1.2)

Figure 1.2. Surface of the closed (C) and open (D) complexes of Klentaq1. The double cyan arrow indicates the only possible direction for DNA motion in the open binary complex.34

Another apparently universal feature of the polymerase mechanism involves two divalent metal cations found in the hydrophilic pocket formed in the closed conformation of the polymerase (Figure 1.3).75 These metal ions are octahedrally coordinated by the three phosphates of the dNTP, several conserved side chain residues of the polymerase active site, and two water molecules. The first metal ion (referred to in the literature as “metal ion A”) encourages the

- attack of the dNTP α phosphate by the primer’s 3’ O by reducing the pKa of the ribose 3’-OH.

“Metal ion B” stabilizes the leaving pyrophosphate, and both ions stabilize the negative charge of the putative pentacovalent intermediate. This nucleotidyl transfer mechanism appears to be involved in all polymerases studied to date.31,45–47,76–78

Figure 1.3. The two-metal ion nucleotidyl transfer mechanism of DNA polymerases. Active site aspartates are numbered according to E. coli DNA polymerase I.75

NUCLEOBASE FEATURES AFFECTING EFFICIENT INCORPORATION BY DNA

POLYMERASES

Despite these widespread homologies in polymerase structures and mechanisms, there are significant differences among the polymerase families in what features of the triphosphate and templating nucleobases are important for efficient incorporation by polymerases. Since the discovery of the structure of DNA, the Watson-Crick hydrogen bonding patterns have been noted

10 as the most likely mechanism for the identification of correct and incorrect bases by polymerases.79 Indeed, some low-fidelity enzymes appear to primarily use the Watson-Crick hydrogen bonding groups on the incoming (d)NTPs and the templating base to identify correct and incorrect incorporation events.80–85

Studies of several Y-family DNA polymerases have demonstrated their use of Watson-

Crick hydrogen bonding groups for efficient dNTP incorporation. For example, several of these studies utilize 2,4-difluorotoluene, a nucleobase analogue which closely mimics the shape of thymidine, yet lacks the Watson-Crick hydrogen bonding capability of thymidine's O2, N-3, and

O4 moieties (Figure 1.4).86 Prakash's group demonstrated that both in pol η and pol κ, the substitution of 2,4-difluorotoluene for thymine as an incoming triphosphate or in the template was strongly inhibitory to DNA synthesis.85,87 Similar results have been observed using purine analogues in pol ι.84

Figure 1.4. The chemical structures and electrostatic potentials of thymine and 2,4-difluorotoluene. 85,87

An emphasis on Watson-Crick hydrogen bonding has also been observed in primases, the low-fidelity enzymes typically responsible for de novo synthesis of an RNA primer for DNA polymerases to work from. Although primases sort into distinct families via sequence homology and appear to have evolved separately from polymerases and from one another, certain important catalytic features are shared across primase families and with pol β, an X-family polymerase.88

Previous work with both human primase89 and herpes simplex virus 1 primase80,90 has demonstrated the dependence of these primases on Watson-Crick hydrogen bonds for efficient nucleotide incorporation. Using an extensive set of nucleobase analogues with removed or modified Watson-Crick hydrogen bonding features (Figure 1.5),89 it was shown that, with few exceptions, polymerization by these primases was strongly inhibited when the Watson-Crick hydrogen bonding patterns in either the triphosphate or the templating base were altered.80,90

Figure 1.5. Sample nucleobase analogues with removed or modified Watson- Crick hydrogen bonding features.89

However, some polymerases do not require intact Watson-Crick hydrogen bonding features for efficient incorporation of dNTPs. Eric Kool was an early proponent of a shape-based theory of nucleobase recognition, in which the primary factor in polymerase selectivity is the steric exclusion of incorrect nucleotides via a tightly restricted active site pocket.86,91–93 His group designed the previously-mentioned thymine analogue 2,4-difluorotoluene (Figure 1.4) as a tool for probing the effects of removing the Watson-Crick hydrogen bonding features while maintaining the precise shape of thymine. In fact, detailed analysis using X-ray crystallography and 1H NMR spectroscopy demonstrated that the ring conformations, bond lengths, glycosidic

13 torsion angles, and overall anti- glycosidic conformations are extremely similar between thymidine 2’-deoxyriboside and 2,4-difluorotoluene-2’-deoxyriboside.86 This confirmed that the analogue can function as a very good nonpolar isosteric substitute for thymine.

Kool and coworkers showed that, unlike the Y family polymerases discussed previously, many A family polymerases will efficiently generate base pairs using 2,4-difluorotoluene, despite its complete inability to form Watson-Crick hydrogen bonds. For example, the Klenow fragment of DNA pol I inserts dATP opposite a templating 2,4-difluorotoluene nearly as efficiently as opposite thymine, and with a specificity for dATP (rather than the other nucleotides) nearly equal to that of a templating thymine (merely 4-fold lower).91 Similarly, the nucleoside triphosphate derivative of 2,4-difluorotoluene was shown to be incorporated against a templating adenine with slightly decreased efficiency compared to dTTP, but again with specificity for adenine approaching that of dTTP.92 Later studies with pol I of Thermus aquaticus and with T7 polymerase confirmed these trends in other A family polymerases.94,95

To further test their theory of shape selectivity, Kool's group also synthesized a set of thymine shape mimics with substituents varying in size over a 1.0 Å range. (Figure 1.6) This allowed the examination of differences in size while the overall shape of thymine was carefully retained. In accordance with the theory of shape selectivity, Klenow fragment rejected the largest analogues, and incorporated the smallest very inefficiently; only the analogues that most closely approximated the size of thymine were incorporated efficiently.96–99

Figure 1.6. Thymine shape mimics with substituents of varying size.93

Thus, many early studies provided strong support for the shape selectivity theory, in which the shape of the base pair formed by the incoming dNTP and template base is the critical factor for determining dNTP incorporation efficiency in A family polymerases. However, over time, several studies demonstrated that Klenow fragment also efficiently generates base pairs whose shapes vary significantly from the correctly-shaped base pairs.81,100–102 Klenow fragment very efficiently incorporates all of the nucleobase analogues in Figure 1.7 against all four natural bases, despite the complete lack of shape complementarity of the analogues to the natural bases.81 Notably, these analogues also lack any semblance of the Watson-Crick hydrogen bonding patterns of the natural bases.

Figure 1.7. Sample nucleobase analogues which lack shape and hydrogen bonding complementarity, yet are incorporated very efficiently by A family and/or B family polymerases.81

Thus, A family polymerases have been shown to require neither shape nor Watson-Crick hydrogen bond formation for efficient dNTP incorporation. To explore what features of the bases are important for efficient incorporation by polymerases, a large panel of purine analogue triphosphates were tested for efficient incorporation by polymerase I of Bacillus

15 stearothermophilus (Figures 1.7 and 1.8).103 This array of purine analogues was generated by the systematic replacement of the nitrogens (N-1, N2, N-3, and N6) from the natural adenine and guanine bases with carbons, until the nearly featureless benzimidazole was obtained. The range of features among these analogues enabled Trostler et al to carefully determine the specific role of each chemical feature of the natural bases. It was shown that the removal of any of the nitrogens decreased the efficiency of correct incorporation of the resulting analogue triphosphate, most severely upon the removal of N-1 or N-3. Also, the removal of any nitrogen resulted in increased misincorporation of the resulting analogue triphosphate, most severely upon the removal of N-1 or N6. Thus, rather than the simple detection of shape or Watson-Crick hydrogen bonding, pol I appears to utilize the nitrogens of purine dNTPs to enhance correct incorporation and discourage misincorporation, with varying emphases of each role placed on the various nitrogens.

Figure 1.8. Purine analogues utilized to probe the roles of specific chemical features of the natural purine nucleobases.103

Much like the trends observed in A family polymerases, B family DNA polymerases have been shown to require neither shape nor Watson-Crick hydrogen bond formation for efficient dNTP incorporation. For example, pol α incorporates the nucleoside triphosphate form of benzimidazole, 5-nitroindole, 5-nitrobenzimidazole, and 6-nitrobenzimidazole (Figure 1.7) against all four natural bases at rates approaching those of the natural bases.81 Instead, as in A family polymerases, B family polymerases appear use specific functional groups on the base of an incoming purine dNTP to prevent misincorporation and to enhance correct incorporation.

During incorporation of the panel of purine analogue triphosphates described previously (Figures

1.7 and 1.8), pol α employs a similar combination of positive and negative selectivity to ensure accuracy of replication as was observed in pol I.104 In pol α, however, N-1 and N-3 prevent misincorporation, while N-1 and N6 enhance correct incorporation, an exact reversal of the trend

17 observed in pol I. The HSV-1 polymerase, another B-family DNA polymerase, also uses the same general mechanisms as pol α.105 Thus, both A and B family polymerases use a combination of positive and negative selectivity to provide accuracy during dNTP incorporation, rather than shape or Watson-Crick hydrogen bonding patterns. However, there are important systematic differences between their solutions, as well as between the solutions of the low fidelity primases and Y family polymerases.

In addition to these investigations into the role of shape, Watson-Crick hydrogen bonds, and specific nucleobase features, consideration has also been given to how hydrophobicity, polarity, electronic character, and other characteristics affect dNTP polymerization.31,39,106 In particular, multiple studies have shown that the minor groove hydrogen bond acceptors play critical roles during dNTP incorporation. N-3 of purines and O2 of pyrimidines provide an unshared pair of electrons and appear to be the only functional groups in a standard Watson-Crick base pair that all standard nucleobases present identically.107,108 These electron-rich groups present hydrogen bonding contacts to polymerase active site amino acid residues, and evidence for conservation of polymerase active site hydrogen-bonding interactions with nascent and terminal Watson-Crick base pairs is found in crystal structures across A and B family polymerases.33–36,39,109,110 Mutating those amino acids that interact with the minor groove hydrogen bond acceptors in either the base pair at the primer terminus or between the incoming dNTP and templating base generally greatly impairs fidelity and/or efficiency of dNTP polymerization.111–113 Although some evidence for interaction with the major groove exists in A family polymerases (for example., Y464 in

KlenTaq interacts with O4 of a templating T or N4 of a templating C),36 generally the shape and

18 chemical properties of the major groove side of the base pair appear less important, since polymerases generally accept base pairs with greatly altered major grooves.100,114,115

NOVEL BASE PAIRS

These sorts of findings have particular relevance in the design of novel base pair systems. A number of groups have developed systems of unnatural base pairs with high selectivity for use with novel in vitro technologies. The following is a brief overview of the unnatural base pairs that can be used as a third base pair in in vitro systems (Figure 1.8).

The unnatural base pair of isoguanine (isoG) and isocystine (isoC) is an early unnatural base pair initially proposed as early as 1962116 and later develop by Benner's group.117 The isoG:isoC pair is based on the concept of using Watson Crick hydrogen bonding patterns that would be orthogonal to the natural bases. Although still useful in certain real-time PCR applications and modified peptide synthesis, this pair tends to suffer from chemical instability of isoC, and from tautomerism of isoG resulting in mispairing with the natural bases. Benner's group addressed these shortcomings via the development of 2-aminoimidazo[1,2-a]-1,3,5-triazin-4(8H)-one (P) and 6-amino-5-nitro-2(1H)-pyridone (Z). In PCR, the P-Z pair exhibits a selectivity of 99.8% per replication cycle and 0.2% per base per replication cycle, with no disruption from multiple consecutive incorporations during PCR. The primary weakness of this system is a slight pH dependency of the pairing selectivity.118,119

Figure 1.9. Unnatural base pairs currently used in in vitro systems.115

Romesberg's group has explored unnatural base pair systems based on hydrophobic partners, starting with the self-pairing of propynyl isocarbostyril (PICS). Though this pair exhibited high thermal stability and relatively high incorporation efficiency and specificity during incorporation, they suffered from very poor extension after their incorporation. This shortcoming was overcome by the development of their 5SICS-NaM pair, which functions with 98.0-99.8% fidelity during

PCR, and also functions in transcription using T7 RNA polymerase, albeit with decreased rates of polymerization.102,120,121

Additionally, 2-amino-6-(thienyl)purine (s) and pyridine-2-one (y) have been developed by

Hirao's group as an unnatural base pair. This system is designed around an orthogonal hydrogen bonding pattern in conjunction with bulky substituents at the purine 6-position to prevent mispairing with the natural pyrimidines via steric hindrances with the pyrimidine 4-position group. Although utilized for synthetic protein synthesis coupled with transcription, the incorporation of s is less selective in replication and transcription. This shortcoming of the s-y

20 pair were addressed by the development of the new pair 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and pyrrole-2-carbaldehyde (Pa). Ds-Pa was the first synthetic base pair that selectively functions in PCR along with the natural base pairs. However, for unknown mechanistic reasons, this system required the use of γ-amidotriphosphates for successful PCR, decreasing PCR efficiency and limiting the range of potential applications. This limitation was overcome via the development of 4-[3-(1,2-dihydroxyethyl)-1-propynyl]-2-nitropyrrole (Diol-Px) as a new partner for Ds. The Ds-Px system exhibits extremely high fidelity in PCR, with selectivity of 99.8-99.9% per replication cycle, and a misincorporation rate of less than 0.01% per base per replication cycle. This system has also been expanded via the development of a strongly fluorescent version of Ds, 7-(2,2'-bithien-5-yl)-imidazo[4,5-b]pyridine (Dss). The primary weakness of these systems is the slight chemical instability of Px under basic conditions. 122–125

CONCLUSION

In addition to providing fundamental insights into DNA polymerase mechanisms, a deeper understanding of the principle(s) underlying how polymerases choose to accurately and efficiently incorporate a dNTP could lead to the improvement of these current unnatural base pair systems, or the development of additional novel base pair systems. The following chapters describe an investigation of A and B family polymerases using modified nucleobases.

II. B Family DNA Polymerases Asymmetrically Recognize

Pyrimidines and Purines

INTRODUCTION.

Accurate replication of genomic DNA is critical for cellular survival and proliferation. Despite the complexity of the cellular DNA replication process, the overall error rates are remarkably low. Three discrete processes contribute to the accuracy of replication. First, replicative DNA polymerases typically exhibit relatively low error frequencies of 10-3 to 10-6 errors per dNTP inserted.1 Second, misincorporation events decrease the rate of elongation significantly, thereby allowing 3'-5' exonucleolytic proofreading to occur and decreasing the error rate by 100-fold or so. Finally, postreplicative repair enzymes reduce the overall error frequency to roughly 10-9 errors per nucleotide inserted.2

The mechanisms by which various polymerases efficiently distinguish between correct and incorrect dNTP substrates during polymerization are not yet fully understood. Furthermore, different polymerases appear to utilize significantly different mechanisms.87,104 Some low- fidelity enzymes, such as human primase, herpes primase, and Y-family DNA polymerases, appear to largely utilize the Watson-Crick hydrogen bonding groups on the incoming (d)NTPs and the templating base to help identify correct and incorrect incorporation events.82–85,126,127 On the other hand, various studies have shown that A and B family DNA polymerases do not require

Watson-Crick hydrogen bond formation for dNTP incorporation.128,129 B family polymerases use specific functional groups on the base of an incoming purine dNTP to prevent misincorporation and to enhance correct incorporation.104,105,130–132 The methods used by A family polymerases are less well understood; while some studies indicate that shape selectivity may be critical for correct

22 dNTP incorporation, others imply that shape is not important.86,91,92,98,103,132–137 For example,

Kool and coworkers showed that some A family polymerases efficiently incorporate 2,4- dihalotoluene dNTPs in a manner consistent with the enzyme using shape as a primary determinant.98 However, these enzymes also readily incorporate purine dNTP opposite a templating T and dITP opposite a templating C,103,138 even though the shapes of purine and hypoxanthine significantly vary from the shapes of adenine and guanine, respectively.

DNA polymerase α (pol α) is a key polymerase (along with primase, pol δ, and pol ε) required during nuclear DNA replication.9 Pol α is a B-family polymerase that typically exhibits low processivity, polymerizing ~12 nucleotides before dissociating, and moderate fidelity, making 10-3-10-5 errors per dNTP polymerized.11,12 Biologically, pol α is responsible for the initial extension of primase-synthesized RNA primers in all new DNA strands. Pol α lacks 3’-5’ exonuclease activity; therefore, the incorporation of an incorrect dNTP results in the dissociation of pol α and subsequent association of a processive replicative polymerase with exonuclease activity (pol δ or pol ε).9,13

Pol α requires neither the formation of Watson-Crick hydrogen bonds nor a correctly shaped base pair for the rapid incorporation of a dNTP.132,139,140 Instead, recent work has shown that during incorporation of dATP and related purine analogues, pol α employs a combination of positive and negative selectivity to ensure accuracy of replication. N-1 and N-3 serve as negative selectors and help prevent misincorporation, while N-1 and N6 act as positive selectors and enhance correct incorporation.104 Thus, a combination of positive and negative selectivity provides accuracy for pol α during dNTP incorporation, rather than shape or hydrogen bonding patterns. The HSV-1 polymerase, another B-family DNA polymerase, uses the same general mechanisms as pol , although the precise roles of N-1 and N6 vary between the two enzymes.105

While the chemical features of purine bases have been examined with respect to their roles in correct incorporation and preventing misincorporation by pol  and herpes DNA polymerase, the contributions of the different functional groups on pyrimidines have not been examined.

Accordingly, we examined the role of O2, N-3, and N4/O4 of pyrimidine dNTPs and template bases for incorporation and fidelity with these two enzymes.

EXPERIMENTAL PROCEDURES

Materials. All reagents were of the highest quality commercially available. Unlabeled natural dNTPs were from Sigma, and radiolabeled dNTPs were from Perkin-Elmer. 2- pyrimidinone dNTP (dZeb) was from Trilink. Protected phosphoramidites were from Glen

Research. Synthetic DNA oligonucleotides were purchased from IDT or Biosearch. The two subunit p180-p70 polymerase complex was expressed in baculovirus-infected SF9 cells at the

Tissue Culture Core Facility of the University of Colorado Health Sciences Center and purified as previously described,141 with the exception that the enzyme was stored in 50% glycerol, 1 mM ethylenediaminetetraacetic acid, 50 mM Tris-HCl, pH 8.8, and 1 mM dithiothreitol. HSV-1 DNA polymerase (UL30/UL42 complex) was expressed and purified as previously described.82

5′-End Labeling of Primers and Annealing of Primer-Templates. DNA primers were 5′-32P- labeled using polynucleotide kinase (New England Biolabs) and [γ-32P]ATP. The labeled primer was gel purified and annealed to the template as previously described.142,143

Polymerization Assays. Assays were performed under steady-state conditions essentially as previously described104,105,130 using either herpes simplex I DNA polymerase or pol . Briefly, assays typically contained 1 µM 5’-[32P]-primer/template, 50 mM Tris-HCl (pH 8.0), 50 mM

MgCl2, 1 mM dithiothreitol, 0.1 mg/mL bovine serum albumin, 5% glycerol, and varying

24 concentrations of natural or analogue dNTPs, in a total volume of 5-10 µL. Reactions were initiated by adding enzyme, incubated at 37 °C for 5-30 min, and quenched with an equal volume of gel loading buffer (formamide/0.05% xylene cyanol and bromophenol blue). Products were separated using denaturing gel electrophoresis (20% polyacrylamide, 8 M urea) and imaged using a Typhoon Phosphorimager (Molecular Dynamics). Kinetic parameters were determined by fitting data to the Michaelis-Menten equation using KaleidaGraph 4.0. All rates were normalized to the same final enzyme concentration (1 nM herpes pol, 5 nM pol ). The reported discrimination values were determined by comparing the efficiency of incorporation for the analogue (Vmax/KM) to the efficiency of incorporation for the corresponding natural nucleotide

(Vmax/KM normalized to 1).

Synthesis of Nucleotide Analogues. C-2’-deoxyribonucleosides (6AmPy, 6ClPy, 6MePy, and 6OPy) were synthesized as previously described.144 2OPy nucleoside and 5’- dimethoxytrityl-3’-phosphoramidites and oligonucleotides were synthesized as described using established procedures90 on an Applied Biosystems 394 automatic DNA synthesizer.145,146

Synthesis of Nucleoside 5’-Triphosphates. Nucleosides were converted to nucleoside 5’- triphosphates as previously described.90 Crude nucleoside triphosphates were purified by loading them onto an anion-exchange column (Sephadex-DEAE A-25, Aldrich, pre-equilibrated in

TEAB and then washed with H2O) followed by elution with a 0-1 M TEAB gradient. Fractions were identified by MALDI mass spectrometry (negative M-1 ion) with a THAP matrix.

Collected fractions were evaporated and purified by reverse-phase (C18) HPLC using a gradient of 0-50% MeCN in 20 mM triethylammonium acetate. The purity was determined by an appearance of a single peak in HPLC (gradient from 0% to 60 % MeCN in 20 mM TEAB in water) and the triphosphates identified by MALDI MS and 31P NMR.

31 6AmPy dNTP: MS (MALDI, negative ion) 449 (M-1) calcd 449; P NMR (400MHz,D2O)

δ-9.8 (bs, 2P, α-P, γ-P), -22.3 (m, 1P, β-P). 6ClPy dNTP: MS (MALDI, negative ion) 468 (M-1)

31 calcd 468; P NMR (400MHz,D2O) δ-9.5 (bs, 2P, α-P, γ-P), -23.0 (m, 1P, β-P). 6MePy

31 dNTP: MS (MALDI, negative ion) 448 (M-1) calcd 448; P NMR (400MHz,D2O) δ-10.4 (bs,

2P, α-P, γ-P), -22.9 (m, 1P, β-P). 6OPy dNTP: MS (MALDI, negative ion) 450 (M-1) calcd

31 450; P NMR(400MHz,D2O) δ- δ-10.0 (bs, 2P, α-P, γ-P), -21.1 (m, 1P, β-P).

RESULTS

Previous studies have shown that B family DNA polymerases readily polymerize purine dNTP analogues whose base size, shape, and Watson-Crick hydrogen-bonding pattern do not closely resemble those of canonical bases, while the canonical bases are only very rarely misincorporated.104,132,140 The incorporation rate of purine dNTPs opposite correct and incorrect template bases depends upon the effects of N-1, N-3, and N6 via a combination of positive and negative selectivity. Herein, we probed the roles of O2, N-3, and N4/O4 of pyrimidines to identify the similarities and differences between the interaction of B family polymerases with purines and pyrimidines (Figure 2.1).

The steady-state kinetic parameters for incorporation of both natural and analogue dNTPs were measured on synthetic primer-templates of defined sequence across from both natural and analogue templating bases. Discrimination values reflect the efficiency of correct dNTP incorporation compared to the incorporation efficiency of the tested dNTP (Vmax/ KM). Table 2.1 shows the data for natural nucleotide incorporation by pol α and herpes pol. Both enzymes

105,132 discriminated against incorrect natural dNTPs by 500 to >10,000-fold.

Figure 2.1. Structures, names, and abbreviations of analogue bases used.

Role of Watson-Crick Hydrogen Bonding Groups. We initially examined the effect of removing N4 from cytosine in the incoming dNTP using the base analogue dZebTP. Table 2.2a shows that pol  polymerized dZebTP 16-fold less efficiently opposite a templating G than it polymerized dCTP. Removing N4 also had effects on fidelity since pol  discriminated against polymerizing dZebTP opposite a templating A by only 140-fold, somewhat less than the 3700- fold for misincorporation of dCTP. To examine the effects of removing the Watson-Crick hydrogen bonding groups at both N-3 and N4/O4, we utilized the base analogue 2-pyridone. Pol

 strongly discriminated against polymerizing both 2-pyridone dNTP opposite the natural bases, as well as the natural dNTPs opposite 2-pyridone. Thus, the Watson-Crick hydrogen bonding groups of a pyrimidine clearly play an important role in enhancing correct dNTP polymerization by pol , but are not essential for preventing misincorporation.

Table 2.1. Natural Base Incorporations

a dNTP DNA-N Vmax KM Vmax/KM Discrimination (primer elongation min-1) (μM) (elongation μM-1 min-1) a)Pol α dA DNA-T 3.4 (0.1) 0.31 (0.05) 11 1 dT DNA-A 3.2 (0.3) 1.7 (0.4) 1.8 1 dU DNA-A 4.8 (0.4) 2.2 (0.4) 2.1 0.86 dC DNA-G 9.6 (0.2) 1.2 (0.1) 8.4 1 dG DNA-C 1.15 (0.09) 0.11 (0.3) 10 1 b)Herpes pol dA DNA-T 1.6 (0.05) 0.41 (0.06) 3.9 1 dT DNA-A 1.7 (0.06) 1.3 (0.2) 1.3 1 dC DNA-G 1.2 (0.02) 1.1 (0.1) 1.1 1 dG DNA-C 6.5 (1.4) 2.6 (0.8) 2.5 1

a Discrimination values reflect the efficiency of dNTP incorporation compared to the incorporation efficiency of the corresponding natural base pair. Values in parentheses are the standard deviations.

Table 2.2. Effects of Watson-Crick Hydrogen Bonding Groups

a dNTP DNA-N Vmax KM Vmax/KM Discrimination (primer elongation min-1) (μM) (elongation μM-1 min-1) a)Pol α dZeb DNA-A 2.1 (0.3) 162 (61) 0.013 140 dZeb DNA-G 4.6 (0.2) 8.5 (1.5) 0.54 16 dC DNA-A 0.22 (0.01) 432 (65) 0.0005 3700 d2OPy DNA-A 4.5 (0.5) 684 (242) 0.0041 450 d2OPy DNA-T 2.6 (1.4) 335 (173) 0.0042 2600 d2OPy DNA-C nd nd nd >10000 d2OPy DNA-G 0.50 (0.3) 161 (17) 0.0015 5600 dA DNA-2OPy nd nd nd >10000 dT DNA-2OPy nd nd nd >10000 dC DNA-2OPy nd nd nd >10000 dG DNA-2OPy nd nd nd >10000 b)Herpes pol d2OPy DNA-A 0.48 (0.07) 430 (180) 0.0011 1200 d2OPy DNA-T 0.29 (0.01) 120 (30) 0.0025 1900 d2OPy DNA-C nd nd nd >20000 d2OPy DNA-G 0.21 (0.02) 350 (80) 0.0006 1850

a Discrimination values reflect the efficiency of dNTP incorporation compared to the incorporation efficiency of the corresponding natural base pair. nd: not detectable. Values in parentheses are the standard deviations.

To determine if other B family DNA polymerases utilize the Watson-Crick hydrogen bonding groups of a pyrimidine similarly to pol , we examined HSV-1 DNA polymerase.

Table 2.2b shows that HSV-1 pol also strongly discriminated against polymerizing 2-pyridone dNTP across from a natural template base. Since the amino acids that comprise the active sites of B-family DNA polymerases are remarkably well conserved, these data suggest that this family of enzymes will generally discriminate against pyrimidine dNTP analogues lacking both

Watson-Crick hydrogen bonding groups.

Role of the Minor Groove Hydrogen Bond Acceptor on a Pyrimidine dNTP. The importance of O2, a hydrogen bond acceptor that lies in the minor groove (Figure 2.2), for generation of base pairs involving pyrimidines was examined using a series of analogues that lacked O2. So that N-3 and N4/O4 (if present) maintained the hybridization states appropriate for either C or T and to avoid adding a positive charge to the ring, N-1 was also converted to carbon such that the nucleosides were C-glycosides. Three of the bases, 6AmPy, 6MePy, and 6ClPy, are

C analogues that can form two, one, and one Watson-Crick hydrogen bonds with G, respectively, while 6OPy is a T analogue that can form two Watson-Crick hydrogen bonds with A (Figure 2.1).

As a T analogue, 6OPy also lacks the methyl group found at C-5 of T. To first test the possibility that the absence of this methyl group was significant, we compared polymerization of dUTP and dTTP (Table 2.1). The similar kinetic parameters for dUTP and dTTP polymerization indicate that the absence of the methyl has little if any effect on polymerization.

Pol  strongly discriminated against polymerizing 6OPy dNTP opposite a templating A (120- fold discrimination, Table 2.3a) even though this base can form two Watson-Crick hydrogen bonds. On the other hand, the loss of O2 did not result in major changes in the rate of misincorporation opposite a template T, C, or G compared to the natural dTTP, indicating that O2 is not a major determinant in preventing misincorporation of dTTP. HSV-1 DNA polymerase likewise discriminated against polymerization of 6OPy dNTP, with the only difference between

HSV-1 DNA polymerase and pol  being the larger effect of losing O2 with the HSV-1 enzyme

(610-fold opposite a template A, Table 2.3b).

Figure 2.2. Configuration of major and minor grooves in relation to a T:A base pair.

Removing O2 from dCTP had larger and more diverse effects than the corresponding modification of dUTP. We synthesized and tested three analogues, 6ClPy dNTP, 6MePy dNTP and 6AmPy dNTP, capable of forming one, one and two Watson-Crick hydrogen bonds with G, respectively (Table 2.4). Pol  did not detectably polymerize 6AmPy dNTP opposite G, even though two Watson-Crick hydrogen bonds could be formed. Likewise, it did not detectably polymerize 6ClPy dNTP or 6MePy dNTP opposite a templating G. Second, pol  misincorporated d6APy dNTP at higher rates than it did dCTP, suggesting that O2 of dCTP analogues plays a greater role in fidelity than does O2 of dTTP. HSV-1 DNA polymerase strongly discriminated against 6AmPy, 6ClPy, and 6MePy dNTPs opposite any template base, more so than did pol  and analogous to this enzymes stronger discrimination against 6OPy dNTP polymerization.

Table 2.3. Effects of O2 in dTTP

a dNTP DNA-N Vmax KM Vmax/KM Discrimination (primer elongation min-1) (μM) (elongation μM-1 min-1) a)Pol α d6OPy DNA-A 2.27 (0.07) 146 (13) 0.016 120 d6OPy DNA-T nd nd nd >10000 d6OPy DNA-C L L 0.018 600 d6OPy DNA-G nd nd nd >10000 b)Herpes pol d6OPy DNA-A 0.42 (0.12) 200 (110) 0.0022 610 d6OPy DNA-T nd nd nd >20000 d6OPy DNA-C nd nd nd >20000 d6OPy DNA-G nd nd nd >20000 aDiscrimination values reflect the efficiency of dNTP incorporation compared to the incorporation efficiency of the corresponding natural base pair. nd: not detectable. L: the rate increased linearly with increasing dNTP concentration, thus making it impossible to calculate KM or Vmax. Vmax/KM was calculated from the slope of the line. Values in parentheses are the standard deviations.

Table 2.4. Effects of O2 in dCTP

a dNTP DNA-N Vmax KM Vmax/KM Discrimination (primer elongation min-1) (μM) (elongation μM-1 min-1) a)Pol α d6AmPy DNA-A 0.83 (0.03) 99 (9) 0.0084 220 d6AmPy DNA-T L L 0.037 270 d6AmPy DNA-C L L 0.0096 1100 d6AmPy DNA-G nd nd nd >10000 d6MPy DNA-A 0.31 (0.05) 675 (210) 0.0005 4000

32 d6MPy DNA-T nd nd nd >10000 d6MPy DNA-C nd nd nd >10000 d6MPy DNA-G nd nd nd >10000 d6ClPy DNA-A 1.03 (0.03) 43 (3) 0.024 76 d6ClPy DNA-T nd nd nd >10000 d6ClPy DNA-C nd nd nd >10000 d6ClPy DNA-G nd nd nd >10000 dC DNA-A 0.22 (0.01) 432 (65) 0.0005 3700 dC DNA-T 0.18 (0.01) 67 (8) 0.0027 4100 dC DNA-C nd nd nd >10000 b)Herpes pol 6AmPy DNA-A 0.075 (0.007) 120 (40) 0.00063 2100 6AmPy DNA-T nd nd nd >20000 6AmPy DNA-C nd nd nd >20000 6AmPy DNA-G 0.043 (0.04) 110 (40) 0.0004 2800 6ClPy DNA-A 0.71 (0.04) 1900 (200) 0.00037 3700 6ClPy DNA-T nd nd nd >20000 6ClPy DNA-C nd nd nd >20000 6ClPy DNA-G nd nd nd >20000 6MePy DNA-A L L 0.00011 12000 6MePy DNA-T nd nd nd >20000 6MePy DNA-C nd nd nd >20000 6MePy DNA-G nd nd nd >20000 aDiscrimination values reflect the efficiency of dNTP incorporation compared to the incorporation efficiency of the corresponding natural base pair. nd: not detectable. L: the rate increased linearly with increasing dNTP concentration, thus making it impossible to calculate KM or Vmax. Vmax/KM was calculated from the slope of the line. Values in parentheses are the standard deviations.

Role of the Minor Groove Hydrogen Bond Acceptor on a Templating Base. We extended these studies to determine how removing O2 from a templating pyrimidine would affect polymerization of a natural dNTP. The loss of O2 from a templating T significantly reduced polymerization of dATP even though two Watson-Crick hydrogen bonds can still form (Table

2.5). Polymerization of non-cognate dNTPs was not affected, indicating that O2 of the template T does not play an important role in fidelity. These data also indicate that removing O2 from T in either the incoming dNTP or the templating base has very similar effects.

Table 2.5. Effects of O2 in the Template

a dNTP DNA-N Vmax KM Vmax/KM Discrimination (primer elongation min-1) (μM) (elongation μM-1 min-1) Pol α dA DNA-6OPy 0.38 (0.03) 4 (1) 0.093 120 dT DNA-6OPy 0.11 (0.01) 66 (16) 0.0016 6900 dG DNA-6OPy 0.10 (0.01) 71 (16) 0.0014 7700 dC DNA-6OPy nd nd nd >10000 dA DNA-6AmPy 0.8 (0.1) 642 (184) 0.0012 8100 dT DNA-6AmPy 0.12 (0.01) 73 (20) 0.0016 6400 dC DNA-6AmPy nd nd nd >10000 dG DNA-6AmPy 0.12 (0.01) 0.16 (0.33) 0.74 14 aDiscrimination values reflect the efficiency of dNTP incorporation compared to the incorporation efficiency of the corresponding natural base pair. nd: not detectable. Values in parentheses are the standard deviations.

Removing O2 from a templating C had relatively small effects on the efficiency of dGTP polymerization (14-fold, Table 2.5), in contrast to the huge effect observed upon removing O2

34 from the incoming dCTP (undetectable polymerization opposite G, Table 2.4a).

Misincorporation opposite a templating 6AmPy (Table 2.5) was not significantly different than misincorporation opposite a templating C, a result that stands in contrast to the decreased fidelity of 6AmPy dNTP polymerization. Thus, the effects of removing O2 from C are highly asymmetric depending upon whether one looks at the incoming dCTP or templating C, and quite different than the effects of removing O2 from T.

The role of the minor groove hydrogen bond acceptor in a purine, N-3, was likewise examined by measuring dNTP incorporation opposite 3-deazaadenine (3DA). Table 2.6 shows that this loss of N-3 impaired incorporation of the cognate dTTP, but did not greatly impact incorporation of noncognate dNTPs. Thus, purine N-3 plays decidedly different roles depending upon whether the purine nucleotide is the dNTP or the templating nucleotide. In the dNTP, N-3 has minimal impact on correct dNTP incorporation, but plays a major role in preventing misincorporation,104 while in the template, N-3 is important for correct incorporation, but has minimal effect in preventing misincorporation. (Table 2.6).

Table 2.6. Effects of Removing N-3 from a Templating dA.

a dNTP DNA-N Vmax KM Vmax/KM Discrimination (primer elongation min-1) (μM) (elongation μM-1 min-1) Pol α dA DNA-3DA 0.13 (0.02) 134 (66) 0.0010 1900 dT DNA-3DA 33 (2) 178 (30) 0.037 50 dC DNA-3DA nd nd nd >10000 dG DNA-3DA nd nd nd >10000

aDiscrimination values reflect the efficiency of dNTP incorporation compared to the incorporation efficiency of the corresponding natural base pair. nd: not detectable. Values in parentheses are the standard deviations.

DISCUSSION AND CONCLUSIONS

The effects of removing heteroatoms from pyrimidine bases in both the template and incoming dNTP on two B family DNA polymerases were examined. Unlike the very small effects of removing N-3 from a purine dNTP,104 removing the functionally equivalent O2 of a pyrimidine dNTP greatly decreased incorporation by B family DNA polymerases and also compromised fidelity in the case of C analogues. Removing O2 from the templating base had more modest effects. Finally, removing the Watson-Crick hydrogen bonding groups from pyrimidines greatly impaired polymerization of the resulting dNTPs, as well as polymerization of natural dNTPs opposite these bases.

Removing O2 from pyrimidine dNTPs had surprisingly large effects on incorporation by both HSV-1 polymerase and pol  (Tables 2.2, 2.3). Even with analogues that could still form two Watson-Crick hydrogen bonds, correct incorporation was significantly impaired. The effects

36 on fidelity varied from no effect to moderate increases in misincorporation (as defined by the polymerization of the analogue dNTP opposite a templating base with which it cannot form any normal Watson-Crick hydrogen bonds).

These very large effects of removing O2 from an incoming pyrimidine dNTP contrast with the effects of removing N-3 from a purine dNTP.104 Both groups reside within the minor groove in similar locations and are hydrogen bond acceptors (Figure 2.2). Yet, whereas converting N3 of dATP or dGTP to a carbon results in only small effects on correct polymerization and either significantly increases or has no effect on polymerization of an incorrect purine dNTP, removing O2 of a pyrimidine dNTP cripples polymerization generally.

While not as dramatic as the differences observed for polymerization of purine dNTPs versus pyrimidine dNTPs, comparing the effects of removing O2 from dUTP and dCTP showed significantly different effects. Removing O2 from dCTP more severely impacted correct incorporation and in the case of pol , had a greater effect on fidelity. These differences provide further support to the idea that the mechanism(s) by which DNA polymerases recognize each of the canonical base-pairs are non-identical. Previous studies showed that the identical modification to different bases can have vastly different effects.138,147 Additional support from this idea comes from biophysical studies by Waksman and coworkers, who found that ternary E-

DNA-dNTP structures of KlenTaq varied accordingly to the identity of the dNTP-templating base examined.148 Furthermore, the enzyme showed different dynamics during replication of each canonical base-pair.149 Thus, it is probably inappropriate to consider a DNA polymerase as a “simple” machine that simply pairs an incoming dNTP with the templating base. Rather, the polymerase may actively read the templating base and then alter the chemistry of base-pair recognition depending upon the templating base.

The effects of removing O2 from a templating U were very similar to the effects of removing O2 from the incoming dUTP during pol -catalyzed DNA synthesis. In contrast, whereas removing O2 from an incoming dCTP severely impacted both correct incorporation and fidelity, eliminating O2 from a templating C had but modest effects on polymerization of a correct dGTP and no significant effects on misincorporation of noncognate dNTPs. In the case of adenine, removing N-3 from a templating A produced a greater impact on polymerization efficiency (50-fold decrease, Table 2.6) than did removing N-3 from the incoming dATP (5-fold decrease104) during generation of an A-T base-pair. These differences provide further evidence that DNA polymerases can recognize nucleotides very asymmetrically depending upon whether they are in the template or are the incoming dNTP, and that minor groove chemistry plays a major role in this asymmetry.

Potentially, three alternative mechanisms could explain these very different results on the effects of removing purine N-3 and pyrimidine O2. The different steric effects of altering N-3 and O2 could explain the differences. Whereas replacing N-3 of a purine with C has only a small steric effect, removing O2 of a pyrimidine has a large effect. Alternatively, the polymerases may differentially interact with the minor groove side of incoming purine and pyrimidine dNTPs, thereby causing the vastly different effects. The active sites of the B family polymerases are remarkably well conserved, especially the group of amino acids that surround the incipient base- pair between the incoming dNTP and the templating base. The B family polymerase from RB69 has been extensively studied structurally and provides potential clues for these differences.33,40,150

While there are no obvious hydrogen bonding groups in RB69 polymerase that could interact with O2 or N-3, the electron deficient edge of a tyrosine sits squarely in the minor groove of the incipient base-pair (Y567 in RB69 polymerase, Y957 in pol , and Y818 in HSV-1 DNA

38 polymerase).33,40,104 In the ternary RB69 polymerase-DNA-dTTP complex, this tyrosine interacts with O2 of the incoming dTTP.40 It is unknown if this tyrosine adopts a similar conformation during polymerization of other dNTPs, or if it adopts different conformations at different points during the catalytic cycle. Importantly, differential interaction of this tyrosine with a purine N-3 versus a pyrimidine O2 would explain the differences between removing the purine N-3 and pyrimidine O2. Likewise, the different effects of removing O2 from an incoming dCTP versus a templating C could be mediated by this tyrosine; for example, it could adopt different positions depending upon the identity of the templating base. This would significantly alter its interactions with the electron rich N-3 of a purine or O2 of a pyrimidine and, depending upon the functional role of these interactions, alter correct and/or incorrect dNTP polymerization. Finally, these differential results could reflect the electronic changes in the aromatic rings caused by removal of purine N-3 and pyrimidine O2. For example, removing N-3 will decrease the  electron density of the ring. The altered electron density could impact both stacking onto the neighboring bases as well as interactions with two conserved amino acids that interact with the  faces of the templating and dNTP bases (asparagines and serine), thereby affecting polymerization.

Importantly, the remarkably well-conserved chemistry of this region of the active site among different B-family polymerases151 suggests that the results observed for HSV-1 polymerase and pol  will be similar in other members of this family.

The Watson-Crick hydrogen bonding groups of a pyrimidine clearly play an important role in enhancing correct dNTP polymerization, but are not essential for preventing misincorporation. In the absence of any Watson-Crick hydrogen bonding groups (i.e., 2- pyridone), neither pol  nor HSV-1 polymerase efficiently polymerized a canonical dNTP.

Adding back N-3 to the pyridine significantly increased polymerization of the resulting dZebTP

39 opposite a templating G, demonstrating the key role of this group in promoting efficient polymerization. As noted earlier, however, the ability to form two Watson-Crick hydrogen bonds did not by itself ensure efficient polymerization. Additionally, the efficient polymerization of dZebTP provides further evidence that a correctly shaped base-pair is not needed for efficient dNTP incorporation by pol .

These results have significant implications for the design of novel base pairs that are incorporated efficiently and accurately by polymerases, particularly if one would like to design bases that are “purine-like” and “pyrimidine-like”. Efficient and accurate replication of any novel base-pair requires that the chemical features of the two bases satisfy the requirements of the polymerase. However, the data presented herein show that polymerases can exhibit distinctly different requirements for purine and pyrimidine dNTPs (e.g., the minor groove H-bond acceptors N-3 and O2 on purines and pyrimidines). Furthermore, the chemical requirements can vary depending upon whether the base is on the incoming dNTP or on the template strand. For example, while accurate and efficient incorporation of dCTP absolutely requires O2 of dCTP, this is not true for a templating C. These large differences in chemical requirements for even the different natural bases imply that different unnatural bases will also have diverse and potentially unpredictable requirements, thereby greatly complicating efforts to rationally design novel base- pairs.

III. Pyrimidine Features Play Essential but Asymmetric Roles During Incorporation by Klenow Fragment

INTRODUCTION

Despite decades of study, the chemical features of dNTPs and templating nucleotides that determine the efficiency of dNTP polymerization are not yet fully understood. Complicating matters, different polymerases appear to utilize significantly different mechanisms.87,104 The incorporation efficiency of dNTPs by some enzymes families, such as human primase, herpes primase, and Y family DNA polymerases, appears to be largely determined by the Watson−Crick hydrogen bonding groups on the incoming (d)NTPs and the templating base.80,82–85 On the other hand, various studies have shown that A and B family DNA polymerases do not require

Watson−Crick hydrogen bond formation for efficienct dNTP incorporation.81,131 Specific functional groups on the base of incoming dNTPs dictate both incorporation efficiency and fidelity in B family polymerases;104,105,130,152 however, the methods used by A family polymerases are less well understood. Some studies 91,92,96–98 suggest that the shape of the base pair formed by the incoming dNTP and template base is the critical factor for determining dNTP incorporation efficiency. Notably, Kool has demonstrated that the Klenow fragment (KF) of

DNA polymerase I (exo-), a high fidelity A family DNA polymerase, will efficiently and accurately generate base pairs between adenine (A) and 2,4-difluorotoluene, a base whose shape closely matches that of A’s natural partner thymine (T) while lacking T's hydrogen-bonding moieties.86,91,92 However, several other studies found that KF also efficiently generates base pairs whose shapes vary significantly from the correctly-shaped base pairs. 81,101–103,153

Working from these findings, a number of groups have developed systems of unnatural base pairs with high selectivity for use with in vitro technologies, such as the site-specific

41 incorporation of novel components into nucleic acids and proteins. Notably, Benner at al has developed sets of unnatural base pairs that some polymerases will incorporate relatively efficiently and accurately, most recently 2-aminoimidazo[1,2-a]-1,3,5-triazin-4(8H)-one (P) and

6-amino-5-nitro-2(1H)-pyridone (Z), designed around Watson-Crick hydrogen-bonding patterns orthogonal to the canonical bases.118,119 The Romesberg120,121,154 and Hirao122–125 groups have also developed novel base pairs for relatively efficient and accurate incorporation whose shape somewhat resembles that of a canonical base pair. In addition to providing fundamental insights into DNA polymerase mechanisms, a deeper understanding of the principle(s) underlying how polymerases choose to accurately and efficiently incorporate a dNTP could lead to the improvement of current unnatural base pair systems and the development of additional novel base pairs.

In addition to shape and Watson-Crick hydrogen bonds, consideration has also been given to hydrophobicity, polarity, electronic character, etc. during dNTP polymerization.31,39,106 In particular, multiple studies have shown that the minor groove hydrogen bond acceptors play critical roles during dNTP incorporation. N-3 of purines and O2 of pyrimidines provide an unshared pair of electrons and appear to be the only functional groups in a standard Watson-

Crick base pair that all standard nucleobases present identically. 107,155 These electron-rich groups present hydrogen bonding contacts to polymerase active site amino acid residues, and evidence for conservation of polymerase active site hydrogen-bonding interactions with nascent and terminal Watson-Crick base pairs is found in crystal structures across A and B family polymerases.33–36,39,109,110 Mutating those amino acids that interact with the minor groove hydrogen bond acceptors in either the base pair at the primer terminus or between the incoming dNTP and templating base generally greatly impairs fidelity and/or efficiency of dNTP

42 polymerization.111–113 Although some evidence for interaction with the major groove exists in A family polymerases (for example, T664 in KlenTaq interacts with O4 of a templating T or N4 of a templating C),36 generally the shape and chemical properties of the major groove side of the base pair appear less important, since polymerases generally accept base pairs with greatly altered major grooves.114,115,153

While the functional groups of pyrimidine bases have been examined with respect to their roles in determining incorporation efficiency by B-family DNA polymerases, including pol  and herpes DNA polymerase,152 little is known about their roles in A family polymerases. We used a series of pyrimidine analogues modified at O2, N-3, and N4/O4 to determine how these features impact dNTP polymerization by KF and how the roles of these groups compare to the equivalent groups of purines. Removal of these heteroatoms generally impaired polymerization, with the effects varying from mild to severe. Importantly, the effects of removing specific heteroatoms were remarkably asymmetric in several cases.

EXPERIMENTAL PROCEDURES

Materials. All reagents were of the highest quality commercially available. Unlabeled natural dNTPs were from Sigma, and radiolabeled dNTPs were from Perkin-Elmer. 2-Pyrimidinone dNTP (dZeb) was from Trilink. Protected phosphoramidites were from Glen Research. Synthetic

DNA oligonucleotides were purchased from IDT or Biosearch. KF (exo-) was from New

England Biolabs.

5’-End Labeling of Primers and Annealing of Primer-Templates. DNA primers were 5’-32P- labeled using T4 polynucleotide kinase (New England Biolabs) and [γ-32P]ATP. The labeled

43 primer was gel purified and annealed to the template as previously described.142,143 The primer- template sequences that were used are given in Table 3.1.

Polymerization Assays. Assays were performed under steady-state conditions essentially as previously described104,132 using Klenow fragment (exo-). Assays contained 1 µM 5’-[32P]- primer/template and varying concentrations of natural or analogue dNTPs, and were conducted in commercial NEB2 buffer [50 mM NaCl, 10 mM Tris-HCl (pH 7.9), 10 mM MgCl2, and 1 mM dithiothreitol] supplemented with 0.05 mg/mL bovine serum albumin in a total volume of 5-10

µL. Reactions were initiated by adding enzyme, incubated at 37 °C for 5-30 min, and quenched with an equal volume of gel loading buffer (0.05% xylene cyanol and bromophenol blue in formamide). Products were separated using denaturing gel electrophoresis (20% polyacrylamide,

8 M urea) and imaged using a Typhoon Phosphorimager (Molecular Dynamics). Kinetic parameters were determined by fitting data to the Michaelis-Menten equation using

KaleidaGraph 4.0. All rates were normalized to the same final enzyme concentration (0.1 nM

KF). The reported discrimination values were determined by comparing the efficiency of incorporation for the analogue (Vmax/KM) to the efficiency of incorporation for the corresponding natural nucleotide (Vmax/KM normalized to 1).

Polymerization of Additional dNTPs after the Incorporation of a Normal or Analogue

Nucleotide. Elongation reactions contained the analogue triphosphate at a concentration >> KM and increasing concentrations of the next correct dNTP to be polymerized. Data were analyzed using the running start methodology developed by Goodman and co-workers156 in conjunction with the Molecular Dynamics and KaleidaGraph software as described above.

Synthesis of Nucleotide Analogues. C-2’-deoxyribonucleosides (6AmPy, and 6OPy) were synthesized as previously described.157 2OPy nucleoside and 5’-dimethoxytrityl-3’-

44 phosphoramidites and oligonucleotides were synthesized using established procedures90 and an

Applied Biosystems 394 automatic DNA synthesizer.

Synthesis of Nucleoside 5’-Triphosphates. Nucleosides were converted to nucleoside 5’- triphosphates and purified as previously described.90 Crude nucleoside triphosphates were purified by loading them onto an anion-exchange column (Sephadex-DEAE A-25, Aldrich, pre- equilibrated in TEAB and then washed with H2O) followed by elution with a 0-1 M TEAB gradient. Fractions were identified by MALDI mass spectrometry (negative M-1 ion) with a

THAP matrix. Collected fractions were evaporated and purified by reverse-phase (C18) HPLC using a gradient of 0-50% MeCN in 20 mM triethylammonium acetate. The purity was determined by an appearance of a single peak in HPLC (gradient from 0% to 60 % MeCN in 20 mM TEAB in water) and the triphosphates identified by MALDI MS and 31P NMR.

31 6AmPy dNTP: MS (MALDI, negative ion) 449 (M-1) calcd 449; P NMR (400MHz,D2O)

δ-9.8 (bs, 2P, α-P, γ-P), -22.3 (m, 1P, β-P). 6OPy dNTP: MS (MALDI, negative ion) 450 (M-1)

31 calcd 450; P NMR(400MHz,D2O) δ- δ-10.0 (bs, 2P, α-P, γ-P), -21.1 (m, 1P, β-P).

RESULTS

To better understand how KF, a representative A family polymerase, chooses whether or not to polymerize a dNTP opposite a templating base, we examined dNTP polymerization using a set of pyrimidine analogues lacking the heteroatoms at O2, N-3 and/or N4/O4 (Figure 3.1) on primer- templates of defined sequence (Table 3.1). For two of these analogues, 6AmPy and 6OPy, it was necessary to convert N-1 to carbon such that the nucleosides were C-glycosides so that N-3 and

N4/O4 (if present) maintained the hybridization states appropriate for either C or T and to avoid adding a positive charge to the ring. The steady-state kinetic parameters for incorporation of both natural and analogue dNTPs were measured, and discrimination values reflect the efficiency of correct dNTP incorporation compared to the efficiency of incorporation of a dNTP analogue

(Vmax/KM) or of polymerization of a natural dNTP opposite a templating analogue.

Figure 3.1. Structures, names, and abbreviations of analogue bases used.

Table 3.1. DNA Primer-Templates

DNA-A 5’ – TCCATATCACAT – 3’ 3’ – AGGTATAGTGTAATTCTTATCATCT – 5’

DNA-A2 5’ – TCCATATCACAT – 3’ 3’ – AGGTATAGTGTAATGCTTATCATCT – 5’

DNA-T 5’ – TCCATATCACAT – 3’ 3’ – AGGTATAGTGTATATCTTATCATCT – 5’

DNA-6OPy 5’ – TCCATATCACAT – 3’ 3’ – AGGTATAGTGTA6OPyATCTTATCATCT – 5’

DNA-C 5’ – TCCATATCACAT – 3’ 3’ – AGGTATAGTGTACTTCTTATCATCT – 5’

DNA-6AmPy 5’ – TCCATATCACAT – 3’ 3’ – AGGTATAGTGTA6AmPyTTCTTATCATCT – 5’

DNA-G 5’ – TCCATATCACAT – 3’ 3’ – AGGTATAGTGTAGTTCTTATCATCT – 5’

DNA-I 5’ – TCCATATCACAT – 3’ 3’ – AGGTATAGTGTAITTCTTATCATCT – 5’

The Role of O2, N-3, and N4/O4 in Incoming Pyrimidine Triphosphates. We initially measured the effects of removing O2, N4, and N4 plus N-3 from an incoming pyrimidine dNTP by comparing the incorporation efficiencies of d6AmPyTP, dZebTP and d2OPyTP (Figure 3.1) to the incorporation efficiency of dCTP. KF very strongly discriminated against polymerizing both d6AmPyTP, which lacks O2 of C, as well as d2OPyTP, which lacks both N-3 and N4 of C

(Table 3.2). However, KF polymerized dZebTP, which only lacks N4 of C and retains N-3 and

O2, only 50-fold less efficiently than dCTP (Table 3.2). This variance in discrimination is particularly striking since the only difference between dZebTP and d2OPyTP is the presence or

47 absence of N-3, a difference that minimally affects the shape of the base but replaces an electron rich hydrogen bond acceptor with an electron deficient C-H.

Table 3.2. Pyrimidine Triphosphate Incorporation

a dNTP DNA-N Vmax KM Vmax/KM Discrimination (primer elongation min-1) (μM) (elongation μM-1 min-1) dC DNA-G 330 (10) 0.41 (0.06) 798 1 d6AmPy DNA-G 14 (3) 130 (50) 0.11 7300 d2OPy DNA-G 58 (4) 230 (40) 0.25 3200 dZeb DNA-G 480 (80) 31 (9) 15 52

dT DNA-A 85 (5) 0.4 (0.1) 225 1 dU DNA-A 210 (20) 0.9 (0.5) 239 0.94 d6OPy DNA-A 160 (30) 260 (70) 0.63 360 d2OPy DNA-A 150 (30) 150 (50) 1.02 220

The incorporation efficiencies of the dTTP analogues d6OPyTP and d2OPyTP were likewise compared to incorporation of dTTP and dUTP. As a T analogue, 6OPy lacks the methyl group found at C-5 of T. To exclude the possibility that the absence of the methyl group affects polymerization, we compared the polymerization of dUTP and dTTP, and found that the absence of the methyl has no significant effect on polymerization (Table 3.2). KF discriminated against both d6OPyTP, which lacks O2, and d2OPyTP, which lacks both N-3 and O4, by 200- to 300-

48 fold as compared to TTP (Table 3.2). Thus, although removing the C-5 methyl group of TTP has no effect on polymerization, the removal of either just O2 or N-3 and O4 in TTP moderately inhibits polymerization. Interestingly, loss of either O2 or N-3 plus O4/N4 from an incoming dCTP or TTP had quite different impacts on polymerization of the resulting dCTP and dTTP analogues. In both cases polymerization of the dCTP analogues was more severely decreased than the TTP analogues (by 14- and 20-fold, respectively).

Role of O2 and N4/O4 in Templating Pyrimidines. We next measured the effects of removing O2, N-3, and/or N4/O4 in templating pyrimidines. KF polymerized dGTP opposite a templating C 130-fold more efficiently than opposite the C analogue 6AmPy. (Table 3.3) In contrast to the effect of removing O2 from a templating C, KF incorporated dATP with equal efficiency opposite a templating T and a templating 6OPy. (Table 3.3) This lack of discrimination against 6OPy in the template is particularly striking since the lack of O2 significantly alters the shape and minor groove hydrogen-bonding capabilities of the base. The lack of effect of removing O2 from a templating T and the 130-fold decrease in polymerization efficiency opposite a templating C upon removal of O2 are also extremely different than the 360- and 7300-fold discrimination observed upon removing O2 from either an incoming dTTP or dCTP, respectively (Table 3.2). Thus, KF responds very asymmetrically to identical changes in the templating nucleotide versus the dNTP.

Table 3.3. Incorporation Against Template Pyrimidines

a dNTP DNA-N Vmax KM Vmax/KM Discrimination (primer elongation min-1) (μM) (elongation μM-1 min-1) dG DNA-C 1300 (100) 2 (1) 597 1 dG DNA-6AmPy 82 (5) 18 (6) 4 130 dA DNA-T 660 (60) 6 (3) 106 1 dA DNA-6OPy 730 (50) 7 (3) 111 0.96

Role of the Watson-Crick Hydrogen Bond between O2 of C and N2 of G. Whereas the effects of removing O2 from a templating T could not have resulted from a loss of a Watson-

Crick hydrogen bond to A, this is not the case for C which forms a Watson-Crick hydrogen bonding pair with N2 of G. To determine whether the unfulfilled hydrogen bonding partner N2 in

G impacted polymerization of dGTP opposite 6AmPy, we compared polymerization of dITP and dGTP (Figure 3.1). KF incorporated dITP against a templating C 8-fold less efficiently than dGTP (Table 3.4), indicating that the loss of the hydrogen bond between N2 and O2 has only a small impact on the efficiency of dNTP polymerization. Removing O2 from a templating C decreased polymerization of dGTP and dITP similarly (130- and 94-fold, Tables 3.3 and 3.4).

Since hypoxanthine cannot form a Watson-Crick hydrogen bond with O2 of C, these data suggest that the reduced polymerization of dGTP opposite a templating 6AmPy involves more than the loss of just the hydrogen bond between N2 of dGTP and O2 of the templating base.

Table 3.4. Incorporation of Purine Analogue Hypoxanthine

a dNTP DNA-N Vmax KM Vmax/KM Discrimination (primer elongation min-1) (μM) (elongation μM-1 min-1) dI DNA-C 1800 (200) 23 (9) 76 8 dI DNA-6AmPy 500 (100) 80 (30) 6.4 94 dC DNA-I 810 (90) 30 (20) 27 30 d6AmPy DNA-I 890 (60) 240 (50) 3.8 210

We also compared the incorporation of dCTP and d6AmPyTP against a templating hypoxanthine versus a templating G. KF incorporated dCTP opposite hypoxanthine 30-fold less efficiently than it incorporated dCTP opposite G (Table 3.4). However, whereas KF discriminated very strongly against polymerization of d6AmPyTP opposite a templating G

(7300-fold), it only discriminated against polymerization of d6AmPyTP opposite a templating hypoxanthine by 210-fold. The substantially reduced discrimination against polymerization of

6AmPyTP opposite H suggests that a non-hydrogen bonded N2 within the context of a G-C base pair specifically inhibits dGTP polymerization. Again, we note that KF responds very asymmetrically to the removal of the minor groove N2; although replacing a templating G with hypoxanthine lowers the incorporation efficiency of dCTP by 30-fold (Table 3.4), this replacement increases the incorporation efficiency of d6AmPyTP by 35-fold (Tables 3.2, 3.4).

Role of O2 in Primer Extension. Previous studies155 have shown that if the 3’-terminal nucleotide of the primer is a purine, efficient elongation of the primer requires the minor groove

51 hydrogen bond donor N-3. To determine if this requirement for a minor groove hydrogen bond donor also extends to pyrimidines, we measured elongation of primers containing d6OPy at the primer 3’ terminus. (We selected d6OPy to examine the removal of O2 instead of d6AmPy due to the relatively high incorporation efficiency of d6OPy, as opposed to the unacceptably low incorporation efficency of d6AmPy. [Table 3.2]) We used the “running start” methodology of

Goodman et al.156 to measure the addition of dATP onto a primer bearing either dTTP or d6OPyTP at the 3’ terminus (DNAA2 (Table 3.1). Although KF efficiently incorporated dATP

-1 onto a primer containing a 3’-terminal T (Vmax = 201±6 min and KM = 0.13±0.01 µM, Vmax/ KM

= 1500 µM-1 min-1), it did not detectably polymerize dATP onto a primer containing a 3’- terminal 6OPy, even at 2 mM dATP (10,000-fold greater than needed for extension past dT).

Thus, similar to the result observed with a purine at the primer 3’-terminus, KF requires a minor groove hydrogen bond donor when a pyrimidine resides at the primer 3’-terminus.

DISCUSSION AND CONCLUSIONS

Previous studies have examined the effect of modifying the Watson-Crick and minor groove hydrogen bonding groups of purine dNTPs and templating purines on polymerization by both A and B family DNA polymerases.81,103–105,131 Additionally, previous studies have examined the effects of modifying the Watson-Crick and minor groove hydrogen bonding groups of pyrimidines during dNTP polymerization by B family polymerases.152 Here, we examined the impact of removing O2, N-3, and N4/O4 from pyrimidine dNTPs and templating pyrimidines on the efficiency of dNTP polymerization by an A family enzyme, KF. Removal of these heteroatoms usually but not always impaired polymerization, with the effects varying from

52 essentially none (dATP polymerization opposite 6OPy) to severe (6AmPy:G base pairs).

Importantly, the effects of removing specific heteroatoms were remarkably asymmetric in some cases, even for the same base (6OPy:A base pairs).

A number of studies have suggested that KF uses the shape of the incipient base pair to discriminate between right and wrong dNTPs. Several data described herein suggest that for base pairs that retain at least some Watson-Crick hydrogen bonding capacity, KF does not require the incipient base pair to precisely mimic the shape of a canonical base pair. The removal of O2 of T significantly alters the shape of the resulting base, yet KF polymerizes dATP opposite both a templating T and a templating 6OPy with almost identical efficiency. Second, removing N-3 from dZebTP has at most a small impact on its shape, yet this change reduces the efficiency of polymerization by 50-fold. Finally, removing N2 of dGTP has a relatively small effect on polymerization opposite a templating C, and removing N2 during polymerization opposite a templating 6AmPy has no effect. In both cases, however, this change significantly distorts the shape of the base pair from that of a canonical pair.

Previous studies have also shown that KF will frequently efficiently generate base-pairs whose shape does not closely resemble that of a normal base pair. Examples include the incorporation of benzimidazole, 5-nitrobenzimidazole, 6-nitrobenzimidazole, and 5-nitroindole by KF opposite all four natural bases at rates approaching those of a correct, natural dNTP.81

These data raise the issue as to the extent with which shape contributes to the ability of KF, or any DNA polymerase, to discriminate between right and wrong dNTPs. As noted below, the effects of specific chemical parameters on dNTP polymerization appears very asymmetrical and context dependent. This context dependency may account for shape playing an important role during polymerization of dihalotoluenes opposite A,91,92 but not in other contexts.

One aspect of shape that does play an important role is in the shape of the minor groove.

The structure of the natural base pairs results in the minor groove hydrogen bond acceptors, N-3 of purine and O2 of pyrimidine, being the only two functional groups whose position remains constant in all four base pairs.107,155 This has led to the idea that these groups play critical roles during dNTP polymerization and which has been examined in both A and B family DNA polymerases. With one exception (a templating T; see below), we found that removing O2 of T and C in either the templating base or incoming dNTP greatly inhibited dNTP polymerization, analogous to the effects of removing N-3 from purines. Waring and coworkers have similarly showed that dTTP and dCTP analogues lacking O2 are very poor substrates for Taq polymerase and KF, similar to what we observed.158 In two A family polymerases, KF159 and BF103, removing N-3 from an incoming purine dNTP inhibits the polymerization reaction. Thus, there is broad support for the idea that the minor groove hydrogen bond acceptors are critical for efficient polymerization by both A and B family polymerases.

Further support for the importance of the minor groove hydrogen bonding groups comes from the design of novel base pairs. In generating novel hydrophobic base pairs, Romesberg and coworkers found that the presence of good hydrogen bond acceptors in the minor groove substantially increased the ability of A family polymerases to generate novel base pairs.160

Likewise, early work by Benner et al showed that DNA polymerases do not efficiently generate novel base pairs that retain Watson-Crick hydrogen bonding but lack hydrogen bond acceptors in

161,162 the minor groove (eg, isoG:isoC, and X:Κ), but do efficiently generate novel base pairs if they retain minor groove hydrogen bond acceptors (eg, isoG:TS and P:Z).118,119,163 In fact, minor groove hydrogen bond acceptors in positions emulating the minor groove hydrogen bond acceptors in the natural bases are a universal feature in the most successful novel base pair

54 systems.115 The only exception to the universal importance of the minor groove hydrogen bond acceptors was the removal of O2 from a templating T, which surprisingly did not reduce the efficiency of dATP polymerization.

Removing O2 from either T or C, both in the template and in the triphosphate forms, has strikingly asymmetrical effects. Whereas removing O2 from an incoming dTTP reduced incorporation efficiency by 360-fold (Table 3.2), removing O2 from a templating T resulted in no significant decrease in incorporation of dATP (Table 3.3). Similarly, removing O2 from a templating C decreased the efficiency of dGTP incorporation by 130-fold, while removing O2 form dCTP resulted in much greater discrimination (7300-fold, Tables 3.2, 3.3). Thus, KF uses the minor-groove electronic features of the nucleobases in an asymmetrical and unpredictable basis. Previous studies with A family polymerases103 have similarly noted asymmetrical results in modified purines and pyrimidines, and that the effects of specific functional groups exhibit a strong dependence upon the structure of the rest of the base.

Two other asymmetries are particularly notable. KF incorporated dITP against C only 8-fold less efficiently than dGTP (Table 3.4), yet it incorporated d6AmPyTP against G 7300-fold less efficiently than it incorporated dCTP (Table 3.2). In both cases, the only change was losing the exocyclic minor-groove Watson-Crick bonding partner of the incoming triphosphate, yet the effects were very different. The minor groove hydrogen bond appears much more important during formation of a dCTP:G base pair than during formation of a dGTP:C base pair.

Additionally, when pairing d2OPyTP with a template G, KF discriminated against d2OPyTP polymerization by 3200-fold as compared to the natural dCTP:G pair. On the other hand, when pairing with a template A, KF discriminated against d2OPyTP by only 220-fold as compared to

55 the natural dTTP:A pair (Table 3.2). Thus, interactions of KF with O2 are more important during dCTP polymerization than during dTTP polymerization.

O2 of the incoming pyrimidine dNTP plays a critical role promoting correct dNTP polymerization by KF, while O2 of the templating pyrimidine base is far less critical for promoting dNTP incorporation. One explanation for this asymmetry is that the triphosphate pyridine O2 promotes triphosphate incorporation by binding with important active site residues, ensuring the proper orientation of the incoming triphosphate in the polymerase active site. On the other hand, the O2 of the templating pyrimidines has the far less critical role of helping to maintain the correct orientation of the templating base, whose placement is already much more restricted due to its placement bound in the template strand. In KlenTaq, a very close KF homologue, the side chains R573 and Q754 (R668 and Q849 in KF) always interact with the electron-rich O2 or N-3 moiety present in the minor groove templating and triphosphate bases.36

These residues are universally conserved in A family polymerases, and similar interactions between homologous residues and bases have been observed in T7 DNA polymerase 31 and

Bacillus stearothermophilus 35. The asymmetry in our data is consistent with the idea that R668 is critically responsible for promoting incorporation of the incoming triphosphate via interaction with the pyrimidine O2 or the purine N-3, while the Q849 chain has the less critical role of stabilizing the orientation of the templating base via the pyrimidine O2 or the purine N-3.

A alternative, but related, explanation for the importance of O2 in the incoming pyrimidine triphosphate is that it plays a role in signaling the formation of a correct base pair to the polymerase. In this scheme, when the incoming pyrimidine is aligned properly with the templating base, then the O2 is in the proper position to bind the conserved active site residues, thereby stabilizing the polymerase side chains in the proper orientation for efficient incorporation.

Thus, when the triphosphate O2 is present, it promotes polymerization of the dNTP by stabilization of the proper conformation; when the triphosphate O2 is absent or positioned incorrectly, as in a mispair, the proper conformation is not stabilized, and polymerization is less likely. Structural work by Beese 164 suggests that such substrate misalignment is fundamental in preventing nucleotide misincorporation. This model emphasizes the role of the polymerase in

"reading" the accuracy of the nascent base pair, rather than attempting to "dictate" polymerization.

Interestingly, the trends and asymmetries observed with KF extend to the B-family polymerases. In pol α, as observed here in KF, strong asymmetries in the effects of removing O2 from pyrimidines were observed. These asymmetries were observed between triphosphate and templating pyrimidines, and also between T and C.152 In DNA pol α, removing O2 from T caused similar decreases in polymerization efficiency, regardless of whether T was the incoming triphosphate or the templating base. In contrast, removing O2 from C had drastically asymmetric effects depending on whether C was the templating base or the incoming triphosphate. This trend is mirrored in the case of KF, except the effects on polymerization of base pairs involving C are very similar while effects on polymerization of base pairs involving T are very asymmetrical.

Removing O2 from a pyrimidine at the primer 3’-terminus results in a >10,000-fold decrease in extension efficiency as compared to the corresponding natural base (T). Thus, KF requires O2 in the correct position at the primer terminus to polymerize the next dNTP. Likewise, previous work by Benner and Spratt has demonstrated that KF does not efficiently add the next correct dNTP after incorporation of either 3-deazaadenine or 3-deazaguanine, which lack N-3 in the minor groove position analogous to O2.155,159 Spratt and coworkers also showed that the highly conserved R668 forms hydrogen bonds with the minor grooves of both the terminal and the

57 nascent base pairs.112 Our data thus suggests that the O2 of the incoming triphosphate help to align this conserved arginine with the purine N-3 or the pyrimidine O2 in the minor groove of the existing terminal base pair, enabling the proper alignment of these various feature in the polymerase active site to facilitate the efficient incorporation of the incoming dNTP.

The data presented here indicate that several electronic features of pyrimidines, most notably

O2, play an essential but asymmetrical role in the efficient incorporation of dNTPs by KF, a representative A family polymerase. These surprising asymmetries in the natural bases make it extremely difficult to predict how the polymerase will respond to features of novel unnatural bases pairs. A key unanswered question raised by this study is how the enzyme is detecting the various chemical features of the nucleobases and conveying this information to the active site to promote efficient incorporation.

IV. Synthesis of a Novel Dibasic Nucleoside Analogue

INTRODUCTION

Several groups have developed systems of unnatural base pairs with high incorporation efficiency and selectivity for use with in vitro technologies. Briefly, Benner's group has developed sets of unnatural base pairs that some polymerases will incorporate relatively efficiently and accurately, most recently 2-aminoimidazo[1,2-a]-1,3,5-triazin-4(8H)-one (P) and

6-amino-5-nitro-2(1H)-pyridone (Z), designed around Watson-Crick hydrogen-bonding patterns orthogonal to the canonical bases.118,119 The Romesberg groups have also developed novel base pairs based on hydrophobic partnerings,120,121,154 notably the 5SICS-NaM pair. Hirao has developed unnatural base pairing systems for relatively efficient and accurate incorporation both with and without modified Watson-Crick hydrogen bonding features. (Figure 1.9.)

While examining their steric exclusion theory of nucleobase recognition, Kool's group measured the incorporation of a pyrene nucleoside triphosphate (dPTP), in which the size and shape of the base analogue pyrene approximates that of a complete natural Watson-Crick base pair. (Figure 4.1) They measured the incorporation of dPTP against abasic sites in a templating strand (X), as well as against a templating tetrahydrofuran abasic analogue (ϕ) (Figure 4.1), and found that Klenow fragment (KF) incorporated dPTP against the abasic sites only 4-fold less efficiently than the incorporation of a natural base pair.165 In addition, KF inserts dPTP against abasic sites two orders of magnitude more efficiently than dATP, the nucleotide typically inserted most efficiently against abasic sites by polymerases (an important trend known as the

"A-rule").166–169 They also observed that incorporation of dTTP, dCTP, and dGTP are very inefficient against abasic sites, and that incorporation of dPTP is very inefficient against sites

59 with bases present.165 Thus, Kool's group described a system with great potential as an efficient, selective unnatural base pairing system.

Figure 4.1. (a) Chemical structures of dPTP and abasic nucleosides X and ϕ. (b) Space- filling models of A:T (top) and P- ϕ (bottom) base pairs.165

However, one important result prevented the use of this pyrene/abasic-nucleoside pair as a novel base system. Kool's group observed that upon insertion of dPTP, there was a severe lack of extension past the incorporated analogue by the polymerase.165 Interestingly, this is consistent with its lack of a minor groove hydrogen bond acceptor. It was noted above that removing O2 from a pyrimidine at the primer 3’-terminus results in abolishment of extension by KF, and that previous work by Benner and Spratt has demonstrated the lack of efficient extension by KF after incorporation of purine analogues lacking N-3 in the minor groove position analogous to

O2.155,159 Spratt and coworkers have showed that the highly conserved R668 forms hydrogen bonds with the minor grooves of both the terminal and the nascent base pairs.112 It is likely that

N-3 of the purine and O2 of the pyrimidine, the only two functional groups whose position remains constant in all four base pairs, facilitate the efficient extension of incorporated bases via this conserved residue.107,155

DESIGN OF A NOVEL DIBASIC NUCLEOSIDE ANALOGUE

Accordingly, a base analogue which shares characteristics of size and shape with pyrene, yet includes hydrogen bond acceptors in positions analogous to O2 of pyrimidine and N-3 of purine, is a good candidate for a novel base pairing partner with an abasic nucleoside. In addition, it has been stressed in previous chapters that the exclusion of various nucleobase features have asymmetric, unpredictable effects on the efficiency of incorporation by polymerases. Although dPTP was incorporated efficiently and specifically by KF, this may not be true of other polymerases across the polymerase families. Thus, in designing a novel base pair, it is logical to include as many of the Watson-Crick hydrogen bonding features of a natural base pair as possible. If one is proposing a base analogue that closely matches the size and shape of a natural

61 base pair, and also contains the minor groove hydrogen bonding groups and as many Watson-

Crick hydrogen-bonding groups as are feasible, it is natural to consider the synthesis of an actual natural Watson-Crick base pair (a "dibasic" nucleoside), linked by a flexible linker. (Figure 4.2).

NH HN

N N HN O O O HO P O P O P O N N O O OH OH OH

Figure 4.2. Structure of proposed dibasic (A:T) 2'-deoxyriboside triphosphate.

To position the flexible linker in the position most tolerable by polymerases, it is important to note that the shape and chemical properties of the major groove side of the base pair are less critical for efficient incorporation, since polymerases generally accept base pairs with greatly altered major grooves.100,114,115 Thus, the major groove is a natural position for the flexible carbon chain linker. Although molecular modeling has not revealed an ideally-sized linker to precisely emulate the distance between the major groove groups of a natural base pair (3.1 Å), and thus far inquiries towards the use of computer-aided design methods have gone unanswered,170 precise modeling of the natural base pairs is clearly a requirement neither for dNTP incorporation by polymerases165 nor for successful novel base pair systems.115 Thus, propyl, butyl, and pentyl moieties -- groups long enough to permit the proper distancing of the bases, but short enough to reasonably restrict the potential conformations of the analogue -- will be considered for use as the flexible major-groove linker. This will also allow for the exploration

62 of potentially beneficial hydrogen-bonding interactions between the atoms at the termini of the linker. The use of diamino and dithiol linkers will be explored, not only for the purposes of alternative synthetic routes, but also to provide for variation in major groove interactions.

SYNTHESIS RESULTS AND DISCUSSION

The initially-proposed synthesis of a dibasic (A:T) 2'-deoxyriboside triphosphate is shown in Figure 4.3. All reactants are commercially available. Initial coupling of 6-chloro-2- hydroxypyridine with 1,3-diaminopropane (step 1) was to be followed by reaction with 6- chloropurine-2'-deoxyriboside (step 2), to yield the dibasic deoxyriboside. Subsequently, triphosphorylation of the deoxyriboside was to be performed via standard techniques (steps 3-

4).90

Cl Cl NH H2N N N H N NH HN 2 2 HN N N HO (1) O O O

OH (2) NH HN HN NH N N HN N O O O N HN HO P O P O P O N O N N N O HO O OH OH OH O (3) POCl 3

OH (4) Pyrophosphate OH

Figure 4.3. Proposed synthesis of dibasic (A:T) 2'-deoxyriboside triphosphate.

However, step 1 proved to be more problematic than anticipated. Initial attempts at this reaction focused on the conditions for the Buchwald-Hartwig amination,171–173 a palladium- catalyzed technique for the cross-coupling of amines with aryl halides, in addition to a number of simple conditions to promote aromatic nucleophilic substitution.174,175 Early characterization of these step 1 reaction products via TLC, NMR, and MALDI-MS tentatively indicated a successful reaction. Accordingly, purification of these products and linkage with 6-chloropurine 2'- deoxyriboside was pursued. When these efforts proved unsuccessful, alternative methods for step

1 were pursued, and this cycle was repeated several times with a variety of experimental conditions in all of the steps, in an attempt to identify the problematic step(s).

Eventually, a careful analysis of our NMR data and additional LC/ESI-MS data, with critical input from our collaborator Dr. Byron Purse, showed that an incorrect product was forming. Instead of our desired product (Figure 4.4a; M+ +H, 168), a cyclization reaction was occurring due to the facile formation of a 6-membered ring (Figure 4.4b; M+ +H, 151). A probable mechanism for this cyclization is shown in Figure 4.4c. The conditions of this reaction involved the reflux of the chlorinated pyridine with 10 equivalents of 1,3-diamine in n-butanol for 18 hours. Under these conditions, in-NMR-tube experiments at increasing temperatures established that temperatures of >140°C are necessary for the amination of the aromatic ring to proceed, as evidenced by the persistence of aromatic peaks of 6-Cl-2-hydroxypyridine (δH [400

MHz, DMSO]: 7.67 [1H, dd], 6.92 [1H, d], 6.62 [1H, dd]) until that temperature, at which point aromatic peaks of the coupled product (δH [400 MHz, DMSO]: 7.03 [1H, dd], 5.34 [1H, dd],

5.25 [1H, dd]) begin to appear.

Figure 4.4. Analysis of synthesis step 1. (a) Proposed reaction product of step 1. (b) Actual reaction product of step 1. (c) Likely mechanism for the observed cyclization reaction.

Fortunately, this cyclization can be easily prevented via the use of a protected linker, or by adjusting the order of the synthesis to begin with purine coupling, as depicted in Figure 4.5. In addition, by modifying the linker length, the formation of a stable six-membered ring can also be avoided, not only in the pyridine but also during the purine coupling.

Cl HN NH2 n N N N N H N NH 2 n 2 Cl N N N N (1b) HO HO O O HN

O OH OH (2b)

HN n NH NH n NH N N N HN N HN O O O N N HO P O P O P O N HO O O N O O OH OH OH (3) POCl 3

(4) Pyrophosphate OH OH

Figure 4.5. Modified synthesis of dibasic (A:T) 2'-deoxyriboside triphosphate.

To date, LC/ESI-MS data suggests that coupling of 6-chloropurine-2'-deoxyriboside with

1,3-diaminopropane (M+ +H, 308) and 1,5-dithiopentane (M+ +H, 370) have been achieved under conditions similar to those described previously.176 In each instance, 20mg of 6-chloropurine-2'- deoxyriboside was stirred overnight at 70°C with 3 equivalents of a linker and 100μL of diisopropylethylamine in 300 μL of DMSO or tert-butanol. Purification by HPLC as described previously176 or on a silica column with a gradient of dichloromethane to dichloromethane/methanol 9/1, similar to conditions described previously,157 as well as characterization of these products, is underway.

FUTURE STEPS

Purification and analysis of step 1b products (Figure 4.5) with various linkers (1,3- diaminopropane, 1,4-diaminobutane, and 1,5-dithiopentane) are currently underway. Some of these products have been reacted with a slight excess of 6-chloro-2-hydroxypyridine (step 2b), and analysis of these products are underway. As the conditions for coupling of 6-chloro-2- hydroxypyridine with aminated linkers have already been identified, it is likely that these reactions will be straightforward, although it is possible that issues will arise due to the presence of the deoxyribose group, or due to the potential breakage of the glycosidic bond. (If it appears that the conditions necessary for the coupling of the aminated linkers with the chlorinated pyridine result in the breakage of the glycosidic bond, then it will be simple to modify the synthesis such that a standard deoxyribosylation reaction82,177 is performed after synthesis of a purine-linker-pyridine product.)

Finally, triphosphorylation of the deoxyribose and purification of the products will be performed according to standard conditions described previously.90 Briefly, the nucleosides are to be dissolved in trimethyl phosphate and cooled to 0 °C. POCl3 (1.1 equivalents) in trimethylphosphate will be added dropwise. The mixture will be stirred for 3 hours and then tetrabutylammonium pyrophosphate (5 equivalents) in DMF added. The mixture will be stirred for 4 h, while the temperature reaches room temperature. Crude nucleoside triphosphates will be purified by loading them onto an anion-exchange column (Sephadex-DEAE A-25, Aldrich, pre- equilibrated in TEAB and then washed with H2O) followed by elution with a 0-1 M TEAB gradient. Fractions are to be identified by MALDI mass spectrometry (negative M-1 ion) with a

THAP matrix, collected, evaporated, and purified by reverse-phase (C18) HPLC using a gradient of 0-50% MeCN in 20 mM triethylammonium acetate.

In addition to the triphosphorylation reaction, 5’-dimethoxytrityl-3’-phosphoramidites and oligonucleotides can be synthesized as described using established procedures90 on an Applied

Biosystems 394 automatic DNA synthesizer.145,146 If initial experiments into the incorporation of the triphosphate form of the dibasic analogue are positive, a templating dibasic analogue will permit characterization of its use by polymerases in the reverse context. To complete the novel base pair system, of course, an abasic triphosphate is necessary. I have already completed synthesis of this compound via triphosphorylation of deoxyribose using the standard procedures described in the previous paragraph.90

The sections above have described the synthesis of a novel dibasic deoxyriboside analogue.

In addition to its potential use in a novel base pairing system, it should be noted that this analogue, and related compounds, would also be useful for studying the recognition of this

"supersized" class of nucleobase analogues by various polymerases across the polymerase families. It would be particularly useful to compare and contrast polymerase incorporation efficiency, selectivity, and extension of this analogue, and related compounds, with pyrene.

These results could provide further insight into the complex, asymmetrical trends in nucleobase recognition described in previous chapters.

V. Summary and Future Directions

SUMMARY OF FINDINGS

The work described in the previous chapters describes an investigation into the recognition of nucleobase features by several DNA polymerases. To summarize briefly, I first described the use of a series of pyrimidine analogues modified at O2, N-3, and N4/O4 to determine how two B family DNA polymerases, human DNA polymerase  and herpes simplex virus I DNA polymerase, choose whether or not to polymerize pyrimidine dNTPs. Removing O2 of a pyrimidine dNTP vastly decreased incorporation by these enzymes and also compromised fidelity in the case of C analogues, while removing O2 from the templating base had more modest effects. Removing the Watson-Crick hydrogen bonding groups of N-3 and N4/O4 greatly impaired polymerization, both of the resulting dNTP analogues as well as polymerization of natural dNTPs opposite these pyrimidine analogues when present in the template strand. Thus, the Watson-Crick hydrogen bonding groups of a pyrimidine clearly play an important role in enhancing correct dNTP polymerization, but are not essential for preventing misincorporation.

These studies also indicate that DNA polymerases recognize bases extremely asymmetrically, both in terms of whether they are a purine or pyrimidine and whether they are in the template or are the incoming dNTP.

Secondly, I discussed the use of this series of pyrimidine analogues to determine how these nucleobase features impact dNTP polymerization by the Klenow fragment of DNA polymerase I, an A family polymerase. Removal of these heteroatoms generally impaired polymerization, with the effects varying from mild to severe. The removal of O2 and N4/O4, which significantly altered the shape of the base, was tolerated in some cases with little or no loss in incorporation

69 efficiency, while modification of N-3, which had little impact on the shape of the nucleobase, resulted in a significant loss in incorporation efficiency. Importantly, the effects of removing specific heteroatoms were remarkably asymmetric in several cases, notably in the removal of O2 from pyrimidines both in the templating and triphosphate forms. We found that O2 of the incoming pyrimidine triphosphate is critical for efficient incorporation, while O2 of a templating pyrimidine base is far less critical for efficient incorporation of its corresponding dNTP. We also observed that removing O2 from a pyrimidine at the primer 3’-terminus prohibited extension of the primer.

Finally, I described initial work on the synthesis of a novel dibasic analogue. The design of this analogue emerges from studies demonstrating efficient and selective incorporation of pyrene nucleoside triphosphate, a "base" analogue whose size and shape approximates that of a complete natural Watson-Crick base pair. However, the novel dibasic analogue described above also incorporates chemical features whose importance has been demonstrated in the previous chapters. These features include the presence of minor groove hydrogen bond acceptors to facilitate extension past the analogue upon its incorporation, as well as the Watson-Crick hydrogen bonding groups of an A:T pair, since we have seen that the removal or modification of these groups has unpredictable, but often detrimental, effects upon efficient nucleobase incorporation by polymerases.

ASYMMETRY WITHIN POLYMERASE FAMILIES

The most notable trend across all of these data is the presence of asymmetries in the recognition of nucleobase features by polymerases. Asymmetries between incoming and templating bases, between purines and pyrimidines, and even between different pyrimidines have

70 already been highlighted. Another asymmetry not described thoroughly above, however, is the asymmetry found among different polymerases within the same family. For example, among A family polymerases, the removal of N-3 from dGTP resulted in a mere 12-fold loss in incorporation efficiency by Klenow fragment,159 while the same modification resulted in a 400- fold loss in incorporation efficiency by Bacillus fragment.103 Similarly, among B family polymerases, the removal of O2 from pyrimidine triphosphates had different effects on the incorporation efficiency by pol α than by herpes pol (Tables 2.3, 2.4).

Clearly, many of the recognition mechanisms at work in polymerases are not identical, even within polymerase families. Yet, it is typical to consider a result observed in a particular polymerase as generally representative of other polymerases from the same family. It should not be taken for granted that the results of previous studies with particular polymerases or nucleobase analogues will generalize consistently. Among the trends in polymerase recognition that are known to be asymmetric, yet are critical for a complete grasp of polymerase functioning, is an understanding of polymerase usage of the electronic-rich minor groove features (O2 in pyrimidines and N-3 in purines). These features appear to play a major role during polymerization and extension, and an understanding of their use by polymerases will be particularly important since these features are the only functional groups in a standard Watson-

Crick base pair that all standard nucleobases present identically. Also, we have the tools at hand for a careful study of these features in the form of analogues of adenine, guanine, cytosine, and thymine lacking only the electron-rich minor groove features (3-deazaadenine, 3-deazaguanine,

6-aminopyridine, and 6-oxopyridine, respectively).

Despite the importance of these conserved features and the availability of tools for their study, there are significant gaps in the use of these analogues across the polymerase families. For

71 example, an examination of the treatment by KF of the templating and triphosphate forms of the

O2-lacking pyrimidine analogues was described in Chapter 3 above, but the additional examination of these analogues in BF, Taq, T7, or other A family polymerases would be valuable. And although the treatment of 3-deazaguanine in both triphosphate and templating forms has been examined in KF,159 the treatment of 3-deazaadenine has only been observed non- quantitatively in the triphosphate form,155 and has not been extensively studied in the template form in A family polymerases. Similar gaps exist in the study of these analogues in B family polymerases. A more comprehensive overview of the functioning of these analogues lacking the minor groove electron-rich features will be valuable for understanding their usage across polymerase families, as well as the extent to which asymmetries are present within each family.

The other polymerase families have been less thoroughly examined than the A and B family polymerases. Although some mechanistic and structural studies have been mentioned for the X,

Y, and RT families, these families have not been studied to the extent of the A and B families.

Comparatively little is known of the C and D family polymerases. Triphosphate and templating versions of the four analogues lacking the electron-rich minor groove features are well suited for studying the properties of polymerases from all of these families. Similarly, it would be valuable to understand how polymerases from the various families respond to the various suites of purine and pyrimidine analogues discussed above (Figures 1.5, 1.7, 1.8, 2.1, etc).

MUTAGENESIS OF KEY ACTIVE SITE RESIDUES

Another set of experiments worthy of consideration involve the use of polymerases in which key active site residues have been modified. In Chapter 2, it was noted that several alternative mechanisms are available to explain the observed asymmetric differences in incorporation by B

72 family polymerases upon removing purine N-3 and pyrimidine O2 from templating and triphosphate bases. Potential explanations include the possibility that the polymerase interacts differently with the minor groove of different incoming bases, or that electronic changes in the aromatic rings caused by removal of purine N-3 and pyrimidine O2 differ. The mutagenesis of the tyrosine (Y567 in RB69 polymerase, Y957 in pol , and Y818 in HSV-1 DNA polymerase)4,45,47 suspected to interact with the minor groove features of the incoming bases would shed light on the former hypothesis, while the latter hypothesis could be examined by the mutagenesis of the nearby asparagine and serine residues48 which are suspected to interact with the  faces of the templating and dNTP bases.

Similarly, in Chapter 3, we observed asymmetry in our data for incorporation by B family polymerases upon removing O2 of the triphosphate or templating bases. This asymmetry is consistent with the idea that R668 and Q849 in KF (R573 and Q754 in KlenTaq) interact with the electron-rich O2 or N-3 groups in the minor groove templating and triphosphate bases.36 In an extension of work by Spratt,112 the use of polymerases mutated at these residues in conjunction with the analogues lacking the electron-rich minor groove features would shed light on our hypotheses for the roles of these residues.

DESIGN OF NOVEL BASE PAIRS AND POLYMERASE INHIBITORS

Although the asymmetries we observed make it extremely difficult to predict how the polymerase will respond to features of novel unnatural bases pairs, many of the findings described in previous chapters could still provide valuable insight during the design of novel

73 modified base pair systems or the refinement of existing systems. For example, we have confirmed that the presence of a good hydrogen bond acceptor in the minor groove of the incoming triphosphate, in the position analogous to O2 of pyrimidines and N-3 of purines, is often critical for efficient incorporation and extension by a number of polymerases. Indeed, minor groove hydrogen bond acceptors in positions emulating those groups in the natural bases are a universal feature in the most successful novel base pair systems.115 Designers of future novel base pair systems should strongly consider incorporating a feature such as this to achieve efficient incorporation of their base analogue. In addition, modifications in the major groove, as well as some features along the Watson-Crick hydrogen-bonding edge of the base pair, were tolerated to a varying degree among the polymerases we examined, providing further confirmation that these regions are amenable to modification.

Similarly, the findings described above could also be applied to the rational design of novel polymerase inhibitors based around the modification of the nucleobases. Since nearly all polymerase inhibitors currently in use are based around the modification of the sugar or triphosphate moieties, there is an opportunity to develop a separate class of modified-nucleobase inhibitors with unique mechanisms or benefits. Interestingly, the asymmetries that have been observed between different polymerases will allow for the development of inhibitors which target specific polymerases while leaving other polymerases, even those in the same family, unaffected. For example, the removal of O2 from dTTP had a stronger effect on incorporation by herpes polymerase than by pol α (Table 2.3), while the removal of O2 from dCTP had a stronger effect on incorporation by pol α than by herpes polymerase. A further investigation of this trend using purine analogues, as well as extending the studies to other polymerases, could inform the development of modified-nucleobase polymerase inhibitors that affects the herpes polymerase

74 more potently than human B family polymerases. These, and other ideas, could provide valuable contributions to novel base pair or polymerase inhibitor design by building on the various data described above.

BIBLIOGRAPHY

(1) Kunkel, T. A., and Bebenek, K. (1988) Recent studies of the fidelity of DNA synthesis. Biochimica et Biophysica Acta 951, 1–15.

(2) Roberts, J., and Kunkel, T. (1996) The Fidelity of Eukaryotic DNA Replication, in DNA Replication in Eukaryotic Cells: Concepts, Enzymes, and Systems (DePamphilis, M., Ed.), pp 217–247. Cold Spring Harbor Press, Cold Spring Harbor, NY.

(3) Braithwaite, D. K., and Ito, J. (1993) Compilation, alignment, and phylogenetic relationships of DNA polymerases. Nucleic Acids Research 21, 787–802.

(4) Ito, J., and Braithwaite, D. K. (1991) Compilation and alignment of DNA polymerase sequences. Nucleic Acids Research 19, 4045–57.

(5) Delarue, M., Poch, O., Tordo, N., Moras, D., and Argos, P. (1990) An attempt to unify the structure of polymerases. Protein Engineering 3, 461–7.

(6) Joyce, C. M., and Steitz, T. A. (1994) Function and structure relationships in DNA polymerases. Annual Review of Biochemistry 63, 777–822.

(7) Rothwell, P., and Waksman, G. (2005) Structure and mechanism of DNA polymerases. Advances in Protein Chemistry 71, 401–440.

(8) Kornberg, A. (1960) Biologic synthesis of deoxyribonucleic acid. Science 131, 1503–8.

(9) Kornberg, A., and Baker, T. (1992) DNA replication. Vol 5. New York: WH Freeman.

(10) Chan, S. H., Yu, A. M., and McVey, M. (2010) Dual roles for DNA polymerase theta in alternative end-joining repair of double-strand breaks in Drosophila. PLoS Genetics 6, e1001005.

(11) Thompson, H. C., Sheaff, R. J., and Kuchta, R. D. (1995) Interactions of calf thymus DNA polymerase alpha with primer/templates. Nucleic Acids Research 23, 4109–15.

(12) Dong, Q., Copeland, W. C., and Wang, T. S. (1993) Mutational studies of human DNA polymerase alpha. Serine 867 in the second most conserved region among alpha-like DNA polymerases is involved in primer binding and mispair primer extension. The Journal of Biological Chemistry 268, 24175–82.

(13) Pavlov, Y. I., Frahm, C., Nick McElhinny, S. A., Niimi, A., Suzuki, M., and Kunkel, T. A. (2006) Evidence that errors made by DNA polymerase alpha are corrected by DNA polymerase delta. Current Biology 16, 202–7.

(14) Kelman, Z., and O’Donnell, M. (1995) DNA polymerase III holoenzyme: structure and function of a chromosomal replicating machine. Annual Review of Biochemistry 64, 171–200.

(15) Lamers, M. H., Georgescu, R. E., Lee, S.-G., O’Donnell, M., and Kuriyan, J. (2006) Crystal structure of the catalytic alpha subunit of E. coli replicative DNA polymerase III. Cell 126, 881– 92.

(16) Uemori, T., Sato, Y., Kato, I., Doi, H., and Ishino, Y. (1997) A novel DNA polymerase in the hyperthermophilic archaeon, Pyrococcus furiosus: gene cloning, expression, and characterization. Genes to Cells 2, 499–512.

(17) Matsumoto, Y., and Kim, K. (1995) Excision of deoxyribose phosphate residues by DNA polymerase beta during DNA repair. Science 269, 699–702.

(18) Domínguez, O., Ruiz, J. F., Laín de Lera, T., García-Díaz, M., González, M. A., Kirchhoff, T., Martínez-A, C., Bernad, A., and Blanco, L. (2000) DNA polymerase mu (Pol mu), homologous to TdT, could act as a DNA mutator in eukaryotic cells. The EMBO Journal 19, 1731–42.

(19) García-Díaz, M., Domínguez, O., López-Fernández, L. A., De Lera, L. T., Saníger, M. L., Ruiz, J. F., Párraga, M., García-Ortiz, M. J., Kirchhoff, T., Del Mazo, J., Bernad, A., and Blanco, L. (2000) DNA polymerase lambda (Pol lambda), a novel eukaryotic DNA polymerase with a potential role in meiosis. Journal of Molecular Biology 301, 851–67.

(20) Burgers, P. M., Koonin, E. V, Bruford, E., Blanco, L., Burtis, K. C., Christman, M. F., Copeland, W. C., Friedberg, E. C., Hanaoka, F., Hinkle, D. C., Lawrence, C. W., Nakanishi, M., Ohmori, H., Prakash, L., Prakash, S., Reynaud, C. A., Sugino, A., Todo, T., Wang, Z., Weill, J. C., and Woodgate, R. (2001) Eukaryotic DNA polymerases: proposal for a revised nomenclature. The Journal of Biological Chemistry 276, 43487–90.

(21) Motea, E. A., and Berdis, A. J. (2010) Terminal deoxynucleotidyl transferase: the story of a misguided DNA polymerase. Biochimica et Biophysica Acta 1804, 1151–66.

(22) Prasad, R., Widen, S. G., Singhal, R. K., Watkins, J., Prakash, L., and Wilson, S. H. (1993) Yeast open reading frame YCR14C encodes a DNA beta-polymerase-like enzyme. Nucleic Acids Research 21, 5301–7.

(23) Friedberg, E. C., and Gerlach, V. L. (1999) Novel DNA polymerases offer clues to the molecular basis of mutagenesis. Cell 98, 413–6.

(24) Friedberg, E. C., Feaver, W. J., and Gerlach, V. L. (2000) The many faces of DNA polymerases: strategies for mutagenesis and for mutational avoidance. Proceedings of the National Academy of Sciences of the United States of America 97, 5681–3.

(25) Goodman, M. F., and Tippin, B. (2000) Sloppier copier DNA polymerases involved in genome repair. Current Opinion in Genetics & Development 10, 162–8.

(26) Johnson, R. E., Washington, M. T., Prakash, S., and Prakash, L. (1999) Bridging the gap: a family of novel DNA polymerases that replicate faulty DNA. Proceedings of the National Academy of Sciences of the United States of America 96, 12224–6.

(27) Woodgate, R. (1999) A plethora of lesion-replicating DNA polymerases. Genes & Development 13, 2191–5.

(28) Götte, M., Li, X., and Wainberg, M. A. (1999) HIV-1 reverse transcription: a brief overview focused on structure-function relationships among molecules involved in initiation of the reaction. Archives of Biochemistry and Biophysics 365, 199–210.

(29) Greider, C. W., and Blackburn, E. H. (1985) Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 43, 405–13.

(30) Coté, M. L., and Roth, M. J. (2008) Murine leukemia virus reverse transcriptase: structural comparison with HIV-1 reverse transcriptase. Virus research 134, 186–202.

(31) Doublié, S., Tabor, S., Long, A. M., Richardson, C. C., and Ellenberger, T. (1998) Crystal structure of a bacteriophage T7 DNA replication complex at 2.2 A resolution. Nature 391, 251– 8.

(32) Korolev, S., Nayal, M., Barnes, W. M., Di Cera, E., and Waksman, G. (1995) Crystal structure of the large fragment of Thermus aquaticus DNA polymerase I at 2.5-A resolution: structural basis for thermostability. Proceedings of the National Academy of Sciences of the United States of America 92, 9264–8.

(33) Wang, J., Sattar, a K., Wang, C. C., Karam, J. D., Konigsberg, W. H., and Steitz, T. a. (1997) Crystal structure of a pol alpha family replication DNA polymerase from bacteriophage RB69. Cell 89, 1087–99.

(34) Li, Y., Korolev, S., and Waksman, G. (1998) Crystal structures of open and closed forms of binary and ternary complexes of the large fragment of Thermus aquaticus DNA polymerase I: structural basis for nucleotide incorporation. The EMBO Journal 17, 7514–25.

(35) Kiefer, J. R., Mao, C., Braman, J. C., and Beese, L. S. (1998) Visualizing DNA replication in a catalytically active Bacillus DNA polymerase crystal. Nature 391, 304–7.

(36) Li, Y., and Waksman, G. (2001) Crystal structures of a ddATP-, ddTTP-, ddCTP, and ddGTP- trapped ternary complex of Klentaq1: insights into nucleotide incorporation and selectivity. Protein Science 10, 1225–33.

(37) Ollis, D. L., Brick, P., Hamlin, R., Xuong, N. G., and Steitz, T. A. (1985) Structure of large fragment of Escherichia coli DNA polymerase I complexed with dTMP. Nature 313, 762–766.

(38) H Klenow,K Overgaard-Hansen. (1970) Proteolytic cleavage of DNA polymerase from Escherichia Coli B into an exonuclease unit and a polymerase unit. FEBS letters 6, 25 – 27.

(39) Eom, S. H., Wang, J., and Steitz, T. A. (1996) Structure of Taq polymerase with DNA at the polymerase active site. Nature 382, 278–81.

(40) Franklin, M. C., Wang, J., and Steitz, T. a. (2001) Structure of the replicating complex of a pol alpha family DNA polymerase. Cell 105, 657–67.

(41) Hashimoto, H., Nishioka, M., Fujiwara, S., Takagi, M., Imanaka, T., Inoue, T., and Kai, Y. (2001) Crystal structure of DNA polymerase from hyperthermophilic archaeon Pyrococcus kodakaraensis KOD1. Journal of Molecular Biology 306, 469–77.

(42) Hopfner, K. P., Eichinger, A., Engh, R. A., Laue, F., Ankenbauer, W., Huber, R., and Angerer, B. (1999) Crystal structure of a thermostable type B DNA polymerase from Thermococcus gorgonarius. Proceedings of the National Academy of Sciences of the United States of America 96, 3600–5.

(43) Rodriguez, A. C., Park, H. W., Mao, C., and Beese, L. S. (2000) Crystal structure of a pol alpha family DNA polymerase from the hyperthermophilic archaeon Thermococcus sp. 9 degrees N-7. Journal of Molecular Biology 299, 447–62.

(44) Zhou, B. L., Pata, J. D., and Steitz, T. A. (2001) Crystal structure of a DinB lesion bypass DNA polymerase catalytic fragment reveals a classic polymerase catalytic domain. Molecular Cell 8, 427–37.

(45) Pelletier, H., Sawaya, M. R., Kumar, A., Wilson, S. H., and Kraut, J. (1994) Structures of ternary complexes of rat DNA polymerase beta, a DNA template-primer, and ddCTP. Science 264, 1891–903.

(46) Steitz, T. A., Smerdon, S. J., Jäger, J., and Joyce, C. M. (1994) A unified polymerase mechanism for nonhomologous DNA and RNA polymerases. Science 266, 2022–5.

(47) Sawaya, M. R., Prasad, R., Wilson, S. H., Kraut, J., and Pelletier, H. (1997) Crystal structures of human DNA polymerase beta complexed with gapped and nicked DNA: evidence for an induced fit mechanism. Biochemistry 36, 11205–15.

(48) Krahn, J. M., Beard, W. A., Miller, H., Grollman, A. P., and Wilson, S. H. (2003) Structure of DNA polymerase beta with the mutagenic DNA lesion 8-oxodeoxyguanine reveals structural insights into its coding potential. Structure 11, 121–7.

(49) Ling, H., Boudsocq, F., Woodgate, R., and Yang, W. (2001) Crystal structure of a Y-family DNA polymerase in action: a mechanism for error-prone and lesion-bypass replication. Cell 107, 91–102.

(50) Ling, H., Boudsocq, F., Plosky, B. S., Woodgate, R., and Yang, W. (2003) Replication of a cis-syn thymine dimer at atomic resolution. Nature 424, 1083–7.

(51) Ling, H., Sayer, J. M., Plosky, B. S., Yagi, H., Boudsocq, F., Woodgate, R., Jerina, D. M., and Yang, W. (2004) Crystal structure of a benzo[a]pyrene diol epoxide adduct in a ternary complex with a DNA polymerase. Proceedings of the National Academy of Sciences of the United States of America 101, 2265–9.

(52) Nair, D. T., Johnson, R. E., Prakash, S., Prakash, L., and Aggarwal, A. K. (2004) Replication by human DNA polymerase-iota occurs by Hoogsteen base-pairing. Nature 430, 377–80.

(53) Silvian, L. F., Toth, E. A., Pham, P., Goodman, M. F., and Ellenberger, T. (2001) Crystal structure of a DinB family error-prone DNA polymerase from Sulfolobus solfataricus. Nature Structural Biology 8, 984–9.

(54) Trincao, J., Johnson, R. E., Escalante, C. R., Prakash, S., Prakash, L., and Aggarwal, A. K. (2001) Structure of the catalytic core of S. cerevisiae DNA polymerase eta: implications for translesion DNA synthesis. Molecular Cell 8, 417–26.

(55) Uljon, S. N., Johnson, R. E., Edwards, T. A., Prakash, S., Prakash, L., and Aggarwal, A. K. (2004) Crystal structure of the catalytic core of human DNA polymerase kappa. Structure 12, 1395–404.

(56) Das, D., and Georgiadis, M. M. (2004) The crystal structure of the monomeric reverse transcriptase from Moloney murine leukemia virus. Structure 12, 819–29.

(57) Esnouf, R., Ren, J., Ross, C., Jones, Y., Stammers, D., and Stuart, D. (1995) Mechanism of inhibition of HIV-1 reverse transcriptase by non-nucleoside inhibitors. Nature Structural Biology 2, 303–8.

(58) Hsiou, Y., Ding, J., Das, K., Clark, A. D., Hughes, S. H., and Arnold, E. (1996) Structure of unliganded HIV-1 reverse transcriptase at 2.7 A resolution: implications of conformational changes for polymerization and inhibition mechanisms. Structure 4, 853–60.

(59) Rodgers, D. W., Gamblin, S. J., Harris, B. A., Ray, S., Culp, J. S., Hellmig, B., Woolf, D. J., Debouck, C., and Harrison, S. C. (1995) The structure of unliganded reverse transcriptase from the human immunodeficiency virus type 1. Proceedings of the National Academy of Sciences of the United States of America 92, 1222–6.

(60) Ren, J., Bird, L. E., Chamberlain, P. P., Stewart-Jones, G. B., Stuart, D. I., and Stammers, D. K. (2002) Structure of HIV-2 reverse transcriptase at 2.35-A resolution and the mechanism of resistance to non-nucleoside inhibitors. Proceedings of the National Academy of Sciences of the United States of America 99, 14410–5.

(61) Ding, J., Das, K., Moereels, H., Koymans, L., Andries, K., Janssen, P. A., Hughes, S. H., and Arnold, E. (1995) Structure of HIV-1 RT/TIBO R 86183 complex reveals similarity in the binding of diverse nonnucleoside inhibitors. Nature Structural Biology 2, 407–15.

(62) Kohlstaedt, L. A., Wang, J., Friedman, J. M., Rice, P. A., and Steitz, T. A. (1992) Crystal structure at 3.5 A resolution of HIV-1 reverse transcriptase complexed with an inhibitor. Science 256, 1783–90.

(63) Pata, J. D., Stirtan, W. G., Goldstein, S. W., and Steitz, T. A. (2004) Structure of HIV-1 reverse transcriptase bound to an inhibitor active against mutant reverse transcriptases resistant to other nonnucleoside inhibitors. Proceedings of the National Academy of Sciences of the United States of America 101, 10548–53.

(64) Ren, J., Esnouf, R. M., Hopkins, A. L., Warren, J., Balzarini, J., Stuart, D. I., and Stammers, D. K. (1998) Crystal structures of HIV-1 reverse transcriptase in complex with carboxanilide derivatives. Biochemistry 37, 14394–403.

(65) Ren, J., Nichols, C. E., Chamberlain, P. P., Weaver, K. L., Short, S. A., and Stammers, D. K. (2004) Crystal structures of HIV-1 reverse transcriptases mutated at codons 100, 106 and 108 and mechanisms of resistance to non-nucleoside inhibitors. Journal of Molecular Biology 336, 569–78.

(66) Smerdon, S. J., Jäger, J., Wang, J., Kohlstaedt, L. A., Chirino, A. J., Friedman, J. M., Rice, P. A., and Steitz, T. A. (1994) Structure of the binding site for nonnucleoside inhibitors of the reverse transcriptase of human immunodeficiency virus type 1. Proceedings of the National Academy of Sciences of the United States of America 91, 3911–5.

(67) Ding, J., Das, K., Hsiou, Y., Sarafianos, S. G., Clark, A. D., Jacobo-Molina, A., Tantillo, C., Hughes, S. H., and Arnold, E. (1998) Structure and functional implications of the polymerase active site region in a complex of HIV-1 RT with a double-stranded DNA template-primer and an antibody Fab fragment at 2.8 A resolution. Journal of Molecular Biology 284, 1095–111.

(68) Huang, H., Chopra, R., Verdine, G. L., and Harrison, S. C. (1998) Structure of a covalently trapped catalytic complex of HIV-1 reverse transcriptase: implications for drug resistance. Science 282, 1669–75.

(69) Jacobo-Molina, A., Ding, J., Nanni, R. G., Clark, A. D., Lu, X., Tantillo, C., Williams, R. L., Kamer, G., Ferris, A. L., and Clark, P. (1993) Crystal structure of human immunodeficiency virus type 1 reverse transcriptase complexed with double-stranded DNA at 3.0 A resolution shows bent DNA. Proceedings of the National Academy of Sciences of the United States of America 90, 6320–4.

(70) Jaeger, J., Restle, T., and Steitz, T. A. (1998) The structure of HIV-1 reverse transcriptase complexed with an RNA pseudoknot inhibitor. The EMBO journal 17, 4535–42.

(71) Sarafianos, S. G., Clark, A. D., Das, K., Tuske, S., Birktoft, J. J., Ilankumaran, P., Ramesha, A. R., Sayer, J. M., Jerina, D. M., Boyer, P. L., Hughes, S. H., and Arnold, E. (2002) Structures of HIV-1 reverse transcriptase with pre- and post-translocation AZTMP-terminated DNA. The EMBO journal 21, 6614–24.

(72) Sarafianos, S. G., Das, K., Tantillo, C., Clark, A. D., Ding, J., Whitcomb, J. M., Boyer, P. L., Hughes, S. H., and Arnold, E. (2001) Crystal structure of HIV-1 reverse transcriptase in complex with a polypurine tract RNA:DNA. The EMBO journal 20, 1449–61.

(73) Patel, P. H., Kawate, H., Adman, E., Ashbach, M., and Loeb, L. a. (2001) A single highly mutable catalytic site amino acid is critical for DNA polymerase fidelity. The Journal of Biological Chemistry 276, 5044–51.

(74) Yang, G., Franklin, M., Li, J., Lin, T.-C., and Konigsberg, W. (2002) Correlation of the kinetics of finger domain mutants in RB69 DNA polymerase with its structure. Biochemistry 41, 2526–34.

(75) Steitz, T. A. (1999) DNA Polymerases : Structural Diversity and Common Mechanisms. The Journal of Biological Chemistry 274, 17395–17398.

(76) Beese, L. S., and Steitz, T. A. (1991) Structural basis for the 3’-5' exonuclease activity of Escherichia coli DNA polymerase I: a two metal ion mechanism. The EMBO journal 10, 25–33.

(77) Steitz, T. A. (1993) DNA- and RNA-dependent DNA polymerases. Current Opinion in Structural Biology 3, 31–38.

(78) Steitz, T. A., and Steitz, J. A. (1993) A general two-metal-ion mechanism for catalytic RNA. Proceedings of the National Academy of Sciences of the United States of America 90, 6498–502.

(79) Watson, J. D., and Crick, F. H. (1953) Genetical implications of the structure of deoxyribonucleic acid. Nature 171, 964–7.

(80) Ramirez-Aguilar, K. a, Moore, C. L., and Kuchta, R. D. (2005) Herpes simplex virus 1 primase employs watson-crick hydrogen bonding to identify cognate nucleoside triphosphates. Biochemistry 44, 15585–93.

(81) Chiaramonte, M., Moore, C. L., Kincaid, K., and Kuchta, R. D. (2003) Facile polymerization of dNTPs bearing unnatural base analogues by DNA polymerase alpha and Klenow fragment (DNA polymerase I). Biochemistry 42, 10472–81.

(82) Moore, C. L., Zivkovic, A., Engels, J. W., and Kuchta, R. D. (2004) Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates. Biochemistry 43, 12367–74.

(83) Arezi, B., and Kuchta, R. D. (2000) Eukaryotic DNA primase. Trends in Biochemical Sciences 25, 572–6.

(84) Choi, J.-Y., Lim, S., Eoff, R. L., and Guengerich, F. P. (2009) Kinetic analysis of base- pairing preference for nucleotide incorporation opposite template pyrimidines by human DNA polymerase iota. Journal of Molecular Biology 389, 264–74.

(85) Wolfle, W., and Washington, M. (2005) Evidence for a Watson-Crick hydrogen bonding requirement in DNA synthesis by human DNA polymerase kappa. Molecular and Cellular Biology 25, 7137–7143.

(86) Guckian, K. M., and Kool, E. T. (1997) Highly Precise Shape Mimicry by a Difluorotoluene Deoxynucleoside, a Replication-Competent Substitute for Thymidine. Angewandte Chemie (International ed. in English) 36, 2825–2828.

(87) Washington, M. T., Helquist, S. A., Kool, E. T., Prakash, L., and Prakash, S. (2003) Requirement of Watson-Crick hydrogen bonding for DNA synthesis by yeast DNA polymerase eta. Molecular and Cellular Biology 23, 5107–12.

(88) Kirk, B. W., and Kuchta, R. D. (1999) Arg304 of human DNA primase is a key contributor to catalysis and NTP binding: primase and the family X polymerases share significant sequence homology. Biochemistry 38, 7727–36.

(89) Urban, M., Joubert, N., Purse, B. W., Hocek, M., and Kuchta, R. D. (2010) Mechanisms by which human DNA primase chooses to polymerize a nucleoside triphosphate. Biochemistry 49, 727–35.

(90) Urban, M., Joubert, N., Hocek, M., Alexander, R. E., and Kuchta, R. D. (2009) Herpes simplex virus-1 DNA primase: a remarkably inaccurate yet selective polymerase. Biochemistry 48, 10866–81.

(91) Moran, S., Ren, R., and Kool, E. T. (1997) Difluorotoluene, a nonpolar isostere for thymine, codes specifically and efficiently for adenine in DNA replication. Journal of the American Chemical Society 119, 2056–2057.

(92) Moran, S., Ren, R., and Kool, E. T. (1997) A thymidine triphosphate shape analog lacking Watson-Crick pairing ability is replicated with high sequence selectivity. Proceedings of the National Academy of Sciences of the United States of America 94, 10506–11.

(93) Kool, E., and Sintim, H. (2006) The difluorotoluene debate—a decade later. Chemical communications 3665–3675.

(94) Kool, E., Morales, J., and Guckian, K. (2000) Mimicking the Structure and Function of DNA: Insights into DNA Stability and Replication. Angewandte Chemie (International ed. in English) 39, 990–1009.

(95) Kim, T. W., Brieba, L. G., Ellenberger, T., and Kool, E. T. (2006) Functional evidence for a small and rigid active site in a high fidelity DNA polymerase: probing T7 DNA polymerase with variably sized base pairs. The Journal of Biological Chemistry 281, 2289–95.

(96) Kim, T. W., and Kool, E. T. (2004) A set of nonpolar thymidine nucleoside analogues with gradually increasing size. Organic letters 6, 3949–52.

(97) Kim, T. W., and Kool, E. T. (2005) A series of nonpolar thymidine analogues of increasing size: DNA base pairing and stacking properties. The Journal of Organic Chemistry 70, 2048–53.

(98) Kim, T. W., Delaney, J. C., Essigmann, J. M., and Kool, E. T. (2005) Probing the active site tightness of DNA polymerase in subangstrom increments. Proceedings of the National Academy of Sciences of the United States of America 102, 15803–8.

(99) Delaney, J. C., Henderson, P. T., Helquist, S. A., Morales, J. C., Essigmann, J. M., and Kool, E. T. (2003) High-fidelity in vivo replication of DNA base shape mimics without Watson- Crick hydrogen bonds. Proceedings of the National Academy of Sciences of the United States of America 100, 4469–73.

(100) Lavergne, T., Malyshev, D. a, and Romesberg, F. E. (2012) Major groove substituents and polymerase recognition of a class of predominantly hydrophobic unnatural base pairs. Chemistry (Weinheim an der Bergstrasse, Germany) 18, 1231–9.

(101) Hwang, G. T., and Romesberg, F. E. (2008) Unnatural substrate repertoire of A, B, and X family DNA polymerases. Journal of the American Chemical Society 130, 14872–82.

(102) Betz, K., Malyshev, D. a, Lavergne, T., Welte, W., Diederichs, K., Dwyer, T. J., Ordoukhanian, P., Romesberg, F. E., and Marx, A. (2012) KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry. Nature Chemical Biology 8, 612–4.

(103) Trostler, M., Delier, A., Beckman, J., and Urban, M. (2009) Discrimination between right and wrong purine dNTPs by DNA polymerase I from Bacillus stearothermophilus. Biochemistry 48, 10866–10881.

(104) Beckman, J., Kincaid, K., Hocek, M., Spratt, T., Engels, J., Cosstick, R., and Kuchta, R. D. (2007) Human DNA polymerase alpha uses a combination of positive and negative selectivity to polymerize purine dNTPs with high fidelity. Biochemistry 46, 448–60.

(105) Cavanaugh, N. a, Urban, M., Beckman, J., Spratt, T. E., and Kuchta, R. D. (2009) Identifying the features of purine dNTPs that allow accurate and efficient DNA replication by herpes simplex virus I DNA polymerase. Biochemistry 48, 3554–64.

(106) Tahirov, T. H., Temiakov, D., Anikin, M., Patlan, V., McAllister, W. T., Vassylyev, D. G., and Yokoyama, S. (2002) Structure of a T7 RNA polymerase elongation complex at 2.9 A resolution. Nature 420, 43–50.

(107) Seeman, N. C., Rosenberg, J. M., and Rich, A. (1976) Sequence-specific recognition of double helical nucleic acids by proteins. Proceedings of the National Academy of Sciences of the United States of America 73, 804–8.

(108) Hendrickson, C. L., Devine, K. G., and Benner, S. a. (2004) Probing minor groove recognition contacts by DNA polymerases and reverse transcriptases using 3-deaza-2’- deoxyadenosine. Nucleic acids research 32, 2241–50.

(109) Beese, L. S., Derbyshire, V., and Steitz, T. A. (1993) Structure of DNA polymerase I Klenow fragment bound to duplex DNA. Science 260, 352–5.

(110) Beese, L. S., Friedman, J. M., and Steitz, T. A. (1993) Crystal structures of the Klenow fragment of DNA polymerase I complexed with deoxynucleoside triphosphate and pyrophosphate. Biochemistry 32, 14095–101.

(111) Singh, K., and Modak, M. J. (2003) Presence of 18-A long hydrogen bond track in the active site of Escherichia coli DNA polymerase I (Klenow fragment). Its requirement in the stabilization of enzyme-template-primer complex. The Journal of Biological Chemistry 278, 11289–302.

(112) Spratt, T. (2001) Identification of hydrogen bonds between Escherichia coli DNA polymerase I (Klenow fragment) and the minor groove of DNA by amino acid substitution of the polymerase and atomic substitution of the DNA. Biochemistry 40.

(113) Thompson, E. H. Z., Bailey, M. F., Van der Schans, E. J. C., Joyce, C. M., and Millar, D. P. (2002) Determinants of DNA mismatch recognition within the polymerase domain of the Klenow fragment. Biochemistry 41, 713–22.

(114) Stengel, G., Purse, B. W., Wilhelmsson, L. M., Urban, M., and Kuchta, R. D. (2009) Ambivalent incorporation of the fluorescent cytosine analogues tC and tCo by human DNA polymerase alpha and Klenow fragment. Biochemistry 48, 7547–55.

(115) Hirao, I., and Kimoto, M. (2012) Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma. Proceedings of the Japan Academy, Series B 88, 345–67.

(116) Rich, A. (1962) Problems of evolution and biochemical information transfer., in Horizons in Biochemistry (Kasha, M. and Pullman, B., pp. 103–126., Ed.). Academic Press, New York.

(117) Piccirilli, J. A., Krauch, T., Moroney, S. E., and Benner, S. A. (1990) Enzymatic incorporation of a new base pair into DNA and RNA extends the genetic alphabet. Nature 343, 33–7.

(118) Yang, Z., Sismour, A. M., Sheng, P., Puskar, N. L., and Benner, S. A. (2007) Enzymatic incorporation of a third nucleobase pair. Nucleic Acids Research 35, 4238–49.

(119) Yang, Z., Chen, F., Alvarado, J. B., and Benner, S. A. (2011) Amplification, mutation, and sequencing of a six-letter synthetic genetic system. Journal of the American Chemical Society 133, 15105–12.

(120) Seo, Y. J., Matsuda, S., and Romesberg, F. E. (2009) Transcription of an expanded genetic alphabet. Journal of the American Chemical Society 131, 5046–7.

(121) Malyshev, D. a, Pfaff, D. a, Ippoliti, S. I., Hwang, G. T., Dwyer, T. J., and Romesberg, F. E. (2010) Solution structure, mechanism of replication, and optimization of an unnatural base pair. Chemistry (Weinheim an der Bergstrasse, Germany) 16, 12650–9.

(122) Hirao, I., Harada, Y., Kimoto, M., Mitsui, T., Fujiwara, T., and Yokoyama, S. (2004) A two-unnatural-base-pair system toward the expansion of the genetic code. Journal of the American Chemical Society 126, 13298–305.

(123) Mitsui, T., Kimoto, M., Harada, Y., Yokoyama, S., and Hirao, I. (2005) An efficient unnatural base pair for a base-pair-expanded transcription system. Journal of the American Chemical Society 127, 8652–8.

(124) Morohashi, N., Kimoto, M., Sato, A., Kawai, R., and Hirao, I. (2012) Site-specific incorporation of functional components into RNA by an unnatural base pair transcription system. Molecules 17, 2855–76.

(125) Yamashige, R., Kimoto, M., Takezawa, Y., Sato, A., Mitsui, T., Yokoyama, S., and Hirao, I. (2012) Highly specific unnatural base pair systems as a third base pair for PCR amplification. Nucleic Acids Research 40, 2793–806.

(126) Ramirez-Aguilar, K. A., and Kuchta, R. D. (2004) Herpes simplex virus-1 primase: a polymerase with extraordinarily low fidelity. Biochemistry 43, 9084–91.

(127) Moore, C. L., Chiaramonte, M., Higgins, T., and Kuchta, R. D. (2002) Synthesis of nucleotide analogues that potently and selectively inhibit human DNA primase. Biochemistry 41, 14066–75.

(128) McCulloch, S. D., and Kunkel, T. A. (2008) The fidelity of DNA synthesis by eukaryotic replicative and translesion synthesis polymerases. Cell research 18, 148–61.

(129) Kuchta, R., Beckman, J., Kincaid, K., and Moore, C. (2006) Mechanisms by which DNA and RNA polymerases discriminate between right and wrong (d) NTPs. FASEB J.

(130) Patro, J. N., Urban, M., and Kuchta, R. D. (2009) Role of the 2-amino group of purines during dNTP polymerization by human DNA polymerase alpha. Biochemistry 48, 180–9.

(131) Kincaid, K., Beckman, J., Zivkovic, A., Halcomb, R. L., Engels, J. W., and Kuchta, R. D. (2005) Exploration of factors driving incorporation of unnatural dNTPS into DNA by Klenow fragment (DNA polymerase I) and DNA polymerase alpha. Nucleic Acids Research 33, 2620–8.

(132) Chiaramonte, M., Moore, C. L., Kincaid, K., and Kuchta, R. D. (2003) Facile polymerization of dNTPs bearing unnatural base analogues by DNA polymerase alpha and Klenow fragment (DNA polymerase I). Biochemistry 42, 10472–81.

(133) Henry, A. A., Olsen, A. G., Matsuda, S., Yu, C., Geierstanger, B. H., and Romesberg, F. E. (2004) Efforts to expand the genetic alphabet: identification of a replicable unnatural DNA self- pair. Journal of the American Chemical Society 126, 6923–31.

(134) Leconte, A. M., Hwang, G. T., Matsuda, S., Capek, P., Hari, Y., and Romesberg, F. E. (2008) Discovery, characterization, and optimization of an unnatural base pair for expansion of the genetic alphabet. Journal of the American Chemical Society 130, 2336–43.

(135) Lee, H. R., Helquist, S. a, Kool, E. T., and Johnson, K. a. (2008) Importance of hydrogen bonding for efficiency and specificity of the human mitochondrial DNA polymerase. The Journal of Biological Chemistry 283, 14402–10.

(136) Kunkel, T. A., and Bebenek, K. (2000) DNA replication fidelity. Annual Review of Biochemistry 69, 497–529.

(137) Kool, E. T. (2002) Active site tightness and substrate fit in DNA replication. Annual Review of Biochemistry 71, 191–219.

(138) Patro, J. N., Urban, M., and Kuchta, R. D. (2009) Interaction of human DNA polymerase alpha and DNA polymerase I from Bacillus stearothermophilus with hypoxanthine and 8- oxoguanine nucleotides. Biochemistry 48, 8271–8.

(139) Wu, Y., Ogawa, A. K., Berger, M., McMinn, D. L., Schultz, P. G., and Romesberg, F. E. (2000) Efforts toward Expansion of the Genetic Alphabet: Optimization of Interbase Hydrophobic Interactions. Journal of the American Chemical Society 122, 7621–7632.

(140) Ogawa, A. K., Wu, Y., McMinn, D. L., Liu, J., Schultz, P. G., and Romesberg, F. E. (2000) Efforts toward the Expansion of the Genetic Alphabet: Information Storage and Replication with Unnatural Hydrophobic Base Pairs. Journal of the American Chemical Society 122, 3274–3287.

(141) Cavanaugh, N. A., and Kuchta, R. D. (2009) Initiation of new DNA strands by the herpes simplex virus-1 primase-helicase complex and either herpes DNA polymerase or human DNA polymerase alpha. The Journal of Biological Chemistry 284, 1523–32.

(142) Kuchta, R. D., Mizrahi, V., Benkovic, P. A., Johnson, K. A., and Benkovic, S. J. (1987) Kinetic mechanism of DNA polymerase I (Klenow). Biochemistry 26, 8410–7.

(143) Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (3 Volume Set). Cold Spring Harbor Laboratory Pr.

(144) Joubert, N., Pohl, R., Klepetérová, B., and Hocek, M. (2007) Modular and practical synthesis of 6-substituted pyridin-3-yl C-nucleosides. The Journal of Organic Chemistry 72, 6797–805.

(145) Beaucage, S. L., and Caruthers, M. H. (1981) Deoxynucleoside phosphoramidites—A new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Letters 22, 1859– 1862.

(146) McBride, L. J., and Caruthers, M. H. (1983) An investigation of several deoxynucleoside phosphoramidites useful for synthesizing deoxyoligonucleotides. Tetrahedron Letters 24, 245– 248.

(147) Henry, A. A., Yu, C., and Romesberg, F. E. (2003) Determinants of unnatural nucleobase stability and polymerase recognition. Journal of the American Chemical Society 125, 9638–46.

(148) Li, Y., Kong, Y., Korolev, S., and Waksman, G. (1998) Crystal structures of the Klenow fragment of Thermus aquaticus DNA polymerase I complexed with deoxyribonucleoside triphosphates. Protein Science 7, 1116–23.

(149) Rothwell, P. J., and Waksman, G. (2007) A pre-equilibrium before nucleotide binding limits fingers subdomain closure by Klentaq1. The Journal of Biological Chemistry 282, 28884– 92.

(150) Shamoo, Y., and Steitz, T. A. (1999) Building a replisome from interacting pieces: sliding clamp complexed to a peptide from DNA polymerase and a polymerase editing complex. Cell 99, 155–66.

(151) Wang, T. S., Wong, S. W., and Korn, D. (1989) Human DNA polymerase alpha: predicted functional domains and relationships with viral DNA polymerases. FASEB Journal 3, 14–21.

(152) Lund, T. J., Cavanaugh, N. a, Joubert, N., Urban, M., Patro, J. N., Hocek, M., and Kuchta, R. D. (2011) B family DNA polymerases asymmetrically recognize pyrimidines and purines. Biochemistry 50, 7243–50.

(153) Lavergne, T., Malyshev, D. a, and Romesberg, F. E. (2012) Major groove substituents and polymerase recognition of a class of predominantly hydrophobic unnatural base pairs. Chemistry (Weinheim an der Bergstrasse, Germany) 18, 1231–9.

(154) Betz, K., Malyshev, D. a, Lavergne, T., Welte, W., Diederichs, K., Dwyer, T. J., Ordoukhanian, P., Romesberg, F. E., and Marx, A. (2012) KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry. Nature Chemical Biology 8, 612–4.

(155) Hendrickson, C. L., Devine, K. G., and Benner, S. a. (2004) Probing minor groove recognition contacts by DNA polymerases and reverse transcriptases using 3-deaza-2’- deoxyadenosine. Nucleic Acids Research 32, 2241–50.

(156) Goodman, M. F., Creighton, S., and Btoom, L. (1993) Biochemical Basis of DNA Replication Fidelity. Critical Reviews in Biochemistry and Molecular Biology 28, 83–126.

(157) Joubert, N., Pohl, R., Klepetérová, B., and Hocek, M. (2007) Modular and practical synthesis of 6-substituted pyridin-3-yl C-nucleosides. The Journal of Organic Chemistry 72, 6797–805.

(158) Guo, M., Hildbrand, S., Leumann, C. J., Mclaughlin, L. W., and Waring, M. J. (1998) Inhibition of DNA polymerase reactions by pyrimidine nucleotide analogues lacking the 2-keto group. Nucleic Acids Research 26, 1863–1869.

(159) McCain, M. D., Meyer, A. S., Schultz, S. S., Glekas, A., and Spratt, T. E. (2005) Fidelity of mispair formation and mispair extension is dependent on the interaction between the minor groove of the primer terminus and Arg668 of DNA polymerase I of Escherichia coli. Biochemistry 44, 5647–59.

(160) Matsuda, S., Leconte, A. M., and Romesberg, F. E. (2007) Minor groove hydrogen bonds and the replication of unnatural base pairs. Journal of the American Chemical Society 129, 5551– 7.

(161) Switzer, C. Y., Moroney, S. E., and Benner, S. A. (1993) Enzymatic recognition of the base pair between isocytidine and isoguanosine. Biochemistry 32, 10489–96.

(162) Horlacher, J., Hottiger, M., Podust, V. N., Hübscher, U., and Benner, S. A. (1995) Recognition by viral and cellular DNA polymerases of nucleosides bearing bases with nonstandard hydrogen bonding patterns. Proceedings of the National Academy of Sciences of the United States of America 92, 6329–33.

(163) Sismour, a M., and Benner, S. a. (2005) The use of thymidine analogs to improve the replication of an extra DNA base pair: a synthetic biological system. Nucleic Acids Research 33, 5640–6.

(164) Wang, W., Wu, E. Y., Hellinga, H. W., and Beese, L. S. (2012) Structural factors that determine selectivity of a high fidelity DNA polymerase for deoxy-, dideoxy-, and ribonucleotides. The Journal of Biological Chemistry 287, 28215–26.

(165) Matray, T. J., and Kool, E. T. (1999) A specific partner for abasic damage in DNA. Nature 399, 704–8.

(166) Sagher, D., and Strauss, B. (1983) Insertion of nucleotides opposite apurinic/apyrimidinic sites in deoxyribonucleic acid during in vitro synthesis: uniqueness of adenine nucleotides. Biochemistry 22, 4518–26.

(167) Schaaper, R. M., Kunkel, T. A., and Loeb, L. A. (1983) Infidelity of DNA synthesis associated with bypass of apurinic sites. Proceedings of the National Academy of Sciences of the United States of America 80, 487–91.

(168) Randall, S. K., Eritja, R., Kaplan, B. E., Petruska, J., and Goodman, M. F. (1987) Nucleotide insertion kinetics opposite abasic lesions in DNA. The Journal of Biological Chemistry 262, 6864–70.

(169) Paz-Elizur, T., Takeshita, M., and Livneh, Z. (1997) Mechanism of bypass synthesis through an abasic site analog by DNA polymerase I. Biochemistry 36, 1766–73.

(170) Custelcean, R., Bosano, J., Bonnesen, P. V, Kertesz, V., and Hay, B. P. (2009) Computer- aided design of a sulfate-encapsulating receptor. Angewandte Chemie (International ed. in English) 48, 4025–9.

(171) Surry, D. S., and Buchwald, S. L. (2008) Biaryl phosphane ligands in palladium-catalyzed amination. Angewandte Chemie (International ed. in English) 47, 6338–61.

(172) Surry, D. S., and Buchwald, S. L. (2011) Dialkylbiaryl Phosphines in Pd-Catalyzed Amination: A User’s Guide. Chemical Science 2, 27–50.

(173) Urban, M., Pohl, R., Klepetarova, B., and Hocek, M. (2006) New modular and efficient approach to 6-substituted pyridin-2-yl C-nucleosides. The Journal of Organic Chemistry 71, 7322–8.

(174) Pavia, M. R., Taylor, C. P., Hershenson, F. M., and Lobbestael, S. J. (1987) N,N- Disubstituted 6-alkoxy-2-pyridinamines as anticonvulsant agents. Journal of Medicinal Chemistry 30, 1210–1214.

(175) Cantello, B. C. C., Cawthorne, M. A., Cottam, G. P., Duff, P. T., Haigh, D., Hindley, R. M., Lister, C. A., Smith, S. A., and Thurlby, P. L. (1994) [[.omega.- (Heterocyclylamino)alkoxy]benzyl]-2,4-thiazolidinediones as potent antihyperglycemic agents. Journal of Medicinal Chemistry 37, 3977–3985.

(176) Brock, A. K., Kozekov, I. D., Rizzo, C. J., and Harris, T. M. (2004) Coupling products of nucleosides with the glyoxal adduct of deoxyguanosine. Chemical Research in Toxicology 17, 1047–56.

(177) Parsch, J., and Engels, J. W. (2002) C-F...H-C hydrogen bonds in ribonucleic acids. Journal of the American Chemical Society 124, 5664–72.