Ofthecc-Sensitivecem-C7havebeengeneratedthatfallintotwo

[CANCERRESEARCH55, 348-353, January 15, 19951 Splice Site Mutation in the Glucocorticoid Receptor Gene Causes Resistance to Glucocorticoid-induced Apoptosis in a Human Acute Leukemic Cell Line1

Elisabeth M. C. Strasser-Wozak, Rosa Hattmannstorfer, Monika HÃ¡la, Bernd L. Hartmann, Michael Fiegi, Stephan Geley, and Reinhard Kofler@

Department of Molecular Biology, Institute for General and Erperimenwi Pathology, School ofMedicine. University of Ituzsbrucl@ Austria

ABSTRACT which CC triggers the genetic death program and its essential components remain to be discovered. Induction of apoptosis is the molecular basis for the therapeutic appli GC elicit their responses via the GR, a ligand-activated tran cation ofglucocortlcoids (GC) In human leukemia The beneficial effect of scription factor of the zinc finger type (20â€”25). Substrate binding endocrine therapy Is, however, hampered by the occurrence of resistant clones evolving under selective GC pressure. To delineate molecular induces conformational changes and alters the phosphorylation mechanisms of GC resistance, we PCR amplified, cloned, and sequenced state of the OR, allowing its translocation into the nucleus, where GC receptor (GR) transcripts and gene segments from a GC-reslstant it interacts with specific nucleotide sequences termed glucocorti subclone of the human acute leukemic cell line CCRF-CEM, termed coid response elements to regulate transcription rates of adjacent CEM-R6. Our analyses revealed that one GR gene allele harbOreda point genes. In addition to this classical mechanism, GRs further direct mutation (L753F) previously shown to compromise CR function in other gene expression via posttranscriptional and translational mecha CCRF-CEM derivatives. On the second allele, we identified an A to C nisms (26, 27) as well as interaction with other transcription point mutation In the 3'-splice junction of hats-on C. As a consequence, a factors (28â€”30).Which of the above mechanisms of gene regula cryptic splice site 8 base pairs downstream within exon 8 is recognized, tion are used and what genes interact to precipitate programmed which leads to an 8-base deletion in the CR mRNA, resulting In reading cell death is, however, still a matter of debate. frame shift and 2 consecutive In-frame preterminal stop codons. Trans lation of this mutant mRNA would produce a truncated CR protein Resistance to CC-induced apoptosis in human leukemia might missing 93 amino acids of the ligand-binding domain and expressing 9 result from qualitative or quantitative defects in the expression of the altered residues at its new COOH terminus. In concert with the L753F CR gene itself or of any of the genes participating in signal transduc mutation on the other allele, this molecular defect explains the CC tion of programmed cell death distal of the receptor. To address these resistant phenotype and provides further evidence for mutational CR possibilities, we and others use the CCRF-CEM in vitro model for gene inactivation as a mechanism for human leukemic ceHs to escape human acute T-lymphocytic leukemia from which a CC-sensitive CC-induced apoptosis. (CEM-C7) and a CC-resistant (CEM-Ci) subline were originally derived (31, 32). Subsequently, a number of CC-resistant derivatives INTRODUCTION oftheCC-sensitiveCEM-C7havebeengeneratedthatfallintotwo CC-resistant phenotypes: â€œreceptorless,â€•definedas having little or no The rational for including GC@ in combined chemotherapy of detectable CC binding in a whole cell radioreceptor assay, and â€œac various hematological malignancies, such as acute T-cell leukemia, is tivation labile,â€•characterized by a receptor with almost normal CC based on their cytolytic effect (1, 2). Not all patients, however, benefit binding but unable to retain ligand after attempted activation (33â€”35). from endocrine therapy, and even after an initial therapeutic response, Molecular analyses revealed that CEM-C7 cells were heterozygous GC-resistant tumors often evolve under selective GC pressure, thus for a mutation (L753F) in the ligand-binding domain of its CR gene limiting clinical utilization of this treatment. Despite obvious theoret (36, 37),whilethethreeCEM-C7-derivedmutantsstudiedinthis ical and clinical significance, the molecular mechanisms underlying respect (ICR27TK3, 4R4, 3R7) acquired genetic defects in the second GC-induced cell death and resistance to this phenomenon are still CR allele, explaining their CC resistance (37â€”39).How these and largely unknown. Recently, GC-induced cytolysis was identified as a other defects relate to the above phenotypes and affect CR function is special form of programmed cell death exhibiting the essential fea a subject of considerable theoretical and practical significance tures of apoptosis (reviewed in Refs. 3 and 4). Programmed cell death (see â€œDiscussionâ€•). is a physiological form of cellular demise that has developed in In this paper, we describe a CC-resistant, receptorless CCRF-CEM multicellular organisms and participates in organogenesis, sexual dii sublime, termed CEM-R6, that has spontaneously acquired an A to 0 ferentiation, formation of the immune system, virus defense, and other mutation in the 3'-splice junction of intron C. This point mutation phenomena. Apoptosis, on the other hand, refers to the morphological leads to usage of a cryptic splice site and an 8-base deletion in the CR characteristics often associated with programmed cell death, including mRNA, resulting in frame shift and 2 premature in-frame translational cell shrinkage, condensation, and fragmentation of chromatin, mem stop codons. In concert with the L753F mutation on the other CR brane blebbing, and generation of â€œapoptoticbodiesâ€•that are removed allele, this genetic defect might be responsible for the CC-resistant by adjacent parenchymal and phagocytic cells without spilling of phenotype of this cell line. cellular contents and signs of inflammation (5â€”9).Although signal pathways and genes participating in various systems of programmed cell death have been identified (10â€”19),the precise mechanisms by MATERIALS AND METHODS

Cell CUltUre and Phenotypic Analysis. GC-sensitive (CEM-C7) and Received 8/24/94; accepted 11/8/94. CC-resistant (CEM.R6) cell lines (courtesy of Dr. A. Csordas, University of The costs of publication of this article were defrayed in part by the payment of page charges.Thisarticlemustthereforebeherebymarkedadvertisementinaccordancewith Innsbruck, Austria) were grown at 37Â°Cin RPMI 1640 supplemented with 18 U.S.C. Section 1734 solely to indicate this fact. 10% bovine calf serum-100 Units/mipenicillin-100 mg/mI streptomycin.2 mM I Supported by a grant from the Austrian Research Council (F204). L-glutamine. The CEM-C7 line was subcloned by limiting dilution, and a 2 To whom requests for reprints should be addressed, at Department of Molecular CC-sensitive subclone, termed CEM-C7H2, was used for further studies. Cell Biology, Institute of General and Experimental Pathology, Fritz-Pregl-Str. 3, A-602O Innsbruck, Austria. number and viability were determined by trypan blue exclusion. To analyze 3 The abbreviations used are: OC, glucocorticoid(s); OR, glucocorticoid receptor; dcx, proliferation, viability, and apoptosis, 2.5 X 10@'cells/ml were cultured in the dexamethasone; poly(A@)RNA, polyadenylated RNA. presence or absence of 1 @Mdcx in 24-well flat-bottom plates. For 348

[3H]thymidine uptake assays, triplicates of 100 gil were removed after 18, 42, in 10 @tlreversetranscription buffer containing 1 mi@iofeachdeoxyribonucleo and 66 h, pulsed with 1 @Ci[3H]thymidine (NEN, Boston, MA) in 96-well side triphosphate, 10 units RNasin, 1 @.tgBSA,5 ng random hexanucleotides, U-bottomed microtiter plates for another 6 h, and washed, and the incorporated and 100-200 units Moloney murine leukemia virus reverse transcriptase tracer was quantified in an MR-300 liquid scintillation counter (Kontron, (Promega). The reaction was allowed to proceed for 8 mm at 20Â°C, another 8 Vienna, Austria). To estimate the degree of apoptosis, 5 X 10@'cellswere mm at 25Â°C,and1 h at 37Â°Candwas terminated by heating to 95Â°Cfor5 mm. removed from the 24-well plates after 24, 48, and 72 h and lysed in 0.1% CR cDNA was specificallyamplifiedby incubating2 @lcDNAwith5 @i.llOX Triton X-100-0.1% sodium citrate; the nuclei were harvested by centrifugation, Taq buffer, 0.6 ,.d 10 mM deoxyribonucleoside triphosphates, 10 pmol oligo stained with propidium iodide (50 @g/m1),andquantitated by flow cytometry nucleotides 0N225 and 0N226, 5 @l10 mM MgCl2, and 0.5 @lTaq DNA (FACS III; Becton Dickinson) with an Argon laser of 488 nra wavelength (40). polymerase (Promega) in a final volume of 50 p.1.After denaturation (2 mis, All samples were further subjected to automated cell cycle determination by 94Â°C),amplificationwas carried out for 30 cycles (94Â°C,1mis; 63.5Â°C,1mis; the built-in fluorescence-activated cell sorter program. GR status was deter 72Â°C,3.5mis), followed by 10 mm at 72Â°Cinan Omni-Cene thermal cycler mined by the whole cell-binding method as described previously (41). Briefly, (Hybaid, Teddisgton, United Kingdom). Successful amplification of the 2773- 5 X 106washed cells were cultured for 1 h at 37Â°Cwithvarious concentrations base pair fragment was verified by electrophoresis of a lO-pi PCR aliquot on of [3H]triamcinoloneacetonide (0.6â€”40flM,NEN) in the presence or absence a 1% agarose gel run in lx buffer (0.089 MTris-O.089Mboric acid-O.002M of 20 @Munlabeledligand, washed 3 times in ice-cold PBS, resuspended in 3 EDTA) and stained with ethidium bromide. Oligonucleotides 0N244 and ml scintillation cocktail, and counted in an MR-300 scintillation counter 0N245 were used to amplify a 248- base pair fragment enclosing the 3'-splice (Kontron). The specific ligand-binding ability was determined by Scatchard junction of intron C from 100 ng genomic DNA using the same PCR reagents analysis and expressed as receptor sites/cell. as above and 30 cycles (1 mis at 94Â°C,1mis at 53Â°C,and1 mis at 72Â°C). Extraction of DNA and Puly(A'@) RNA. Genomic DNA was prepared Cloning and Sequencing. PCR productswere digestedwith 0.5 mg/mI according to a protocol for phenol-free extractions (42), yielding 600â€”1000g.@g proteisase K is the presence of 0.5% SDS for 30 mm. In the case of DNA/i X iO@cells. For purification of poly(A@) RNA (43), 1 X 10@washed PCR-amplified CR cDNA, fragments smaller than 284 base pairs were dim cells were resuspended in 40 ml lysis buffer (0.5% SDS-0.1 MNaCl-20 m@i isated using a Sephacryl 8400 column (Promega). The eluate was extracted Tris, pH 7.4-1 mMEDTA) containing 8 mg proteinase K (BOhringerMann once with phenol-chloroform and once with isoamyl alcohol-chloroform and heim, Vienna, Austria), sonificated for 30 s (Sonicator@, Heat Systems precipitated with 2.5 volumes 100% ethanol in the presence of 0.6 M ammo Ultrasonics, Inc.), and incubated for 1 h at 37Â°C.After addition of 2.5 ml 5 M NaG and 50 mg oligo(dT)-cellulose (Serva, Heidelberg, Germany), the sus nium acetate, rinsed, pelleted, and resuspended in 15 p@lnuclease-free water pension was agitated on a roller drum at room temperature for 1 h and (Promega). Approximately 200 ng insert were ligated into 50 ng pCEM-T subsequently washed 3 times in 40 ml high-salt buffer (0.1% SDS-0.4 M vector (Promega) overnight at 15Â°Cusisg2 units T4-DNA ligase (Promega). NaCl-10 mMTris, pH 7.4-1 nmt EDTA). The poly(A@)RNA was eluted in After inactivation of the enzyme at 68Â°Cfor8 mis, the recombinant plasmid 1800 @.dlow ionic strength buffer (10 mM Tris, pH 7.4-1 mM EDTA-0.1% was transformed isto Escherichia coli strain MC1O61by electroporation, and SDS), precipitatedwith 0.1 volume 3 M sodium acetate and 0.6 volume clones containing CR amplificates were identified by hybridization with 32P- isopropanol for 30 min at â€”20Â°C,washedin 80% ethanol, and resuspended in labeled oligonucleotides 0N219 and 0N220 (44). Since CEM-R6 cells are 30 @dbuffer(10 mMTris-1 mMEDTA, pH 7.6). The amount ofpoly(A@) RNA heterozygous for the L753F mutation (see â€œResultsâ€•),cDNAcolonies corre isolated from 1 X 10@lymphoidcells was between 4 and 8 mg. The quality of sponding to the L753F mutant or the wild-type allele could be distinguished by poly(A@)RNA was controlled by agarose gel electrophoresis in 1-fold 40 mM differential hybridization using 0N221 and 0N222. E. coil transformed with Tris acetate-2 mM EDTA, containing 0.5 @g/mlethidiumbromide (Sigma, subcloned genomic PCR products encoding the istron C/exon 8 boundary were Deisenhofen, Germany). identified by hybridization with 0N241 and 0N243. Oligonucleotides. The oligonucleotides used in this study were purchased To confirminsertidentity,plasmidDNA of positiveclones was preparedby from Codon (Vienna, Austria). Their sequences are summarized in Table 1, alkalise lysis (45) and subjected to restriction enzyme analysis with Sal!, PstI, and their orientation and approximate location within the CR gene and/or CR BglLI, and EcoPJ. CsCl-purifled double-stranded DNA of positive clones was cDNA are indicated in Fig. 1. For radiolabeling, 25 pmol oligonucleotide were sequenced by dideoxynucleotide chain termination (46) using modified 11- incubated in 20 p1 kinase buffer containing 33 pmol [â€˜y-32P]ATP(NEN; DNA polymerase (Sequenase, version 2.0; USB, Qeveland, OH) as recom specific activity, 3000 Ci/mmol) and 5 units T4-polynucleotide kinase mended by the producer. a-35S-dATP-labeled reactions were separated on (Promega, Madison, WI) for 30 mis at 37Â°C(44). denaturing 6% polyacrylamide gels and exposed to AGFA Curix X-ray ifims Reverse PCR and Amplification of Genomic DNA. Poly(A@) RNA (300 at room temperature overnight and for 3 days. Sequence analysis was per ng) was heated to 65Â°Cfor5 mis, chilled on ice, and transcribed into cDNA formed on several independent cDNA and genomic clones for each allele.

primersCode Table 1 Oligonucleotide probes and Usageâ€•0N219 SequenceÂ° s/ass' Positionc Seq0N220 GGTTGAAAATCTCCTTAACTATTGC s 2316-2340 PCR,Hyb, Seq0N221 TTGGGCACTGGTGGTTTAGG as 2788-2768 PCR, Hyb, Seq0N222 ATTTCAGCTAACATCTC as 2399-2383 Hyb, Hybridization0N225 ATTTCAGC@AACATCTC as 2399-2383 AAGTTCATCACACAGACTTTGGGC as 2805-2782 Reverse PCR ON226PCR0N232 AGTTGTTTATCTCGGCTGCGGC a 55-76 Reverse Hybridization0N233 ACACCAGGTAGAGTTTG as 1402-1386 Seq0N237 ACACCAGGCAGAGTTTG as 1402-1386 Hyb, Sequencing0N238 TCCAAGCAGCGAAGAC s 298-313 Sequencing0N239 CAGACATTTTATTACC as 1084-1069 Sequencing0N240 TAATCAGATCAGGACG as 2017-2002 Sequencing0N241 TCCAGCTCCTCAACAG s 1351â€”1366 Hybridization0N242 AGACCGTCCTTAGGAA as 2171-2156 Hybridization0N243 AGACCGTCCTGAAGAG as 2171â€”2148 TCCTTAGGAActaaaa as 2165â€”htsron0 Hybridization 0N244 gacacagtgagaccctatct a IntronG PCR 0N245PCR0N253 CATGCATAGAATCCARGAGT as 2311-2292 Reverse PCR0N254 TACACAGGCTTCAGGTATCTTATGA a 2090-2114 Hybridizationa TCCTTAGGAAccaaaa as 2165â€”Intron0 Sequencesin5' to 3' direction;upperandlower caselettersindicateexon(49) andintron (50) sequences,respectively.Mutatednucleotidesareunderlined. bantisense.C Orientation of probes: s, sense; as, PositionwithinthecDNAsequenceaccordingtoHollenbergetal.(49). d@pplication of probes: Hyb, hybridization; Seq, sequencing. 349

RESISTANCE TO GLUCOCORTICOID-INDUCEDAPOFFOSIS tospecificallybindtheradiolabeledsubstrate(exemplifiedinFig.3). 214 These data defined the phenotype of CEM-R6 cells as receptorless u@ .u@ III ut .m and suggested that these cells acquired a defect in the GR gene itself or, less likely, in genes affecting its expression. @ DNA -1IJ.1 2 f##J#ffJ#1@#@ H as I- Molecular Analysis of the GR Gene. To identifypossibleOR gene defects causing CC resistance in CEM-R6 cells, we first @ RNA II I 2 bId a lslilal J @3-isoform screened for the functionally deleterious L753F mutation present in RNA Ill 2 I3(@5IbI7I8I Sc. I a-lsoform other CEM sublines (37â€”39)by dot blot analyses of the PCR-ampli fled genomic region surrounding the mutation. Differential hybridiza tion with radiolabeled oligonucleotide probes distinguishing between @@ Protein iosoit.j Nq@Id@-cOOH the mutated (ON22l) and the wild-type (0N222) form of codon 753 Fig. I. Map of the human OR gene, its two alternatively spliced mRNAs, and the revealed that CEM-R6 cells were heterozygous for this defect functional OR protein encoded by the GRa-mRNA isoform. The major protein domains (data not shown). are indicated: i, , 12,transactivationdomains; DBD, DNA-binding domain; ligand, ligand binding domain. Boxes and numbers, exons; lines, intervening sequences; arrows with To address possible alterations in the second CR allele, a 2.7- numbers, orientation and approximate localization of the corresponding oligonucleotides kilobase fragment encompassing the entire CR-coding region was listed in Table I. reverse transcribed from poly(A@) RNA, PCR amplified, and cloned, and both alleles were specifically identified by differential hybridiza tion using the same oligonucleotide probes as above. Sequence anal Table 2 Effect of I pu dexaniethasone on lymphocyte proliferation measured by [3H]thymidine incorporation yses of multiple independently derived L753F-negative clones con [3Hjmymidine uptake of CEM-R6 and CEM-C7H2 cells cultured in the absence (0) firmed the absence of the A to T transversion in codon 753 on the or presence (dcx) of 1 p.t@idcxfor identical times. Shown is the average of 2 assays in second allele and uncovered a deletion of the first 8 bases encoded by thplicates, SD values werevalues.24h <9% of mean exon 8 (Fig. 4). To determine whether this deletion was already 72h0 48h present in the CR gene or, alternatively, resulted from aberrant splic dcxCEM-R6 dcx 0 dcx 0 ing, we PCR amplified and cloned the region surrounding the intron 69499 69078 80753 85292 99862 108348 C/exon 8 boundary. Sequence analyses of several independent clones CEM-C7H2 69897 30297 94988 1367 79453 194 revealed an A to C point mutation in the 3'-splice site ofintron C (Fig. 5). Apparently,this mutationleads to the recognitionof a cryptic splice site located 8 base pairs downstream within the ensuing exon, Dot Blot Analysis. For dot blot analysis, 1 @tlPCRamplificate correspond which explains the corresponding deletion detected in the cDNA ing either to the genomic region around the 3â€˜-intron0 splice junction or to the sequence. The resultant reading frame shift entailed two consecutive mRNA sequence surrounding codon 753 were dotted onto Hybond-N mem preterminal in-frame stop codons 9 triplets 3' of the cryptic splice site. bmanes(Amersham-MedPro,Vienna, Austria), denatured, baked at 80Â°Cfor2 Thus, CEM-R6 cells carry L753F on one and a splice site mutation on h, and hybridized with 32P-labeled oligonucleotides 0N243 or 0N254 (to the other CR allele. detect the A to G splice site mutation) or ON22l and ON222 (to detect the A to T mutation in codon 753) at 37Â°Covernight. The filters were washed in 2X SSC for 30 mm at room temperature and 5 mm at 40Â°C(0N243,ON254) or 42Â°C(ON221, 0N222) and exposed to an AGFA Curix X-ray film with an CEM-R6 CEM-C7H2 amplifying screen at â€”70Â°Cfor3â€”24h. 24h 24h 5, RESULTS E z Phenotypic Characteristics. To verify the CC-resistant pheno 4, C.) type of CEM-R6 cells, the effect of CC on viability, cell proliferation, cell cycle progression, and percentage of apoptotic cells was deter @@@ mined in comparison to the CC-sensitive CEM-C7H2 line. Exposure 2 I..,[email protected],TIn-1..La . a to 1 @.LMdcxfor up to 72 h did not affect viability of CEM-R6 cells, CEM-Rb U@M-U1l1@ whereas it suppressed that of CEM-C7H2 almost completely. Simi 48h 48h laxly, CEM-R6 lymphocytes incorporated equal amounts of [3H]thy 5, midine in the presence or absence of 1 p.M dex, while CC-treated E CEM-C7H2 cells ceased to proliferate (Table 2). Consistent with z a, these results, flow cytometric analyses of propidium iodide-labeled C.) nuclei revealed that stimulation with 1 @.LMdcxhad no effect on the percentage of apoptotic cells in the CEM-R6 line, in contrast to C F @-.;â€˜@ CEM-C7H2, which exhibited >90% apoptotic cells after 48 and 72 h @2 @2 (Fig. 2 and Table 3). Furthermore, a CC-induced effect on cell cycle Fluorescence Intensity Intensity progression was detected only in the CC-sensitive CEM-C7H2 sub (arbitrary units)Fluorescence (arbitrary units) line that revealed a significant increase of viable cells in the C1 phase Fig. 2. Representative example of flow cytometric cell cycle and apoptosis analysis of of the cell cycle after 24 h exposure to CC (Fig. 2). GC-treated CEM-R6 (a and c) and CEM-C7H2 (b and d) cells. Propidium iodide-stained nuclei from apoptotic cells appear between the vertical bars, and the first and second peaks To determine whether the CC resistance of the CEM-R6 subline correspond to nuclei from cells in the 0, and G@/Mphasesof the cell cycle, respectively. was associated with reduced CC-binding activity, radioreceptor as Percentages of apoptotic cells from this (a, 6.9%; b, 10.5%; c, 2.1%; d, 97.5%) and says with whole cells were performed. While the CC-sensitive CEM additional experiments are summarized in Table 3. Whereas CEM-R6 exhibited normal DNA content with cells executing all phases of the cell cycle (a and c), 82% of C7H2 line expressed approximately 10,000 GR sites with a KD of lymphocytes from the GC-sensitive C7H2 subline were arrested in G@ after 24 h of 3.2 X lO@ Mper cell, CC-resistant CEM-R6 cells consistently failed stimulation (b), preceding apoptotic DNA fragmentation 24 h later (d). 350

Table 3 Effect of I iu dexamethasone on percentage of apoptotic cells evaluated byfluorescence-activated cell sorter Percentage of apoptotic CEM-R6 and CEM-C7H2fiuorescence-activated24h cells cultured in the absence (0) or presence (dcx) of 1 @LMdcxfor the indicated times as determ by cell sorter analyses. Shown is the average percentage of 2 assays performed in duplicates Â±SD.med 48h72h0

0dcxCEM-R6 dcx 0 dcx 0.3CEM-C7H2 8.4 Â±0.2 7.0 Â±0.3 1.7Â±0.0 2.1 Â±0.1 3.4 Â±0.72.5 Â± 7.6 Â±0.8 10.6Â±0.8 5.1 Â±0.6 97.1 Â±0.4 7.2 Â±0.292.4 Â±0.5

DISCUSSION t In this paper we have described a CC-resistant subline of the human Exon7 GAT C T-lymphoblastic leukemic cell line CCRF-CEM, termed CEM-R6, that owes its CC resistance to 2 point mutations, one on each allele. I The first, an A to T transversion in codon 753, leads to an amino acid I exchange from leucine to phenylalanine in the CR ligand-binding Exon8 C domain and has been previously observed in other CCRF-CEM sub A lines (37â€”39).Thus, the CC-sensitive CEM-C7 line is heterozygous for L753F, while CC-resistant sublines of CEM-C7 have either lost (ICR27TK3, 4R4) (38) or mutated (3R7) (39) the second intact GR G allele. The effect of the mutation on CR function, particularly on the G generation of the 2 phenotypes observed in GC-resistant CCRF-CEM A sublines, i.e. , activation labile and receptorless, has been studied in C great detail: Consistent with its association with CC resistance, G GR753F (also designated CRÂ°)shows no (38) or markedly reduced G (39) transactivating activity when tested on a CC-responsive reporter Fig. 4. Autoradiograph showing the cDNA sequence corresponding to the exon 7-exon construct. In vitro translation assays by Ashraf and Thompson (38) 8 boundary of the L753F-negative OR allele of CEM-R6 cells. The first 8 bases encoded have further shown that GR753F has the binding characteristics typical by exon 8 (boxed in the wild-type sequence shown to the left) are deleted. of the activation-labile phenotype, i.e., it binds ligands like the wild type receptor, but this binding is labile under conditions that activate produced the receptorless phenotype, perhaps because it lacks either the receptor (high ionic strength, 25Â°C)and is stabilized by molyb the appropriate cellular milieu or an assisting CR like that of 3R7 to date. Nevertheless, the same receptor in vivo may generate either the generate an activation-labile phenotype. activation-labile phenotype, as in 4R4, or the receptorless phenotype In contrast to the L753F mutation present in CEM-C7, its (defined by no or insignificant ligand binding), as in ICR27TK3, derivatives, and, in the GC-resistant CEM-Ci cell line (our un apparently depending on the â€œcellularmilieuâ€•(38). Powers et a!. (39) published results), and, in the CC-resistant CEM-C 1 line (our also observed that the receptorless 1CR27 expressed only CR753F; unpublished results), the A to C point mutation in the highly however, their activation-labile cell line 3R7 expressed GR7S3F in conserved 3'-splice site of intron C on the other CR allele is combination with a receptor that carries a mutation in the DNA apparently specific for the CEM-R6 subline, since it is not present binding domain (C421Y) and supposedly assists in generating the in CEM-C7 or CEM-Cl cells (data not shown). As demonstrated activation-labile phenotype in this cell. In our CEM-R6 line, GR7S3F above, it entails use of a cryptic splice site causing an 8-base deletion in the mRNA, which leads to 2 premature in-frame stop 350C codons at positions 684 and 685. Although mutated mRNA species are often retained within the nucleus (47), this one is exported to 300C the cytoplasm, as evidenced by cDNA cloning and, if translated, would result in a truncated CR protein lacking the COOH-terminal 93 amino acids and having 9 altered residues at its new COOH 250C terminus. We are currently investigating whether the truncated protein is indeed produced and, if so, whether it has any remaining 200C activity. In particular, we want to establish whether this mutant 2a. might still interact with AP- 1 like the ligand-activated wild-type C.) 150( CR (28, 29), because CEM-R6 cells are also resistant to phorbol ester-induced inhibition of proliferation (our unpublished results). 100( Since phorbol ester effects are mediated via AP-l, the intriguing possibility exists that a single mutation entails protection against CC-induced apoptosis and phorbol ester-mediated proliferation 500 inhibition. In conclusion, analyses of CC resistance in human leukemic CCRF â€”, CEM lines suggestthat leukemic cells escapethe cytolytic effect of CC 0 5 10 15 20 25 30 35 40 45 by mutating their CR genes at various functionally important sites. @H-TriamclnoIoneacetonidenmoIll Another possibility that yields essentially the same result has recently been reported in a CC-resistant human myeloma cell line that inactivated Fig. 3. Representative example of a whole cell radioreceptor assay of OC-sensitive CEM-C7H2 (0) and OC-resistant CEM-R6 (0) cells. Points (bars), means (Â±SD)of its CR by alternative splicing (48). Whether these mechanisms also occur specifically bound radioactivity from an assay performed in triplicates. in vivo in the development of CC resistance during human leukemia 351

E A GAT C GATC AE @ x A â€” A I I @ Fig. 5. Autoradiograph showing the genomic se 0 C C quence of the intron 7-exon 8 boundary of both N C CN CEM-R6ORalleles.In contrastto the regularsplice I I signal (AG) present in allele I, allele II exhibits an A to 8 8 G transition at the 3' terminus of intron 0. The normal wIwf and mutant splice signals are boxed. N t N T t T R t R t @ 0 0 N N G G

therapy, and if so, at what frequency, is currently unknown. Considering 16. Qarke,A.R.,Purdie,C.A, Harrison,D.J.,Morris,R.0., Bird,C.C.,Hooper,M.L, the complex pathway leading from CR activation to ultimate cell lysis, andWylie, A. H.Thymocyteapoptosisinducedbyp53-dependentandindependent pathways. Nature (Land.), 362: 849â€”852, 1993. inactivation of the CR might not be the only mechanism of CC resist 17. Bansal, N., Houle, A., and Melnykovych, G. Apoptosis: mode of cell death induced ance, and alternative escape pathways using mutations of genes down inT cellleukemialinesbydexamethasoneandotheragents.FASEBI.,5: 211â€”216, stream of the CR might be expected. However,correspondingmutations 1991. 18. Briehl, M. M., and Miesfeld, R. L Isolation and characterization of transcripts and the affected genes still need to be defined. induced by androgen withdrawal and apoptotic cell death in the rat ventral prostat@ MoLEndocrinol.,5:1381â€”1388,1991. 19. Bourgeois, S., Gruol, D. J., Newby, R. F., and Rajab, F. M. Expression ofan mdrgene ACKNOWLEDGMENTh is associated with a new form of resistance to dexamethasone-inducedapoptosis. MoL Endocrinol., 7: 840â€”851, 1993. 20. Yamainoto, K. R. Steroid receptor regulated transcription of specific genes and gene We thankDr. A. Csordasfor the CEM-C7andCEM-R6cell lines, Dr. E. networks. Annu. Rev. Genet., 19: 209-252, 1985. B. Thompson for providing unpublished results and CEM-Ci cells, S. 21. Gustafsson,J-&,Carlstedt-Duke,J.,Poellinger,L, Okret,S., WikstrOm,A-C., Aichberger and I. Jaklitsch for excellent technical assistance, Drs. S. BrOnnegArd,M., Gillner, M., Dong, Y., Fuxe, K., Cintra, A., HArfstrand, A., and Schwarz and 0. Wick for stimulating discussions, and M. K. Occhipinti for Agnati, L. Biochemistry, molecular biology, and physiology of the glucocorticoid receptor. Endocr. Rev., 8: 185â€”234,1987. editing the manuscript. 22. Evans, R. M. The steroid and thyroid hormone receptor superfamily. Science (Washington DC), 240: 889â€”895,1988. 23. Micsfeld, R. L The structure and function ofsteroid receptor proteins. CRCCrIt. Rev. REFERENCES Biochem. MoL Biol., 24: 101â€”117,1989. 24. Truss, M., and Beato, M. Steroid hormone receptors: interaction with deoxyribonu 1. DeVita, V. T., Hubbard, S. M., and Longo, D. L. The chemotherapy of lymphomas: cleic acid and transcription factors. Endocr. Rev., 14: 459â€”479,1993. looking back, moving forwardâ€”theRichard and Hinda Rosenthal Award lecture. 25. Funder, J. W. Mineralocorticoids, glucocorticoids, receptors and response elements. Cancer Res., 47: 5810â€”5824,1987. Science (Washington DC), 259: 1132â€”1133,1993. 2. Baxter,J.D., Harris,A.W., Tomkins,0.M., andCohn,M. Glucocorticoidreceptors 26. Nielsen, D. A., and Shapiro, D. J. Insights into hormonal control of messenger RNA in lymphoma cells in culture: relation to killing activity. Science (Washington DC), stability. Mol. EndOCrinOL,4: 953-957, 1990. 171: 189â€”191,1971. 27. Verdi, J. M., and Campagnoni, A. T. Translational regulation by steroids. Identifi 3. Schwartzman, R. A. and Cidlowski, 3. A. Apoptosis: the biochemistry and molecular cation of a steroid modulatory element in the 5'-untranslated region of the myelin biology of programmed cell death. Endocr. Rev., 14: 133-151, 1993. basic protein messenger RNA. J. Biol. Chem., 265: 20314â€”20320,1990. 4. Thompson, E. B. Apoptosis and steroid hormones. Mol. Endocrinol., 8: 665â€”673, 28. Jonat, C., RahmSdOrf, H. J., Park, K-K, Cato, A. C. B., Gebel, S., Ponta, H., and 1994. Herrlich, P. Antitumor promotion and antiinflammation: down-modulation of AP-l 5. Wyllie, A. H., Kerr, J. F. R., and Currie, A. R. Cell death: the significance of (Fos/Jun) activity by glucocorticoid hormone. Cell, 62: 1189â€”1204,1990. apoptosis. Int. Rev. Cytol., 68: 251â€”307,1980. 29. Yang-Yen, H-F., Chambard, J-C., Sun, Y-L, Smeal, T., Schmidt, T. I., Dmuin, I., 6. Ellis,R. E., Yuan,3.,and Horvitz,H.R. Mechanismsandfunctionsofcelldeath. and Karin, M. Transcriptional interference between c-Jun and the glucocorticoid Annu. Rev. Cell Biol., 7: 663â€”698,1991. receptor: mutual inhibition of DNA binding due to direct protein-protein interaction. 7. Raff, M. C. Social controls on cell survival and cell death. Nature (Land.), 356: Cell,62:1205â€”1215,1990. 397â€”400,1992. 30. Ray, A., and Prefontaine,K. E. Physicalassociationand functionalantagonism 8. Vaux, D. L, Haecker, 0., and Strasser, A. An evolutionary perspective on apoptosis. between the p65 subunit of transcription factor NF-kappaB and the glucocorticoid Cell, 76: 777â€”779,1994. receptor. Proc. NatI. Acad. Sci. USA, 91: 752â€”756,1994. 9. Schwartz, L M., and Osborne, B. A. Programmed cell death, apoptosis and killer 31. Norman, M. R., and Thompson, E. B. Characterization of a glucocorticoid-sensitive genes. Immunol. Today, 14: 582-590, 1993. human lymphoid cell line. Cancer Res., 37: 3785â€”3791,1977. 10. Yuh, Y-S., and Thompson, E. B. Glucocorticoid effect on oncogenc/growth gene expres 32. Zawydiwski, R., Harmon, J. M., and Thompson, H. B. Glucocorticoid-resistant human sian in human T lymphoblastic leukemic cell line CCRF-CEM. Specific c-mr mRNA acute lymphoblastic leukemic cell line with functional receptor. Cancer Res., 43: suppression by dexamethasone. J. BiOL O@em.,264: 10904-10910, 1989. 3865â€”3873,1983. 11. Sentman, C. L, Shutter, J. R., Hockenbery, D., Kanagawa, 0., and Korsmeyer, S. J. 33. Schmidt, T. J., Harmon, J. M., and Thompson, E. B. â€œActivation-labileâ€•glucocorti Bcl-2 inhibits multiple forms of apoptosis but not negative selection in thymocytes. coid-receptor complexes of a steroid-resistant variant of CEM-C7 human lymphoid Cell, 67: 879â€”888,1991. cells. Nature (Load.), 286: 507-510, 1980. 12. Alnemri, E. S., Femandes, T. F., Haldar, S., Croce, C. M., and Utwack, 0. Involve 34. Harmon, J. M., and Thompson, E. B. Isolation and characterization of dexametha ment of BCL-2in glucocorticoid-inducedapoptosisof humanpre-B-leukemias. anne-resistant mutants from human lymphoid cell line CEM-C7. MoL Cell. BiOL,1: Cancer Res., 52: 491â€”495,1992. 512â€”521,1981. 13. Evan, 0. I., wylie, A. H., Gilbert, C. S., Littlewood, T. D., Land, H., Brooks, M., 35. Harmon, J. M., Thompson, E. B., and Baione, K. A. Analysis of glucocorticoid Waters, C. M., Penn, L Z., and Hancock, D. C. Induction of apoptosis in fibroblasts resistant human leukemic cells by somatic cell hybridization. Cancer Rca., 45: by c-myc protein. Cell, 69: 119â€”128,1992. 1587â€”1593,1985. 14. Yonish-Rouach, E., Grunwald, D., Wilder, S., Kimchi, A., May, E., Lawrence, J-J., 36. Palmer,L A.,andHarmon,J.M.Biochemicalevidencethatglucocorticoid-sensitive May, P., and Oren, M. p53-mediated cell death: relationship to cell cycle control. celllinesderivedfromthehumanleukemiccelllineCCRF-CEMexpressa normal Mol. Cell. Biol., 13: 1415â€”1423,1993. and a mutant glucocorticoid receptor gene. Cancer Rca., 51: 5224-5231, 1991. 15. Yuan, J., Shaham, S., Ledoux, S., Ellis, H. M., and Horvitz, H. R. The C. elegans cell 37. Palmer, L A., Hukku, B., and Harmon, J. M. Human glucocorticoid receptor gene death gene ced-3 encodes a protein similar to mammalian interleukin-1@-converting deletion following exposure to cancer chemotherapeutic drugs and chemical enzyme. Cell, 75: 641â€”652,1993. mutagens. Cancer Rca., 52: 6612-6618, 1992. 352

38. AShraf, J., and Thompson, E. B. Identification of the activation-labile gene: a single 44. Maniatis, T., Fritsch, E. F., and Sambrook, J. Molecular aornng. Cold Spring Harbor point mutation in the human glucocorticoid receptor presents as two distinct receptor Laboratories, Cold Spring Harbor, NY, 1982. phenotypes.Mol.EndocrinoL,7:631â€”642,1993. 45. Bimboim, H. C. A rapid alkaline extraction method for the isolation ofplasmid DNA. 39. Powers,J. H., Hillmann,A. 0., Tang, D. C., and Harmon,J. M. Cloningand Methods Enzymol., 100: 243-255, 1983. expression of mutant glucocorticoid receptors from glucocorticoid-sensitive and 46. Sanger, F., Nicklen, S., and Coulson, A. R. DNA sequencing with chain-terminating -resistant human leukemic cells. Cancer Rca., 53: 4059-4065, 1993. inhibitors. Proc. NatL Acad. Sci. USA, 74: 5463â€”5467,1977. 40. Nicoletti, I., Migliorati, 0., Pagliacci, M. C., Grignani, F., and Riccardi, C. A rapid 47. McIntosh,I., Hamosh,k, and Diets, H. C. Nonsensemutationsand diminished and simple method for measuring thymocyte apoptosis by propidium iodide staining mRNAlevels.NatureGenet.,4: 219,1993. andflowcytometry.J.ImmunoLMethods,139:271â€”279,1991. 48. Moalli, P. A., Pillay, S., Krett, N. L, and Rosen, S. T. Alternatively spliced 41. Helmberg,A.,FSssler,R.,Geley,S.,JÃ¶hrer,K..Kroemer,0., BOck,0.,andKofler, glucocorticoid receptor messenger RNAs in glucocorticoid-resistant human multiple R. Glucocorticoid-regulated gene expression in the immune system: analysis of myeloma cells. Cancer Res., 53: 3877â€”3879,1993. glucocorticoid-regulated transcripts from the mouse macrophage-like cell line 49. Hollenberg,S. M., Weinberger,C., Ong, E. S., Cerelli,0., Oro, A., Lebo, R., P388D1. J. Immunol., 145: 4332â€”4337,1990. Thompson, E. B., Rosenfeld, M. G., and Evans, R. M. Primary structure and 42. Miller, S. A., Dykes, D. D., and Polesky, H. F. A simple salting out procedure for expression of a functional human glucocorticoid receptor cDNA. Nature (Land.), extracting DNA from human nucleated cells. Nucleic Acids Rca., 16: 1215â€”1217, 318: 635â€”641, 1985. 1988. 50. Karl, M., Lamberts, S. W. J., Detera-Wadleigh, S. D., Encio, I. J., Stratakis, C. A., 43. Aviv, H., and Leder, P. Purification of biologically active globin messenger RNA by Hurley, D. M., Accili, D., and Chrousos, 0. P. Familial glucocorticoid resistance chromatography on oligothymidylic add-cellulose. Proc. NatI. Acad. Sci. USA, 69: caused by a splice site deletion in the human glucocorticoid receptor gene. J. Gin. 1408â€”1412 1972. Endocrinol. Metab., 76: 683â€”689,1993.

353

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 1995 American Association for Cancer Research. Splice Site Mutation in the Glucocorticoid Receptor Gene Causes Resistance to Glucocorticoid-induced Apoptosis in a Human Acute Leukemic Cell Line

Elisabeth M. C. Strasser-Wozak, Rosa Hattmannstorfer, Monika Hála, et al.

Cancer Res 1995;55:348-353.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/55/2/348

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/55/2/348. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.