DOCSLIB.ORG

Inhibitors Including ATIII, .Ol-Antitrypsin,O(1-Antichymotrypsino

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Inhibitors Including ATIII, .Ol-Antitrypsin,O(1-Antichymotrypsino Volume 14 Number 2 1986 Nucleic Acids Research A new mamber of the plasma protease inhibitor gene famfly Hermann Ragg Hoechst AG, D-6230 Frankfurt 80, FRG Received 30 September 1985; Revised and Accepted 2 December 1985 ABSTRACT A 2.1-kb cDNA clone representing a new member of the prote- ase inhibitor family was isolated from a human liver cDNA libra- ry. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reac- tive center. HLS2 is about 25-28% homologous to three human mem- bers of the plasma protease inhibitor family: antithrombin III, o(l-antitrypsin and ol-antichymotrypsin. A comparison with publi- shed partial amino acid sequences shows that hLS2 is closely re- lated to the thrombin inhibitor heparin cofactor II. INTRODUCTION Plasma protease inhibitors are involved in the control of blood coagulation, complement activation and aspects of inflam- mation (1). Most of these inhibitors interact with their protea- se counter parts by forming 1:1 complexes. The inhibitors are believed to serve as bait by presenting their reactive site as a substrate to the appropriate protease (1,2), a process followed by a strong association between the inhibitor and the protease with the consequence that both molecules become inactive. It has been suggested that the protease specificity of the inhibitors is determined, at least in part, by a single amino acid (P1) at the reactive center (2). This view is strongly sup- ported by the recent identification of a naturally occuring mu- tant of o(l-antitrypsin (an inhibitor of elastase), in which a methionine residue at the reactive center has been changed to arginine. This amino acid is usually found in the Pl-position of antithrombin III (ATIII), and consequently the mutated o(l- antitrypsin molecule acts as a thrombin inhibitor (3). It has recently been proposed that several serine protease inhibitors including ATIII, .ol-antitrypsin,o(1-antichymotrypsino- C IRL Press Umited, Oxford, England. 1073 Nucleic Acids Research gen and mouse contrapsin (4) belong to a family of genes which has evolved from a common ancestor over about 500 million years (5-7). Surprisingly, ovalbumin and angiotensinogen are also mem- bers of this family (5,8,9). Angiotensinogen is the precursor of angiotensin I and II, which participate in the regulation of blood pressure and water balance (10). An inhibiting function, however, has not been attributed to the parent molecule. The biological function of ovalbumin is unknown. The plasma protease inhibitors perform important physiolo- gical functions. o(l-antitrypsin and ATIII deficiencies, which may be inherited or acquired, can result in serious illnesses. Lack of o(l-antitrypsin may be associated with emphysema, a con- dition which is probably due to the uncontrolled proteolytic ac- tion of elastase - a target enzyme of 0(l-antitrypsin (11,12). ATIII inhibits thrombin and several other coagulation factors (13,15). Individuals displaying ATIII deficiency are prone to spontaneous thrombosis and the risks associated with it. Many of the reactions which involve ATIII, are accelerated by the mucopolysaccharide heparin (16) and, until recently, the anticoagulant effect of heparin has been attributed to ATIII (13). Increasing evidence that heparin activates another inhibi- tor of thrombin has resulted in the isolation and characteriza- tion of heparin cofactor II - also termed antithrombin BM - (17,18). Both ATIII and heparin cofactor II are thrombin in- hibitors, however, in contrast to ATIII, the activity of heparin cofactor II against other blood coagulation factors is limited. In two recent reports (19,20) heparin cofactor II deficiency has been shown to be associated with thrombosis. This article describes the isolation and characterization of a cDNA clone which encodes a new member of the plasma protea- se inhibitor family which is closely related to heparin cofactor II. MATERIALS AND METHODS Synthesis of oligonucleotides. Oligonucleotides were synthesized as previously described (21). They were purified by preparative poylacrylamide gel elec- trophoresis, followed by HPLC on a Du Pont Zorbax C8-column (22). 1074 Nucleic Acids Research RNA preparation and analysis. Total RNA was isolated from frozen human liver biopsy mate- rial using a modified version of the guanidinium thiocyanate me- thod (23). After pelleting through a cushion of 5.7 M cesium chlo- ride, the RNA was dissolved in 50 mM Tris-HCl, 10 mM EDTA, 0.2 % SDS, pH 7.4, extracted with chloroform/l-butanol and reprecipita- ted twice with ethanol. The precipitate was redissolved and ex- tracted twice with phenol and once again with chloroform. One vo- lume consisting of 8 M urea and 4 M LiCl was added to the final aqueous phase and the RNA precipitated at o0C overnight (24). To- tal RNA was fractionated by two passages over oligo(dT)-cellulose to obtain poly(A)+RNA (25). Agarose gel electrophoresis and trans- fer of RNA to nitrocellulose paper were performed as described (26). cDNA cloning Synthesis of cDNA was basically performed as described (27). One unit RNAsin (Biotec) was included per p1 final volume during first strand synthesis. The Klenow fragment (Boehringer Mannheim) of DNA polymerase I (100 units/200 p1) was used for second strand synthesis. The reaction was incubated for 4 h at 15°C and for a further 2 h at 20°C. Single-stranded ends and loop structures were digested with nuclease S1 and the cDNA was subsequently repaired with the Klenow fragment of DNA polymerase I (28). The double- stranded cDNA was ligated into the vector pUC 13, a derivative of the pUC plasmid series (29), which had been treated with SmaI and calf intestine phosphatase. E. coli HB101 was transformed and se- lected for ampicillin resistance. For synthesis of cDNA by speci- fic priming, 10 pg of poly(A)+RNA and 500 pmol of 5'-end-labeled primer (5'CCCGGGGTGTCAGTTGCGCTTCGA) were heated for 3 min at 70°C in 1 mM Tris-HCl pH 7.5, 0.1 mM EDTA, 0.5 M KC1 (total volume - 52 p1) and subsequently cooled for 30 min to 43°C. The subse- quent reactions were in accordance with published procedures (30). T4 DNA polymerase (PL-Biochemicals) was used to produce blunt ends (31). 32p 5'-end-labeled HindIII-linkers (5'pGCAAGCTTGC, BRL) were attached (32) and after cleaving with HindIII, the cDNA was liga- ted into pAT1S3 (33) which had been cleaved with HindIII and treated with phosphatase. 1075 Nucleic Acids Research Screening of the cDNA libraries Colonies were grown on nitrocellulose f.ilters, incubated with chloramphenicol and prepared for hybridization as described (34). Prehybridization (4-8 h) and hybridization (15-24 h) were carried out in 6 x SET (1 x SET = 0.15 M NaCl, 30 mM Tris-HCl, 1 mM EDTA, pH 8.0) (34), 5 x Denhardt's solution, 0.2% SDS, 200 pg/ml calf thymus DNA, 200 pg/ml yeast RNA, 0.5% (R) Nonidet P-40 at 420C with 1.25 pmol/ml 32p 5'-end-labeled oligonucleotide probe (8 x 104 c.p.m./pmol) or with nick-translated restriction frag- ments ( ) 108 c.p.m./pg). Oligonucleotides used for hybridization and primer extension were labeled by phosphorylation of the 5'-end with ( J-32p) ATP (New England Nuclear) using T4 polynucleotide kinase (28). The filters used for screening with oligonucleotides were washed twice in 6 x SSC (1 x SSC = 0.15 M NaCl, 15 mM sodium citrate, pH 7.0) for 20 min at room temperature, and twice in the same solution at 330C. The filters used for hybridization with nick-translated restriction fragments were washed for one 15-minute period in each of the following: 6 x SSC at room tempe- rature, 2 x SSC at 420C, 1 x SSC at 50°C and finally in 0.1 x SSC at 50°C. Sequence determinations. Plasmid DNA was cleaved with the appropriate restriction en- zymes and the fragments were labeled at the 3'-end by filling in or at the 5'-end by treating with kinase (28). After secondary cleavage and agarose gel electrophoresis, the DNA fragments were electroeluted, subjected to the chemical degradation procedure (35) and analyzed on thin sequencing gels (36). RESULTS In an attempt to isolate cDNA sequences which encode plasma protease inhibitors, a human liver cDNA library was screened using an oligonucleotide (5'-GGGTTGGCTACTCTGCCCATGAAGA) complementary to the coding strand of an amino acid sequence which is strongly con- served in ATIII, o(l-antitrypsin and ovalbumin (Figure 1). Under moderately stringent hybridization and washing conditions, 58 hy- bridization-positive clones were isolated from about 24 000 trans- formants. Plasmid DNA from these clones was analyzed using re- 1076 Nucleic Acids Research o( 1-antitrypsin: -Leu-Phe-Met-Gly-Lys-Val-Val-Asn-Pro- ATIII: -Ile-Phe-Met-Gly-Arg-Val-Ala-Asn-Pro- Ovalbumin: -Leu-Phe-Phe-Gly-Arg-Cys-Val-Ser-Pro- Figure 1. Alignment of the conserved amino acid sequences of uj- antitrypsin, ATIII and ovalbumin (7), from which the oligonucleo- tide probe used for screening the cDNA library was deduced. The actual positions of the amino acid blocks in the respective pro- teins are 383-391 ( ol-antitrypsin) 421-429 (ATIII) and 377-385 (ovalbumin). striction enzymes and one of the clones (pL10/2), containing a 1.5 kilobase (kb) insert, displayed none of the restriction frag- ments to be expected in ATIII or o(l-antitrypsin cDNA (56, 57). Southern analysis of a series of double digestions using various restriction enzymes localized the hybridizing sequence in a 160-bp PvuII-EcoRI fragment (data not shown). Subsequent sequencing of this region revealed a 24-base sequence which, with the exception of two mismatch positions was complementary to the oligonucleotide used for hybridization.
Load more

Recommended publications
  • Identification of an Alpha-1 Antitrypsin Variant with Enhanced Specificity For
    www.nature.com/scientificreports OPEN Identifcation of an alpha‑1 antitrypsin variant with enhanced specifcity for factor XIa by phage display, bacterial expression, and combinatorial mutagenesis Varsha Bhakta1, Mostafa Hamada2, Amy Nouanesengsy2, Jessica Lapierre2, Darian L. Perruzza2 & William P. Shefeld1,2* Coagulation Factor XIa (FXIa) is an emerging target for antithrombotic agent development. The M358R variant of the serpin alpha‑1 antitrypsin (AAT) inhibits both FXIa and other proteases. Our aim was to enhance the specifcity of AAT M358R for FXIa. We randomized two AAT M358R phage display libraries at reactive centre loop positions P13‑P8 and P7‑P3 and biopanned them with FXIa. A bacterial expression library randomized at P2′‑P3′ was also probed. Resulting novel variants were expressed as recombinant proteins in E. coli and their kinetics of FXIa inhibition determined. The most potent FXIa‑inhibitory motifs were: P13‑P8, HASTGQ; P7‑P3, CLEVE; and P2‑P3′, PRSTE (respectively, novel residues bolded). Selectivity for FXIa over thrombin was increased up to 34‑fold versus AAT M358R for these single motif variants. Combining CLEVE and PRSTE motifs in AAT‑RC increased FXIa selectivity for thrombin, factors XIIa, Xa, activated protein C, and kallikrein by 279‑, 143‑, 63‑, 58‑, and 36‑fold, respectively, versus AAT M358R. AAT‑RC lengthened human plasma clotting times less than AAT M358R. AAT‑RC rapidly and selectively inhibits FXIa and is worthy of testing in vivo. AAT specifcity can be focused on one target protease by selection in phage and bacterial systems coupled with combinatorial mutagenesis. Trombosis, the blockage of intact blood vessels by occlusive clots, continues to impose a heavy clinical burden, and is responsible for one quarter of deaths world-wide1.
    [Show full text]
  • Heparin/Heparan Sulfate Proteoglycans Glycomic Interactome in Angiogenesis: Biological Implications and Therapeutical Use
    Molecules 2015, 20, 6342-6388; doi:10.3390/molecules20046342 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Review Heparin/Heparan Sulfate Proteoglycans Glycomic Interactome in Angiogenesis: Biological Implications and Therapeutical Use Paola Chiodelli, Antonella Bugatti, Chiara Urbinati and Marco Rusnati * Section of Experimental Oncology and Immunology, Department of Molecular and Translational Medicine, University of Brescia, Brescia 25123, Italy; E-Mails: [email protected] (P.C.); [email protected] (A.B.); [email protected] (C.U.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +39-030-371-7315; Fax: +39-030-371-7747. Academic Editor: Els Van Damme Received: 26 February 2015 / Accepted: 1 April 2015 / Published: 10 April 2015 Abstract: Angiogenesis, the process of formation of new blood vessel from pre-existing ones, is involved in various intertwined pathological processes including virus infection, inflammation and oncogenesis, making it a promising target for the development of novel strategies for various interventions. To induce angiogenesis, angiogenic growth factors (AGFs) must interact with pro-angiogenic receptors to induce proliferation, protease production and migration of endothelial cells (ECs). The action of AGFs is counteracted by antiangiogenic modulators whose main mechanism of action is to bind (thus sequestering or masking) AGFs or their receptors. Many sugars, either free or associated to proteins, are involved in these interactions, thus exerting a tight regulation of the neovascularization process. Heparin and heparan sulfate proteoglycans undoubtedly play a pivotal role in this context since they bind to almost all the known AGFs, to several pro-angiogenic receptors and even to angiogenic inhibitors, originating an intricate network of interaction, the so called “angiogenesis glycomic interactome”.
    [Show full text]
  • (HCII) Heparin Cofactor II Antigen
    Supplied Materials: 1.1.1. Capture Antibody (HCII(HCII----EIAEIAEIAEIA----C):C):C):C): One yellow-capped vial ** REPRESENTATIVE DATA SHEETS** containing 0.4 ml of polyclonal affinity purified anti-HCII antibody for coating plates. MatchedMatchedMatched-Matched---PairPair Antibody Set 2.2.2. Detecting Antibody (HCII(HCII----EIAEIAEIAEIA----D):D):D):D): Four neutral-capped for ELISA of human tubes each containing 10 ml of pre-diluted peroxidase conjugated polyclonal anti-HCII antibody for detection of Heparin Cofactor II antigen (HCII) captured HCII. °°° Sufficient reagent for 4 x 96 wellwell4 plates Store reagents at 22----8888 CCC Product #: HCII-HCII-EIAEIA Product #:Product #: HCIIHCII-- EIAEIA Materials Required but not Provided: Lot # SAMPLE Expiry Date:Expiry Date: SAMPLE 1. Coating Buffer: 50 mM Carbonate 1.59g of Na2CO3 and 2.93g of NaHCO3 up to 1 litre. Adjust pH to 9.6. Store at 2-8°C up to 1 month. 222. PBS: (base for wash buffer and blocking buffer) PBS:PBS: 8.0g NaCl, 1.15g Na2HPO4, 0.2g KH2PO4 and 0.2g KCl, up to Store atStore at 2 2----8888°°°CCC 1 litre. Adjust pH to 7.4, if necessary. Store up to 1 month at 2-8°C, discard if there is evidence of microbial growth. For Research Use Only Not for use in diagnostic procedures. 333. Wash Buffer: PBS-Tween (0.1%,v/v) To 1 litre of PBS add 1.0 ml of Tween-20. Check that the pH is 7.4. Store at 2-8°C up to 1 week. Description of Heparin Cofactor II (HCII) Heparin Cofactor II (HCII), also known as heparin cofactor A 4.
    [Show full text]
  • Heparin Cofactor II Inhibits Arterial Thrombosis After Endothelial Injury Li He Washington University School of Medicine in St
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2002 Heparin cofactor II inhibits arterial thrombosis after endothelial injury Li He Washington University School of Medicine in St. Louis Cristina P. Vicente Washington University School of Medicine in St. Louis Randal J. Westrick University of Michigan - Ann Arbor Daniel T. Eitzman University of Michigan - Ann Arbor Douglas M. Tollefsen Washington University School of Medicine in St. Louis Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation He, Li; Vicente, Cristina P.; Westrick, Randal J.; Eitzman, Daniel T.; and Tollefsen, Douglas M., ,"Heparin cofactor II inhibits arterial thrombosis after endothelial injury." The ourJ nal of Clinical Investigation.,. 213-219. (2002). https://digitalcommons.wustl.edu/open_access_pubs/1423 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Heparin cofactor II inhibits arterial thrombosis after endothelial injury Li He,1 Cristina P. Vicente,1 Randal J. Westrick,2 Daniel T. Eitzman,2 and Douglas M. Tollefsen1 1Division of Hematology, Department of Internal Medicine, and Department of Biochemistry and Molecular Biophysics, Washington University, St. Louis, Missouri, USA 2Division of Cardiology, Department of Medicine, University of Michigan, Ann Arbor, Michigan, USA Address correspondence to: Douglas M. Tollefsen, Division of Hematology, Box 8125, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, Missouri 63110, USA. Phone: (314) 362-8830; Fax: (314) 362-8826; E-mail: [email protected].
    [Show full text]
  • Heparin Sensitivity and Resistance: Management During Cardiopulmonary Bypass
    Society of Cardiovascular Anesthesiologists Cardiovascular Anesthesiology Section Editor: Charles W. Hogue, Jr. Perioperative Echocardiography and Cardiovascular Education Section Editor: Martin J. London Hemostasis and Transfusion Medicine Section Editor: Jerrold H. Levy E REVIEW ARTICLE CME Heparin Sensitivity and Resistance: Management During Cardiopulmonary Bypass Alan Finley, MD and Charles Greenberg, MD Heparin resistance during cardiac surgery is defined as the inability of an adequate heparin dose to increase the activated clotting time (ACT) to the desired level. Failure to attain the target ACT raises concerns that the patient is not fully anticoagulated and initiating cardiopulmonary bypass may result in excessive activation of the hemostatic system. Although antithrombin deficiency has generally been thought to be the primary mechanism of heparin resistance, the reasons for heparin resistance are both complex and multifactorial. Furthermore, the ACT is not specific to heparin’s anticoagulant effect and is affected by multiple variables that are com- monly present during cardiac surgery. Due to these many variables, it remains unclear whether decreased heparin responsiveness as measured by the ACT represents inadequate anticoagula- tion. Nevertheless, many clinicians choose a target ACT to assess anticoagulation, and inter- ventions aimed at achieving the target ACT are routinely performed in the setting of heparin resistance. Treatments for heparin resistance/alterations in heparin responsiveness include additional heparin or antithrombin supplementation. In this review, we discuss the variability of heparin potency, heparin responsiveness as measured by the ACT, and the current management of heparin resistance. (Anesth Analg 2013;116:1210–22) major challenge to the advancement of cardiac surgery Heparin resistance during cardiac surgery is defined as the is establishing a way to prevent thrombosis within failure of unusually high doses of heparin to achieve a target Athe cardiopulmonary bypass (CPB) circuit.
    [Show full text]
  • NIH Public Access Author Manuscript J Thromb Haemost
    NIH Public Access Author Manuscript J Thromb Haemost. Author manuscript; available in PMC 2009 April 20. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: J Thromb Haemost. 2007 July ; 5(Suppl 1): 102±115. doi:10.1111/j.1538-7836.2007.02516.x. Serpins in thrombosis, hemostasis and fibrinolysis J. C. RAU*,1, L. M. BEAULIEU*,1, J. A. HUNTINGTON†, and F. C. CHURCH* *Department of Pathology and Laboratory Medicine, Carolina Cardiovascular Biology Center, School of Medicine, University of North Carolina, Chapel Hill, NC, USA †Department of Haematology, Division of Structural Medicine, Thrombosis Research Unit, Cambridge Institute for Medical Research, University of Cambridge, Wellcome Trust/MRC, Cambridge, UK Summary Hemostasis and fibrinolysis, the biological processes that maintain proper blood flow, are the consequence of a complex series of cascading enzymatic reactions. Serine proteases involved in these processes are regulated by feedback loops, local cofactor molecules, and serine protease inhibitors (serpins). The delicate balance between proteolytic and inhibitory reactions in hemostasis and fibrinolysis, described by the coagulation, protein C and fibrinolytic pathways, can be disrupted, resulting in the pathological conditions of thrombosis or abnormal bleeding. Medicine capitalizes on the importance of serpins, using therapeutics to manipulate the serpin-protease reactions for the treatment and prevention of thrombosis and hemorrhage. Therefore, investigation of serpins, their cofactors, and their structure-function relationships is imperative for the development of state-of- the-art pharmaceuticals for the selective fine-tuning of hemostasis and fibrinolysis. This review describes key serpins important in the regulation of these pathways: antithrombin, heparin cofactor II, protein Z-dependent protease inhibitor, α1-protease inhibitor, protein C inhibitor, α2-antiplasmin and plasminogen activator inhibitor-1.
    [Show full text]
  • Corticosteroid-Binding Globulin (Cbg): Deficiencies and the Role
    CORTICOSTEROID-BINDING GLOBULIN (CBG): DEFICIENCIES AND THE ROLE OF CBG IN DISEASE PROCESSES by LESLEY ANN HILL B.Sc. University of Western Ontario, 2011 A DISSERTATION SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Reproductive and Developmental Sciences) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) July 2017 © Lesley Ann Hill, 2017 Abstract Corticosteroid-binding globulin (CBG, SERPINA6) is a serine protease inhibitor family member produced by hepatocytes. Plasma CBG transports biologically active glucocorticoids, determines their bioavailability to target tissues and acts as an acute-phase negative protein with a role in the delivery of glucocorticoids to sites of inflammation. A few CBG-deficient individuals have been identified, yet the clinical significance of this remain unclear. In this thesis, I investigated 1) the biochemical consequences of naturally occurring single nucleotide polymorphisms in the SERPINA6 gene, 2) the role of human CBG during infections and acute inflammation and 3) CBG as a biomarker of inflammation in rats. A comprehensive analysis of functionally relevant naturally occurring SERPINA6 SNP revealed 11 CBG variants with abnormal production and/or function, diminished responses to proteolytic cleavage of the CBG reactive center loop (RCL) or altered recognition by monoclonal antibodies. In a genome-wide association study, plasma cortisol levels were most closely associated with SERPINA6 SNPs and plasma CBG-cortisol binding capacity. These studies indicate that human CBG variants need to be considered in clinical evaluations of patients with abnormal cortisol levels. In addition, I obtained evidence that discrepancies in CBG values obtained by the 9G12 ELISA compared to CBG binding capacity and 12G2 ELISA are likely due to differential N-glycosylation rather than proteolysis, as recently reported.
    [Show full text]
  • Hepatic Fibrosis and Carcinogenesis in A1-Antitrypsin Deficiency: A
    Downloaded from http://cshperspectives.cshlp.org/ on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press Hepatic Fibrosis and Carcinogenesis in a1-Antitrypsin Deficiency: A Prototype for Chronic Tissue Damage in Gain-of-Function Disorders David H. Perlmutter and Gary A. Silverman Departments of Pediatrics, Cell Biology, and Physiology, University of Pittsburgh School of Medicine, Children’s Hospital of Pittsburgh and Magee-Womens Hospital of UPMC, Pittsburgh, Pennsylvania 15224 Correspondence: [email protected] In a1-antitrypsin (AT) deficiency, a point mutation renders a hepatic secretory glycoprotein prone to misfolding and polymerization. The mutant protein accumulates in the endoplas- mic reticulum of liver cells and causes hepatic fibrosis and hepatocellular carcinoma by a gain-of-function mechanism. Genetic and/or environmental modifiers determine whether an affected homozygote is susceptible to hepatic fibrosis/carcinoma. Two types of proteo- stasis mechanisms for such modifiers have been postulated: variation in the function of intracellular degradative mechanisms and/or variation in the signal transduction pathways that are activated to protect the cell from protein mislocalization and/or aggregation. In recent studies we found that carbamazepine, a drug that has been used safely as an anti- convulsant and mood stabilizer, reduces the hepatic load of mutant ATand hepatic fibrosis in a mouse model by enhancing autophagic disposal of this mutant protein. These results provide evidence that pharmacological manipulation of endogenous proteostasis mechan- isms is an appealing strategy for chemoprophylaxis in disorders involving gain-of-function mechanisms. he classical form of a1-antitrypsin (AT) in 1963, we now know that this liver disease Tdeficiency is a relatively common genetic results from the accumulation of mutant AT disease that causes hepatic fibrosis and carcino- inside of liver cells.
    [Show full text]
  • Plasma Heparin Cofactor II Activity Is Inversely Associated with Left Atrial Volume and Diastolic Dysfunction in Humans with Cardiovascular Risk Factors
    Hypertension Research (2011) 34, 225–231 & 2011 The Japanese Society of Hypertension All rights reserved 0916-9636/11 $32.00 www.nature.com/hr ORIGINAL ARTICLE Plasma heparin cofactor II activity is inversely associated with left atrial volume and diastolic dysfunction in humans with cardiovascular risk factors Takayuki Ise1,4, Ken-ichi Aihara1,4, Yuka Sumitomo-Ueda1, Sumiko Yoshida1, Yasumasa Ikeda2, Shusuke Yagi3, Takashi Iwase3, Hirotsugu Yamada3, Masashi Akaike3, Masataka Sata3 and Toshio Matsumoto1 Thrombin has a crucial role in cardiac remodeling through protease-activated receptor-1 activation in cardiac fibroblasts and cardiomyocytes. As heparin cofactor II (HCII) inhibits the action of tissue thrombin in the cardiovascular system, it is possible that HCII counteracts the development of cardiac remodeling. We investigated the relationships between plasma HCII activity and surrogate markers of cardiac geometry, including left atrial volume index (LAVI), relative wall thickness (RWT) and left ventricular mass index, and deceleration time (DcT) and the ratio of peak E velocity to early diastolic mitral annulus velocity (E/e’ ratio) as surrogate markers of left ventricular diastolic dysfunction measured using echocardiography in 304 Japanese elderly individuals without systolic heart failure (169 men and 135 women; mean age: 65.4±11.8 years). Mean plasma HCII activity in all participants was 95.8±17.0% and there was no difference between the mean plasma HCII activities in males and females. Multiple regression analysis revealed that there were significant inverse relationships between plasma HCII activity and LAVI (coefficient: À0.2302, Po0.001), between HCII activity and RWT (coefficient: À0.0007, Po0.05), between HCII activity and DcT (coefficient: À0.5189, Po0.05) and between HCII activity and E/e’ ratio (coefficient: À0.0558, Po0.01).
    [Show full text]
  • Heparin Cofactor II Is Regulated Allosterically and Not Primarily by Template Effects
    Heparin cofactor II is regulated allosterically and not primarily by template effects. Studies with mutant thrombins and glycosaminoglycans. Sheehan JP, Tollefsen DM, Sadler JE. Department of Medicine, Jewish Hospital of St. Louis, Washington University School of Medicine, Missouri 63110. Abstract Besides its critical role in hemostasis, the serine protease thrombin also participates in wound healing, inflammation, and atherosclerosis. Thrombin is inhibited by the serpins antithrombin and heparin cofactor II (HCiI) in reactions that are accelerated markedly by specific glycosaminoglycans. Following vascular injury, thrombin must be inhibited at both intravascular and extravascular sites that impose different constraints on the recognition of thrombin by these inhibitors. The present study examines the role of anion-binding exosite II of thrombin in the interaction with glycosaminoglycans and HCII. Acceleration of thrombin inhibition by serpins in the presence of glycosaminoglycans is proposed to occur by a template mechanism, in which inhibitor and protease bind simultaneously to the same glycosaminoglycan chain, facilitating their interaction. According to the template model, disruption of protease binding to glycosaminoglycan should significantly reduce acceleration of the inhibition. Specific mutations in exosite II (R89E, R245E, K248E, and K252E) disrupted thrombin binding to both dermatan sulfate and heparin, indicating that both glycosaminoglycans bind to a common site in exosite II. The same mutations markedly decreased the rate constant for thrombin inhibition by antithrombin-heparin (up to 100-fold) but had little effect on the rate constant for thrombin inhibition by HCII-heparin (7-fold maximal reduction) and no effect on the rate constant for thrombin inhibition by HCII-dermatan sulfate. These results are incompatible with a template model for thrombin inhibition by HCII and dermatan sulfate.
    [Show full text]
  • Vitamin D Association with Coagulation Factors in Polycystic Ovary Syndrome Is Dependent Upon Body Mass Index Abu Saleh Md Moin1, Thozhukat Sathyapalan2, Alexandra E
    Moin et al. J Transl Med (2021) 19:239 https://doi.org/10.1186/s12967-021-02897-0 Journal of Translational Medicine LETTER TO THE EDITOR Open Access Vitamin D association with coagulation factors in polycystic ovary syndrome is dependent upon body mass index Abu Saleh Md Moin1, Thozhukat Sathyapalan2, Alexandra E. Butler1*† and Stephen L. Atkin3† Keywords: Polycystic ovary syndrome, Vitamin D, Obesity, Fibrinogen, Coagulation To the Editor: seasonal fuctuation in vitamin D levels, the period of Polycystic ovary syndrome (PCOS) is associated with vitamin D sampling in this study was done between metabolic consequences including obesity and insulin March to September of each year that would allow vita- resistance that are related to the excess prevalence of type min D targets being achieved through 9 min of sunlight 2 diabetes, hypertension, and cardiovascular diseases exposure alone in the North of England [6]. Te New- in later life [1]. It is reported that PCOS subjects show castle & North Tyneside Ethics committee approved this marked platelet dysfunction [2] and decreased plasma study; all patients gave written informed consent. PCOS fbrinolytic activity, resulting in a prothrombotic state diagnosis was based on all three Rotterdam consensus [3]. In addition, coagulation variables such as thrombin- diagnostic criteria [7] and all had a liver ultrasound to activatable fbrinolysis inhibitor, plasminogen activator exclude non-alcoholic fatty liver disease [8].” None of the inhibitor-1 (PAI-1), D-dimer, Antithrombin and throm- women were taking vitamin D supplements at the time of bomodulin have been reported to be elevated in PCOS enrolment, nor had they taken any in the 6 months prior compared to control subjects [4], and the functional to enrolment in the study which was one of the exclusion coagulation tests including prothrombin time, thrombin criteria.
    [Show full text]
  • Phylogeny of the Serpin Superfamily: Implications of Patterns of Amino Acid Conservation for Structure and Function
    Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Article Phylogeny of the Serpin Superfamily: Implications of Patterns of Amino Acid Conservation for Structure and Function James A. Irving,1 Robert N. Pike,1 Arthur M. Lesk,2 and James C. Whisstock1,3 1Department of Biochemistry and Molecular Biology, Monash University, Clayton Campus, Melbourne, Victoria 3168, Australia; 2Wellcome Trust Centre for the Study of Molecular Mechanisms in Disease, Cambridge Institute for Medical Research, University of Cambridge Clinical School, Cambridge CB2 2XY, United Kingdom We present a comprehensive alignment and phylogenetic analysis of the serpins, a superfamily of proteins with known members in higher animals, nematodes, insects, plants, and viruses. We analyze, compare, and classify 219 proteins representative of eight major and eight minor subfamilies, using a novel technique of consensus analysis. Patterns of sequence conservation characterize the family as a whole, with a clear relationship to the mechanism of function. Variations of these patterns within phylogenetically distinct groups can be correlated with the divergence of structure and function. The goals of this work are to provide a carefully curated alignment of serpin sequences, to describe patterns of conservation and divergence, and to derive a phylogenetic tree expressing the relationships among the members of this family. We extend earlier studies by Huber and Carrell as well as by Marshall, after whose publication the serpin family has grown functionally, taxonomically, and structurally. We used gene and protein sequence data, crystal structures, and chromosomal location where available. The results illuminate structure–function relationships in serpins, suggesting roles for conserved residues in the mechanism of conformational change.
    [Show full text]