Immunity and Sexual Signaling in the wolf spider Schizocosa ocreata
A dissertation submitted to the
Graduate School
of the University of Cincinnati
in partial fulfillment of the
requirements for the degree of
Doctor of Philosophy
in the Department of Biological Sciences
of the College of Arts and Sciences
by
Rachel Gilbert
B.S. University of Cincinnati
May 2011
Committee Chair: George W. Uetz, Ph.D. ABSTRACT
All taxa must cope with assault from parasites and pathogens, and have thus developed an immune system that may require resources that would otherwise be invested in life history traits, such as those used in mating and reproduction. Consequently, male sexual signaling traits that are costly to develop and maintain can act as honest signals, since only the highest quality males can cope with the energetic demands required to both express these traits and maintain an effective immune system. In this study, I investigated the tradeoffs between immunity and sexual signaling in the brush-legged wolf spider Schizocosa ocreata. First, I sought to determine whether male multimodal sexual signals are an honest indicator of male health and immunity, and whether females can acquire information about male health status through the evaluation of these traits in a live mating context. While I found evidence that females avoid the chemical cues of infected males, there was no difference in vibratory sexual signals or in overall mating success between infected and healthy males. However, these were males that were infected as adults, after sexual signaling traits were fixed, and may not accurately reflect a change in male health. Therefore, I infected males as juveniles during the penultimate stage of development, when the most resources should be allocated toward the development of sexual signals. These juvenile infected males had higher immune function as adults, but had more asymmetrical visual traits, lower quality vibratory signals, and overall lower mating success.
I also sought to understand the underlying mechanisms that may be mediating these tradeoffs between immunity and sexual signaling. Because the bacterial pathogen used to elicit an immune response in these studies was being consumed orally, I wanted to see whether the microbiome may be negatively influenced by these infection techniques, and could therefore
ii be causing the lower body mass and lower quality sexual signals seen in the juvenile infected males. I found that juvenile infected males had a significantly different core microbiome than control males and males infected as adults, with reduced diversity indices that may be an underlying cause of the juvenile infected phenotype. I also used an RNA-based gene expression approach to see which sets of genes are involved in the immune response of infected adults, as well as the long-term changes in gene expression in juvenile infected males as a way to link the physiological response to infection with altered phenotypic expression of sexual signaling traits.
I found a massive downregulation of genes involved in respiration and melanization, which are also likely important for the development of the darkly pigmented bristles of tufts that make up the visual sexual signal of males in this species. These results all suggest a strong evolutionary relationship between immunity and sexual signaling in this species, and lays the groundwork for a new model organism with which to study these complex tradeoffs.
iii COPYRIGHT NOTICE
Portions of this dissertation appeared in:
Gilbert, R., Karp, R. D., & Uetz, G. W. (2016). Effects of juvenile infection on adult immunity and secondary sexual characters in a wolf spider. Behavioral Ecology, arv241. http://doi.org/10.1093/beheco/arv241
Gilbert, R., & Uetz, G. W. (2016). Courtship and male ornaments as honest indicators of immune function. Animal Behaviour, 117, 97–103. http://doi.org/http://dx.doi.org/10.1016/j.anbehav.2016.04.013
iv ACKNOWLEDGEMENTS
First and foremost, I cannot express in words the level of gratitude I feel for the endless support
I’ve received from my advisor, Dr. George Uetz. His passion for science and mentorship are what influenced my decision to attend graduate school, and his ability to recognize potential in others is the reason that I even made it into this program. He always has an open door, and is willing to read endless iterations of manuscripts and allowed me to attend conferences in exotic locations on his own dime. I am forever grateful to him for taking me in as a naïve undergraduate who had no idea what I wanted to do or any idea what research was and making me a published author who has a pretty good shot as an accomplished researcher.
I would also like to thank my research advisory committee, who has stood by me throughout a very nontraditional degree. Dr. Karp has been on my side from year one, supporting my career even when others didn’t. Dr. Weiss has been very supportive and encouraged my research with enthusiasm, even though it is well outside of her specialty. Dr.
Benoit has allowed me to use countless resources from his own laboratory to support my projects, and I look forward to a long and fruitful collaboration with his lab in future research.
Dr. Maurer is an essential voice of reason, making sure that my inability to focus on a single project doesn’t get too out of hand, and that I remain rooted in core concepts that are easy to forget. Every one of them stepped up and joined my committee just months before my qualifying exam, which is exceptionally difficult and I will be forever appreciative for their support. While she’s not on my committee, Julie Stacy is an honorary member as she has been an invaluable resource for my work. She helped me learn microbiology skills, always provided
v me with reagents and LB plates so that I wouldn’t have to make them myself, and is always a positive presence in my graduate career.
I would also like to thank the many members of the Uetz lab for their constant support.
We’ve spent many nights bonding over beer, bourbon and Settlers of Catan, and I never would have made it through the program without having a labmate to complain to or to bounce ideas off of. Alex and Brent were always there to keep my impostor syndrome in check, Emily has been a constant friend and partner in crime, Tim and Maddi and Trinity have been good sports in entertaining my occasional outbursts. Special thanks go to Charity Combs, Katie Ward
(Surharski) and Brittany Hall and the remaining army of undergraduates for their contributions to the projects in this dissertation.
I would also like to take the time to thank the other graduate students in the department, with whom I have become a close colleague and even closer friends. Without the social structure that they provided, I would have let the stress of graduate school overwhelm me. Having people to suffer with keeps you grounded, provides you with a means to bounce ideas off of with scientists outside of your own field, and keeps your ego in constant check. I’m going to miss the arguments and discussions that we’ve had, but I look forward to seeing where all of your careers go, and hope to collaborate with you all in the future.
The support I’ve received outside of the department has been invaluable as well. Kitty
Uetz is always there for me and Dr. Uetz’s other students, and is always willing to throw us a party or invite us to her art shows for beautiful art and free food. My good friends Casey (Cas) and Mary Kate (MK) have been with me since I started graduate school, and have been a constant shoulder to cry on and a source of encouragement. My parents have always been
vi supportive, even though they have no idea what I do for a living. They’ve always made sure I had the resources I need to finish my schooling, even at the expense of their own well-being, to make sure that I have more than they ever did.
vii TABLE OF CONTENTS
Introduction……………………………………………………………………………………………….………………………………1
References…………………………………………………………………………………………….……………………….9
CHAPTER 1
Courtship and male ornaments as honest indicators of immune function…………………………….14
Abstract…………………………………………………………………………………………………………………………………..15
Introduction…………………………………………………………………………………………………………………………….16
Methods and Materials…………………………..……………………………………………………………………………….19
Results……………………………………………………………………………………………………………………………………..24
Discussion………………………………………………………………………………………………………………………………..26
References……………………………………………………………………………………………………………………………….30
Figures……………………………………………………………………………………………………………………………………..38
CHAPTER 2
Effects of juvenile infection on adult immunity and secondary sexual characters in a wolf spider………………………………………………………………………………………………………………………45
Abstract………………………………………………………………………………………………………………………………….46
Introduction…………………………………………………………………………………………………………………………...47
Methods and Materials…………………………………………………………………………………………………………..50
viii Results…………………………………………………………………………………………………………………………………….54
Discussion………………………………………………………………………………………………………………………………57
References……………………………………………………………………………………………………………………………..63
Figures…………………………………………………………………………………………………………………………………...72
CHAPTER 3
Male chemical cues as reliable indicators of infection in the wolf spider
Schizocosa ocreata………………………………………………………………………………………………………………...78
Abstract…………………………………………………………………………………………………………………………...... 79
Introduction…………………………………………………………………………………………………………………………...80
Methods and Materials…………………………………………………………………………………………………………..81
Results…………………………………………………………………………………………………………………………...... 85
Discussion…………………………………………………………………………………………………………………………...... 86
References…………………………………………………………………………………………………………………………...... 88
Figures…………………………………………………………………………………………………………………………………....92
CHAPTER 4
Infection influences vibratory signaling in a wolf spider with multimodal communication……………………………………………………………………………………………………………………….95
Abstract…………………………………………………………………………………………………………………………………..96
ix Introduction……………………………………………………………………………………………………………………………97
Methods and Materials…………………………………………………………………………………………………………..99
Results……………………………………………………………………………………………………………………………………102
Discussion………………………………………………………………………………………………………………………………103
References…………………………………………………………………………………………………………………………….105
Figures…………………………………………………………………………………………………………………………………..107
CHAPTER 5
Infection influences the adult microbiome of a wolf spider…………………………………………………111
Abstract…………………………………………………………………………………………………………………………………112
Introduction…………………………………………………………………………………………………………………………..113
Methods and Materials………………………………………………………………………………………………………….115
Results……………………………………………………………………………………………………………………………………116
Discussion………………………………………………………………………………………………………………………………118
References…………………………………………………………………………………………………………………………….121
Figures…………………………………………………………………………………………………………………………………..123
CHAPTER 6
Characterization of immune related genes in a wolf spider…………………………………………………129
Abstract…………………………………………………………………………………………………………………………………130
x Introduction…………………………………………………………………………………………………………………………..131
Methods and Preliminary Results………………………………………………………………………………………….132
Discussion……………………………………………………………………………………………………………………………..135
References…………………………………………………………………………………………………………………………….137
Figures…………………………………………………………………………………………………………………………………..140
GENERAL CONCLUSIONS……………………………………………………………………………………………………….146
xi Overview
Animals must be able to balance the costs of maintaining an immune system that can fight off the pathogens in their environment with the costs of reproductive activities, such as courtship and mating. Because both immunity and courtship are so energetically demanding, only the highest quality males can develop adequate sexual signals and still mount an immune response when infected. Therefore, by choosing to mate with a male that is both healthy and has high quality sexual signals, a female can maximize her fitness benefits by both avoiding coming into contact with infected males and passing on better and healthier genes to her offspring.
While decades of studies have shown that these two life history processes are inextricably linked in various ways, the specific physiological mechanisms underlying these tradeoffs remain elusive. Invertebrates provide an excellent model by which to study these tradeoffs because they have a relatively simple immune system, but well-defined patterns of complex courtship that have been shown in many systems to reflect male health and immune strength. The wolf spider Schizocosa ocreata is particularly interesting in this context because they have multimodal sexual signaling, in which there are three signaling modalities that may convey different types of information about male quality to a potential mate. This study utilizes laboratory infection techniques to measure the relationship between infection and sexual signaling, the ability of sexual signals to provide females with health cues, and some of the possible physiological mechanisms that may be underlying these relationships.
1 Ecological Immunology
Ecological immunology is a relatively new field exploring the relationship between the immune system and individual fitness under constraints imposed by the environment. Recently, research concerning the relationship between immune function and behavior in animals has focused on aspects of animal communication (Peters et al. 2004, Kivleniece et al. 2010).
Hamilton and Zuk (1982) were among the first to propose that sexual selection and female preference for elaborate sexual signaling traits may be in part driven by parasite-mediated selective forces. By selecting males that display the best traits, females are actually selecting for genetic variance in immunity and parasite resistance, since trait expression may depend on a male’s ability to fight off pathogens efficiently. Milinski and Bakker (1990) demonstrated this empirically in three-spined sticklebacks, where female choosiness for red pigmentation led to a reduced likelihood of infection and offspring with higher immunity. This model has been historically difficult to test, as there has not been a robust analysis of the genetic mechanisms that may be underlying parasite-mediated sexual selection (Balenger and Zuk 2014).
Despite the lack of advances in this field, there have been many studies focusing on the direct tradeoffs between sexual signals and immunity at the physiology level. Because signaling itself is energetically costly, it can reduce immunological defenses (Bradbury & Vehrencamp
2011). As a consequence of these costs, potential fitness trade-offs arise when animals under immune stress express sexual signaling traits. Because of the handicaps that these traits impose on males, these signals are therefore thought to be ‘honest’ signals, since only males of the highest quality can withstand all of the energetic demands of signaling and immunity (Zahavi
1975, Folstad & Karter 1992). The immunocompetence hypothesis (Folstad & Karter 1992)
2 suggests that some male signaling traits evolved as indicators of healthy immune function, because they serve as criteria for females to assess male health during mate choice (Bradbury &
Vehrencamp 2011). In fact, many studies have found a positive correlation between sexually selected traits and some aspect of immune function, suggesting that female mate preference may be acting as a selective pressure that influences the ability of males to withstand such trade-offs between sexual signalling and immunity (Ahtiainen et al., 2004; Lawniczak et al.,
2007; Rantala et al., 2002; Ryder & Siva-Jothy, 2000; Simmons et al., 2005).
Immunity and sexual selection
While much of the research in this field has been carried out on vertebrate models, there has been a recent shift towards studying immunocompetence and ecological immunology in a wider evolutionary context, specifically using invertebrates. Studies of invertebrate immune defenses are far less common, but could provide unique and valuable insights to the evolution of animal immune defenses (Rolff & Siva-Jothy 2003; Hawley & Altizer 2010).
Invertebrates possess a relatively simple, innate immune system that consists of both cellular and humoral mechanisms. The humoral component involves rapid production of a variety of general and species-specific antimicrobial peptides as well as the activation of the phenoloxidase cascade response, which leads to melanization. Once the invading parasite or pathogen is detected by circulating hemocytes and encapsulated by melanin, it is subjected to killing factors including asphyxiation, toxic quinones produced by the prophenoloxidase cascade, and antimicrobial peptides (reviewed in Rolff and Siva-Jothy 2003). If the object cannot be cleared by the lysis activity of AMPs alone, such as in the case of a parasite or a large
3 quantity of bacteria or fungi, then a large number of hemocytes will surround and encapsulate the object, simultaneously causing a melanization cascade to be initiated by pro-phenoloxidase and free hemocyanins in the hemolymph. This cellular capsule and subsequent melanization will effectively asphyxiate the parasite and clear the infection. This type of immune response, called the encapsulation or phagocytic response, is mostly regarded as a secondary immune response. The secretion of AMPs and the initiation of the coagulation cascade are the primary immune response to the presence of infectious agents (Nentwig 2013, Fukuzawa et al. 2008).
Insect immunity is fairly well characterized in the literature, but far less is known about chelicerate immune systems, which differ in function from most arthropods. For example, chelicerates (including spiders) do not have a true phenoloxidase component of humoral immunity, and an oxygen-carrying compound called hemocyanin acts as a phenoloxidase during initial immune activation. Additionally, there has been demonstrated flexibility of the arthropod
IMD pathway within chelicerates, providing further evidence for variation in innate immunity across taxa (Shaw et al. 2017). However, existing immunological studies done in chelicerates have been carried out primarily in ticks or in Limulus horseshoe crabs, and most of the evidence linking immune function in horseshoe crabs and spiders is anecdotal (reviewed in Nentwig
2013). Most recent research in spider immunology is related to the identification of antimicrobial peptides (Fukuzawa et al.2008) and economically motivated studies of pesticides.
Although there is very little information about spider immunity, even fewer existing studies in this field are concerned with the role of immunity in the context of sexual selection.
While the role of immunity in sexual selection is not well-characterized for spiders, predictions can be made based on our current understanding of condition-dependent
4 components of male sexual signaling in a wide variety of taxa. Male secondary sexual characteristics are often expressed as visual components of sexual signaling, and are known to correlate positively with aspects of mate quality (e.g., pathogen resistance); males with ‘good genes’ display brighter, larger or more conspicuous ornaments (Zahavi 1975, Hamilton & Zuk
1982, Andersson 1994). These characters are often condition-dependent, and factors such as foraging history (Badyaev and Qvarnstrom 2002, Uetz et al. 2002, Jawor and Breitwisch 2004) and immune stress (Peters et al. 2004) may have an impact on size and quality of male ornamentation. In addition, a link between acoustic signaling and male immune function has been shown for some species of insects and spiders (Rantala & Kortet 2003; Fedorka et al.
2006; Ahtiainen et al.2005). However, sexual signaling is not limited to a single mode of communication. Some species have sexual displays that are complex, sometimes consisting of multiple signaling modalities that may each reflect different types of information (Candolin
2003). Studies of multimodal sexual signaling and the ability of each signaling modality to reflect male health and immune quality are lacking, and remains an enigmatic and intriguing question in this field.
Microbiomes as mediators of immunity and sexual signaling
The microbiome is an important and often underappreciated aspect of arthropod evolution
(McFall-Ngai et al. 2013). It is often the first point of contact between an organism and the microbes in its environment, and plays a key role in mitigating the effects of harmful microbes
(Broderick 2016). Additionally, endosymbionts can increase protection against parasites and pathogens (Ye et al. 2013, Paredes et al. 2016), influence sex ratio of populations (Kageyama et
5 al. 2012), and modulate nutrient uptake (Ponton et al. 2013). While there have been many studies focusing on the role of endosymbionts as mediators of behavior and life history tradeoffs, fewer studies have been focused on the role of infection and its potential lasting impacts on development and behavior. Because infection can influence the native microbiome of a host and therefore influence established endosymbionts, infection could possibly be a major mechanism for influencing host health by manipulating the microbiome (Freitak et al.
2007, Vallet-Gely et al. 2008).
The influence of the microbiome on host behavior is an emerging field, but has already provided intriguing evidence for its importance in several key behavioral processes (Lewis &
Lizé 2015). The microbiome has been shown to modulate social interactions within groups
(Archie & Theis 2011, Keiser et al. 2016), impact memory and learning (Li et al. 2009), and can even influence mate preference (Miller et al. 2010, Sharon et al. 2010). Despite the relative importance of host-bacteria symbioses in ecology and behavior, there are no studies directly or indirectly linking the microbiome to sexual signaling. By taking advantage of a system where sexual signaling and the associated tradeoffs with immunity are being established, a link between these important life history traits with the microbiome may be possible.
Study Species
The brush-legged wolf spider Schizocosa ocreata has been a frequent subject for the study of animal communication, because males utilize multimodal courtship (i.e., visual and vibratory signals), and females must simultaneously process information from multiple sensory modes when assessing potential mates (Uetz 2000; Uetz et al. 2009). The multimodal courtship
6 displays of male S. ocreata are complex, including both a visual component (ornamental foreleg tufts, leg-waving and tapping) and a vibratory component (percussion, stridulation). Both of these modes are capable of eliciting receptivity from females when presented alone (Hebets &
Uetz 1999), but together receive an enhanced response (Uetz et al. 2009). Both visual and vibratory components have been shown to be condition-dependent and to correlate with overall male quality (female S. ocreata prefer males with larger tufts, more vigorous courtship and louder seismic signals - Uetz 2000; Uetz et al. 2002; Gibson and Uetz 2008). Female chemical cues are highly important in the context of mating, where they can provide a male with information about whether or not a female has mated (Roberts and Uetz 2005), what her post-maturity age is (Roberts and Uetz 2005), and female foraging history and hunger status
(Moskalik and Uetz 2011). To date, there has been no evidence to support female evaluation or recognition of male chemical cues, although a thorough investigation using manipulation has not yet been performed.
Dissertation overview
This dissertation adopts a highly integrative approach to answering the questions proposed above. First, I examined the ability of sexual signals to convey male health status by infecting males as an adult, then measuring female receptivity to these infected males as well as the fitness consequences to females that choose to mate with these infected males. Second, I examined the tradeoffs between infection and sexual signaling by infecting males as juveniles
(right before sexual maturity), and investigating the ability of adult males with exposure to a pathogen during a developmentally critical period to successfully mate with a female. I then
7 examined the roles of the vibratory and chemical signaling modalities in infection separately, in order to tease apart the effects of infection on each signal and try to determine which signals might be honest indicators of male health. I then attempted to investigate some of the underlying physiological mechanisms that may be mediating these tradeoffs by examining the effects of infection on the microbiome, which is potentially very important in both developing the immune system and in providing the resources necessary for sexual signaling behaviors.
Lastly, I further attempted to investigate mechanisms of immunity and sexual signaling by examining the changes in gene expression that occur after infection, to see if there are any novel or existing mechanisms of immune response in this species that could be directly related to courtship and sexual signaling. The culmination of this work provides some novel insights into the relationship between multimodal sexual signals, immunity, and physiology that enhance the fields of sexual selection, behavioral ecology, microbiology, and immunology.
8 REFERENCES
Ahtiainen JJ, Alatalo R V, Kortet R, Rantala MJ. 2005. A trade-off between sexual signalling and
immune function in a natural population of the drumming wolf spider Hygrolycosa
rubrofasciata. J. Evol. Biol. 18:985–91.
Ahtiainen JJ. 2004. Sexual advertisement and immune function in an arachnid species
(Lycosidae). Behav. Ecol. 15:602–606.
Andersson M. 1994. No Title. Princeton University Press.
Archie EA, Theis KR. 2011. Animal behaviour meets microbial ecology. Anim. Behav. 82:425–
436.
Badyaev A V., Qvarnström A. 2002. Putting sexual traits into the context of an organism: a life-
history perspective in studies of sexual selection. Auk 119:301.
Balenger SL, Zuk M. 2014. Testing the Hamilton-Zuk Hypothesis: Past, Present, and Future.
Integr. Comp. Biol. 54:601–613.
Bradbury JW, Vehrencamp SL. 2011. Principles of animal communication. Sinauer Associates.
Broderick NA. 2016. Friend, foe or food? Recognition and the role of antimicrobial peptides in
gut immunity and Drosophila–microbe interactions. Philos. Trans. R. Soc. B Biol. Sci.
371:20150295.
Candolin U. 2003. The use of multiple cues in mate choice. Biol. Rev. 78:575–595.
Fedorka KM, Mousseau TA. 2006. Immune system activation affects male sexual signal and
reproductive potential in crickets. Behav. Ecol. 18:231–235.
Folstad I, Karter AJ. 1992. Parasites, Bright Males, and the Immunocompetence Handicap. Am.
Nat. 139:603–622.
9 Freitak D, Wheat CW, Heckel DG, Vogel H. 2007. Immune system responses and fitness costs
associated with consumption of bacteria in larvae of Trichoplusia ni. BMC Biol. 5:56.
Gibson JS, Uetz GW. 2008. Seismic communication and mate choice in wolf spiders:
components of male seismic signals and mating success. Anim. Behav. 75:1253–1262.
Hamilton WD, Zuk M. 1982. Heritable True Fitness and Bright Birds: A Role for Parasites?
Science (80-. ). 218:384–387.
Hawley DM, Altizer SM. 2011. Disease ecology meets ecological immunology: understanding
the links between organismal immunity and infection dynamics in natural populations.
Funct. Ecol. 25:48–60.
Hebets EA, Uetz GW. 1999. Female responses to isolated signals from multimodal male
courtship displays in the wolf spider genus Schizocosa (Araneae: Lycosidae). Anim. Behav.
57:865–872.
Jawor JM, Breitwisch R. 2004. Multiple Ornaments in Male Northern Cardinals , Cardinalis
cardinalis , as Indicators of Condition. Methods 126:113–126.
Kageyama D, Narita S, Watanabe M. 2012. Insect Sex Determination Manipulated by Their
Endosymbionts: Incidences, Mechanisms and Implications. Insects 3:161–199.
Kivleniece I, Krams I, Daukšte J, Krama T, Rantala MJ. 2010. Sexual attractiveness of immune-
challenged male mealworm beetles suggests terminal investment in reproduction. Anim.
Behav. 80:1015–1021.
Lawniczak MKN, Barnes AI, Linklater JR, Boone JM, Wigby S, Chapman T. 2007. Mating and
immunity in invertebrates. Trends Ecol. Evol. 22:48–55.
Lewis Z, Lizé A. 2015. Insect behaviour and the microbiome. Curr. Opin. Insect Sci. 9:86–90.
10 Li W, Dowd SE, Scurlock B, Acosta-Martinez V, Lyte M. 2009. Memory and learning behavior in
mice is temporally associated with diet-induced alterations in gut bacteria. Physiol. Behav.
96:557–567.
McFall-Ngai M, Hadfield MG, Bosch TCG, Carey H V, Domazet-Lošo T, Douglas AE, Dubilier N,
Eberl G, Fukami T, Gilbert SF, et al. 2013. Animals in a bacterial world, a new imperative for
the life sciences. Proc. Natl. Acad. Sci. U. S. A. 110:3229–36.
Milinski M, Bakker TCM. 1990. Female sticklebacks use male coloration in mate choice and
hence avoid parasitized males. Nature 344:330–333.
Miller WJ, Ehrman L, Schneider D, Fogarty M, Mahowald A, Dobzhansky T, Malogolowkin C.
2010. Infectious Speciation Revisited: Impact of Symbiont-Depletion on Female Fitness and
Mating Behavior of Drosophila paulistorum. Parrish C, editor. PLoS Pathog. 6:e1001214.
Moskalik B, Uetz GW. 2011. Experience with chemotactile cues indicating female feeding
history impacts male courtship investment in the wolf spider Schizocosa ocreata. Behav.
Ecol. Sociobiol. 65:2175–2181.
Nentwig W, editor. 2013. Spider Ecophysiology. Berlin, Heidelberg: Springer Berlin Heidelberg.
Paredes JC, Herren JK, Schüpfer F, Lemaitre B. 2016. The role of lipid competition for
endosymbiont-mediated protection against parasitoid wasps in Drosophila. 7.
Peters A, Delhey K, Denk AG, Kempenaers B. 2004. Trade-offs between immune investment and
sexual signaling in male mallards. Am. Nat. 164:51–9.
Ponton F, Wilson K, Holmes AJ, Cotter SC, Raubenheimer D, Simpson SJ. 2013. Integrating
nutrition and immunology: A new frontier. J. Insect Physiol. 59:130–137.
11 Rantala MJ, Jokinen I, Kortet R, Vainikka A, Suhonen J. 2002. Do pheromones reveal male
immunocompetence? Proc. Biol. Sci. 269:1681–5.
Rantala MJ, Kortet R, Kotiaho JS, Vainikka A, Suhonen J. 2003. Condition dependence of
pheromones and immune function in the grain beetle Tenebrio molitor. Funct. Ecol.
17:534–540.
Roberts JA, Uetz GW. 2005. Information content of female chemical signals in the wolf spider,
Schizocosa ocreata: male discrimination of reproductive state and receptivity. Anim.
Behav. 70:217–223.
Rolff J, Siva-Jothy MT. 2003. Invertebrate Ecological Immunology. Science (80-91). 301:472–
475.
Ryder JJ, Siva-Jothy MT. 2000. Male calling song provides a reliable signal of immune function in
a cricket. Proc. Biol. Sci. 267:1171–5.
Shaw, Dana K., et al. "Infection-derived lipids elicit an immune deficiency circuit in arthropods."
Nature Communications 8 (2017).
Simmons L, Zuk M, Rotenberry J. 2005. Immune function reflected in calling song characteristics
in a natural population of the cricket. Anim. Behav. 69:1235–1241.
Uetz GW, Papke R, Kilinc B. 2002. Influence of feeding regime on body size, body condition and
a male secondary sexual character in Schizocosa ocreata wolf spiders (Araneae, Lycosidae):
condition-dependence in a visual signaling trait. J. Arachnol. 30:461–469.
Uetz GW, Roberts JA, Taylor PW. 2009. Multimodal communication and mate choice in wolf
spiders: female response to multimodal versus unimodal signals. Anim. Behav. 78:299–305.
12 Uetz G. 2000. Signals and multi-modal signaling in spider communication. Anim. Signals. Signal.
Signal Des.
Vallet-Gely I, Lemaitre B, Boccard F. 2008. Bacterial strategies to overcome insect defences.
Nat. Rev. Microbiol. 6:302–313.
Ye YH, Woolfit M, Rancès E, O’Neill SL, McGraw EA, Zug R, Hammerstein P, Werren J, Baldo L,
Clark M, et al. 2013. Wolbachia-Associated Bacterial Protection in the Mosquito Aedes
aegypti. Pimenta PF, editor. PLoS Negl. Trop. Dis. 7:e2362.
Zahavi A. 1975. Mate selection—A selection for a handicap. J. Theor. Biol. 53:205–214.
13 CHAPTER 1
Courtship and male ornaments as honest indicators of immune function
Rachel Gilbert, George W. Uetz
This chapter has been published in Animal Behaviour (Gilbert & Uetz 2016)
Department of Biological Sciences, University of Cincinnati, Cincinnati, OH, U.S.A.
Correspondence: R. Gilbert, Department of Biological Sciences, University of Cincinnati, 614
Rieveschl Hall, Cincinnati, OH 45221-0006, U.S.A.
E-mail address: [email protected] (R. Gilbert).
14 ABSTRACT
Having an effective immune system can be very costly, sometimes at the expense of other important life history traits, including reproduction. This trade-off can be exaggerated in males of species that have costly sexual signalling, where condition-dependent components of the signalling system reflect the health status of the bearer. It is therefore vital for a male to be able to adequately balance the costs of activating the immune system successfully while also expressing high-quality sexual signals. We examined males of the brush-legged wolf spider
Schizocosa ocreata to see whether static condition-dependent components of sexual signalling in adult males are indicative of health status (immune stress response, encapsulation) and whether female preference for these traits is influenced by infection. After experimental ingestion of a bacterial pathogen (Pseudomonas aeruginosa), symmetry of male foreleg tuft (a secondary sexual trait) was found to predict the intensity of the subsequent infection, such that males with more asymmetrical tufts had higher levels of bacteria in the haemolymph. Females were equally likely to mate with infected and uninfected males in mating trials, but females that mated with infected males had bacteria in their haemolymph and on their body surface.
Males that engaged in courtship had significantly lower encapsulation responses than males that did not engage in courtship, but among those males that courted, larger tuft size indicated a higher encapsulation response even after energetically costly courtship. These results indicate that females may be able to use static sexual signalling traits to examine a male’s overall health, but females do not appear to discriminate against males who are actively infected, even though there is a direct cost to the female via the transfer of male infection.
15 INTRODUCTION
Organisms across all taxa must cope with assault from a variety of parasites and pathogens.
While it is advantageous for an individual to have a broadly effective immune system, there is often a complex balance between the ability to successfully execute an immune response and simultaneously express costly sexually selected traits, such as male secondary sexual characters. A broad generalization of the immunocompetence handicap hypothesis (ICHH) predicts that only high-quality males will be able to allocate resources to both immune system activation and the development of these condition-dependent traits (Folstad & Karter, 1992;
Simmons, 2011). These types of sexual traits are therefore thought to enforce signalling honesty, since low-quality males cannot withstand the costs of both mounting an immune response and investing resources into sexual signalling (Folstad & Karter, 1992; Grafen, 1990;
Zahavi, 1975). Consequently, females that select males with more exaggerated signalling traits may receive indirect fitness benefits via successful offspring (Sheldon & Vernhulst, 1996;
Westneat & Birkhead, 1998). While there is evidence that females gain indirect fitness benefits by selecting for a trait that indicates heritable immunocompetence (Cotter & Wilson, 2002;
Fellowes et al., 1998; Ryder & Siva-Jothy, 2001), there may also exist direct benefits to the female as well. If a condition-dependent trait is indicative of an individual’s immune capacity, then it could signal a male’s current state of infection, such that a female may be able to avoid an infected male and hence the risk of infection (Able, 1996; Houde & Torio, 1992; Loehle,
1997; Milinski & Bakker, 1990).
Many studies in both vertebrates (Duffy & Ball, 2002; Garvin et al., 2007; Griggio et al.,
2009; López & Martín, 2005; Møller & Petrie, 2002; Mougeot, 2008) and invertebrates
16 (Ahtiainen et al., 2004; Lawniczak et al., 2007; Rantala et al., 2002; Ryder & Siva-Jothy, 2000;
Simmons et al., 2005) have found a positive correlation between sexually selected traits and some aspect of immune function, suggesting that female mate preference may be acting as a selective pressure that influences the ability of males to withstand such trade-offs between sexual signalling and immunity. However, some species have sexual displays that are complex, sometimes consisting of multiple signalling modalities that may each reflect different types of information (Candolin, 2003; Johnstone, 1996; Møller & Pomiankowski, 1993). In some cases, static (fixed) and dynamic traits may correlate with separate aspects of male quality (Møller &
Pomiankowski, 1993). While each signal may convey information on different temporal aspects of male condition, all traits combined should be expected to reflect overall male quality, since females would be receiving a more complete assessment of males rather than just relying on a single trait (Doucet, 2003; Loyau et al., 2005; Martín et al., 2008; Møller & Petrie, 2002).
The brush-legged wolf spider Schizocosa ocreata has a multimodal sexual signalling system, with both visual (foreleg ornaments and leg-tapping displays) and vibratory
(stridulation and percussion) components. Females prefer males with larger foreleg tufts, greater courtship display rates and higher-amplitude vibratory signals. The foreleg ornaments
(tufts of bristles) are fixed at sexual maturity and are indicative of past condition (Uetz et al.,
1996; Uetz et al., 2002; Uetz et al., 2009) whereas behavioural displays (courtship vigour) are more dynamic and prone to fluctuate with current male condition (Gibson & Uetz, 2012). There is also some evidence in S. ocreata that past male condition reflected in these traits may include exposure to parasites and pathogens. Males infected in the laboratory as juveniles had more asymmetrical foreleg tufts at maturity, as well as decreased courtship vigour and lower
17 mating success than control males, indicating that infection is causing some level of developmental stress that results in lower-quality condition-dependent traits (Gilbert et al.,
2016). Additionally, males infected as juveniles had higher encapsulation rates (one measure of immune function) at maturity than control males, suggesting that resources may be allocated away from investment in sexual signals and into immune function (Gilbert et al., 2016).
While these results suggest that there is some type of life history trade-off occurring in at least one condition-dependent modality expressed by this species, it remains to be examined whether infection as an adult has an impact on male signalling quality and effort. Because foreleg tufts are fixed after moulting to sexual maturity, infection as an adult would be expected to affect only the more dynamic components of the signalling system, such as courtship vigour. As a consequence, females may not be able to assess male infection status as accurately, since it is unlikely that active infection (exposure as an adult) would be reflected in fixed traits (i.e. leg tufts). It is currently unknown whether dynamic signalling modalities can potentially indicate to a female that the male signaller is currently infected. In this study, we examined relationship(s) between immunity and multimodal sexual signalling in several ways:
(1) by infecting adult males and looking at the impact of infection on courtship, performance and mating success; (2) by investigating the potential for transfer of infection during copulation to assess the potential fitness consequences of mating with an infected male and (3) by testing whether the expression of an adult indicator trait (foreleg tuft size) is related to immune response (Fig. 1).
18 METHODS
Study Species and Care
All spiders were captured as juveniles from a deciduous leaf litter forest at the
Cincinnati Nature Center (Clermont County, OH, U.S.A.) in August 2014. Spiders were housed individually in opaque deli dish containers on a 13:11 h light:dark cycle, provided access to water ad libitum and fed on a consistent schedule of two to three crickets (Acheta domesticus, approximately 3.2 mm in length) twice per week. Spiders were kept in separate opaque containers except during mating trials. We examined all individuals postmortem for the presence of parasites (nematodes, insect larvae) and excluded infected individuals from our analysis to rule out the possibility of immunosuppression outside of the experimental treatment. All spiders used in the following experiments were 7–12 days postmaturity.
Experimental Infection
Infection methods were modified from Gilbert et al. (2016). One week after moulting to sexual maturity, males were subjected to oral ingestion of the bacterial pathogen Pseudomonas aeruginosa (strain PA-14). This pathogen occurs naturally in the environment in which these spiders are found and has been found in the haemolymph of a few individuals at very low levels
(Gilbert, n.d.). All stocks were kept in Copan Cryovials at -80 °C and grown on Luria broth media
(1.0% Tryptone, 0.5% yeast extract, 1.0% NaCl, 1.5% agar). All plates containing bacteria were cultured daily approximately 18 h prior to use in the experiments and were discarded within 24 h after culturing. Spiders (N=60) were withheld water for 24 h to encourage complete consumption of a 1 μl droplet of sterile water containing 600 colony forming units (CFUs) of
19 bacteria as determined by McFarland turbidity standards (McFarland, 1907). Any spider not observed drinking the full amount of water was dismissed from further experiments. Control groups (N=50 males) were withheld water for 24 h, then given a 1 μl droplet of sterile water only. Following exposure, spiders were returned to a clean housing container and resumed a normal diet and ad libitum access to water.
Mating Trials
We placed infected males (N=20, within 1 h of infection) and control males (N=20) individually into a round plastic arena (diameter: 15.5 cm, height 7.2 cm) lined with filter paper.
After a 2 min acclimation period, we placed a virgin adult female (N=40) in the centre of the arena and allowed each pair 5 min to begin mating. Pairs that did not mate within 5 min were removed from the arenas (N = 8). In cases of successful mating (N=32), copulation was allowed to proceed until natural separation of mating pairs (2–10 h).
Courtship vigour and mating success
All behaviour trials were recorded using a Sony camcorder (model HDV-XR260V) and scored blindly at a later date for male courtship displays (leg waves, leg taps, body bounce) to get an approximation of male courtship vigour (number of courtship displays per second) and overall mating success (Delaney et al., 2007; Kaston, 1936; Montgomery, 1903).
20 Transfer of infection
After allowing mated pairs to separate naturally, we immediately quantified (within 1 min) P. aeruginosa CFUs on the body surface and in the haemolymph of surviving
(noncannibalized) males (N=25 total, 15 infected and 10 control) and females (N=25 total).
Quantification of bacterial presence
To determine levels of P. aeruginosa infection on the body surface and in the haemolymph of treated S. ocreata at the conclusion of the experiment, we anaesthetized the spiders in CO2, then subsequently dipped them in 200 μl of 1X PBS buffer and vortexed them at low power for 60 s. We then removed the spiders and immediately surface-sterilized them by dipping them in both 95% ethanol (EtOH) and a sterilizing solution (5% NaClO, 10% EtOH, 85% sterile DI H2O; Yoder et al., 2003). After allowing 60 s for the spiders to dry, we harvested 3 μl of haemolymph by removing the first and second legs at the coxal joints. We used a capillary tube to transfer the haemolymph into an Eppendorf tube containing 200 μl of sterile 1X PBS buffer. We spread both solutions of buffer (one collected from the body surface and one from the haemolymph) onto an LB plate and allowed it to incubate for 18 h at 35 °C. We counted individual colonies using ImageJ.
Intensity of Infection and Tuft Size and Symmetry
To examine whether male tuft size or symmetry varies with the intensity of infection, we counted the number of CFUs from the haemolymph of adult virgin males 1 h (N=25), 3 h
(N=25) and 5 h (N=25) after oral ingestion of P. aeruginosa (see Quantification of Bacterial
21 Presence). We then assessed the size and symmetry of each male’s tufts postmortem. We measured male tufts using ImageJ. We examined haemolymph of control males (N=25) using the same methods to compare levels of infection between treatment groups.
Courtship, Tuft Size and Encapsulation
We also examined whether energetically costly courtship influences immune responses of uninfected males and whether immune response (encapsulation) is correlated with foreleg tuft size. Males used in this experiment were exposed to female chemical cues only (i.e. silk cues, rather than live females) to reduce variation in the amount of time that each male spent courting. We collected female silk cues by placing a female (2 weeks postmaturity) on filter paper and allowing her to deposit silk for 24 h. We used silk from a different female for each male tested. We allowed males to court for 5 min. Then, 24 h later, we evaluated encapsulation responses of males that courted and males that did not court.
We used the encapsulation response in this experiment as an approximation of immune function (Ahtianen, 2004; Ahtianen et al., 2005). Methods used for measuring encapsulation rate were modified from Ahtiainen et al. (2005). We anaesthetized spiders (N=45) using CO2 and immobilized them by taping them upside down on a glass slide. We used a sterile needle
(Hamilton, 26 gauge) to puncture the underside of the abdomen, through which we introduced a sterile nylon monofilament (Stroft, 0.5 x 0.08 mm) into the body cavity. After 180 min, we dissected out the filament (a lethal process) and digitally imaged it. We measured encapsulation melanization by taking the total greyscale average between 0 and 200 (ImageJ,
National Institutes of Health, Bethesda, MD, U.S.A., http://rsbweb.nih.gov/ij/). Higher greyscale
22 average values indicate lower density of melanization. In the present study, we report the inverse function of these values to make them more intuitive (where higher values reflect higher densities of melanization).
We measured tufts for these same individuals (N = 18 noncourting males, N=10 courting males) by removing both forelegs (postmortem) and using ImageJ to find tuft area (in mm2). We quantified tuft symmetry by taking the absolute value of the left tuft area minus the right tuft area. We expressed tuft size as the average of the area for both tufts. We quantified relative tuft size by scaling to a fixed measure of body size (cephalothorax width).
Ethical Note
Although there are no state or federal regulations (Ohio, U.S.A.) and no institutional requirements (University of Cincinnati) for care and maintenance of our study species, S. ocreata, we made every effort to comply with ASAB/ABS Guidelines for the treatment of animals in behavioural research and teaching. We infected spiders with a proven sublethal dose of Pseudomonas aeruginosa, a common arthropod pathogen, to which they are likely exposed in the wild. We know of no published materials concerning pain or discomfort caused by ingestion and subsequent infection of this pathogen. At the end of the study, spiders were humanely euthanized with CO2 anaesthetization and freezing, then placed in 70% ethanol.
Statistical Analysis
We used a Shapiro–Wilk test for normality on every response variable for the data. All distributions were found to fit a normal distribution with a P value greater than 0.05. We used a
23 Grubb’s outlier test to determine statistical outliers in the data. We then removed outliers from the data set and re-evaluated the data for normality. Outlier removal only occurred for the tuft symmetry test, in which the outliers most likely occurred because tuft dissection in three documented cases involved accidental removal of some bristles, which influenced the results unnecessarily. We used Dunnett’s (1955) post hoc analysis for the haemolymph assays because we performed multiple t tests to compare treatment groups to one control. For encapsulation data, we used the inverse function simply to make the data easier to interpret (higher numbers in the raw data reflected lower encapsulation; thus, we used the inverse to indicate higher values as higher encapsulation).
RESULTS
Male courtship vigour and mating success
For males that were exposed to live females during mating trials, there was no significant difference between control males and infected males in the amount of time taken to successfully copulate with a female (F1,34=-1.129, P=0.266). There was also no statistically significant difference in courtship vigour (t1,34=1.40, P=0.17) or overall mating success ( 21
=0.805, P=0.369; Fig. 2).
Transfer of infection
After natural separation of copulating pairs, there was a significant correlation between total CFUs on the infected male’s body surface and total CFUs on the (previously uninfected) female’s body surface (R2=0.446, F1,10=6.02, P=0.034; Fig. 3a), indicating transfer during
24 copulation. Likewise, significant correlations were found between total CFUs in the male’s haemolymph and total CFUs on the female’s body surface (R2=0.510, F1,14=16.46, P=0.0014;
Fig. 3b) and between total CFUs on the male’s body surface and total CFUs in the female’s haemolymph (R2=0.545, F1,10=12.11, P=0.0059; Fig. 4). There was no significant correlation between number of CFUs transferred and duration of copulation for either female body surface
(F1,14=0.113, P=0.743) or female haemolymph (F1,14=1.206, P=0.3006). No culturable bacteria were seen in any of the control mated pairs, nor in the pairs with treated males where the female was not mounted and had not successfully copulated.
Infection Intensity and Tuft Size and Symmetry
Overall, there was a significant correlation between the number of CFUs in male haemolymph and tuft asymmetry (F1,43=15.224, P=0.0003). Subsequent analyses revealed a significant correlation between tuft asymmetry and CFUs in haemolymph at 1 h (R2=0.694,
F1,13= 29.497, P=0.0001) and 3 h (R2=0.39, F1,13=8.312, P=0.0128) postinfection, but not at 5 h postinfection (R2=0.224, F1,13=3.753, P=0.074; Fig. 5).
Courtship, Tuft Size and Encapsulation
For uninfected males exposed to female silk cues, there was a significant correlation between encapsulation rate and tuft size, such that males with larger tufts had a higher rate of encapsulation (R2=0.219, F1,18=5.073, P=0.037; Fig. 6). In addition, following exposure to female silk cues, males that performed 5 min of courtship had significantly lower encapsulation than males that did not perform courtship (F1,30=4.74, P=0.037; Fig. 7). Among those males
25 that courted, males with larger relative tuft size had significantly higher encapsulation rate than those with smaller relative tuft size (R2=0.365, F1,10=5.193, P=0.0487).
DISCUSSION
The results of this study show that, overall, there is strong evidence that male foreleg tufts may be indicators of a male’s ability to resist pathogenic infection, as well as the ability to cope with the high energetic costs of courtship while still maintaining a higher level of immune function relative to males with smaller foreleg tufts. This supports the idea that static sexual traits can be indicative of different and distinct temporal aspects of male quality and may potentially provide a choosy female with indirect benefits, such as more fit offspring (Ali &
Tallamy, 2010; Head et al., 2005; Hoikkala et al., 1998). Because this experiment required sacrifice of mated females, fecundity and offspring quality and other fitness measures could not be evaluated. Future experiments will involve a more in-depth examination of heritable fitness.
While females choosing a male with larger and more symmetrical tufts may accrue indirect benefits by having more attractive or fit offspring, there are more immediate and direct benefits of female choice. In this study, we found that males with more symmetrical foreleg tufts had a lower intensity of infection after consuming a bacterial pathogen. We also found that males with a higher intensity of infection transferred more bacteria to the body surface and haemolymph of females during copulation. These findings suggest that a female who chooses a male with more symmetrical foreleg tufts could be less susceptible to transmittable diseases or parasites (Able, 1996; Milinski & Bakker, 1990). The transmission of parasites and pathogens during copulation has been shown in some insects (Knell & Webberley, 2004; Mann
26 et al., 2011; Miest & Bloch-Qazi, 2014; Reinhardt et al., 2005; Webberley et al., 2006), but prior to the present study, had not previously been examined in spiders. Transmission during copulation could be occurring through a number of modes, including seminal fluids (Lung et al.,
2001; Otti et al., 2009), surface exposure (Miest & Bloch-Qazi, 2014) or cuticular puncture by males using their fangs to restrain females (Johns et al., 2009). Since the results our experiment only provide sufficient evidence for surface exposure, other potential modes of pathogen transmission remain to be examined in S. ocreata.
Previous studies of S. ocreata have shown that infection at the juvenile stage significantly reduces male tuft symmetry, courtship vigour and overall mating success after sexual maturity (Gilbert et al., n.d.). Males that were exposed to bacterial infection as a juvenile ultimately had higher encapsulation response as adults than males that were not exposed to pathogens, but in this study, infection as an adult did not have an impact on any aspect of mating success. This suggests that the impact of infection on reproduction in males may depend on age or life stage (terminal investment), such that males choose to invest more resources in courtship and mating rather than fighting off infection when exposed to pathogens as an adult, whereas males infected before sexual maturity choose to invest in fighting off infection (and thus surviving to sexual maturity (Jacot et al., 2005; Polak & Starmer 1998).
Because female S. ocreata only mate once (usually within 1–2 weeks postmaturity; Norton &
Uetz, 2005), there could be even higher selection pressure for mature males to invest resources into mating instead of immune activation, since mating opportunities are limited and drop severely as the mating season progresses (Uetz, n.d.).
27 While this study only examined male foreleg tufts and courtship vigour, there are other signalling modalities in this sexual signalling system that may reflect infection status. For example, males in this species have a complex vibratory component, where males use their pedipalps to create a complex and condition-dependent vibration through the leaf litter
(Gibson & Uetz, 2012). The amplitude of this vibratory courtship is correlated with male size
(static) as well as male mass (dynamic), so it is possible that the signal quality may be reduced for infected males and would therefore influence female mate choice for this modality (Gibson
& Uetz, 2008). Future studies should examine the impact of infection on the remaining components of the multimodal sexual signalling system in S. ocreata.
This experiment demonstrates the first evidence of the transmission of pathogenic bacteria during copulation in spiders, as well as compelling evidence that the secondary sexual trait in this species potentially reflects both direct and indirect benefits to females. By discriminating against males whose smaller or more asymmetrical leg tufts may signal lower immunity and lower resistance to parasites, females reduce the chance of infection and/or might pass stronger immune traits on to their offspring. Further work will examine the heritability of these properties as well as further potential fitness consequences to females and offspring.
ACKNOWLEDGMENTS
This research was supported by National Science Foundation grant IOS-1026995 (to
G.W.U.), the University of Cincinnati Sigma Xi Chapter (to R.G.) and the University Research
Council. This research was conducted for the requirements of the Ph.D. program in the
28 Department of Biological Sciences at the University of Cincinnati. We thank the Cincinnati
Nature Center for providing access to their property to collect the spiders used in this project.
Thanks to J. Benoit, B. Stoffer and G. W. Uetz for providing feedback on early drafts of the manuscript. Thanks also to Julie Stacey for assisting with microbiological materials and to C.
Combs for providing research assistance.
29 REFERENCES
Able, D.J. (1996). The contagion indicator hypothesis for parasite-mediated sexual selection.
Proceedings of the National Academy of Sciences of the United States of America, 93(5),
2229–2233. doi:10.1073/pnas.93.5.2229.
Ahtiainen, J.J. (2004). Sexual advertisement and immune function in an arachnid species
(Lycosidae). Behavioral Ecology, 15(4), 602–606. doi:10.1093/beheco/arh062.
Ahtiainen, J.J., Alatalo, R.V, Kortet, R., & Rantala, M.J. (2005). A trade-off between sexual
signalling and immune function in a natural population of the drumming wolf spider
Hygrolycosa rubrofasciata. Journal of Evolutionary Biology, 18(4), 985–991.
doi:10.1111/j.1420-9101.2005.00907.x.
Ali, J.G., & Tallamy, D.W. (2010). Female spotted cucumber beetles use own cuticular
hydrocarbon signature to choose immunocompatible mates. Animal Behaviour, 80, 9–12.
doi:10.1016/j.anbehav.2010.03.014.
Candolin, U. (2003). The use of multiple cues in mate choice. Biological Reviews, 78(4), 575–
595. doi:10.1017/S1464793103006158.
Cotter, S.C., & Wilson, K. (2002). Heritability of immune function in the caterpillar Spodoptera
littoralis. Heredity, 88(4), 229–234. doi:10.1038/sj.hdy.6800031.
Delaney, K.J., Roberts, J.A., & Uetz, G.W. (2007). Male signaling behavior and sexual selection in
a wolf spider (Araneae: Lycosidae): a test for dual functions. Behavioral Ecology and
Sociobiology, 62(1), 67–75. doi:10.1007/s00265-007-0438-7.
30 Doucet, S.M. (2003). Multiple sexual ornaments in satin bowerbirds: ultraviolet plumage and
bowers signal different aspects of male quality. Behavioral Ecology, 14(4), 503–509.
doi:10.1093/beheco/arg035.
Duffy, D.L., & Ball, G.F. (2002). Song predicts immunocompetence in male European starlings
(Sturnus vulgaris). Proceedings of the Royal Society B: Biological Sciences, 269(1493), 847–
852. doi:10.1098/rspb.2002.1956.
Dunnett, C.W. (1955). A multiple comparison procedure for comparing several treatments with
a control. Journal of the American Statistical Association, 50(272), 1096–1121.
Fellowes, M.D.E., Kraaijeveld, A.R., & Godfray, H.C.J. (1998). Trade-off associated with selection
for increased ability to resist parasitoid attack in Drosophila melanogaster. Proceedings of
the Royal Society B: Biological Sciences, 265(1405), 1553–1558. doi:10.1098/rspb.1998.0471.
Folstad, I., & Karter, A.J. (1992). Parasites, bright males, and the immunocompetence handicap.
American Naturalist, 139(3), 603–622.
Garvin, J.C., Dunn, P.O., Whittingham, L.A., Steeber, D.A., & Hasselquist, D. (2007). Do male
ornaments signal immunity in the common yellowthroat? Behavioral Ecology, 19(1), 54–60.
doi:10.1093/beheco/arm099.
Gibson, J.S., & Uetz, G.W. (2008). Seismic communication and mate choice in wolf spiders:
components of male seismic signals and mating success. Animal Behaviour, 75, 1253–1262.
doi:10.1016/j.anbehav.2007.09.026.
Gibson, J.S., & Uetz, G.W. (2012). Effect of rearing environment and food availability on seismic
signalling in male wolf spiders (Araneae: Lycosidae). Animal Behaviour, 84, 85–92.
doi:10.1016/j.anbehav.2012.04.010.
31 Gilbert, R., Karp, R.D., & Uetz, G.W. (2016). Effects of juvenile infection on adult immunity and
secondary sexual characters in a wolf spider. Behavioral Ecology, Advance online publication.
doi:10.1093/beheco/arv241.
Grafen, A. (1990). Biological signals as handicaps. Journal of Theoretical Biology, 144(4), 517–
546. doi:10.1016/S0022-5193(05)80088-8.
Griggio, M., Zanollo, V., & Hoi, H. (2009). UV plumage color is an honest signal of quality in male
budgerigars. Ecological Research, 25(1), 77–82. doi:10.1007/s11284-009-0632-3.
Head, M.L., Hunt, J., Jennions, M.D., & Brooks, R. (2005). The indirect benefits of mating with
attractive males outweigh the direct costs. PLoS Biology, 3(2), e33.
doi:10.1371/journal.pbio.0030033.
Hoikkala, A., Aspi, J., & Suvanto, L. (1998). Male courtship song frequency as an indicator of
male genetic quality in an insect species, Drosophila montana. Proceedings of the Royal
Society B: Biological Sciences, 265(1395), 503–508. doi:10.1098/rspb.1998.0323.
Houde, A.E., & Torio, A.J. (1992). Effect of parasitic infection on male color pattern and female
choice in guppies. Behavioral Ecology, 3(4), 346–351. doi:10.1093/beheco/3.4.346.
Jacot, A., Scheuber, H., Kurtz, J., & Brinkhof, M.W.G. (2005). Juvenile immune system activation
induces a costly upregulation of adult immunity in field crickets Gryllus campestris.
Proceedings of the Royal Society B: Biological Sciences, 272(1558), 63–69.
doi:10.1098/rspb.2004.2919.
Johns, J.L., Roberts, J.A., Clark, D.L., & Uetz, G.W. (2009). Love bites: male fang use during
coercive mating in wolf spiders. Behavioral Ecology and Sociobiology, 64(1), 13–18.
doi:10.1007/s00265-009-0812-8.
32 Johnstone, R.A. (1996). Multiple displays in animal communication: ‘backup signals’ and
‘multiple messages’. Philosophical Transactions of the Royal Society B: Biological Sciences,
351(1337), 329–338. doi:10.1098/rstb.1996.0026.
Kaston, B.J. (1936). The senses involved in the courtship of some vagabond spiders.
Entomologica Americana, 16, 97–166.
Knell, R.J., & Webberley, K.M. (2004). Sexually transmitted diseases of insects: distribution,
evolution, ecology and host behaviour. Biological Reviews, 79(3), 557–581.
doi:10.1017/S1464793103006365.
Lawniczak, M.K.N., Barnes, A.I., Linklater, J.R., Boone, J.M., Wigby, S., & Chapman, T. (2007).
Mating and immunity in invertebrates. Trends in Ecology & Evolution, 22(1), 48–55.
doi:10.1016/j.tree.2006.09.012.
Loehle, C. (1997). The pathogen transmission avoidance theory of sexual selection. Ecological
Modelling, 103(2-3), 231–250. doi:10.1016/S0304-3800(97)00106-3.
López, P., & Martín, J. (2005). Female Iberian wall lizards prefer male scents that signal a better
cell-mediated immune response. Biology Letters, 1(4), 404–406. doi:10.1098/rsbl.2005.0360.
Loyau, A., Saint Jalme, M., Cagniant, C., & Sorci, G. (2005). Multiple sexual advertisements
honestly reflect health status in peacocks (Pavo cristatus). Behavioral Ecology and
Sociobiology, 58(6), 552–557. doi:10.1007/s00265-005-0958-y.
Lung, O., Kuo, L., & Wolfner, M.F. (2001). Drosophila males transfer antibacterial proteins from
their accessory gland and ejaculatory duct to their mates. Journal of Insect Physiology, 47(6),
617–622. doi:10.1016/S0022-1910(00)00151-7.
33 Mann, R.S., Pelz-Stelinski, K., Hermann, S.L., Tiwari, S., & Stelinski, L.L. (2011). Sexual
transmission of a plant pathogenic bacterium, Candidatus liberibacter asiaticus, between
conspecific insect vectors during mating. PLoS One, 6(12), e29197.
doi:10.1371/journal.pone.0029197.
Martín, J., Amo, L., & López, P. (2008). Parasites and health affect multiple sexual signals in
male common wall lizards, Podarcis muralis. Naturwissenschaften, 95(4), 293–300.
doi:10.1007/s00114-007-0328-x.
McFarland, J. (1907). The nephelometer: an instrument for estimating the number of bacteria
in suspensions used for calculating the opsonic index and for vaccines. Journal of the
American Medical Association, 49(14), 1176–1178.
doi:10.1001/jama.1907.25320140022001f.
Miest, T.S., & Bloch-Qazi, M.C. (2014). Sick of mating: sexual transmission of a pathogenic
bacterium in Drosophila melanogaster. Fly, 2(4), 215–219. doi:10.4161/fly.6726.
Milinski, M., & Bakker, T.C.M. (1990). Female sticklebacks use male coloration in mate choice
and hence avoid parasitized males. Nature, 344(6264), 330–333. doi:10.1038/344330a0.
Møller, A.P. (2002). Condition dependence, multiple sexual signals, and immunocompetence in
peacocks. Behavioral Ecology, 13(2), 248–253. doi:10.1093/beheco/13.2.248.
Møller, A.P., & Pomiankowski, A. (1993). Why have birds got multiple sexual ornaments?
Behavioral Ecology and Sociobiology, 32(3), 167–176. doi:10.1007/BF00173774.
Montgomery, T.H. (1903). Studies on the habits of spiders, particularly those of the mating
period. Proceedings of the National Academy of Sciences of Philadelphia, 55, 59–149.
34 Mougeot, F. (2008). Ornamental comb colour predicts T-cell-mediated immunity in male red
grouse Lagopus lagopus scoticus. Naturwissenschaften, 95(2), 125–132. doi:10.1007/s00114-
007-0303-6.
Norton, S., & Uetz, G.W. (2005). Mating frequency in Schizocosa ocreata (Hentz) wolf spiders:
evidence for a mating system with female monandry and male polygyny. Journal of
Arachnology, 33(1), 16–24. doi:10.1636/S02-72.
Otti, O., Naylor, R.A., Siva-Jothy, M.T., & Reinhardt, K. (2009). Bacteriolytic activity in the
ejaculate of an insect. American Naturalist, 174(2), 292–295. doi:10.1086/600099.
Polak, M., & Starmer, W.T. (1998). Parasite-induced risk of mortality elevates reproductive
effort in male Drosophila. Proceedings of the Royal Society B: Biological Sciences, 265(1411),
2197–2201. doi:10.1098/rspb.1998.0559.
Rantala, M.J., Jokinen, I., Kortet, R., Vainikka, A., & Suhonen, J. (2002). Do pheromones reveal
male immunocompetence? Proceedings of the Royal Society B: Biological Sciences,
269(1501), 1681–1685. doi:10.1098/rspb.2002.2056.
Reinhardt, K., Naylor, R.A., & Siva-Jothy, M.T. (2005). Potential sexual transmission of
environmental microbes in a traumatically inseminating insect. Ecological Entomology, 30(5),
607–611. doi:10.1111/j.0307-6946.2005.00730.x.
Ryder, J.J., & Siva-Jothy, M.T. (2000). Male calling song provides a reliable signal of immune
function in a cricket. Proceedings of the Royal Society B: Biological Sciences, 267(1449),
1171–1175. doi:10.1098/rspb.2000.1125.
35 Ryder, J.J., & Siva-Jothy, M.T. (2001). Quantitative genetics of immune function and body size in
the house cricket, Acheta domesticus. Journal of Evolutionary Biology, 14(4), 646–653.
doi:10.1046/j.1420-9101.2001.00302.x.
Sheldon, B.C., & Verhulst, S. (1996). Ecological immunology: costly parasite defences and trade-
offs in evolutionary ecology. Trends in Ecology & Evolution, 11(8), 317–321.
doi:10.1016/0169-5347(96)10039-2.
Simmons, L.W. (2011). Resource allocation trade-off between sperm quality and immunity in
the field cricket, Teleogryllus oceanicus. Behavioral Ecology, 23(1), 168–173.
doi:10.1093/beheco/arr170.
Simmons, L., Zuk, M., & Rotenberry, J. (2005). Immune function reflected in calling song
characteristics in a natural population of the cricket. Animal Behaviour, 69, 1235–1241.
doi:10.1016/j.anbehav.2004.09.011.
Uetz, G.W., McClintock, W.J., Miller, D., Smith, E.I., & Cook, K.K. (1996). Limb regeneration and
subsequent asymmetry in a male secondary sexual character influences sexual selection in
wolf spiders. Behavioral Ecology and Sociobiology, 38(4), 253–257.
doi:10.1007/s002650050240.
Uetz, G.W., Papke, R., & Kilinc, B. (2002). Influence of feeding regime on body size, body
condition and a male secondary sexual character in Schizocosa ocreata wolf spiders
(Araneae, Lycosidae): condition-dependence in a visual signaling trait. Journal of
Arachnology, 30(3), 461–469. doi:10.1636/0161-8202(2002)030[0461:IOFROB]2.0.CO;2.
36 Uetz, G.W., Roberts, J.A., Wrinn, K.M., Polak, M., & Cameron, G.N. (2009). Impact of a
catastrophic natural disturbance on fluctuating asymmetry (FA) in a wolf spider. Ecoscience,
16(3), 379–386. doi:10.2980/16-3-3261.
Webberley, K.M., Buszko, J., Isham, V., & Hurst, G.D.D. (2006). Sexually transmitted disease
epidemics in a natural insect population. Journal of Animal Ecology, 75(1), 33–43.
doi:10.1111/j.1365-2656.2005.01020.x.
Westneat, D.F., & Birkhead, T.R. (1998). Alternative hypotheses linking the immune system and
mate choice for good genes. Proceedings of the Royal Society B: Biological Sciences,
265(1401), 1065–1073. doi:10.1098/rspb.1998.0400.
Yoder, J.A., Hanson, P.E., Zettler, L.W., Benoit, J.B., Ghisays, F., & Piskin, K.A. (2003). Internal
and external mycoflora of the American dog tick, Dermacentor variabilis (Acari: Ixodidae),
and its ecological implications. Applied and Environmental Microbiology, 69(8), 4994–4996.
doi:10.1128/AEM.69.8.4994-4996.2003.
Zahavi, A. (1975). Mate selection: a selection for a handicap. Journal of Theoretical Biology,
53(1), 205–214.
Figure 1. Visual representation of the methods used for all experiments. Top box represents
initial sample sizes; bottom boxes represent actual sample sizes of spiders that survived to
be included in statistical analysis. Spiders were also removed from experiments if they were
found to have parasites. CFU: colony forming units.
37 Figure 1. Visual representation of the methods used for all experiments. Top box represents initial sample sizes; bottom boxes represent actual sample sizes of spiders that survived to be included in statistical analysis. Spiders were also removed from experiments if they were found to have parasites. CFU: colony forming units.
38 Figure 2. Overall percentage of successful mating attempts by control and infected males.
39 Figure 3. (a) Number of colony forming units (CFUs) found on the body surface of uninfected females after copulation compared to the number on the male’s body surface. (b) Number of
CFUs found on the female’s body surface postcopulation compared to the total CFUs found in infected male haemolymph.
40 Figure 4. Number of colony forming units (CFUs) found in female haemolymph after copulation compared to CFUs found on the infected male’s body surface.
41 Figure 5. Number of colony forming units (CFUs) found in circulating haemolymph of adult male
S. ocreata compared to tuft asymmetry. Separate lines indicate samples grouped by the time the bacteria were measured (latency postinfection).
42 Figure 6. Encapsulation rate of males relative to average male foreleg tuft size. The inverse relationship of greyscale density was used to make the relationship clearer.
43 Figure 7. Encapsulation rates of males that courted for 5 min when exposed to female silk cues
(no female present) and of males that did not court in response to female silk cues.
44 CHAPTER 2
Effects of juvenile infection on adult immunity and secondary sexual characters in a wolf spider
Rachel Gilbert, Richard D. Karp, George W. Uetz
This chapter has been published in Behavioral Ecology (Gilbert et al. 2016)
Department of Biological Sciences, University of Cincinnati, Cincinnati, OH, U.S.A.
Correspondence: R. Gilbert, Department of Biological Sciences, University of Cincinnati, 614
Rieveschl Hall, Cincinnati, OH 45221-0006, U.S.A.
E-mail address: [email protected] (R. Gilbert).
45 ABSTRACT
The immunocompetence handicap hypothesis postulates that higher-quality males may be able to balance potential conflicts between resource-demanding activities, such as courtship behavior and immune responses, whereas lower-quality males suffer from immuno- suppression or lower reproductive output. In this study, we examined the immune response of the brush-legged wolf spider Schizocosa ocreata to infection with pathogenic bacteria as juveniles (penultimate), and its impact on development of adult male secondary sexual signaling traits. After oral ingestion of a bacterial pathogen, active bacteria were found in the hemolymph for up to 5 h. We found that immune activation (ingestion of bacteria) at the juvenile stage resulted in higher immune response as an adult than control individuals, but also led to lower body condition index values and a higher degree of asymmetry in secondary sexual signaling traits (foreleg tufts). Infected males also had relatively smaller tufts than control males when penultimate body condition was added as a covariate and tuft size was appropriately scaled. Additionally, males infected as juveniles had significantly lower mating success than control males, although this difference was not due to courtship vigor. These results suggest that during development, juvenile males may be allocating more resources into immune function during infection, potentially at the cost of reduced sexual signaling and mating success as adults, and that there is the potential for complex trade-offs between immunity and sexual signaling in this species.
46 INTRODUCTION
Organisms from a wide variety of taxa must cope with infections from parasites and pathogens.
Mounting an immune response can be costly for both vertebrate and invertebrate species
(Lochmiller and Deerenberg 2000; Norris and Evans 2000; Freitak et al. 2003), and consequently may result in trade-offs with other important, but resource-demanding life-history traits such as development (Brommer 2004; Bascuñán-García et al. 2010) and reproduction (Sheldon and
Verhulst 1996; Adamo et al. 2001; Schwartz and Koella 2004). The relationship between infection and sexual signaling has been of significant research interest in recent years and has become an important concept in the study of sexual selection (Andersson 1994; Møller et al.
1999; Andersson and Simmons 2006; Lawniczak et al. 2007).
The information contained in male sexual signaling displays has been long debated, but it has been proposed that they may allow a female to indirectly ascertain a male’s immunocompetence via sexual signaling components that also correlate with aspects of a male’s immune capacity (Ahtiainen 2004; Loyau et al. 2005; Tregenza et al. 2006). This is based on the assumption that only a high-quality male would be able to bear the burden of developing elaborate secondary sexual signaling traits or performing energetically costly displays while presumably suffering little to no cost to their resistance to parasites and pathogens (Zahavi 1975; Folstad and Karter 1992). Although it is unlikely that females are selecting for immunocompetence directly, it is possible that by selecting for males in better condition, females are creating a selection pressure for higher-quality males that are better able to balance both immunity and condition-dependent sexual signaling (Adamo and Spiteri
2005, 2009). This could be especially important in populations that have to balance constant
47 exposure to pathogens and parasites with developing resource-costly secondary sexual signaling traits, which have been shown to reflect previous exposure to immune challenge as well as a male’s current health status (Hamilton and Zuk 1982; Folstad and Karter 1992).
Because males of many animal species do not possess secondary sexual signaling traits until they reach sexual maturity, the development of these traits often occurs in late juvenile stages in many invertebrates (Birkhead et al. 1999; Moczek and Nijhout 2004; Fry 2006). Immune activation at these critical developmental stages can influence adult phenotype in many ways, including stunted growth and altered fecundity (Krist and Lively 1998). Juvenile exposure to immune stress has also been shown to have a negative impact on sexual signaling traits in some arthropod species (Jacot et al. 2005; Fedorka and Mousseau 2006), but to date, there are no studies examining these trade-offs in spiders.
Spiders have an understudied but unique immune system that differs markedly from that of insects (reviewed in Nentwig 2013), increasing the need for experimental investigation of the potential for a relationship between immune function and sexual signaling traits. It has been demonstrated in a wolf spider (genus: Hygrolycosa) that courtship can reduce a male’s ability to mount an immune response (Ahtiainen 2004) and that more attractive males have more robust immune function (Ahtiainen et al. 2006), suggesting that the evolution of their complex mating behaviors could potentially be influenced by an immunocompetence handicap.
However, to our knowledge, there are no studies that examine how juvenile pathogen exposure is related to adult immune function and sexual signaling in spiders.
48 The brush-legged wolf spider Schizocosa ocreata is an ideal study species for research in the field of ecoimmunology. They live in a deciduous leaf litter environment that provides ample opportunities for exposure to parasites and pathogens, and are often parasitized as juveniles and adults by nematodes (family: Mermithidae) as well as Diptera (Acroceridae) and
Hymenoptera (Ichneumonidae) (Cady et al. 1993; Uetz GW, unpublished data). In addition to living in a habitat that requires a broadly effective immune system, this species utilizes multimodal sexual signaling, which has been shown to be energetically costly to the male (Cady et al. 2011). Male fore-leg tufts, a conspicuous secondary sexual signaling trait, are influenced by foraging success (Uetz et al. 2002), stress or injury during development (Uetz et al. 1996), and developmental instability (Uetz et al. 2009). Male leg tufts and courtship vigor have all been shown to influence female mate choice (Delaney et al. 2007; Uetz and Norton 2007;
Gibson and Uetz 2008). Taken together, it is possible that the evolution and persistence of such traits could be due in part to a handicap-driven hypothesis such as the immunocompetence handicap hypothesis (ICHH). In this study, males of this species were exposed to experimental immune stress in the laboratory and measured at sexual maturity for changes in body condition, tuft quality, and immune function. Differences in adult male courtship behavior and mating success were also recorded. Under the ICHH, we predicted that infection at the juvenile stage would result in smaller and more asymmetrical tufts, as well as a decrease in court-ship vigor and mating success due to the allocation of resources away from reproduction and mating and instead investing more into immune activities.
49 METHODS AND MATERIALS
Study species/care
Males and females were captured as juveniles from deciduous leaf litter at the Cincinnati
Nature Center (Clermont County, OH). All spiders used in studies were captured from the field in March 2014 with the exception of the encapsulation experiment, where males collected from
August 2013 and March 2014 were pooled together due to low sample sizes. Spiders were housed individually in deli dish containers on a 13:11 light:dark cycle, were provided water ad libitum, and were fed 2 crickets (Acheta domesticus, approximately 1/8” in length) twice per week. Information on parasitism, maturity dates, and mortality was tracked for every individual used in this study. All individuals used in the study were examined postmortem for the presence of internal parasites and were removed from analysis if they were found to be parasitized. Juvenile males were chosen from the population on molting to the penultimate stage, where they can be identified by having slightly enlarged pedipalps when compared with females and other juvenile spiders. Juvenile male individuals were assigned randomly to treatment groups, and all analyses were performed blind.
Measurement of body condition and secondary sexual signaling traits
All spiders used in experiments had live mass recorded (Radwag AS-220 Balance) and were digitally imaged for measurements of cephalothorax and abdomen width (ImageJ). In all cases of experimental infection, measurements were taken both at the penultimate stage and as adults. The forelegs containing the tufts were removed postmortem and digitally imaged
(ImageJ) for later analysis of both tuft size (area in square millimeter) and symmetry (|Left-
50 Right tuft| or |L-R|). Analyses of fluctuating asymmetry (FA) were conducted from 3 replicated measures of each leg tuft as recommended by Swaddle et al. (1994) and Palmer and Strobeck
(2003) as in Uetz et al. (2009).
We assessed overall body condition at both the penultimate stage (24 h before experimental infection) and adulthood (24 h following the molt to sexual maturity), using a body condition index (BCI) calculated as the residual from a regression of mass against a cephalothorax width
(Jakob et al. 1996). Within this analysis, we used an analysis of covariance (ANCOVA) with treatment as the main factor and mass and cephalothorax width as covariates to assess condition at adulthood in order to test for differences between BCI across treatment groups
(Garcia-Berthou 2001).
Experimental infection
Spiders were exposed to a bacterial pathogen 2 weeks after molting to the penultimate stage of maturity (Pseudomonas aeruginosa, strain PA14, donated by the Ausubel Lab at Harvard
University). This is a species of bacteria that has been found in the same environment as these spiders, as well as actively circulating in the hemolymph at concentrations between 0 and 200 colony forming unit (CFU) per spider in a small number of individuals (Gilbert R, unpublished data). All bacteria stocks were kept in Copan Cryovials at −80 °C, which maintains pathogenicity and viability of stocks for several years by freezing bacteria in a cryopreservation medium
(consisting of sucrose, glycerol, phosphate-buffered saline, and peptone). Fresh cultures of bacteria were grown from this stock as needed on Luria broth (LB) plates (1.0% tryptone, 0.5%
51 yeast extract, 1.0% NaCl, and 1.5% agar) within 24 h prior to use for experimental infection methods to ensure pathogenicity and to reduce the potential for decrease of CFUs.
Spiders (N = 100) were infected by ingestion of a 1 µL droplet of sterile water containing approximately 600 CFU as determined by McFarland turbidity standards. In order to encourage rapid ingestion of the solution, spiders had water withheld for 24 h prior to exposure. The solution was administered using a pipette, and any spider not observed drinking the full amount of solution was dis-missed from the experiment. A control group of males (N = 100) was withheld water for 24 h, then given a 1 µL droplet of sterile water only. One hour following exposure, spiders were returned to their containers with access to water and a consistent feeding schedule (Figure 1a).
Encapsulation measurement
Methods for measuring encapsulation rate were modified from Ahtiainen et al. (2005).
All encapsulation experiments were per-formed 1 week after the final molt to sexual maturity.
Males were used from 2 different collection seasons in order to increase low sample sizes
(juvenile infected: NAugust = 7, NMarch = 9; control: NAugust = 11, NMarch = 10). Spiders were anesthetized with CO2 and fixed upside down to a glass slide using clear tape. A puncture was made into the underside of the abdomen using a sterilized needle (Hamilton, 26 gauge). A nylon monofilament (Stroft, 0.5 × 0.08 mm2) was inserted through the puncture completely so that the wound was allowed to close completely, preventing further hemolymph loss. After a
180-min period, the filament was dissected out and digitally imaged. Encapsulation melanization was measured by taking the total gray scale average of the filament from 3
52 different angles on a scale of 0–200 (ImageJ). Because this method is lethal, spiders that were evaluated for encapsulation response were not able to be used further in other experiments.
Measuring duration and intensity of infection (hemolymph assay)
A subset of spiders (N = 75) was used to confirm the above infection techniques and to determine the rate at which bacteria ingested orally were able to bypass the gut epithelium and enter the circulating hemolymph. After experimental infection (1-, 3-, 5-, and 7-h increments), hemolymph was collected with a micropipette by anesthetizing the spider with CO2 and removing the 1st and 2nd legs at the coxal joint. Cross-contamination was controlled for by dipping spiders in both 95% ethanol (EtOH) and a sterilizing solution (5% NaClO, 10% EtOH, 85%
DI H2O; Yoder et al. 2003) prior to harvesting hemolymph. In a microcentrifuge tube, 5 µL of hemolymph was added to 10 µL sterile 1× phosphate-buffered saline and transferred to LB plate in order to assess the number of subsequent CFUs contained in the hemolymph sample
(Figure 1b).
Male courtship behavior and mating success
One week after reaching sexual maturity, one male (N = 50) was placed into a plastic arena
(diameter: 15.5 cm, height 7.2 cm) lined with filter paper. After a 2-min acclimation period, a naive adult female (2-week postmaturity) was placed into the arena. Male and female pairs were given 10 total minutes after introduction of the female to court and mate/cannibalize/not mate. Filter paper was replaced in between trials, and females were only used once. All trials were recorded using a Sony camcorder (model HDV-XR260V) and analyzed at a later date for
53 male courtship behaviors: total number of courtship displays (leg waves, leg taps, body bounce), courtship vigor (total displays per second), and overall mating success.
Statistical analysis
A Shapiro–Wilk test for normality was used on every response variable for the data, and the data were transformed appropriately for tuft symmetry analysis and the hemolymph assay analysis to fit normality assumptions. After these 2 transformations, all distributions were found to fit a normal distribution with a P value greater than 0.05. A Grubb’s outlier test was used to determine if any data were considered statistical outliers for every response variable, and these data were removed appropriately. Outlier removal only occurred for the tuft symmetry test, in which the outliers only most likely occurred because tuft dissection in 3 documented cases involved the accidental removal of some bristles, therefore influencing the results unnecessarily. A t-test was used to test for statistical significance between infected and control groups for tuft size and symmetry analysis, mass and cephalothorax width analysis, encapsulation rate analysis, and courtship behavior analysis. An ANCOVA was used to analyze
BCI. Dunnett’s method post hoc analysis was used for the hemolymph assay because multiple t- tests were being performed to compare treatment groups with one control.
RESULTS
Body condition at sexual maturity
Males that were given 600 CFU of P. aeruginosa 2 weeks after reaching the penultimate stage of maturity had significantly lower body mass at adulthood than males who were only
54 given sterile water as a control (t27 = 2.11, P = 0.044; Figure 2a). Additionally, males who were infected at the juvenile stage gained significantly less mass than control males when measured as adults (t27 = 4.86, P < 0.0001). Although adult cephalothorax width was not significantly different between the infected and control males (t27 = 0.45, P = 0.654; Figure 2b), we found that males infected as juveniles had a significantly lower BCI as adults than control males (t31 =
3.25, P = 0.002; Figure 2c). The length of the penultimate instar duration was not significantly different between control and infected groups (t27 = 1.49, P = 0.146). Mortality was not significantly different between the control and infected treatment groups (χ2 = 2.221, P =
0.136).
Encapsulation response
Males that were subjected to oral ingestion of 600 CFU of P. aeruginosa at the juvenile stage were found to have significantly higher encapsulation rate as adults than control males
(t45 = −4.231, P < 0.0001; Figure 3). Collection season (August or March) was not a significant factor when added to the model to test for season effects (F2,47 = 1.345, P = 0.440).
Foreleg tuft size and symmetry
Two outliers were removed from tuft size analysis, and 3 outliers were removed from the tuft asymmetry analysis as determined by Grubb’s outlier test. Remaining data were log transformed in order to conform to normality standards as tested by a Shapiro–Wilk statistical test prior to analysis. Tuft size was not significantly different between infected and uninfected males (t38 = 1.37; P = 0.177). However, males infected at the juvenile stage had a significantly
55 higher degree of FA in the size of foreleg tufts than did control males (t38 = 2.94; P = 0.0056;
Figure 4a). A regression of adult tuft size against juvenile BCI revealed that tuft size at adulthood show significant differences between treatment groups; when juvenile (penultimate) body condition is added as a covariate and tuft size subsequently scaled, uninfected males had significantly larger relative tuft size (t46 = −3.03, P = 0.0041; Figure 4b). This ANCOVA also revealed that penultimate body condition is correlated with average tuft size within both infected and uninfected males (t46 = 3.75, P = 0.0005). The overall model for this ANCOVA showed significant differences based on treatment (F2,46 = 8.042, P = 0.0011; Table 1).
Male courtship behavior and mating success
There was no significant difference between juvenile infected and control groups for total number of courtship displays (t30 = 0.301, P = 0.617) or courtship vigor (t38 = 1.86, P =
0.0726). Juvenile infected males had significantly lower overall mating success (38.5% success) than control males (78.9% success) (χ2 = 5.46, P = 0.019).
Intensity and duration of infection
Following oral ingestion of 600 CFU of P. aeruginosa, males were found to have significant amounts of bacteria in the hemolymph for up to 5 h (F71,4 = 19.512, P < 0.0001;
Figure 5). After post hoc analysis using Dunnett’s method, the group measured at 7-h postinfection was not found to have any bacteria in the hemolymph when compared with the control group that had just received sterile water (P = 0.75).
56 DISCUSSION
Results of our experimental studies show that exposure to a bacterial pathogen in the juvenile stage of male S. ocreata negatively influences the development and expression of secondary sexual signaling traits and mating success as an adult. These results are consistent with another study in an insect species, the field cricket Gryllus campestris, where males challenged at the juvenile stage with lipopolysaccharide (LPS) had smaller secondary sexual signaling traits, even though there was no significant effect on body size (Jacot et al. 2005). It has been shown in other insect species that these trade-offs in sexual trait development and immune activation may be due in part to the immunosuppressive effects of juvenile hormone
(JH), a common arthropod hormone (Rantala et al. 2003). The role of JH in the development of sexual signaling has not been examined in spiders, but it is possible that there is a similar hormone-mediated trade-off when juvenile males are immune challenged during development.
Octopamine, another common arthropod hormone that displays some immunosuppressive effects (reviewed in Adamo 2008), has been implicated as a predictor of male mating tactics in another spider species (Hebets et al. 2015), and should therefore not be ruled out as a possible mediator of immune-based trade-offs with sexual signaling in this species.
In wolf spiders, a previous study found a relationship between immune responses and courtship vigor (i.e., courtship can significantly reduce a male’s immune response), but only for males infected as adults (Ahtiainen 2004; Ahtiainen et al. 2006). In contrast, our results suggest that juvenile exposure could be critical to fitness by impacting adult signaling traits and potentially other aspects of courtship not previously measured. In S. ocreata, previous studies have shown that tuft size (McClintock and Uetz 1996; Uetz 2000; Persons and Uetz 2005), tuft
57 symmetry (Uetz et al. 1996; Uetz and Smith 1999), as well as vibratory signal amplitude and frequency (Gibson and Uetz 2008) are the 2 signaling components that best predict mating success in a live mating context. In the current study, males infected as juveniles have significantly smaller and more asymmetrical tufts than control males, but a direct link to mating success was not demonstrated because tuft measurements and mating success were recorded from separate individuals.
Many studies use bacterial derivatives such as LPS to elicit an immune response by injecting the endotoxin directly into the hemolymph (as in Jacot et al. 2005), which induces a strong immune response within both the cavity epithelial tissue and the fat bodies of the organism (Schmid-Hempel 2005; Siva-Jothy et al. 2005; Lemaitre and Hoffmann 2007).
However, oral ingestion is the more likely natural route of exposure in foraging insects
(Vodovar et al. 2005; Liehl et al. 2006), and may be especially true in the case of spiders, which have external digestion. This route of transmission can cause an immune reaction not only in the hemolymph, but also induces a localized immune response in the epithelial gut tissue (Tzou et al. 2000; Buchon et al. 2009). Little is known about immune systems of spiders, and there is nothing to date published concerning localized infections. The handful of studies concerning immunology have shown that some spiders have antimicrobial peptides (AMPs) specific to
Gram-positive bacteria (Baumann, Kämpfer, et al. 2010), Gram-negative bacteria (Lorenzini et al. 2003; Baumann, Kämpfer, et al. 2010), and fungi (Lorenzini et al. 2003; Fukuzawa et al. 2008;
Riciluca et al. 2012), and that these AMPs are expressed mainly in the hemocytes, although potentially in small amounts in subesophageal nerve mass (Baumann, Kuhn-Nentwig, et al.
2010). The presence or absence of these various AMPs varies across orders within class
58 Arachnida, and is not very well characterized for a majority of spider species (Nentwig 2013). It is therefore unclear in this study whether there is a localized immune response occurring in the gut tissue or if an immune response is being triggered by the migration of hemocytes to active bacteria in the hemolymph (Fukuzawa et al. 2008).
Based on results in the hemolymph assay (Figure 5), males were found to have up to
291 CFU of active bacteria in 3 µL of hemolymph, much lower than the initial ingested dose of
600 CFU/1 µL, suggesting that there is potentially some type of physical or immunological barrier preventing the crossing of ingested pathogens into the hemolymph. In Drosophila melanogaster, there is evidence of a chitinous physical barrier in the gut called the peritrophic matrix, which protects the organism from damage caused by reactive oxygen species and antioxidants produced by ingested pathogenic bacteria (Kuraishi et al. 2011). There could be a similar mechanism in the spider gut, but this remains to be studied in more detail. There is also the potential for persistent infections in the gut caused by the tendency of some Pseudomonas species to form a biofilm on ingestion, causing a prolonged immune response and, therefore, potentially an exaggerated detriment to resources available for development (Liehl et al. 2006;
Freitak et al. 2007). There is a critical need for investigation of tissue-specific immune responses in spiders, potentially taking advantage of the accessibility of tissue-specific RNA sequencing that would allow for characterization of expression patterns of immune genes in the gut tissue following ingestion of a pathogen (Tzou et al. 2000; Freitak et al. 2007).
Interestingly, this study showed that adult males that were exposed to bacterial ingestion as a juvenile showed stronger encapsulation response when measured as an adult when compared with males who received no bacterial challenge as a juvenile. If immune
59 activation as a juvenile truly depletes resources available for development, then it would be possible for the male to subsequently invest more in optimizing immune defenses than sexual signaling. It has been shown in insect species that immune challenge at the juvenile stage can decrease investment in reproductive activities (Fedorka and Mousseau 2006; McNamara et al.
2013), but no studies in insects or other arthropods have shown that it also has the potential to increase adult immune function. Although encapsulation was found to be significantly higher in adults when infected as juveniles, this is only a single measure of immune response, and this trend should not be assumed for all other types of immune responses (such as AMP activity).
Recent literature has suggested that all arachnid immune components are expressed constitutively (not induced) and are located centrally in the hemocytes, which may complicate the application of known immunological measures typically used in insects to spiders, such as lytic activity (measurement of AMP activity), because these compounds may not be differentially expressed before and after infection (Bechsgaard et al. 2015). Future studies in spiders should examine the efficacy of multiple measures of immunity, including the validation of previously established methods.
Although it seems that the results of this study suggest that females are likely assessing visual cues and not courtship behavior itself as a potential mode of mate selection, this does not rule out the possibility of some other type of signal to be affected by infection. For example, males of this species also have a complex substrate-coupled vibratory component of courtship, which has been shown to be condition dependent (Gibson and Uetz 2012). As vibratory signal amplitude is correlated with male size and mass (Gibson and Uetz 2008), juvenile infection has the potential to affect this modality since there is a reduction in adult
60 mass when males are infected as juveniles. Additionally, cuticular hydrocarbons have been shown to play a role in recognition and as a sex pheromone in both insects (Ferveur 2005;
Howard and Blomquist 2005; Everaerts et al. 2010; Thomas 2011) and spiders (Riechert and
Singer 1995; Prouvost et al. 1999; Schiestl et al. 2000; Grinsted et al. 2011), and the chemical composition of these compounds in insects can change after infection (Lecuona et al. 1991;
Salvy et al. 2001; Pedrini et al. 2007). In S. ocreata, female chemical cues contain information about species specificity (Roberts and Uetz 2004), mating status (Roberts and Uetz 2005), and feeding history (Moskalik and Uetz 2011). However, there is a lack of information so far about the relevance of male chemical cues in this species and whether infection could potentially modulate female mate choice decisions as a result of exposure to a pathogen. Future studies should take into account multiple modalities of sexual signaling, examining each in detail to determine how each is influenced by infection at both the juvenile and adult stages.
Nevertheless, this study opens up a novel avenue of research in the field of ecological immunology and sexual signaling using S. ocreata as a study species.
This study has demonstrated that there are clear trade-offs between infection, immune function, and adult male secondary sexual signaling traits, but the precise mechanisms by which these trade-offs occur are not as apparent. Because the physiological mechanisms underlying both immunity and sexual signaling activities in spiders remain relatively unknown, finding a direct link between the two will require extensive further research before making assumptions about this complex relationship. Because the knowledge we do have about spider immunology is limited to what can be gleaned from comparative studies of Limulus and insects, more
61 comprehensive experimental manipulations will be needed to disentangle these complex trade- offs.
ACKNOWLEDGEMENTS
This research was supported by National Science Foundation grant IOS-1026995 (to
G.W.U.), and the University of Cincinnati Sigma Xi Chapter (R.G.) and University Research
Council. This research was conducted as part of the requirements for the PhD in Biological
Sciences from the University of Cincinnati. We thank the Cincinnati Nature Center for permitting us to collect spiders on their Rowe Woods property. Thanks to J. Stacey for assistance with items related to microbiology, to G.W.U., B. Stoffer, and J. Benoit for providing feedback on early drafts of this manuscript, and to K. Surharski and other students in the Uetz lab for various assistance.
62 REFERENCES
Adamo SA. 2004. How should behavioural ecologists interpret measurements of immunity?
Anim Behav. 68:1443–1449.
Adamo SA. 2008. Norepinephrine and octopamine: linking stress and immune function across
phyla. Invert Surviv J. 5:12–19.
Adamo SA, Jensen M, Younger M. 2001. Changes in lifetime immunocompetence in male and
female Gryllus texensis (formerly G. integer): trade-offs between immunity and
reproduction. Anim Behav. 62:417–425.
Adamo SA, Spiteri RJ. 2005. Female choice for male immunocompetence: when is it worth it?
Behav Ecol. 16:871–879.
Adamo SA, Spiteri RJ. 2009. He’s healthy, but will he survive the plague? Possible constraints on
mate choice for disease resistance. Anim Behav. 77:67–78.
Ahtiainen JJ. 2004. Sexual advertisement and immune function in an arachnid species
(Lycosidae). Behav Ecol. 15:602–606.
Ahtiainen JJ, Alatalo RV, Kortet R, Rantala MJ. 2005. A trade-off between sexual signalling and
immune function in a natural population of the drumming wolf spider Hygrolycosa
rubrofasciata. J Evol Biol. 18:985–991.
Ahtiainen JJ, Alatalo RV, Kortet R, Rantala MJ. 2006. Immune function, dominance and mating
success in drumming male wolf spiders Hygrolycosa rubrofasciata. Behav Ecol Sociobiol.
60:826–832.
Andersson MB. 1994. Sexual selection. Princeton (NJ): Princeton University Press.
63 Andersson M, Simmons LW. 2006. Sexual selection and mate choice. Trends Ecol Evol. 21:296–
302.
Bascuñán-García AP, Lara C, Córdoba-Aguilar A. 2010. Immune investment impairs growth,
female reproduction and survival in the house cricket, Acheta domesticus. J Insect Physiol.
56:204–211.
Baumann T, Kämpfer U, Schürch S, Schaller J, Largiadèr C, Nentwig W, Kuhn-Nentwig L. 2010.
Ctenidins: antimicrobial glycine-rich peptides from the hemocytes of the spider Cupiennius
salei. Cell Mol Life Sci. 67:2787–2798.
Baumann T, Kuhn-Nentwig L, Largiadèr CR, Nentwig W. 2010. Expression of defensins in non-
infected araneomorph spiders. Cell Mol Life Sci. 67:2643–2651.
Bechsgaard J, Vanthournout B, Funch P, Vestbo S, Gibbs RA, Richards S, Sanggaard KW, Enghild
JJ, Bilde T. 2015. Comparative genomic study of arachnid immune systems indicates loss of β
GRPs and the IMD pathway. J. Evol. Biol.
Birkhead TR, Fletcher F, Pellatt EJ. 1999. Nestling diet, secondary sexual traits and fitness in the
zebra finch. Proc Biol Sci. 266:385–390.
Brommer JE. 2004. Immunocompetence and its costs during development: an experimental
study in blue tit nestlings. Proc Biol Sci. 271(Suppl 3):S110–S113.
Buchon N, Broderick NA, Poidevin M, Pradervand S, Lemaitre B. 2009. Drosophila intestinal
response to bacterial infection: activation of host defense and stem cell proliferation. Cell
Host Microbe. 5:200–211.
64 Cady AB, Delaney KJ, Uetz GW. 2011. Contrasting energetic costs of courtship signaling in two
wolf spiders having divergent courtship behaviors. J. Arachnol. 39:161–165.
Cady A, Leech R, Sorkin L, Stratton G, Caldwell M. 1993. Acrocerid (Insecta:Diptera) life
histories, behaviors, host spiders (Arachnida:Araneida), and distribution records. Can
Entomol. 125:931–944.
Delaney KJ, Roberts JA, Uetz GW. 2007. Male signaling behavior and sexual selection in a wolf
spider (Araneae: Lycosidae): a test for dual func-tions. Behav Ecol Sociobiol. 62:67–75.
Everaerts C, Farine JP, Cobb M, Ferveur JF. 2010. Drosophila cuticular hydrocarbons revisited:
mating status alters cuticular profiles. PLoS One. 5:e9607.
Fedorka KM, Mousseau TA. 2006. Immune system activation affects male sexual signal and
reproductive potential in crickets. Behav Ecol. 18:231–235.
Ferveur JF. 2005. Cuticular hydrocarbons: their evolution and roles in Drosophila pheromonal
communication. Behav Genet. 35:279–295.
Folstad I, Karter AJ. 1992. Parasites, bright males, and the immunocompetence handicap. Am
Nat. 139:603–622.
Freitak D, Ots I, Vanatoa A, Hõrak P. 2003. Immune response is energetically costly in white
cabbage butterfly pupae. Proc Biol Sci. 270(Suppl 2):S220–S222.
Freitak D, Wheat CW, Heckel DG, Vogel H. 2007. Immune system responses and fitness costs
associated with consumption of bacteria in larvae of Trichoplusia ni. BMC Biol. 5:56.
Fry CL. 2006. Juvenile hormone mediates a trade-off between primary and secondary sexual
traits in stalk-eyed flies. Evol Dev. 8:191–201.
65 Fukuzawa AH, Vellutini BC, Lorenzini DM, Silva PI Jr, Mortara RA, da Silva JM, Daffre S. 2008.
The role of hemocytes in the immunity of the spider Acanthoscurria gomesiana. Dev Comp
Immunol. 32:716–725.
Garcia-Berthou E. 2001. On the misuse of residuals in ecology: test-ing regression residuals vs.
the analysis of covariance. J Anim Ecol. 70:708–711.
Gibson JS, Uetz GW. 2008. Seismic communication and mate choice in wolf spiders:
components of male seismic signals and mating success. Anim Behav. 75:1253–1262.
Gibson JS, Uetz GW. 2012. Effect of rearing environment and food avail-ability on seismic
signalling in male wolf spiders (Araneae: Lycosidae). Anim Behav. 84:85–92.
Grinsted L, Bilde T, d’Ettorre P. 2011. Cuticular hydrocarbons as potential kin recognition cues
in a subsocial spider. Behav Ecol. 22:1187–1194.
Hamilton WD, Zuk M. 1982. Heritable true fitness and bright birds: a role for parasites? Science.
218:384–387.
Hebets EA, Hansen M, Jones TC, Wilgers DJ. 2015. Octopamine levels relate to male mating
tactic expression in the wolf spider Rabidosa punctulata. Anim Behav. 100:136–142.
Howard RW, Blomquist GJ. 2005. Ecological, behavioral, and biochemical aspects of insect
hydrocarbons. Annu Rev Entomol. 50:371–393.
Jacot A, Scheuber H, Kurtz J, Brinkhof MW. 2005. Juvenile immune status affects the expression
of a sexually selected trait in field crickets. J Evol Biol. 18:1060–1068.
Jakob EM, Marshall SD, Uetz GW. 1996. Estimating fitness: a comparison of body condition
indices. Oikos. 77:61–67.
66 Krist AC, Lively CM. 1998. Experimental exposure of juvenile snails (Potamopyrgus
antipodarum) to infection by trematode larvae (Microphallus sp.): infectivity, fecundity
compensation and growth. Oecologia. 116:575–582.
Kuraishi T, Binggeli O, Opota O, Buchon N, Lemaitre B. 2011. Genetic evidence for a protective
role of the peritrophic matrix against intestinal bacterial infection in Drosophila
melanogaster. Proc Natl Acad Sci USA. 108:15966–15971.
Lawniczak MK, Barnes AI, Linklater JR, Boone JM, Wigby S, Chapman T. 2007. Mating and
immunity in invertebrates. Trends Ecol Evol. 22:48–55.
Lecuona R, Riba G, Cassier P, Clement JL. 1991. Alterations of insect epi-cuticular hydrocarbons
during infection with Beauveria bassiana or B. brongniartii. J Invertebr Pathol. 58:10–18.
Lemaitre B, Hoffmann J. 2007. The host defense of Drosophila melanogaster. Annu Rev
Immunol. 25:697–743.
Liehl P, Blight M, Vodovar N, Boccard F, Lemaitre B. 2006. Prevalence of local immune response
against oral infection in a Drosophila/Pseudomonas infection model. PLoS Pathog. 2:e56.
Lochmiller RL, Deerenberg C. 2000. Trade-offs in evolutionary immunology: just what is the cost
of immunity? Oikos. 88:87–98.
Lorenzini DM, da Silva PI Jr, Fogaça AC, Bulet P, Daffre S. 2003. Acanthoscurrin: a novel glycine-
rich antimicrobial peptide constitutively expressed in the hemocytes of the spider
Acanthoscurria gomesiana. Dev Comp Immunol. 27:781–791.
Loyau A, Saint Jalme M, Cagniant C, Sorci G. 2005. Multiple sexual advertisements honestly
reflect health status in peacocks (Pavo cristatus). Behav Ecol Sociobiol. 58:552–557.
67 McClintock WJ, Uetz GW. 1996. Female choice and preexisiting bias: visual cues during
courtship in two Schizocosa wolf spiders (Araneae: Lycosidae). Anim Behav. 52:167–181.
McNamara KB, van Lieshout E, Jones TM, Simmons LW. 2013. Age-dependent trade-offs
between immunity and male, but not female, reproduction. J Anim Ecol. 82:235–244.
Moczek AP, Nijhout HF. 2004. Trade-offs during the development of primary and secondary
sexual traits in a horned beetle. Am Nat. 163:184–191.
Møller AP, Christe P, Lux E. 1999. Parasitism, host immune function, and sexual selection. Q Rev
Biol. 74:3–20.
Moskalik B, Uetz GW. 2011. Experience with chemotactile cues indicating female feeding
history impacts male courtship investment in the wolf spider Schizocosa ocreata. Behav Ecol
Sociobiol. 65:2175–2181.
Nentwig W, editor. 2013. Spider ecophysiology. Berlin (Germany): Springer Berlin Heidelberg.
Norris K, Evans MR. 2000. Ecological immunology: life history trade-offs and immune defense in
birds. Behav Ecol. 11:19–26.
Palmer AR, Strobeck C. 2003. Fluctuating asymmetry analyses revisited. In: Polak M, editor.
Developmental instability: causes and consequences. Oxford: Oxford University Press. p.
279–319.
Pedrini N, Crespo R, Juárez MP. 2007. Biochemistry of insect epicuticle degradation by
entomopathogenic fungi. Comp Biochem Physiol C Toxicol Pharmacol. 146:124–137.
Persons MH, Uetz GW. 2005. Sexual cannibalism and mate choice decisions in wolf spiders:
influence of male size and secondary sexual characters. Anim Behav. 69:83–94.
68 Prouvost O, Trabalon M, Papke M, Schulz S. 1999. Contact sex signals on web and cuticle of
Tegenaria atrica (Araneae, Agelenidae). Arch Insect Biochem Physiol. 40:194–202.
Rantala MJ, Vainikka A, Kortet R. 2003. The role of juvenile hormone in immune function and
pheromone production trade-offs: a test of the immunocompetence handicap principle. Proc
Biol Sci. 270:2257–2261.
Riciluca KCT, Sayegh RSR, Melo RL, Silva PI. 2012. Rondonin an anti-fungal peptide from spider
(Acanthoscurria rondoniae) haemolymph. Results Immunol. 2:66–71.
Riechert SE, Singer FD. 1995. Investigation of potential male mate choice in a monogamous
spider. Anim Behav. 49:715–723.
Roberts JA, Uetz GW. 2004. Chemical signaling in a wolf spider: a test of ethospecies
discrimination. J Chem Ecol. 30:1271–1284.
Roberts JA, Uetz GW. 2005. Information content of female chemical signals in the wolf spider,
Schizocosa ocreata: male discrimination of reproductive state and receptivity. Anim Behav.
70:217–223.
Salvy M, Martin C, Bagnères AG, Provost E, Roux M, Le Conte Y, Clément JL. 2001. Modifications
of the cuticular hydrocarbon profile of Apis mellifera worker bees in the presence of the
ectoparasitic mite Varroa jacobsoni in brood cells. Parasitology. 122:145–159.
Schiestl FP, Ayasse M, Paulus HF, Löfstedt C, Hansson BS, Ibarra F, Francke W. 2000. Sex
pheromone mimicry in the early spider orchid (Ophrys sphegodes): patterns of hydrocarbons
as the key mechanism for pollination by sexual deception. J Comp Physiol A. 186:567–574.
Schmid-Hempel P. 2005. Evolutionary ecology of insect immune defenses. Annu Rev Entomol.
50:529–551.
69 Schwartz A, Koella JC. 2004. The cost of immunity in the yellow fever mosquito, Aedes aegypti
depends on immune activation. J Evol Biol. 17:834–840.
Sheldon BC, Verhulst S. 1996. Ecological immunology: costly para-site defences and trade-offs
in evolutionary ecology. Trends Ecol Evol. 11:317–321.
Siva-Jothy MT, Moret Y, Rolff J. 2005. Advances in insect physiology. Vol. 32. San Diego (CA):
Elsevier Academic Press Inc.
Swaddle JP, Witter MS, Cuthill IC. 1994. The analysis of fluctuating asymmetry. Anim Behav.
48:986–989.
Thomas ML. 2011. Detection of female mating status using chemical signals and cues. Biol Rev
Camb Philos Soc. 86:1–13.
Tregenza T, Simmons LW, Wedell N, Zuk M. 2006. Female preference for male courtship song
and its role as a signal of immune function and condition. Anim Behav. 72:809–818.
Tzou P, Ohresser S, Ferrandon D, Capovilla M, Reichhart JM, Lemaitre B, Hoffmann JA, Imler JL.
2000. Tissue-specific inducible expression of antimicrobial peptide genes in Drosophila
surface epithelia. Immunity. 13:737–748.
Uetz GW. 2000. Signals and multi-modal signalling in spider communica-tion. In: Espmark Y,
Amundsen T, Rosenqvist G, editors. Animal signals. Signalling and signal design in animal
communication. Proceedings of Fifth International Kongsvoll Symposium. Trondheim
(Norway): Tapir Publishers. p. 387–405.
Uetz GW, McClintock WJ, Miller D, Smith EI, Cook KK. 1996. Limb regener-ation and subsequent
asymmetry in a male secondary sexual character influences sexual selection in wolf spiders.
Behav Ecol Sociobiol. 38:253–257.
70 Uetz GW, Norton S. 2007. Preference for male traits in female wolf spiders varies with the
choice of available males, female age and reproductive state. Behav Ecol Sociobiol. 61:631–
641.
Uetz GW, Papke R, Kilinc B. 2002. Influence of feeding regime on body size, body condition and
a male secondary sexual character in Schizocosa ocreata wolf spiders (Araneae, Lycosidae):
condition-dependence in a visual signaling trait. J Arachnol. 30:461–469.
Uetz GW, Roberts JA, Wrinn KM, Polak M, Cameron GN. 2009. Impact of a catastrophic natural
disturbance on fluctuating asymmetry (FA) in a wolf spider. Ecoscience. 16:379–386.
Uetz GW, Smith EI. 1999. Asymmetry in a visual signaling character and sexual selection in a
wolf spider. Behav Ecol Sociobiol. 45:87–93.
Vodovar N, Vinals M, Liehl P, Basset A, Degrouard J, Spellman P, Boccard F, Lemaitre B. 2005.
Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species.
Proc Natl Acad Sci USA. 102:11414–11419.
Yoder JA, Hanson PE, Zettler LW, Benoit JB, Ghisays F, Piskin KA. 2003. Internal and external
mycoflora of the American dog tick, Dermacentor variabilis (Acari: Ixodidae), and its
ecological implications. Appl Environ Microbiol. 69:4994–4996.
Zahavi A. 1975. Mate selection—a selection for a handicap. J Theor Biol. 53:205–214.
71 Figure 1. (a) Experimental design of all spiders assigned to a treatment at the juvenile stage and allowed to survive to sexual maturity. (b) All spiders assigned to a treatment at the juvenile stage and used for hemolymph assays.
72 Figure 2. Mass at sexual maturity and (b) cephalothorax width of males infected with 600 CFU of Pseudomonas aeruginosa at the juvenile stage versus those that received only sterile water as a control. (c) BCI at sexual maturity for males infected at the juvenile stage vs. control males.
Error bars represent ±1 standard error.
73 Figure 3. (a) Density of melanization, reflecting immune function at sexual maturity for males infected with 600 CFU of Pseudomonas aeruginosa at the juvenile stage versus control males.
Gray scale values of the encapsulated filament were transformed to make the relationship clearer. Error bars represent ± 1 standard error. (b) Nylon monofilaments dissected from abdomen of control male (left) and juvenile infected male (right).
74 Figure 4. (a) FA of leg tuft area (in square millimeter) for males subjected to infection at the juvenile stage versus control males. FA was measured as the absolute value |L-R|. Error bars represent ± 1 standard error. (b) Regression of average adult tuft size (in square millimeter) against penultimate (juvenile) body condition, grouped by treatment. Red markers and line represent males infected with 600 CFU at the penultimate stage; blue markers and line represent control males.
75 Table 1. ANCOVA analysis of average tuft size by treatment group, adding penultimate body condition as a covariate.
76 Figure 5. Number of Pseudomonas aeruginosa CFU found in the hemolymph of males at various time increments post-infection. Asterisks indicate statistical significance from the control group.
Error bars represent ± 1 standard error.
77 CHAPTER 3
Male chemical cues as reliable indicators of infection in the wolf spider Schizocosa ocreata
Rachel Gilbert and George W. Uetz
This chapter has been submitted to Behavioral Ecology and Sociobiology.
Department of Biological Sciences, University of Cincinnati, Cincinnati, OH, U.S.A.
Correspondence: R. Gilbert, Department of Biological Sciences, University of Cincinnati, 614
Rieveschl Hall, Cincinnati, OH 45221-0006, U.S.A.
E-mail address: [email protected] (R. Gilbert).
ORCID: 0000-0002-1380-8012
78 ABSTRACT
Sexual signals can convey important information about mate quality, and can also transmit critical information to the receiver about a signaler’s health status, helping an individual to avoid infected or immunocompromised conspecifics. Chemical signals are especially important in this context, because they represent an honest and dynamic signaling modality that receivers can use to make updated mate choice decisions to avoid compromising their own health. In this study, we investigated the viability of male chemical cues in the wolf spider Schizocosa ocreata as a reliable indicator of health status. Using video playback associated with male cuticular compounds, we show that females are more receptive to videos paired with cues from control males rather than infected males. We also show that these cuticular compounds can be isolated and retain similar female behavioral responses when extracted with a nonpolar solvent, suggesting that these cuticular compounds may be complex hydrocarbons. This is the first evidence for female discrimination and recognition of male chemical cues in this species, which opens up important new avenues of research in a well-studied species with complex multimodal signaling.
79 INTRODUCTION
Chemical signals are widely used in a variety of animal taxa for communication, often in the context of sexual selection. While there have been numerous studies examining the role of chemical signals in mate choice (reviewed in Johansson and Jones 2007), less is known about the types of information that these honest signals convey about signalers. Chemical signals have been shown to reflect information about health status and immune function in both vertebrates (Penn and Potts 1998, Reusch et al. 2001, Zala et al. 2004, López et al. 2006) and invertebrates (Rantala et al. 2003, Ali and Tallamy 2010, Richard et al. 2012). This is potentially very important because females can become infected by mating with a male that is infected with a parasite or pathogen (Milinski and Bakker 1990, Scheffer 1992; Gilbert and Uetz 2016).
By being able to avoid coming into contact with infected conspecifics, individuals can behaviorally reduce their risk of infection (Kiesecker et al. 1999, Richard et al. 2012).
However, there are very few studies that have examined the reliability of chemical signals in mating systems with multimodal sexual communication, where different signaling modalities may convey contrasting information about a male’s current health status. In the wolf spider Schizocosa ocreata, research has demonstrated that female chemical cues can provide important information to males, such as whether or not a female has mated (Roberts and Uetz
2005), what her post-maturity age is (Roberts and Uetz 2005), and female foraging history
(Moskalik and Uetz 2011). Despite the importance of chemical signals in this species and in many other spiders, the relevance of chemical cues in the context of infection and immunity has not yet been evaluated.
80 Previous research has shown that male foreleg tufts, a secondary sexual trait, are predictors of both male immune function and the intensity with which a male is infected after being exposed to a bacterial pathogen. However, foreleg tufts are fixed at sexual maturity, and will not fluctuate with male health status if infected after sexual maturity. While these static traits do correlate positively with male immune function as an adult and therefore may predict a male’s ability to fight off an infection, they are not direct indicators of whether or not a male is actually infected (Gilbert et al. 2016, Gilbert and Uetz 2016). A more dynamic trait, such as chemical cues, may be a more reliable cue for females to gather information about a male’s current health status, because they can potentially change rapidly to more accurately convey current male condition.
In this study, we seek to understand whether females can ascertain a male’s health status through chemical signals by isolating cuticle-based compounds and testing female mate preference. Because females do not display receptivity to male chemical signals alone, we paired these isolated compounds with video playback of a courting male, and tested female mate preference between identical videos, each with infected or uninfected male cues present.
Females should be expected to avoid chemical cues from infected males, and instead display receptivity to videos associated with control (healthy) male chemical signals.
METHODS
Study species care
Spiders were collected as subadults from deciduous leaf litter at the Cincinnati Nature Center
(Clermont County, OH, USA). Spiders were housed individually in opaque deli dish containers on
81 a 13:11h light:dark cycle, given access to water ad libitum, and fed on a schedule of 2-3 crickets
(Gryllodes sigillatus) twice per week. All individuals were examined postmortem for the presence of parasites (nematodes, Diptera and Hymenoptera larvae) and infected individuals were excluded from analysis in order to minimize the effects of infection not related to the experiment.
Experimental Infection
Infection methods were modified from Gilbert et al. (2016). One week after molting to sexual maturity, males were infected with the bacterial pathogen Pseudomonas aeruginosa strain PA-
14. This pathogen has been used successfully in previous studies to elicit an immune response
(Gilbert et al. 2016, Gilbert and Uetz 2016), and has been found in individuals that were sequenced using 16s rRNA primers (Gilbert, unpublished data). Stocks were kept at -80 C in
Copan Cryovials and grown 18 hours before experiments on Luria broth media (1.0% Tryptone,
0.5% yeast extract, 1.0% NaCl, 1.5% agar). In order to encourage oral consumption of a 1 l droplet of sterile water containing 600 colony forming units of the pathogen, males were withheld water for 24 hours before infection. Control males were withheld water for 24 hours, then given a droplet of sterile water. Any spider that did not consume the full amount of water was dismissed from further experiments. All spiders were returned to clean containers, and resumed a normal diet of water and feeding.
82 Video playback trials
In order to investigate whether females could discriminate between chemical cues from infected and uninfected males, circular plastic arenas (30 cm in diameter) with two iPod touch units placed on opposing sides were used as a 2-choice design (Figure 1). An 8cm by 18cm strip of filter paper containing male chemical cues was placed in front of each iPod Touch unit (4th edition) playing a video of a courting male of average size and vigor on a gray background
(Roberts et al. 2006). This stimulus has been used in previous studies to elicit female receptivity, and represents a male with body size and courtship vigor of the population mean
(Roberts et al. 2007, Moskalik and Uetz 2011, Stoffer and Uetz 2015). The arena was cleaned with 70% ethanol between each trial in order to remove any remaining chemical cues, and the placement of filter paper on either side of the arena was randomized.
Collection of chemical cues
Three days after infection treatment, males were placed on filter paper and allowed to freely wander for 12 hours before being removed and placed back in their container. This filter paper was then cut into strips and used within 2 hours for all trials. Because these 12 hour experiments could introduce unintentional sources of chemical compounds (feces, etc), we ran the same experimental setup using cuticular extracts. In order to extract cuticular compounds 3 days after infection, CO2-anesthetized males were placed in 1mL of solvent for 10 minutes.
Because cuticular compounds in wolf spiders have not been characterized, both polar
(Methanol, HPLC grade, Fisher Chemical 67-56-1) and nonpolar (Pentane, HPLC grade, Fisher
Chemical 109-66-0) solvents were used to extract cuticular cues. After mixing the samples
83 briefly using a vortexer, males were discarded, and 500µl of solution was pipetted evenly across filter paper. Paper was allowed to dry for 10 minutes before use in female preference trials, ensuring that all solvent had evaporated, leaving only cuticular compounds on the filter paper at the time of female contact.
Silk counting experiment
In order to ensure that we were evaluating cuticular chemical compounds and not potential confounding chemicals from silk-based cues, a separate group of infected (N=15) and control
(N=14) males were allowed to walk around on filter paper containing a grid with 766 2mm x
2mm sub-squares (Sweger et al. 2010). After allowing the male to wander freely on grid for 24 hours, filter paper was analyzed for both total silk strands present and the total number of sub- squares containing silk.
Statistical analysis
In the video playback experiments, each female was analyzed for time spent on each type of filter paper treatment, total number of receptivity displays (settle, tandem leg extend, slow turn), and the proportion of receptivity to videos associated with each type of chemical treatment using two-tailed T-tests for unequal variances and Pearson’s chi-square tests, respectively (Stratton and Uetz 1981, 1983, McClintock and Uetz 1996, Scheffer et al. 1996).
Because male silk counts were very zero-inflated, both the total number of silk strands and the total number of boxes containing silk were log transformed such that the reported data are
Log(N+0.5) for both. All data were analyzed using JMP Pro 12 (12.1.0, SAS).
84 RESULTS
Video playback trials – male contact
In experiments where males were allowed to walk around on filter paper for 24 hours, females were more receptive overall to the video associated with control male contact than the video with infected male contact (Fig. 2a; c2=20.45, P<0.0001). Females also showed a greater number of receptivity displays to the video associated with control male contact (Fig. 2b; t53=4.324, P<0.0001) and also spent significantly more time on filter paper with control male contact than infected male contact (Fig. 2c; t64=4.583, P<0.0001). In experiments where two different uninfected control males were allowed to contact filter paper on either side of the arena, there was no difference in overall female receptivity (c2=1.33, P=0.248), time associated
(t45=0.34, P=0.735), or total receptivity displays (t45=0.822, P=0.414).
Video playback trials – cuticular compound extracts
For experiments where male cuticular compounds were extracted with pentane (nonpolar), females showed overall greater receptivity (c2=11.11, P=0.0009) and more receptivity displays
(t26=-3.642, P=0.0012) to the video associated with control male cuticular compounds compared to infected male cuticular compounds, but there was no difference in the time spent associated with filter paper that contained control or infected cues (t34=-1.138, P=0.262). When cuticular compounds were extracted with methanol (polar), there was no significant difference
2 in overall female receptivity (c =2.263, P=0.1325), total receptivity displays (t43=-0.857,
P=0.3957), or time associated (t43=0.021, P=0.983) (Figure 3).
85 Silk Counting
After letting males freely walk on a grid for 24 hours, just 50% of all males had laid at least one strand of silk. There was no significant difference in the number of males across treatments that produced silk (c2=0.013, P=0.908), no difference in the total number of silk strands present on the grid (t27=-0.109, P=0.913) or in the total number of grid boxes that contained silk (t27=-
0.106, P=0.9163).
DISCUSSION
This is the first time that a study of S. ocreata has provided evidence for the relevance of male chemical cues in any context. Interestingly, previous data suggests that females are not able to discriminate between male chemical signals, female chemical signals, or a blank stimulus when given a choice (Orton 2010, unpublished M.S. Thesis data). However, this study suggests that male chemical cues may be relevant in the context of infection or perhaps social context (i.e. giving females a choice between two males of varying quality or health statuses), paving the way for future studies of the newfound relevance of male chemical signals in this well-studied species.
Much research in this species has focused on the importance of male visual signals (Uetz et al. 1996, Uetz et al. 2002, Uetz et al. 2009, Gilbert et al. 2016) and vibratory signals (Taylor et al. 2006, Gibson and Uetz 2012). However, results of this study suggest that females are also able to detect a male’s current health status via cuticle-based chemical compounds, and are less likely to show receptivity to a male that has recently consumed a bacterial pathogen. This is particularly interesting given that in live mating trials, females do not discriminate against males
86 who are infected with the same pathogen at the same dose (Gilbert and Uetz 2016). This could be because females may evaluate sexual signals differently, and can possibly gather important information about male quality from one signaling modality that outweighs information within another signaling modality. It could also be due to the fact that males follow females with vigorous vibratory and visual courtship so closely that they may not be able to sufficiently process information in chemical signals while also processing that in other signaling modalities simultaneously, which may cause a sensory overload (Candolin 2003, Hebets and Papaj 2005).
The current study isolated chemical cues from males, allowing females ample time to make a mate choice decision based on infection-induced changes in chemical cues.
While this study did not seek to investigate the differences in the chemical compounds themselves, the results of this study suggest that male cuticular hydrocarbons (CHC) may be playing a role in female mate preference in this system, at least in the context of infection and immunity. Work in other arthropods has shown that infection and bacterial composition can modify CHC profile (Lecuona et al. 1991, Zurek et al. 2002, Sharon et al. 2010), but no studies to date have found a direct link between modification of CHCs by pathogenic infection and changes in mate preference or sexual behavior. Future research should therefore focus on elucidating the specific mechanisms that may be responsible for the behavioral evidence showing that females avoid male cuticular cues by assessing CHCs using chemical analyses.
87 REFERENCES
Ali JG, Tallamy DW. 2010. Female spotted cucumber beetles use own cuticular hydrocarbon
signature to choose immunocompatible mates. Anim. Behav. 80:9–12.
Candolin U. 2003. The use of multiple cues in mate choice. Biol. Rev. 78:575–595.
Delaney KJ, Roberts JA, Uetz GW. 2007. Male signaling behavior and sexual selection in a wolf
spider (Araneae: Lycosidae): a test for dual functions. Behav. Ecol. Sociobiol. 62:67–75.
Gilbert R, Karp RD, Uetz GW. 2016 Jan 26. Effects of juvenile infection on adult immunity and
secondary sexual characters in a wolf spider. Behav. Ecol.:arv241.
Gilbert R, Uetz GW. 2016. Courtship and male ornaments as honest indicators of immune
function. Anim. Behav. 117:97–103.
Hebets EA, Papaj DR. 2005. Complex signal function: developing a framework of testable
hypotheses. Behav. Ecol. Sociobiol. 57:197–214.
Johansson BG, Jones TM. 2007. The role of chemical communication in mate choice. Biol. Rev.
82:265–289.
Kiesecker JM, Skelly DK, Beard KH, Preisser E. 1999. Behavioral reduction of infection risk. Proc.
Natl. Acad. Sci. U. S. A. 96:9165–8.
Lecuona R, Riba G, Cassier P, Clement JL. 1991. Alterations of insect epicuticular hydrocarbons
during infection with Beauveria bassiana or B. brongniartii. J. Invertebr. Pathol. 58:10–18.
López P, Amo L, Martín J. 2006. Reliable Signaling By Chemical Cues Of Male Traits And Health
State In Male Lizards, Lacerta monticola. J. Chem. Ecol. 32:473–488.
McClintock WiJ, Uetz G, W. 1996. Female choice and pre-existing bias: visual cues during
courtship in two Schizocosa wolf spiders (Araneae: Lycosidae). Anim. Behav. 52:167–181.
88 Milinski M, Bakker TCM. 1990. Female sticklebacks use male coloration in mate choice and
hence avoid parasitized males. Nature 344:330–333.
Moskalik B, Uetz GW. 2011. Experience with chemotactile cues indicating female feeding
history impacts male courtship investment in the wolf spider Schizocosa ocreata. Behav.
Ecol. Sociobiol. 65:2175–2181.
Penn D, Potts WK. 1998. Untrained mice discriminate MHC-determined odors. Physiol. Behav.
64:235–243.
Rantala MJ, Kortet R, Kotiaho JS, Vainikka A, Suhonen J. 2003. Condition dependence of
pheromones and immune function in the grain beetle Tenebrio molitor. Funct. Ecol.
17:534–540.
Reusch TBH, Häberli MA, Aeschlimann PB, Milinski M. 2001. Female sticklebacks count alleles in
a strategy of sexual selection explaining MHC polymorphism. Nature 414:300–302.
Richard F-J, Holt HL, Grozinger CM. 2012. Effects of immunostimulation on social behavior,
chemical communication and genome-wide gene expression in honey bee workers (Apis
mellifera). BMC Genomics 13:558.
Roberts JA, Taylor PW, Uetz GW. 2006. Consequences of complex signaling: predator detection
of multimodal cues. Behav. Ecol. 18:236–240.
Roberts JA, Uetz GW. 2005. Information content of female chemical signals in the wolf spider,
Schizocosa ocreata: male discrimination of reproductive state and receptivity. Anim. Behav.
70:217–223.
89 Roberts JA, Uetz GW. 2005. Information content of female chemical signals in the wolf spider,
Schizocosa ocreata: male discrimination of reproductive state and receptivity. Anim. Behav.
70:217–223.
Scheffer SJ 1992. Transfer of a larval mantispid during copulation of Its spider host. Insect
Behav. 5: 797-800.
Scheffer SJ, Uetz GW, Stratton GE. 1996. Sexual selection, male morphology, and the efficacy of
courtship signalling in two wolf spiders (Araneae: Lycosidae). Behav. Ecol. Sociobiol. 38:17–
23.
Sharon G, Segal D, Ringo JM, Hefetz A, Zilber-Rosenberg I, Rosenberg E. 2010. Commensal
bacteria play a role in mating preference of Drosophila melanogaster. Proc. Natl. Acad. Sci.
U. S. A. 107:20051–6.
Stoffer B, Uetz GW. 2015. The effects of social experience with varying male availability on
female mate preferences in a wolf spider. Behav. Ecol. Sociobiol. 69:927–937.
Stratton GE, Uetz GW. 1983. Communication via substratum-coupled stridulation and
reproductive isolation in wolf spiders (Araneae: Lycosidae). Anim. Behav. 31:164–172.
Stratton GE, Uetz GW. 1981. Acoustic Communication and Reproductive Isolation in Two
Species of Wolf Spiders. Science 214:80-92.
Sweger AL, Marr M, Satteson A, Rypstra AL, Persons MH. 2010. The effects of predation risk on
female silk deposition and male response to predator-cued conspecifics in the wolf spider,
Pardosa milvina (Araneae: Lycosidae). J. Arachnol. 38:393–397.
Taylor PW, Roberts JA, Uetz GW. 2006. Mating in the absence of visual cues by Schizocosa
ocreata (Hentz 1844) wolf spiders (Araneae, Lycosidae). J. Arachnol. 34:501–505.
90 Uetz GW, McClintock WJ, Miller D, Smith EI, Cook KK. 1996. Limb regeneration and subsequent
asymmetry in a male secondary sexual character influences sexual selection in wolf spiders.
Behav. Ecol. Sociobiol. 38:253–257.
Uetz GW, Papke R, Kilinc B. 2002. Influence of feeding regime on body size, body condition and
a male secondary sexual character in Schizocosa ocreata wolf spiders (Araneae, Lycosidae):
condition-dependence in a visual signaling trait. J. Arachnol. 30:461–469.
Uetz GW, Roberts JA, Wrinn KM, Polak M, Cameron GN. 2009. Impact of a Catastrophic Natural
Disturbance on Fluctuating Asymmetry (FA) in a Wolf Spider. Ecoscience 16:379–386.
Zala SM, Potts WK, Penn DJ. 2004. Scent-marking displays provide honest signals of health and
infection. Behav. Ecol. 15:338–344.
Zurek L, Wes Watson D, Krasnoff SB, Schal C. 2002. Effect of the entomopathogenic fungus,
Entomophthora muscae (Zygomycetes: Entomophthoraceae), on sex pheromone and other
cuticular hydrocarbons of the house fly, Musca domestica. J. Invertebr. Pathol. 80:171–176.
91 Figure 1. Arena for testing female preference of male chemical cues with video playback. Left arena includes a choice between control and infected male cues, right includes chemical cues from two different control males. Female is allowed to wander freely around arena.
92 Figure 2. Female behavior in response to videos associated with filter paper that contained chemical cues from direct male contact for 24 hours. A) Female receptivity, which indicates whether or not a female displayed any receptivity display to the video. B) Number of total receptivity displays that the female produced towards the video. C) Total time that a female spent walking on top of filter paper containing respective male chemical cues.
93 Figure 3. Female behavior in response to chemicals that were extracted from the male cuticle using pentane (left) and methanol (right) as solvents. Top graphs represent overall female receptivity, middle graphs are the total number or female receptivity displays, bottom graphs are the total time the female spent on each piece of filter paper.
94 CHAPTER 4
Infection influences vibratory signaling in a wolf spider with multimodal communication
Rachel Gilbert, George W. Uetz
Department of Biological Sciences, University of Cincinnati, Cincinnati, OH, U.S.A.
Correspondence: R. Gilbert, Department of Biological Sciences, University of Cincinnati, 614
Rieveschl Hall, Cincinnati, OH 45221-0006, U.S.A.
E-mail address: [email protected] (R. Gilbert).
ORCID: 0000-0002-1380-8012
95 Abstract
Despite the widespread use of vibratory signals in communication, little is known about the content of these signals and the types of information that they can provide to a receiver within the context of sexual signaling. While most research on sexual signals as an indicator of health status and infection have been focused on visual traits, there is evidence to suggest that substrate-borne vibratory cues could be a reliable indicator of male quality and possibly infection history. In this study, we investigated the ability of the vibratory cues in multimodal sexual signals of Schizocosa ocreata wolf spiders to convey health information to a female, and whether females adjusted their mate choice decisions based on these cues. Individual components of the complete vibratory signal, including stridulatory pulse rate, mean amplitude, and peak amplitude, were all significant predictors of mating success in live trials.
Males infected as a juvenile (during the penultimate molt) had significantly lower stridulatory rate and peak amplitude than control males. There were no significant differences in any of the vibratory signal components between control males and males infected as adults (one hour prior to mating trials). This suggests that the vibratory cues in this species may be altered when infection occurs during development, allowing females to avoid males that have been immunocompromised in the past. However, these cues are not reliable indicators of whether a male is actively infected, which means that the evaluation of these cues will not help a female avoid coming into contact with infected individuals. Taken together, these results suggest that vibratory signals may convey honest information about male quality and past health, allowing females to choose mates that have not been compromised during development.
96 Introduction
Vibratory signals are ubiquitous across a variety of taxa, but are particularly common among invertebrates (Hill 2009). These substrate-borne signals can convey a diversity of information, such as parent/offspring communication (Nomakuchi et al. 2012), communication amongst individuals living in a group (Boucher and Schneider 2009), food recruitment (reviewed in
Cocroft and Hamel 2010), and mate quality (de Luca and Morris 1998, Sivalinghem et al. 2010, reviewed in Hill 2009 and Randall 2014). The omnipresence of vibratory signaling as a form of communication implies that this signaling modality provides important information about signaler status or potential signaler quality.
While broadcasting vibratory signals may benefit males by attracting potential mates, it also makes them more susceptible to exploitation of vibratory signals by parasites and parasitoids (Kotiaho et al. 1998, Zuk and Kolluru 1998, Haynes and Yeargan 1999, Torr et al.
2004, Laumann et al.2007, Meuche et al.2016). Furthermore, males that engage in energetically costly vibratory courtship behavior may have reduced immune function, meaning that not only are signaling males more likely to be infected, but they may be simultaneously immunocompromised (Ahtiainen et al. 2005). This suggests that vibratory cues may be an honest signaling modality, and will likely reflect male health and heritable quality (Ahtiainen et al. 2005, Alatalo 1998). However, very little is known about the ability of the signal itself to convey information about a signaler’s health and therefore the perceived potential for that individual to transmit infection if a receiver comes in contact with the signaler.
This can become complicated even further when considering organisms with multimodal signals, which may each convey different and even conflicting information. The
97 brush-legged wolf spider Schizocosa ocreata is one such example of a spider that uses multimodal sexual signaling (chemical, visual, and vibrational) to court females. It has been shown that asymmetry in foreleg tufts, a visual trait, can be induced by infection during development (Gilbert et al. 2016). Similarly, infection can negatively influence male courtship vigor (Gilbert and Uetz 2016). However, it is not known whether the vibratory signaling modality is affected by infection. Previous studies in this species have shown that female mate choice correlates positively with stridulation duration, peak amplitude and peak frequency, indicating that females will respond with receptivity to the vibratory signal in isolation, and that females may perceive a stronger and faster signal as higher quality (Gibson and Uetz 2008).
Therefore, it may be possible for a female to obtain information about a male’s health and infection history through the evaluation of these signals.
Because females in previous studies have discriminated against males infected as juveniles but not males only infected as adults, we wanted to see if the differences in mate choice were due to any variation in vibratory signal quality. In this study, we investigated the effect of infection on male vibratory signals by measuring substrate-borne cues produced my males that were exposed to a bacterial pathogen in the lab. Males infected as a juvenile have been shown to have reduced body mass and courtship vigor, therefore it is expected that these males will also have reduced vibratory output compared to control males and males that were infected only as an adult.
98
Methods
Study species and care
All spiders were captured as juveniles from a deciduous leaf litter forest at the Cincinnati
Nature Center (Clermont County, Ohio) in October 2015. Spiders were housed individually in opaque deli dish containers on a 13:11 light:dark cycle, were provided access to water ad libitum, and were fed on a consistent schedule of 2-3 crickets (Acheta domesticus, approximately 1/8” in length) twice per week. All individuals used in this study were examined post-mortem for the presence of parasites (nematodes, insect larvae) and were removed from the analysis if infected in order to rule out the possibility of immunosuppression outside of the experimental treatment affecting vibratory modality. All spiders used in the following experiments were 13-16 days post-maturity.
Experimental infection
Infection methods were modified from Gilbert et al. 2016. One week after males molted to sexual maturity (for adult infected males) or two weeks after molting to the penultimate stage
(for juvenile infected males), they were subjected to oral ingestion of the bacterial pathogen
Pseudomonas aeruginosa (strain PA-14). This pathogen occurs naturally in the environment that these spiders are found in, and has been found in the hemolymph of few individuals at very low levels (Gilbert, unpublished data). All stocks were kept in Copan Cryovials at -80°C and grown on Luria Broth media (1.0% Tryptone, 0.5% yeast extract, 1.0% NaCl, 1.5% agar). All plates containing bacteria used in experiments were cultured daily approximately 18 hours
99 before use, and were discarded within 24 hours after culturing. Spiders (N=60) were withheld water for 24 hours to encourage complete consumption of a 1μl droplet of sterile water containing 600 colony forming units (CFU) of bacteria as determined by McFarland turbidity standards (McFarland 1907). Any spider not observed drinking the full amount of water was dismissed from further experiments. Control groups (N=50 males) were withheld water for 24 hours, then given a 1μl droplet of sterile water only. Following exposure, spiders were returned to a clean housing container and resumed a normal diet and ad libitum access to water.
Treatment groups designated as ‘Infected’ denote males that were infected one hour prior to recording courtship signals, while ‘Juvenile Infected’ denotes males that were infected ~2 weeks before reaching sexual maturity and recorded within one week of molting to sexual maturity (~3 weeks after infection).
Live mating trials
All behavior trials were recorded using a Sony camcorder (model HDV-XR260V) and scored blindly by an observer at a later date for male courtship displays (leg waves, leg taps, body bounce) to get an approximation of male courtship vigor (number of these courtship displays per second), and overall mating success (Montgomery 1903, Kaston 1936, Delaney et al. 2007).
At 13-16 days post-maturity, a male was placed into an arena simultaneously with a female of the same age. Courtship occurred in a plastic arena (145mm diameter) with a clean piece of filter paper at the bottom. Pairs were recorded for 10 minutes total.
100
Vibratory signal measurement
All signals were recorded inside an anechoic and vibration-isolated booth. Video was recorded using a Sony Handycam (HDR-XR260) in order to visually confirm vibratory signal elements.
Substrate-borne vibrations were recorded using a PDV-100 laser Doppler vibrometer
(125 mm/s/V sensitivity, 500 mm/s max, 96-mm standoff distance) connected to an external sound card (Roland QuadCapture) and calibrated with a 1-kHz tone (LDV at 50% FS). Digital signal processing of male vibratory signals was conducted in SpectraPLUS-SC (24 kHz sampling rate, 2048 FFT, Hanning window), with independent scaling and calibration for each signal.
Vibratory signal analysis
Males of Schizocosa ocreata have multiple components to their vibratory signaling modality: pulses of stridulation produced by the pedipalps, percussive strikes of the chelicerae against the substrate, and leg/body taps, the rate and peak amplitude of which all correlate positively with female mate choice (Gibson and Uetz 2008). In this study, we measured stridulatory pulse rate, mean amplitude, and peak amplitude using waveforms generated in SpectraPLUS-SC (Figure 1).
Stridulatory pulse rate was determined by counting the total number of stridulatory pulses throughout an entire 10-minute recording, and reporting them as a rate of pulses/second.
Average amplitude was taken by measuring the amplitude (mm/s) of cheliceral strikes and body bounces, and averaging the individual amplitudes across the entire 10-minute recording. In order to determine peak amplitude, five cheliceral strikes were chosen at random and averaged. This was done because 1) cheliceral strikes represent the highest amplitude
101 component within the vibratory signal and 2) amplitude can vary widely based on the male’s distance from the laser within the arena, therefore an average should represent the peak amplitude while removing distance as a factor (since distance from the laser could not be measured).
Statistical Analysis
Date were analyzed in JMP Pro 12.1.0. For analyses comparing individual vibratory components
(stridulatory rate, mean amplitude, and peak amplitude) with overall mating success, a student’s t-test was used. For analyses comparing individual vibratory components (stridulatory rate, mean amplitude, and peak amplitude) across the three treatment groups (control, infected, and juvenile infected), a one-way ANOVA was used. The Tukey-Kramer HSD was used to compare means in analyses using the one-way ANOVA.
Results
Consistent with a previous study (Gibson and Uetz 2008), male stridulatory rate (t18=2.69, p=0.0148) mean amplitude (t18=2.706, p=0.0147) and peak amplitude (t18=4.48, p=0.0003) all significantly predict mating success with a female in live trials. For stridulatory rate, there was no significant difference between infected males and control males, but juvenile infected males had a significantly lower stridulatory rate than controls (F2,17=5.57, p=0.013)(Figure 2). There was no significant difference across any treatment groups for average amplitude (F2,18=0.95, p=0.396)(Figure 3). For peak amplitude, there was no difference between control and infected
102 treatments, but juvenile infected individuals had a significantly lower peak amplitude than both control and infected individuals (F2,33=7.98, p=0.0015)(Figure 4).
Discussion
The results of this experiment are consistent with previous studies showing that females are equally receptive to control males and males that were infected as adults, at the same period of one hour before mating trials (Gilbert and Uetz 2016). However, females were less receptive overall to males that were infected as juveniles (Gilbert et al. 2016). These juvenile infected males have more asymmetrical foreleg tufts (the visual signaling component) as well as lower overall body mass, therefore it could be predicted that vibratory signaling modality is similarly negatively affected by infection during development. The penultimate juvenile molt is a critical developmental period, as males do not possess costly secondary sexual traits until the terminal molt. These juvenile infected males also had higher adult immunity than males that had not been exposed to a pathogen during their juvenile stages, suggesting that there may be a prioritizing of resources towards the immune system rather than sexual signals when challenged during development (Gilbert et al. 2016).
These previous studies have also shown that males infected as a juvenile have lower mass at sexual maturity, which could account for the lower peak amplitude, but not the lower stridulatory pulse rate, as stridulation is not likely to depend on mass or size (Gilbert et al.
2016). It is unclear from the results of this study why stridulation pulse rate is lower in juvenile infected males, but it may be due to the overall lower courtship vigor that these males show in previous live mating trials. Female S. ocreata prefer males with higher courtship vigor and higher stridulation pulse duration, suggesting that females are selecting males that are better
103 able to produce more vigorous vibratory signals rather than just the strongest signals (Delaney et al. 2007, Gibson and Uetz 2008). This is also true of many other spider species, including one wolf spider that was shown to drum so vigorously that immune function was consequently reduced (Ahtiainen et al. 2005).
It should be noted that the experiments in the current study were live mating trials, and therefore females were able to assess the full multimodal signal produced by males. Thus, it may be possible that the reduced quality of visual signals were still a factor in the reduced mating success of juvenile infected males. However, because mating success was correlated with each vibratory signaling component, and the juvenile infected males do have reduced vibratory signaling strength and rate compared to controls, it stands to reason that the reduced vibratory cues may be a contributing factor to reduced perceived male quality.
There is a substantial lack in knowledge about information content found in vibratory signals, especially in the context of sexual selection (reviewed in Hill 2009). While the results of this study suggest that there is a link between vibratory signaling and infection in this species, there is still much work that needs to be done to understand which aspects of male quality females are extracting from the content of these cues.
104 References
Ahtiainen JJ, Alatalo R V, Kortet R, Rantala MJ. 2005. A trade-off between sexual signalling and
immune function in a natural population of the drumming wolf spider Hygrolycosa
rubrofasciata. J. Evol. Biol. 18:985–91.
Alatalo R V., Kotiaho J, Mappes J, Parri S. 1998. Mate choice for offspring performance: major
benefits or minor costs? Proc. R. Soc. London B Biol. Sci. 265.
Boucher M, Schneider SS. 2009. Communication signals used in worker–drone interactions in the
honeybee, Apis mellifera. Anim. Behav. 78:247–254.
Cocroft R, Hamel J. 2010. Vibrational communication in the “other insect societies”: A diversity of
ecology, signals, and signal functions. Transworld Research Network, Trivandrum. de Luca P, Morris G. 1998. Courtship communication in meadow katydids: female preference for
large male vibrations. Behaviour 135:777–794.
Delaney KJ, Roberts JA, Uetz GW. 2007. Male signaling behavior and sexual selection in a wolf
spider (Araneae: Lycosidae): a test for dual functions. Behav. Ecol. Sociobiol. 62:67–75.
Gibson JS, Uetz GW. 2008. Seismic communication and mate choice in wolf spiders: components of
male seismic signals and mating success. Anim. Behav. 75:1253–1262.
Haynes KF, Yeargan KV. 1999. Exploitation of intraspecific communication systems: illicit signalers
and receivers. Ann Entomol Soc Am. 92:960–970.
Hill PSM. 2009. How do animals use substrate-borne vibrations as an information source?
Naturwissenschaften 96:1355–1371.
Kotiaho J, Alatalo RV, Mappes J, Parri S, Rivero A. 1998. Male mating success and risk of predation in
a wolf spider: a balance between sexual and natural selection? J Anim Ecol. 67:287–291.
105 Laumann RA, Moraes MCB, Čokl A, Borges M. 2007. Eavesdropping on sexual vibratory signals of
stink bugs (Hemiptera: Pentatomidae) by the egg parasitoid Telenomus podisi. Anim. Behav.
73:637–649.
Meuche I, Keller A, Ahmad Sah HH, Ahmad N, Grafe TU. 2016. Silent listeners: can preferences of
eavesdropping midges predict their hosts’ parasitism risk? Behav. Ecol. 27:995–1003.
Nomakuchi S, Yanagi T, Baba N, Takahira A, Hironaka M, Filippi L. 2012. Provisioning call by mothers
of a subsocial shield bug. Knell R, editor. J. Zool. 288:50–56.
Randall JA. 2014. Vibrational Communication: Spiders to Kangaroo Rats. In: Biocommunication of
Animals. Dordrecht: Springer Netherlands. p. 103–133.
Sivalinghem S, Kasumovic MM, Mason AC, Andrade MCB, Elias DO. 2010. Vibratory communication
in the jumping spider Phidippus clarus: polyandry, male courtship signals, and mating success.
Behav. Ecol. 21:1308–1314.
Torr P, Heritage S, Wilson MJ. 2004. Vibrations as a novel signal for host location by parasitic
nematodes. Int. Journal for Parasitology 34:997-999.
Uetz GW, Roberts JA, Clark DL, Gibson JS, Gordon SD. 2013. Multimodal signals increase active
space of communication by wolf spiders in a complex litter environment. Behav. Ecol. Sociobiol.
67:1471–1482.
Virant-Doberlet M, King RA, Polajnar J, Sydmonson WOC. 2011. Molecular diagnostics reveal spiders
that exploit prey vibrational signals used in sexual communication. Mol. Ecol. 20:2204–2216.
Zuk M, Kolluru GR. 1998. Exploitation of sexual signals by predators and parasitoids. Q Rev Biol.
73:415–438.
106 Figure 1. Waveform generated from SpectraPLUS-SC detailing 4 seconds of typical male S. ocreata courtship. Larger amplitude signals labeled as ‘cheliceral strikes’ and smaller amplitude pulses labeled as ‘stridulatory pulse’. Rates of signals determined by counting the total number of individual components and dividing by the total duration of the trial in seconds.
107 Figure 2. Stridulatory rate (the average number of stridulatory pulses per second) as it predicts overall mating success when all treatment groups are pooled together (left), and the average stridulatory pulse duration across all treatment groups (right).
2.5 3.5 A * 3 2 AB AB 2.5
1.5 2 B
1.5 1
1 Stridulatory Rate (pulses/sec) Stridulatory Rate (pulses/sec) 0.5 0.5
0 0 Not Mated Mated Control Infected Juvenile infected
108 Figure 3. Average amplitude (mm/s) of vibratory signals as it predicts mating success when all treatments are pooled together (left), and average amplitude (mm/s) across treatment groups
(right). Average amplitude was determined by measuring the amplitude of all cheliceral strikes and body bounces, and averaging the individual amplitudes across the entire 10-minute recording.
100 3.5 A 90 * A 3 80 A A 2.5 * 70 60 2 50 1.5 40 30 1
Mean Amplitude (mm/s) 20 Mean Amplitude (mm/s) 0.5 10 0 0 Not Mated Mated Control Infected Juvenile Infected
109 Figure 4. Peak amplitude (mm/s) as it predicts mating success when all treatments are pooled together (left) and the peak amplitude (mm/s) across all treatment groups (right). Peak amplitude determined by averaging five randomly selected cheliceral strikes within a 10-minute recording.
120 100 A A 90 100 80 ** A 70 80 60 60 50 40 40 B 30 Peak Amplitude (mm/s)
Peak Amplitude (mm/s) 20 20 10 0 0 Not Mated Mated Control Infected Juvenile Infected
110 CHAPTER 5
Infection influences the adult microbiome of a wolf spider
Rachel Gilbert, Trinity L. Hamilton, George W. Uetz
Department of Biological Sciences, University of Cincinnati, Cincinnati, OH, U.S.A.
Correspondence: R. Gilbert, Department of Biological Sciences, University of Cincinnati, 614
Rieveschl Hall, Cincinnati, OH 45221-0006, U.S.A.
E-mail address: [email protected] (R. Gilbert).
ORCID: 0000-0002-1380-8012
111 Abstract
The microbiome can have significant impacts on host immunity and susceptibility to parasites and pathogens, although few studies have examined the lingering effects of pathogenic infection on the microbiome. Even less clear is how a host is able to balance the fitness tradeoffs required to both fight off infections and simultaneously perform costly behaviors such as mating and reproduction. In this study, we infected male Schizocosa ocreata wolf spiders as juveniles (penultimate) or as adults with the bacterial pathogen Pseudomonas aeruginosa in order to investigate whether there were significant changes in the composition or proportions of the microbiome associated with infection. Whole organism 16S rRNA sequencing revealed that males infected as juveniles had a significantly altered adult core microbiome compared to controls and to adult infected males, as well as a greater proportion of pathogenic bacteria.
This fundamental shift in the structure and function of the adult microbiome in juvenile infected males is consistent with behavioral and physiological evidence showing that these males have a significantly lower body condition, lower quality secondary sexual signals, and lower mating success. These males also had significantly higher immune function than control individuals, which is interesting given this new data which shows that juvenile infected males may have a higher proportion of pathogenic bacteria present. This suggests that the immune response may be activated or upregulated as a way of coping with the abundance of novel and/or pathogenic bacteria, as seen in other invertebrate species.
112 Introduction
The microbiome is an important and often underappreciated aspect of arthropod evolution. The composition of gut microbiota can have significant impacts on host immunity and susceptibility to parasites and pathogens. While there have been several studies showing that endosymbionts can increase protection against parasites and pathogens (Ye et al. 2013,
Paredes et al. 2016), few studies have examined the lingering effects of pathogenic infection on the microbiome, and especially the life history tradeoffs that can occur from persistent infections. In insects, infections in the gut can lead to lowered nutrient intake and processing
(Ponton et al. 2013), energetically-costly immune activation in the gut lining (Lemaitre and
Hoffmann 2007), and host death (Ryu et al. 2008).
Less clear is the connection between the microbiome and behavior under these conditions, and how a host is able to balance the fitness tradeoffs that are occurring with the shifting of resources used to both fight off infections and simultaneously perform costly behaviors such as mating and reproduction. The wolf spider Schizocosa ocreata has been a popular model for studying sexual selection and behavior, but has recently shown potential to be used as a model for studying the life history tradeoffs associated with sexual behavior and infection. Laboratory infection of juvenile (penultimate) male spiders causes a significant reduction in body condition and quality of sexual signals as adults, but actually increases the male’s immune system compared to controls as adults (Gilbert et al. 2016).
However, males infected as adults experience no effect on behavior, and a decrease in immunity for a short period following the clearing of the bacteria (Gilbert and Uetz 2016).
Behavioral studies have shown that male cuticular chemical cues are compromised in a way
113 that reduces female receptivity, suggesting that females may be able to tell when a male is infected by evaluating a chemical change that is associated with infection within 1 hour of exposure (Gilbert, unpublished data). Males in this study (as well as in previous studies) orally consumed an LD15 dose of a pathogenic strain of Pseudomonas aeruginosa, a bacterium that has a propensity for forming microbiome-altering biofilms in many types of ecological settings
(Whiteley et al. 2001). Previous studies have shown that the consumed bacteria are also passing through the gut and entering the hemolymph and circulatory system of the spider, suggesting that a sufficient amount of colony forming units (CFU) may be entering the gut that a biofilm is either possible or likely (Gilbert and Uetz 2016, Gilbert et al. 2016). Taken together, these studies suggest that there are complex physiological tradeoffs occurring between development, infection, and behavior, with the strong possibility that the microbiome may play a significant role in mediating these tradeoffs.
In this study, we aim to examine the bacterial microbiome of S. ocreata males to evaluate whether there are significant changes in the composition or proportions of bacteria found in control, infected, and adult males infected as a juvenile (penultimate). Specifically, we seek to understand the following questions: 1) Does infection impact the adult microbiome, and 2) Does infection as a juvenile change the structure of the microbiome in any way that might be influencing development, which could be a possible explanation for the low body condition but higher immune function seen in previous studies.
114 Methods
Experimental infection - Infection methods were modified from Gilbert et al. 2016. One week after males molted to sexual maturity (for adult infected males) or two weeks after molting to the penultimate stage (for juvenile infected males), they were subjected to oral ingestion of the bacterial pathogen Pseudomonas aeruginosa (strain PA-14). All stocks were kept in Copan
Cryovials at -80°C and grown on Luria Broth media (1.0% Tryptone, 0.5% yeast extract, 1.0%
NaCl, 1.5% agar). All plates containing bacteria used in experiments were cultured daily approximately 18 hours before use, and were discarded within 24 hours after culturing. Spiders were withheld water for 24 hours to encourage complete consumption of a 1 μl droplet of sterile water containing 600 CFU of bacteria as determined by McFarland turbidity standards
(McFarland 1907) or just water (for control males). Any spider not observed drinking the full amount of water was dismissed from further experiments. All spiders were the same age at the time of RNA extraction (1 week post-maturity). For infected males, RNA extraction occurred 1 hour after infection. For juvenile infected males, RNA extraction occurred within 24 hours of molting to sexual maturity, which was ~3 weeks after infection.
RNA extraction and Sequence Analysis – RNA was extracted from males using the RNeasy Lipid
Tissue Mini Kit with an initial homogenization step using QIAshredder microcentrifuge spin- columns (Qiagen). RNA was converted to cDNA using the ThermoFisher RevertAid Reverse
Transcription kit. Sampled cDNA was submitted to the Center for Bioinformatics & Functional
Genomics at Miami University (Oxford, OH, USA) where amplicons were sequenced using
MiSeq Illumina 2 × 300 bp chemistry with the primers 515Ff and 806rB targeting the V4
115 hypervariable region of bacterial and archaeal 16S SSU rRNA gene sequences (Caporaso et al.
2012; Aprill et al., 2015). Post sequence processing was performed using the Mothur (ver.
1.38.0) sequence analysis platform (Schloss et al., 2009) following the MiSeq SOP (Kozich et al.,
2013). Operational taxonomic units (OTUs) assigned at a sequence similarity of 97% and classified within Mothur against the SILVA database (v123). Chimeras were identified and removed using the UCHIME and CD-HIT programs. Alpha diversity metrics were calculated using
Mothur.
Nucleotide sequence accession numbers
Because this study is not yet complete, sequence data has not yet been deposited in the
NCBI Sequence Read Archive (SRA) database. Accession numbers will be reported upon publication of this data in a peer-reviewed journal.
Results
Microbiome composition
Sequencing of SSU cDNA from control, adult infected and juvenile infected spiders resulted in
236,897 distinct OTUs (defined at 3.0% sequence dissimilarities)(Table 1). Across treatments, total OTUs recovered ranged from 18,000 to 62,000 OTUs per sample (Table 1). Based on rarefaction analysis, the majority of the predicted 16S rRNA sequence gene diversity was sampled at this depth of sequencing (Supplementary Figure 1). The majority of OTUs recovered from both treatment groups were affiliated with bacteria (average 99.99%). The most abundant
OTUs in both the control treatments and adult infected treatments were affiliated with members of the phyla Bacteroidetes, Firmicutes, and Proteobacteria. For those OTUs that could
116 be classified to the Order level, the most abundant were affiliated with Bacteroidales,
Clostridiales, Enterobacteriales, Lactobacillales, and Pseudomonadales. Within the core microbiome, 13.6% of OTUs could be classified to Phylum, 18.1% to Class, 18.1% to Order,
22.2% to Family, and 9.1% classified to Genus.
Core microbiome
Consideration of the core microbiota may be particularly beneficial in the study of host-microbe associations. Here, we defined the core microbiome as taxa comprising 83.3% of the total OTUs in the control spiders. This delineation resulted in 20 taxa. The core microbiome of the control spiders and the adult infected spiders were very similar—OTUs affiliated with Bacteroidetes,
Firmicutes, and Proteobacteria were the most abundant. Compared to the core microbiome of the controls, the microbiomes of the juvenile infected samples varied widely. The microbiome of Juvenile infected 1 included a total of 33,806 OTUs. The majority of these OTUs were affiliated with Cytophagia, Actinobacteria, Xanthomonadales, Betaproteobacteria, and
Plantomycetes. In addition, a number of other OTUs were more abundant in Juvenile infected 1 compared to the control and adult infected samples (Figure 3). In contrast, a OTUs recovered from the other spiders were not recovered from Juvenile infected 2 including members of the classes Bacteroidia, Clostridia, Enterobacteriales, and families Porphyromonadaceae and
Lachnospiraceae (Figure 3). The microbiome of Juvenile infected 2 included a total of 18,019
OTUs. The majority of these OTU’s were affiliated with Pseudomonadales.
The shared Chao values were higher for comparisons between control and infected individuals, and lowest for comparisons including juvenile infected samples. Shared Chao values
117 were particularly low when samples compared to juvenile infected 2 (Table 2) which is consistent with this sample having the lowest richness and diversity. Juvenile infected 1 had the highest species richness (Figure 1) and diversity (Figure 2) of any sample.
Discussion
Previous research in this species showed that males infected as adults had nearly cleared an infection at the same dose within just a few hours, so a significant change in the microbiome is not likely just a short time after infection (Gilbert and Uetz 2016). As expected, the core microbiome and diversity indices are highly similar across the control and adult infected treatments. However, males infected as juveniles have a core microbiome that is drastically different than the controls and adult infected individuals. Males infected as juveniles probably devote a large proportion of resources the development of secondary sex traits, as well as to the physiologically-demanding process of molting, so it is more likely that infection as a juvenile may have a larger impact on the microbiome and the immune system’s ability to clear an infection. This could also be a possible explanation for the low quality sexual signals that are produced by males that were infected as juveniles in a previous study (Gilbert et al. 2016).
The high contrast between the juvenile infected samples is of particular interest. Juvenile 1 has the highest diversity index of any sample, while Juvenile 2 has the lowest. High diversity after infection could be a sign that disruption of the native microbiome allowed new or low- abundance bacteria to colonize, when they otherwise may not have been able to compete for resources due to the high abundances of a few core species.
118 Low diversity may be caused by several factors. Since ingested bacteria are usually eliminated by the immune system, a large-scale or exaggerated immune response brought on by the consumption of a large dose of bacteria may cause the elimination of unintended symbiotic or native bacteria (Vallet-Gely et al. 2008). Because the microbiome is important in the development and maintenance of the immune system in insects, a sudden imbalance caused by consuming pathogenic bacteria may be causing a localized immune response in the gut lining, which may in turn initiate a depletion of commensal bacteria (reviewed in Broderick
2016). Juvenile infected males have been shown to have a significantly higher baseline immune function as adults than males who had not been infected as a juvenile, which may be in part mediated by the transformation that occurs within the microbiome after infection during development.
Additionally, Pseudomonas aeruginosa, the bacteria used in this study to elicit an immune response, also has the tendency to biofilm (Hall-Stoodley et al. 2004). In fact, there is a greater proportion of Pseudomonas spp. found in the juvenile infected 2 sample than in any other sample, with a smaller but still significant amount of Pseudomonas spp. in the juvenile infected 1 sample, suggesting that these bacteria may be causing a persistent infection in the gut that is promoting an imbalance. Furthermore, a biofilm could be responsible for the depletion of bacteria species in the microbiome of juvenile infected 2, since this phenomenon is likely to increase competition for resources, reducing the ability of multiple species to colonize and proliferate.
This study provides compelling evidence for the negative effects of infection on the microbiome of juvenile spiders, and presents a possible explanation for why infection has a
119 negative effect on the development of sexual signaling traits in previous studies. Studies of the influence of infection on the microbiome of non-vector arthropods is lacking, and even less is known about the links between infection, the microbiome and other important life history traits. The results of this study fill in some of these gaps in knowledge, and lays the groundwork for future studies that will examine the functional role of these bacteria in development and the immune response.
120 References
Broderick NA. 2016. Friend, foe or food? Recognition and the role of antimicrobial peptides in
gut immunity and Drosophila–microbe interactions. Philos. Trans. R. Soc. London B Biol. Sci.
371.
Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Huntley J, Fierer N, Owens SM, Betley J,
Fraser L, Bauer M, et al. 2012. Ultra-high-throughput microbial community analysis on the
Illumina HiSeq and MiSeq platforms. ISME J. 6:1621–1624.
Gilbert R, Karp RD, Uetz GW. 2016. Effects of juvenile infection on adult immunity and
secondary sexual characters in a wolf spider. Behav. Ecol. 27:946–954.
Gilbert R, Uetz GW. 2016. Courtship and male ornaments as honest indicators of immune
function. Anim. Behav. 117:97–103.
Hall-Stoodley L, Costerton JW, Stoodley P. 2004. Bacterial biofilms: from the Natural
environment to infectious diseases. Nat. Rev. Microbiol. 2:95–108.
Lee W-J, Brey PT. 2013. How Microbiomes Influence Metazoan Development:Insights from
History and Drosophila Modeling of Gut-Microbe Interactions. Annu. Rev. Cell Dev. Biol.
29:571–592.
Lemaitre B, Hoffmann J. 2007. The host defense of Drosophila melanogaster. Annu. Rev.
Immunol. 25:697–743.
McFarland J. 1907. The nephelometer: an instrument for estimating the number of bacteria in
suspensions used for calculating the opsonic index and for vaccines. JAMA J. Am. Med.
Assoc. 49:1176.
121 Paredes JC, Herren JK, Schüpfer F, Lemaitre B. 2016. The role of lipid competition for
endosymbiont-mediated protection against parasitoid wasps in Drosophila. 7.
Ponton F, Wilson K, Holmes AJ, Cotter SC, Raubenheimer D, Simpson SJ. 2013. Integrating
nutrition and immunology: A new frontier. J. Insect Physiol. 59:130–137.
Ryu J-H, Kim S-H, Lee H-Y, Bai JY, Nam Y-D, Bae J-W, Lee DG, Shin SC, Ha E-M, Lee W-J. 2008.
Innate immune homeostasis by the homeobox gene caudal and commensal-gut mutualism
in Drosophila. Science (80-. ). 319.
Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, Lesniewski RA, Oakley BB,
Parks DH, Robinson CJ, et al. 2009. Introducing mothur: open-source, platform-
independent, community-supported software for describing and comparing microbial
communities. Appl. Environ. Microbiol. 75:7537–41.
Vallet-Gely I, Lemaitre B, Boccard F. 2008. Bacterial strategies to overcome insect defences.
Nat. Rev. Microbiol. 6:302–313.
Whiteley M, Bangera MG, Bumgarner RE, Parsek MR, Teitzel GM, Lory S, Greenberg EP. 2001.
Gene expression in Pseudomonas aeruginosa biofilms. Nature 413:860–864.
Ye YH, Woolfit M, Rancès E, O’Neill SL, McGraw EA, Zug R, Hammerstein P, Werren J, Baldo L,
Clark M, 2013. Wolbachia-associated bacterial protection in the mosquito Aedes aegypti.
Pimenta PF, editor. PLoS Negl. Trop. Dis. 7:e2362.
122 Table 1. Total number of operational taxonomic units (OTU) for each sample.
Sample OTU count Control 1 31710 Control 2 61789 Infected 1 34055 Infected 2 57518 Juvenile Infected 1 33806 Juvenile Infected 2 18019
123 Table 2. Shared Chao (species similarity) compared across all samples. This analysis estimates the number of bacterial species shared between two samples.
Comparison Shared Chao Control 1 Control 2 175.550003 Control 1 Infected 1 194.642853 Control 1 Infected 1 208.038467 Control 1 Infected 2 139.628784 Control 2 Infected 2 278.299988 Infected 1 Infected 2 185.558334 Control 1 Juv Inf 1 69.5 Control 2 Juv Inf 1 96.696426 Infected 1 Juv Inf 1 77.333336 Infected 2 Juv Inf 1 48.625 Control 1 Juv Inf 2 16 Control 2 Juv Inf 2 10 Infected 1 Juv Inf 2 10.5 Infected 2 Juv Inf 2 25 Juv Inf 1 Juv Inf 2 47.75
124 Figure 1. Observed Species Richness (OSR) among samples. This represents an estimate of the number of individual bacterial species found within each individual spider.
1400
1050
700
350 Observed Species Richness
0 Control 1 Control 2 Infected 1 Infected 2 Juv Infected 1 Juv Infected 2
125 Figure 2. Inverse Simpson’s Index among samples. This is a measure of a-diversity, and an indication of the richness in a community with uniform evenness.
30.
22.5
15.
Inverse Simpson's Index 7.5
0. Control 1 Control 2 Infected 1 Infected 2 Juv Infected 1 Juv Infected 2
126 Figure 3. Top 20 most abundant microbial taxa in samples Control 1 and 2, and their relative abundances in other treatment groups. 100% Alphaproteobacteria Rhizobiales Pseudomonadaceae Pseudomonadales Rikenellaceae 75% Lactobacillales Bacilli Lachnospiraceae Ruminococcaceae Enterobacteriaceae
50% Enterobacteriales Parabacteroides Gammaproteobacteria Clostridiales Clostridia Relative Abundance
25% Porphyromonadaceae Firmicutes Bacteroidales Bacteroidia Bacteroidetes 0%
127 Supplementary Figure 1
Rarefaction Curve
Infected 2 1000
Control 2 800 Infected 1 Juv Infected 1
Control 1 600
400
Juv Infected 2 200
0 0 10000 20000 30000 40000 50000 60000 70000
128 CHAPTER 6
Characterization of immune related genes in a wolf spider
Rachel Gilbert, Emily Jennings, Joshua Benoit, George W. Uetz
Department of Biological Sciences, University of Cincinnati, Cincinnati, OH, U.S.A.
Correspondence: R. Gilbert, Department of Biological Sciences, University of Cincinnati, 614
Rieveschl Hall, Cincinnati, OH 45221-0006, U.S.A.
E-mail address: [email protected] (R. Gilbert).
ORCID: 0000-0002-1380-8012
129 Abstract
For decades, researchers have been interested in discovering the mechanisms underlying the tradeoffs between male courtship signals and immunity. Spiders have the potential to be an excellent model for studying these tradeoffs, since several sets of immune-related genes are hypothesized to be involved in the development of coloration and pigmentation, including the melanin used to develop secondary sexual traits. Despite their potential to uncover these novel tradeoffs, spiders remain a severely understudied taxa in the context of genetics, and a full investigation of the immune system has never been attempted. In this study, we used RNA-seq data from infected and uninfected males to assemble a transcriptome de novo, and analyzed changes in gene expression in order to determine which genes are involved in the immune response. Further, we investigated the potential functional role of melanin-related hemocyanin genes, which are prime candidates for tradeoffs between immunity and melanized sexual signaling traits. This study provides new insights into the arachnid immune response, including a description of immune processes that may differ significantly from traditionally-studied arthropods.
130 Introduction
Arthropods are exposed to a wide variety of parasites and pathogens, and consequently have acquired a broadly-effective innate immune system to combat infections. While many arthropod immune systems, especially insects, have been examined at length, a thorough examination of the spider immune system remains incomplete. Existing studies of spider immunity have investigated individual components of the immune system including antifungal peptides (Barbosa et al. 2007, Ayroza et al.2012, Riciluca et al. 2012), antimicrobial peptides
(Lorenzini et al. 2003, Baumann et al. 2010a, Baumann et al.2010b, Lorenzini et al. 2003, Mafra et al. 2012), and neutrophil-like hemocytes (Fukuzawa et al. 2008, Soares et al. 2013, Kuhn-
Nentwig et al. 2014). Recent genomic evidence (in distantly related arachnid taxa, see
Bechsgaard et al. 2015 for review) has shown that spiders are lacking several major immune components integral to the immune response in other arthropods, such as the receptors that are responsible for the recognition of Gram-positive bacteria in hemolymph.
However, these studies were performed across numerous distantly-related species, therefore a comprehensive evaluation of the arachnid immune system after immune activation has not been established, limiting our functional knowledge of the spider immune system. RNA sequencing allows us to not only take an organism-wide approach to examining a physiological response to a stimulus, but also allows us to directly compare homology across taxa, allowing for the discovery of novel innate immune components that may be unique to spiders.
Furthermore, there are few genomic resources for spiders, making de novo RNA assembly an essential tool that will continue to advance mechanistic studies in this understudied taxa.
131 The wolf spider Schizocosa ocreata has been studied extensively as a model for behavior and sexual signaling, and has recently been used to examine the tradeoffs between sexual signaling traits and immunity (Gilbert et al. 2016, Gilbert and Uetz 2016). Research has also shown that courtship can be costly, and reduces the ability of males to demonstrate an encapsulation response to a monofilament when measured 24 hours after courtship (Gilbert and Uetz 2016). Taken together, these studies imply that there may be a measurable tradeoffs between immunity and courtship activities. In this study, we utilize the ability of RNA sequencing to reveal patterns of gene expression of immune-related genes, and try to determine the potential functional roles of differentially-expressed genes that may be related to sexual signaling in spiders.
Methods and Preliminary Results
Experimental immune challenge
All spiders used in this study were collected from the field at the Cincinnati Nature Center in
Clermont County, OH. They were kept on a consistent light cycle and fed crickets twice per week, and provided water ad libitum. Spiders were withheld water for approximately 24 hours in order to make them more readily consume a 1μl droplet of water containing either 600 colony forming units (CFU) of Pseudomonas aeruginosa (strain PA-14) or simply sterile water as a control. One hour post-infection, males were placed in an -80°C freezer for future RNA extraction.
132
RNA Sequencing and Analysis
Whole organism RNA extractions were performed using the RNeasy® Lipid Tissue Mini Kit
(Qiagen) with an initial homogenization step using a BeadBlaster 24 (Benchmark) and
QIAshredder microcentrifuge spin-columns (Qiagen)(Rosendale et al. 2016). All RNA was sequenced in duplicate on an Illumina HiSeq 2500 Rapid Sequencing platform at the Cincinnati
Children’s Hospital Core Sequencing Facility, with polyA stranded library preparation (v.2 kit) and 75bp read length. Sequences were assembled de novo and trimmed using CLC Genomics
Workbench (Qiagen) and Trinity (v2.0.6). Gene annotation was performed using Blast2GO
(NCBI) version 3.1. TransDecoder was used to isolate candidate coding regions within our transcript sequences, and the CD-HIT-EST program (Huang et al. 2010) was used to perform hierarchical clustering. Quality of the assembly was assessed using BUSCO (Benchmarking
Universal Single Copy Orthologs) (Simao et al. 2015). After Transdecoder and CD-HIT-EST,
34,886 sequences were remaining for analysis. BUSCO score for the assembly was 92% complete (980), 15.9% duplicated (169), 4.8% fragmented (51), and 3.2% missing (35).
Quantitative PCR expression analyses
Whole organism RNA was extracted from infected and control males with two biological replicates using the RNeasy® Lipid Tissue Mini Kit (Qiagen) with an initial homogenization step using QIAshredder microcentrifuge spin-columns (Qiagen). Total RNA (1μg) was reverse transcribed into cDNA (ThermoScientific RevertAid RT Kit). Primers were designed for 4 functional genes of interest and 4 housekeeping genes using Primer-BLAST (NCBI, Table 1). RT-
133 PCR was performed on an Eco RT-PCR system (Illumina) using the Maxima SYBR Green/ROX qPCR kit (ThermoScientific).
Hemolymph Acidification
In order to examine the potential physiological mechanisms of the immune response, we tested to see whether there was any change in pH associated with infection (such as lactic acid buildup). One hour post-infection, males were placed on surface-sterilized Parafilmâ and had
2μl of hemolymph extracted by cutting the first pair of legs on the right side of the body. Within
3 seconds, the first measurement of pH was taken using a micro pH electrode (Thermo
Scientific™ Orion™ 9810BN) attached to a pH meter (Fisher Scientific™ accumet™ AP110).
Subsequent measurements were taken at 10 seconds and 30 seconds in order to assess change in pH. There was no significant difference in measured hemolymph pH between control and infected males (t17=-0.853, P=0.4052)(Figure 1).
Phenoloxidase Assay
To see whether the up-regulated proteases are converting hemocyanin to phenoloxidase during the immune response, we measured PO activity using the L-DOPA assay (Laughton and Siva-
Jothy 2011). This assay measures the ability of L-3,4-dihydroxyphenylalanine to cleave hemocyanin and produce phenoloxidase. One hour post-infection, hemolymph from 20 males were added to a 96-well plate which contained dilutions of L-3,4-dihydroxyphenylalanine
(Sigma). Absorbance readings were taken at 490nm every 60 seconds for 20 minutes on a
Synergy H1 Hybrid plate reader (BioTek).
134 Discussion
Preliminary evidence suggests that the most significantly downregulated set of genes are all related to the arthropod respiratory protein hemocyanin, which are copper-carrying subunits in the hemolymph that are responsible for saturating tissues with oxygen (Rehm et al. 2012). In spiders, this protein is also responsible for creating melanin, which is used during the encapsulation response, and likely also used to develop the darkened bristles that make up the foreleg tufts of S. ocreata males (Coates and Nairn 2013, Hsuing et al. 2015). Therefore, this is one possible major mechanism by which tradeoffs may be occurring between the immune system and the development of visual signaling traits. By studying the changes in hemocyanin protein concentration as well as the changes in melanin concentration during development, future studies can examine in more detail whether this could be a novel mechanism for a multi- function protein to play a role in complex life history tradeoffs.
Because a significant drop in respiratory protein expression can cause a buildup in lactic acid and other compounds associated with a low-oxygen environment during the recovery phase, we wanted to evaluate whether the pH of the hemolymph was dropping significantly after infection (Paul et al. 1994). While we found that there was no difference in hemolymph pH, this does not confirm that there is lower oxygen content in the blood, and does not explain the physiological consequences of reduced hemocyanin expression. Furthermore, hemocyanin is a long-lived protein, and therefore a drop in pH may not be detectable within the 1 hour timeframe (Paul et al. 1994, Burmester 2013). Furthermore, the measurement of phenoloxidase revealed that there is no significant difference in the amount of phenoloxidase present in infected and control male hemolymph, implying that there is no difference in the
135 ability of hemocyanin to be converted to phenoloxidase. Because the role or phenoloxidase in the arachnid immune response is not well-characterized, it may be possible that this is not a significant mechanism in arachnid innate immunity, even though previous studies have found that hemocyanin can be converted to phenoloxidase in some spiders (Laino et al. 2015). This would mean that the hemocyanin may be more heavily involved in the production of melanin seen in the encapsulation response, or may serve a novel role in arachnids. Future studies should focus on elucidating the mechanisms and functional role of hemocyanin in arachnids, including more quantitative measures of hemocyanin content after infection.
136 References
Ayroza G, Ferreira ILC, Sayegh RSR, Tashima AK, da Silva Junior PI. 2012. Juruin: an antifungal
peptide from the venom of the Amazonian Pink Toe spider, Avicularia juruensis, which contains
the inhibitory cystine knot motif. Front. Microbiol. 3:324.
Barbosa FM, Daffre S, Maldonado RA, Miranda A, Nimrichter L, Rodrigues ML. 2007. Gomesin, a
peptide produced by the spider Acanthoscurria gomesiana, is a potent anticryptococcal agent
that acts in synergism with fluconazole. FEMS Microbiol. Lett. 274:279–86.
Baumann T, Kämpfer U, Schürch S, Schaller J, Largiadèr C, Nentwig W, Kuhn-Nentwig L. 2010.
Ctenidins: antimicrobial glycine-rich peptides from the hemocytes of the spider Cupiennius salei.
Cell. Mol. Life Sci. 67:2787–98.
Baumann T, Kuhn-Nentwig L, Largiadèr CR, Nentwig W. 2010. Expression of defensins in non-
infected araneomorph spiders. Cell. Mol. Life Sci. 67:2643–51.
Bechsgaard J, Vanthournout B, Funch P, Vestbo S, Gibbs RA, Richards S, Sanggaard KW, Enghild JJ,
Bilde T. 2015 Nov. Comparative genomic study of arachnid immune systems indicates loss of β
GRPs and the IMD pathway. J. Evol. Biol.:n/a-n/a.
Burmester T. 2013. Evolution and Adaptation of Hemocyanin Within Spiders. In: Spider
Ecophysiology. Berlin, Heidelberg: Springer Berlin Heidelberg. p. 3–14.
Coates CJ, Nairn J. 2013. Hemocyanin-derived phenoloxidase activity: A contributing factor to
hyperpigmentation in Nephrops norvegicus. Food Chem. 140:361–369.
Fukuzawa AH, Vellutini BC, Lorenzini DM, Silva PI, Mortara RA, da Silva JMC, Daffre S. 2008. The role
of hemocytes in the immunity of the spider Acanthoscurria gomesiana. Dev. Comp. Immunol.
32:716–25.
137 Fukuzawa AH, Vellutini BC, Lorenzini DM, Silva PI, Mortara R a, da Silva JMC, Daffre S. 2008. The role
of hemocytes in the immunity of the spider Acanthoscurria gomesiana. Dev. Comp. Immunol.
32:716–25.
Gilbert R, Karp RD, Uetz GW. 2016. Effects of juvenile infection on adult immunity and secondary
sexual characters in a wolf spider. Behav. Ecol. 27:946–954.
Gilbert R, Uetz GW. 2016. Courtship and male ornaments as honest indicators of immune function.
Anim. Behav. 117:97–103.
Hsiung B-K, Blackledge TA, Shawkey MD. 2015. Spiders do have melanin after all. J. Exp. Biol. 218.
Kuhn-Nentwig L, Kopp LS, Nentwig W, Haenni B, Streitberger K, Schürch S, Schaller J. 2014.
Functional differentiation of spider hemocytes by light and transmission electron microscopy,
and MALDI-MS-imaging. Dev. Comp. Immunol. 43:59–67.
Laino A, Lavarías S, Suárez G, Lino A, Cunningham M. 2015. Characterization of phenoloxidase
activity from spider Polybetes pythagoricus hemocyanin. J. Exp. Zool. Part A Ecol. Genet. Physiol.
323:n/a-n/a.
Laughton AM, Siva-Jothy MT, Siva-Jothy MT. 2011. A standardised protocol for measuring
phenoloxidase and prophenoloxidase in the honey bee, Apis mellifera. Apidologie 42:140–149.
Lorenzini DM, Fukuzawa AH, da Silva PI, Machado-Santelli G, Bijovsky AT, Daffre S. 2003. Molecular
cloning, expression analysis and cellular localization of gomesin, an anti-microbial peptide from
hemocytes of the spider Acanthoscurria gomesiana. Insect Biochem. Mol. Biol. 33:1011–1016.
Lorenzini DM, da Silva PI, Fogaça AC, Bulet P, Daffre S. 2003. Acanthoscurrin: a novel glycine-rich
antimicrobial peptide constitutively expressed in the hemocytes of the spider Acanthoscurria
gomesiana. Dev. Comp. Immunol. 27:781–791.
138 Mafra DG, da Silva PI, Galhardo CS, Nassar R, Daffre S, Sato MN, Borges MM. 2012. The spider
acylpolyamine Mygalin is a potent modulator of innate immune responses. Cell. Immunol.
275:5–11.
Markl J, Decker H, Borner J, Markl J, Burmester T, Markl J, Decker H, Van-Holde K, Miller K,
Burmester T, et al. 1992. Molecular Structure of the Arthropod Hemocyanins. In: BMC
Evolutionary Biology 2012 12:1. Vol. 12. BioMed Central. p. 325–376.
Paul RJ, Bergner B, Pfeffer-Seidl A, Decker H, Efinger R, Storz H. 1994. Gas transport in the
haemolymph of arachnids: oxygen transport and the physiological role of haemocyanin. J. exp.
Biol 188:25–46.
Riciluca KCT, Sayegh RSR, Melo RL, Silva PI. 2012. Rondonin an antifungal peptide from spider
(Acanthoscurria rondoniae) haemolymph. Results Immunol. 2:66–71.
Rosendale, Andrew J., et al. "Mechanistic underpinnings of dehydration stress in the American dog
tick revealed through RNA-Seq and metabolomics." J. Exp. Biology 219.12 (2016): 1808-1819.
Simão FA, Waterhouse RM, Ioannidis P, Kriventseva E V., Zdobnov EM. 2015. BUSCO: assessing
genome assembly and annotation completeness with single-copy orthologs. Bioinformatics
31:3210–3212.
Soares T, Cavalcanti MGDS, Ferreira FRB, Cavalcanti M do S de M, Alves LC, Brayner FA, Paiva PMG.
2013. Ultrastructural characterization of the hemocytes of Lasiodora sp. (Koch, 1850) (Araneae:
Theraphosidae). Micron 48:11–6.
139 Table 1. Primers used in qPCR analysis
Gene name Role Forward Reverse E3 ubiquitin-protein Functional TCTTTGGAACAGGCAACAGA TTCAACCTGATTGGTGGACA ligase HUWE1 U14-lycotoxin-Ls1a Functional CGAAAAATATTGCCCTACGC ACCAGGGTTGTCTGATGGAG Annulin, Functional CATAGTGGGCGAGTGGATCT GTTCCAGACGGTGGGTCTAA Hemocyanin Functional CCCTGATGGAGCTAATGTGAA ATGTTTCCGGTGAGCAATTC ribosomal protein S4 Housekeeping GGCAACGTGTAGTGTTGTCG TCTTGGGGCAAATACACCTC translation elongation Housekeeping CCTCCCTTCAGTGAGAGTCG GCATCCAAGGCTTGAAGAAG factor EF-1 alpha ribosomal protein l13a Housekeeping AGAGGCCCATTCCACTTTCG GCAGCTTCACCACGTTTTGT glucose 6-phosphate Housekeeping AGGGAGCAGTGTCGGAAGTA CCAAATCACCCGATGCTCCT dehydrogenase (gpdh)
140 Table 2. Genes related to phenoloxidase (proteases) and hemocyanin
Description Fold Change P-value Chemotrypsin-like protease 34.23 0.001 Proteasome 10.66 0.03 Proteasome Activator 60 .004 Serine protease nudel 50.05 <.0001 Chemotrypsin-like protease -52.32 0.007 Hemocyanin subunit 1 -84.89 0.006 Hemocyanin subunit 3 -1,066.63 0.0012 Hemocyanin subunit 3 -657.81 0.001 Hemocyanin subunit 4 -203.36 0.004 Hemocyanin subunit 4 -141.15 0.006 Hemocyanin subunit 5 -1,097.85 0.0029 Hemocyanin subunit 5 -158.34 0.04 Hemocyanin subunit 5 -129.11 0.04 Hemocyanin subunit 5 -113.86 0.008 Hemocyanin subunit 5 -112.36 0.02 Hemocyanin subunit 5 -94.12 0.04 Hemocyanin subunit 5 -65.75 0.004 Hemocyanin subunit 6 -304.8 0.02 Hemocyanin subunit 6 -255.81 0.03 Hemocyanin subunit 6 -235.78 0.0003 Hemocyanin subunit 6 -227.89 0.005 Hemocyanin subunit 6 -184.81 0.02 Hemocyanin subunit 6 -175.72 0.004 Hemocyanin subunit 6 -168.31 0.006 Hemocyanin subunit 6 -165.79 0.01 Hemocyanin subunit 6 -148.1 0.006 Hemocyanin subunit 6 -120.16 0.001 Hemocyanin subunit 6 -117.74 0.04 Hemocyanin subunit 6 -80.75 0.04 Hemocyanin subunit F -50.94 0.0001 Hemocyanin subunit G -57.58 0.0001
141 Figure 1. Mean pH of 3 separate measures of male hemolymph in control males and males infected for one hour.
7.05
7
6.95
6.9
6.85 Mean pH
6.8
6.75
6.7 Control Infected
142 Figure 2. Phenoloxidase measurements (absorbance at 490nm) across a 20-minute time period.
Hemolymph samples were taken from males 1 hour post-infection.
0.14 0.13
0.12 Infected 0.11 Control 0.1 0.09 0.08 0.07 0.06 Phenoloxidase (absorbance) 0.05 0.04 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Time (minutes)
143 Table S1. GSEA (Gene Set Enrichment Analysis) of significantly downregulated genes. Size represents the number of genes that are enriched for a particular term. Description Size cell adhesion (GO_REF:nd [ND]) 68 small GTPase mediated signal transduction (GO_REF:nd [ND]) 190 translation (GO_REF:nd [ND]) 244 intracellular protein transport (GO_REF:nd [ND]) 188 translational initiation (GO_REF:nd [ND]) 101 vesicle-mediated transport (GO_REF:nd [ND]) 86 protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO_REF:nd [ND]) 12 positive regulation of GTPase activity (GO_REF:nd [ND]) 201 ubiquitin-dependent protein catabolic process (GO_REF:nd [ND]) 70 pseudouridine synthesis (GO_REF:nd [ND]) 12 ion transmembrane transport (GO_REF:nd [ND]) 127 protein folding (GO_REF:nd [ND]) 88 regulation of cell migration (GO_REF:nd [ND]) 20 peptidyl-tyrosine dephosphorylation (GO_REF:nd [ND]) 124 nucleocytoplasmic transport (GO_REF:nd [ND]) 44 tRNA processing (GO_REF:nd [ND]) 21 ER to Golgi vesicle-mediated transport (GO_REF:nd [ND]) 10 regulation of cell adhesion (GO_REF:nd [ND]) 15 regulation of embryonic development (GO_REF:nd [ND]) 15 mitosis (GO_REF:nd [ND]) 12 chloride transport (GO_REF:nd [ND]) 14 rRNA processing (GO_REF:nd [ND]) 19 vacuolar transport (GO_REF:nd [ND]) 10 regulation of developmental process (GO_REF:nd [ND]) 12 peptidyl-tyrosine phosphorylation (GO_REF:nd [ND]) 159 RNA processing (GO_REF:nd [ND]) 45 semaphorin-plexin signaling pathway (GO_REF:nd [ND]) 28 protein peptidyl-prolyl isomerization (GO_REF:nd [ND]) 26 phosphorylation (GO_REF:nd [ND]) 354 RNA metabolic process (GO_REF:nd [ND]) 16 regulation of mitotic cell cycle (GO_REF:nd [ND]) 14 ribosome biogenesis (GO_REF:nd [ND]) 23 regulation of Rho protein signal transduction (GO_REF:nd [ND]) 65 nucleosome assembly (GO_REF:nd [ND]) 10 regulation of signal transduction (GO_REF:nd [ND]) 10 ionotropic glutamate receptor signaling pathway (GO_REF:nd [ND]) 42 iron ion transport (GO_REF:nd [ND]) 10 regulation of translational initiation (GO_REF:nd [ND]) 16 regulation of small GTPase mediated signal transduction (GO_REF:nd [ND]) 20 autophagy (GO_REF:nd [ND]) 15 self proteolysis (GO_REF:nd [ND]) 11 cell differentiation (GO_REF:nd [ND]) 18 phospholipid biosynthetic process (GO_REF:nd [ND]) 16 RNA phosphodiester bond hydrolysis (GO_REF:nd [ND]) 18 glycosaminoglycan biosynthetic process (GO_REF:nd [ND]) 13 endocytosis (GO_REF:nd [ND]) 25 formation of translation preinitiation complex (GO_REF:nd [ND]) 15 termination of G-protein coupled receptor signaling pathway (GO_REF:nd [ND]) 26 regulation of biological process (GO_REF:nd [ND]) 32 protein ubiquitination (GO_REF:nd [ND]) 87 phosphorelay signal transduction system (GO_REF:nd [ND]) 12 cellular metabolic process (GO_REF:nd [ND]) 15 methylation (GO_REF:nd [ND]) 153
144 Table S2. GSEA of significantly upregulated genes. Size represents the number of genes that are enriched for a given term.
Description Size oxidation-reduction process (GO_REF:nd [ND]) 812 DNA integration (GO_REF:nd [ND]) 214 negative regulation of endopeptidase activity (GO_REF:nd [ND]) 64 DNA metabolic process (GO_REF:nd [ND]) 172 chromosome organization (GO_REF:nd [ND]) 18 proteolysis (GO_REF:nd [ND]) 459 transmembrane transport (GO_REF:nd [ND]) 424 single-organism cellular process (GO_REF:nd [ND]) 91 DNA biosynthetic process (GO_REF:nd [ND]) 45 transposition, DNA-mediated (GO_REF:nd [ND]) 97 single-organism metabolic process (GO_REF:nd [ND]) 34 regulation of transcription from RNA polymerase II promoter (GO_REF:nd [ND]) 85 peptide cross-linking (GO_REF:nd [ND]) 11 regulation of transcription, DNA-dependent (GO_REF:nd [ND]) 537 fatty acid metabolic process (GO_REF:nd [ND]) 13 regulation of DNA-dependent transcription, elongation (GO_REF:nd [ND]) 14 transcription, RNA-dependent (GO_REF:nd [ND]) 15 synapse organization (GO_REF:nd [ND]) 13 DNA duplex unwinding (GO_REF:nd [ND]) 44 macromolecule metabolic process (GO_REF:nd [ND]) 35 telomere maintenance (GO_REF:nd [ND]) 22 potassium ion transport (GO_REF:nd [ND]) 32 sodium ion transport (GO_REF:nd [ND]) 25 response to oxidative stress (GO_REF:nd [ND]) 58 neurotransmitter transport (GO_REF:nd [ND]) 38 negative regulation of peptidase activity (GO_REF:nd [ND]) 20 DNA replication (GO_REF:nd [ND]) 70 RNA-dependent DNA replication (GO_REF:nd [ND]) 26 transport (GO_REF:nd [ND]) 240 proline biosynthetic process (GO_REF:nd [ND]) 11 nucleobase-containing compound metabolic process (GO_REF:nd [ND]) 26 cell cycle arrest (GO_REF:nd [ND]) 10 chitin metabolic process (GO_REF:nd [ND]) 55 DNA replication initiation (GO_REF:nd [ND]) 22 single-organism transport (GO_REF:nd [ND]) 51 primary metabolic process (GO_REF:nd [ND]) 61 sodium ion transmembrane transport (GO_REF:nd [ND]) 59 cellular amino acid metabolic process (GO_REF:nd [ND]) 18 phospholipid catabolic process (GO_REF:nd [ND]) 12 cell-cell adhesion (GO_REF:nd [ND]) 11 nucleotide catabolic process (GO_REF:nd [ND]) 10 ion transport (GO_REF:nd [ND]) 106 immune system process (GO_REF:nd [ND]) 10 cellular macromolecule metabolic process (GO_REF:nd [ND]) 34 cGMP biosynthetic process (GO_REF:nd [ND]) 27 glycosylation (GO_REF:nd [ND]) 11
145 GENERAL CONCLUSIONS
Both immunity and mating activities are important processes in the life history of an organism.
Understanding the tradeoffs associated between the two helps us to better understand the evolution of sexual signaling traits, as well as the potential selection pressures governing female mate choice and fitness. Spiders are understudied as a whole, but the growing amount of research provides a new avenue to study novel insights into the role of immunity in behavior, as the two processes are linked in ways that are different from traditional model arthropods.
My dissertation research combined methods from a variety of disciplines in order to investigate the behavioral and functional link between immunity, infection and multimodal sexual signals.
The first chapter of my dissertation work investigated the efficacy of visual signals as indicators of male immune quality, as well as the ability of females to make mate choice decisions based on infection of potential male partners. In this study, I showed that male foreleg tufts (secondary sexual traits) accurately predict male immune strength, as males with larger tufts had a higher encapsulation response, and males with more symmetrical tufts had fewer bacteria in their hemolymph after being infected with a standard dose. Additionally, I showed that females do not discriminate against infected males, and are infected during copulation as a result due to the sexual transmission of bacteria. I conclude that while the visual signaling component of this species can provide females with predictive information about male infection tolerance, there does not seem to be a reduction in female preference for males that are more likely to be infected in this species.
The second chapter of this dissertation research was focused on the impact that infection as a juvenile can have on adult male immunity, mating success, and expression of
146 sexual signaling traits. Because the foreleg tufts are not expressed until sexual maturity, infection during the molt just prior to sexual maturity could be expected to divert resources away from the development of costly signaling traits and invest more resources into increasing the adult immune response. In fact, I found that males infected ~3 weeks before sexual maturity had a significantly higher immune response as adults, but that they suffered from overall lower body condition and more asymmetrical foreleg tufts. Furthermore, foreleg tuft size as an adult could be predicted by the body condition that a male was in prior to infection, indicating that a larger and higher quality male may be able to tolerate infection more efficiently than a lower quality male. As a consequence, these males suffered from lower overall mating success, indicating that exposure to a pathogen during a critical developmental stage is detrimental to expression of adult sexual signals in this species.
While the first two chapters of this dissertation focused on visual traits, the third chapter focused on the chemical signaling modality. While there is no previous evidence to support the idea that females can detect male chemical cues, let alone gather information about male quality from chemical cues in this species, I wanted to investigate whether this signaling modality could provide a female with an avenue to behaviorally avoid nearby infected males, and subsequently lower mating success for males associated with infected chemical cues. I found that when I isolated the chemical cues of infected males and paired them with a video stimulus of a control courting male, females were significantly less receptive to the videos associated with infected male cues. This relationship persisted whether the filter paper contained cues from direct male contact, or the filter paper contained male cuticular cues that were extracted using solvents of varying polarities. Therefore, I conclude that the differences in
147 female receptivity are likely due to alterations to cuticle-based compounds, and may provide female with a means to avoid actively-infected males that are in close proximity.
The last of the multimodal signals that I evaluated were the vibratory signals. In this species and in many spiders, substrate-borne vibratory signals are important for conveying information about species identity and potentially male quality to a female. In the fourth chapter of this dissertation research, I wanted to examine whether the individual components of the male vibratory signal that I know correlate with female mating success are impacted by infection as an adult or as a juvenile. Because these signals are transmitted through complex environments efficiently, it may be possible for females to detect and avoid infected males that cannot be evaluated visually or chemically in the complex leaf litter habitat. When I measured the vibratory signal of a live mating trial, I found that there was no significant difference in any of the signal contents or rates between adult infected and control males, males infected as juveniles were found to have lower stridulatory pulse rate and power peak signal amplitude, suggesting that males infected as juveniles are courting with less vigorous and weaker vibratory signals than controls or males infected 1 hour before mating trials. This is consistent with data from chapter 2 showing that juvenile infected males are overall lower quality, and evidence from chapter 1 which showed that females do not discriminate against adult infected males in the context of mating and courtship.
In chapter 5 of this dissertation, I sought to elucidate the potential physiological mechanisms for the tradeoffs that we’re seeing between infection and immunity. Because the bacteria that spiders in these studies is known to be particularly harmful for native gut bacteria,
I wanted to investigate the adult microbiome to see whether an altered bacterial community
148 may be mediating the lower body condition and higher immune response in juvenile infected males. I sequenced the 16s rRNA microbiomes for control males, males infected as adults, and males infected as juveniles, and found that while there is a reliably consistent core of bacteria in the microbiome (top 20 most abundant species across controls) for control and adult infected males, the core microbiome of juvenile infected males is significantly altered as adults.
There are conflicting results with species richness and diversity, but this conflicting data should be resolved with the impending increase in sample sizes for each treatment. Interestingly, the juvenile infected males had more Pseudomonas aeruginosa detected in the microbiome than either controls or males that were actively infected during microbiome extraction, suggesting that the initial P. aeruginosa dose is either not decreasing over time, or may even be increasing due to a persistent infection in the gut. Because this imbalance could also be causing a consistent immune reaction in gut tissue or in hemolymph, it may be possible that the altered microbiome is in part responsible for the pulling of resources away from sexual signal development that was alluded to in chapter 2.
Lastly, the lack of genetic data available for this species and for spiders in general hindered the ability of this dissertation work to make assumptions about the role of the immune system in the development of sexual signals and the negative effects of juvenile infection. To compensate for this lack in available data, I extracted RNA from adult infected, juvenile infected, and control males and performed a gene expression analysis in order to determine which genes might be involved in the immune response. While this data is still in the early stages of analysis, preliminary evidence suggests that there may be a significant role for hemocyanin in the immune response, which is a common arthropod respiratory pigment with a
149 historically uncommon and not-well-understood role in arachnid physiology. Hemocyanin is significantly downregulated in infected males, which is counterintuitive to the phenoloxidase role that this respiratory molecule has been thought to play historically. Future studies will examine the role of this protein in the melanization response, as well as other immune and development-related processes in order to determine its importance in these life history traits.
In summary, I have taken an integrative approach to investigating the relationship between immunity and multimodal sexual signaling in this species. Spiders are an emerging system for behavioral, manipulative, functional, and molecular studies, and this dissertation research further enhances the potential for spiders to serve as models for answering complex evolutionary questions. This research also provides support for previous hypotheses that postulate the close relationship between immunity and reproduction, and also adds to this literature by suggesting several new potential mechanisms and avenues for further research in the fields of sexual selection, immunology, and microbiology.
150