Incipient Speciation in Freshwater Fish Species from Two Isolated Watersheds

City University of New York (CUNY) CUNY Academic Works

All Dissertations, Theses, and Capstone Projects Dissertations, Theses, and Capstone Projects

9-2015

Paula Gore Miller Graduate Center, City University of New York

How does access to this work benefit ou?y Let us know!

More information about this work at: https://academicworks.cuny.edu/gc_etds/949 Discover additional works at: https://academicworks.cuny.edu

This work is made publicly available by the City University of New York (CUNY). Contact: [email protected]

Incipient Speciation in Freshwater Fish Species from Two Isolated Watersheds

Paula Gore Miller

A dissertation submitted to the Graduate Faculty in Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy, The City University of New York 2015

This manuscript has been read and accepted for the Graduate Faculty in Biology in satisfaction of the Dissertation requirement for the degree of Doctor of Philosophy

Dr. Joseph Rachlin ______

______Date Chair of the Examining Committee Dr. Joseph Rachlin Lehman College, CUNY

iii Dr. Laurel Eckhardt ______Executive Officer

______Date Executive Officer

______Dr. Dwight Kincaid Lehman College, CUNY ______Dr. Stephen Redenti Lehman College, CUNY ______Dr. Barbara Warkentine SUNY Maritime College ______Dr. Joseph Stabile Iona College, New Rochelle, NY Supervisory Committee THE CITY UNIVERSITY OF NEW YORK

iii

Abstract

Incipient Speciation in Freshwater Fish Species from Two Isolated Watersheds

Paula Gore Miller

Advisor: Dr. Joseph W. Rachlin

The process of speciation occurs as a result of restricted gene flow between segments of an

interbreeding population occupying different geographic areas. This separation may result in

isolated populations which undergo genetic and phenotypic changes. The Wisconsin glacial

period, which ended approximately 17,500 years ago, dramatically altered the geography of North iv America. The glacier covered almost the entire North America as it advanced. Areas that were not

covered with ice provided suitable habitats (refugia) for relict species that were previously

widespread in the northern section of the continent. As the ice sheet retreated, animals and plants

were able to return to the once glaciated areas. However, as the glacier retreated, it disrupted the

distribution patterns of aquatic animals and produced large numbers of small isolated populations.

As a result of the Wisconsin glaciation, the Bronx and Saw Mill Rivers now exist in separate but

parallel watersheds.

The main focus of this research was to decipher if there is evidence of incipient speciation

between freshwater fish populations that reside in two isolated river systems: the Bronx and Saw

Mill Rivers that have been separated since the Wisconsin glaciation approximately 17,500 years

ago. Both rivers contain many of the same fish species. The target species were Rhinichthys

atratulus (Blacknose Dace), Etheostoma olmstedi (Tessellated Darter) and Catostomus

commersonii (White Sucker). In this study the number of chromosomes and their morphology, the

morphological, meristic and osteological differentiation, and the genetic divergence of these fish

populations from both rivers were investigated.

The result of the chromosomal analyses indicated that for each fish species from both rivers

there was no difference between populations. Three metaphase spreads were obtained for each of

the 22 Blacknose Dace for a total of 66 spreads examined. The karyotype consisted of 16

metacentric, 28 submetacentric, 2 subtelocentric, and 4 telocentric, yielding a diploid number of

2n=50 chromosomes.

The diploid number for the Tessellated Darter was 2n = 48. A total of ten fish from the v Bronx River and twelve from the Saw Mill River was examined. Their karyotype consisted of 42

acrocentric and 6 telocentric chromosomes. The White Sucker had a diploid number 2n = 98 with

5 metacentric, 7 submetacentric and 86 subtelocentric chromosomes.

Unlike the results for the chromosomal component of this study, morphometric, meristic,

osteologic and genetic differences were observed between the different species from both rivers.

An analysis of variance (ANOVA) was conducted on all morphometric, meristic, and osteologic

characters. Morphometric analyses indicated that the differences were greater in the Blacknose

Dace than in the Tessellated Darter and the White Sucker. Of the fifty-two morphometric

characters examined for the Blacknose Dace and the White Sucker, twenty-seven characters (52

%) for the Blacknose Dace and seventeen (32%) for the White Sucker were significantly different

(p < 0.05). In addition, only fifteen of sixty-two characters (24%) for the Tessellated Darter were

significantly different (p < 0.05).

Of the fifteen meristic counts conducted only 4 (26%) was significantly different

(p < 0.05) for the Blacknose Dace and for the White Sucker. There were no significant differences

observed for the meristic count for the Tessellated Darter between the two rivers. The p-values for

the osteological data were comparable to that of the meristic data as there was a significant

difference between the populations for the Blacknose Dace (25 %) and the White Sucker (12 %),

but not for the Tessellated Darter.

Molecular data supported the morphometric, meristic and osteologic analyses in that there

are genetic variations between the different populations of fish from both rivers. Using mtDNA

control region for the Blacknose Dace and the White Sucker and cytochrome b gene for the

vi Tessellated Darter, a similar pattern of divergence was observed between the populations from the

Bronx and Saw Mill Rivers. Each fish species had haplotypes common to both rivers. However,

there were haplotypes not shared between the two rivers. Significant differences in haplotype

frequencies within the three fish species indicate the populations are beginning to diverge (P <

0.0001). For this reason, due to genetic drift, genetic differences could lead to incipient speciation

and eventually result in actual speciation if the present environmental conditions persist within the

Bronx and Saw Mill Rivers.

Acknowledgements

I would like to thank first and foremost my mentor Dr. Joseph Rachlin, who introduced me

to this work, and advised me throughout this project. Without his guidance and patience the

completion of this manuscript definitely would not have been possible. I also want to thank Dr.

Barbara Warkentine (SUNY Maritime College) for taking the time to care, for all the advice and

much time and effort she put into reading this document and for being the voice of reason when it

was needed.

I would also like to thank the other members of my advisory committee: Dr. Dwight

Kincaid who, along with Dr. Rachlin, advocated for me in my earlier years in the program and for

vii making sure my funding was always in place. Thanks also to Dr. Stephen Redenti for assisting in

my receiving the PSC-CUNY grant. This contributed to the completion of the DNA aspect of this

research and many many thanks to Dr. Joseph Stabile (Iona College) for accepting me into his lab

and for taking the time from his busy schedule to help me complete the DNA component of this

research.

The support of all the students in LaMER, Lehman College’s Laboratory for Marine and

Estuarine Research was invaluable. In particular I would like to thank Dr. Athena Tiwari for

endless hours of support and advice and for being a friend and a fierce warrior in helping me

complete this document, and to Dr. Jack Henning for his constant support and encouragement, but

most of all for compiling a plant list for both research sites.

A mountain of gratitude to the Biology Department at Lehman College mainly to Dr.

Joseph Rachlin, Dr. Leisl Jones and Mrs. Dolores Vitanza who allowed me to teach as an adjunct

lecturer throughout my graduate study. This opportunity not only provided me with a steady

income but also gave me the opportunity to hone my skills as a teacher and to assist students as

vii

they pursue their own academic aspirations. In addition, many thanks to Mrs. Christina West and

Mr. Mike Baxter for all their technical help and always having a cheerful and positive attitude.

I am also in debt to the people of the doctoral program at the Graduate Center, especially to

Mrs. Joan Reid who has been a constant source of strength and support since I began my graduate

study. In addition, my gratitude to Dr. Laurel Eckhardt and Dr. Richard Chappell (both of the

CUNY Graduate Center) for the far-sighted and humane way in which they treat graduate students.

My sincere gratitude to Mr. Dudley and Philetia Clayton and family, who kindly accepted

me into their beautiful home, guided and provided me with my very first job in America. Without

this opportunity, life as I know it in America would not have been possible. I am forever in their

viii debt.

I am also indebted to many friends namely Marva Foster, Yvonne Chin Irving, Antoinette

Jackson and Company, Michelle Johnson and Johanna Melamid who have supported me through

sleepless nights or took the time to just check in on me.

I could never have accomplished what I have without the support from my siblings, aunts,

uncles and cousins who made me believe that I am the little train that could. They were my

consummate supporters which whom I could never have achieved this goal.

To one of my greatest cheerleader, my husband Demetrius, without whose support and

partnership I may not have been able to make my way though this project. He permitted me to

vent my frustrations, encouraged me during the difficult times and celebrated the many different

milestones along the way. To my extended family especially Mrs. Ophelia Miller, Ms. Parris

Miller and Mrs. Gail Fitch; my sincere appreciation to you all. Thank you for your continued love

and support over the years.

viii

Last but not least to the greatest Dad that ever lived and a Mom who taught me the value of

hard work, perseverance and prayer. They both have contributed to my success in America. I

thank them for all the great memories, laughter and love.

TABLE OF CONTENTS

TITLE PAGE…………………………………………………………………………… i

ABSTRACT ……………………………………………………………………………. iv . ACKNOWLEDMENTS………………………………………………………………… vii

LIST OF TABLES ……………………………………………………………………… xiii

LIST OF FIGURES ……………………………………………………………………… xiv

CHAPTER 1. INTRODUCTION AND BACKGROUND OF THE PRIMARY FRESHWATER FISH………………………………………………..... 1

1.1. Introduction…………..……………………..……………..…………….…….…… 1

x 1.2. Background: Post Glacial Redispersal……………………………………….…….. 7 1.3. Field Collection……………………………………………………………….……. 9 1.4. Study Areas: Saw Mill River at Chappaqua…………………………...……….…. 10 1.5. Bronx River at Davis Brook……………………………………….……………..... 12 1.6. Description of Families and Historical Migration Patterns……………..…………. 14 1.7. Rhinichthys atratulus (Herman, 1804) - Blacknose Dace …………………………. 15 1.8. Etheostoma olmstedi (Storer, 1842) - Tessellated Darter……….…………………... 17 1.9. Catostomus commersonii (Lacepede, 1803) – White Sucker………………………… 18 1.10. References……………………..………………………………….…..………...... 22

CHAPTER 2. CHROMOSOMAL EVOLUTION IN THREE FRESHWATER FISH SPECIES FROM TWO ISOLATED WATERSHED...... 26

Abstract………………………………………………………………………………… 26

2.1. Introduction………………………………………………………………….…...... 27 2.2. Materials and Methods…………………………………………………….….……. 31 Cell Harvest…………………………………………………………….………… 31 Slide Preparation………………………………………………………….……… 32 Giemsa Staining………………………………………………………………….. 32 Levan Scale…………………………………………………………………………. 32 2.3. Results……………………………………………………………………….……… 34 2.4. Discussion…………...……………………………………………………..……...... 35 2.5. References……………………………………………………………………..…… 43

CHAPTER 3. GEOGRAPHIC VARIATION IN BIOMETRIC CHARACTERS OF THREE FRESHWATER FISH SPECIES FROM TWO ISOLATED WATERSHEDS………………………..…….………...... 46

Abstract………………………………………………………………………….………... 46 3.1. Introduction………………………………………………………………………...... 47 3.2. Materials and Methods……………………………………………………………….. 50 Enzyme Clearing and Staining………………………………………………...... 50 Morphometric Measurements……………………………………….……...... 50 3.3. Results………………………………………………………………………………… 52 3.4. Discussion…………………………………………………………………….……… 53 3.5. References…………………………………………………………………….……… 68

CHAPTER 4. DISCRIMINATION OF THREE FRESH FRESHWATER FISH SPECIES FROM TWO ISOLATED WATERSHEDS BASED ON MITOCHONDRIAL DNA SEQUENCES……………………………… 73

Abstract……………………………………………………….…………………………… 73

xi 4.1. Introduction………………………………………………………….……….………. 74 4.2. Materials and Methods……………………………………………………………….. 80 DNA Isolation from Fin Clip Samples …………………………………...... 80 PCR Amplification of mtDNA Control Region……………………………………. 81 Mitochondrial DNA Sequencing………………………………………...... 83 4.3. Results……………………………………………………………….……………….. 85 4.4. Discussion……………………………………………………………………………. 87 4.5. References……………………………………………………………….……...... 104

CHAPTER 5. SUMMARY AND CONCLUSION…………………………….………… 108

5.0. Summary and Conclusion……………………………………………………………… 108

LIST OF APPENDICES…………….………………..……….…………………………. 110

LIST OF APPENDICES

Appendix A. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY...... 110

Appendix B. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY……………………………………………………………………………………………. 122

Appendix C. Morphometric characters for Tessellated Darter, Davis Brook at Bronx River, NY…………………………………………………………………………………………... 137

Appendix D. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY…………………………………………………………………………………………… 146

Appendix E. Morphometric characters for White Sucker, Davis Brook at Bronx River, NY….………………………………………………………………………………………. 158

Appendix F. Morphometric characters for White Sucker, Chappaqua at Saw Mill River, xii NY.………………………………………………………………………………………..... 167

Appendix G. Meristic characters for Blacknose Dace, Davis Brook at Bronx River, NY………………………………………………………………………………………..…. 176

Appendix H. Meristic characters for Blacknose Dace, Chappaqua at Saw Mill River, NY………………………………………………………………………………………….. 179

Appendix I. Meristic characters for Tessellated Darter, Davis Brook at Bronx River, NY…………………………………………………………………………………………. 182

Appendix J. Meristic characters for Tessellated Darter, Chappaqua at Saw Mill River, NY…………………………………………………………………………………………. 184

Appendix K. Meristic characters for White Sucker, Davis Brook at Bronx River, NY…………...... 187

Appendix L. Meristic characters for White Sucker, Chappaqua at Saw Mill River, NY…………………………………………………………………………………………. 189

Appendix M. Osteologic characters for Blacknose Dace, Davis Brook at Bronx River, NY…………………………………………………………………………………………. 191

Appendix N. Osteologic characters for Blacknose Dace, Chappaqua at Saw Mill River, NY…………………………………………………………………………………………. 193

Appendix O. Osteologic characters for Tessellated Darter, Davis Brook at Bronx River, NY…………………………………………………………………………………………. 196

xii

Appendix P. Osteologic characters for Tessellated Darter, Chappaqua at Saw Mill River, NY………………………………………………………………………………………...... 198

Appendix Q. Osteologic characters for White Sucker, Davis Brook at Bronx River, NY………...... 201

Appendix R. Osteologic characters for White Sucker, Chappaqua at Saw Mill River, NY………………………………………………………………………………………….. 203

Appendix S. Arlequin Data Input File for the Blacknose Dace……………………………. 205

Appendix T. Arlequin Data Input File for the Tessellated Darter…………………………. 211

Appendix U. Arlequin Data Input File for the White Sucker……………………………… 222

xiii

LIST OF TABLES

Table 2-1. Nomenclature for centromeric position of chromosomes………………………. 39

Table 2-2. Comparison of karyotypes of two populations of Blacknose Dace…………….. 40

Table 2-3. Comparison of karyotypes of two populations of White Sucker ………………. 41

Table 2-4. Comparison of karyotypes of two populations of Tessellated Darter ………….. 42

Table 3-1. Sample size of each fish from both rivers for morphological analyses…...... 59

Table 3-2. Morphometric Characters Analyzed Using One-Way ANOVA………………… 61

Table 3-3. Meristic Characters Analyzed Using One-Way ANOVA…………………...... 63

Table 3-4. Internal Osteological Characters Analyzed Using One-Way ANOVA……...... 64 xiv Table 4-1. Results for the mtDNA CR analysis for Blacknose Dace from each river……... 92

Table 4-2. Results for mtDNA control region analysis for White Sucker from each river… 93

Table 4-3. Results for mtDNA cytb analysis for Tessellated Darter from each river…...... 94

Table 4-4. Haplotypes present in the Bronx and Saw Mill Rivers for the Blacknose Dace.. 95

Table 4-5. Relative frequencies of haplotypes in both river populations for the Blacknose Dace…………………………………………………………………….……… 96

Table 4-6. Haplotypes present in the Bronx and Saw Mill Rivers for the White Sucker…. 97

Table 4-7. Relative frequency of haplotypes in both river populations for the White Sucker 98

Table 4-8. Haplotypes present in the Bronx and Saw Mill Rivers for the Tessellated Darter 99

Table 4-9. Relative frequency of haplotypes in both river populations for the Tessellated Darter……………………………………………………………………...... 100

xiv

LIST OF FIGURES

Figure 1-1. Geographic location of Saw Mill River at Chappaqua and Bronx River at Davis Brook…………….……….…………………………...... ….………….. 19

Figure 1-2. Saw Mill River at Chappaqua……………………...... 20

Figure 1-3. Bronx River at Davis Brook……………………...... 20

Figure 1-4. Blacknose Dace………………………………………………….…...... 21

Figure 1-5. Tessellated Darter…………………………………………………………...... 21

Figure 1-6. White Sucker………………………………………………………………...... 21

Figure 2-1. Diagram of centromeric position of chromosomes……………………….……... 39

Figure 2-2. Metaphase plate of Rhinichthys atratulus (Blacknose Dace)………….…...... 40 xv Figure 2-3. Metaphase plate of Catostomus commersonii (White Sucker)….……….…...... 41

Figure 2-4. Metaphase plate of Etheostoma olmstedi (Tessellated Darter) ………………….. 42

Figure 3-1. Illustration of the left side of specimen showing truss morphometric characters……….………………………………………………………………… 59

Figure 3-2. Enzyme clearing and staining of the White Sucker caudal skeleton……..……… 60

Figure 3-3. Principal Component Analysis of the morphometric characters for the Blacknose Dace from both rivers……………………………………………………………… 65

Figure 3-4. Principal Component Analysis of the morphometric characters for the

White Sucker from both rivers…………………………………………………… 66

Figure 3-5. Principal Component Analysis of the morphometric characters for the Tessellated Darter from both rivers……………………………………………… 67

Figure 4-1. A minimum spanning network of mtDNA control region sequence haplotypes of the Blacknose Dace (Rhinichthys atratulus) from the Bronx and Saw Mill Rivers using statistical parsimony as implemented in TCS Version 1.3.1 (Clement et al. 2000)………………………. 101

Figure 4-2. A minimum spanning network of mtDNA control region sequence haplotypes of the White Sucker (Catostomus commersonii) from the Bronx River and Saw Mill Rivers using statistical parsimony as implemented in TCS Version 1.3.1 (Clement et al. 2000)…………………………………………………………….. 102

Figure 4-3. A minimum spanning network of cytb gene region haplotypes of the Tessellated Darter (Etheostoma olmstedi) from the Bronx River and Saw Mill Rivers using statistical parsimony as implemented in TCS Version 1.3.1 (Clement et al. 2000)……………………………………………………………. 103

xvi

Chapter 1: Introduction and Background of the Primary Freshwater Fish

1.1. Introduction

Traditionally research on aquatic organisms has lagged behind their terrestrial counterparts

because of a lack of adequate access to aquatic environments. However, due to the advances in

technology and molecular techniques, research on how fish speciate has become a point of interest

and has helped to resolve the phylogeny of different taxa (Cowman 2014).

The goal of this study was to determine if two populations of primary freshwater fish which

originated from the same parent population have significantly changed over time and have

therefore evolved into different species. Primary freshwater fishes are those with no tolerance for

1 saltwater and are unable to pass barriers of sea water. Before addressing this goal it was first

necessary to fully investigate the following heavily debated evolutionary biology questions:

“What defines a species?” “How are different species formed?” and “What is speciation”? To

answer the question proposed by this research we must first try to answer these questions.

Different opinions surround the definition of a species. Preference for one species concept

over another, and with it a concept of speciation, influences what approach one will take in

research such as this. The standard convention when studying speciation is often based on the

Biological Species Concept (BSC) proposed by Mayr, which centers on the evolution of

reproductive isolation between populations (Mayr 1949). This concept is inadequate in cases of

asexual and unisexual organisms. In addition, it does not include speciation in the absence of

breeding barriers (Coyne 1994).

Over the years, different species concepts have been proposed to address this concern and

two have bearing on this research, the Genetic and Morphological Species Concepts. The Genetic

Species Concept states that a species is a group of genetically compatible interbreeding natural

populations that are genetically isolated from other such groups (Baker and Bradley 2006). The

Genetic Species Concept focuses on genetic difference rather than reproductive isolation. The

dilemma with this concept is determining the degree of genetic difference necessary to indicate a

separate species. The Morphological Species Concept states that a species is a group of organisms

that possess the same body shape and other phenotypic features. According to this concept the

species is static with no variation in shape (Mayr 1969). This theory is subjective and researchers

may disagree on which features to use to distinguish a species. In addition, organisms from the

same species can vary in shape. For example, at different stages of the aphid life cycle, aphids

have both winged and wingless and sexual and asexual forms.

2 These alternative concepts have been rejected by evolutionary biologists. As a result,

there is not a general consensus as to how different species originate, or definitively what species

are (Mayden 1997

The Phylogenetic Species Concept best applies to this research. The PSC proposed by

Cracraft in 1983 is a lineage-based species concept. A lineage is a line of direct ancestry

representing ancestral to descendant populations over time. The PSC defines a species as ‘a

cluster of organisms that are diagnostically different from other such clusters; are descended from

a common ancestor, possess a combination of certain derived traits, and within which there is a

parental pattern of ancestry and descent” (Cracraft 1989). The PSC captures what is meant by

“species” in this study, and as a result this research was developed accordingly.

Fish evolved over 5 million years ago and comprise approximately 30,000 species. Though

2.8% of the earth’s water is fresh and 2.7 % is not usable by fish, almost 35% of fish species are

found in freshwater. Consequently, freshwater habitats are about 10,000 times more speciose than

marine ones (Vega and Wiens 2012). This difference could be the result of physical barriers that

inhibit gene flow and promote genetic divergence. Vicariant events in freshwater habitats are

common and are likely a cause of allopatric speciation (Coyne and Orr 2004, Dawson and Hamner

2008). Geologic events such as orogenesis and continental drift are widely recognized causes of

vicariant events for freshwater fishes (Burridge et al. 2006).

Speciation occurs more rapidly in fish than in other taxa. Fish in lakes display some of the

most explosive speciation on earth (Cristescu et al. 2010). Due to their relative seclusion, newly

formed rivers and lakes are prime habitats for early colonists as they are rich in resources and

ecological opportunities. For fish, speciation occurs in less than 0.3 million years. In island

dwelling birds and arthropods speciation may occur in 0.6-1.3 million years (McCune 1997).

3 Many fish species differentiate when their ancestral population becomes divided by environmental

barriers e.g. mountains, rivers etc. This model of speciation is the foundation of this research.

During speciation, a parent population becomes divided and is subjected to different biotic

and abiotic factors. As a result, morphological variation, genetic divergence and reproductive

isolation may occur. Speciation results in evolutionary change that produces discrete units or

morphologically distinct organisms called species. This process occurs as a result of restricted

gene flow between segments of an interbreeding population. Restriction may occur “if a biological

barrier to gene exchange arose within the confines of a randomly mating population without any

spatial segregation of the incipient species” (Futuyma 2013). This is called sympatric speciation or

speciation by dispersal/migration. Speciation can also occur where a parent population is separated

by the presence of a physical barrier creating discrete units or species. This type of speciation is

called allopatric speciation or speciation by vicariance (Futuyma 2013).

Both sympatric and allopatric speciation produce different biogeographical patterns.

Sympatric speciation results in the overlapping of ranges within the same geographic region by

two different species. However, with allopatric speciation the parent population is separated by an

insurmountable barrier resulting in different subpopulations occupying different geographical

areas. The individual subpopulations are then subjected to different selective pressures such as

natural selection and/or genetic drift. Natural selection and genetic drift then alters allele

frequencies differently in the different gene pools. Over time the individual subpopulations

undergo genetic, morphological, and phenotypic changes resulting in discrete units or distinct

organisms called species (Futuyma 2013).

The resulting populations are therefore distinctly different and could not interbreed if

rejoined. Such cases are more frequent in freshwater than in terrestrial or marine animals, as the

4 watersheds between river basins are efficient barriers, at least for fishes, molluscs and higher

crustaceans, even if these are inhabitants of headwaters (Banarescu 1992). Evidence of allopatric

speciation includes populations of the mosquitofish Gambusia hubbsi on the Andros Island in the

Bahamas (Futuyma 2013). Genetic and morphological analyses indicated that incipient speciation

of the post Pleistocene population has occurred in this mosquitofish. Little or no gene flow

occurred between populations of these fish inhabiting underwater caves since the last glaciation.

The habitats in the caves are very similar except one pond has predatory fishes. As a result of

natural selection, in the high predation pond the body plan that enables a rapid burst of speed

evolved. However, in low predation ponds, selection favored a different body plan. The result of

this study indicated that in nature, speciation can occur as a product of divergence, producing

distinct physiological characteristics as evidence, long after speciation has concluded.

The purpose of this research was to determine if incipient speciation has occurred in three

freshwater species of fish -Rhinichthys atratulus (Blacknose Dace), Etheostoma olmstedi

(Tessellated Darter) and Catostomus commersonii (White Sucker) - in two isolated watersheds

separated since the last glacial period 17,500 years ago (The Earth Institute at Columbia University

2006). These two watersheds; the Bronx and Saw Mill Rivers are parallel to each other but are

completely separated by an insurmountable landmass. Figures 1.1 summarizes the locations of

these rivers.

This study was motivated by a previous chromosomal study on incipient speciation

conducted by Arcement and Rachlin in 1976. In that study, the karyotype of Fundulus diaphanus

from a population in the Hudson River was compared to another of the same species from a

population in Connecticut. These watersheds are adjacent but independent of each other. The

authors hypothesized that since the rivers have been separated for approximately 17,500 years,

5 chromosomal evolution of the isolated populations should be evident. Their results, based on

measurements of both long and short arms of the chromosomes, arm ratio, chromosomal types and

total arm length indicated there were subtle differences between both populations. The karyotypes

differed in the number of acrocentrics and secondary constrictions but were identical in modal

number, arm number and number of submetacentrics. These results may indicate incipient

speciation. This difference may have resulted from different environments acting as selective

agents.

Using their methodologies as a basis, these three species of fish - the Blacknose Dace, the

Tessellated Darter, and the White Sucker - from two different watersheds were evaluated in the

lower Westchester County region of New York; the Bronx and Saw Mill Rivers. In addition to

looking at chromosomal differences, as was done in the Arcement and Rachlin study, this study

expanded on their methodologies to determine if incipient speciation is occurring by incorporating

morphological and meristic analyses. This was accomplished by examining the osteology of the

fish after they had been cleared and stained. Furthermore, molecular techniques were utilized to

determine any changes that maybe indicated at the genetic (mtDNA) level.

1.2. Background: Post Glacial Redispersal

The distribution of fresh water fishes is the result of past geography. Post glacial history is

important to support the foundation of this research, which states that both river systems have been

separated since the Pleistocene. The Pleistocene epoch, which began 2.5-3.0 million years ago,

represents the world’s most recent period of repeated glaciations (Crowley and North 1991). One

third of the earth was covered with ice during this maximum glaciation. In North America, the

Wisconsinan was the last glacial age.

The Wisconsin glacial period commenced approximately 70,000 years ago and reached its

maximum 17,500 years ago. The glacial ice sheet covered almost the entire North American

7 continent. Two ice sheets, the Laurentide and Cordilleran, were more than a mile thick and

eliminated all aquatic life from the areas they occupied (Hocutt and Wiley 1986). As the ice sheet

advanced it gouged out large basins that dramatically altered the geography and climate over the

continent. Areas to the south of the ice sheet provided suitable habitats (refugia) for relict species

that were previously widespread in the northern section of the continent.

Recent research at Lamont-Doherty Earth Observatory on the isotope of beryllium 10Be

indicate that the glaciers began to melt and retreated at the end of the Wisconsin approximately

17,500 (The Earth Institute at Columbia University 2006) years ago, which indicated the end of the

Pleistocene. This resulted in the rise in sea level. The huge amount of water that was produced

covered the lowland streams and lakes that existed. Areas that were not covered with ice included

Beringia, parts of Alaska, northwestern Canada and southern sections of the continent (Crossman

and McAllister 1986). As the ice sheet retreated, animals and plants were able to return to the

once glaciated areas. This disrupted the distribution patterns of aquatic animals and produced

large numbers of small isolated populations that are evolutionarily different.

Twice in Pleistocene history this disruption has occurred, producing small isolated

populations of fish (Briggs 1995). It happened first during the peak of the glaciations when

populations were restricted to small habitats (refugia) and then again when post glacial streams and

lakes began to dry up. An example of this presently exists in the Great Basin of North America,

where large ancestral populations of fish once existed in the pluvial lakes about 10,000 years ago.

Small remnant populations of these fish currently exist in isolated springs and streams. Many of

these have undergone sufficient evolutionary change in their restricted environments to be

considered unique species.

The Wisconsin glaciation was a vicariant event that confined freshwater fishes to different

8 habitats, creating different species as these “genetic pools of fishes underwent evolutionary change

due to natural selection and genetic drift” (Hocutt and Wiley 1986).

As a result of the Wisconsin glaciation, the Bronx and Saw Mill Rivers now exist in

separate but parallel watersheds. They do, however, contain many of the same fish species that

have been separated since the end of the Wisconsin glaciation.

1.3. Field Collection

The two watersheds that were studied are the Bronx River and the Sawmill River. Both

rivers are ideal for this study as they exist in two separate and independent watersheds. Many

species of fish inhabit both rivers, however, the Blacknose Dace, the Tessellated Darter, and the

White Sucker were chosen because they are present in abundance in both rivers and they represent

three different families that thrived after the Laurentide ice sheet retreated.

Sampling of fish took place from June through September 2009 - 2010. Each site was

sampled twice weekly between 9am - 12 noon. Adult fish were collected using a 1.2 meter X 1.2

meter push net with a 0.3 cm mesh. The fish were transported back to the Laboratory for Marine

9 and Estuarine Research (LaMER) at Lehman College, in an aerated holding cooler, to be further

processed and analyzed.

In addition, measurements of physical water conditions were taken at each sampling site

during each collecting period. These included dissolved oxygen, pH, water temperature, total

dissolved solids and conductivity.

1.4. Study Areas: Saw Mill River at Chappaqua

The Saw Mill River emerges from a 1.75 acre Tercia pond in the town of New Castle

which is approximately 3.2km from Chappaqua. Chappaqua is located

at 41°15′65″N 073°77′56″W and its elevation is 150 m (492 feet) (Carbonaro 2007). The river is

approximately 32km (20 miles) long with an average width of 2-4 meters (8-12 feet) wide.

Upstream areas are 3-8 meters wide with a depth less than 1 meter. There is a common pattern of

alternating pools and riffles throughout the river. It flows from the town of New Castle and

empties in the Hudson River in the City of Yonkers. From New Castle, the river travels through

Mount Pleasant (including the villages of Pleasantville and Sleepy Hollow, though just

10 marginally), and Greenburg (including the unincorporated section and the villages of Tarrytown,

Elmsford, Irvington, Ardsley, Dobbs Ferry, and Hastings-on Hudson), on its way to Yonkers and

the Hudson River (Rachlin and Warkentine 2012).

The mouth of the Saw Mill River is widest where it receives an influx of water from the

Hudson River. Below the area where the Saw Mill River meets the Hudson River is a tidal estuary

where the lower half of the Hudson is influenced by saltwater from the Atlantic Ocean

(Rachlin and Warkentine 2012).

The Saw Mill River at Chappaqua is a low wetland area with no overhanging vegetation

(Figure1-2). It sits between a parking lot to the east and a railroad track to the west. Chappaqua is

characterized by woody climbing plants such as Ampelopsis brevipedunculata (porcelain berry),

Lonicera japonica (japanese honeysuckle) and Toxicodendron radicans (poison ivy), shrubs such

as Lindera benzoin (spice bush), Rosa multiflora (multiflora rose), and Rhus typhina (staghorn

sumac), and herbaceous flowering plants such as Alliaria petiolaris (garlic mustard), Barbarea

vulgaris (winter cress), and Ambrosia artemisiifolia (ragweed). However, moving further from the

source, the vegetation is characterized by a deciduous forest. This riparian zone helps to filter

pollutants and prevent river banks from erosion.

Included in the submerged aquatic vegetation at Chappaqua are Elodea canadensis

(Canadian waterweed) and Potamogeton crispus (curly pondweed). Aquatic vegetation serves as a

habitat for fish and contributes to the oxygenation of the river.

At the river’s source, the soil is made up of heterogeneous sediments of glacial origin

which covers the bottom of the river. Advancing down the river the soil is composed of mud and

sand to cobble and boulder. This provides a habitat for macro-invertebrates and fish.

The Saw Mill River watershed basin is 69 km (26.5 square miles) with an average width of

11 2.4 km (1.4 miles). Presently, 110,000 people lives in the watershed. The land bordering the

watershed is used for residential, commercial, and recreational purposes. Consequently, 63% of

the watershed consists of dense urban land development, 34% forest, and 1% for agricultural use

(Tran et al. 2010). The river lies between two parkways; the Saw Mill Parkway which criss-

crosses the river at a few places along its length and Route 9A.

1.5. Bronx River at Davis Brook

It is hypothesized that the Bronx River originated prior to the Pleistocene Period as a pre-

glacial stream with its source in present day upstate New York. Glaciers during the Pleistocene

then blocked the river’s path, modifying its course to the present position (Rachlin and Warkentine

2012). The Bronx River is 37 km (23 miles) long and its watershed is almost entirely contained

within Westchester County and the Bronx Borough of New York City.

The original source of the Bronx River is lost. The lake that developed when the Kensico

Dam was first built in 1888 to establish the Kensico Reservoir has drowned it. Thus the current

main tributary of the Bronx River immediately below the Kensico Dam is Davis Brook and this is

12 now the new source of the Bronx River (Rachlin and Warkentine 2012).

From its source at Davis brook, the river streams through Westchester County. It then

enters the Bronx County where it flows through the New York Botanical Garden and Wildlife

Conservation Society’s Zoological Gardens. It continues southward through commercial areas of

the South Bronx where it merges with salt water from the East River at Hunts Point, and ultimately

to Long Island Sound.

The Bronx River at Davis Brook is located at 41°04′23.63″N 73°46′20.04″W (Wang and

Pant 2010) with an elevation of 361 feet (Rachlin and Warkentine 2012). Davis Brook is saddled

between a parking lot on the right and a Metro north railroad track on the left. Davis Brook

consists of a secondary deciduous forest which contributes to the health of the river (Figure 1-3).

Included in the forest are broad leaf plant species such as Acer rubrum (red maple), Acer

platanoides (Norway maple) and Alnus incana (speckled alder). Common vines present include

Toxicodendron radicans (poison ivy) and Celastrus orbiculatus (asiatic bittersweet). Distichlis

spicata (spike grass) and Phragmites australis (common reed) are also abundantly present. The

forest not only lowers water temperature for aquatic organisms and preserve water quality by

filtering sediments from runoff, but also provides habitat and food for wildlife e.g. migrating birds

and insects.

The soil at the Bronx River is composed of glacial till and exhibits a wide range in particle

size from clay to boulder. The Bronx River watershed is bordered by a mix of residential,

parkland and industrial uses and is paralleled by the Bronx River Parkway.

1.6. Description of Fish and Historical Migration Patterns

The primary freshwater fish evolved entirely in freshwater. As a result of their physiology,

primary freshwater fishes are unable to pass barriers of sea water as they are salt intolerant.

Consequently, these primary fishes are confined to their own particular drainage system which is

bordered by a saltwater barrier. This makes the primary freshwater fish ideal for biogeographic

studies. These fishes can only migrate from one isolated stream to the next through changes in the

land. In the absence of human intervention, intermingling of fish between basins can only take

place during marine regressions when sea level decreases and downstream connections between

basins become possible, or during orogenesis, which allows river captures between opposite sides

14 of mountains (Reyjol et al. 2007).

This inability to survive in saltwater makes the freshwater fish effective in reconstructing

past continental relationships as they must remain in freshwater and cannot be transported by

winds, floating debris, birds or other agents (Briggs 1995). In addition, the species used in this

study are not used for game or commercial purposes and therefore have little chance of being cross

introduced into the different river systems by humans. These features made these primary

freshwater fish ideal for this study.

1.7. Rhinichthys atratulus (Herman, 1804) - Blacknose Dace

The cyprinoids (minnows, daces, carps and chubs) are members of the superorder

Ostariophysi. Ostariophysan fish are dominant in freshwater habitats. This success is attributed

to the possession of a weberian apparatus that transmits sound impulses from the swim bladder to

the inner ear (Briggs 1995, 2005). This anatomical structure results in a heightened auditory

reception that allows these fish to detect and evade oncoming predators in the fresh water

environment. Ostariophysans are primary freshwater fishes (Myers 1938) that have been confined

to freshwater throughout their history.

The Cyprinidae is the most successful, in terms of diversity, and is therefore the largest

15 primary, freshwater fish family in the world with 210 genera and more than 2010 species. The

family presently has an extensive distribution in Eurasia, Africa, and North America (Berra 2007).

The oldest fossil cyprinids date to the Eocene of Asia (Jiajian 1990). This is consistent with the

view that the Orient, more specifically Southeast Asia, is the center of origin of cyprinids.

It is hypothesized that the Cyprinodontiform fish originated in the late Triassic (Parenti

1981). It then radiated in early Paleogene and was present in India by the Eocene (Hora 1939).

By the Oligocene they were in Western Europe (Banarescu 1992). At this time, Africa and Eurasia

were connected. This terrestrial connection greatly contributed to the dispersal of freshwater fauna

via glacier movements, and / or the shifting of streams caused by tectonic events, all through

southern Europe (Briggs 1995). The cyprinids then migrated to North America via the Bering land

bridge during low sea level of the Oligocene (Berra 2007) and to Africa by the Miocene (Van

Couvering 1977).

Cyprinids appear in the fossil record of North America in the mid-Oligocene (Cavender

1991). During the Miocene, Cyprinids in the west gradually dispersed eastward. Regions in the

west underwent several tectonic events, dividing populations into smaller fragments which resulted

in an increased rate of extinction (Banarescu 1992). However, eastern North America remained

relatively unaffected which aided the diversity of freshwater fishes.

Presently, the Blacknose Dace, Rhinichthys atratulus (Figure 1-4), a primary freshwater

fish, ranges from Nova Scotia Canada to Georgia and west to Mississippi and the Dakotas. The

Blacknose Dace inhabits pools of headwaters, creeks and rivers. R. atratulus feeds on aquatic

invertebrates such as insect larvae, nymphs, small crustaceans, c hironomids, small worms, and

algae. Fry forage on invertebrates in shallow water with soft silty substrates. As they grow their

diet changes. They then forage on invertebrates associated with riffles and deep eddying pools

16 (Tarter 1970).

R. atratulus matures by age two and lives for 2-3 years. Spawning occurs in late May or

early June in shallow pools with gravel bottoms as well as in slow runs with temperatures ranging

from 15.60 C to 220 C (Traver 1929, Schwartz, 1958). At hatching, the length of fry is 5mm long.

At age one year the hatchling is 29mm long and 45mm by age two (Noble 1965). The species

seldom reaches 102 mm (Trautman 1957).

Blacknose Dace use shaded areas as cover, and can be found in clear streams in undercut

banks, roots, brush, and overhanging vegetation (Trautman 1957). Adult Blacknose Dace typically

occur in rocky and gravelly streams (Bragg and Stasiak 1978) with highest densities over gravel-

cobble substrates (Gibbons and Gee 1972). During the winter the Blacknose Dace migrate from

cool headwater streams into rivers (Noble 1965).

1.8. Etheostoma olmstedi, (Storer, 1842) - Tessellated Darter

Collette and Banarescu (1977) propose that the primary freshwater fish family Percidae

originated in Europe, then dispersed over the North Atlantic land bridge between the end of the

Cretaceous, early Miocene. During the Miocene contact between Europe and North America was

disrupted due to continental drift and the warming of the continent. This resulted in the

development of two independent percid faunas.

In North America, the Percidae family has approximately 10 genera which include 195

species, the second largest freshwater fish family (second to the Cyprinidae) (Wood and Mayden

1997). Percids range from eastern North America, through Europe and northern Asia. They are

17 however missing from eastern Asia and western North America.

Etheostoma is the largest genus of North American freshwater fishes with about 123

species. The Tessellated Darter (Figure 1-5) can be recognized by the tessellations dark ”W” or

“M” markings on the sides. This species lacks a swim bladder and has a rounded tail that is not

very efficient for swimming. As a result, the darter sits on the substrate and “darts” from place to

place.

Darters favor sandy substrates with moderate to slow-flowing water. Spawning occurs in

late April or May in shallow streams with rocky bottoms. The female lays 30 to 200 eggs on the

underside of a rock. The male fertilizes the eggs as they are laid.

The Tessellated Darter's diet is composed of benthic invertebrates such as chironomids

cladocerca, copepods, amphipods and mayfly nymphs. Darters live for 3-4 years and reach

approximately 88mm in length when fully grown. Darters are not used in commercial fishing but

may serve as forage items for other game species (Werner 2004).

1.9. Catostomus commersonii - (Lacepède, 1803) - White Sucker

It is hypothesized that the family Catostomidae originated in Asia and migrated to North

America by crossing the Bering Strait land bridge that existed during the Pleistocene epoch. The

oldest known fossils of the primary freshwater fish Catostomidae are from the Paleocene of

Alberta (Cavender 1986). There are 15 genera with 66 species and is presently found in China,

Northeastern Siberia, and North America.

The White Sucker (Catostomus commersonii) (Figure 1-6) is found in streams and rivers in

midwestern and northern North America. They are medium sized soft-rayed benthic fishes with a

protrusible mouth devoid of teeth. They tend to favor gravel bottoms with quick current (Werner

18 2004). Suckers migrate upstream to spawn, moving at night into fast flowing streams to mate.

Females can carry up to 140,000 eggs, and spawn in late April, early May. The eggs are hatched

within 5-10 days then the fry moves downstream to deeper water.

Fry feed on micro-crustaceans, rotifers and algae. As they grow their diet consists of

aquatic insect larvae, small worms, snails, clams and larger crustaceans such as copepods and

Daphnia. Suckers are a good indicator of water quality as they thrive in unpolluted water. White

suckers rarely live to age 10. Adults average 457mm in length (Werner 2004).

Chappaqua

Davis Brook

Figure 1-1. Geographic location of Saw Mill River at Chappaqua and Bronx River at Davis Brook (Rachlin and Warkentine 2012).

Figure 1-2. Saw Mill River at Chappaqua.

Figure 1-3. Bronx River at Davis Brook.

Figure 1-4. Blacknose Dace, Rhinichthys atratulus

Figure 1-5. Tessellated Darter, Etheostoma olmstedi

Figure 1-6. White Sucker, Catostomus commersonii

1.10. References

Arcement, R.J. and J. W. Rachlin. 1976. A study of the karyotype of a population of banded killifish (Fundulus diaphanus) from the Hudson River. Journal of Fish Biology 8:119-125.

Baker, R.J. and R.D. Bradley. 2006. Speciation in mammals and the genetic species concept. Journal of Mammology 87(4): 643-662.

Banarescu, P.1992. Zoogeography of Freshwaters, Vol. 1, pp 23-45. Aula-Verlag, Wiesbaden, Germany.

Berra, T.M. 2007. Freshwater Fish Distribution, pp. 89-97. University of Chicago Press, Chicago, IL. Bragg, R.J. and R.H. Stasiak. 1978. An ecological study of the Blacknose Dace, Rhinichthys atratulus, in Nebraska. Proceedings of Nebraska Academy of Science Affiliation Society. Cited from Sport Fish 23(4): 55.

Briggs, J.C. 1995. Global Biogeography, pp. 23-59. Elsevier Science B.V., Berlin, Germany.

22 Briggs, J.C. 2005. The biogeography of otophysian fishes (Ostariophysi: Otophysi): a new appraisal. Journal of Biogeography 32: 287–294.

Burridge, C.P., Craw, D. and J.M. Waters. 2006. River capture, range expansion, and cladogenesis: the genetic signature of freshwater vicariance. Evolution 60: 1038–1049.

Carbonaro, R.F. 2007. Effect of urban runoff on seasonal and spatial trends in the water quality of the Saw Mill River. Report submitted to the New York State Water Resources Institute. Retrieved 1.11.2015 from http://water.usgs.gov/wrri/06grants/progress/2006NY83B.pdf.

Cavender, T.M. 1986. Review of the fossil history of North American freshwater fishes. In The Zoogeography of North American freshwater fishes, pp. 699-724. C.H. Hocutt and E.O. Wiley, John Wiley, New York, NY.

Cavender, T.M. 1991. The fossil record of the Cyprinidae. In Winfield, I.J. and J.S. Nelson Cyprinid fishes: systematics, biology and exploitation, pp. 34-54. Chapman and Hall, Fish and Fisheries Service 3, London, U.K.

Collette, B.B. and P. Banarescu. 1977. Systematics and zoogeography of the fishes of the family Percidae. Journal of the Fisheries Research Board of Canada 34: 1450-1463.

Cowman, P.F. 2014. Historical factors that have shaped the evolution of tropical reef fishes: a review of phylogenies, biogeography, and remaining questions. Frontiers in Genetics 5: 1- 15. Coyne, J.A. 1994. Ernest Mayr and the origin of species. Evolution 43: 362-381.

Coyne, J.A. and H.A. Orr. 2004. Speciation, pp. 25-35. Sinauer Associates Inc., Sunderland, MA.

Cracraft, J. 1989. Speciation and its ontology: the empirical consequences of alternative species concepts for understanding patterns and processes of differentiation. In Otte, D. and J.A. Endler. Speciation and its consequences, pp. 29-59. Sinauer Associates Inc., Sunderland, MA.

Cristescu, M.E., Adamowicz, S.J., Vaillant, J.J. and D.G. Haffner. 2010. Ancient Lakes Revisited: from ecology to the genetics of speciation. Molecular Ecology. 19: 4837-4851.

Crossman, E.J and D.E. McAllister. 1986. Zoogeography of freshwater fishes of the Hudson Bay drainage, Ungava Bay and the Arctic archipelago. In Hocutt, C.H. and E.O. Wiley. The Zoogeography of North American Freshwater fishes, pp. 53-104. John Wiley, New York. Crowley, T.J. and G.R. North. 1991. Paleoclimatology, pg. 335. Oxford University Press, New

York.

23 Dawson, M.N. and W.M. Hamner. 2008. A biophysical perspective on dispersal and the geography of evolution in marine and terrestrial systems. Journal of the Royal Society Interface 5: 135–150.

Futuyma, D.J. 2013. Evolutionary Biology, 3rd Edition, pp 484-509. Sinauer Associates Inc., Sunderland, MA.

Gibbons, J. R. H. and J. H. Gee. 1972. Ecological segregation between Longnose and Blacknose Dace (genus Rhinichthys) in the Mink River, Manitoba. Journal of Fisheries Research Board of Canada 29: 1245-1252.

Hocutt, C.H. and E.O.Wiley. 1986. The Zoology of North American Freshwater Fishes, pp. 131- 158. Wiley Interscience Publication, New York, NY.

Hora, S.L. 1939. On some fossil fish scales from the Inter-trappean beds at Deothan and Kheri, Central Province. Records of the Geological Survey of India 73: 267-294.

Jiajian, Z. 1990. The Cyprinidae fossils from middle Miocene of Shanwang Basin. Vertebrata PalAsiatica 28(2): 95-127.

Mayden, R.L. 1997. A hierarchy of species concepts: the denouement in the saga of the species problem. In Claridge, M.F., Dawah, H.A., and M.R. Wilson. Species: in the units of biodiversity, pp. 381- 424. Chapman and Hall, New York, NY.

Mayr, E. 1949. The species concept: semantic versus semantics. Evolution 3: 371-372.

Mayr, E. 1969. The biological meaning of species. Biological Journal of the Linnean Society 1: 311-320.

McCune, A.R. 1997. How fast is speciation? Molecular, geological, and phylogenetic evidence from adaptive radiations of fishes. In Givnish, T.J and K.J. Sytsma. Molecular Evolution and Adaptive Radiation, pp.585-610. Cambridge University Press, Cambridge, U.K.

Myers, G.S. 1938. Fresh-water fishes and West Indian Zoogeography. Smithsonian Report 1937: 339–364.

Noble, R. L. 1965. Life history and ecology of western Blacknose Dace, Boone County, Iowa, 1963-1964. Iowa Academy of Science 72: 282-293.

Parenti, L.R. 1981. A phylogenetic and biogeographic analysis of Cyprinodontiform fishes (Teleostei, Atherinomorpha). Bulletin of the American Museum of Natural History 168: 335-557.

Rachlin, J.W. and B.E. Warkentine. 2012. An evaluation of fish assemblages of the Saw Mill

River, New York: an urban stream. Northeastern Naturalist 19 (special issue 6): 129-142.

24 Reyjol, Y, Hugueny, B., Pont, D., Bianco, P.G., Beier, U., Caiola, N., Casals, F., and T. Virbickas. 2007. Patterns in species richness and endemism of European freshwater fish. Global Ecology and Biogeography 16: 65–75.

Schwartz, F.J. 1958. The breeding behavior of the southern Blacknose Dace, Rhinichthys atratulus obtusus Agassiz. Copeia 1958: 141-143.

Tarter, D.C. 1970. Food and feeding habits of the western Blacknose Dace, Rhinichthys atratulus meleagris Agassiz, in Doe Run, Meade County, Kentucky. American Midland Naturalist 83: 134-159.

The Earth Institute at Columbia University. 2006. New study shows much of the world emerged from last ice age together. Science Daily. Retrieved 1.12.15 from www.sciencedaily.com/releases/2006/06/060611101855.htm.

Tran, C.P., Bode, R.W., Smith, A.J., and G.S. Kleppel. 2010. Land-use proximity as a basis for assessing stream water quality in New York State (USA). Ecological Indicators 10: 727– 733.

Trautman, M.B. 1957. The fishes of Ohio, pg.683. Ohio State University Press, Columbus, OH.

Traver, J.R. 1929. The habits of the Blacknosed Dace, Rhinichthys atronasus (Mitchell). Journal Elisha Mitchell Scientific Society 45(1): 101-129.

Van Couvering, J.A.H. 1977. Early records of freshwater fishes in Africa. Copeia 1: 163-166.

Vega, G.C. and J.J. Wiens. 2012. Why are there so few fish in the sea? Proceedings of the Royal Society B 279: 2323–2329.

Wang, J. and H.K. Pant. 2010. Identification of organic phosphorus compounds in the Bronx River bed sediments by phosphorus-31 nuclear magnetic resonance spectroscopy. Environmental Monitoring and Assessment 171: 309–319.

Werner, R.G. 2004. Freshwater Fishes of the Northeastern United States, pp. 260-261. Syracuse University Press, Syracuse, NY.

Wood, R.M. and R.L. Mayden. 1997. Phylogenetic relationships among selected darter subgenera (Teleostei: Percidae) as inferred from analysis of allozymes. Copeia 2: 265-274.

Chapter 2: Chromosomal evolution in three freshwater fish species from two isolated watershed

Abstract: Chromosomal data have been used to investigate phylogenetic relationships among

taxa. In a previous study conducted by Arcement and Rachlin (1976) chromosomal analyses of

two populations of Fundulus diaphanous from two isolated rivers that had been separated since the

Pleistocene glaciations revealed a difference in chromosome number and type. In the present

study the karyotype of three different species (Catostomus commersonii (White Sucker),

Etheostoma olmstedi (Tessellated Darter), and Rhinichthys atratulus (Blacknose Dace)) from two

isolated watersheds, the Bronx and Saw Mill Rivers, which had been separated since the last

26 glacial retreat 17,500 years ago, were studied to determine if there were significant differences

between their chromosome number and type. The results of the chromosomal analyses for the

Blacknose Dace, Tessellated Darter and White Sucker from each river yielded a diploid

chromosome number of 2n = 50, 2n = 48 and 2n = 98 respectively. These results show that there

was no difference between chromosome number and type between populations, and therefore no

evidence of chromosomal evolution between populations of these fish between both rivers since

the Pleistocene glaciations is indicated.

2.1. Introduction

Proper resolution of fish chromosomes has become a valuable tool for studies defining

genetically isolated populations and for assessing phylogenetic relationships (Levitzky 1931,

Rachlin et al. 1978, Rivlin et al. 1985). The morphology of chromosomes, i.e. their visual

appearance in the nucleus of the cell, can be used to resolve the systematics of a family as the

detailed observation of chromosomes provides a view into the individual’s genetic makeup

(Dobigny et al., 2004).

The number of chromosomes varies among species. At the low end, the nematode,

Parascaris univalens has a diploid number 2n=2 (Goday and Pimpinelli 1986). In animals, one of

27 the highest in chromosome number is the short nose sturgeon, Acipenser brevirostrum with 2n=

372 chromosomes (Kim et al. 2005). The high record is amongst the ferns with the Adder’s-

Tongue Fern Ophioglossum having 2n=1,262 chromosomes (Khandelwal 1990).

Each species has a fixed number of chromosomes and the shapes and sizes of those

chromosomes are specific to each as well. As a result, dissimilarity in chromosomal number

provides the groundwork for a range of studies that examines taxonomic relationships between

species. In some cases there is even significant variation within species (Godfrey and Masters

2000, Candan 2013). A notable example is the Indian Muntjac (Muntiacus muntjak), which has a

diploid chromosome number of 2n=7 in the male and 2n=6 in the female. Its relative, the Reeve’s

muntjac (Muntiacus reevesi) has a diploid number of 2n=46 and the karyotypes of the two species

are very different (Wurster and Benirschke 1970). Based on the differences in morphology,

chromosomal analysis is sufficient to distinguish one species from another and therefore is a

reliable scientific tool for research (Gates 1925, Stebbins 1950, Dobigny et al. 2004, Zhang 2011).

In this study, an investigation into the morphology of mitotic chromosomes of three

freshwater fish species was performed to determine if there were any differences between

populations of these freshwater fish species that have been isolated since the Pleistocene

glaciations.

Mitotic chromosomes offer a unique opportunity to observe the organism’s DNA as the

karyotype provides a phenotypic view of the genotype. Arcement and Rachlin (1976) studied the

karyotype of Fundulus diaphanus from two populations of fish in two isolated watersheds that

have been separated for 17,500 years. Their main goal was to decipher differences, if any, present

in the karyotypes of both populations. Results from the study did indicate that there were subtle

28 differences in the chromosomal morphology of these isolated populations. They indicated that

these changes could be the initial stage in the process of speciation. Further, Arcement and

Rachlin speculated that this could be due to the environment acting as a selecting agent.

The Arcement and Rachlin study was predicated on studies by Avise and Selander in 1972

and Patton in 1972. Avise analyzed alloenzymes (variant forms of an enzyme that are coded by

different alleles at the same locus) of cave dwelling fishes of the genus Astyanax. He

hypothesized that if cave environments are relatively stable and uniform temporally and spatially,

genetic variability would be low. Avise demonstrated that several species of cave dwelling fishes

that had been separated since the Pleistocene glaciations differed genetically and morphologically

from each other.

Patton 1972 corroborated Avise’s results. He proved that the chromosomal diversity within

Thomomys bottae, a pocket gopher, lies not in diploid number but almost totally in chromosome

morphology. While most individual populations of T. bottae are karyotypically unique, a general

pattern of geographic variation was apparent among different localities. This gave support to the

theory that analyzing the structure of chromosomes can indicate how different isolated populations

are.

Howell and Villa (1976) conducted chromosomal studies on the Blacknose Dace

(Rhinichthys atratulus) and the Longnose Dace (Rhinichthys cataractae). They compared the

karyotypes of these two cyprinid fishes to decipher if there were any gross karyotypic differences

between the two species. Their results revealed that there were no differences in gross karyotype

of the two Rhinichthys and both fish had a diploid number of 2n=50.

Tetraploidy in suckers have been reported by Beamish and Tsuyuki (1971) in North

American catostomids. They reported that C. commersonii have 2n=98-100 chromosomes.

29 Beamish and Tsuyuki (1971) hypothesized that the catostomids underwent duplication of their

chromosomal complement in Asia and that the evolution of tetraploidy is closely related to the

success of the family. A chromosome number of 2n=98 was confirmed for C. commersonii by

Uyeno and Smith in 1972 using differential staining techniques.

Chromosomes of both European and North American species of the family Percidae have

been analyzed karyologically. The Tessellated Darter, which is a member of the family Percidae,

has a diploid chromosome number 2n = 48 (Gold et al. 1980).

In this study, mitotic chromosomes were treated with a differential stain called Giemsa.

Chromosomes display a banded pattern when treated with Giemsa stain that varies in width and

intensity. Bands are alternating light and dark stripes that appear along the lengths of

chromosomes (Dobigny et al. 2004). Heterochromatic regions when treated with Giemsa stain

more darkly as these regions are rich in adenine and thymine. In contrast, regions rich in guanine

and cytosine incorporate less Giemsa stain and are therefore less bright in color. The presence of

these dark and light banded regions on each chromosome can be used to compare similarities or

differences between populations of fish. In addition, these unique banding patterns can be used to

identify if any chromosomal abnormality are present (Iannuzzi and Berardino 2008, Acton 2013).

Some of these chromosomal aberrations may become fixed in the population by positive selection

over time and could possibly be observed.

Therefore, the question asked was are there any observable chromosomal differences

between the three target species found in these two parallel watersheds that have been separated

since the Pleistocene?

2.2. Materials and Methods

The method used to obtain chromosome spreads from gill epithelium was taken from

Rivlin et al. 1985. Gill epithelium is preferred for use as the cells are in an active state of division

within the different filaments and there is a wealth of tissue for chromosome study. Colchicine was

used to arrest cell division during mitosis in metaphase. An intraperitoneal injection of 0.1 ml of a

0.1% colchicine solution was injected into each fish. Fish were then placed in an aerated cooler

and then transported to the Laboratory of Marine and Estuarine Research (LaMER) at Lehman

College.

Cell Harvest

31 After three hours post injection of colchicine solution, each fish was sacrificed using 0.1%

solution of MS222 (tricaine methanesulphonate) until opercular activity ceased. Gill arches were

removed from the right side of the fish only and then placed in a hypotonic 0.075 M potassium

chloride solution (KCl) for two hours. The voucher specimens were then preserved in 75%

ethanol.

After 20 minutes, the solution of KCl was decanted and the gill arches were then rinsed in

freshly made, cold, 3:1 absolute methanol: glacial acetic acid fixative for 30 minutes. The fixative

was then poured off and replaced with a fresh cold fixative for 10 minutes. This was repeated two

more times for a total of 1 hour in the fixative.

In addition to acting as a fixative, methanol is used in combination with glacial acetic acid

to aid in the swelling of cells (Denton 1973) as glacial acetic acid is 100% vinegar and has a higher

penetrating power than alcohol. The swelling of cells is desirable as it preserves the structure of

the chromosomes by way of decreasing the probability of distortion through shrinkage (Denton

1973) and by preventing the overlapping or bundling of chromosomes. This allows the

chromosomes to be more visible and easier to analyze. Furthermore, methanol and glacial acetic

acid are used to remove the last traces of the solution of KCl (Rivlin et al. 1985).

Slide Preparation

Microscope slides were previously washed with detergent, dipped into two changes of 95%

ethanol, dried then stored. Cleaned slides were dipped in 95% ethanol then swirled in distilled

water until the water sheets. After an hour in the fixative, each gill arch was picked up with curved

forceps, then holding the slide at a 45o angle, the gill filaments were gently dabbed onto the slides

for 3-5 spots (Rivlin et al.). The slides were then laid flat to dry overnight.

Giemsa Staining

32 The slides were stained with 4% Giemsa (2 ml Giemsa: 50 ml Sorensen phosphate buffer

solution) for 10 minutes at room temperature and then allowed to dry for at least 15 minutes. The

slides were then scanned at 40X with a light microscope. The preferred chromosome spreads were

photographed using a Motic USB2 camera with an oil immersion objective of 100X.

Levan Scale

Morphological identification of chromosomes types in relation to centromere position and

relative arm length provide important information when karyotyes are described. Karyotypes

made from mitotic metaphase chromosome spreads were studied according to the protocol

proposed by Levan et al. 1964. Levan et al. (1964) developed a system of classification based on

centromeric position. The location of the centromere can be expressed as a ratio “r = L / S”, where

“L” represent the length of the long arm and “S” represent the length of the short arm of the

chromosome. On a scale of 1-7, a chromosome was considered to be terminal if the L/S ratio was

above 7, sub-terminal if between 3.00-6.99, sub-median if between 1.71-2.99 and median if

between 1.00-1.70 (Table 2.1, Figure 2.1).

Each chromosome spread was counted and measurements of the total length, Long (L) and

Short arm (S) lengths were recorded. Attention was paid to the length of the chromatid and the

position of the centromere and was classified accordingly. Three chromosome spreads of each fish

from each species were compared.

2.3. Results

Tables 2.2, 2.3, and 2.4 summarize the cytogenetic results for the Blacknose Dace, White

Sucker and Tessellated Darter respectively. A total of 66 metaphase spreads were examined for

the Blacknose Dace from each river (Figure 2.2, Table 2.2). Chromosomal counts obtained for the

Blacknose Dace indicated the 2n modal number to be 50. There was no difference in

chromosomal type between the two populations. There were 16 metacentric, 28 submetacentric, 2

subtelocentric and 4 telocentric chromosome types in the two populations for both rivers. The

result for the Blacknose Dace did not indicate chromosomal evolution between both rivers.

Analysis of the karyotype for the White Sucker yielded similar results. A modal number of

34 98 was obtained for both populations of White Sucker from each river (Figure 2.3, Table 2.3). The

karyotype consists of 5 metacentric, 7 submetacentric and 86 subtelocentric.

It was also revealed that the chromosome 2n modal number for the Tessellated Darter was

48 (Figure 2.4, Table 2.4). There were only two chromosomal types for the Tessellated Darter. A

count of 42 acrocentric and 6 telocentric was recorded. There were no differences between the

populations for both rivers.

2.4. Discussion

The role chromosomal changes play in evolutionary divergence and relationship is evident

throughout the biological literature. One notable example is the evolutionary relationship between

chimpanzee (Pan troglodyte) and human (Homo sapiens). Scientists have questioned why these

related hominids have different sets of chromosomes: humans have 23 (2n = 46) pairs of

chromosomes and chimpanzees have 24 (2n = 48) pair. It was discovered that human chromosome

number 2 is a result of the fusion of the ancestral chimp chromosome 12 and 13. This

chromosomal rearrangement resulted in the inactivation of one of the two original centromeres and

the sequences that resided near the ends of the ancestral chromosomes are now located in the

35 middle. This rearrangement resulted in two closely related but different species

(Mikkelsen et al. 2005, Miller 2008).

In addition, chromosomal analyses have been proven to be reliable in detecting

homogeneity or heterogeneity between different species. This is evident in the genus of killifish,

Orestias. Chromosomal analyses indicated that the diploid numbers for this genus ranged from

2n=48 to 2n=55 and therefore divided the genus into two groups. In addition, each of the five

species of Orestias studied had a characteristic karyotype, with differences in chromosome

number, or chromosome morphology, or both (Vila et al. 2011).

The investigation of the chromosomes of the Blacknose Dace, Tessellated Darter and the

White Sucker did not reveal intraspecific differences between the two different populations of fish

in the Bronx and Saw Mill Rivers based on the technique used. There were no banding patterns

observed with Giemsa stain in this study. In comparison to other groups such as mammals and

birds, visualizing banding patterns in fish is difficult due to the small chromosome size (Fontana

2002). Furthermore, the genomes of endotherms tend to be rich in guanine and cytosine (GC)

whereas poikilotherms tend to be scarce in guanine and cytosine. This difference in GC

composition contributes to the difficulty in visualizing fish chromosomes (Medrano et al. 1988).

During this research it was apparent that in some instances the slightest variation in

measurement could shift the position of the centromere, therefore placing the chromosomes in one

category or the other. Metaphase spreads of the Blacknose Dace and the Tessellated Darter were

clear with the majority of the chromosomes neatly separated. However, in the case of the White

Sucker the numbers of metacentric and submetacentric chromosomes vary slightly due to L/S

ratio. This indistinctness could be attributed to the closeness of the chromosomes to each other and

could have altered the quantity of the chromosome types counted. However, since the end results

36 revealed the same karyotype profile, the proximity of the chromosomes had no bearing on the

results.

In the Arcement and Rachlin study (1976), it was discovered that the family Fundulidae

had a diploid chromosome number range 2n = 36 - 48. The difference in chromosome number may

be due to Robertsonian rearrangements. Among the major chromosomal changes involved in cases

of karyotype variability, the Robertsonian fusion-fission type is the most frequently occurring.

The Robertsonian fusion-fission phenomenon does not affect the size of the genome. This

phenomenon affects the type of chromosome present and occurs as a breakage in the short arms of

two acrocentric chromosomes and the subsequent fusion of the long arms into a single

chromosome. A Robertsonian fusion combines the long arms of two telocentric chromosomes. The

karyotype loses two telocentric chromosomes and gains a single meta or acrocentric chromosome.

This fusion result in a single chromosome and a reduction in chromosome number. The reciprocal

is called a Robertsonian fission. This occurs when a single meta or acrocentric chromosome splits

and the two arms segregate independently into two telocentrics (Singh et al. 2013). Other

examples of karyotype evolution by means of Robertsonian translocation have also been reported

in Gerbillus pyramidum (Wahrman and Gourevitz 1973) and Rattus rattus (Yosida et al. 1974).

The methodology used in this research did not reveal a difference in chromosome

morphology between different fish populations, therefore, the use of other techniques is required.

Fluorescent in situ hybridization (FISH) is a methodology that has become available to replace

conventional Giemsa stain (Nakano and Kodama 2001). This technique uses painting of specific

chromosomes with fluorescent dyes through in situ hybridization. FISH is based on DNA probes

annealing to specific target sequence of sample DNA. Initially short sequences of single-stranded

DNA that match a portion of the gene the researcher is looking for are created. These are called

37 probes. The probe is then labeled with a fluorescent dye. Since the probe is single stranded DNA,

it binds to the complementary strand of DNA on the organism’s chromosomes. As the probe binds

to the chromosome, its fluorescent tag provides a way for researchers to see its location and

enables the detection of specific DNA sequences on chromosomes. The high sensitivity and

specificity of the probe can be used in the detailed analysis of chromosome structure (Bishop

2010).

This technique has been successful in the investigation of the chromosomal

rearrangements that have occurred in the karyotypes of two stickleback species: the threespine

stickleback (G. aculeatus) and the fourspine stickleback (A. quadracus) since they diverged from a

common ancestor. The researchers discovered that A. quadracus and G. aculeatus diverged

approximately 35 million years ago and possess different chromosome number and type of

chromosomes (Urton et al. 2011).

Another methodology that is applicable involves the investigation of the nucleolar

organizing region (NOR). The NOR is the chromosomal region around which the nucleolus

forms. This region contains several copies of ribosomal DNA genes. This procedure involves

silver staining (silver nitrate solution) of the "nucleolar organizing region", which contains rRNA

genes. The number of stain deposited and the number of NORs differs among populations.

In a study by Brassesco et al. (2004) it was demonstrated that the use of NOR staining was

important in determining the differences among eight species of the freshwater fish Curimatidae.

Although the species were similar genetically and morphologically, it was possible to differentiate

between C. platanus and P. squamoralevis using markers neither revealed by NOR staining

(Brassesco et al. 2004).

In this study analysis using Giemsa stain revealed no chromosomal changes between

38 populations and did not support divergence between species. Insufficient time and a lack of

resources made it impossible to employ these methodologies (FISH and NOR). Future research

should include fluorescent in situ hybridization and NOR staining as both methodologies select for

different nucleotides and have been proven to be successful in the detailed analysis of chromosome

structure.

Table 2-1. Nomenclature for centromeric position of chromosomes (Levan et al. 1964).

Chromosome Designation Centromeric Position Median Metacentric Sub-median Sub-metacentric Terminal region Acrocentric Sub-terminal Sub-telocentric Terminal Telocentric Lateral N/A

Lateral

39 Median

Median

Sub–median

Sub-terminal

Terminal

Figure 2-1. Diagram of centromeric position of chromosomes (Levan et al. 1964).

˽ 100 µm

Figure 2-2. Metaphase plate of Rhinichthys atratulus (Blacknose Dace). Bars represent 100 µm.

Table 2-2. Comparison of karyotypes of two populations of Blacknose Dace.

Karyotype of Blacknose Bronx River Saw Mill River Dace N=22 N=22 Number of cells analyzed 66 66 (3 spreads per fish) Modal number 50 50

Metacentric 16 16

Submetacentric 28 28

Subtelocentric 2 2

Telocentric 4 4

˽ 100 µm

Figure 2-3. Metaphase plate of Catostomus commersonii (White Sucker). Bars represent 100 µm.

Table 2-3. Comparison of karyotypes of two populations of White Sucker.

Karyotype of Bronx River Saw Mill River White Sucker N=17 N=20

Number of cells 51 60 (3 spreads per fish) Modal number 98 98

Metacentric 5 5

Submetacentric 7 7

Subtelocentric 86 86

˽ 100µm

42 Figure 2-4. Metaphase plate of Etheostoma olmstedi (Tessellated Darter). Bars represent 100 µm.

Table 2-4. Comparison of karyotypes of two populations of Tessellated Darter.

Karyotype of Bronx River Saw Mill River Tessellated Darter N=10 N=12

Number of cells 30 36 (3 spreads per fish)

Modal number 48 48

Acrocentric 42 42

Telocentric 6 6

2.5. References

Acton, A. 2013. Cell Nucleus Structures - Advances in research and application, pg.116. Scholarly Editions, Atlanta, GA.

Arcement, R.J. and J.W. Rachlin. 1976. A study of the karyotype of a population of banded killifish, Fundulus diaphanus, from the Hudson River. Journal of Fish Biology 8:119-125.

Avise, J.C. and R.K. Selander. 1972. Evolutionary dwelling of cave - dwelling fishes of the genus Astyanex. Evolution 26: 1-19.

Beamish, R.J. and H. Tsuyuki. 1971. A biochemical and cytological study of the Longnose Sucker (Catostomus catostomus) and large and dwarf forms of the White Sucker (Catostomus commersonii). Journal of the Fisheries Research Board of Canada 28: 1745- 1748.

Bishop, R. 2010. Applications of fluorescence in situ hybridization (FISH) in detecting genetic

aberrations of medical significance. Bioscience Horizons 3(1): 85–95.

43 Brassesco, M.S., Pastori, M.C., Roncati, H.A. and A. S. Fenocchio. 2004. Comparative cytogenetic studies of Curimatidae (Pisces, Characiformes) from the middle Paraná River (Argentina). Genetics and Molecular Research 3(2): 293–301.

Candan, F. 2013. Some observations on plant karyology and investigation methods. In Silva- Opps, M. Current Progress in Biological Research, Chapter 10, pp. 217-255. Intech Publishers, Croatia.

Denton, T.E. 1973. Fish chromosome methodology, pg. 10. Charles C. Thomas Publisher LTD., Springfield, IL.

Dobigny, G., Ducroz, J.F., Robinson, T. J. and V. Volobouev. 2004. Cytogenetics and cladistics. Systematic Biology 53(3): 470 - 484.

Fontana, F. 2002. A cytogenetic approach to the study of taxonomy and the evolution in sturgeons. Journal of Applied Ichthyology 18: 226 - 233.

Gates, R.R. 1925. Symposium on species and chromosomes: species and chromosomes. The American Naturalist 59: 193-224.

Goday, C. and S. Pimpinelli. 1986. Cytological analysis of chromosomes in the two species Parascaris univalens and P. equorum. Chromosoma 94: 1-10.

Godfrey, L.R. and J. Masters. 2000. Kinetochore reproduction theory may explain rapid chromosome evolution. Proceedings of the National Academy of Sciences 97: 9821– 9823.

Gold, J., Karel, W.J. and M. R. Strand. 1980. Chromosome formulae of North American fishes. The Progressive Fish-Culturist 42: 10-23.

Howell, W.M. and J. Villa. 1976. Chromosomal homogeneity in two sympatric cyprinid fishes of the genus Rhinichthys. Copeia 1: 112-116.

Iannuzzi, L. and D.D. Berardino. 2008. Tools of the trade: diagnostics and research in domestic animal cytogenetics. Journal of Applied Genetics 49(4): 357-366.

Khandelwal, S. 1990. Chromosome evolution in the genus Ophioglossum L. Journal of the Linnean Society 102: 205-217.

Kim, D.S., Nam, K.Y., Noh, K.J., Park, H.C. and F.A. Chapman. 2005. Karyotype of the North American Shortnose Sturgeon Acipenser brevirostrum with the highest chromosome number in the Acipenseriformes. Short Report. Ichthyological Research 52: 94-97.

Levan, A., Freda, K. and A.N. Sondberg. 1964. Nomenclature for centromeric position of

chromosomes. Hereditas 52: 201-220.

44 Levitzky, G.A. 1931. The karyotype in systematic. Bulletin of Applied Botany and Genetics in Plant Breeding 27: 220-40.

Medrano, L., Bernardi, G., Couturier, J., Dutrillaux, B. and G.Bernardi. 1988. Chromosome banding and genome compartmentalization in fishes. Chromosoma 96: 178-183.

Mikkelsen, T. S., Hillier, L.W., Eichler, E. E., Zody1, M. C., Jaffe, D. B., Yang, S., Enard,W. and I. Hellmann. 2005. Initial sequence of the chimpanzee genome and comparison with the human genome. Nature 437: 69-87.

Miller, R.K. 2008. Only a Theory, pp.106-107. Viking Press-Penguin House, New York, NY.

Nakano, M. and Y. Kodama. 2001. Detection of stable chromosome aberrations by FISH in A-

bomb survivors: comparison with previous solid Giemsa staining data on the same 230 individuals. International Journal of Radiation Biology 77: 971-7.

Patton, J. L. 1972. Patterns of geographic variation in karyotype in the pocket gopher, Thomomys bottae (Eydoux and Gervais). Evolution 26: 574-586.

Rachlin, J.W., Beck, A. and J.M. O’Conner. 1978. Karyotypic analysis of the Hudson River striped bass, Morone saxatilis. Copeia 2: 343-345.

Rivlin, K., Rachlin, J.W. and G. Dale. 1985. A simple method for the preparation of fish chromosomes applicable to field work, teaching and banding. Journal of Fish Biology 26: 267-272.

Singh, S.S., Singh, C.B. and G. Waikhom. 2013. Karyotype analysis of the new catfish Mystus ngasep (Siluriformes: Bagridae) from Manipur, India. Turkish Journal of Fisheries and Aquatic Sciences 13: 179-185.

Stebbins, G.L. 1950. Variation and evolution in plants, Chapter 12, pg. 25. The Karyotype. Columbia University Press, New York, N.Y.

Urton, J.R., McCann, S.R., and C.L Peichel. 2011. Karyotype differentiation between two stickleback species (Gasterosteidae). Cytogenetic and Genome Research 135: 150–159.

Uyeno, T. and G.R. Smith. 1972. Tetraploid origin of the karyotype of catostomid fishes. Science 175: 644-646.

Vila, I., Scott, S., Mendez, M. A., Valenzuela, F., Iturra, P. and E. Poulin. 2011. Orestias gloriae, a new species of cyprinodontid fish from saltpan spring of the southern high Andes (Teleostei: Cyprinodontidae). Ichthyological Exploration of Freshwaters 22(4): 345–353.

Wahrman, J. and P. Gourewitz. 1973. Extreme chromosome variability in a colonizing rodent.

45 Chromosome Today 4: 399-424.

Wurster, D.H. and K. Benirschke. 1970. Indian Momtjac, Muntiacus muntiak: A Deer with a low diploid chromosome number. Science 168(3937): 1364 -1366.

Yosida, T. H., Kato, H., Tsuchiya, K., Sagait, T. and K. Moriwaki. 1974. Cytogenetic survey of black rats Rattus rattus, in South West and Central Asia, with special regard to the evolutional relationship between three geographical types. Chromosoma 45: 99-109.

Zhang, P. 2011. Karyotype studies on Tagetes erecta L. and Tagetes patula L. African Journal of

Biotechnology 10(72): 16138–16144.

Chapter 3: Geographic variation in biometric characters of three freshwater fish species from two isolated watersheds

Abstract: A comprehensive morphometric, meristic and osteological statistical analysis was

performed on three freshwater fish species - Catostomus commersonii (White Sucker), Etheostoma

olmstedi (Tessellated Darter), and Rhinichthys atratulus (Blacknose Dace) - that were collected

from the headwaters of the Bronx and Saw Mill Rivers. One way ANOVAs revealed that of the

fifty-two morphometric characters examined for the Blacknose Dace and the White Sucker 52%

showed a significant difference (p < 0.05) for the Blacknose Dace and 33% for the White Sucker.

For the Tessellated Darter fifteen of the sixty-two characters examined (24%) showed a significant

difference (p < 0.05). Meristic analyses revealed that of the fifteen counts conducted, only 4 46 (26%) were significantly different (p < 0.05) for the Blacknose Dace and 3 (20%) for the White

Sucker. There were no significant differences observed for the meristic count for the Tessellated

Darter between the two rivers. The p-values for the osteological data were comparable to that of

the meristic data, as there was a significant difference between the populations for the Blacknose

Dace (25%) and the White Sucker (12%) but not for the Tessellated Darter. These results indicate

subtle changes between populations and therefore support the hypothesis that there are differences

between the populations from the two isolated watersheds.

3.1. Introduction

Systematists are often interested in quantifying differences in form among different

species, conspecific populations, or ontogenic stages (Straus and Bookstein 1982). Morphometric

and meristic analysis remains the simplest and most direct way among methods of species

identification (Schaeffer 1976, Creech 1992, Mamuris et al. 1998, Bronte et al. 1999, Hockaday et

al. 2000). The study of morphological characters, with the aim of defining or characterizing

population units, has a long tradition in ichthyology (Ihssen et al. 1981, Tudela 1999, Murta 2000).

For instance, one of the earliest studies performed on the European anchovy, Engraulis

encrasicolus, aimed at identifying and categorizing individuals based on their morphology. This

47 early research grouped individuals from a taxonomic point of view leading to the establishment of

a number of subspecies, predominantly in the eastern Mediterranean (Fage 1911, Aleksandrov

1927, Shevchenko1981).

Using statistical tools to analyze morphological data has been practiced in biology for over

50 years (Reyment 2010). The science of morphometry--a set of statistical procedures used to

analyze variability in size and shape of organisms--was first implemented by Robert Blackith

(1957) while studying growth and form in insects (Kendall et al.1999, Reyment 2010). Using

measurements from the carapace of grasshoppers, Blackith (1957) was able to follow the

likelihood of the development of a swarming phase in a population of grasshoppers by pinpointing

morphological changes indicating a population explosion. Swarming, which is characterized by

different morphological, physiological and behavioral traits, is a defining characteristic of

grasshoppers and is characterized by flying adults (Blackith 1957). Swarms are nomadic, can

travel great distances and can rapidly strip fields and damage crops wherever the swarm settles

(Gray et al. 2009). Using a change in their morphology to predict behavior prompted the

integration of morphometric analyses in biological research and has since then proven to be a

reliable method in the field of biology (Blackith 1957, Simpson and Sword 2008, Gray et al.

2009).

In the field of ichthyological taxonomy measurable components called landmark features--

distances between physical features or landmarks of fish anatomy such as the size of body parts

and fins and its ratio of body length--have been integrated into the study of morphological

characters (Reyment 2010, Dwivedi and Dubey 2013, Muchlisin 2013). Landmark features were

initially developed by Strauss and Bookstein (1982) for fishes, but are applicable for diverse taxa.

Topographical positions that can be clearly defined on the anatomy in all organisms of the same

48 species with a high degree of precision and accuracy are referred to as landmark features.

According to Strauss and Brookstein (1982) these anatomical positions are true homologous points

which are identified by a consistent feature located at the same relative position, and provide a

spatial map of the position of the anatomical features for each individual.

These distance measurements allow one to infer the geometrical arrangement of the

individual fish shape (Barlow 1961, Rohlf 1990) and to statistically analyze morphology to

differentiate among different species and among different populations within a species (Murta

2000, Eagle et al. 2008). Landmark features can be displayed as a box-truss network as indicated

in Figure 3.1. In this research the number of fish examined for morphometric differentiation

between both rivers is shown in Table 3.1. and the landmark features used in this study is listed in

Table 3.2.

Adaptive variation in bone structure has been used to differentiate and classify fish at the

different taxonomic levels. Examples include the Cichlid fish of Africa (Sturmbauer 1992),

Parastromateus niger in the family Carangidae (Hilton et al. 2010), the Galician threespine

stickleback of northwest Spain (Hermida et al. 2005) and to differentiate between Etheostoma

olmstedi and Etheostoma nigrum in Canada (Chapleau and Pageau 1985).

For this reason, the objectives of the present study were to evaluate the morphometric

variations among three freshwater fish species. The questions to be answered were (1) is there

morphological difference between populations? (2) Is there significant morphological variation

between the populations? (3) If so, which morphological traits are involved?

3.2. Materials and Methods: Enzyme Clearing and Staining

The morphometric and meristic study was conducted using specimens fixed in 95 %

alcohol. Fish were cleared and stained according to the protocol published by Dingerkus and

Lowell (1977). Fish were washed, de-scaled and eviscerated. They were then stained with 10 mg

alcian blue in 20 ml glacial acetic acid and 80 ml of ethyl alcohol for 48 hours, and then

transferred to 95% ethyl alcohol for 2-3 hours. Each fish was then placed in a solution of saturated

sodium borate solution with 1% trypsin. Bony tissues were then stained with alizarin red S (Figure

3.2) in 0.5% potassium hydroxide solution (KOH) for 24 hours. Before storing in glycerin, the

specimens were dehydrated through graded changes in KOH - glycerin.

50 Morphometric, meristic and osteological characters were examined and recorded for the

Blacknose Dace, White Sucker and Tessellated Darter according to Hubbs and Lagler (1958) and

Rachlin (1987). All morphological measurements (Table 3.2) were determined with the use of a

caliper. Meristic (Table 3.3) and osteological counts (Table 3.4) were attained using a dissecting

microscope. Scale counts were taken prior to subjecting the fish to the clearing and staining

process. In order to ensure that meristic characters were completely defined and developed, only

adults were used, and to normalize the data, only adult fish or fish from the same age class were

used. Age of each fish was determined through scale analysis. Counting of meristic characters and

scale analysis were performed prior to the clearing and staining process. As in previous studies the

left side of each fish was used for this research (Klepaker 1995, McPhail 1993). To determine the

differences between the populations of fish from both rivers, an analysis of variance (ANOVA)

was performed on the morphometric, meristic and osteologic characters (Tables 3.2, 3.3, and 3.4

respectively). A value of p <0.05 indicated statistical significance for each statistical computation.

One-way ANOVAs and Principal component analyses were performed with PAST Statistical

software package V3.09 (Hammer et al. 2001).

3.3. Results

Fifty-two morphometric characters were compared for the Blacknose Dace and the White

Sucker. Twenty-seven characters (52 %) for the Blacknose Dace and seventeen (33 %) for the

White Sucker showed significant differences at p < 0.05. In addition, sixty-two characters were

analyzed for the Tessellated Darter but only fifteen (24%) of these had p-values less than 0.05.

The p-values for all meristic measurements are shown in Table 3.3. There is a significant

difference between the populations for the Blacknose Dace and White Sucker (26 %) from both

rivers, but not for the Tessellated Darter.

Eight osteological characters were examined and counted for each species (Table 3.4).

52 The findings were similar to that of the meristic data. Based on the results after performing a one-

way ANOVA there was a significant difference between the populations of the Blacknose Dace

(25%) and the White Sucker (12.5%) from both rivers, but no difference was found for the

Tessellated Darter.

Principal component analyses (PCA) were performed on the morphometric characters to

decipher any possible heterogeneity between populations of fish from both rivers. Figure, 3.3, 3.4

and 3.5 represents PCA analyses of the Blacknose Dace, White Sucker and the Tessellated Darter

respectively. The result of the PCA analysis for the Blacknose Dace (Figure 3.3) revealed two

separate groupings with character loadings on the first and second principal components which

accounted for 41.4% and 31.8% of the variance respectively. Unlike the Blacknose Dace separate

groups were not observed for the White Sucker (Figure 3.4) and the Tessellated Darter (Figure

3.5). A value of 74% and 22.9% accounted for the variance for the first and second components

for the White Sucker and 64.3 % and 13.3% for the Tessellated Darter.

3.4. Discussion

Morphological attributes, including meristic and osteological characters, have traditionally

been used to describe evolutionary relationships. According to Nayman (1965), morphometric

measurements and meristic counts are considered to be the easiest and most authentic methods for

the identification of specimens. Despite the introduction of new techniques which directly

examine biochemical or molecular genetic variation, morphometric analysis still plays an

important role in stock delineation even to date (Swain and Foote 1999, Muchlisin 2013).

In this study, the external and internal anatomy of the different fish species (Table 3.1)

from the Bronx and Saw Mill Rivers was analyzed to determine if there is anything

53 morphologically unique about each population that would support the hypothesis that there is a

difference between three populations of fish that have been separated since the last glaciation

17,500 years ago. The result of one-way ANOVAs indicated significant differences in several

measurements of the external morphology (Table 3.2) and the meristic and osteological counts

(Tables 3.3 and 3.4). In general there was a greater difference between populations for the

Blacknose Dace than for the White Sucker and the Tessellated Darter. The results of the PCA

analyses supported the morphometric data. Results of the PCA analysis showed a difference

between populations for the Blacknose Dace from both rivers. However, there were no clear

division for the White Sucker and the Tessellated Darter.

In general, fish demonstrate greater variances in morphological traits both within and

between populations than any other vertebrates and are more susceptible to environmentally

induced morphological variations (Allendorf and Phelps 1988, Wimberger 1992). Phenotypic

plasticity--the ability of an organism to express different phenotypes depending on the

environment (Agrawal 2001)--has been hypothesized to be an important strategy for organisms to

cope with environmental variations (Stearns 1983, Scheiner 1993). Through its ecological effects,

phenotypic plasticity can facilitate evolutionary change and speciation (Scheiner 1993).

Phenotypic plasticity in fish is very high, as fish are very sensitive to environmental

changes and quickly adapt themselves by changing their physiology and behavior (Hossain et al

2010). These modifications can ultimately change their morphology as morphological characters

can show high plasticity in response to differences in environmental conditions (Stearns 1983,

Hossain et al. 2010). Consequently, morphometric analysis is especially suitable to assess

environmental effects in fish (Swain and Foote 1999, Samaradivakara et al. 2012).

Fish morphology can change quickly in response to environmental factors (Ihssen et al.

54 1981). Swain et al. (2005) stated that morphological and skeletal variation in fish may exist

between isolated populations due to the different environmental conditions in the different habitats.

Previous research, including that on the Atlantic herring Clupea harengus (Blaxter 1957, Ryman et

al. 1984) and the Spanish sardine Sardinella aurita (Kinsley et al. 1994), described the existence

of genetically homogenous fish populations in different habitats that display morphological

variation and based on the results have concluded that this plays a major role as a basis for

phenotypic variability.

In general, different environmental factors can influence fish shape. These factors include

water temperature and salinity (Martin 1949), nutrition (Lovell 1989) and predation (Wimberger

1992). For example, water temperature is one of the most important environmental factors

influencing fish development (Blaxter 1992, Chambers and Leggett 1987). Variation in shape and

size can be attributed to differences in water temperatures. With few exceptions, northern

representatives of a species, or a genus, are larger than those in the south (Hubbs 1926, Vladykov

1934).

A close relationship between temperature and developmental/growth rates has also been

reported in many fish species (Pepin 1991, Martell et al. 2005, López-Olmeda and Sánchez-

Vázquez 2010). Growth rate determines body shape by altering the timing of transition from one

growth stanza to another (Huxley 1932, Martin 1949). Changes in growth rate and many

biochemical reaction rates are influenced as water temperature affects metabolism, respiration,

immune function and the oxygen demand of fish (Martell et al. 2005). Growth rate will double if

temperature increases by 100C (180F) within their preferred range. In general, the cooler the

water, the slower the development, while warmer waters cause development to speed up. This was

demonstrated by Martin (1949) who reared Rainbow Trout, Salmo gairdneri, at different

55 temperatures. Fish reared at higher temperatures grew faster but had smaller heads than those

developed at lower temperatures.

In addition, temperature not only affects morphological characters but it affects the

development of meristic characters such as scale and fin rays (Barlow 1961). Meristic characters

are fixed early in development. However, the number (i.e. the total amount) of elements is

determined by the developmental rate (Hubbs 1926, Gabriel 1944), which in turn can be

influenced by water temperature (as shown in the previous paragraph). Longer developmental

periods usually produce higher counts in meristic structures (Barlow 1961). Hence, a change in

temperature can affect the rate of growth and ultimately affect how many scales are present at

maturity.

Customarily, the cooler the temperature, the greater the meristic count (Hubbs 1926,

Taning 1952). This is evident in most fish in the northern and southern hemisphere. In the

northern hemisphere, meristic counts tend to be greater, when compared to the southern

hemisphere. In both hemispheres there is a good correlation between cooler environmental

temperatures and higher meristic counts.

Fin rays, which are the last anatomical structure to appear during development (Barlow

1958, Hubbs 1924), are also affected by fluctuations in temperature. Schmidt (1919) compared

guppies, Lebistes reticulatus, developed at 180C with those at 250C. This was further supported by

the work of Hubbs (1924) and Molander and Molander-Swedmark (1957).

To boot, the number of vertebrae are also affected by changes in temperature. In a study

conducted by Bailey and Gosline (1955) fish from a uniform genetic stock of Etheostoma nigrum,

the Johnny Darter, were subjected to different temperatures. Higher counts of vertebrae were

56 observed in cooler temperature than their cohorts in warmer temperatures. Gabriel (1944) and

Blaxter (1957) observed same results for the killifish Fundulus heteroclitus and the herring Clupea

harengus.

Previous morphometric studies have been completed on each species of fish used in this

research. Here I use these studies to compare and discuss different characters used to categorize

each fish in this research. In a study conducted by Joseph Eastman (1980) a total of 725 catostomid

fishes,--20 from different species and 13 genera--were examined for inter- and intra-specific

variation in the caudal skeleton. Due to its use for locomotion, more specifically propulsion, the

caudal skeleton (which supports and strengthens the caudal fin) is an important character for the

study of relationships and phylogeny. The caudal skeleton increases the forward movement of the

fish’s body. The shape of the tail, the rigidity of the elements i.e. pre-terminal and terminal

vertebrae in addition to epurals, uroneurals, urostyle, and hypurals, and the length of the caudal

peduncle (where the tail bends) all aid in the movement of the fish. The configuration of the bones

in the caudal skeleton tend to be different for fish residing in fast moving streams verses those in

slow moving streams. Of the 725 catostomid fishes investigated, 525 were White Suckers

(Catostomus commersonii). The results of the Eastman study indicated that the number of

elements in the caudal skeleton is a stable morphological character in the family Catostomidae.

Only one genus, Erimyzon, showed a reduced number of elements. In addition, other Catostomids

described in the Eastman study differed by the ossification of the caudal skeleton and presence of a

distinctly forked caudal tail as in the Humpback Sucker (Xyrauchen texanus) and the

Moxostomatini respectively. The number of hypural bones present is used to differentiate between

species in the family Catostomidae. In this research the number of hypural plate elements for the

White Sucker was found to be significantly different (p < 0.001) indicating that the process of

57 genetic drift is acting independently in both rivers.

In a study on Etheostoma olmstedi Cole (1965) investigated meristic characters and

suggested that the number of dorsal-rays, the number of left pectoral rays, and the number of

infraorbital canals were the three best characters to be used to discriminate between species of

Etheostoma. In addition, he (Cole 1967) also noted that the pores on the preoperculomandibular

canal and scalation indices permit one to distinguish different species with some accuracy (Cole

1965, 1967). Regrettably, research on the preoperculomandibular canal and the infraorbital canal

were the only two characters not included in this research. However, my analyses of the 16

meristic characters showed no significant differences between two isolated populations of the

Tessellated Darter (Table 3.3).

Characters deemed informative in deciphering different species within the family

Rhinichthys were used in this research. Hubbs and Lagler (1958) distinguished R. atratulus from

R. meleagris by its more slender caudal peduncle and larger eyes. In 1973, Scott and Grossman

suggested that R. obtusus and R. meleagris could be differentiated by the number of pectoral fin

rays. Trautman (1957) used mouth size and head shape to differentiate between R. obtusus and R.

meleagris.

In this study, the length and depth of the caudal peduncle and the number of scales in

lateral series were significantly different (p < 0.05) as in the studies mentioned above. All other

characters mentioned were not found to show a significant difference.

Morphometric methods can be used for localizing significant structural differences among

populations. In this study, morphometric measurements and meristic and osteologic counts

yielded significant information which may reflect incipient speciation between each species from

both rivers.

Table 3-1. Sample size of each fish from both rivers for morphological analyses.

Sample Size Bronx River Saw Mill (N) River Blacknose 34 38 Dace Tessellated 25 34 Darter

White Sucker 24 28

Figure 3-1. Illustration of the left side of specimen showing truss morphometric characters (Rachlin 1987).

Figure 3-2. Enzyme clearing and staining of the White Sucker caudal skeleton, magnification X3.

Table 3-2. Morphometric characters analyzed using one-way ANOVA, (p–values* = significance).

Morphological Characters in cm Dace Darter Sucker

Head Length 0.4719 0.7663 0.2882 Eye diameter 0.4627 0.3303 0.6121 Interorbital width 0.3007 0.0791 0.0994 Snout to anus 0.0687 *0.0027 *0.0146 Snout to anal fin 0.1786 0.1365 0.0713 Snout to origin of pelvic fin 0.6142 0.3403 *0.0011 Snout to origin of pectoral fin *0.0224 *0.0271 0.1417 ^Distance between 2 dorsal fins N/A 0.1704 N/A Posterior end of primary dorsal fin to dorsal origin of caudal fin 0.0706 0.1987 *0.1681 Posterior end of primary dorsal fin to posterior end of anal fin 0.0983 0.3459 0.239 ^Posterior end of secondary dorsal fin to dorsal origin of caudal fin N/A *0.0002 N/A

^Posterior end of secondary dorsal fin to ventral origin of caudal fin N/A *3.818E-05 N/A

61 ^Posterior end of secondary dorsal fin to posterior end of anal fin N/A 0.293 N/A Posterior end of anal fin to dorsal origin of caudal fin *0.0154 *0.0003 0.7534 Posterior end of anal fin to ventral origin of caudal fin *0.0501 *0.0041 0.3256 Origin of primary dorsal fin to pelvic fin 0.4289 0.2325 *0.0122 Origin of primary dorsal fin to origin of anal fin 0.3012 0.122 *0.0069 Origin of primary dorsal fin to posterior end of anal fin 0.8968 0.2378 *0.0029 Ôrigin of secondary dorsal fin to origin of anal fin N/A 0.2155 N/A Ôrigin of secondary dorsal fin to posterior end of anal fin N/A 0.4505 N/A Origin of pelvic fin to origin of anal fin *0.0228 0.1533 0.8686 Origin of pelvic fin to posterior end of primary dorsal fin 0.4072 0.9042 0.1303 Ôrigin of pelvic fin to origin of secondary dorsal fin N/A 0.0941 N/A Origin of anal fin to posterior end of primary dorsal fin 0.1655 *0.0523 *0.0307 Ôrigin of anal fin to posterior end of secondary dorsal fin N/A 0.2411 N/A Predorsal length 0.8146 0.7686 0.0875

Post dorsal length *0.0001 0.8009 *0.0001 Basal length of primary dorsal fin 0.5259 0.8357 0.1739 ^Basal length of secondary dorsal fin N/A 0.6153 N/A Basal length of right pectoral fin 0.2103 0.6284 *0.0003 Basal length of left pectoral fin 0.3710 0.6144 *4.00E-06 Basal length of right pelvic fin 0.5262 0.8126 0.5933 Basal length of left pelvic fin *0.0055 0.4419 *2.79E-06 Basal length of caudal fin 0.0729 *0.0282 0.4044 Basal length of anal fin 0.2800 0.3789 0.4486 Length of right pectoral fin ( longest ray) *0.0013 *3.677E-10 *0.0119 Length of left pectoral fin ( longest ray) *0.0014 *1.936E-11 *0.0473 ^Characters present in Tessellated Darter only

Table 3-2 continued. Morphometric characters analyzed using one-way ANOVA, (p–values* = significance).

Morphological Characters in cm Dace Darter Sucker Length of caudal fin (longest ray) *0.0006 *3.97E-06 0.0752 Length of anal fin (longest ray) *0.0012 *2.505E-12 0.1901 Length of right pelvic fin ( longest ray) 0.1773 0.0571 0.1678 Length of left pelvic fin ( longest ray) 0.2084 0.0573 *0.0219 Length of longest primary dorsal ray *0.0025 *0.0010 0.1243 ^Length of longest secondary dorsal ray N/A 0.1681 N/A Gape height *7.085E-12 0.8045 0.1837 Closed mouth width ( jaw angle to jaw angle) *0.0199 0.0544 0.8769 Length of maxilla 0.142 0.9576 0.2173 Length of mandible 0.2857 0.9348 0.1029 Number of chin barbel No variance N/A N/A Length of chin barbel No variance N/A N/A -07

Total Length *5.825E 0.1037 0.2128

62 Standard length *0.0056 0.0530 0.3278 Fork length *2.414E-05 N/A 0.2437 Height of primary dorsal fin *0.0001E-05 *0.0390 0.8654 ^Height of secondary dorsal fin N/A 0.1361 N/A Height of right pectoral fin *8.513-09 0.3317 0.4855 Height of left pectoral fin *0.0012 0.0755 0.7917 Height of right pelvic fin *2.12E-17 0.9604 0.2253 Height of left pelvic fin *1.478E-07 0.0766 0.1182 Height of caudal fin 0.3056 0.5061 0.4685 Height of anal fin *0.0061 0.9301 0.2435 Mouth length *0.0180 0.6672 0.0895 Snout length *0.0180 0.2121 0.2953 Body depth *6.604E-06 0.2741 *0.0341 Caudal peduncle depth *1.139E-11 0.0759 0.1761 Caudal peduncle length *6.137E-12 0.9415 0.1391 ^Characters present in Tessellated Darter only

Table 3-3. Meristic characters analyzed using one-way ANOVA, (p–values * = significance).

Meristics Dace Darter Sucker

Number of scales in lateral series *1.852E-05 0.8352 *0.0002 Scales below lateral line 0.0988 0.7683 *5.823E-05 Scales above lateral line *0.0040 0.528 0.2417 Scales on side of caudal peduncle *0.0342 0.0874 *0.0076 Scales around caudal peduncle 0.1118 0.0771 0.3212 Scales before dorsal fin 0.5038 0.5463 0.2361 Cheek scales N/A 0.449 N/A Circumference scale *9.771E-08 0.2515 *1.186E-06 Number of rays in primary dorsal fin No variance1 No variance1 No variance1 Number of rays in caudal fin No variance1 No variance1 No variance1 Number of rays in right pectoral fin No variance1 No variance1 No variance1 1 1 1

Number of rays in left pectoral fin No variance No variance No variance 1 1 1 Number of rays in right pelvic fin No variance No variance No variance 63 Number of rays in left pelvic fin No variance1 No variance1 No variance1 Number of rays in anal fin No variance1 No variance1 No variance1 Branchiostegal rays No variance1 No variance1 No variance1

1No variance means all values for this character state were equal.

Table 3-4. Osteologic characters analyzed using one-way ANOVA, (p–values * = significance).

Osteologic Characters Dace Darter Sucker Epipleural rib *0.0080 No Variance1 No Variance1 Caudal Vertebrae No Variance1 No Variance1 No Variance1 Anal fin pterygiophore No Variance1 No Variance1 No Variance1 Procurrent rays - dorsal 0.2840 No Variance1 No Variance1 Procurrent rays- ventral No Variance1 No Variance1 No Variance1 Hypural Plate Elements *0.0073 No Variance1 *0.001 Epural No Variance1 No Variance1 No Variance1 Neural Spine No Variance1 No Variance1 No Variance1

1No variance means all values for this character state were equal.

t -1

e n

o -2

m o

C -3

-4

-5

-6

-7

65 -10 -5 0 5 10 15 20 25 30 35 Component 1

Figure 3-3. Principal component analysis of the morphometric characters for the Blacknose

Dace from both rivers.

t 4

e n

o 0

m o

C -4

-8

-12

-16

-20

66 -8 0 8 16 24 32 40 48 56 Component 1

Figure 3-4. Principal component analysis of the morphometric characters for the White Sucker from both rivers.

n 6

o p

m 4

o C 2

-2

67 -10 -5 0 5 10 15 20 25 30 35 Component 1

Figure 3-5. Principal component analysis of the morphometric characters for the Tessellated Darter from both rivers.

3.5. References

Agrawal, A. 2001. Phenotypic Plasticity in the Interactions and Evolution of Species. Science 294(5541): 321-326.

Aleksandrov, A. 1927. Anchovies from the Sea of Azov and the Black Sea. Report in Science Statistics Fishery, Kertch 1: 2-3.

Allendorf, F.W. and S.R. Phelps. 1988. Loss of genetic variation in hatchery stock of cutthroat trout. Transactions of the American Fisheries Society 109: 537-543.

Bailey, R. M. and W.A. Gosline. 1955. Variation in systematic significance of vertebral counts in the American fishes of the family Percidae. Miscellaneous Publication 93: 1-44. Museum of Zoology, University of Michigan.

Barlow, G.W. 1958. Geographic variation in the morphology and physiology of the gobid fishes

of the genus Gillichthys. Doctoral Dissertation, pg. 219. University of California, Los

Angeles, CA.

68 Barlow, G.W. 1961 Causes and significance of morphological variation in fishes. Systematic Zoology 10: 105-117.

Blackith, R.E. 1957. Polymorphism in some Australian locusts and grasshoppers. Biometrics 13: 183–196.

Blaxter, J.H.S. 1957. Herring rearing-111. The effect of temperature and other factors on myotome counts. Scottish Home Department of Marine Research 1: 1-16.

Blaxter, J.H.S. 1992. The effect of temperature on larval fishes. Netherlands Journal of Zoology 42: 336–357.

Bronte, C. R., Fleischer, G.W., Maistrenko, S.G. and N.M. Pronin. 1999. Stock structure of

Lake Baikal omul as determined by whole body morphology. Journal of Fish Biology 54: 787-798.

Chambers, R. C. and W. C. Leggett. 1987. Size and age at metamorphosis in marine fishes: An analysis of lab-reared winter flounder Pseudopleuronectes americanus with a review of variation in other species. Canadian Journal of Fisheries and Aquatic Sciences 44: 1936- 1947.

Chapleau, F. and G. Pageau. 1985. Morphological differentiation of Etheostoma olmstedi and E. nigrum (Pisces: Percidae) in Canada. Copeia 4: 855-865.

Cole, C.F. 1965. Additional evidence for separation of Etheostoma olmstedi Storer from Etheostoma nigrum, Rafinesque Copeia 1965: 8–13.

Cole, C.F. 1967. A study of the Eastern Johnny Darter, Etheostoma olmstedi Storer (Teleostei Percidae). Chesapeake. Science 8: 28–51.

Creech, S. 1992. A multivariate morphometric investigation of Atherina boyeri risso. 1810 and A. P. Cuvier 1829 (Teleosti: Atherinidae) morphometric evidence in support of two species. Journal of Fish Biology 41: 341-353.

Dingerkus, G. and D.U. Lowell. 1977. Enzyme clearing of alcian blue stained whole small vertebrates for demonstration of cartilage. Stain Technology 52(4):229-232.

Dwivedi, A. K. and V.K. Dubey. 2013. Advancements in morphometric differentiation: a review on stock identification among fish populations. Reviews in Fish Biology and Fisheries 23: 23-39.

Eagle, T.C., Cadrin, S.X., Caldwell, M.E., Methot, R.D. and M.F. Nammack. 2008. Conservation units of managed fish, threatened or endangered species, and marine

mammals. NOAA Technical Memorandum NMFS-OPR: 37.

69 Eastman, J.T. 1980. The Caudal Skeletons of Catostomid Fishes. American Midland Naturalist 103: 133 - 148.

Fage, L. 1911. Research on the biology of anchovy, Engraulis encrasicolus. Annals of the Institute of Oceanography 2: 1- 44.

Gabriel, M.L. 1944. Factors affecting the number and form of vertebrae in Fundulus heteroclitus. Journal of Experimental Zoology 95: 105-143.

Gray, L. J., Sword, G. A, Anstey, M. L., Clissold, F. J. and S. J. Simpson. 2009. Behavioral phase polyphenism in the Australian plague locust (Chortoicetes terminifera). Biology Letters 5: 306 – 309.

Hammer, Ø., Harper, D.A.T., and P.D. Ryan. 2001. PAST: Paleontological statistics software

package for education and data analysis. Palaeontologia Electronica 4(1): 9.

Hermida, M., Fernandez, J.C., Amaro, R., and E.S. Miguel. 2005. Morphometric and meristic variation in Galician threespine stickleback populations, Northwest Spain. Environmental Biology of Fishes 73: 189-200.

Hilton, E.J., Johnson, D.G. and W.F. Smith-Vaniz. 2010. Osteology and Systematics of Parastromateus niger (Perciformes: Carangidae), with comments on the carangid dorsal gill-arch skeleton. Copeia 2: 312-333.

Hockaday, S., Beddow, T. A., Stone, M., Hancock, P. and L. G. Ross. 2000. Using truss networks to estimate the biomass of Oreochromis niloticus and to investigate shape characteristics. Journal of Fish Biology 57: 981-1000.

Hossain, M. A. R., Nahiduzzaman, M.D., Saha D.,Khanam, H. and S. Alam. 2010. Landmark- based morphometric and meristic variations of the endangered carp, Kalibaus Labeo calbasu, from stocks of two isolated rivers, the Jamuna and Halda, and a hatchery. Zoological Studies 49(4): 556–563.

Hubbs, C.L. 1924. Studies on the fishes of the order Cyprinodontes. The subspecies of Pseudoxiphophorus bimaculatus and Priapichthys annectens. Miscellaneous Publication 13:17-23. Museum of Zoology, University of Michigan.

Hubbs, C. L.1926. The structural consequences of modifications of the developmental rate in fishes, considered in reference to certain problems of evolution. American Naturalist 60: 57-81.

Hubbs, C. L., and K. L. Lagler. 1958. Fishes of the Great Lakes region, 2nd edition. Cranbrook Institute of Science Bulletin 26:1-213.

Huxley, J.S. 1932. Problems of relative growth, pg. 276. Dial, New York, NY.

70 Ihssen, P.E., Evans, D.O., Christie, W.J., Reckahn, J.A., and R.L. DesJardine. 1981. Life history, morphology, and electrophoretic characteristics of five allopatric stocks of lake whitefish (Coregonus clupeaformis) in the Great Lakes region. Canadian Journal of Fish and Aquatic Science 38: 1790–1807.

Kendall, D.G., Barden, D., Carne, T. K. and H. Le. 1999. Shape and shape theory, pg. 306. Wiley and Sons, Chichester, U.K.

Kinsley, S.T., Orsoy, T., Bert, T.M. and B. Mahmoudi. 1994. Population structure of the Spanish sardine Sardinella aurita: natural morphological variation in a genetically homogeneous population. Marine Biology 118: 309-317.

Klepaker, T. 1995. Post glacial evolution in lateral Plate Morps in Norweigian Freshwater Populations of the Threespine Stickleback (Gasterosteus aculeatus). Canadian Journal of

Zoology 73: 898.

López-Olmeda, J. F. and F. J. Sánchez-Vázquez. 2010. Thermal biology of zebrafish (Danio rerio). Journal of Thermal Biology 36: 91-104.

Lovell, T. 1989. Nutrition and feeding in fish, pp. 73-92. Van Nostrand Reinhold, New York, NY.

Mamuris,Z., Apostolidis, P., Panagiotaki, P., Theodorou, A. J. and C. Triantaphyllidisdir. 1998. Morphological variation between red mullet populations in Greece. Journal of Fish Biology 52: 107-117.

Martell, D. J., Kieffer ., J. D. and E. A. Trippel. 2005. Effects of temperature during early life history on embryonic and larval development and growth in haddock. Journal of Fish Biology 66: 1558-1575.

Martin, W.R. 1949. The mechanics of environmental control of body forms in fishes. University of Toronto, Biological series, No. 58. Publications of the Ontario Fish research Lab No. 70.

McPhail, J.D. 1993. Ecology and Evolution of Sympatric Sticklebacks (Gasterosteus): Origin of the Species Pairs. Canadian Journal of Zoology 71: 515-523.

Molander, A.R. and M. Molander-Swedmark. 1957. Experimental investigations on variation in plaice (Pleuronectes platessa L.) Institute of Marine Research, Lysekil. Series in Biology, Fishery Board of Sweden 7: 1-45.

Muchlisin, Z.A. 2013. Morphometric variations of Rasbora Group (Pisces: Cyprinidae) in Lake Laut Tawar, Aceh Province, Indonesia, Based on Truss Character Analysis. Journal of Biosciences 20(3): 138–143.

Murta, A.G. 2000. Morphological variation of horse mackerel (Trachurus trachurus) in the

Iberian and North African Atlantic: implications for stock identification. ICES Journal of

Marine Science 57: 1240-1248.

71 Nayman, W.H. 1965. Growth and Ecology of fish population. Journal of Animal Ecology 20: 201-219.

Pepin, P. 1991. Effect of temperature and size on development, mortality, and survival rates of the pelagic early life history stages of marine fish. Canadian Journal of Fisheries and Aquatic Sciences 48: 503-518.

Rachlin, J.W. 1987. Fish truss specimen data sheet. Laboratory of Marine and Estuarine Research (LaMER), Lehman College, Bronx, NY.

Reyment, .A.R. 2010. Morphometrics: An Historical Essay (B). Naturhistoriska Riksmuset: 45- 76. Stockholm, Sweden S10405.

Rohlf, J. 1990. Morphometrics. Annual Review of Ecology and Systematics 21: 299-316.

Ryman, N., Lagercrantz, U., Andersson, L., Chakraborty. P. and R. Rosenberg. 1984. Lack of Correspondence between genetic and morphologic variability patterns in the Atlantic herring (Clupea harengus). Heredity 53: 687-704.

Samaradivakara, S., Hirimuthugoda, N., Gunawardana, R., Illeperuma, R., Fernandopulle, N., Silva, A. D. and P. Alexander. 2012. Morphological Variation of Four Tilapia Populations in Selected Reservoirs in Sri Lanka. Tropical Agricultural Research 23(2): 105–116.

Schaeffer, B. 1976. Practical aspects of homology recognition. In Masterton, R. B., Hodos, W. and H. Jerison, editors. Evolution, brain, and behavior, pp. 169-173. Erlbaum Associates, Hillsdale, NJ.

Scheiner, S.M. 1993. Genetics and evolution of phenotypic plasticity. Annual Review in Ecology, Evolution and Systematics 24: 35–68.

Schmidt, J. 1919. Racial studies in fish. Experimental investigations with Lebistes reticulatus. Journal of Genetics 8:147-153.

Scott, W.B. and E.J. Crossman. 1973. Freshwater fishes of Canada. Fisheries Research Board of Canada Bulletin 184: 1-966.

Shevchenko, N.F. 1981.Geographical variability of the anchovy Engraulis encrasicolus (Clupeiformes, Engraulidae), in the Mediterranean Basin. Journal of Ichthyology 20: 15-24.

Simpson, S.J. and G.A. Sword. 2008. Locusts. Current Biology 18: 364-366.

Stearns, S.C. 1983. A Natural Experiment in Life-History Evolution: Field Data on the Introduction of Mosquitofish (Gambusia affinis) to Hawaii. Evolution

37(3): 601–617.

72 Strauss, R.E. and F.L. Bookstein. 1982. The truss: body form reconstructions in morphometrics. Systematic Zoology 31: 113–135.

Sturmbauer, C. and A. Meyer. 1992. Genetic divergence, speciation and morphological stasis in a lineage of African cichlid fishes. Nature 358: 578 - 581.

Swain, D.P. and C.J. Foote. 1999. Stocks and chameleons: the use of phenotypic variation in stock identification. Fisheries Research 43: 113-128.

Swain, D.P., Hutchings, J.A., and C.J. Foote. 2005. Environmental and genetic influences on stock identification characters. In Cadrin, S.X., Friedland, K.D. and J. Waldman, editors. Stock Identification Methods, pp 45–85. Elsevier Academic Press, San Diego, CA.

Taning, A.V. 1952. Experimental study of meristic characters in fishes. Biological Reviews

27(2): 169-193.

Trautman, M. B. 1957. The fishes of Ohio, pg. 683. Ohio State University Press, Columbus, OH.

Tudela, S. 1999. Morphological variability in a Mediterranean, genetically homogenous population of the European anchovy, Engraulis encrasicolus. Fishery Research 42: 229- 243.

Vladykov, V.D. 1934. Environmental and taxonomic characters of fishes. Transaction of Royal Canadian Institute 20: 99-140.

Wimberger, P. H. 1992. Plasticity of fish body shape. The effects of diet, development, family and age in two species of Geophagus (Pisces: Cichlidae). Biological Journal of the Linnean Society 45: 197-218.

Chapter 4: Discrimination of three freshwater fish species from two isolated watershed based on mitochondrial DNA sequences

Abstract: This study examined the Blacknose Dace, the White Sucker and the Tessellated Darter

from the Bronx and Saw Mill Rivers, N.Y. The goal of this study was to use a genetic marker to

determine if these species of fish from two isolated watersheds have diverged since the Pleistocene

glaciation. A similar pattern of divergence between the populations from the two rivers could give

inferences on how species recolonized the rivers once the glaciers receded. Mitochondrial DNA

control region sequence data suggest that there was moderate nucleotide diversity in the Blacknose

dace (Fst of 0.51) and White Sucker (Fst = 0.01). Mitochondrial DNA sequence data from the 73 cytochrome b gene indicated that there was little nucleotide divergence in the Tessellated Darter

(Fst = 0.05). Each fish species had one or two common haplotypes in each river but there were also

many haplotypes not shared between rivers. There were also significant differences in haplotype

frequencies within the three fish species which indicate the populations are beginning to diverge (P

< 0.0001). These similar patterns were observed in all three fish species even though two different

regions of mitochondrial DNA were utilized. These consistent patterns suggest that after the

glacier retreated, both the Bronx and Saw Mill Rivers were recolonized at approximately the same

time by a single founding population from each species.

4.1. Introduction

During the retreat of the last glacier in North America, 17,500 years ago, waterways were

created that permitted a number of fish populations to recolonize regions which they once

occupied. This glaciation had many influences on modern vertebrate phylogeography, including

reorganizing the distributions of many organisms by forcing them out of their pre-glacial ranges

(Avise and Walker 1998). The Bronx and Saw Mill River were created as the Pleistocene glacier

retreated. Fish then migrated to the individual watersheds and established populations. It is

hypothesized that these populations have been isolated since then and their descendants now reside

in the Bronx and Saw Mill Rivers. These two rivers occupy two separate watersheds and are not

74 connected to each other. This is important as freshwater fish species are deterred from

recolonization through routes surrounded by marine waterways.

The objective of this research was to determine if fish populations from the Bronx and Saw

Mill Rivers diverged following the Pleistocene. Chromosomal analysis of the three freshwater fish

species revealed no significant differences between populations from both rivers (chapter 2). In

contrast, results from morphological examination did indicate that there were significant

differences between populations (chapter 3).

Molecular techniques can provide additional information. It can be especially useful in

studying populations that have few morphological differences. Additionally, DNA data does not

suffer from ecophenotypic variation that morphological data can suffer from. Each individual

organism is a repository of genetic information that informs us of its evolutionary history. To this

end, incorporating molecular data can provide a wealth of demographic and phylogenetic

information that can be used to confirm morphological and chromosomal data (Maddison 1997,

Slowinski and Page 1999).

Mitochondrial DNA (mtDNA) is used here to study the evolutionary relationships of three

fish species - the Blacknose Dace, the Tessellated Darter and the White Sucker- in the two river

systems. The complete mtDNA genome is 16,805 nucleotides in length and contains two

ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and one control region

(CR) (Peng et al. 2007). The mtDNA CR is an area of the mitochondrial genome which is non-

coding. Non-coding DNA sequences are components of an organism's DNA that do not encode

protein sequences. The CR is divided into three domains which differ from each other in rate of

evolution and base content (Clayton 1984, 1992, Lee et al. 1995). The main domain contains the

heavy strand origin of replication. It is characterized by a high guanine to cytosine content and is

75 relatively conserved (Saccone et al. 1991). The other two domains (domain I and domain II) are

hypervariable in base substitutions and are characterized by adenine and thymine base

compositions (Brown et al. 1986, Wenink et al. 1994). Due to the fast rate of evolution of domain

I and domain II, the CR has been typically deemed to be most appropriate for population level

studies (Vigilant et al. 1991, Bensch and Hasselquist 1999). The slower evolving main domain is

generally used to resolve phylogenetic relationships above the species level (Saccone et al. 1991,

Douzery and Randi 1997).

Cytochrome b (cytb) is one of 13 protein coding region of the mtDNA. However, cytb is

the only cytochrome that is coded by mtDNA. The cytb gene evolves at a slower rate than the

control region and is commonly used to examine relationships at the population level but also in

inter-specific comparisons. The nucleotide sequence of the cytb gene can contain species –

specific information. As a result, the cytb gene is used in many phylogenetic studies (Smith and

Patton 1991, Carr and Marshall 1991).

All vertebrates contain multiple copies of mtDNA. Homoplasmy means that all mtDNA

copies within an individual are exactly the same. Heteroplasmy (where individuals have different

copies of mtDNA) is not common in vertebrates. As a molecular marker, mtDNA has many

advantages. The mitochondrial genome is self-replicating and is maternally inherited. It is haploid

and does not experience recombination thus allowing the mtDNA molecules to be passed intact

from mother to daughter (Barton 1983). Hence, the sperm derived mtDNA is never transmitted to

the offspring (DeLuca et al. 2012). This uniparental inheritance pattern also makes data analysis

easier.

Individuals are usually homoplasmic for one mitochondrial haplotype. This means that

76 each molecule as a whole usually has a single genealogical history through maternal lineages. For

these reasons, scientists are able to trace maternal lineages far back in time. This makes mtDNA

ideal for evolutionary studies below and above the population level. For example, a study

conducted by Wirgin et al. (2001) analyzed the mtDNA control region of the Robust Redhorse,

Moxostoma robustum, a riverine catostomid, from two rivers in Georgia to determine the genetic

relatedness and structure of these populations to guide restoration efforts. Fixed differences in

mtDNA haplotypes were found between the two river systems which strongly argue for the

designation of these populations as Evolutionary Significant Units.

Another example includes a study conducted by Burridge et al. 2006. The goal was to

assess if two species of the galaxiid fish, Galaxias vulgaris and Galaxias divergens, that have been

separated during the Quaternary period, in the Clarence and Wairau Rivers in New Zealand, had

the same genetic signature when compared to samples from the geographically intermediate

Awatere River. Sequence analysis of the mitochondrial cytb gene revealed that populations from

the Clarence and Wairau Rivers were closely related sister-groups, whereas samples from the

geographically intermediate Awatere River are genetically divergent.

Mitochondrial cytb is also used to resolve phylogenetic relationships at the species level.

Mesquita et al. (2001) examined the genetic population structure for the freshwater fish

Chondrostoma lusitanicum throughout its geographical range in Portugal with the aim of resolving

the phylogeographic relationships between populations. The results revealed high values of

haplotype diversity with 16 different haplotypes in 19 individuals which indicate very low within-

basin nucleotide diversity (i.e. all individuals are very similar genetically). These results suggest

that genetic drift is acting independently in the different geographical habitats resulting in different

77 populations with significantly different haplotypes. Consequently, the results support a distinct

taxonomic status at the species level.

Previous research on the Blacknose Dace using mtDNA was conducted by Tipton et al.

(2011). They investigated the postglacial recolonization of the Blacknose Dace in New England.

They hypothesized that the earliest deglaciated region which is modern day Connecticut, was

recolonized by the Blacknose Dace via a single founding event by a single population. They tested

the hypothesis phylogenetically by studying the genetic diversity of the Blacknose Dace in the

different drainage basins within Connecticut. By sequencing the mtDNA CR, the results indicated

low nucleotide diversity, high haplotype diversity and a dominant haplotype found across the state.

The results of this study indicate a recolonization initially by a single founding event that came

from a single refugium.

Molecular studies involving Percidae have inferred relationships among genera and

species. Several studies using mtDNA data initially attempted resolving percid relationships with

DNA sequencing (Bailey and Gosline 1955, Collette and Banarescu 1977, Song et al. 1998). In

these studies taxonomic sampling was sparse and many intermediate nodes were poorly resolved.

A subsequent study using the cytb gene and the small subunit ribosomal gene, 12S rRNA (12S),

was able to verify phylogenetic relationships among the Percidae (Sloss et al. 2004). The 12S

gene evolves at a slower rate than cytb (Hillis and Dixon 1991, Sumida et al. 2000) thereby

exhibiting less homoplasy in deeper relationships. Sloss et al. (2004) analyses of the 12S

mitochondrial gene placed the Tessellated Darter (E. olmstedi) consistently in the family Percidae

and demonstrated the Percidae to be a monophyletic group.

A study conducted by McCartney and Barreto (2010) examined the phylogenetic

relationship of the Waccamaw Darter (E. perlongum) in the Waccamaw River to its sister species

78 the Tessellated Darter (E. olmstedi) in adjoining Pee Dee and Cape Fear drainages in southeastern

North Carolina. In this study species status was assessed by sequencing the mitochondrial cytb

gene in both species. The results indicated that haplotypes of E. perlongum in the Waccamaw

River were very similar to the haplotypes of E. olmstedi in the Pee Dee and Cape Fear drainages.

However, there were different haplotype frequencies present in the two drainages. Since there was

no gene flow between rivers the significant differences in haplotype frequencies suggest

divergence between the populations.

Using mtDNA, this study investigates if there is evidence of incipient speciation in three

fresh water fish species (Catostomus commersonii (White Sucker), Etheostoma olmstedi

(Tessellated Darter), and Rhinichthys atratulus (Blacknose Dace)) since the Laurentide ice sheet

retreated 17,500 years ago. In this research the control region was used to study the Blacknose

Dace and the White Sucker. Cytb was used to analyze the relationships in the Tessellated Darter

because DNA sequence results using CR were inconsistent in this species.

The questions asked here are (1) is there any genetic relatedness between fish populations

that have been isolated since the last glacial retreat 17,500 years ago? If so, how different are the

populations and is this observed pattern of divergence similar in all three species studied?

4.2. Materials and Methods

Specimens were collected from the headwaters of the Bronx and Saw Mill Rivers. The fish

were sacrificed using MS222 (tricaine methanesulphonate) until opercular activity stopped. All

specimens were then stored in 75% ethanol until processing. Fin clips were then excised for DNA

processing.

DNA Isolation from Fin Clip Samples

Fin clip tissue was placed in 15ml Eppendorf tubes with 10 ml of phospho-buffered saline

(PBS) (0.15 M NaCl, 0.08M Na2HPO4, 0.03M NaH2PO4). The tubes were rocked for 10 minutes

and the PBS was poured out. The samples were rocked in ddH2O for two cycles, 10 minutes each.

80 The water was then poured off, the fin clip dried with paper towel and then incubated in 1.5 ml

tubes with 600µL of 1X CTAB buffer (Saghai-Maroof et al. 1984). Next, 10 µL proteinase K

(20mg/ml) was added and the tubes were incubated for at least one hour at 650 C. This was then

followed by phenol-chloroform extractions which were used to isolate DNA from each sample

(Sambrook et al. 1996). The DNA was then precipitated in 600µL of ice cold 100% isopropanol

after incubation at -800C for at least 30 minutes. The DNA was centrifuged at 16,000 x g for 25 to

30 minutes at 40C and washed in cold 70% ethanol. Samples were then air dried and resuspended

in 30µL of - TE (10mM Tris-HCL, 1mM EDTA, pH 8.0) buffer.

PCR Amplification of mtDNA Control Region

PCR amplification of the mtDNA control region was performed for the Blacknose Dace

and the White Sucker. The reaction mixture for PCR was performed in 25µL total volume. The

mixture contained 5µL of 5X buffer, 0.5µL (100nM) of each deoxynucleotide triphosphate

(dNTP), 0.5µL of a 10µM of each Dace specific primers ctr-H (5’-CCR GAA GTA GGA ACC

AGA TG -3’) and ctr-L (5’-AAC TCT CAC CCC TAG CTC CCA AAG-3’) (Tipton et al. 2011),

0.2 µL TaqI, Polymerase (Promega Inc), 1.5µL of MgCl2 (25mm), 15.8µL of ddH20 and 1µL of

DNA template. The size of the PCR product was checked against EZ load 100 base pair (bp) PCR

Molecular Ruler from Bio-Rad Inc. Amplification for the DNA for the Blacknose Dace was

0 0 0 81 started at 95 C for 5 minutes, followed by 35 cycles of 95 C for 1 minute, 50 C for 1 minute, and

720C for 1 minute; followed by an extension of 7 minutes at 720C.

The same procedure was conducted for the White Sucker. However, the annealing

temperature was 520 C for 1 min. The universal primers used for the White Sucker were tPro2 (5’-

GTT AAA TTC CTC CCT AGA GCC CAG-3’) and tPhe (5’-GGT GGA GCT TTC TAG GCT

CAT CTT -3’). The tPro2 primer was derived from the tRNA proline gene and the tPhe primer

was derived from the tRNA Phenylalanine gene. Both genes are highly conserved among fish

(Brown et al. 1986).

The cytb gene region was used to amplify DNA for the Tessellated Darter. Initial attempts

to sequence the Tessellated Darter CR were inconsistent. The procedure was the same as above

however, the annealing temperature was 540C. The species specific primers used for the

Tessellated Darters were EPERF2 (5’-CTG CCC CCT CAA ATA TTT CGG -3’) and EPERR2

(5’-TAT AGG AAA GAT GCG ACT TGG-3’).

Nested sequencing primers for the White Sucker and Tessellated Darter were created in the

lab. This was accomplished by taking a portion from the PCR product and comparing it to a

known sequence of the mitochondrial control region of the same fish on NCBI. Using this

information, species specific primers were designed.

Mitochondrial DNA Sequencing

The PCR amplicons were run on 1% ethidium bromide stained low melt agarose gels in

0.5X TBE. To prepare the electrophoresis box a gel dock was placed into the gel box. A rubber

comb was placed in the top notch in the gel dock. A 0.5 X TBE solution was made with 4 liters of

distilled water, 21.6 gm of Trizma base minimum (Tris), 11 gm of Borate (Boric acid) and 8mls of

EDTA. The solution was then inverted to obtain a homogenous mixture.

To prepare a 1 % agarose gel, 0.5g of molecular biology grade agarose was mixed with 50

mls TBE then heated in a microwave for 2 minutes. The heated agarose was then poured into the

gel dock until there was about 2 mm of agarose in each dock. The gel was then allowed to solidify

83 for approximately 20 minutes.

As the gel solidified, using a pippette, 1.5 µl of loading dye was thoroughly mixed in an

eppendorf tube with 5 µl DNA from each PCR reaction. The gel comb was removed after

solidification and 0.5 X TBE buffer was added to the gel box until the gel was completely covered.

Using a pipette, the sample was then dispensed into an empty well of the gel. Each sample was

recorded while loading the gel. To prevent cross contamination each pipette tip was discarded

before a new sample was loaded. One well was filled with the DNA ladder to ensure the PCR

amplicon was the correct size and that the DNA was clean. 1.5 µl of the DNA ladder was pipetted

into one empty well. The wells were then placed towards the negative electrode as DNA migrates

from negative to the positive electrode. When all samples were loaded, a constant voltage of 90

volts was applied for 60 minutes.

On completion, the loading dye travelled approximately three-quarters of the way down the

gel. The gel was then removed from the gel box and placed in a solution of 10 µl of ethidium

bromide (10mg/µl) and 200ml of deionized water then rocked for 10 minutes. The gel was then

viewed using ultra violet light and photographed. Once confirmed that high-quality DNA was

obtained, 7µl of the PCR product was combined with 3 µl of distilled water, per fish, for

sequencing.

PCR products were sent to GENEWIZ to be cleaned and sequenced. Results were received

in an .ab1 file format along with a chromatogram file for each sequence. Each sample was

sequenced with forward and reverse primers. These DNA sequences were assembled using CAP 3

Sequence Assembly program (Huang and Madan 1999). Unknown regions were verified by

reading the chromatogram from the forward and reverse sequences and ambiguous nucleic acids

were corrected manually. For each sample, any questionable areas outside the region of interest

84 were trimmed and then analyzed using BioEdit-Biological Sequence Alignment Software (Hall

1999). Fish were assigned mtDNA haplotype based on having unique combinations of nucleotides

at polymorphic sites (Wirgin et al. 2001). Statistical computations such as the AMOVA, genetic

diversity indices, Fst (10,000 permutations), exact test of differentiation (10,000 permutations) and

nucleotide diversity were performed using Arlequin v 3.11 software (Excoffier et al. 2010). In

addition, a haplotype network for each species was constructed using TCS 1.21 software (Clement

et al. 2000).

4.3. Results

Results from the sequences analyzed using Arlequin v 3.11 software (Excoffier et al. 2010)

are shown in Tables 4.1 - 4.9. A total of 470 base pairs (bp) were sequenced from the Blacknose

Dace mtDNA control region. As seen in Table 4.1, there were five transitions, five transversions

and three indels for the Blacknose Dace in the Bronx River. However, only four transitions, one

transversion and two indels for the Blacknose Dace were observed in the Saw Mill River. The

fixation statistic (Fst) and the pairwise exact test were also informative. Fst is a measure of

population differentiation based on allelic variation. In pair-wise comparisons, populations with

an Fst = 1 have fixed genetic differences and are believed to have no gene flow. If the two

85 populations have an Fst = 0, then they are believed to have panmixis with no genetic differentiation

between them. The pairwise exact test measures the difference in haplotype frequencies between

populations from two rivers. Comparison of the Blacknose Dace resulted in an Fst = 0.51,

p<0.0001 and indicates a high level of divergence in the mtDNA sequence. The pairwise

comparison of this species between the two river systems demonstrated a significant difference in

haplotype frequencies (P < 0.0001).

The results for the White Sucker were similar to that of the Blacknose Dace. As seen in

Table 4.2, there were six transitions and four transversions among the 1,010 nucleotides examined

for the White Sucker in the Bronx River. However, there were eleven transitions and sixteen

transversions observed in the Saw Mill River. There were no fixed nucleotide differences

observed between populations. The Fst of 0.10 indicated moderate levels of DNA sequence

divergence (P = 0.06) difference between the populations. However, there was a significant

difference in the haplotype frequencies (P < 0.001) between rivers.

There were no fixed differences observed among the 918 base pair sequence of cytb for the

Tessellated Darter. Similar to the results for the Blacknose Dace and the White Sucker, there were

four transitions, four transversions and four indels for the Tessellated Darter in the Bronx River.

However, six transitions, no transversions and three indels were observed in the Saw Mill River

(Table 4.3). The Fst value for this cytb sequence was low at 0.05 and not significant (P = 0.09).

The pairwise exact test of differentiation supported a significant difference in the haplotype

frequencies between the river systems (P < 0.0001).

Tables 4.4, 4.6, and 4.8 represent the different haplotypes present in each population.

Tables 4.5, 4.7, and 4.9 illustrate the frequency of each haplotype in the different populations.

86 Results from the sequences analyzed using TCS 1.21 software (Clement et al. 2000) are

shown in Figures 4.1- 4.3. The haplotype network for the Blacknose Dace (Figure 4.1, GenBank

accession numbers KT762174 through KT762191) showed haplotype D1 as basal. A maximum of

2 mutational steps separates D1 from the most divergent haplotype D13 which is present in the

Saw Mill River.

A similar result was obtained for the White Sucker. Haplotypes S1 and S2 was basal with

a maximum of 2 mutational steps to S11, the most divergent haplotype from the Saw Mill River

(Figure 4. 2. GenBank accession numbers KT762159 through KT762173).

A maximum of two mutational steps separated haplotype TD1 in the Bronx River from the

most divergent haplotype TD11 in the Saw Mill River for the Tessellated Darter (Figure 4. 3.

GenBank accession numbers KT762192 through KT762212). These results were consistent with

those for the Blacknose Dace and White Sucker.

4.4. Discussion

Molecular data provide a complimentary approach to discriminate taxa distinguished by

morphological characters (Goetz 2003, Sanders and Lee 2007). The use of mtDNA has been

incorporated in scientific research and has proven to be a reliable methodology in discriminating

between species (Near and Keck 2005, Drummond et al. 2006). In this study, the primers used

were specific to the amplification of the mitochondrial CR for the Blacknose Dace and the White

Sucker, and the cytb gene region for the Tessellated Darter.

The results for the different statistical computations revealed a similar trend of divergence

for all three species. Haplotypes - combinations of alleles that differ at least by a single nucleotide

87 and tend to be inherited together - and their frequencies, present in the Bronx and Saw Mill Rivers

for the Blacknose Dace are shown in Table 4.4 and 4.5. In Table 4.4 haplotypes D1 and D2 are

found in both the Bronx and Saw Mill Rivers. Haplotypes D4 through D9 are found in the Bronx

River only. Haplotypes D10 through D15 are found in the Saw Mill River only. The frequencies

of each haplotype in both rivers are relatively low (Table 4.5) which suggests that the parent

population of the Blacknose Dace recently became divided.

The results suggest that haplotypes D1 and D2, which are present in both the Bronx and

Saw Mill Rivers, were present in the parent population after the Wisconsin glacier retreated. The

high Fst (0.51) demonstrates a good deal of nucleotide diversity. Most important is that the exact

test (P < 0.0001) indicates that the two populations have diverged since the populations re-

established after the Pleistocene. This is evident as haplotype D1 is in high frequency in the Saw

Mill River (0.667) but haplotype D3 is in high frequency (0.667) in the Bronx River (Table 4.5).

The common haplotypes, D1 and D2, suggest that both Blacknose Dace populations were re-

established in the rivers at approximately the same time after the glaciers receded. Since that time

the populations have diverged due to processes such as genetic drift and /or selection.

There were comparable results for the White Sucker using the mtDNA CR. Haplotypes

present in the Bronx and Saw Mill Rivers are shown in Tables 4.6 - 4.7. Haplotypes S1 and S2 are

found in both rivers. Haplotypes S3 through S7 are found only in the Bronx River and haplotypes

S8 through S12 are found strictly in the Saw Mill River. Once more a pattern of divergence is

observed as haplotype S2 frequency is in a moderate frequency in the Saw Mill River (0.235) but

in a very high frequency in the Bronx River (Table 4.7). A moderate Fst of 0.10 indicates that there

is some nucleotide divergence however, as in the Blacknose Dace there is significant difference in

88 haplotype frequencies (P < 0.0001) which suggest divergence.

A similar pattern of haplotypic diversity was observed for the Tessellated Darter even

though the data were obtained from the cytb gene which evolves at a slower rate than mtDNA CR.

Haplotypes and their frequencies, present in the Bronx and Saw Mill Rivers for the Tessellated

Darter are shown in Table 4.8 and 4.9. Haplotypes TD1 and TD2 are found in both rivers.

Haplotypes TD3 through TD8 are found in the Bronx River only. Haplotypes TD 9 through TD17

are found in the Saw Mill River only. The Fst is lower in the Tessellated Darter (Fst = 0.05). This

indicates very little nucleotide divergence, but there is still a significant difference in haplotype

frequency (P < 0.0001) showing divergence between both rivers. These results indicate a parent

population that has recently divided since the Pleistocene glaciations.

The results of this study are similar to previous research conducted by Mesquita et al. 2001,

McCartney and Barreto 2010 and Tipton et al. 2011. Mesquita et al. 2001, using mtDNA CR

examined the genetic diversity on the freshwater fish Chondrostoma lusitanicum from five

different basins throughout its geographical range in Portugal. A total of forty-two fish were

collected. Their results indicated high haplotype diversity between basins. However, the

frequencies of each haplotype between basins were low. Although the sample size was small, their

results were comparable to results obtained in previous allozyme studies for the same species

(Alves and Coelho 1994, Coelho et al. 1997) and similar to other cyprinids in the genus Leuciscus

(Hanfling and Brandl 1998).

McCartney and Barreto 2010 sequenced the Waccamaw Darter and Tessellated Darter in

Lake Waccamaw and the Pee Dee drainages using the cytb gene. Historically no gene flow was

recorded between the lake and the river since the Pleistocene. However, migration has occurred

between drainages. Statistical analyses and results of the cytb gene sequences indicate that the

89 haplotypes of the Waccamaw Darter and Tessellated Darter between a river and drainage were

very similar and frequently differ by several nucleotides. They concluded that a high haplotype

frequency maybe due to the adaptation of each species to a novel environment.

Similar results were obtained by Tipton et al. (2011). Using mtDNA CR they sequenced

782 fish from 25 locations across Connecticut to decipher if different populations of the Blacknose

Dace were recolonized from a single parent population. Similar to this research the results indicate

a significant difference in haploid frequencies with low nucleotide diversity across the state.

However, a dominant haplotype was present across the state. The presence of a dominant

haplotype across the state indicated that the present populations are descendants from a single

parent refugium. Although high haplotypic diversity was observed, the lack of nucleotide diversity

and the absence of fixed differences between populations indicate that these present populations

may have been recently separated.

These results were comparable to those of this research. As in the above studies there

appears to be no gene flow (migration) between populations of fish in each study. The results of

this study indicate the presence of a dominant haplotype in both the Bronx and Saw Mill Rivers for

the three fish species. There were no fixed differences present to indicate different species.

However, as in the aforementioned studies, the presence of these dominant haplotypes (Tables 4.4,

4.6 and 4.8) indicate that the present populations are descendants from a single parent population.

To summarize, vicariant events can result in allopatric speciation through changes in the

geohydrology of drainage systems (Seehausen and Wagner 2014). This occurs as a result of slow

genetic drift in stable populations (Wright 1931), drift associated with founder events (Mayr 1954)

and the effects of selection acting on the different alleles present in the parent population.

Organisms in isolated environments may experience evolutionary divergence due to

90 genetic drift. Primary freshwater fish are prevented from migrating between rivers as they are

surrounded by marine waters. This finite population contains specific alleles endemic to its

particular environment. With each successive generation these alleles may become fixed in its

isolated environment. The smaller the population size, the faster the alleles become fixed in the

population, resulting in the lost of genetic variation over time. Because of genetic drift, and the

creation of new haplotypes by mutation, the allelic variation within a population increases and with

time evolves into individual species. At present there exist specific alleles in the Bronx and Saw

Mill Rivers. Over time, due to genetic drift and the isolation of the river systems preventing gene

flow between populations, the three fish species will eventually evolve into different fish species.

The results obtained for the Fst and especially the pairwise exact test looked at population

differences on a micro scale. These results indicated no fixed differences i.e. completely different

haplotypes present, between populations for each species. The lack of nucleotide divergence

between the two populations indicated that they shared a recent common ancestor and has not yet

evolved into different species. Congruent results were observed for all three species of fish as

there were two haplotypes common in both the Bronx and Saw Mill Rivers but there were

significant differences in haplotype frequency with the observation of unique haplotypes to each

river. This pattern strongly suggests that the two rivers were recolonized by all three species at

approximately the same time after the Pleistocene glacier retreated. The presence of different

haplotypes in each river system strongly indicates that these populations of fish have diverged via

genetic drift since the Pleistocene. Even though the two river systems are similar in environmental

parameters, minor differences, indicating divergence, are starting to accrue. Therefore, mtDNA

results support the morphometric data. Thus one sees that divergence needs to occur before

incipient speciation results.

Table 4-1. Results for mtDNA CR analysis for Blacknose Dace from each river, (Fst = 0.51, P < 0.0001; Pairwise Exact Test P < 0.0001).

Blacknose Dace Bronx River Saw Mill River (N=30) (N=21) # of transitions 5 4 # of transversions 5 1 # of indels 3 2

Table 4-2. Results for mtDNA control region analysis for White Sucker from each river, (Fst = 0.10, P < 0.06; Pairwise Exact Test P < 0.0001).

White Sucker Bronx River Saw Mill River (N=17) (N=20) # of transitions 6 11 # of transversions 4 16 # of indels 0 0

Table 4-3. Results for mtDNA cytb analysis for Tessellated Darter from each river, (Fst = 0.05, P < 0.09; Pairwise Exact Test P < 0.0001).

Tessellated Darter Bronx River Saw Mill River (N=15) (N=17) # of transitions 4 6 # of transversions 4 0 # of indels 4 3

Table 4-4. Haplotypes present in the Bronx and Saw Mill Rivers for the Blacknose Dace.

Fish Haplotype Bronx River Saw Mill River (30) (21) rabr13 D4 1 0

rabr15 D5 1 0

rabr18 D6 rabr17 D7 2 0

rabr19 D3 20 0

*rabr28 *rabr22 D1 3 14 *rabr24

*rasm3

95 rabr43 D8 1 0

rabr29 D9 1 0

*rabr30 D2 1 1 *rasm30

rasm4 D10 0 1

rasm10 D11 0 1 rasm16 D12 0 1 rasm13 D13 0 1 rasm14 D14 0 1

rasm23 D15 0 1

* Haplotypes present in founding population

Table 4-5. Relative frequencies of haplotypes in both river populations for the Blacknose Dace.

Fish Haplotype Bronx River Saw Mill River (30) (21) rabr13 D4 0.0333 0

rabr15 D5 0.0333 0

rabr18 D6 rabr17 D7 0.0667 0

rabr19 D3 0.667 0 *rabr28

*rabr22 D1 0.1 0.667 *rabr24 96 * rasm3

rabr43 D8 0.0333 0

rabr29 D9 0.0333 0

*rabr30 D2 0.0333 0.0476 *rasm30

rasm4 D10 0 0.0476

rasm10 D11 0 0.0476

rasm16 D12 0 0.0476

rasm13 D13 0 0.0476

rasm14 D14 0 0.0476

rasm23 D15 0 0.0476

* Frequency of haplotypes in founding population

Table 4-6. Haplotypes present in the Bronx and Saw Mill Rivers for the White Sucker.

Fish Haplotype Bronx River Saw Mill River (17) (20) ccbr1 S3 ccbr4 S4 5 0

ccbr18 S5 2 0

*ccbr19 *ccsm4 S1 1 1

ccbr7 S6 1 0

*ccbr13 *ccbr16 S2 4 14

*ccsm12

97 ccbr12 S7 4 0

ccsm26 S8 0 1

ccsm3 S9 0 1

ccsm19 S10 0 1

ccsm20 S11 0 1

ccsm15 S12 0 1

* Haplotypes present in founding population

Table 4-7. Relative frequency of haplotypes in both river populations for the White Sucker.

Fish Haplotype Bronx River Saw Mill River (17) (20) ccbr1 S3 ccbr4 S4 0.294 0

ccbr18 S5 0.118 0

*ccbr19 *ccsm4 S1 0.0588 0.05

ccbr7 S6 0.0588 0

*ccbr13

*ccbr16 S2 0.235 0.7

98 *ccsm12

ccbr12 S7 0.235 0

ccsm26 S8 0 0.05

ccsm3 S9 0 0.05

ccsm19 S10 0 0.05

ccsm20 S11 0 0.05

ccsm15 S12 0 0.05

* Frequency of haplotypes in founding population

Table 4-8. Haplotypes present in the Bronx and Saw Mill Rivers for the Tessellated Darter.

Fish Haplotype Bronx River Saw Mill River (15) (16) eobr5 TD3 1 0

eobr10 TD4 1 0

eobr8 TD5 1 0

eobr8b TD6 1 0

eobr7 TD7 1 0

*eobr6 *eobr13 TD1 4 2

*eosm27

*eosm24 99 eobr14 TD8 2 0

*eobr26 *eosm12 TD2 4 2 *eosm14

eosm13 TD9 0 1

eosm15 TD10 0 1

eosm16 TD11 0 3

eosm22 TD12 0 2

eosm21 TD13 0 1

eosm23 TD14 0 1

eosm20 TD15 0 1

eosm25 TD16 0 1

eosm26 TD17 0 1

* Haplotypes present in founding population

Table 4-9. Relative frequency of haplotypes in both river populations for the Tessellated Darter.

Fish Haplotype Bronx River Saw Mill River (15) (16) eobr5 TD3 0.0667 0 0.0667 eobr10 TD4 0 0.0667 eobr8 TD5 0 0.0667 eobr8b TD6 0 0.0667 eobr7 TD7 0

*eobr6 *eobr13 TD1 0.267 0.125

*eosm27

*eosm24 100 eobr14 TD8 0.133 0

*eobr26 *eosm12 TD2 0.267 0.125 *eosm14

eosm13 TD9 0 0.0625

eosm15 TD10 0 0.0625

eosm16 TD11 0 0.188

eosm22 TD12 0 0.125

eosm21 TD13 0 0.0625

eosm23 TD14 0 0.0625

eosm20 TD15 0 0.0625

eosm25 TD16 0 0.0625

eosm26 TD17 0 0.0625

*Frequency of haplotypes in founding population

100

101

Figure 4-1. A minimum spanning network of mtDNA control region sequence haplotypes of the Blacknose Dace (Rhinichthys atratulus) from the Bronx and Saw Mill Rivers developed using statistical parsimony as implemented in TCS Version 1.3.1 (Clement et al. 2000). D1 and D2 are basal haplotypes found in both the Bronx and Saw Mill Rivers. Bronx River haplotypes are in ovals and Saw Mill River haplotypes are in rectangles.

101

102

Figure 4-2. A minimum spanning network of mtDNA control region sequence haplotypes of the White Sucker (Catostomus commersonii) from the Bronx and Saw Mill Rivers using statistical

parsimony as implemented in TCS Version 1.3.1 (Clement et al. 2000). S1 and S2 are basal haplotypes found in both the Saw Mill and Bronx Rivers. Bronx River haplotypes are in ovals and Saw Mill River haplotypes are in the rectangles.

102

103

Figure 4-3. A minimum spanning network of cytb gene region haplotypes of the Tessellated Darter (Etheostoma olmstedi) from the Bronx and Saw Mill Rivers using statistical parsimony as implemented in TCS Version 1.3.1 (Clement et al. 2000). TD1 and TD2 are basal haplotypes found in both the Saw Mill and Bronx Rivers. Bronx River haplotypes are in ovals and Saw Mill River haplotypes are in rectangles.

103

4.5. References

Alves, J. and M.M. Coelho. 1994. Genetic variation and population subdivision of the endangered Iberian cyprinid Chondrostoma lusitanicum. Journal of Fish Biology 44: 627-636.

Avise, J. C. and D. Walker. 1998. Pleistocene phylogeographic effects on avian populations and the speciation process. Proceedings of the Royal Society of London 265: 457- 463.

Bailey, R.M. and W.A. Gosline. 1955. Variation and systematic significance of vertebral counts in the American fishes of the family Percidae. Miscellaneous Publication of the Museum of Zoology University of Michigan 93: 1–44.

Barton, N. H. and J.S. Jones.1983. Mitochondrial DNA: new clues about evolution. Nature. 306: 317–318.

Bensch, S. and D. Hasselquist.1999. Phylogeographic population structure of great reed warblers: an analysis of mtDNA control region sequences. Biological Journal of the Linnaean

104 Society 66: 171–185.

Brown, G.G., Gadaleta, G., Pepe, G., Saccone, C. and E. Sbisà. 1986. Structural conservation and variation in the D-loop containing region of vertebrate mitochondrial DNA. Journal of Molecular Biology 192: 503–511.

Burridge, C.P., Craw, D. and J.M. Waters. 2006. River capture, range expansion and cladogenesis: the genetic signature of freshwater vicariance. Evolution 60(5): 1038-1049.

Carr, S. M. and H. D. Marshall. 1991. Detection of intraspecific DNA sequence variation in the mitochondrial cytochrome b gene of Atlantic cod (Gadus morhua) by the polymerase chain reaction. Canadian Journal of Fish and Aquatic Science 48: 48-52.

Carson, H.L. and A.R. Templeton. 1984. Genetic revolution in relation to speciation

phenomena-the founding of new populations. Annual Review in Ecology and Systematics. 15: 97–131

Clayton, D.A. 1984. Transcription of the mammalian mitochondrial genome. Annual Review in Biochemistry 53: 573–594.

Clayton, D.A. 1992. Transcription and replication of animal mitochondrial DNAs, pp. 217–232. In: Wolstenholme DR, Jeon KW (eds) Mitochondrial genomes. International Review of Cytology, vol. 141. Academic Press, San Diego, CA.

Clement, M., Posada, D. and K. Crandall. 2000. TCS: a computer program to estimate gene genealogies. Molecular Ecology 9(10): 1657-1660.

104

Coelho, M.M., Alves, J. and E. Rodrigues. 1997. Patterns of genetic divergence in Chondrostoma lusitanicum Collares Pereira, in intermittent Portuguese rivers. Fisheries Management and Ecology 4: 223 - 232.

Collette, B.B. and P. Barnarescu. 1977. Systematics and zoogeography of the fishes of the family Percidae. Journal of the Fisheries Research Board of Canada 34: 1450–1463

DeLuca, S.Z. and P.H. O’Farrell. 2012. Barriers to male transmission of mitochondrial DNA in sperm development. Developmental Cell 22: 660–668.

Douzery, E. and E. Randi. 1997. The mitochondrial control region of Cervidae: evolutionary patterns and phylogenetic content. Molecular Biology and Evolution 14: 1154–1166.

Drummond, A. J., Ho, S.Y., Phillips, M.J, and A. Rambaut. 2006. Relaxed phylogenetics and dating with confidence. Public Library of Science Biology 4: 699-710.

Excoffier, L. and H.E.L. Lischer. 2010. Arlequin suite version 3.5: A new series of programs to perform population genetics analyses under Linux and Windows.

105 Molecular Ecology Resources 10: 564-567.

Goetz, E. 2003. Cryptic speciation of the high seas; global phylogenetics of the copepod family Eucalanidae Proceedings of the Royal Society A 370: 2321-2331.

Hall, T.A. 1999. BioEdit Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acid Symposium Series 41: 5.

Hanfling, B. and R. Brandl. 1998. Genetic differentiation of the bullhead Cottus gobio L. across watersheds in Central Europe: evidence for two taxa. Heredity 80: 110-117.

Hillis, D.M. and M.T. Dixon. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Quarterly Review in Biology 66: 411–453.

Huang, X. and A. Madan. 1999. CAP3: A DNA sequence assembly program. Genome Research 9: 868-877.

Lee, W.J., Coroy, J., Howell, W.H. and T.D. Kocher. 1995. Structure and evolution of fish mitochondrial control regions. Journal of Molecular Evolution 41: 54–66.

Maddison, W.P. 1997. Gene trees in species trees. Systematic Biology 46: 523–536.

Mayr, E. 1954. Change of genetic environment and evolution, pp. 157–80. In Evolution as a process, (J Huxley, AC Hardy, EB Ford eds). Allen and Unwin, London, UK.

McCartney, M.A. and F.E. Barreto. 2010. A mitochondrial DNA analysis of the species status of the endemic Waccamaw darter, Etheostoma perlongum. Copeia 1: 103-113.

105

Mesquita, N., Carvalho, G., Shaw, P., Crespo, E. and M.M. Coelho. 2001. River basin-related genetic structuring in an endangered fish species, Chondrostoma lusitanicum, based on mtDNA sequencing and RFLP analysis. Heredity 86(3): 253–264.

Near, T.J. and B.P. Keck. 2005. Dispersal, vicariance and timing of diversification in Nothonotus darters. Molecular Ecology 14: 3485-3496.

Peng, R., Zeng, B., Meng, X., Yue, B., Zhang,Z. and F. Zou. 2007. The complete mitochondrial genome and phylogenetic analysis of the giant panda (Ailuropoda melanoleuca). Gene 397(1-2): 76-83.

Saccone, C., Pesole, G. and E. Sbisa. 1991. The main regulatory region of mammalian mitochondrial DNA: structure-function model and evolutionary pattern. Journal of Molecular Evolution 33: 83–91.

Saghai-maroof, M.A., Soliman, K.M., Jorgensen, R.A. and R.W. Allard. 1984. Ribosomal

DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics. Proceedings of the National Academy of Science USA

106 81: 8014-8018.

Sambrook, J., Fritsch, E. F. and T. Maniatis. 1996. Molecular Cloning: A Laboratory Manual, edi. 2, pp 15-22. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Sanders, K. L. and M.S.Y. Lee. 2007. Evaluating molecular clock calibrations using Bayesian analyses with soft and hard bounds. Biology Letters 3: 275-279.

Seehausen, O. and C.E. Wagner. 2014. Speciation in Freshwater Fishes. Annual Review of Ecology, Evolution and Systematics 45: 621–51.

Sloss, B.L., Billington, N. and B.M. Burr. 2004. A molecular phylogeny of the Percidae (Teleostei, Perciformes) based on mitochondrial DNA sequence. Molecular Phylogenetics and Evolution 32(2): 545–562.

Slowinski, J.B. and R.D.M. Page. 1999. How species phylogenies should be inferred from sequence data? Systematic Biology 48: 814–825.

Smith, M.F. and J.L. Patton. 1991. Variation in mitochondrial cytochrome b sequence in natural populations of South American akodontine rodents (Muridae, Sigmodontinae). Molecular Biology and Evolution 8: 85–103.

Song, C.B., Near, T.J. and L.M. Page. 1998. Phylogenetic relations among Percid fishes as inferred from mitochondrial cytochrome b DNA sequence data. Molecular Phylogenetics Evolution 10: 343–353.

106

Sumida, M., Ogata, M. and M. Nishioka. 2000. Molecular phylogenetic relationships of pond frogs distributed in the palearctic region inferred from DNA sequences of mitochondrial 12S ribosomal RNA and cytochrome b genes. Molecular Phylogenetics and Evolution 16: 278–285.

Templeton, A.R. 1981. Mechanisms of speciation—a population genetic approach. Annual Review of Ecology and Systematics 12: 23-48.

Tipton, M.L., Gignoux-Wolfsohn, S., Stonebraker, P. and B. Chernoff. 2011. Postglacial recolonization of eastern Blacknose Dace, Rhinichthys atratulus (Teleostei: Cyprinidae), through the gateway of New England. Ecology and Evolution 1: 343–358.

Vigilant, L., Stoneking, M., Harpending, H., Hawkes, K. and A.C. Wilson. 1991. African populations and the evolution of human mitochondrial DNA. Science 253: 1503-1507.

Wenink, P.W., Baker, A.J. and M.G.J. Tilanus. 1994. Mitochondrial control region sequences

in two shorebird species, the Turnstone and the Dunlin, and their utility in population genetic studies. Molecular Biology and Evolution 11: 22–31.

107 Wirgin, I., Opperman, T. and J. Stabile. 2001. Genetic divergence of Robust Redhorse Moxostoma robustum (Cypriniformes Catostomidae) from the Oconee River and the Savannah River Based on mitochondrial DNA control region sequences. Copeia 2: 526-530.

Wright, S. 1931. Evolution in Mendelian populations. Genetics 16: 97–159.

107

Chapter 5. Summary and Conclusion

The existence of geographical barriers greatly favors the formation of new species. Parent

populations that are divided by natural barriers and remain separated for thousands of years are

exposed to different environmental conditions no matter how subtle. For this reason, the

examination of three freshwater fish species from two watersheds that have been isolated since the

Pleistocene was warranted. This paper represents the results of a quantitative examination of

chromosomal, morphometric, osteologic, meristic and mtDNA analyses.

There were no chromosomal differences observed between populations of fish in the two

108 isolated watersheds given the staining technique used in this study. However, results from

morphometric, osteologic and meristic analyses indicated that there were significant differences

between the two populations of fish.

The results of the molecular data supported the results of the morphometric data. There

were haplotypes common to both the Bronx and Saw Mill Rivers but also present were haplotypes

unique to both rivers. This pattern was present in all three fish species and suggests that the two

rivers were recolonized by all three species at approximately the same time. In addition, the

presence of different haplotypes in each river system indicates that these populations of fish have

diverged since the Pleistocene.

This study demonstrates that there are morphologic and genetic differences between the

three populations of fish. Considering how long the populations have been separated, the

geographic distance between rivers, and the effects of genetic drift acting independently in each

river, indicates that the time frame involved 17,500 years is sufficient time to observe subtle

differences between populations. It seems credible to hypothesize that if these systems remain

108

separated and the present environmental conditions persist, the small scale changes (genetic

variations) that are currently present in both river systems will accumulate overtime resulting in

individual species.

109

Appendix A. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 1 Head Length 1.40 1.35 1.40 1.45 1.40 1.40 1.30 0.95 1.20 1.25 1.25 2 Eye diameter 0.30 0.30 0.30 0.30 0.30 0.25 0.25 0.25 0.25 0.20 0.25 3 Interorbital width 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 4 Snout to anus 3.80 3.60 3.80 3.70 4.10 3.70 3.40 3.70 3.50 3.30 3.20 5 Snout to anal fin 4.00 3.80 4.00 4.00 4.20 3.80 3.50 3.90 3.60 2.60 3.30 6 Snout to origin of pelvic fin 3.00 2.80 3.10 3.10 3.20 3.10 2.80 3.00 2.70 1.20 2.70 7 Snout to origin of pectoral fin 1.40 1.30 1.40 1.50 1.40 1.40 1.20 1.30 1.20 1.90 1.20 8 Posterior end of dorsal fin to dorsal origin of caudal fin 2.20 2.00 2.10 2.20 2.20 2.00 2.00 2.00 2.00 2.00 1.80 9 Posterior end of dorsal fin to posterior end of anal fin 1.10 1.00 0.90 1.00 1.00 1.00 0.90 0.90 0.90 0.80 0.80 10 Posterior end of anal fin to dorsal origin of caudal fin 1.60 1.50 1.70 1.70 1.70 1.60 1.50 1.50 1.60 1.60 1.60 11 Posterior end of anal fin to ventral origin of caudal fin 1.50 1.30 1.50 1.70 1.50 1.50 1.50 1.50 1.50 1.50 1.50

110

12 Origin of dorsal fin to pelvic fin 1.20 1.20 1.20 1.20 1.20 1.20 1.00 1.10 1.00 0.80 1.00

13 Origin of dorsal fin to origin of anal fin 1.40 1.30 1.40 1.40 1.40 1.40 1.30 1.20 1.10 1.10 1.10 110 14 Origin of dorsal fin to posterior end of anal fin 1.60 0.40 1.50 1.60 1.50 1.40 1.40 1.50 1.40 1.30 1.20

15 Origin of pelvic fin to origin of anal fin 0.90 1.10 0.90 0.80 1.00 0.70 1.00 0.90 0.85 1.80 0.60 16 Origin of pelvic fin to posterior end of dorsal fin 1.30 1.30 1.30 1.30 1.30 1.20 1.30 1.30 1.30 0.80 1.00 17 Origin of anal fin to posterior end of dorsal fin 1.10 1.00 1.00 0.90 1.00 1.00 0.90 1.00 0.80 0.80 0.90 18 Predorsal length 3.40 3.30 3.40 3.20 3.40 3.10 3.10 3.20 3.00 2.30 2.80 19 Post dorsal length 2.90 2.50 2.50 2.70 2.60 2.55 2.50 2.50 2.30 2.30 1.80 20 Basal length of dorsal fin 0.50 0.50 0.60 0.60 0.60 0.60 0.45 0.60 0.50 0.50 0.60 21 Basal length of right pectoral fin 0.30 0.30 0.30 0.40 3.00 0.25 0.30 0.25 0.25 0.25 0.30 22 Basal length of left pectoral fin 0.30 0.30 0.30 0.30 0.30 0.25 0.30 0.15 0.25 0.20 0.25 23 Basal length of right pelvic fin 0.20 0.20 0.20 0.30 0.20 0.20 0.20 0.20 0.20 0.25 0.20

24 Basal length of left pelvic fin 0.20 0.20 0.20 0.25 0.20 0.20 0.20 0.20 0.20 0.20 0.25

Appendix A continued. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 12 13 14 15 16 17 18 19 20 21 22 1 Head Length 1.40 1.65 1.40 1.55 1.25 1.45 1.30 1.50 1.50 1.50 1.60 2 Eye diameter 0.25 0.30 0.25 0.30 0.25 0.25 0.25 0.30 0.20 0.30 0.30 3 Interorbital width 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 4 Snout to anus 3.70 4.00 3.60 4.10 3.00 3.40 3.40 3.70 3.30 4.20 4.10 5 Snout to anal fin 4.20 4.10 3.70 4.30 3.20 3.60 3.60 3.90 3.60 4.50 4.20 6 Snout to origin of pelvic fin 3.10 3.20 2.80 3.30 2.50 2.70 3.00 3.00 2.50 3.10 3.30 7 Snout to origin of pectoral fin 1.40 1.50 1.30 1.60 1.20 1.40 1.20 1.50 1.25 1.50 1.60 8 Posterior end of dorsal fin to dorsal origin of caudal fin 2.10 2.20 1.95 2.30 1.80 2.00 2.00 2.40 1.80 2.30 2.30 9 Posterior end of dorsal fin to posterior end of anal fin 0.95 1.00 0.90 0.90 0.80 0.90 0.80 1.10 0.80 1.10 1.10 10 Posterior end of anal fin to dorsal origin of caudal fin 1.50 1.80 1.70 1.70 1.40 1.70 1.50 1.80 1.40 1.80 1.70 11 Posterior end of anal fin to ventral origin of caudal fin 1.30 1.70 1.40 1.60 1.40 1.60 1.50 1.60 1.50 1.50 1.60

111

12 Origin of dorsal fin to pelvic fin 1.10 1.30 1.10 1.30 1.00 1.10 1.10 1.20 1.00 1.30 1.30

13 Origin of dorsal fin to origin of anal fin 1.20 1.50 1.30 1.40 1.10 1.20 1.25 1.40 0.90 1.50 1.40 111 14 Origin of dorsal fin to posterior end of anal fin 1.40 1.60 1.40 1.60 1.25 1.35 1.50 1.50 1.30 1.70 1.60

15 Origin of pelvic fin to origin of anal fin 0.90 0.90 0.80 0.80 0.90 0.80 0.80 0.70 0.80 1.50 1.00 16 Origin of pelvic fin to posterior end of dorsal fin 1.10 0.70 1.10 1.30 1.20 1.20 1.20 1.20 1.10 1.40 1.50 17 Origin of anal fin to posterior end of dorsal fin 1.00 1.10 0.80 1.00 0.80 0.90 0.90 1.10 0.70 1.20 1.10 18 Predorsal length 3.30 3.70 3.15 3.40 2.80 3.10 2.90 3.15 2.70 3.30 3.65 19 Post dorsal length 1.90 2.20 2.30 2.80 2.10 1.80 2.30 2.70 2.30 2.70 2.80 20 Basal length of dorsal fin 0.50 0.60 0.60 0.70 0.40 0.50 0.50 0.60 0.50 0.70 0.50 21 Basal length of right pectoral fin 0.25 0.30 0.30 0.30 0.30 0.35 0.25 0.40 0.30 0.30 0.30 22 Basal length of left pectoral fin 0.20 0.30 0.35 0.25 0.30 0.30 0.30 0.40 0.30 0.30 0.30 23 Basal length of right pelvic fin 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 24 Basal length of left pelvic fin 0.15 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20

Appendix A continued. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 23 24 25 26 27 28 29 30 31 32 33 1 Head Length 1.40 1.35 1.20 1.30 1.20 1.20 1.20 1.30 1.25 1.35 1.10 2 Eye diameter 0.30 0.30 0.30 0.25 0.25 0.25 0.20 0.30 0.20 0.30 0.25 3 Interorbital width 0.10 0.10 0.10 0.05 0.10 0.10 0.10 0.10 0.10 0.10 0.10 4 Snout to anus 3.60 3.40 3.20 3.30 3.20 3.40 3.30 3.30 3.20 3.50 4.20 5 Snout to anal fin 3.70 3.60 3.30 3.50 3.30 3.50 3.40 3.50 3.30 3.70 4.30 6 Snout to origin of pelvic fin 3.00 2.80 2.40 2.70 2.50 2.80 2.60 2.90 2.60 2.90 3.30 7 Snout to origin of pectoral fin 1.30 1.30 1.20 1.20 1.30 1.25 1.20 1.30 1.20 1.30 1.60 8 Posterior end of dorsal fin to dorsal origin of caudal fin 2.00 2.00 1.70 2.00 1.90 1.90 1.80 2.00 1.80 2.10 2.40 9 Posterior end of dorsal fin to posterior end of anal fin 1.00 1.00 1.80 0.90 0.80 0.90 0.70 0.90 0.80 1.90 1.10 10 Posterior end of anal fin to dorsal origin of caudal fin 1.60 1.70 1.40 1.30 1.40 1.50 1.40 1.50 1.40 1.60 1.80 11 Posterior end of anal fin to ventral origin of caudal fin 1.40 1.60 1.25 1.20 1.40 1.50 1.40 1.40 1.20 1.40 1.70

112

12 Origin of dorsal fin to pelvic fin 1.20 1.10 0.90 1.00 1.00 1.00 1.00 1.00 1.20 1.20 1.20

13 Origin of dorsal fin to origin of anal fin 1.40 1.20 1.00 1.00 1.10 1.00 1.10 1.20 1.00 1.30 1.40 112 14 Origin of dorsal fin to posterior end of anal fin 1.50 1.40 1.20 1.30 1.30 1.20 1.20 1.30 1.20 1.50 1.60

15 Origin of pelvic fin to origin of anal fin 0.85 0.80 1.00 1.00 0.80 1.30 0.80 0.60 0.70 0.85 0.90 16 Origin of pelvic fin to posterior end of dorsal fin 1.00 1.30 1.00 1.10 1.00 0.70 1.20 1.20 1.10 1.30 1.30 17 Origin of anal fin to posterior end of dorsal fin 0.90 1.00 0.80 0.80 0.85 1.10 1.30 0.90 0.80 1.10 1.20 18 Predorsal length 3.10 3.05 2.60 2.75 2.60 0.80 2.30 2.85 2.70 3.20 3.60 19 Post dorsal length 2.50 2.50 2.10 2.00 2.10 2.10 2.10 2.10 2.10 2.50 3.00 20 Basal length of dorsal fin 0.60 0.40 0.45 0.40 0.50 0.40 0.50 0.50 0.50 0.60 0.60 21 Basal length of right pectoral fin 0.30 0.40 0.25 0.25 0.30 0.25 0.30 0.25 0.30 0.25 0.30 22 Basal length of left pectoral fin 0.30 0.20 0.25 0.25 0.30 0.25 0.30 0.25 0.30 0.25 0.30 23 Basal length of right pelvic fin 0.20 0.30 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20

24 Basal length of left pelvic fin 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20

Appendix A continued. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 34 35 1 Head Length 1.50 1.10 2 Eye diameter 0.30 0.35 3 Interorbital width 0.10 0.10 4 Snout to anus 3.70 4.10 5 Snout to anal fin 3.90 4.30 6 Snout to origin of pelvic fin 2.90 3.30 7 Snout to origin of pectoral fin 1.50 1.60 8 Posterior end of dorsal fin to dorsal origin of caudal fin 2.20 2.50 9 Posterior end of dorsal fin to posterior end of anal fin 0.90 1.00 10 Posterior end of anal fin to dorsal origin of caudal fin 1.50 1.80 11 Posterior end of anal fin to ventral origin of caudal fin 1.50 1.70

3 12 Origin of dorsal fin to pelvic fin 1.20 1.30

13 Origin of dorsal fin to origin of anal fin 1.30 1.40 113 14 Origin of dorsal fin to posterior end of anal fin 1.60 1.50

15 Origin of pelvic fin to origin of anal fin 0.90 1.15 16 Origin of pelvic fin to posterior end of dorsal fin 1.30 1.50 17 Origin of anal fin to posterior end of dorsal fin 1.00 1.10 18 Predorsal length 3.30 3.60 19 Post dorsal length 2.50 2.40 20 Basal length of dorsal fin 0.50 0.60 21 Basal length of right pectoral fin 0.25 0.30 22 Basal length of left pectoral fin 0.25 0.30 23 Basal length of right pelvic fin 0.20 0.20 24 Basal length of left pelvic fin 0.20 0.20

Appendix A continued. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 25 Basal length of caudal fin 0.50 0.60 0.55 0.55 0.40 0.50 0.55 0.70 0.50 0.60 0.60 26 Basal length of anal fin 0.40 0.60 0.50 0.60 0.50 0.50 0.50 0.50 0.40 0.77 0.60 27 Length of longest dorsal ray 1.10 1.15 1.10 1.10 0.95 1.15 1.05 1.25 1.00 1.10 1.25 28 Length of right pectoral fin ( longest ray) 1.00 1.15 1.05 1.00 0.95 1.10 0.95 1.50 1.00 1.20 1.20 29 Length of left pectoral fin ( longest ray) 0.95 1.10 1.20 1.00 0.95 1.10 0.90 1.10 0.90 1.10 1.10 30 Length of right pelvic fin ( longest ray) 0.80 0.80 0.90 0.75 0.75 0.85 0.95 1.00 0.95 0.80 0.90 31 Length of left pelvic fin ( longest ray) 0.80 0.80 0.90 0.80 0.70 0.85 0.80 1.00 0.70 0.90 0.85 32 Length of caudal fin (longest ray) 1.20 1.20 1.40 1.30 1.10 1.30 1.30 1.40 1.10 1.40 1.50 33 Length of anal fin (longest ray) 1.20 1.30 1.05 1.35 0.85 1.00 0.95 1.05 0.90 1.35 1.35 34 Gape height 0.35 0.30 0.30 0.30 0.25 0.30 0.25 0.35 0.30 0.35 0.30 35 Closed mouth width ( jaw angle to jaw angle) 0.40 0.40 0.40 0.40 0.30 0.40 0.40 0.40 0.35 0.45 0.40

114

36 Length of maxilla 0.30 0.40 0.35 0.35 0.30 0.30 0.40 0.35 0.30 0.35 0.40

37 Length of mandible 0.25 0.35 0.30 0.30 0.25 0.30 0.35 0.30 0.25 0.30 0.35 114 38 Total Length 6.80 7.60 6.70 7.60 6.00 6.70 6.50 7.20 6.30 7.40 7.70

39 Standard length 5.60 6.30 5.40 6.20 4.80 5.30 5.30 5.90 5.10 6.00 6.20 40 Fork length 6.50 7.30 6.40 7.30 5.70 6.30 6.20 6.80 5.90 7.00 7.30 41 Height of dorsal fin 0.50 0.60 0.40 0.50 0.40 0.40 0.50 0.40 0.40 0.60 0.70 42 Height of right pectoral fin 0.20 0.30 0.50 0.40 0.40 0.50 0.40 0.50 0.50 0.40 0.50 43 Height of left pectoral fin 0.20 0.30 0.50 0.40 0.40 0.50 0.40 0.40 0.50 0.40 0.50 44 Height of right pelvic fin 0.15 0.20 0.20 0.20 0.20 0.20 0.25 0.50 0.20 0.30 0.30 45 Height of left pelvic fin 0.15 0.20 0.20 0.20 0.20 0.20 0.25 0.50 0.20 0.30 0.20 46 Height of caudal fin 0.50 0.70 0.60 0.60 0.50 0.50 0.70 0.70 0.60 7.00 0.70 47 Height of anal fin 0.30 0.60 0.40 0.30 0.30 0.50 0.30 0.45 0.30 0.50 0.50

48 Snout to eye apex 0.45 0.50 0.40 0.50 0.40 1.40 0.35 0.55 0.40 0.45 0.50

Appendix A continued. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 12 13 14 15 16 17 18 19 20 21 22 25 Basal length of caudal fin 0.50 0.60 0.55 0.55 0.40 0.50 0.55 0.70 0.50 0.60 0.60 26 Basal length of anal fin 0.40 0.60 0.50 0.60 0.50 0.50 0.50 0.50 0.40 0.77 0.60 27 Length of longest dorsal ray 1.10 1.15 1.10 1.10 0.95 1.15 1.05 1.25 1.00 1.10 1.25 28 Length of right pectoral fin ( longest ray) 1.00 1.15 1.05 1.00 0.95 1.10 0.95 1.50 1.00 1.20 1.20 29 Length of left pectoral fin ( longest ray) 0.95 1.10 1.20 1.00 0.95 1.10 0.90 1.10 0.90 1.10 1.10 30 Length of right pelvic fin ( longest ray) 0.80 0.80 0.90 0.75 0.75 0.85 0.95 1.00 0.95 0.80 0.90 31 Length of left pelvic fin ( longest ray) 0.80 0.80 0.90 0.80 0.70 0.85 0.80 1.00 0.70 0.90 0.85 32 Length of caudal fin (longest ray) 1.20 1.20 1.40 1.30 1.10 1.30 1.30 1.40 1.10 1.40 1.50 33 Length of anal fin (longest ray) 1.20 1.30 1.05 1.35 0.85 1.00 0.95 1.05 0.90 1.35 1.35 34 Gape height 0.35 0.30 0.30 0.30 0.25 0.30 0.25 0.35 0.30 0.35 0.30 35 Closed mouth width ( jaw angle to jaw angle) 0.40 0.40 0.40 0.40 0.30 0.40 0.40 0.40 0.35 0.45 0.40

115

36 Length of maxilla 0.30 0.40 0.35 0.35 0.30 3.50 0.40 0.35 0.30 0.35 0.40

37 Length of mandible 0.25 0.35 0.30 0.30 0.25 0.30 0.35 0.30 0.25 0.30 0.35 115 38 Total Length 6.80 7.60 6.70 7.60 6.00 6.70 6.50 7.20 6.30 7.40 7.70

Appendix A continued. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 23 24 25 26 27 28 29 30 31 32 33 25 Basal length of caudal fin 0.60 0.50 0.50 0.45 0.50 0.50 0.50 0.50 0.50 0.60 0.60 26 Basal length of anal fin 0.50 0.40 0.40 0.40 0.40 0.50 0.50 0.50 0.40 0.40 0.50 27 Length of longest dorsal ray 1.10 1.15 1.10 0.95 0.90 1.00 0.95 1.05 0.95 1.10 1.20 28 Length of right pectoral fin ( longest ray) 1.00 1.10 1.00 0.80 0.90 0.75 0.85 1.00 0.90 1.05 1.20 29 Length of left pectoral fin ( longest ray) 1.10 1.00 0.80 1.00 1.00 0.90 0.80 0.90 0.90 1.00 1.20 30 Length of right pelvic fin ( longest ray) 0.85 0.80 0.70 0.50 0.55 0.50 0.45 0.50 0.55 0.80 1.20 31 Length of left pelvic fin ( longest ray) 0.80 0.80 0.60 0.65 0.80 0.80 0.70 0.70 0.85 0.80 0.90 32 Length of caudal fin (longest ray) 1.40 1.20 1.10 1.20 1.10 1.25 1.10 1.10 1.10 1.35 1.40 33 Length of anal fin (longest ray) 1.25 1.05 1.05 1.10 0.95 1.15 1.10 0.95 0.85 0.30 1.45 34 Gape height 0.30 0.20 0.25 0.25 0.25 0.30 0.25 0.30 0.30 0.30 0.30 35 Closed mouth width ( jaw angle to jaw angle) 0.35 0.40 0.30 0.35 0.35 0.40 0.30 0.30 0.35 0.40 0.40

116

36 Length of maxilla 0.30 0.35 0.30 0.30 0.25 0.30 0.30 0.40 0.30 0.40 0.40

37 Length of mandible 0.25 0.30 0.25 0.20 0.20 0.25 0.25 0.30 0.25 0.30 0.35 116 38 Total Length 6.90 6.50 5.70 6.00 7.00 6.30 6.10 6.10 6.00 6.90 7.60

39 Standard length 5.50 5.10 4.60 4.70 4.70 5.00 4.80 4.80 4.80 5.50 6.00 40 Fork length 6.50 6.20 5.50 5.70 5.60 5.90 5.80 5.80 5.70 6.50 7.10 41 Height of dorsal fin 0.60 0.40 0.50 0.40 0.40 0.40 0.50 0.50 0.40 0.70 0.60 42 Height of right pectoral fin 0.40 0.50 0.30 0.30 0.40 0.30 0.30 0.30 0.40 0.30 0.50 43 Height of left pectoral fin 0.40 0.50 0.30 0.30 0.40 0.30 0.30 0.30 0.40 0.30 0.50 44 Height of right pelvic fin 0.30 0.30 0.20 0.20 0.25 0.20 0.20 0.20 0.20 0.20 0.30 45 Height of left pelvic fin 0.30 0.30 0.20 0.20 0.25 0.20 0.20 0.20 0.20 0.20 0.30 46 Height of caudal fin 0.70 0.70 0.60 0.50 0.50 0.50 0.50 0.40 0.50 0.70 0.60 47 Height of anal fin 0.40 0.30 0.35 0.20 0.25 0.30 0.25 0.30 0.25 0.40 0.40 48 Snout to eye apex 0.45 0.35 0.35 0.35 0.35 0.45 0.35 0.35 0.45 0.45 0.50

Appendix A continued. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 34 35 25 Basal length of caudal fin 0.60 0.65 26 Basal length of anal fin 0.50 0.60 27 Length of longest dorsal ray 1.10 1.40 28 Length of right pectoral fin ( longest ray) 1.10 1.20 29 Length of left pectoral fin ( longest ray) 1.10 1.20 30 Length of right pelvic fin ( longest ray) 0.90 0.90 31 Length of left pelvic fin ( longest ray) 0.90 1.00 32 Length of caudal fin (longest ray) 1.30 1.40 33 Length of anal fin (longest ray) 1.30 1.50 34 Gape height 0.30 0.35 35 Closed mouth width ( jaw angle to jaw angle) 0.40 0.50

117

36 Length of maxilla 0.30 0.40

37 Length of mandible 0.25 0.35 117 38 Total Length 7.00 8.00

39 Standard length 5.60 6.50 40 Fork length 6.70 7.50 41 Height of dorsal fin 0.55 0.60 42 Height of right pectoral fin 0.30 0.50 43 Height of left pectoral fin 0.30 0.50 44 Height of right pelvic fin 0.20 0.30 45 Height of left pelvic fin 0.20 0.30 46 Height of caudal fin 0.50 0.60 47 Height of anal fin 0.40 0.50 48 Snout to eye apex 0.40 0.60

Appendix A continued. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 49 Mouth length 0.30 0.25 0.30 0.25 0.30 0.30 0.25 0.30 0.20 0.25 0.30 50 Body depth 1.30 1.20 1.30 1.40 1.40 1.20 1.00 1.30 0.90 0.80 0.80 51 Caudal peduncle depth (Height) 1.10 0.60 0.60 0.60 0.55 0.65 0.50 0.60 0.60 0.50 0.50 52 Caudal peduncle length 1.60 2.50 2.55 2.10 2.20 2.10 1.80 1.90 1.85 1.80 1.80 53 Number of chin barbels 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 54 Length of chin barbels 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10

118

Appendix A continued. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 12 13 14 15 16 17 18 19 20 21 22 49 Mouth length 0.30 0.35 0.30 0.30 0.30 0.25 0.25 0.30 0.30 0.30 0.25 50 Body depth 1.00 0.40 1.10 1.40 0.90 1.40 0.80 0.90 0.80 1.40 1.10 51 Caudal peduncle depth (Height) 1.10 0.65 0.60 0.60 0.50 0.60 0.55 0.65 0.50 0.60 0.65 52 Caudal peduncle length 2.00 2.20 1.30 2.30 1.80 2.00 2.00 2.20 1.80 2.20 2.10 53 Number of chin barbels 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 54 Length of chin barbels 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10

119

Appendix A continued. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 23 24 25 26 27 28 29 30 31 32 33 49 Mouth length 0.25 0.25 0.30 0.20 0.20 0.20 0.30 0.20 0.30 0.25 0.25 50 Body depth 0.90 0.60 0.70 0.70 0.60 0.80 0.80 0.90 0.70 1.30 1.40 51 Caudal peduncle depth (Height) 0.50 0.55 0.45 0.45 0.45 0.55 0.45 0.45 0.45 0.60 0.70 52 Caudal peduncle length 1.80 1.75 1.50 1.70 1.60 1.80 1.70 1.70 1.80 2.00 2.30 53 Number of chin barbels 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 54 Length of chin barbels 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10

120

Appendix A continued. Morphometric characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 34 35 49 Mouth length 0.25 0.30 50 Body depth 1.20 1.35 51 Caudal peduncle depth (Height) 0.60 0.65 52 Caudal peduncle length 2.10 2.30 53 Number of chin barbels 2.00 2.00 54 Length of chin barbels 0.10 0.10

121

Appendix B. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 1 Head Length 1.30 1.20 1.50 1.40 1.40 1.40 1.35 1.35 1.00 2 Eye diameter 0.25 1.25 0.25 0.30 0.30 0.30 0.30 0.30 0.20 3 Interorbital width 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 4 Snout to anus 3.50 3.20 3.30 3.50 3.50 3.60 3.80 3.30 2.60 5 Snout to anal fin 3.60 3.30 3.80 3.60 3.60 3.70 3.90 3.40 2.70 6 Snout to origin of pelvic fin 2.70 2.60 2.90 2.70 2.80 2.80 3.00 2.65 2.15 7 Snout to origin of pectoral fin 1.20 1.30 1.40 1.30 1.40 1.30 1.50 1.30 1.10 8 Posterior end of dorsal fin to dorsal origin of caudal fin 1.30 1.85 2.00 1.80 1.90 2.10 2.00 1.80 1.50 9 Posterior end of dorsal fin to posterior end of anal fin 0.90 0.90 1.10 0.90 0.90 0.90 1.10 0.90 0.75 10 Posterior end of anal fin to dorsal origin of caudal fin 1.40 1.40 1.30 1.50 1.50 1.60 1.50 1.40 1.20 11 Posterior end of anal fin to ventral origin of caudal fin 1.35 1.40 1.50 1.30 1.30 1.40 1.50 1.30 1.15

122 0.90

12 Origin of dorsal fin to pelvic fin 1.15 1.15 1.15 1.20 1.20 1.20 1.10 1.20

0.95

122 13 Origin of dorsal fin to origin of anal fin 1.20 1.10 1.30 1.25 1.20 1.30 1.25 1.25 14 Origin of dorsal fin to posterior end of anal fin 1.45 1.40 1.50 1.50 1.40 1.60 1.50 1.45 1.10

15 Origin of pelvic fin to origin of anal fin 0.80 0.90 0.80 0.80 0.85 1.00 0.85 0.80 0.60 16 Origin of pelvic fin to posterior end of dorsal fin 1.20 1.20 1.20 1.25 1.20 1.25 1.25 1.15 0.90 17 Origin of anal fin to posterior end of dorsal fin 1.00 0.90 0.90 1.00 1.00 1.00 0.90 0.90 0.70 18 Predorsal length 3.10 2.80 3.15 3.10 3.15 3.15 3.30 2.95 2.30 19 Post dorsal length 1.80 1.90 2.10 1.90 1.90 2.00 2.10 1.75 1.45 20 Basal length of dorsal fin 0.60 0.50 0.60 0.60 0.50 0.60 0.60 0.50 0.45 21 Basal length of right pectoral fin 0.20 0.30 0.25 0.25 0.25 0.25 0.25 0.20 0.20 22 Basal length of left pectoral fin 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.20 23 Basal length of right pelvic fin 0.25 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 24 Basal length of left pelvic fin 0.20 0.20 0.20 0.25 0.25 0.20 0.25 0.25 0.20

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 10 11 12 13 14 15 16 17 18 1 Head Length 1.05 1.10 1.15 1.15 1.25 1.25 1.30 1.20 1.20 2 Eye diameter 0.25 0.20 0.25 0.25 0.30 0.25 0.25 0.25 0.25 3 Interorbital width 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 4 Snout to anus 2.70 1.10 3.30 3.10 3.20 3.55 3.20 3.20 3.20 5 Snout to anal fin 2.80 0.20 3.80 2.90 3.30 3.60 3.35 3.30 3.30 6 Snout to origin of pelvic fin 2.20 0.10 2.90 2.20 2.60 2.80 2.60 2.50 2.50 7 Snout to origin of pectoral fin 1.10 3.00 1.40 1.10 1.30 1.30 1.50 1.20 1.20 8 Posterior end of dorsal fin to dorsal origin of caudal fin 1.00 1.60 2.00 1.60 1.70 1.95 1.95 1.80 1.80 9 Posterior end of dorsal fin to posterior end of anal fin 0.80 0.70 1.10 0.70 0.80 0.95 0.90 0.80 0.80 10 Posterior end of anal fin to dorsal origin of caudal fin 1.20 1.40 1.30 1.40 1.50 1.50 1.50 1.40 1.30 11 Posterior end of anal fin to ventral origin of caudal fin 1.00 1.30 1.50 1.30 1.10 1.50 1.40 1.35 1.30

123 0.90 1.00 1.15 1.00 1.00 1.20 1.20 1.10 1.10

12 Origin of dorsal fin to pelvic fin

0.90 1.05 1.30 1.05 1.05 1.30 1.15 1.10 1.15

123 13 Origin of dorsal fin to origin of anal fin 14 Origin of dorsal fin to posterior end of anal fin 1.10 1.20 1.50 1.20 1.25 1.45 1.40 1.20 1.30

15 Origin of pelvic fin to origin of anal fin 0.60 0.65 0.80 0.65 0.70 0.80 0.65 0.75 0.70 16 Origin of pelvic fin to posterior end of dorsal fin 0.90 1.20 1.25 1.20 1.00 1.30 1.20 1.20 1.10 17 Origin of anal fin to posterior end of dorsal fin 0.70 0.80 1.00 0.80 0.80 0.95 0.95 0.80 0.85 18 Predorsal length 2.30 2.70 3.10 2.70 2.75 3.10 3.00 2.85 2.80 19 Post dorsal length 1.50 1.50 1.90 1.50 1.70 1.90 1.85 1.70 1.70 20 Basal length of dorsal fin 0.40 0.50 0.60 0.50 0.45 0.50 0.50 0.45 0.50 21 Basal length of right pectoral fin 0.20 0.25 0.25 0.25 0.20 0.20 0.30 0.20 0.45 22 Basal length of left pectoral fin 0.20 0.30 0.25 0.30 0.20 0.30 0.35 0.25 0.30 23 Basal length of right pelvic fin 0.20 0.20 0.20 0.20 0.20 0.20 0.25 0.25 0.20

24 Basal length of left pelvic fin 0.20 0.25 0.25 0.25 0.15 0.25 0.20 0.20 0.20

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 19 20 21 22 23 24 25 26 27 1 Head Length 1.50 1.30 1.20 1.30 1.45 1.40 1.50 1.45 1.45 2 Eye diameter 0.25 0.25 0.20 0.25 0.25 0.30 0.30 0.30 0.30 3 Interorbital width 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 4 Snout to anus 3.50 3.20 3.10 3.10 3.35 3.65 3.60 3.50 4.00 5 Snout to anal fin 3.60 3.30 3.20 3.20 3.45 3.70 3.80 3.70 4.30 6 Snout to origin of pelvic fin 2.70 2.60 2.40 2.50 2.70 3.00 2.90 3.00 3.20 7 Snout to origin of pectoral fin 1.40 1.30 1.20 1.25 1.35 1.35 1.35 1.40 1.50 8 Posterior end of dorsal fin to dorsal origin of caudal fin 2.00 1.80 1.60 1.60 2.00 2.20 2.20 2.20 2.20 9 Posterior end of dorsal fin to posterior end of anal fin 0.90 0.80 0.70 0.80 1.00 0.90 0.90 1.00 1.10 10 Posterior end of anal fin to dorsal origin of caudal fin 1.60 1.40 1.40 1.30 1.50 1.50 1.70 1.70 1.60 11 Posterior end of anal fin to ventral origin of caudal fin 1.50 1.40 1.30 1.40 1.40 1.30 1.50 1.50 1.40

124 1.30 1.30 1.00 1.00 1.10 1.20 1.30 1.20 1.20

12 Origin of dorsal fin to pelvic fin

1.20 1.20 1.05 1.10 1.20 1.30 1.30 1.30 1.50

124 13 Origin of dorsal fin to origin of anal fin 14 Origin of dorsal fin to posterior end of anal fin 1.50 1.30 1.20 1.30 1.40 1.50 1.40 1.50 1.60

15 Origin of pelvic fin to origin of anal fin 0.95 0.50 0.65 0.65 0.80 0.80 1.00 1.00 1.20 16 Origin of pelvic fin to posterior end of dorsal fin 1.30 1.25 1.20 1.10 1.30 1.20 1.30 1.20 1.30 17 Origin of anal fin to posterior end of dorsal fin 1.00 0.90 0.80 0.80 0.95 0.90 1.10 1.00 1.20 18 Predorsal length 3.20 2.90 2.70 2.70 3.00 3.10 3.20 3.30 3.50 19 Post dorsal length 2.10 1.75 1.50 1.70 1.90 2.20 2.50 2.00 2.50 20 Basal length of dorsal fin 0.65 0.55 0.50 0.50 0.55 0.60 0.50 0.60 0.80 21 Basal length of right pectoral fin 0.30 0.35 0.25 0.20 0.35 0.25 0.30 0.30 0.30 22 Basal length of left pectoral fin 0.35 0.35 0.30 0.30 0.35 0.25 0.30 0.30 0.30 23 Basal length of right pelvic fin 0.25 0.25 0.20 0.20 0.25 0.20 0.20 0.20 0.20 24 Basal length of left pelvic fin 0.30 0.20 0.25 0.20 0.25 0.20 0.20 0.20 0.20

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 28 29 30 21 32 33 34 35 1 Head Length 1.50 1.40 1.50 1.30 1.50 1.30 1.30 1.30 2 Eye diameter 0.25 0.25 0.30 0.25 0.30 0.25 0.30 0.25 3 Interorbital width 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 4 Snout to anus 4.10 3.50 4.20 3.60 3.70 3.70 3.80 3.90 5 Snout to anal fin 4.25 3.70 4.30 3.70 3.80 3.80 4.00 4.00 6 Snout to origin of pelvic fin 3.30 2.80 3.30 2.90 2.80 2.90 3.20 3.10 7 Snout to origin of pectoral fin 1.50 1.30 1.60 1.30 1.40 1.30 1.30 1.50 8 Posterior end of dorsal fin to dorsal origin of caudal fin 2.20 2.10 2.20 2.10 2.20 2.20 2.10 2.30 9 Posterior end of dorsal fin to posterior end of anal fin 1.00 1.00 1.00 1.00 0.80 0.90 1.10 1.10 10 Posterior end of anal fin to dorsal origin of caudal fin 1.70 1.70 1.70 1.50 1.80 1.60 1.60 1.70 11 Posterior end of anal fin to ventral origin of caudal fin 1.60 1.60 1.70 1.40 1.60 1.50 1.60 1.60

125 1.30 1.00 1.30 1.20 1.20 1.30 1.10 1.20

12 Origin of dorsal fin to pelvic fin

1.40 1.20 1.40 1.30 1.25 1.30 1.30 1.30

125 13 Origin of dorsal fin to origin of anal fin 14 Origin of dorsal fin to posterior end of anal fin 1.70 1.40 1.50 1.50 1.40 1.50 1.50 1.60

15 Origin of pelvic fin to origin of anal fin 1.10 0.80 1.00 0.80 0.90 0.90 0.90 0.90 16 Origin of pelvic fin to posterior end of dorsal fin 1.40 1.30 1.40 1.20 1.40 1.30 1.30 1.20 17 Origin of anal fin to posterior end of dorsal fin 1.10 1.00 1.10 0.90 0.90 0.90 1.00 0.90 18 Predorsal length 3.50 3.10 3.55 3.30 3.35 3.25 3.20 3.25 19 Post dorsal length 2.10 2.50 2.80 2.40 2.50 2.60 2.60 2.60 20 Basal length of dorsal fin 0.70 0.60 0.50 0.60 0.60 0.60 0.50 0.60 21 Basal length of right pectoral fin 0.30 0.30 0.30 0.30 0.30 0.30 0.30 0.40 22 Basal length of left pectoral fin 0.30 0.35 0.30 0.30 0.30 0.30 0.30 0.40 23 Basal length of right pelvic fin 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.25 24 Basal length of left pelvic fin 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.25

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 36 37 38 1 Head Length 1.40 1.30 1.10 2 Eye diameter 0.25 0.30 0.25 3 Interorbital width 0.10 0.10 0.10 4 Snout to anus 3.90 3.70 3.35 5 Snout to anal fin 4.00 3.80 3.40 6 Snout to origin of pelvic fin 3.20 2.90 2.80 7 Snout to origin of pectoral fin 1.40 1.40 1.10 8 Posterior end of dorsal fin to dorsal origin of caudal fin 2.10 2.25 1.80 9 Posterior end of dorsal fin to posterior end of anal fin 0.90 0.90 0.80 10 Posterior end of anal fin to dorsal origin of caudal fin 1.60 1.70 1.40 11 Posterior end of anal fin to ventral origin of caudal fin 1.50 1.70 1.30

126 1.20 1.10 1.00

12 Origin of dorsal fin to pelvic fin

1.30 1.20 1.10

126 13 Origin of dorsal fin to origin of anal fin 14 Origin of dorsal fin to posterior end of anal fin 1.40 1.30 1.20

15 Origin of pelvic fin to origin of anal fin 0.90 0.80 0.80 16 Origin of pelvic fin to posterior end of dorsal fin 1.30 1.20 1.00 17 Origin of anal fin to posterior end of dorsal fin 1.00 0.90 0.90 18 Predorsal length 3.30 3.30 2.75 19 Post dorsal length 2.55 2.50 2.20 20 Basal length of dorsal fin 0.50 0.50 0.45 21 Basal length of right pectoral fin 0.30 0.35 0.25 22 Basal length of left pectoral fin 0.30 0.35 0.25 23 Basal length of right pelvic fin 0.20 0.25 0.20 24 Basal length of left pelvic fin 0.20 0.25 0.20

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 25 Basal length of caudal fin 0.50 0.45 0.50 0.50 0.50 0.55 0.55 0.50 0.35 26 Basal length of anal fin 0.45 0.50 0.50 0.50 0.45 0.40 0.50 0.40 0.95 27 Length of longest dorsal ray 0.80 0.90 1.00 1.05 1.00 0.90 1.00 0.95 0.90 28 Length of right pectoral fin ( longest ray) 0.90 0.90 1.05 1.00 1.00 1.00 0.95 1.00 0.90 29 Length of left pectoral fin ( longest ray) 0.60 0.80 0.80 0.85 0.80 0.80 0.90 0.80 0.60 30 Length of right pelvic fin ( longest ray) 0.80 0.75 0.80 0.75 0.80 0.80 0.70 0.80 0.70 31 Length of left pelvic fin ( longest ray) 1.10 1.00 0.00 1.20 1.15 1.10 1.30 1.20 1.00 32 Length of caudal fin (longest ray) 1.15 1.00 1.20 1.15 1.20 1.20 1.30 1.20 0.95 33 Length of anal fin (longest ray) 0.45 0.50 0.50 0.50 0.45 0.40 0.50 0.40 0.45 34 Gape height 0.40 0.35 0.45 0.40 0.40 0.40 0.45 0.35 0.35 35 Closed mouth width ( jaw angle to jaw angle) 0.30 0.30 0.40 0.35 0.35 0.35 0.35 0.30 0.30

127

36 Length of maxilla 0.25 0.25 0.35 0.30 0.30 0.30 0.30 0.25 0.25

37 Length of mandible 6.30 6.20 7.00 6.60 6.60 7.00 7.10 6.40 5.90 127 38 Total Length 5.20 5.20 5.70 5.40 5.50 5.80 5.80 5.20 4.90

39 Standard length 6.00 5.80 6.50 6.20 6.20 6.60 6.20 6.00 5.50 40 Fork length 0.55 0.50 0.55 0.50 0.60 0.60 0.60 0.60 0.70 41 Height of dorsal fin 0.50 0.60 0.50 0.50 0.50 0.50 0.50 0.40 0.50 42 Height of right pectoral fin 0.50 0.60 0.50 0.50 0.50 0.50 0.50 0.50 0.65 43 Height of left pectoral fin 0.40 0.40 0.40 0.45 0.40 0.45 0.40 0.35 0.50 44 Height of right pelvic fin 0.50 0.40 0.50 0.50 0.45 0.45 0.50 0.50 0.50 45 Height of left pelvic fin 1.20 0.90 0.00 1.20 1.20 1.25 1.00 1.10 1.00 46 Height of caudal fin 0.50 0.50 0.70 0.60 0.55 0.60 1.10 1.20 0.50 47 Height of anal fin 0.30 0.30 0.25 0.20 0.25 0.20 0.25 0.30 0.30 48 Mouth length 0.60 0.60 0.60 0.65 0.70 0.65 0.65 0.65 0.55

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 10 11 12 13 14 15 16 17 18 25 Basal length of caudal fin 0.60 0.60 0.65 0.60 0.55 0.70 0.60 0.60 0.55 26 Basal length of anal fin 0.40 0.50 0.50 0.50 0.45 0.50 0.50 0.45 0.40 27 Length of longest dorsal ray 0.95 0.95 0.50 0.95 0.85 0.95 0.95 0.95 1.00 28 Length of right pectoral fin ( longest ray) 0.90 0.90 1.05 0.90 0.70 0.80 0.70 0.70 0.75 29 Length of left pectoral fin ( longest ray) 0.90 0.90 1.00 0.90 0.70 0.75 0.80 0.80 0.85 30 Length of right pelvic fin ( longest ray) 0.60 0.60 0.85 0.60 0.50 0.55 0.60 0.50 0.50 31 Length of left pelvic fin ( longest ray) 0.70 0.70 0.75 0.70 0.55 0.70 0.70 0.65 0.65 32 Length of caudal fin (longest ray) 1.00 1.00 1.20 1.00 1.05 1.00 0.90 1.00 1.00 33 Length of anal fin (longest ray) 0.95 0.95 1.15 0.95 1.00 1.10 0.80 1.05 0.90 34 Gape height 0.45 0.45 0.50 0.45 0.45 0.50 0.45 0.50 0.45 35 Closed mouth width ( jaw angle to jaw angle) 0.35 0.35 0.40 0.35 0.40 0.45 0.45 0.40 0.40

128

36 Length of maxilla 0.30 0.30 0.35 0.30 0.30 0.40 0.35 0.35 0.35

37 Length of mandible 0.25 0.25 0.30 0.25 0.25 0.30 0.30 0.30 0.30 128 38 Total Length 5.90 5.90 6.60 5.90 5.90 6.60 6.20 6.00 6.00

39 Standard length 4.90 4.90 5.40 4.90 4.90 5.60 5.20 5.00 5.00 40 Fork length 5.50 5.50 6.20 5.50 5.50 6.20 5.90 5.80 5.70 41 Height of dorsal fin 0.70 0.70 0.50 0.70 0.50 0.90 0.60 0.70 0.70 42 Height of right pectoral fin 0.50 0.50 0.50 0.50 0.45 0.50 0.65 0.40 0.60 43 Height of left pectoral fin 0.65 0.65 0.50 0.65 0.40 0.50 0.65 0.40 0.60 44 Height of right pelvic fin 0.50 0.50 0.45 0.50 0.40 0.60 0.60 0.50 0.50 45 Height of left pelvic fin 0.50 0.50 0.50 0.50 0.35 0.45 0.45 0.50 0.50 46 Height of caudal fin 1.00 1.00 1.20 1.00 0.80 1.25 1.00 0.90 0.80 47 Height of anal fin 0.50 0.50 0.60 0.50 0.50 0.50 0.50 0.50 0.40 48 Mouth length 0.25 0.30 0.30 0.25 0.30 0.30 0.25 0.30 0.30

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 19 20 21 22 23 24 25 26 27 25 Basal length of caudal fin 0.65 0.60 0.60 0.55 0.65 0.65 0.60 0.60 0.70 26 Basal length of anal fin 0.50 0.45 0.50 0.50 0.55 0.50 0.60 0.60 0.60 27 Length of longest dorsal ray 1.15 1.00 0.95 0.90 1.00 1.00 1.15 1.20 1.10 28 Length of right pectoral fin ( longest ray) 0.90 0.70 0.90 0.70 0.95 0.95 1.00 1.10 1.10 29 Length of left pectoral fin ( longest ray) 1.00 0.80 0.90 0.80 1.00 1.10 1.10 1.10 1.10 30 Length of right pelvic fin ( longest ray) 0.80 0.80 0.60 0.50 0.85 0.80 0.85 0.90 0.90 31 Length of left pelvic fin ( longest ray) 0.90 0.80 0.70 0.60 0.85 0.75 0.90 0.80 0.90 32 Length of caudal fin (longest ray) 1.10 1.00 1.00 0.95 1.00 1.10 1.20 1.30 1.40 33 Length of anal fin (longest ray) 1.00 0.85 0.95 0.95 1.00 1.20 1.15 1.35 1.30 34 Gape height 0.60 0.50 0.45 0.45 0.50 0.50 0.30 0.30 0.30 35 Closed mouth width ( jaw angle to jaw angle) 0.50 0.50 0.35 0.40 0.50 0.40 0.50 0.60 0.60

129

36 Length of maxilla 0.40 0.35 0.30 0.30 0.40 0.40 0.40 0.40 0.50

37 Length of mandible 0.35 0.30 0.25 0.25 0.30 0.35 0.35 0.40 0.45 129 38 Total Length 7.00 6.30 5.90 6.00 6.50 6.90 1.00 1.00 1.00

39 Standard length 5.80 5.20 4.90 4.80 5.30 5.70 7.10 7.50 7.50 40 Fork length 6.50 6.10 5.50 5.60 6.10 6.60 5.50 6.00 5.90 41 Height of dorsal fin 0.80 0.80 0.70 0.40 0.90 0.70 6.60 7.10 7.00 42 Height of right pectoral fin 0.90 0.70 0.50 0.50 0.65 0.50 0.60 0.60 0.50 43 Height of left pectoral fin 0.85 0.60 0.65 0.60 0.70 0.50 0.60 0.40 0.40 44 Height of right pelvic fin 0.70 0.50 0.50 0.40 0.5 0.50 0.60 0.40 0.40 45 Height of left pelvic fin 0.80 0.50 0.50 0.50 0.60 0.50 0.20 0.30 0.30 46 Height of caudal fin 1.10 0.85 1.00 0.80 1.10 0.80 0.30 0.30 0.40 47 Height of anal fin 0.60 0.40 0.50 0.50 0.60 0.60 0.50 0.60 0.80 48 Mouth length 0.30 0.20 0.25 0.30 0.25 0.30 0.25 0.30 0.30

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 28 29 30 31 32 33 34 35 25 Basal length of caudal fin 0.65 0.60 0.70 0.60 0.60 0.60 0.60 0.60 26 Basal length of anal fin 0.60 0.50 0.60 0.50 0.60 0.60 0.50 0.50 27 Length of longest dorsal ray 1.30 1.20 1.20 1.05 1.20 0.70 1.20 1.15 28 Length of right pectoral fin ( longest ray) 1.10 1.15 1.15 1.00 1.05 1.00 1.01 1.10 29 Length of left pectoral fin ( longest ray) 1.20 1.10 1.10 0.90 1.00 1.00 1.10 1.20 30 Length of right pelvic fin ( longest ray) 0.90 0.95 0.90 0.80 0.90 0.85 0.90 0.95 31 Length of left pelvic fin ( longest ray) 0.90 1.00 0.90 0.70 0.80 0.90 0.80 0.90 32 Length of caudal fin (longest ray) 1.40 1.30 1.50 1.25 1.20 1.40 1.40 1.30 33 Length of anal fin (longest ray) 1.30 0.95 1.35 1.20 1.10 1.20 1.30 1.15 34 Gape height 0.35 0.30 0.35 0.35 0.30 0.30 0.35 0.35 35 Closed mouth width ( jaw angle to jaw angle) 0.50 0.50 0.60 0.50 0.40 0.50 0.50 0.40

130

36 Length of maxilla 0.40 0.40 0.50 0.50 0.50 0.40 0.45 0.40

37 Length of mandible 0.45 0.35 0.40 0.40 0.40 0.40 0.40 0.35 130 38 Total Length 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00

39 Standard length 7.50 6.90 7.60 6.10 7.10 7.10 7.20 7.30 40 Fork length 6.00 5.50 6.30 5.40 5.70 5.70 5.80 5.80 41 Height of dorsal fin 7.00 6.50 7.20 6.20 6.80 6.70 6.70 6.90 42 Height of right pectoral fin 0.60 0.50 0.80 0.80 0.80 0.60 0.70 0.70 43 Height of left pectoral fin 0.50 0.70 0.40 0.30 0.60 0.40 0.40 0.60 44 Height of right pelvic fin 0.50 0.70 0.40 0.30 0.60 0.40 0.40 0.60 45 Height of left pelvic fin 0.30 0.30 0.50 0.40 0.40 0.40 0.30 0.30 46 Height of caudal fin 0.30 0.30 0.40 0.30 0.40 0.40 0.30 0.50 47 Height of anal fin 0.60 0.60 0.80 0.70 0.80 0.60 0.60 0.70 48 Mouth length 0.35 0.25 0.20 0.25 0.20 0.25 0.25 0.25

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 36 37 38 25 Basal length of caudal fin 0.50 0.50 0.50 26 Basal length of anal fin 1.10 1.15 1.05 27 Length of longest dorsal ray 0.95 1.10 0.90 28 Length of right pectoral fin ( longest ray) 1.00 1.10 0.80 29 Length of left pectoral fin ( longest ray) 0.85 1.10 0.70 30 Length of right pelvic fin ( longest ray) 0.80 0.90 0.60 31 Length of left pelvic fin ( longest ray) 1.35 1.30 1.30 32 Length of caudal fin (longest ray) 1.20 1.10 1.10 33 Length of anal fin (longest ray) 0.35 0.30 0.25 34 Gape height 0.50 0.50 0.40 35 Closed mouth width ( jaw angle to jaw angle) 0.40 0.45 0.35

131

36 Length of maxilla 0.40 0.35 0.30

37 Length of mandible 1.00 1.00 1.00 131 38 Total Length 7.10 7.10 6.10

39 Standard length 5.80 5.80 4.80 40 Fork length 6.60 6.60 5.80 41 Height of dorsal fin 0.60 0.70 0.50 42 Height of right pectoral fin 0.40 0.70 0.30 43 Height of left pectoral fin 0.40 0.60 0.30 44 Height of right pelvic fin 0.30 0.50 0.20 45 Height of left pelvic fin 0.35 0.50 0.20 46 Height of caudal fin 0.70 0.60 0.50 47 Height of anal fin 0.25 0.25 0.20 48 Mouth length 0.60 0.60 0.45

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 49 Snout to eye apex 0.45 0.45 0.50 0.50 0.45 0.50 0.40 0.45 0.20 50 Body depth 1.20 1.20 1.20 1.15 1.15 1.30 1.15 1.20 0.45 51 Caudal peduncle depth (Height) 0.60 0.60 0.60 0.60 0.60 0.60 0.60 0.55 1.20 52 Caudal peduncle length 1.90 1.90 2.00 1.80 1.90 2.10 2.20 1.80 0.55 53 Number of chin barbels 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 54 Length of chin barbels 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10

132

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 10 11 12 13 14 15 16 17 18 49 Snout to eye apex 0.20 0.20 0.50 0.20 0.20 0.15 0.20 0.20 0.20 50 Body depth 0.45 0.45 1.15 0.45 0.40 0.45 0.45 0.40 0.45 51 Caudal peduncle depth (Height) 1.20 1.20 0.60 1.20 1.10 1.25 1.15 1.10 1.20 52 Caudal peduncle length 0.55 0.55 1.80 0.55 0.55 0.60 0.55 0.50 0.50 53 Number of chin barbels 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 54 Length of chin barbels 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10

133

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 19 20 21 22 23 24 25 26 27 49 Snout to eye apex 0.20 0.15 0.20 0.20 0.50 0.55 0.50 0.20 0.20 50 Body depth 0.50 0.45 0.45 0.40 1.20 1.20 0.45 0.45 0.40 51 Caudal peduncle depth (Height) 1.40 1.20 1.20 1.20 0.60 0.60 1.30 1.30 1.30 52 Caudal peduncle length 0.65 0.60 0.55 0.50 2.00 2.20 0.65 0.60 0.65 53 Number of chin barbels 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 54 Length of chin barbels 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10

134

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 28 29 30 31 32 33 34 35 49 Snout to eye apex 0.20 0.15 0.20 0.20 0.15 0.15 0.15 0.20 50 Body depth 0.50 0.35 0.45 0.45 0.45 0.40 0.50 0.45 51 Caudal peduncle depth (Height) 1.30 1.00 1.40 1.20 1.30 1.20 1.40 1.30 52 Caudal peduncle length 0.65 0.55 0.60 0.45 0.55 0.50 0.60 0.60 53 Number of chin barbels 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 54 Length of chin barbels 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10

135

Appendix B continued. Morphometric characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 36 37 38 49 Snout to eye apex 0.15 0.20 0.15 50 Body depth 0.50 0.40 0.30 51 Caudal peduncle depth (Height) 1.30 1.20 1.10 52 Caudal peduncle length 0.60 0.55 0.45 53 Number of chin barbels 2.00 2.00 2.00 54 Length of chin barbels 0.10 0.10 0.10

136

Appendix C. Morphometric characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 1 Head Length 1.20 1.30 1.50 1.50 1.70 1.55 1.50 1.40 1.35 1.35 2 Eye diameter 0.10 31.00 0.05 0.05 0.01 0.04 0.01 0.01 0.01 0.01 3 Interorbital width 0.30 0.35 0.25 0.25 0.30 0.30 0.25 0.25 0.25 0.25 4 Snout to anus 2.80 3.50 3.50 3.30 3.50 3.40 3.20 3.00 2.90 2.70 5 Snout to anal fin 3.00 3.60 3.70 3.40 3.60 3.50 3.30 3.20 3.10 3.10 6 Snout to origin of pelvic fin 1.50 1.70 1.90 1.60 2.00 1.80 1.60 1.60 1.80 1.50 7 Snout to origin of pectoral fin 1.30 1.50 1.70 1.40 1.70 1.50 1.50 1.40 1.30 1.30 8 Distance between 2 dorsal fins 0.00 0.50 0.40 0.45 0.40 0.35 0.40 0.60 0.30 0.40 9 Posterior end of primary dorsal fin to dorsal origin of caudal fin 2.50 3.00 3.10 3.00 3.40 3.20 2.50 2.60 2.70 2.60 10 Posterior end of primary dorsal fin to posterior end of anal fin 1.30 1.80 1.80 1.20 1.90 1.80 1.60 1.50 1.70 1.70 11 Posterior end of secondary dorsal fin to dorsal origin of caudal fin 1.15 1.10 1.00 1.30 1.50 1.20 1.20 1.10 1.10 1.10

137

12 Posterior end of secondary dorsal fin to ventral origin of caudal fin 1.30 1.40 1.20 1.30 1.30 1.00 1.20 1.10 1.20 1.00

13 Posterior end of secondary dorsal fin to posterior end of anal fin 0.80 1.10 0.80 0.80 0.80 0.90 1.30 1.30 1.10 0.70 137 14 Posterior end of anal fin to dorsal origin of caudal fin 1.20 1.80 1.60 1.50 1.70 1.50 1.40 1.40 1.40 1.20

15 Posterior end of anal fin to ventral origin of caudal fin 1.50 1.50 1.60 1.60 1.60 1.50 1.30 1.20 1.30 1.40 16 Origin of primary dorsal fin to pelvic fin 1.00 1.30 1.10 1.20 1.20 1.10 1.00 1.10 1.00 1.10 17 Origin of primary dorsal fin to origin of anal fin 1.70 2.10 2.10 2.10 2.10 2.00 1.70 1.80 1.80 1.99 18 Origin of primary dorsal fin to posterior end of anal fin 2.40 2.70 2.80 2.30 2.90 2.90 2.50 2.50 2.40 2.50 19 Origin of secondary dorsal fin to origin of anal fin 0.90 1.10 1.10 0.90 1.00 0.95 0.90 0.85 0.90 0.90 20 Origin of secondary dorsal fin to posterior end of anal fin 1.20 1.30 1.50 1.50 1.50 1.60 1.30 1.30 1.30 1.30 21 Origin of pelvic fin to origin of anal fin 1.50 2.00 1.80 2.00 1.80 1.80 1.80 1.60 1.50 1.60 22 Origin of pelvic fin to posterior end of primary dorsal fin 1.60 1.70 1.50 1.60 1.60 1.50 1.50 1.30 1.30 1.40 23 Origin of pelvic fin to origin of secondary dorsal fin 1.70 2.10 2.00 2.00 1.80 2.00 1.80 1.80 1.50 1.80 24 Origin of anal fin to posterior end of primary dorsal fin 1.00 1.40 1.30 2.30 1.50 1.30 1.10 1.10 1.10 1.10

Appendix C continued. Morphometric characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 11 12 13 14 15 16 17 18 19 20 1 Head Length 1.30 1.50 1.50 1.20 1.50 1.00 1.10 1.10 1.20 1.15 2 Eye diameter 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.30 0.25 0.25 3 Interorbital width 0.30 0.25 0.30 0.25 0.30 0.02 0.02 0.10 0.10 0.10 4 Snout to anus 2.60 3.20 3.20 2.90 3.30 2.50 2.60 2.60 2.70 2.60 5 Snout to anal fin 2.80 3.30 3.30 3.00 3.20 2.50 2.70 2.70 2.80 2.75 6 Snout to origin of pelvic fin 1.30 1.60 1.70 1.30 1.60 1.30 1.30 1.30 1.30 1.40 7 Snout to origin of pectoral fin 1.20 1.50 1.40 1.20 1.50 1.70 1.10 1.20 1.30 1.30 8 Distance between 2 dorsal fins 0.25 0.40 0.30 0.30 0.40 0.30 0.30 0.20 0.20 0.20 9 Posterior end of primary dorsal fin to dorsal origin of caudal fin 2.50 2.50 1.50 2.00 2.50 2.00 2.30 2.25 2.40 2.40 10 Posterior end of primary dorsal fin to posterior end of anal fin 1.50 1.60 1.70 1.70 1.50 1.50 1.40 1.30 1.20 1.20 11 Posterior end of secondary dorsal fin to dorsal origin of caudal fin 1.10 1.20 1.00 1.00 1.30 1.00 0.90 1.00 1.00 1.00

138

12 Posterior end of secondary dorsal fin to ventral origin of caudal fin 1.00 1.20 2.10 1.10 1.20 1.00 0.90 1.00 0.90 1.20

13 Posterior end of secondary dorsal fin to posterior end of anal fin 0.70 1.30 1.90 0.60 0.70 0.40 0.50 0.50 0.65 0.60 138 14 Posterior end of anal fin to dorsal origin of caudal fin 1.50 1.40 1.60 1.20 1.50 1.20 1.20 1.20 1.50 1.50

15 Posterior end of anal fin to ventral origin of caudal fin 1.30 1.30 3.20 1.20 1.40 1.00 1.10 1.10 1.10 1.40 16 Origin of primary dorsal fin to pelvic fin 1.10 1.00 1.30 1.00 1.40 0.80 0.80 0.80 1.05 0.95 17 Origin of primary dorsal fin to origin of anal fin 1.70 1.70 2.00 2.00 1.90 1.40 1.50 1.50 1.60 1.50 18 Origin of primary dorsal fin to posterior end of anal fin 2.20 2.50 2.70 2.20 2.20 2.00 2.20 1.90 2.20 2.10 19 Origin of secondary dorsal fin to origin of anal fin 0.80 0.90 0.70 0.70 0.80 0.70 0.70 0.70 0.80 0.80 20 Origin of secondary dorsal fin to posterior end of anal fin 1.30 1.30 1.50 1.30 1.30 0.70 1.00 0.80 1.20 1.00 21 Origin of pelvic fin to origin of anal fin 1.60 1.80 1.60 1.60 1.60 1.40 1.50 1.50 1.50 1.40 22 Origin of pelvic fin to posterior end of primary dorsal fin 1.50 1.50 1.70 1.10 1.40 1.10 1.20 1.20 1.40 1.40 23 Origin of pelvic fin to origin of secondary dorsal fin 1.80 1.80 1.70 1.50 1.70 1.50 1.80 1.50 1.70 1.60 24 Origin of anal fin to posterior end of primary dorsal fin 1.10 1.10 1.30 1.00 1.20 0.90 1.00 0.85 0.90 0.80

Appendix C continued. Morphometric characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 21 22 23 24 25 1 Head Length 1.10 1.00 1.20 1.25 1.20 2 Eye diameter 0.20 0.20 0.25 0.25 0.20 3 Interorbital width 0.10 0.10 0.10 0.10 0.10 4 Snout to anus 2.50 2.30 2.60 3.20 2.80 5 Snout to anal fin 2.60 2.40 2.75 3.35 2.90 6 Snout to origin of pelvic fin 1.30 1.20 1.40 1.50 1.50 7 Snout to origin of pectoral fin 1.10 1.00 1.25 1.40 1.30 8 Distance between 2 dorsal fins 0.25 0.25 0.30 0.40 0.30 9 Posterior end of primary dorsal fin to dorsal origin of caudal fin 2.20 1.90 2.00 2.60 2.30 10 Posterior end of primary dorsal fin to posterior end of anal fin 1.30 1.10 1.20 1.80 1.50 11 Posterior end of secondary dorsal fin to dorsal origin of caudal fin 1.10 0.95 1.00 0.85 1.00

139

12 Posterior end of secondary dorsal fin to ventral origin of caudal fin 0.90 0.90 0.90 0.70 0.90

13 Posterior end of secondary dorsal fin to posterior end of anal fin 0.60 0.50 0.50 0.70 0.70 139 14 Posterior end of anal fin to dorsal origin of caudal fin 1.20 1.10 1.50 1.40 1.50

15 Posterior end of anal fin to ventral origin of caudal fin 1.30 0.80 1.40 1.30 1.20 16 Origin of primary dorsal fin to pelvic fin 0.90 0.80 0.90 0.90 0.90 17 Origin of primary dorsal fin to origin of anal fin 1.50 0.20 1.30 1.90 1.70 18 Origin of primary dorsal fin to posterior end of anal fin 1.40 1.60 2.00 2.40 2.10 19 Origin of secondary dorsal fin to origin of anal fin 0.70 0.60 0.75 0.90 0.80 20 Origin of secondary dorsal fin to posterior end of anal fin 0.90 0.80 1.00 1.20 1.10 21 Origin of pelvic fin to origin of anal fin 1.35 1.00 1.45 1.80 1.60 22 Origin of pelvic fin to posterior end of primary dorsal fin 1.20 1.15 1.45 1.40 1.30 23 Origin of pelvic fin to origin of secondary dorsal fin 1.50 1.40 1.70 2.00 1.60 24 Origin of anal fin to posterior end of primary dorsal fin 0.90 0.60 0.80 1.10 1.00

Appendix C continued. Morphometric characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 25 Origin of anal fin to posterior end of secondary dorsal fin 1.20 1.40 1.30 1.30 1.50 1.00 0.90 1.20 1.20 1.20 26 Predorsal length 1.80 2.00 2.05 1.80 2.00 1.90 1.85 1.80 1.70 1.70 27 Post dorsal length 3.10 4.20 2.70 2.60 4.00 2.50 2.50 2.60 2.50 2.50 28 Basal length of primary dorsal fin 0.90 1.10 1.00 0.90 1.00 1.00 1.00 0.90 0.90 0.70 29 Basal length of secondary dorsal fin 1.30 1.70 1.50 1.60 1.80 1.40 1.30 1.20 1.20 1.20 30 Basal length of right pectoral fin 0.40 0.50 0.40 0.40 0.35 0.40 0.30 0.45 0.30 0.40 31 Basal length of left pectoral fin 0.40 0.35 0.40 0.40 0.40 0.45 0.30 0.40 0.25 0.40 32 Basal length of right pelvic fin 0.20 0.20 0.25 0.20 0.20 0.20 0.20 0.20 0.20 0.20 33 Basal length of left pelvic fin 0.20 0.25 0.20 0.20 0.25 0.25 0.20 0.20 0.20 0.20 34 Basal length of caudal fin 0.60 0.65 0.60 0.50 0.60 0.50 0.50 0.50 0.45 0.50 35 Basal length of anal fin 0.90 0.80 0.90 0.90 0.90 0.80 0.80 0.80 0.80 0.60

140

36 Length of longest primary dorsal ray 1.00 0.95 1.20 0.95 1.90 1.15 0.75 1.00 0.90 0.70

37 Length of longest secondary dorsal ray 0.90 0.80 1.10 1.10 1.30 0.90 0.90 1.10 0.90 0.80 140 38 Length of right pectoral fin ( longest ray) 1.35 1.30 1.70 1.50 1.50 1.30 1.30 1.20 1.30 1.20

39 Length of left pectoral fin ( longest ray) 1.40 1.40 1.60 1.50 1.50 1.50 1.40 1.40 1.20 1.10 40 Length of right pelvic fin ( longest ray) 1.00 1.00 1.35 1.20 1.10 1.05 1.00 0.95 1.00 1.05 41 Length of left pelvic fin ( longest ray) 1.00 1.00 1.20 1.50 1.50 1.10 1.10 1.30 1.00 0.90 42 Length of caudal fin (longest ray) 1.20 1.20 1.30 1.20 1.30 1.10 1.35 1.00 1.10 1.00 43 Length of anal fin (longest ray) 1.10 0.60 1.00 0.70 0.90 1.40 0.60 0.70 0.20 0.45 44 Gape height 0.50 0.50 0.50 0.50 0.45 0.40 0.40 0.25 0.35 0.45 45 Closed mouth width ( jaw angle to jaw angle) 0.40 0.45 0.60 0.50 0.50 0.40 0.45 0.40 0.45 0.50 46 Length of maxilla 0.40 0.40 0.40 0.35 0.45 0.45 0.40 0.35 0.35 0.40 47 Length of mandible 0.36 0.36 0.35 0.30 0.40 0.40 0.30 0.30 0.30 0.30 48 Number of chin barbels 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

Appendix C continued. Morphometric characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 11 12 13 14 15 16 17 18 19 20 25 Origin of anal fin to posterior end of secondary dorsal fin 1.30 0.90 1.50 1.20 1.20 0.80 0.90 0.85 1.20 0.90 26 Predorsal length 1.60 1.85 1.85 1.50 1.70 1.35 1.40 1.50 1.60 1.05 27 Post dorsal length 2.50 2.50 3.90 3.10 3.50 2.80 2.55 3.00 3.20 3.20 28 Basal length of primary dorsal fin 0.80 1.00 0.90 0.40 1.00 0.70 0.74 0.65 0.90 0.95 29 Basal length of secondary dorsal fin 1.20 1.30 1.50 0.40 1.20 1.00 0.80 1.00 1.00 1.10 30 Basal length of right pectoral fin 0.25 0.30 0.30 0.20 0.35 0.25 0.30 0.20 0.35 0.30 31 Basal length of left pectoral fin 0.25 0.30 0.30 0.30 0.35 0.30 0.25 0.20 0.30 0.30 32 Basal length of right pelvic fin 0.20 0.20 0.30 0.20 0.20 0.20 0.30 0.15 0.15 0.20 33 Basal length of left pelvic fin 0.20 0.20 0.30 0.20 0.20 0.20 0.20 0.15 0.20 0.15 34 Basal length of caudal fin 0.50 0.50 0.60 0.40 0.40 0.30 0.30 0.45 0.50 0.45 35 Basal length of anal fin 0.50 0.80 1.00 0.80 0.60 0.60 0.50 0.45 0.70 0.60

141

36 Length of longest primary dorsal ray 0.40 0.75 0.90 0.70 0.50 0.40 0.50 0.60 0.60 0.60

37 Length of longest secondary dorsal ray 0.80 0.90 0.40 1.00 0.90 0.60 0.80 0.70 0.80 0.60 141 38 Length of right pectoral fin ( longest ray) 1.30 1.30 1.50 0.80 1.30 1.05 1.10 1.05 1.20 1.10

39 Length of left pectoral fin ( longest ray) 1.30 1.40 1.50 1.20 1.40 1.00 1.10 1.15 1.20 1.00 40 Length of right pelvic fin ( longest ray) 0.80 1.00 1.00 1.00 1.30 1.10 0.80 0.80 0.80 0.80 41 Length of left pelvic fin ( longest ray) 0.90 1.10 1.15 1.00 1.10 0.80 0.75 0.80 0.85 0.90 42 Length of caudal fin (longest ray) 0.90 1.35 1.20 1.10 1.20 0.80 0.80 0.80 0.70 0.70 43 Length of anal fin (longest ray) 0.40 0.60 0.60 0.70 0.50 0.70 0.70 0.80 0.50 0.40 44 Gape height 0.30 0.40 0.40 0.20 0.40 0.20 0.30 0.45 0.50 0.55 45 Closed mouth width ( jaw angle to jaw angle) 0.40 0.45 0.50 0.25 0.50 0.30 0.35 0.45 0.50 0.50 46 Length of maxilla 0.30 0.40 0.40 0.20 0.35 0.20 0.30 0.30 0.35 0.35 47 Length of mandible 0.25 0.30 0.35 0.15 0.30 0.15 0.25 0.25 0.30 0.30 48 Number of chin barbels 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

Appendix C continued. Morphometric characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 21 22 23 24 25 25 Origin of anal fin to posterior end of secondary dorsal fin 0.80 0.90 1.10 1.10 1.10 26 Predorsal length 0.95 1.30 1.60 1.65 1.60 27 Post dorsal length 2.90 2.50 3.10 2.80 2.50 28 Basal length of primary dorsal fin 0.70 0.60 0.80 0.80 0.80 29 Basal length of secondary dorsal fin 0.80 0.80 1.10 1.40 1.30 30 Basal length of right pectoral fin 0.25 0.20 0.35 0.35 0.30 31 Basal length of left pectoral fin 0.20 0.20 0.30 0.30 0.30 32 Basal length of right pelvic fin 0.15 0.15 0.20 0.20 0.20 33 Basal length of left pelvic fin 0.20 0.10 0.20 0.20 0.20 34 Basal length of caudal fin 0.40 0.64 0.60 0.60 0.50 35 Basal length of anal fin 0.40 0.40 0.60 0.70 0.50

142

36 Length of longest primary dorsal ray 0.50 0.30 0.60 0.80 0.70

37 Length of longest secondary dorsal ray 0.50 0.40 0.50 1.00 0.90 142 38 Length of right pectoral fin ( longest ray) 1.05 0.80 1.10 1.10 1.40

39 Length of left pectoral fin ( longest ray) 1.10 0.90 1.20 1.40 1.40 40 Length of right pelvic fin ( longest ray) 0.07 0.60 0.80 1.00 1.10 41 Length of left pelvic fin ( longest ray) 0.80 0.60 0.85 1.00 1.00 42 Length of caudal fin (longest ray) 0.40 0.60 0.70 0.90 0.90 43 Length of anal fin (longest ray) 0.50 0.40 0.50 1.10 0.75 44 Gape height 0.50 0.40 0.60 0.55 0.40 45 Closed mouth width ( jaw angle to jaw angle) 0.40 0.35 0.60 0.40 0.30 46 Length of maxilla 0.35 0.35 0.40 0.40 0.35 47 Length of mandible 0.30 0.25 0.30 0.30 0.30 48 Number of chin barbels 0.00 0.00 0.00 0.00 0.00

Appendix C continued. Morphometric characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 49 Total Length 6.20 7.00 7.10 6.90 7.50 7.00 6.50 6.10 6.00 6.10 50 Standard length 5.00 5.70 5.80 5.60 6.00 5.50 5.20 5.00 4.90 4.80 51 Fork length 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 52 Height of primary dorsal fin 0.50 0.90 1.10 0.50 1.00 0.90 1.00 0.50 0.50 0.50 53 Height of secondary dorsal fin 0.70 1.20 1.30 0.80 13.00 1.70 1.20 0.60 0.40 0.40 54 Height of right pectoral fin 0.60 0.60 0.40 0.30 0.30 0.40 0.30 0.30 0.25 0.40 55 Height of left pectoral fin 0.60 0.60 0.40 0.35 0.30 0.40 0.30 0.30 0.25 0.40 56 Height of right pelvic fin 0.20 0.40 0.40 0.30 0.40 0.30 0.20 0.30 0.30 0.40 57 Height of left pelvic fin 0.30 0.40 0.40 0.30 0.40 0.30 3.00 0.40 0.30 0.30 58 Height of caudal fin 0.60 0.80 0.60 0.50 0.70 0.60 0.50 0.40 0.50 0.50 59 Height of anal fin 0.30 0.20 0.40 0.10 0.40 0.20 0.30 0.30 0.10 0.20

143

60 Mouth length 0.35 0.45 0.45 0.40 0.50 0.45 0.40 0.35 0.40 0.40

61 Snout length 0.36 0.35 0.50 0.35 0.40 0.40 0.40 0.35 0.35 0.35 143 62 Body depth 0.80 1.10 1.00 1.10 1.15 1.10 1.00 0.85 0.96 1.00

63 Caudal peduncle depth/height 0.45 0.55 0.50 0.55 0.55 0.50 0.45 0.45 0.40 0.45 64 Caudal peduncle length 1.00 1.00 1.20 1.30 1.50 1.30 1.30 1.70 1.20 1.10

Appendix C continued. Morphometric characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 11 12 13 14 15 16 17 18 19 20 49 Total Length 5.70 6.50 6.70 5.50 6.40 5.00 5.35 5.30 5.80 5.60 50 Standard length 4.90 5.20 5.50 4.40 5.20 4.20 4.40 4.50 4.90 4.90 51 Fork length 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 52 Height of primary dorsal fin 0.40 1.00 0.50 0.40 0.40 0.20 0.40 0.60 0.60 0.60 53 Height of secondary dorsal fin 0.40 1.20 0.40 0.40 0.50 0.20 0.40 0.40 0.80 0.60 54 Height of right pectoral fin 0.30 0.30 0.40 0.30 0.40 0.30 0.30 0.30 0.35 0.40 55 Height of left pectoral fin 0.30 0.30 0.40 0.30 0.40 0.30 0.30 0.30 0.30 0.40 56 Height of right pelvic fin 0.25 0.20 0.20 0.20 0.40 0.20 0.20 0.20 0.30 0.30 57 Height of left pelvic fin 0.25 3.00 0.30 0.20 0.40 0.20 0.20 0.20 0.25 0.25 58 Height of caudal fin 0.40 0.50 0.50 0.40 0.60 0.45 0.40 0.60 0.90 0.70 59 Height of anal fin 0.20 0.30 0.20 0.30 0.25 0.15 0.20 0.40 0.50 0.50

144 60 Mouth length 0.30 0.40 0.35 0.35 0.40 0.20 0.30 0.30 0.20 0.25

61 Snout length 0.30 0.40 0.35 3.00 0.40 0.25 0.25 0.35 0.40 0.40 144 62 Body depth 1.00 1.00 1.10 0.85 0.90 0.80 0.80 0.80 0.90 0.80

63 Caudal peduncle depth/height 0.50 0.45 0.55 0.50 0.45 0.35 0.40 0.40 0.35 0.45 64 Caudal peduncle length 1.50 1.30 1.40 1.10 1.30 1.00 0.20 1.00 0.15 1.10

Appendix C continued. Morphometric characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 21 22 23 24 25 49 Total Length 5.10 4.60 5.10 6.40 6.00 50 Standard length 4.40 4.00 4.80 5.40 5.00 51 Fork length 0.00 0.00 0.00 0.00 0.00 52 Height of primary dorsal fin 0.50 0.40 0.70 1.00 0.90 53 Height of secondary dorsal fin 0.70 0.50 0.90 1.20 1.00 54 Height of right pectoral fin 0.40 0.30 0.35 0.50 0.40 55 Height of left pectoral fin 0.25 0.30 0.45 0.40 0.40 56 Height of right pelvic fin 0.25 0.25 0.30 0.40 0.30 57 Height of left pelvic fin 0.30 0.20 0.25 0.30 0.30

145 58 Height of caudal fin 0.60 0.60 0.90 0.70 0.60

59 Height of anal fin 0.35 0.40 0.50 0.36 0.40

145 60 Mouth length 0.15 0.15 0.30 0.20 0.15

61 Snout length 0.30 0.30 0.40 0.35 0.30

62 Body depth 0.90 0.70 0.80 0.90 0.80 63 Caudal peduncle depth/height 0.40 0.30 0.45 0.45 0.45 64 Caudal peduncle length 1.10 1.10 1.25 1.00 1.00

Appendix D. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 1 Head Length 1.20 1.30 1.25 1.20 1.30 1.20 1.10 0.80 1.25 1.10 2 Eye diameter 0.25 0.30 0.30 0.30 0.30 0.30 0.25 0.30 0.35 0.20 3 Interorbital width 0.30 0.25 0.20 0.25 0.30 0.30 0.30 0.30 0.30 0.30 4 Snout to anus 3.10 0.25 0.10 0.20 0.20 0.15 0.10 0.10 0.15 0.20 5 Snout to anal fin 3.30 2.70 2.70 2.80 2.60 2.70 2.60 2.60 2.70 2.60 6 Snout to origin of pelvic fin 1.50 1.30 1.50 1.50 1.40 1.40 1.50 1.40 1.40 1.30 7 Snout to origin of pectoral fin 1.30 1.20 1.40 1.30 1.10 1.30 1.20 1.20 1.20 1.10 8 Distance between 2 dorsal fins 0.70 0.40 0.30 0.40 0.30 0.25 0.30 0.35 0.30 0.40 9 Posterior end of primary dorsal fin to dorsal origin of caudal fin 3.00 2.60 2.40 2.40 2.30 2.50 2.10 2.10 2.50 2.40 10 Posterior end of primary dorsal fin to posterior end of anal fin 1.90 1.70 1.50 1.50 1.40 1.60 1.40 1.30 1.50 1.70 11 Posterior end of secondary dorsal fin to dorsal origin of caudal fin 0.85 0.80 0.90 0.80 0.85 0.80 1.00 0.80 0.90 0.70

146 12 Posterior end of secondary dorsal fin to ventral origin of caudal fin 1.10 0.90 0.90 1.00 0.90 0.95 0.70 0.90 1.00 0.60

13 Posterior end of secondary dorsal fin to posterior end of anal fin 0.80 0.60 0.60 0.80 0.75 0.80 0.70 0.50 0.80 0.85 146 14 Posterior end of anal fin to dorsal origin of caudal fin 1.50 1.20 1.20 1.20 1.20 1.40 1.10 0.90 1.10 0.90

15 Posterior end of anal fin to ventral origin of caudal fin 1.30 1.10 1.30 1.00 1.10 1.00 1.20 0.80 1.20 1.00 16 Origin of primary dorsal fin to pelvic fin 1.20 1.00 1.00 1.00 0.95 0.85 0.90 0.90 1.00 0.90 17 Origin of primary dorsal fin to origin of anal fin 2.00 1.60 1.50 1.50 1.40 1.40 1.40 1.50 1.50 1.60 18 Origin of primary dorsal fin to posterior end of anal fin 2.50 2.30 2.30 2.00 2.00 1.80 1.80 2.10 2.40 2.10 19 Origin of secondary dorsal fin to origin of anal fin 1.00 0.90 0.80 0.80 0.85 0.85 0.80 0.70 0.90 0.70 20 Origin of secondary dorsal fin to posterior end of anal fin 1.30 1.20 1.20 1.20 1.10 1.10 1.20 1.05 1.40 1.05 21 Origin of pelvic fin to origin of anal fin 1.70 1.30 1.10 1.20 1.20 1.50 1.30 1.60 1.40 1.40 22 Origin of pelvic fin to posterior end of primary dorsal fin 1.40 1.40 1.30 1.20 1.30 1.40 1.20 1.10 1.40 1.10 23 Origin of pelvic fin to origin of secondary dorsal fin 1.90 1.50 1.50 1.60 1.50 1.60 1.30 1.50 1.70 1.70 24 Origin of anal fin to posterior end of primary dorsal fin 1.40 0.90 0.90 0.80 0.90 1.10 0.90 1.20 1.00 0.90

Appendix D continued. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 11 12 13 14 15 16 17 18 19 20 1 Head Length 1.50 1.60 1.55 1.40 1.30 1.40 1.40 1.50 1.45 1.35 2 Eye diameter 0.30 0.40 0.35 0.30 0.30 0.25 0.35 0.35 0.30 0.30 3 Interorbital width 0.10 0.20 0.10 0.10 0.10 0.10 0.10 0.15 0.10 0.10 4 Snout to anus 2.90 3.30 3.30 2.90 2.60 2.90 2.90 3.10 3.00 2.80 5 Snout to anal fin 3.10 3.40 3.60 3.00 2.70 3.00 3.00 3.40 3.40 3.10 6 Snout to origin of pelvic fin 1.60 1.70 1.60 1.50 1.40 1.50 1.50 1.70 1.50 1.70 7 Snout to origin of pectoral fin 1.40 1.50 1.40 1.20 1.20 1.30 1.20 1.40 1.60 1.30 8 Distance between 2 dorsal fins 0.30 0.50 0.40 0.40 0.30 0.30 0.30 0.20 0.25 0.20 9 Posterior end of primary dorsal fin to dorsal origin of caudal fin 2.50 2.80 2.70 2.40 2.30 2.40 2.30 3.20 2.80 0.70 10 Posterior end of primary dorsal fin to posterior end of anal fin 1.80 1.60 1.80 1.10 1.20 1.60 1.70 1.80 1.70 1.50 11 Posterior end of secondary dorsal fin to dorsal origin of caudal fin 0.90 1.70 1.10 0.90 0.90 1.10 0.80 0.90 1.10 1.00

147 12 Posterior end of secondary dorsal fin to ventral origin of caudal fin 0.80 1.30 1.00 0.90 0.90 0.90 0.80 0.80 0.60 1.00

13 Posterior end of secondary dorsal fin to posterior end of anal fin 1.30 1.70 1.30 1.20 1.10 1.50 1.30 1.20 1.30 1.30 147 14 Posterior end of anal fin to dorsal origin of caudal fin 1.40 1.60 1.30 1.20 1.40 1.20 1.20 1.50 1.00 1.50

15 Posterior end of anal fin to ventral origin of caudal fin 1.10 1.50 1.40 1.20 1.20 1.20 1.20 1.20 1.40 1.30 16 Origin of primary dorsal fin to pelvic fin 0.90 1.10 1.30 1.20 1.00 1.00 1.00 1.00 1.50 1.00 17 Origin of primary dorsal fin to origin of anal fin 1.70 1.90 2.00 1.70 1.50 1.50 1.80 2.00 1.40 1.70 18 Origin of primary dorsal fin to posterior end of anal fin 2.40 2.50 2.50 2.20 1.90 2.50 2.40 2.60 2.70 2.50 19 Origin of secondary dorsal fin to origin of anal fin 0.80 1.30 1.10 0.90 0.80 0.90 0.80 1.00 1.00 0.90 20 Origin of secondary dorsal fin to posterior end of anal fin 1.10 1.40 1.30 1.20 1.20 1.50 1.20 1.20 1.50 1.30 21 Origin of pelvic fin to origin of anal fin 1.50 2.10 1.90 1.70 1.30 1.80 1.50 1.70 1.60 1.70 22 Origin of pelvic fin to posterior end of primary dorsal fin 1.50 1.80 1.70 1.50 1.50 1.50 1.50 1.50 1.30 1.40 23 Origin of pelvic fin to origin of secondary dorsal fin 1.60 2.20 1.90 0.70 1.60 1.70 1.80 1.80 1.80 1.70 24 Origin of anal fin to posterior end of primary dorsal fin 1.20 1.30 1.20 1.10 1.00 1.20 1.00 1.20 1.10 1.20

Appendix D continued. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 21 22 23 24 25 26 27 28 29 30 1 Head Length 1.35 1.10 1.25 1.30 1.20 1.20 1.25 1.50 1.25 1.30 2 Eye diameter 0.30 0.20 0.30 0.25 0.25 0.30 0.25 0.35 0.25 0.30 3 Interorbital width 0.10 0.05 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 4 Snout to anus 3.10 2.50 2.90 2.90 2.70 2.60 2.60 3.10 2.60 2.80 5 Snout to anal fin 3.30 2.60 3.00 3.10 2.70 2.70 2.80 3.40 2.70 2.90 6 Snout to origin of pelvic fin 1.70 1.30 1.30 1.40 1.40 1.40 1.40 1.65 1.40 1.50 7 Snout to origin of pectoral fin 1.40 1.20 1.10 1.20 1.20 1.20 1.20 1.50 1.20 1.30 8 Distance between 2 dorsal fins 0.20 0.30 0.20 0.00 0.20 0.30 0.25 0.20 0.25 0.20 9 Posterior end of primary dorsal fin to dorsal origin of caudal fin 2.50 2.40 2.10 2.50 1.80 2.00 2.10 2.80 2.00 2.10 10 Posterior end of primary dorsal fin to posterior end of anal fin 1.30 1.20 1.20 1.50 1.20 1.20 1.10 1.70 1.20 1.20 11 Posterior end of secondary dorsal fin to dorsal origin of caudal fin 1.00 0.80 0.90 0.90 0.80 0.70 0.80 1.00 0.80 0.70

148 12 Posterior end of secondary dorsal fin to ventral origin of caudal fin 0.90 0.90 0.90 1.00 0.70 0.80 0.80 0.90 0.70 0.60

13 Posterior end of secondary dorsal fin to posterior end of anal fin 1.10 1.10 1.00 1.20 0.60 0.60 0.70 0.70 0.60 0.60 148 14 Posterior end of anal fin to dorsal origin of caudal fin 1.40 1.10 1.20 1.40 1.10 1.00 1.20 1.40 1.10 1.20

15 Posterior end of anal fin to ventral origin of caudal fin 1.20 1.20 1.10 1.30 1.00 1.00 1.00 1.20 0.90 1.20 16 Origin of primary dorsal fin to pelvic fin 1.00 0.80 0.80 1.00 0.58 0.90 0.80 1.20 0.80 1.00 17 Origin of primary dorsal fin to origin of anal fin 1.80 1.50 1.70 1.80 1.35 1.45 1.20 1.80 1.40 1.30 18 Origin of primary dorsal fin to posterior end of anal fin 2.10 1.90 2.10 2.50 1.90 1.90 1.70 2.70 2.00 2.00 19 Origin of secondary dorsal fin to origin of anal fin 1.80 1.70 1.00 0.80 0.75 0.75 0.70 0.90 0.65 0.70 20 Origin of secondary dorsal fin to posterior end of anal fin 1.30 0.90 1.10 1.20 1.00 1.10 1.00 1.50 1.10 1.00 21 Origin of pelvic fin to origin of anal fin 1.80 1.20 1.50 1.70 1.40 1.50 1.50 1.80 1.30 1.50 22 Origin of pelvic fin to posterior end of primary dorsal fin 1.30 1.00 1.30 1.60 1.20 1.30 1.30 1.80 1.30 1.40 23 Origin of pelvic fin to origin of secondary dorsal fin 1.60 1.20 1.50 1.80 1.40 1.50 1.50 2.10 1.55 1.70 24 Origin of anal fin to posterior end of primary dorsal fin 0.90 0.80 1.00 1.10 0.80 0.70 0.80 0.90 0.70 0.80

Appendix D continued. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 31 32 33 34 1 Head Length 1.20 1.40 1.20 1.30 2 Eye diameter 0.30 0.30 0.25 0.30 3 Interorbital width 0.10 0.10 0.10 0.10 4 Snout to anus 2.50 3.00 2.60 2.70 5 Snout to anal fin 2.75 3.20 2.75 2.80 6 Snout to origin of pelvic fin 1.45 1.60 1.45 1.40 7 Snout to origin of pectoral fin 1.20 1.30 1.25 1.20 8 Distance between 2 dorsal fins 0.20 0.25 0.30 0.30 9 Posterior end of primary dorsal fin to dorsal origin of caudal fin 2.00 2.40 2.00 2.15 10 Posterior end of primary dorsal fin to posterior end of anal fin 1.40 1.50 1.20 1.20 11 Posterior end of secondary dorsal fin to dorsal origin of caudal fin 1.00 1.00 1.00 1.00

149 12 Posterior end of secondary dorsal fin to ventral origin of caudal fin 0.80 1.10 0.80 0.80

13 Posterior end of secondary dorsal fin to posterior end of anal fin 0.70 0.58 0.60 0.50 149 14 Posterior end of anal fin to dorsal origin of caudal fin 1.20 1.30 1.10 1.10

15 Posterior end of anal fin to ventral origin of caudal fin 1.00 1.10 1.00 1.15 16 Origin of primary dorsal fin to pelvic fin 0.90 1.15 0.50 0.90 17 Origin of primary dorsal fin to origin of anal fin 1.50 1.65 1.40 1.50 18 Origin of primary dorsal fin to posterior end of anal fin 2.25 2.40 1.96 2.00 19 Origin of secondary dorsal fin to origin of anal fin 0.75 0.90 0.75 0.75 20 Origin of secondary dorsal fin to posterior end of anal fin 1.00 1.20 0.90 0.90 21 Origin of pelvic fin to origin of anal fin 1.40 1.70 1.35 1.50 22 Origin of pelvic fin to posterior end of primary dorsal fin 1.20 1.70 1.50 1.50 23 Origin of pelvic fin to origin of secondary dorsal fin 1.60 1.95 1.60 1.70 24 Origin of anal fin to posterior end of primary dorsal fin 0.80 0.80 0.80 0.90

Appendix D continued. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 25 Origin of anal fin to posterior end of secondary dorsal fin 1.50 1.20 1.10 1.20 1.30 1.40 1.00 1.00 1.20 1.00 26 Predorsal length 1.80 1.40 1.70 1.50 1.50 1.60 1.60 1.50 1.70 1.60 27 Post dorsal length 3.10 2.90 2.20 2.00 2.20 2.00 2.00 2.00 2.30 2.30 28 Basal length of primary dorsal fin 0.70 0.80 0.85 0.70 0.90 0.55 0.70 0.60 0.50 0.70 29 Basal length of secondary dorsal fin 1.30 1.40 1.20 1.20 1.00 1.15 1.00 0.70 1.30 1.20 30 Basal length of right pectoral fin 0.35 0.35 0.30 0.40 0.40 0.36 0.20 0.30 0.30 0.30 31 Basal length of left pectoral fin 0.40 0.30 0.40 0.40 0.40 0.40 0.15 0.30 0.35 0.30 32 Basal length of right pelvic fin 0.20 0.10 0.20 0.20 0.25 0.20 0.35 0.20 0.20 0.20 33 Basal length of left pelvic fin 0.20 0.15 0.20 0.25 0.20 0.20 0.30 0.20 0.20 0.20 34 Basal length of caudal fin 0.60 0.40 0.40 0.40 0.50 0.50 0.40 0.35 0.50 0.35 35 Basal length of anal fin 0.80 0.80 0.80 0.70 0.55 0.80 0.45 0.60 0.65 0.70

150

36 Length of right pectoral fin ( longest ray) 1.25 1.20 1.15 1.15 1.15 1.20 1.20 1.10 1.30 1.20

37 Length of left pectoral fin ( longest ray) 1.30 1.20 1.20 1.20 1.10 1.20 1.20 1.00 1.30 1.20 150 38 Length of caudal fin (longest ray) 1.20 1.20 1.20 1.10 1.00 1.00 0.90 1.05 1.10 1.05

39 Length of anal fin (longest ray) 0.70 0.80 1.10 1.00 1.10 1.90 0.95 0.70 1.00 0.70 40 Length of right pelvic fin ( longest ray) 1.00 1.10 1.00 0.80 0.70 0.80 0.75 0.60 0.80 0.95 41 Length of left pelvic fin ( longest ray) 0.90 0.75 0.90 0.70 0.85 0.85 0.80 0.80 0.90 0.80 42 Length of longest primary dorsal ray 0.80 1.00 1.10 1.40 1.10 0.95 0.90 0.50 1.00 0.80 43 Length of longest secondary dorsal ray 0.90 0.70 0.90 0.70 0.80 0.85 0.90 0.20 0.70 0.70 44 Gape height 0.30 0.20 0.30 0.35 0.30 0.40 0.30 0.25 0.30 0.30 45 Closed mouth width ( jaw angle to jaw angle) 0.30 0.35 0.35 0.40 0.30 0.30 0.30 0.20 0.25 0.20 46 Length of maxilla 0.40 0.30 0.35 0.45 0.30 0.35 0.30 0.20 0.40 0.30 47 Length of mandible 0.30 0.25 0.30 0.40 0.25 0.30 0.25 0.15 0.30 0.25 48 Number of chin barbels 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

Appendix D continued. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 11 12 13 14 15 16 17 18 19 20 25 Origin of anal fin to posterior end of secondary dorsal fin 1.10 1.40 1.80 1.10 1.20 1.30 1.40 1.10 1.30 1.20 26 Predorsal length 1.70 1.90 2.00 1.60 1.70 1.75 1.80 1.75 1.90 1.70 27 Post dorsal length 3.25 3.70 3.80 3.00 2.90 3.50 2.20 3.60 3.60 3.30 28 Basal length of primary dorsal fin 0.60 1.20 1.10 0.80 0.80 1.00 1.10 1.20 1.00 1.10 29 Basal length of secondary dorsal fin 1.50 1.70 1.50 1.20 1.10 1.50 1.30 1.50 1.60 1.30 30 Basal length of right pectoral fin 0.30 0.40 0.40 0.30 0.25 0.30 0.30 0.30 0.30 0.35 31 Basal length of left pectoral fin 0.30 0.30 0.30 0.30 0.25 0.30 0.30 0.30 0.30 0.40 32 Basal length of right pelvic fin 0.20 0.30 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 33 Basal length of left pelvic fin 0.12 0.20 0.20 0.10 0.20 0.20 0.20 0.20 0.20 0.20 34 Basal length of caudal fin 0.45 0.50 0.50 0.50 0.45 0.50 0.45 0.50 0.40 0.50 35 Basal length of anal fin 0.70 0.80 0.85 0.60 0.80 0.80 0.80 0.80 0.70 0.70

151

36 Length of longest primary dorsal ray 1.10 1.60 1.50 1.25 1.35 1.40 1.30 1.30 1.40 1.40

37 Length of longest secondary dorsal ray 1.20 1.60 1.40 1.20 1.20 1.40 1.20 1.40 1.40 1.40 151 38 Length of right pectoral fin ( longest ray) 1.00 1.30 1.10 0.95 1.00 1.10 1.10 1.10 1.10 1.10

39 Length of left pectoral fin ( longest ray) 0.70 0.65 0.50 0.40 0.30 0.40 0.70 0.40 0.45 0.20 40 Length of right pelvic fin ( longest ray) 0.90 1.00 0.90 0.90 0.95 1.00 0.90 1.05 0.75 0.90 41 Length of left pelvic fin ( longest ray) 0.95 1.00 1.00 1.00 1.00 1.00 1.90 1.00 0.80 1.00 42 Length of caudal fin (longest ray) 0.80 0.70 0.80 0.70 0.70 1.00 0.70 0.70 0.90 1.10 43 Length of anal fin (longest ray) 1.00 1.10 1.00 0.90 0.90 0.80 0.90 0.90 1.10 0.90 44 Gape height 0.30 0.50 0.60 0.50 0.40 0.50 0.50 0.50 0.40 0.50 45 Closed mouth width ( jaw angle to jaw angle) 0.40 0.60 0.50 0.45 0.35 0.45 0.45 0.40 0.40 0.40 46 Length of maxilla 0.35 0.40 0.35 0.40 0.35 0.35 0.40 0.35 0.40 0.40 47 Length of mandible 0.30 0.35 0.30 0.35 0.30 0.30 0.25 0.30 0.35 0.35 48 Number of chin barbels 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

Appendix D continued. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 21 22 23 24 25 26 27 28 29 30 25 Origin of anal fin to posterior end of secondary dorsal fin 0.80 0.90 1.10 1.10 1.10 0.80 0.90 1.10 1.10 1.10 26 Predorsal length 0.95 1.30 1.60 1.65 1.60 0.95 1.30 1.60 1.65 1.60 27 Post dorsal length 2.90 2.50 3.10 2.80 2.50 2.90 2.50 3.10 2.80 2.50 28 Basal length of primary dorsal fin 0.70 0.60 0.80 0.80 0.80 0.70 0.60 0.80 0.80 0.80 29 Basal length of secondary dorsal fin 0.80 0.80 1.10 1.40 1.30 0.80 0.80 1.10 1.40 1.30 30 Basal length of right pectoral fin 0.25 0.20 0.35 0.35 0.30 0.25 0.20 0.35 0.35 0.30 31 Basal length of left pectoral fin 0.20 0.20 0.30 0.30 0.30 0.20 0.20 0.30 0.30 0.30 32 Basal length of right pelvic fin 0.15 0.15 0.20 0.20 0.20 0.15 0.15 0.20 0.20 0.20 33 Basal length of left pelvic fin 0.20 0.10 0.20 0.20 0.20 0.20 0.10 0.20 0.20 0.20 34 Basal length of caudal fin 0.40 0.64 0.60 0.60 0.50 0.40 0.64 0.60 0.60 0.50 35 Basal length of anal fin 0.40 0.40 0.60 0.70 0.50 0.40 0.40 0.60 0.70 0.50

152

36 Length of longest primary dorsal ray 0.50 0.30 0.60 0.80 0.70 0.50 0.30 0.60 0.80 0.70

37 Length of longest secondary dorsal ray 0.50 0.40 0.50 1.00 0.90 0.50 0.40 0.50 1.00 0.90 152 38 Length of right pectoral fin ( longest ray) 1.05 0.80 1.10 1.10 1.40 1.05 0.80 1.10 1.10 1.40

39 Length of left pectoral fin ( longest ray) 1.10 0.90 1.20 1.40 1.40 1.10 0.90 1.20 1.40 1.40 40 Length of right pelvic fin ( longest ray) 0.07 0.60 0.80 1.00 1.10 0.07 0.60 0.80 1.00 1.10 41 Length of left pelvic fin ( longest ray) 0.80 0.60 0.85 1.00 1.00 0.80 0.60 0.85 1.00 1.00 42 Length of caudal fin (longest ray) 0.40 0.60 0.70 0.90 0.90 0.40 0.60 0.70 0.90 0.90 43 Length of anal fin (longest ray) 0.50 0.40 0.50 1.10 0.75 0.50 0.40 0.50 1.10 0.75 44 Gape height 0.50 0.40 0.60 0.55 0.40 0.50 0.40 0.60 0.55 0.40 45 Closed mouth width ( jaw angle to jaw angle) 0.40 0.35 0.60 0.40 0.30 0.40 0.35 0.60 0.40 0.30 46 Length of maxilla 0.35 0.35 0.40 0.40 0.35 0.35 0.35 0.40 0.40 0.35 47 Length of mandible 0.30 0.25 0.30 0.30 0.30 0.30 0.25 0.30 0.30 0.30 48 Number of chin barbels 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

Appendix D continued. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 31 32 33 34 25 Origin of anal fin to posterior end of secondary dorsal fin 1.20 1.30 0.90 0.90 26 Predorsal length 1.60 1.80 1.60 1.65 27 Post dorsal length 3.00 3.50 2.80 3.00 28 Basal length of primary dorsal fin 0.85 1.10 0.70 0.60 29 Basal length of secondary dorsal fin 1.12 1.35 1.10 1.00 30 Basal length of right pectoral fin 0.30 0.30 0.30 0.30 31 Basal length of left pectoral fin 0.25 0.35 0.25 0.30 32 Basal length of right pelvic fin 0.20 0.25 0.20 0.20 33 Basal length of left pelvic fin 0.15 0.25 0.20 0.20 34 Basal length of caudal fin 0.50 0.60 0.40 0.45 35 Basal length of anal fin 0.80 0.80 0.55 0.60

153

36 Length of longest primary dorsal ray 1.30 1.50 1.20 1.25

37 Length of longest secondary dorsal ray 1.25 1.50 1.10 1.20 153 38 Length of right pectoral fin ( longest ray) 0.80 1.00 0.80 0.80

39 Length of left pectoral fin ( longest ray) 0.45 0.50 0.35 0.40 40 Length of right pelvic fin ( longest ray) 0.80 0.90 0.70 0.80 41 Length of left pelvic fin ( longest ray) 0.85 0.95 0.80 0.80 42 Length of caudal fin (longest ray) 0.65 0.70 0.60 0.60 43 Length of anal fin (longest ray) 0.70 0.80 0.50 0.50 44 Gape height 0.50 0.60 0.50 0.50 45 Closed mouth width ( jaw angle to jaw angle) 0.45 0.50 0.35 0.45 46 Length of maxilla 0.40 0.35 0.30 0.40 47 Length of mandible 0.30 0.30 0.25 0.30 48 Number of chin barbels 0.00 0.00 0.00 0.00

Appendix D continued. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 49 Total Length 6.20 5.60 5.60 5.50 5.20 5.30 5.30 5.10 5.90 5.40 50 Standard length 5.00 4.30 4.50 4.50 4.30 4.30 4.30 4.30 4.80 4.30 51 Fork length 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 52 Height of primary dorsal fin 0.50 0.50 0.50 0.50 0.35 0.30 0.30 0.30 0.40 0.35 53 Height of secondary dorsal fin 0.60 0.30 0.70 0.50 0.40 0.35 0.35 0.35 0.30 0.35 54 Height of right pectoral fin 0.60 0.40 0.50 0.50 0.50 0.40 0.40 0.20 0.30 0.30 55 Height of left pectoral fin 0.55 0.45 0.50 0.50 0.50 0.40 0.40 0.25 0.30 0.30 56 Height of right pelvic fin 0.30 0.20 0.30 0.30 0.30 0.30 0.25 0.36 0.30 0.30 57 Height of left pelvic fin 0.35 0.25 0.25 0.30 0.30 0.30 0.30 0.30 0.30 0.30 58 Height of caudal fin 0.80 0.40 0.50 0.50 0.60 0.60 0.50 0.50 0.55 0.50 59 Height of anal fin 0.30 0.15 0.10 0.20 0.30 0.10 0.20 0.10 0.10 0.10

154

60 Mouth length 0.35 0.35 0.35 0.30 0.30 0.35 0.30 0.30 0.35 0.30

61 Snout length 0.35 0.35 0.35 0.35 0.30 0.30 0.35 0.30 0.30 0.25 154 62 Body depth 0.80 0.90 0.80 0.80 0.70 0.90 0.60 0.70 0.90 0.80

63 Caudal peduncle depth 0.45 0.40 0.45 0.35 0.40 0.40 0.35 0.35 0.45 0.35 64 Caudal peduncle length 1.30 1.00 1.20 1.00 1.10 0.90 1.00 0.70 0.70 1.00

Appendix D continued. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 11 12 13 14 15 16 17 18 19 20 49 Total Length 6.00 6.90 7.00 5.80 5.60 6.10 6.00 6.40 6.55 6.15 50 Standard length 5.00 5.70 5.70 4.90 4.60 5.10 5.00 5.30 5.40 5.10 51 Fork length 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 52 Height of primary dorsal fin 0.30 0.60 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.50 53 Height of secondary dorsal fin 0.30 0.50 0.50 0.40 0.40 0.40 0.50 0.60 0.50 0.60 54 Height of right pectoral fin 0.50 0.40 0.40 0.40 0.50 0.40 0.30 0.20 0.30 0.30 55 Height of left pectoral fin 0.50 0.40 0.40 0.40 0.40 0.40 0.30 0.30 0.30 0.30 56 Height of right pelvic fin 0.30 0.30 0.25 0.20 0.30 0.30 0.20 0.15 0.20 0.20 57 Height of left pelvic fin 0.30 0.30 0.20 0.20 0.30 0.20 0.20 0.20 0.20 0.20 58 Height of caudal fin 0.50 0.60 0.40 0.50 0.45 0.50 0.50 0.50 0.50 0.50 59 Height of anal fin 0.20 0.20 0.30 0.20 0.35 0.20 0.20 0.20 0.15 0.20

155

60 Mouth length 0.35 0.45 0.45 0.40 0.40 0.40 0.35 0.35 0.40 0.35

61 Snout length 0.30 0.45 0.40 0.35 0.40 0.40 0.40 0.35 0.40 0.35 155 62 Body depth 0.90 0.95 1.00 1.00 1.85 1.00 0.80 0.85 0.90 1.00

63 Caudal peduncle depth/height 0.40 0.50 0.50 0.45 0.40 0.45 0.50 0.45 0.50 0.50 64 Caudal peduncle length 1.30 1.20 1.50 1.50 1.50 1.20 1.30 1.30 1.30 1.30

Appendix D continued. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 21 22 23 24 25 26 27 28 29 30 49 Total Length 5.90 5.00 5.30 6.00 5.10 5.20 5.30 6.80 5.20 6.50 50 Standard length 4.90 4.10 4.40 4.80 4.30 4.50 4.50 5.70 4.50 4.80 51 Fork length 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 52 Height of primary dorsal fin 0.50 0.30 0.30 0.50 0.70 0.70 0.70 1.00 0.70 0.80 53 Height of secondary dorsal fin 0.50 0.20 0.20 0.40 0.90 0.90 0.80 1.50 0.90 0.90 54 Height of right pectoral fin 0.30 0.20 0.30 0.25 0.40 0.40 0.40 0.80 0.40 0.40 55 Height of left pectoral fin 0.30 0.25 0.30 0.40 0.50 0.40 0.45 0.70 0.40 0.30 56 Height of right pelvic fin 0.20 0.20 0.20 0.30 0.30 0.30 0.30 0.60 0.30 0.30 57 Height of left pelvic fin 0.20 0.20 0.20 0.30 0.30 0.30 0.30 0.40 0.30 0.30

156 58 Height of caudal fin 0.50 0.40 0.40 0.50 0.80 0.80 0.80 1.00 0.90 0.70

59 Height of anal fin 0.25 0.20 0.20 0.20 0.40 0.45 0.40 0.80 0.60 0.50

156 60 Mouth length 0.35 0.30 0.30 0.30 0.20 0.20 0.20 0.30 0.25 0.20

61 Snout length 0.35 0.30 0.25 0.30 0.30 0.35 0.35 0.35 0.35 0.45

62 Body depth 1.00 0.60 0.70 0.80 0.70 0.80 0.70 1.10 0.80 0.90 63 Caudal peduncle depth/height 0.60 0.35 0.35 0.40 0.30 0.40 0.35 0.50 0.35 0.40 64 Caudal peduncle length 1.20 0.80 0.80 1.10 1.00 1.50 1.20 1.30 1.20 1.10

Appendix D continued. Morphometric characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 31 32 33 34 49 Total Length 5.50 6.20 5.30 5.50 50 Standard length 4.70 5.30 4.50 4.40 51 Fork length 0.00 0.00 0.00 0.00 52 Height of primary dorsal fin 0.70 0.80 0.60 0.60 53 Height of secondary dorsal fin 1.00 1.30 0.80 0.80 54 Height of right pectoral fin 0.45 0.50 0.45 0.35 55 Height of left pectoral fin 0.45 0.70 0.45 0.45 56 Height of right pelvic fin 0.30 0.45 0.30 0.40 57 Height of left pelvic fin 0.30 0.40 0.30 0.30

157 58 Height of caudal fin 1.00 1.00 0.80 0.80

59 Height of anal fin 0.90 0.70 0.40 0.50

157 60 Mouth length 0.20 0.30 0.30 0.20

61 Snout length 0.35 0.40 0.40 0.30

62 Body depth 0.80 1.00 0.80 0.80 63 Caudal peduncle depth/height 0.45 0.50 0.35 0.40 64 Caudal peduncle length 1.00 0.80 0.80 1.00

Appendix E. Morphometric characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 1 Head Length 1.90 2.05 2.10 1.90 1.90 1.25 1.10 1.10 1.70 1.25 2 Eye diameter 0.35 0.40 0.50 0.50 0.45 0.30 0.30 0.40 0.40 0.30 3 Interorbital width 0.10 0.10 0.25 0.25 0.25 0.20 0.10 0.15 0.15 0.10 4 Snout to anus 5.50 5.80 6.20 5.60 4.30 3.30 3.00 3.20 5.20 3.70 5 Snout to anal fin 5.60 5.90 6.50 5.80 5.40 3.40 3.10 3.30 5.30 3.70 6 Snout to origin of pelvic fin 4.05 4.20 4.60 4.20 3.40 2.50 2.40 2.40 3.70 2.70 7 Snout to origin of pectoral fin 2.00 1.90 2.20 2.00 1.80 1.30 1.10 1.20 1.70 1.30 8 Posterior end of dorsal fin to dorsal origin of caudal fin 2.60 2.80 3.20 2.80 2.60 1.90 1.60 1.50 2.40 1.80 9 Posterior end of dorsal fin to posterior end of anal fin 1.70 1.80 2.20 1.80 1.80 1.30 1.10 1.00 2.50 1.20 10 Posterior end of anal fin to dorsal origin of caudal fin 1.50 1.50 1.70 1.60 1.50 1.10 1.00 0.90 1.20 1.10 11 Posterior end of anal fin to ventral origin of caudal fin 1.10 1.10 1.10 1.30 1.30 0.90 0.80 0.80 1.20 0.80

158 12 Origin of dorsal fin to pelvic fin 1.70 1.90 2.00 1.80 1.60 0.90 0.90 1.00 1.30 1.00

13 Origin of dorsal fin to origin of anal fin 2.50 2.70 3.10 2.60 2.50 1.50 1.30 1.50 2.00 1.60 158 14 Origin of dorsal fin to posterior end of anal fin 3.00 3.20 3.50 3.20 3.80 1.80 1.60 1.70 2.50 1.80

15 Origin of pelvic fin to origin of anal fin 1.50 1.60 1.80 1.70 1.70 1.00 0.80 1.20 1.70 1.50 16 Origin of pelvic fin to posterior end of dorsal fin 1.60 1.50 1.80 1.50 1.40 1.00 0.70 0.80 1.30 1.00 17 Origin of anal fin to posterior end of dorsal fin 1.50 1.60 1.80 1.50 1.50 1.10 0.80 0.80 1.20 0.90 18 Predorsal length 3.70 3.90 4.20 3.70 3.50 2.40 2.10 2.20 3.60 2.50 19 Post dorsal length 3.70 4.00 4.20 4.00 3.50 2.20 2.00 1.90 3.30 2.55 20 Basal length of dorsal fin 1.25 1.25 1.30 1.20 1.20 0.50 0.70 0.70 1.00 0.70 21 Basal length of right pectoral fin 0.35 0.35 6.40 0.35 0.30 0.20 0.20 0.20 0.20 0.25 22 Basal length of left pectoral fin 0.40 0.30 0.40 0.35 0.30 0.10 0.20 0.20 0.20 0.25 23 Basal length of right pelvic fin 0.30 0.30 0.30 0.20 0.25 0.20 0.10 0.10 0.25 0.20 24 Basal length of left pelvic fin 0.40 0.30 0.30 0.20 0.25 0.10 0.10 0.10 0.25 0.20

Appendix E continued. Morphometric characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 11 12 13 14 15 16 17 18 19 20 1 Head Length 1.50 1.60 1.55 1.40 1.30 1.40 1.40 1.50 1.45 1.35 2 Eye diameter 0.30 0.40 0.35 0.30 0.30 0.25 0.35 0.35 0.30 0.30 3 Interorbital width 0.10 0.20 0.10 0.10 0.10 0.10 0.10 0.15 0.10 0.10 4 Snout to anus 2.90 3.30 3.30 2.90 2.60 2.90 2.90 3.10 3.00 2.80 5 Snout to anal fin 3.10 3.40 3.60 3.00 2.70 3.00 3.00 3.40 3.40 3.10 6 Snout to origin of pelvic fin 1.60 1.70 1.60 1.50 1.40 1.50 1.50 1.70 1.50 1.70 7 Snout to origin of pectoral fin 1.40 1.50 1.40 1.20 1.20 1.30 1.20 1.40 1.60 1.30 8 Posterior end of dorsal fin to dorsal origin of caudal fin 0.30 0.50 0.40 0.40 0.30 0.30 0.30 0.20 0.25 0.20 9 Posterior end of dorsal fin to posterior end of anal fin 2.50 2.80 2.70 2.40 2.30 2.40 2.30 3.20 2.80 0.70 10 Posterior end of anal fin to dorsal origin of caudal fin 1.80 1.60 1.80 1.10 1.20 1.60 1.70 1.80 1.70 1.50 11 Posterior end of anal fin to ventral origin of caudal fin 0.90 1.70 1.10 0.90 0.90 1.10 0.80 0.90 1.10 1.00

159 12 Origin of dorsal fin to pelvic fin 0.80 1.30 1.00 0.90 0.90 0.90 0.80 0.80 0.60 1.00

13 Origin of dorsal fin to origin of anal fin 1.30 1.70 1.30 1.20 1.10 1.50 1.30 1.20 1.30 1.30 159 14 Origin of dorsal fin to posterior end of anal fin 1.40 1.60 1.30 1.20 1.40 1.20 1.20 1.50 1.00 1.50

15 Origin of pelvic fin to origin of anal fin 1.10 1.50 1.40 1.20 1.20 1.20 1.20 1.20 1.40 1.30 16 Origin of pelvic fin to posterior end of dorsal fin 0.90 1.10 1.30 1.20 1.00 1.00 1.00 1.00 1.50 1.00 17 Origin of anal fin to posterior end of dorsal fin 1.70 1.90 2.00 1.70 1.50 1.50 1.80 2.00 1.40 1.70 18 Predorsal length 2.40 2.50 2.50 2.20 1.90 2.50 2.40 2.60 2.70 2.50 19 Post dorsal length 0.80 1.30 1.10 0.90 0.80 0.90 0.80 1.00 1.00 0.90 20 Basal length of dorsal fin 1.10 1.40 1.30 1.20 1.20 1.50 1.20 1.20 1.50 1.30 21 Basal length of right pectoral fin 1.50 2.10 1.90 1.70 1.30 1.80 1.50 1.70 1.60 1.70 22 Basal length of left pectoral fin 1.50 1.80 1.70 1.50 1.50 1.50 1.50 1.50 1.30 1.40 23 Basal length of right pelvic fin 1.60 2.20 1.90 0.70 1.60 1.70 1.80 1.80 1.80 1.70 24 Basal length of left pelvic fin 1.20 1.30 1.20 1.10 1.00 1.20 1.00 1.20 1.10 1.20

Appendix E continued. Morphometric characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 21 22 23 24 1 Head Length 1.35 1.10 1.25 1.30 2 Eye diameter 0.30 0.20 0.30 0.25 3 Interorbital width 0.10 0.05 0.10 0.10 4 Snout to anus 3.10 2.50 2.90 2.90 5 Snout to anal fin 3.30 2.60 3.00 3.10 6 Snout to origin of pelvic fin 1.70 1.30 1.30 1.40 7 Snout to origin of pectoral fin 1.40 1.20 1.10 1.20 8 Posterior end of dorsal fin to dorsal origin of caudal fin 0.20 0.30 0.20 0.20 9 Posterior end of dorsal fin to posterior end of anal fin 2.50 2.40 2.10 2.50 10 Posterior end of anal fin to dorsal origin of caudal fin 1.30 1.20 1.20 1.50 11 Posterior end of anal fin to ventral origin of caudal fin 1.00 0.80 0.90 0.90

160 12 Origin of dorsal fin to pelvic fin 0.90 0.90 0.90 1.00

13 Origin of dorsal fin to origin of anal fin 1.10 1.10 1.00 1.20 160 14 Origin of dorsal fin to posterior end of anal fin 1.40 1.10 1.20 1.40

15 Origin of pelvic fin to origin of anal fin 1.20 1.20 1.10 1.30 16 Origin of pelvic fin to posterior end of dorsal fin 1.00 0.80 0.80 1.00 17 Origin of anal fin to posterior end of dorsal fin 1.80 1.50 1.70 1.80 18 Predorsal length 2.10 1.90 2.10 2.50 19 Post dorsal length 1.80 1.70 1.00 0.80 20 Basal length of dorsal fin 1.30 0.90 1.10 1.20 21 Basal length of right pectoral fin 1.80 1.20 1.50 1.70 22 Basal length of left pectoral fin 1.30 1.00 1.30 1.60 23 Basal length of right pelvic fin 1.60 1.20 1.50 1.80 24 Basal length of left pelvic fin 0.90 0.80 1.00 1.10

Appendix E continued. Morphometric characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 25 Basal length of caudal fin 0.90 0.90 1.00 0.80 0.75 0.40 0.40 0.40 0.70 0.55 26 Basal length of anal fin 0.60 0.60 0.70 0.70 0.50 0.40 0.50 0.30 0.40 0.40 27 Length of longest dorsal ray 1.55 1.55 1.70 1.45 1.25 0.95 0.90 0.90 1.30 1.05 28 Length of right pectoral fin ( longest ray) 1.40 1.40 1.40 1.50 1.40 0.80 0.70 0.70 1.20 0.90 29 Length of left pectoral fin ( longest ray) 1.40 1.35 1.50 1.60 1.30 0.70 0.70 0.70 1.10 0.80 30 Length of right pelvic fin ( longest ray) 1.00 1.15 1.40 1.10 1.05 0.75 0.50 1.00 0.70 0.80 31 Length of left pelvic fin ( longest ray) 1.10 1.10 1.30 1.20 1.00 0.05 0.05 0.60 1.00 0.60 32 Length of caudal fin (longest ray) 1.80 1.80 2.15 2.10 1.90 1.40 1.00 1.20 1.70 1.20 33 Length of anal fin (longest ray) 1.30 1.45 1.50 1.45 1.35 0.85 0.70 0.50 1.30 0.95 34 Gape height 0.60 0.50 0.15 0.15 0.01 0.05 0.05 0.05 0.15 0.05 Closed mouth width ( jaw angle to jaw

161 35 angle) 0.45 0.50 0.50 0.50 0.45 0.35 0.25 0.25 0.40 0.40

36 Length of maxilla 0.45 0.40 0.45 0.45 0.40 0.20 0.25 0.25 0.30 0.25 161 37 Length of mandible 0.30 0.30 0.35 0.30 0.20 0.10 0.15 0.15 0.20 0.15

38 Total Length 9.10 9.50 10.50 9.50 9.20 6.00 5.30 5.50 8.50 6.40 39 Standard length 7.30 7.50 8.40 7.60 7.30 4.60 4.15 4.30 6.90 4.90 40 Fork length 8.60 9.20 10.00 8.80 8.80 5.60 4.90 5.25 8.00 6.00 41 Height of dorsal fin 1.00 1.10 0.50 0.50 0.40 0.30 0.30 0.20 0.90 0.60 42 Height of right pectoral fin 1.20 0.60 0.50 0.60 0.45 0.24 0.20 0.20 0.30 0.30 43 Height of left pectoral fin 1.30 0.60 0.60 0.50 0.40 0.30 0.30 0.30 0.30 0.30 44 Height of right pelvic fin 1.00 0.50 0.30 0.30 0.30 0.20 0.15 0.15 0.30 0.20 45 Height of left pelvic fin 1.00 0.50 0.50 0.30 0.25 0.20 0.15 0.20 0.25 0.20 46 Height of caudal fin 1.00 1.50 1.30 1.30 1.00 0.60 0.50 0.50 0.80 0.70 47 Height of anal fin 0.45 0.40 0.35 0.30 0.15 0.15 0.10 0.10 0.50 0.35

48 Mouth length 0.45 0.55 0.50 0.50 0.45 0.25 0.20 0.25 0.30 0.30

Appendix E continued. Morphometric characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 11 12 13 14 15 16 17 18 19 20 25 Basal length of caudal fin 0.45 0.60 0.15 0.50 0.50 0.55 0.60 0.60 0.60 0.60 26 Basal length of anal fin 0.35 0.40 0.35 0.45 0.35 0.90 0.40 0.40 0.40 0.40 27 Length of longest dorsal ray 0.95 1.10 2.40 1.05 1.00 1.00 1.10 1.10 1.00 1.00 28 Length of right pectoral fin ( longest ray) 0.95 1.00 0.75 0.80 0.85 0.70 0.80 1.00 0.80 0.90 29 Length of left pectoral fin ( longest ray) 0.80 1.00 1.80 0.85 0.80 0.80 0.80 1.00 0.80 0.90 30 Length of right pelvic fin ( longest ray) 0.70 0.85 0.70 0.65 0.55 0.55 0.55 0.70 0.60 0.70 31 Length of left pelvic fin ( longest ray) 0.50 0.60 0.65 0.70 0.60 0.60 0.60 0.70 0.60 0.70 32 Length of caudal fin (longest ray) 1.30 1.40 1.20 1.10 1.20 1.10 1.15 1.30 1.20 1.30 33 Length of anal fin (longest ray) 0.85 1.00 0.90 0.85 0.70 0.85 0.70 1.00 0.70 0.90 34 Gape height 0.10 0.10 0.10 0.40 0.40 0.30 0.35 0.40 0.40 0.40 35 Closed mouth width ( jaw angle to jaw angle) 0.35 0.40 0.35 0.35 0.35 0.40 0.40 0.45 0.40 0.45

162 36 Length of maxilla 0.25 0.40 0.25 0.35 0.30 0.30 0.40 0.30 0.35 0.35

37 Length of mandible 0.20 0.20 0.20 0.25 0.25 0.20 0.20 0.25 0.30 0.20 162 38 Total Length 6.30 7.00 6.00 6.00 5.80 5.80 5.90 6.50 6.00 6.10

39 Standard length 5.10 5.50 4.90 4.80 4.80 4.80 4.80 5.30 5.00 5.00 40 Fork length 6.00 6.50 5.70 5.80 5.60 5.50 5.60 6.10 5.80 5.80 41 Height of dorsal fin 0.30 1.20 0.60 0.70 0.50 0.70 0.50 0.60 0.40 0.50 42 Height of right pectoral fin 0.20 0.25 0.30 0.60 0.80 0.30 0.20 0.30 0.30 0.30 43 Height of left pectoral fin 0.20 0.30 0.30 0.80 0.80 0.30 0.20 0.30 0.35 0.35 44 Height of right pelvic fin 0.15 0.20 0.25 0.70 0.50 0.20 0.20 0.30 0.20 0.30 45 Height of left pelvic fin 0.15 0.20 0.25 0.60 0.60 0.20 0.20 0.25 0.20 0.30 46 Height of caudal fin 0.60 0.50 0.50 0.70 0.40 0.60 0.60 0.70 0.80 0.50 47 Height of anal fin 0.40 0.40 0.35 0.30 0.30 0.20 0.20 0.30 3.00 0.20 48 Mouth length 0.25 0.30 0.20 0.20 0.20 0.30 0.25 0.20 0.25 0.20

Appendix E continued. Morphometric characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 21 22 23 24 25 Basal length of caudal fin 0.60 0.75 0.80 0.60 26 Basal length of anal fin 0.30 0.50 0.50 0.30 27 Length of longest dorsal ray 1.10 1.35 1.40 0.95 28 Length of right pectoral fin ( longest ray) 0.90 1.10 1.30 0.80 29 Length of left pectoral fin ( longest ray) 0.90 1.10 1.30 0.85 30 Length of right pelvic fin ( longest ray) 0.70 0.80 0.90 0.50 31 Length of left pelvic fin ( longest ray) 0.75 0.90 1.00 0.60 32 Length of caudal fin (longest ray) 1.20 1.50 1.80 1.25 33 Length of anal fin (longest ray) 0.90 1.25 1.20 0.70 34 Gape height 0.40 0.60 0.55 0.40 35 Closed mouth width ( jaw angle to jaw angle) 0.50 0.70 0.70 0.45

163

36 Length of maxilla 0.35 0.40 0.50 0.30

37 Length of mandible 0.20 0.35 0.40 0.25 163 38 Total Length 6.40 7.80 8.20 5.80

39 Standard length 5.50 6.30 6.50 4.80 40 Fork length 6.00 7.40 7.60 5.60 41 Height of dorsal fin 0.50 1.30 1.20 0.50 42 Height of right pectoral fin 0.35 0.45 0.60 0.30 43 Height of left pectoral fin 0.40 0.45 0.60 0.30 44 Height of right pelvic fin 0.30 0.30 0.45 0.20 45 Height of left pelvic fin 0.30 0.30 0.50 0.20 46 Height of caudal fin 1.30 1.30 1.20 0.90 47 Height of anal fin 0.60 0.60 0.50 0.30 48 Mouth length 0.25 0.25 0.30 0.15

Appendix E continued. Morphometric characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 49 Snout length 0.80 0.85 0.90 0.75 0.65 0.45 0.35 0.45 0.70 0.60 50 Body depth 1.55 1.60 1.70 1.70 1.40 1.00 0.90 1.10 1.05 1.20 51 Caudal peduncle depth (Height) 0.80 0.80 0.80 0.80 0.70 0.45 0.35 0.50 0.60 0.50 52 Caudal peduncle length 2.50 2.70 3.00 1.70 2.50 1.20 1.50 1.60 1.10 0.85

164

Appendix E continued. Morphometric characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 11 12 13 14 15 16 17 18 19 20 49 Snout length 0.50 0.50 0.45 0.50 0.50 0.50 0.55 0.60 0.60 0.60 50 Body depth 1.15 1.10 0.95 1.00 1.00 1.10 1.00 1.15 1.15 1.10 51 Caudal peduncle depth (Height) 0.45 0.50 0.45 0.45 0.40 0.45 0.45 0.45 0.50 0.50 52 Caudal peduncle length 0.80 1.00 0.80 1.60 1.50 1.50 1.80 1.80 1.70 2.00

165

Appendix E continued. Morphometric characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 21 22 23 24 49 Snout length 0.80 0.80 0.80 0.60 50 Body depth 1.30 1.30 1.20 1.10 51 Caudal peduncle depth (Height) 0.60 0.60 0.60 0.50 52 Caudal peduncle length 2.20 2.20 2.20 1.80

166

Appendix F. Morphometric characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 1 Head Length 2.80 2.10 1.50 2.00 1.40 1.50 1.50 1.50 1.25 1.30 2 Eye diameter 0.55 0.40 0.30 0.35 0.30 0.30 0.35 0.30 0.25 0.30 3 Interorbital width 0.30 0.25 0.10 0.20 0.15 0.15 0.15 0.15 0.10 0.15 4 Snout to anus 8.30 6.30 4.50 6.50 3.90 4.10 4.00 4.00 3.30 3.50 5 Snout to anal fin 8.40 6.40 4.60 6.60 4.00 4.20 4.10 4.10 3.50 3.60 6 Snout to origin of pelvic fin 6.00 4.50 3.00 4.80 3.00 3.20 3.00 3.00 2.70 2.70 7 Snout to origin of pectoral fin 3.00 2.00 1.50 2.00 1.50 1.60 1.50 1.60 1.30 1.40 8 Posterior end of dorsal fin to dorsal origin of caudal fin 4.00 3.00 2.20 3.00 2.00 1.80 2.00 2.00 1.70 1.70 9 Posterior end of dorsal fin to posterior end of anal fin 2.70 2.00 1.30 2.10 1.30 1.30 1.50 1.50 0.90 1.30 10 Posterior end of anal fin to dorsal origin of caudal fin 2.20 1.70 1.30 1.70 2.10 1.20 1.20 1.20 1.00 0.90 11 Posterior end of anal fin to ventral origin of caudal fin 2.20 1.40 1.00 1.50 0.90 1.10 1.00 1.00 0.90 0.80

167 12 Origin of dorsal fin to pelvic fin 2.50 2.00 1.30 1.80 1.20 1.30 1.20 1.30 1.10 1.10

13 Origin of dorsal fin to origin of anal fin 3.90 2.90 2.00 2.80 1.30 1.80 1.90 1.70 1.60 1.60 167 14 Origin of dorsal fin to posterior end of anal fin 4.50 3.50 2.20 3.30 2.10 2.30 2.30 2.20 2.90 1.80

15 Origin of pelvic fin to origin of anal fin 2.50 1.80 1.30 1.90 1.20 1.40 1.20 1.40 1.00 1.00 16 Origin of pelvic fin to posterior end of dorsal fin 2.30 1.80 1.20 1.60 1.00 1.20 1.00 1.10 1.00 0.90 17 Origin of anal fin to posterior end of dorsal fin 2.50 1.70 1.30 2.00 1.00 0.90 1.20 1.20 0.90 0.90 18 Predorsal length 5.90 4.00 2.80 4.30 2.50 2.80 2.70 2.70 2.30 2.40 19 Post dorsal length 5.80 4.50 2.80 4.50 2.70 2.80 2.70 2.80 2.20 2.20 20 Basal length of dorsal fin 1.80 1.50 0.80 1.30 1.00 1.00 0.90 0.90 0.60 0.70 21 Basal length of right pectoral fin 0.55 0.40 0.30 0.40 0.30 0.25 0.30 0.25 0.20 0.20 22 Basal length of left pectoral fin 0.50 0.40 0.30 0.30 0.30 0.30 0.25 0.25 0.20 0.20 23 Basal length of right pelvic fin 0.40 0.30 0.20 0.30 0.20 0.20 0.20 0.20 0.15 0.20 24 Basal length of left pelvic fin 0.45 0.30 0.20 0.30 0.20 0.20 0.20 0.20 0.15 0.20

Appendix F continued. Morphometric characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 11 12 13 14 15 16 17 18 19 20 1 Head Length 1.30 1.30 1.35 1.90 1.75 1.50 1.50 1.35 1.70 1.25 2 Eye diameter 0.30 0.30 0.40 0.40 0.40 0.35 0.30 0.30 0.40 0.35 3 Interorbital width 0.10 0.10 0.10 0.20 0.30 0.10 0.10 0.10 0.20 0.10 4 Snout to anus 3.80 3.60 3.80 5.50 4.90 3.80 3.90 3.60 5.00 3.50 5 Snout to anal fin 3.90 3.70 4.00 5.60 2.20 4.10 4.10 3.70 5.10 3.60 6 Snout to origin of pelvic fin 2.40 2.80 2.80 3.90 3.60 2.90 2.90 2.80 3.70 2.60 7 Snout to origin of pectoral fin 1.30 1.30 1.40 1.90 1.70 1.40 1.40 1.40 1.70 1.30 8 Posterior end of dorsal fin to dorsal origin of caudal fin 2.00 2.00 2.20 2.80 2.60 2.10 1.80 2.00 2.80 1.90 9 Posterior end of dorsal fin to posterior end of anal fin 1.30 1.00 1.40 1.80 1.60 1.40 1.50 1.30 1.60 1.20 10 Posterior end of anal fin to dorsal origin of caudal fin 1.00 1.10 1.10 1.60 1.50 1.00 1.00 1.00 1.10 1.00 11 Posterior end of anal fin to ventral origin of caudal fin 0.80 0.96 0.90 1.20 1.20 0.80 0.80 0.90 1.30 0.90

168 12 Origin of dorsal fin to pelvic fin 1.20 1.10 1.30 1.80 1.50 1.20 1.20 1.20 1.50 1.20

13 Origin of dorsal fin to origin of anal fin 1.80 1.80 2.00 2.70 2.60 1.80 1.90 1.70 2.50 1.60 168 14 Origin of dorsal fin to posterior end of anal fin 2.20 2.00 2.30 3.00 3.00 2.20 2.20 2.00 2.80 1.90

15 Origin of pelvic fin to origin of anal fin 1.20 1.00 1.30 1.50 1.50 1.10 1.10 1.10 1.40 1.10 16 Origin of pelvic fin to posterior end of dorsal fin 1.00 1.00 1.20 1.70 1.60 1.10 1.20 1.00 1.40 1.10 17 Origin of anal fin to posterior end of dorsal fin 1.10 1.00 1.20 1.60 1.50 1.00 1.20 1.10 1.50 1.00 18 Predorsal length 2.50 2.65 2.50 3.50 3.30 2.60 2.60 2.55 3.55 2.60 19 Post dorsal length 2.50 2.75 2.80 3.80 4.00 2.70 2.60 2.65 3.70 2.70 20 Basal length of dorsal fin 0.80 0.70 0.90 1.40 1.60 0.90 0.70 0.80 1.10 0.80 21 Basal length of right pectoral fin 0.25 0.20 0.20 0.40 0.30 0.20 0.30 0.20 0.30 0.20 22 Basal length of left pectoral fin 0.25 0.25 0.20 0.40 0.30 0.20 0.25 0.20 0.30 0.20 23 Basal length of right pelvic fin 0.20 0.15 0.20 0.20 0.20 0.20 0.20 0.15 0.20 0.20 24 Basal length of left pelvic fin 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.15 0.20 0.20

Appendix F continued. Morphometric characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 21 22 23 1 Head Length 1.60 1.60 1.60 2 Eye diameter 0.40 0.40 0.35 3 Interorbital width 0.20 0.20 0.20 4 Snout to anus 4.60 4.60 4.10 5 Snout to anal fin 4.70 4.70 4.20 6 Snout to origin of pelvic fin 3.30 3.30 3.00 7 Snout to origin of pectoral fin 1.70 1.60 1.40 8 Posterior end of dorsal fin to dorsal origin of caudal fin 2.40 2.40 2.30 9 Posterior end of dorsal fin to posterior end of anal fin 1.50 1.60 1.50 10 Posterior end of anal fin to dorsal origin of caudal fin 1.20 1.30 1.30 11 Posterior end of anal fin to ventral origin of caudal fin 1.20 1.20 1.20

169 12 Origin of dorsal fin to pelvic fin 1.30 1.50 1.30

13 Origin of dorsal fin to origin of anal fin 2.20 2.20 2.20 169 14 Origin of dorsal fin to posterior end of anal fin 2.60 2.50 2.50

15 Origin of pelvic fin to origin of anal fin 1.40 1.30 1.30 16 Origin of pelvic fin to posterior end of dorsal fin 1.20 1.30 1.40 17 Origin of anal fin to posterior end of dorsal fin 1.40 1.30 1.20 18 Predorsal length 3.10 3.00 3.90 19 Post dorsal length 3.30 3.20 3.30 20 Basal length of dorsal fin 1.00 1.20 1.00 21 Basal length of right pectoral fin 0.30 0.30 0.30 22 Basal length of left pectoral fin 0.30 0.30 0.30 23 Basal length of right pelvic fin 0.20 0.20 0.20 24 Basal length of left pelvic fin 0.20 0.20 0.20

Appendix F continued. Morphometric characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 25 Basal length of caudal fin 1.40 1.10 0.60 0.10 0.70 0.70 0.70 0.80 0.60 0.50 26 Basal length of anal fin 0.80 0.70 0.40 0.70 0.50 0.40 0.40 0.45 0.30 0.40 27 Length of longest dorsal ray 2.15 1.75 1.20 2.30 1.15 1.20 1.15 1.10 1.15 1.00 28 Length of right pectoral fin ( longest ray) 2.00 1.30 1.10 1.80 1.00 1.10 1.00 1.05 0.95 1.00 29 Length of left pectoral fin ( longest ray) 1.90 1.60 1.10 1.70 1.10 1.10 1.00 1.00 0.90 0.90 30 Length of right pelvic fin ( longest ray) 1.50 1.20 0.80 1.20 0.80 0.80 0.80 0.80 0.70 0.70 31 Length of left pelvic fin ( longest ray) 1.30 1.20 1.70 1.10 1.70 0.80 0.70 0.80 0.70 0.70 32 Length of caudal fin (longest ray) 2.00 2.30 1.60 2.10 1.40 1.40 1.20 1.40 1.30 1.20 33 Length of anal fin (longest ray) 2.05 1.65 0.95 1.70 0.95 1.00 0.95 0.90 0.80 0.90 34 Gape height 0.20 0.20 0.10 0.20 0.10 0.15 0.10 0.10 0.15 0.10 Closed mouth width ( jaw angle to jaw

170 35 angle) 0.90 0.60 0.40 0.50 0.40 0.40 0.40 0.45 0.40 0.40

36 Length of maxilla 0.60 0.50 0.35 0.35 0.30 0.35 0.40 0.35 0.30 0.30 170 37 Length of mandible 0.50 0.35 0.30 0.20 0.25 0.20 0.25 0.25 0.25 0.20

38 Total Length 13.50 10.60 7.10 10.90 6.70 7.10 6.50 6.70 6.00 6.00 39 Standard length 11.00 8.40 5.60 8.40 5.20 5.60 5.20 5.20 4.50 4.70 40 Fork length 12.80 9.80 6.80 10.20 6.30 6.80 6.30 6.40 5.80 5.70 41 Height of dorsal fin 1.00 1.00 1.00 1.30 0.80 0.50 0.40 0.40 0.40 0.40 42 Height of right pectoral fin 1.00 0.70 0.30 0.50 0.40 0.40 0.40 0.40 0.30 0.30 43 Height of left pectoral fin 0.80 0.70 0.30 0.50 0.30 0.30 0.40 0.40 0.30 0.35 44 Height of right pelvic fin 0.50 0.50 0.20 0.40 0.25 0.20 0.30 0.30 0.20 0.25 45 Height of left pelvic fin 0.50 0.40 0.20 0.30 0.20 0.30 0.30 0.20 0.20 0.20 46 Height of caudal fin 1.90 1.50 0.70 1.30 1.00 1.10 1.00 1.10 1.00 0.80 47 Height of anal fin 0.50 0.40 0.20 0.35 0.20 0.20 0.10 0.20 0.20 0.10

48 Mouth length 0.80 0.50 0.30 0.50 0.30 0.30 0.35 0.30 0.30 0.30

Appendix F continued. Morphometric characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 11 12 13 14 15 16 17 18 19 20 25 Basal length of caudal fin 0.60 0.50 0.60 0.50 0.80 0.60 0.60 0.60 0.70 0.50 26 Basal length of anal fin 0.40 0.40 0.40 0.70 0.60 0.50 0.40 0.40 0.60 0.40 27 Length of longest dorsal ray 1.15 1.10 1.15 1.80 1.30 1.35 1.30 1.15 1.65 1.10 28 Length of right pectoral fin ( longest ray) 0.95 0.95 1.05 1.55 1.35 1.05 1.15 1.05 1.40 1.10 29 Length of left pectoral fin ( longest ray) 1.00 1.00 1.10 1.50 1.30 1.10 1.10 1.10 1.40 1.00 30 Length of right pelvic fin ( longest ray) 0.75 0.70 0.80 0.60 1.00 0.80 0.85 0.75 1.00 0.80 31 Length of left pelvic fin ( longest ray) 0.70 0.70 0.80 1.00 1.00 0.90 g.7 0.90 1.00 0.80 32 Length of caudal fin (longest ray) 1.40 1.30 1.40 1.90 1.90 1.50 1.60 1.50 1.90 1.40 33 Length of anal fin (longest ray) 0.90 0.80 0.90 1.35 1.35 1.00 0.95 0.95 1.20 0.95 34 Gape height 0.15 0.15 0.30 0.40 0.30 0.30 0.30 0.30 0.30 0.20

171 35 Closed mouth width ( jaw angle to jaw angle) 0.40 0.40 0.40 0.70 0.50 0.40 0.35 0.40 0.40 0.30

36 Length of maxilla 0.30 0.25 0.46 0.50 0.40 0.30 0.30 0.35 0.50 0.30 171 37 Length of mandible 0.25 0.15 0.25 0.40 0.35 0.25 0.20 0.25 0.35 0.25

38 Total Length 6.50 6.40 6.80 9.30 8.70 6.80 6.80 6.70 8.60 6.50 39 Standard length 5.00 5.30 5.30 7.50 6.90 5.40 5.20 5.10 6.80 4.85 40 Fork length 6.20 6.10 6.20 8.80 8.10 6.30 6.20 6.10 8.00 5.80 41 Height of dorsal fin 0.30 0.40 0.80 0.90 0.70 0.50 0.50 0.50 0.70 0.40 42 Height of right pectoral fin 0.40 0.30 0.40 0.70 0.50 0.30 0.30 0.30 0.60 0.40 43 Height of left pectoral fin 0.30 0.30 0.40 0.60 0.50 0.30 0.30 0.30 0.50 0.40 44 Height of right pelvic fin 0.20 0.10 0.25 0.30 0.30 0.20 0.20 0.20 0.30 0.25 45 Height of left pelvic fin 0.20 0.20 0.25 0.30 0.30 0.20 0.20 0.20 0.30 0.25 46 Height of caudal fin 1.00 0.60 0.60 1.00 0.70 0.60 0.60 0.60 0.80 0.70 47 Height of anal fin 0.15 0.20 0.30 0.40 0.50 0.40 0.35 0.40 0.30 0.25

48 Mouth length 0.30 0.25 0.30 0.40 0.40 0.25 0.30 0.30 0.35 0.25

Appendix F continued. Morphometric characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 21 22 23 25 Basal length of caudal fin 0.70 0.70 0.70 26 Basal length of anal fin 0.50 0.50 0.50 27 Length of longest dorsal ray 1.50 1.50 1.30 28 Length of right pectoral fin ( longest ray) 1.35 1.35 1.20 29 Length of left pectoral fin ( longest ray) 1.40 1.30 1.20 30 Length of right pelvic fin ( longest ray) 1.00 0.90 0.90 31 Length of left pelvic fin ( longest ray) 1.00 1.00 0.80 32 Length of caudal fin (longest ray) 1.80 1.60 1.60 33 Length of anal fin (longest ray) 1.20 1.15 1.00 34 Gape height 0.30 0.30 0.30 35 Closed mouth width ( jaw angle to jaw angle) 0.30 0.30 0.30

172

36 Length of maxilla 0.35 0.35 0.40

37 Length of mandible 0.25 0.25 0.30 172 38 Total Length 8.00 7.00 7.30

39 Standard length 6.40 6.20 5.80 40 Fork length 7.50 7.30 6.70 41 Height of dorsal fin 0.60 0.50 1.00 42 Height of right pectoral fin 0.50 0.50 0.50 43 Height of left pectoral fin 0.50 0.50 0.50 44 Height of right pelvic fin 0.20 0.20 0.25 45 Height of left pelvic fin 0.20 0.20 0.25 46 Height of caudal fin 0.60 0.70 0.70 47 Height of anal fin 0.35 0.40 0.35 48 Mouth length 0.40 0.30 0.35

Appendix F continued. Morphometric characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 49 Snout length 1.40 0.95 55.00 1.00 0.60 0.60 0.60 0.60 0.50 0.55 50 Body depth 2.60 1.80 1.50 1.50 1.20 1.30 1.20 1.20 1.05 1.10 51 Caudal peduncle depth (Height) 1.15 0.90 0.60 2.90 0.55 0.55 0.50 0.60 0.45 0.50 52 Caudal peduncle length 3.90 3.00 2.00 0.85 1.80 1.80 1.70 1.80 1.50 1.50

173

Appendix F continued. Morphometric characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 11 12 13 14 15 16 17 18 19 20 49 Snout length 0.55 0.50 0.55 0.85 0.80 0.70 0.60 0.55 0.80 0.60 50 Body depth 1.10 1.20 1.15 1.75 1.50 1.30 1.20 1.10 1.50 1.25 51 Caudal peduncle depth (Height) 0.55 0.50 0.50 0.75 0.65 0.30 0.55 0.50 0.70 0.50 52 Caudal peduncle length 0.80 0.80 0.85 1.50 1.30 0.90 0.75 0.90 1.10 0.85

174

Appendix F continued. Morphometric characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 21 22 23 49 Snout length 0.70 0.80 0.65 50 Body depth 1.30 1.30 1.80 51 Caudal peduncle depth (Height) 0.65 0.60 0.60 52 Caudal peduncle length 1.20 1.00 1.10

175

Appendix G. Meristic characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 Number of scales in lateral series 58 52 51 49 52 58 53 49 47 49 52 51 45 48 2 Scales below lateral line 8 7 5 5 8 6 5 7 6 6 5 7 7 6 3 Scales above lateral line 10 13 11 10 13 10 9 10 11 10 11 9 13 10 4 Scales on side of caudal peduncle 7 8 7 7 8 9 7 8 8 7 8 7 7 8 5 Scales around caudal peduncle 14 17 16 14 17 20 16 16 18 16 15 16 17 16 6 Scales before dorsal fin 32 37 35 35 37 35 32 33 31 32 31 33 32 31 7 Circumference scale 49 47 49 47 49 52 48 47 48 49 50 48 49 51 8 Number of rays in primary dorsal fin 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 Number of rays in caudal fin 18 18 18 18 18 18 18 18 18 18 18 18 18 18 10 Number of rays in right pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13 13 13

176 11 Number of rays in left pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13 13 13

12 Number of rays in right pelvic fin 8 8 8 8 8 8 8 8 8 8 8 8 8 8 176 13 Number of rays in left pelvic fin 8 8 8 8 8 8 8 8 8 8 8 8 8 8

14 Number of rays in anal fin 7 7 7 7 7 7 7 7 7 7 7 7 7 7

Appendix G continued. Meristic characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 15 16 17 18 19 20 21 22 23 24 25 1 Number of scales in lateral series 59 52 54 51 41 55 49 49 46 48 39 2 Scales below lateral line 12 9 11 8 9 11 8 8 9 7 9 3 Scales above lateral line 10 12 13 13 15 10 12 11 11 6 9 4 Scales on side of caudal peduncle 9 11 12 13 15 12 13 13 11 10 11 5 Scales around caudal peduncle 22 23 25 29 31 25 23 27 26 24 25 6 Scales before dorsal fin 46 48 46 53 46 44 39 46 46 42 38 7 Circumference scale 48 46 48 49 47 47 41 43 40 37 34 8 Number of rays in primary dorsal fin 8 8 8 8 8 8 8 8 8 8 8 9 Number of rays in caudal fin 18 18 18 18 18 18 18 18 18 18 18 10 Number of rays in right pectoral fin 13 13 13 13 13 13 13 13 13 13 13

177 11 Number of rays in left pectoral fin 13 13 13 13 13 13 13 13 13 13 13

12 Number of rays in right pelvic fin 8 8 8 8 8 8 8 8 8 8 8 177 13 Number of rays in left pelvic fin 8 8 8 8 8 8 8 8 8 8 8

14 Number of rays in anal fin 7 7 7 7 7 7 7 7 7 7 7

Appendix G continued. Meristic characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 26 27 28 29 30 31 32 33 34 35 1 Number of scales in lateral series 40 49 33 46 44 54 56 57 57 65 2 Scales below lateral line 7 8 8 10 4 5 9 6 6 7 3 Scales above lateral line 8 14 12 12 12 12 10 12 12 10 4 Scales on side of caudal peduncle 10 13 12 13 13 12 11 12 12 12 5 Scales around caudal peduncle 21 25 24 27 16 22 25 26 26 27 6 Scales before dorsal fin 39 39 36 43 38 36 47 43 43 41 7 Circumference scale 42 48 38 49 44 38 48 46 46 58 8 Number of rays in primary dorsal fin 8 8 8 8 8 8 8 8 8 8 9 Number of rays in caudal fin 18 18 18 18 18 18 18 18 18 18 10 Number of rays in right pectoral fin 13 13 13 13 13 13 13 13 13 13 11 Number of rays in left pectoral fin 13 13 13 13 13 13 13 13 13 13

178 12 Number of rays in right pelvic fin 8 8 8 8 8 8 8 8 8 8

13 Number of rays in left pelvic fin 8 8 8 8 8 8 8 8 8 8 178 14 Number of rays in anal fin 7 7 7 7 7 7 7 7 7 7

Appendix H. Meristic characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 Number of scales in lateral series 53 55 57 53 57 55 70 59 57 55 53 45 53 55 2 Scales below lateral line 8 7 9 9 7 8 8 5 9 6 8 7 6 8 3 Scales above lateral line 13 11 11 12 11 12 12 13 11 10 12 15 10 11 4 Scales on side of caudal peduncle 12 14 11 12 10 11 10 9 12 10 10 11 7 11 5 Scales around caudal peduncle 22 21 23 20 14 24 22 21 22 22 25 23 15 20 6 Scales before dorsal fin 35 37 40 32 35 38 27 36 38 42 40 35 39 38 7 Circumference scale 41 40 39 36 34 40 31 32 32 33 34 34 43 40 8 Number of rays in primary dorsal fin 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 Number of rays in caudal fin 18 18 18 18 18 18 18 18 18 18 18 18 18 18 10 Number of rays in right pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13 13 13

179 11 Number of rays in left pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13 13 13

12 Number of rays in right pelvic fin 8 8 8 8 8 8 8 8 8 8 8 8 8 8 179 13 Number of rays in left pelvic fin 8 8 8 8 8 8 8 8 8 8 8 8 8 8

14 Number of rays in anal fin 7 7 7 7 7 7 7 7 7 7 7 7 7 7

Appendix H continued. Meristic characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 15 16 17 18 19 20 21 22 23 24 25 1 Number of scales in lateral series 49 57 59 53 55 49 45 55 57 59 55 2 Scales below lateral line 8 7 5 8 6 9 7 6 8 9 11 3 Scales above lateral line 10 12 15 10 11 12 13 10 11 12 13 4 Scales on side of caudal peduncle 10 12 10 11 9 11 10 11 12 11 11 5 Scales around caudal peduncle 22 23 25 20 21 25 23 20 20 19 23 6 Scales before dorsal fin 42 40 39 39 37 36 35 37 36 37 36 7 Circumference scale 39 38 34 31 39 38 38 33 34 39 39 8 Number of rays in primary dorsal fin 8 8 8 8 8 8 8 8 8 8 8 9 Number of rays in caudal fin 18 18 18 18 18 18 18 18 18 18 18

180 10 Number of rays in right pectoral fin 13 13 13 13 13 13 13 13 13 13 13

11 Number of rays in left pectoral fin 13 13 13 13 13 13 13 13 13 13 13

180 12 Number of rays in right pelvic fin 8 8 8 8 8 8 8 8 8 8 8

13 Number of rays in left pelvic fin 8 8 8 8 8 8 8 8 8 8 8

14 Number of rays in anal fin 7 7 7 7 7 7 7 7 7 7 7

Appendix H continued. Meristic characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 26 27 28 29 30 31 32 33 34 35 36 37 38 1 Number of scales in lateral series 64 45 56 56 71 69 63 75 63 70 62 56 65 2 Scales below lateral line 10 9 10 10 8 12 10 8 7 9 9 7 9 3 Scales above lateral line 16 12 13 12 14 13 13 14 9 14 15 12 15 4 Scales on side of caudal peduncle 14 10 13 11 10 15 12 11 12 13 12 11 13 5 Scales around caudal peduncle 25 24 29 23 23 25 26 24 26 27 27 27 29 6 Scales before dorsal fin 43 39 40 44 36 45 37 46 40 40 37 41 39 7 Circumference scale 42 44 46 47 48 46 48 45 47 38 39 47 46 8 Number of rays in primary dorsal fin 8 8 8 8 8 8 8 8 8 8 8 8 8 9 Number of rays in caudal fin 18 18 18 18 18 18 18 18 18 18 18 18 18

181 10 Number of rays in right pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13 13

11 Number of rays in left pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13 13

181 12 Number of rays in right pelvic fin 8 8 8 8 8 8 8 8 8 8 8 8 8

13 Number of rays in left pelvic fin 8 8 8 8 8 8 8 8 8 8 8 8 8

14 Number of rays in anal fin 7 7 7 7 7 7 7 7 7 7 7 7 7

Appendix I. Meristic characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 12 13 1 Number of scales in lateral series 45 48 48 50 46 47 45 49 48 52 52 48 41 2 Scales below lateral line 7 9 8 6 5 7 7 9 9 8 9 5 7 3 Scales above lateral line 6 5 4 5 5 5 5 4 5 4 7 5 5 4 Scales on side of caudal peduncle 7 7 7 8 6 7 7 6 6 7 6 5 7 5 Scales around caudal peduncle 17 17 13 18 11 12 7 14 12 14 13 12 11 6 Scales before dorsal fin 11 9 16 8 11 11 14 12 14 13 7 12 9 7 Cheek scales 5 7 6 5 4 3 4 4 5 2 3 4 3 8 Circumference scale 22 30 33 31 30 26 31 34 20 24 27 27 27 9 Number of rays in primary dorsal fin 9 9 9 9 9 9 9 9 9 9 9 9 9

182 10 Number of rays in secondary dorsal fin 14 14 14 14 14 14 14 14 14 14 14 14 14

11 Number of rays in caudal fin 19 19 19 19 19 19 19 19 19 19 19 19 19

182 12 Number of rays in right pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13 13

13 Number of rays in left pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13 13

14 Number of rays in right pelvic fin 6 6 6 6 6 6 6 6 6 6 6 6 6 15 Number of rays in left pelvic fin 6 6 6 6 6 6 6 6 6 6 6 6 6 16 Number of rays in anal fin 10 10 10 10 10 10 10 10 10 10 10 10 10

Appendix I continued. Meristic characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 14 15 16 17 18 19 20 21 22 23 24 25 1 Number of scales in lateral series 50 48 49 52 48 52 50 48 41 58 45 46 2 Scales below lateral line 8 6 8 9 7 9 9 8 4 5 3 4 3 Scales above lateral line 5 5 5 6 4 5 4 4 5 4 6 5 4 Scales on side of caudal peduncle 4 5 5 6 7 7 6 6 6 7 7 6 5 Scales around caudal peduncle 12 12 11 14 11 12 11 11 11 12 11 12 6 Scales before dorsal fin 10 13 8 11 11 10 11 12 13 11 11 11 7 Cheek scales 3 4 5 4 5 5 5 6 6 4 5 5 8 Circumference scale 24 26 32 28 31 26 25 26 24 24 24 24 9 Number of rays in primary dorsal fin 9 9 9 9 9 9 9 9 9 9 9 9

183 10 Number of rays in secondary dorsal fin 14 14 14 14 14 14 14 14 14 14 14 14

11 Number of rays in caudal fin 19 19 19 19 19 19 19 19 19 19 19 19

183 12 Number of rays in right pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13

13 Number of rays in left pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13

14 Number of rays in right pelvic fin 6 6 6 6 6 6 6 6 6 6 6 6 15 Number of rays in left pelvic fin 6 6 6 6 6 6 6 6 6 6 6 6 16 Number of rays in anal fin 10 10 10 10 10 10 10 10 10 10 10 10

Appendix J. Meristic characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 12 13 1 Number of scales in lateral series 53 51 46 47 50 49 45 48 51 49 42 47 45 2 Scales below lateral line 8 8 9 10 7 9 7 8 9 9 7 7 7 3 Scales above lateral line 5 11 5 4 5 4 5 6 5 5 5 6 5 4 Scales on side of caudal peduncle 6 6 8 8 7 8 9 8 8 8 5 7 5 5 Scales around caudal peduncle 14 13 17 17 17 16 17 17 17 16 10 12 11 6 Scales before dorsal fin 9 11 9 9 9 8 11 9 11 12 11 7 10 7 Cheek scales 5 3 6 4 5 4 4 4 5 4 4 5 3 8 Circumference scale 30 28 29 28 32 30 28 27 30 31 26 29 25 9 Number of rays in primary dorsal fin 9 9 9 9 9 9 9 9 9 9 9 9 9

184 10 Number of rays in secondary dorsal fin 14 14 14 14 14 14 14 14 14 14 14 14 14

11 Number of rays in caudal fin 19 19 19 19 19 19 19 19 19 19 19 19 19

184 12 Number of rays in right pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13 13

13 Number of rays in left pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13 13

14 Number of rays in right pelvic fin 6 6 6 6 6 6 6 6 6 6 6 6 6 15 Number of rays in left pelvic fin 6 6 6 6 6 6 6 6 6 6 6 6 6 16 Number of rays in anal fin 10 10 10 10 10 10 10 10 10 10 10 10 10

Appendix J continued. Meristic characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 14 15 16 17 18 19 20 21 22 23 24 25 1 Number of scales in lateral series 42 49 47 44 50 49 53 47 48 45 53 45 2 Scales below lateral line 8 7 6 6 7 7 8 6 7 7 8 8 3 Scales above lateral line 6 5 6 5 4 5 5 4 6 5 5 5 4 Scales on side of caudal peduncle 8 7 7 5 5 6 7 5 7 7 8 7 5 Scales around caudal peduncle 15 14 13 12 11 13 15 12 14 16 15 11 6 Scales before dorsal fin 8 8 15 8 12 10 10 10 11 8 15 9 7 Cheek scales 5 4 4 5 4 5 5 4 4 4 6 5 8 Circumference scale 29 25 29 29 38 27 31 27 28 26 34 28 9 Number of rays in primary dorsal fin 9 9 9 9 9 9 9 9 9 9 9 9

185 10 Number of rays in secondary dorsal fin 14 14 14 14 14 14 14 14 14 14 14 14

11 Number of rays in caudal fin 19 19 19 19 19 19 19 19 19 19 19 19

185 12 Number of rays in right pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13

13 Number of rays in left pectoral fin 13 13 13 13 13 13 13 13 13 13 13 13

14 Number of rays in right pelvic fin 6 6 6 6 6 6 6 6 6 6 6 6 15 Number of rays in left pelvic fin 6 6 6 6 6 6 6 6 6 6 6 6 16 Number of rays in anal fin 10 10 10 10 10 10 10 10 10 10 10 10

Appendix J continued. Meristic characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 26 27 28 28 30 31 32 33 34 1 Number of scales in lateral series 43 49 44 49 53 47 48 45 47 2 Scales below lateral line 7 7 7 6 7 7 6 7 7 3 Scales above lateral line 6 5 6 6 6 4 4 5 6 4 Scales on side of caudal peduncle 5 6 7 5 5 6 7 5 6 5 Scales around caudal peduncle 13 12 14 15 14 16 15 15 15 6 Scales before dorsal fin 10 10 11 11 11 10 9 8 9 7 Cheek scales 5 4 5 5 3 4 4 4 5 8 Circumference scale 25 25 28 26 27 28 26 34 28 9 Number of rays in primary dorsal fin 9 9 9 9 9 9 9 9 9

186 10 Number of rays in secondary dorsal fin 14 14 14 14 14 14 14 14 14

11 Number of rays in caudal fin 19 19 19 19 19 19 19 19 19 186 12 Number of rays in right pectoral fin 13 13 13 13 13 13 13 13 13

13 Number of rays in left pectoral fin 13 13 13 13 13 13 13 13 13 14 Number of rays in right pelvic fin 6 6 6 6 6 6 6 6 6 15 Number of rays in left pelvic fin 6 6 6 6 6 6 6 6 6 16 Number of rays in anal fin 10 10 10 10 10 10 10 10 10

Appendix K. Meristic characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 Number of scales in lateral series 57 66 67 63 63 55 60 66 62 53 66 65 53 63 55 2 Scales below lateral line 11 10 10 13 11 12 10 9 8 7 7 7 7 10 11 3 Scales above lateral line 11 14 11 10 9 7 11 10 10 10 11 10 9 11 11 4 Scales on side of caudal peduncle 9 6 9 8 7 6 7 8 7 7 7 7 6 9 9 5 Scales around caudal peduncle 21 14 17 14 16 12 10 17 16 12 15 11 13 17 14 6 Scales before dorsal fin 31 25 27 27 24 29 24 30 29 30 39 31 35 24 30 7 Circumference scale 32 24 38 44 45 36 37 23 35 36 40 38 41 44 45 8 Number of rays in primary dorsal fin 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 9 Number of rays in caudal fin 19 19 19 19 19 19 19 19 19 19 19 19 19 19 19

187 10 Number of rays in right pectoral fin 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11

11 Number of rays in left pectoral fin 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 187 12 Number of rays in right pelvic fin 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10

13 Number of rays in left pelvic fin 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 14 Number of rays in anal fin 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8

Appendix K continued. Meristic characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 16 17 18 19 20 21 22 23 24 1 Number of scales in lateral series 60 62 53 66 62 54 60 61 62 2 Scales below lateral line 12 11 11 10 11 10 11 11 12 3 Scales above lateral line 11 10 11 11 10 10 10 9 9 4 Scales on side of caudal peduncle 7 7 9 9 9 7 7 7 9 5 Scales around caudal peduncle 16 12 10 10 10 11 11 14 12 6 Scales before dorsal fin 29 29 29 25 25 25 24 25 30 7 Circumference scale 39 35 36 40 38 38 38 40 39 8 Number of rays in primary dorsal fin 13 13 13 13 13 13 13 13 13 9 Number of rays in caudal fin 19 19 19 19 19 19 19 19 19 10 Number of rays in right pectoral fin 11 11 11 11 11 11 11 11 11

188

11 Number of rays in left pectoral fin 11 11 11 11 11 11 11 11 11

188 12 Number of rays in right pelvic fin 10 10 10 10 10 10 10 10 10

13 Number of rays in left pelvic fin 10 10 10 10 10 10 10 10 10

14 Number of rays in anal fin 8 8 8 8 8 8 8 8 8

Appendix L. Meristic characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 Number of scales in lateral series 63 54 48 55 51 51 55 55 53 57 58 59 59 57 57 2 Scales below lateral line 6 7 6 7 9 8 8 5 8 7 6 6 5 7 6 3 Scales above lateral line 12 8 8 7 11 8 8 14 11 12 11 10 8 11 7 4 Scales on side of caudal peduncle 10 5 6 7 8 8 6 6 7 8 7 6 5 6 5 5 Scales around caudal peduncle 18 10 13 13 15 14 11 15 13 15 10 11 11 5 13 6 Scales before dorsal fin 44 23 25 35 27 27 21 22 29 27 26 25 24 24 32 7 Circumference scale 52 49 47 54 38 40 37 47 46 47 46 45 44 48 44 8 Number of rays in primary dorsal fin 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 9 Number of rays in caudal fin 19 19 19 19 19 19 19 19 19 19 19 19 19 19 19

189 10 Number of rays in right pectoral fin 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11

11 Number of rays in left pectoral fin 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 189 12 Number of rays in right pelvic fin 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10

13 Number of rays in left pelvic fin 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10

14 Number of rays in anal fin 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8

Appendix L continued. Meristic characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 16 17 18 19 20 21 22 23 1 Number of scales in lateral series 54 57 55 58 54 58 57 60 2 Scales below lateral line 7 7 7 7 7 8 7 6 3 Scales above lateral line 11 10 8 10 11 10 10 7 4 Scales on side of caudal peduncle 7 6 8 6 6 7 7 7 5 Scales around caudal peduncle 11 14 15 14 12 13 15 12 6 Scales before dorsal fin 27 25 23 25 26 27 25 24 7 Circumference scale 48 50 45 48 50 42 39 43 8 Number of rays in primary dorsal fin 13 13 13 13 13 13 13 13

190 9 Number of rays in caudal fin 19 19 19 19 19 19 19 19

10 Number of rays in right pectoral fin 11 11 11 11 11 11 11 11

190 11 Number of rays in left pectoral fin 11 11 11 11 11 11 11 11

12 Number of rays in right pelvic fin 10 10 10 10 10 10 10 10

13 Number of rays in left pelvic fin 10 10 10 10 10 10 10 10 14 Number of rays in anal fin 8 8 8 8 8 8 8 8

Appendix M. Osteologic characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 Epipleural rib 20 19 19 19 19 20 20 20 20 19 19 19 19 19 19 2 Caudal Vetebrae 19 20 20 20 20 20 20 20 20 20 20 20 20 20 20 3 Anal fin pterygiophore 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 4 Procurrent rays - dorsal 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 5 Procurrent rays- ventral 10 10 9 10 10 10 10 10 10 10 10 10 10 10 10 6 Hypural 7 7 7 6 7 6 6 6 6 6 6 6 6 6 7 7 Epural 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 8 Neural Spine 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25

191

Appendix M continued. Osteologic characters for Blacknose Dace, Davis Brook at Bronx River, NY.

Measurements in cm 16 17 18 19 20 21 22 23 24 25 26 27 28 1 Epipleural rib 19 19 20 20 20 20 20 20 20 20 20 20 20 2 Caudal Vetebrae 20 20 20 20 20 20 20 20 20 20 20 20 20 3 Anal fin pterygiophore 9 9 9 9 9 9 9 9 9 9 9 9 9 4 Procurrent rays - dorsal 11 11 11 11 11 11 11 11 11 11 11 11 11 5 Procurrent rays- ventral 10 10 10 10 10 9 9 10 10 10 10 9 9 6 Hypural 7 7 6 6 6 6 6 6 6 6 6 7 6 7 Epural 1 1 1 1 1 1 1 1 1 1 1 1 1 8 Neural Spine 25 25 25 25 25 25 25 25 25 25 25 25 25

192

Appendix N. Osteologic characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 Epipleural rib 20 19 19 20 19 20 19 20 20 20 20 20 20 20 20 2 Caudal Vetebrae 19 19 19 19 19 19 19 19 19 19 19 19 19 19 19 3 Anal fin pterygiophore 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 4 Procurrent rays - dorsal 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 5 Procurrent rays- ventral 10 9 10 10 10 10 10 10 10 10 10 10 10 10 10 6 Hypural 6 6 6 7 6 6 6 6 6 6 6 6 6 6 6 7 Epural 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 8 Neural Spine 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25

193

Appendix N continued. Osteologic characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 1 Epipleural rib 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 2 Caudal Vetebrae 19 19 19 19 19 19 19 19 19 19 19 19 19 19 19 3 Anal fin pterygiophore 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 4 Procurrent rays - dorsal 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 5 Procurrent rays- ventral 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 6 Hypural 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 7 Epural 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 8 Neural Spine 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25

194

Appendix N continued. Osteologic characters for Blacknose Dace, Chappaqua at Saw Mill River, NY.

Measurements in cm 31 32 33 34 35 36 37 38 1 Epipleural rib 20 20 20 20 20 20 20 20 2 Caudal Vetebrae 19 19 19 19 19 19 19 19 3 Anal fin pterygiophore 9 9 9 9 9 9 9 9 4 Procurrent rays - dorsal 11 11 11 11 11 11 11 11 5 Procurrent rays- ventral 9 10 10 10 10 10 10 10 6 Hypural 6 6 6 6 6 6 6 6 7 Epural 1 1 1 1 1 1 1 1 8 Neural Spine 25 25 25 25 25 25 25 25

195

Appendix O. Osteologic characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 Epipleural rib 18 18 18 18 18 18 18 18 18 18 18 18 18 18 18 2 Caudal Vetebrae 18 18 18 18 18 18 18 18 18 18 18 18 18 18 18 3 Anal fin pterygiophore 11 10 10 10 10 10 10 10 10 10 10 10 10 10 10 4 Procurrent rays - dorsal 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 5 Procurrent rays- ventral 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 6 Hypural 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 7 Epural 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 8 Neural Spine 33 33 33 34 33 33 33 33 33 33 33 33 33 33 33

196

Appendix O continued. Osteologic characters for Tessellated Darter, Davis Brook at Bronx River, NY.

Measurements in cm 16 17 18 19 20 21 22 23 24 25 1 Epipleural rib 18 18 18 18 18 18 18 18 18 18 2 Caudal Vetebrae 18 18 18 18 18 18 18 18 18 18 3 Anal fin pterygiophore 10 10 10 10 10 10 10 10 10 10 4 Procurrent rays - dorsal 10 10 10 10 10 10 10 10 10 10 5 Procurrent rays- ventral 11 11 11 11 11 11 11 11 11 11 6 Hypural 3 3 3 3 3 3 3 3 3 3 7 Epural 2 2 2 2 2 2 2 2 2 2 8 Neural Spine 33 33 33 33 33 33 33 33 33 33

197

Appendix P. Osteologic characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 Epipleural rib 18 15 17 18 18 17 17 17 18 18 18 18 17 18 17 2 Caudal Vetebrae 18 18 18 18 18 18 18 18 18 18 18 18 18 18 18 3 Anal fin pterygiophore 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 4 Procurrent rays - dorsal 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 5 Procurrent rays- ventral 9 10 10 9 10 10 10 10 10 10 10 10 10 10 10 6 Hypural 3 3 2 4 3 3 3 3 3 3 3 3 3 3 3 7 Epural 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 8 Neural Spine 34 33 33 33 33 34 33 33 33 33 33 33 33 33 33

198

Appendix P continued. Osteologic characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 1 Epipleural rib 17 18 18 18 18 17 17 17 17 17 18 18 18 18 18 2 Caudal Vetebrae 18 18 18 18 18 18 18 18 18 18 18 18 18 18 18 3 Anal fin pterygiophore 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 4 Procurrent rays - dorsal 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 5 Procurrent rays- ventral 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 6 Hypural 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 7 Epural 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 8 Neural Spine 33 33 33 33 34 33 33 33 33 33 33 33 33 33 33

199

Appendix P continued. Osteologic characters for Tessellated Darter, Chappaqua at Saw Mill River, NY.

Measurements in cm 31 32 33 34 1 Epipleural rib 18 17 17 17 2 Caudal Vetebrae 18 18 18 18 3 Anal fin pterygiophore 10 10 10 10 4 Procurrent rays - dorsal 11 11 11 11 5 Procurrent rays- ventral 10 10 10 10 6 Hypural 3 3 3 3 7 Epural 2 2 2 2 8 Neural Spine 33 33 33 33

200

Appendix Q. Osteologic characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 Epipleural rib 19 19 19 19 19 19 19 19 19 19 19 19 19 19 19 2 Caudal Vetebrae 21 21 21 21 21 21 21 21 21 21 21 21 21 21 21 3 Anal fin pterygiophore 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 4 Procurrent rays - dorsal 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 5 Procurrent rays- ventral 7 8 8 8 8 8 7 8 8 8 8 8 8 8 8 6 Hypural 7 6 6 6 6 7 7 7 6 7 7 6 6 6 6 7 Epural 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 8 Neural Spine 42 42 42 42 42 42 42 42 42 42 42 42 42 42 42

201

Appendix Q continued. Osteologic characters for White Sucker, Davis Brook at Bronx River, NY.

Measurements in cm 16 17 18 19 20 21 22 23 1 Epipleural rib 19 19 19 19 19 19 19 19 2 Caudal Vetebrae 21 21 21 21 21 21 21 21 3 Anal fin pterygiophore 9 9 9 9 9 9 9 9 4 Procurrent rays - dorsal 9 9 9 9 9 9 9 9 5 Procurrent rays- ventral 8 8 8 8 8 8 8 8 6 Hypural 6 7 6 6 7 7 6 6 7 Epural 1 1 1 1 1 1 1 1 8 Neural Spine 42 42 42 42 42 42 42 42

202

Appendix R. Osteologic characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 Epipleural rib 19 19 19 19 19 19 19 19 19 19 19 19 19 19 19 2 Caudal Vetebrae 21 21 21 21 21 21 21 21 21 21 21 21 21 21 21 3 Anal fin pterygiophore 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 4 Procurrent rays - dorsal 10 9 10 10 10 10 10 10 10 10 10 10 10 10 10 5 Procurrent rays- ventral 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 Hypural 6 6 6 6 6 6 6 6 5 6 5 6 7 6 6 7 Epural 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 8 Neural Spine 42 42 42 42 42 42 42 42 42 42 42 42 42 42 42

203

Appendix R continued. Osteologic characters for White Sucker, Chappaqua at Saw Mill River, NY.

Measurements in cm 16 17 18 19 20 21 22 23 24 1 Epipleural rib 19 19 19 19 19 19 19 19 19 2 Caudal Vetebrae 21 21 21 21 21 21 21 21 21 3 Anal fin pterygiophore 9 9 9 9 9 9 9 9 9 4 Procurrent rays - dorsal 10 10 10 10 10 10 10 10 10 5 Procurrent rays- ventral 6 6 6 6 6 6 6 6 6 6 Hypural 6 6 6 6 6 6 6 6 6 7 Epural 1 1 1 1 1 1 1 1 1 8 Neural Spine 42 42 42 42 42 42 42 42 42

204

Appendix S. Arlequin Data Input File for the Blacknose Dace

[Profile]

Title="mtDNA sequences in Shortnose"

#Data from : #Graven, L., Passarino, G., Semino, O., Boursot, P., Santachiara-Benerecetti, A. S., #Langaney, A., and Excoffier, L., 1995, Evolutionary correlation between #control region sequence and RFLP diversity pattern in the mitochondrial genome #of a Senegalese sample, Mol. Biol. Evol. 12(2):334-345

NbSamples=2

GenotypicData=0 DataType=DNA

LocusSeparator=NONE MissingData='?'

[Data]

[[Samples]] SampleName="bronxriver" SampleSize=30 SampleData= { rabr13 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTTTGTCCCTGATTT CTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAATAT GGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTAGG GGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGCGT ATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGATAA TACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGCGT TAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATATA GGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG rabr15 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGATTT CTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAATAT GGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTAGG GGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGCGT ATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGATAA TACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGCGT TAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATATA GGTTACTTTCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG

205

rabr18 1 ACCAGATGCCAGGAATAGTTCACAGTGTGC- ACCCCCACATATTGTGTCCCTGTATTCTATCATGCATGATATGCCTTATATGACCCGG TTGGTGGTCTCTTACTACATTAATATGGTTACGTTAAACCTTAGGTGGTGATTTCAAG GAAAGTGTTGAGTGCCATATCTAGGGGAAAAACCTAGTTCCCAGGTTAAAATAAAT TATTTGTGAGTTTTAATGATTAGCGTATGTACGTCTTAGACGTTAGTACTTGCTTTTG GGTTAAGATAAATGAATGGTGATAATACATATATATGCACTAACACAACACACAAT ATTACAAAGAATATTATGTGTTGCGTTAGACCATATATAAGTACTGTACACATGTAA TACTATACACGGTACCGAACCATATAGGTTACTATCAGAAGATAGTTTAATTTAGAA TTCTGGCTTTGGGAGCTAGGGG rabr19 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGTATT CTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAATAT GGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCGTATCTAGG GGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGCGT ATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGATAA

TACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGCGT TAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATATA GGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG rabr17 1 ACCAGATGCCAGGAATAGTTCACAGTGTGC- ACCCCCACATATTGTGTCCCTGTATTCTATCATGCATGATATGCCTTATATGACCCGG TTGGTGGTCTCTTACTACATTAATATGGTTACGTTAAACCTTAGGTGGTGATTTCAAG GAAAGTGTTGAGTGCCATATCTAGGGGAAAAACCTAGTTCCCAGGTTAAAATAAAT TATTTGTGAGTTTTAATGATTAGCGTATGTACGTCTTAGACGTTAGTACTTGCTTTTG GGTTAAGATAAATGAATGGTGATAATACATATATATGCACTAACACAACACACAAT ATTACAAAGAATATTATGTGTTGCGTTAGACCATATATAAGTACTGTACACATGTAA TACTATACACGGTACCGAACCATATAGGTTACTATCAGAAGATAGTTTAATTTAGAA TTCTGGCTTTGGGAGCTAGGGG rabr19 19 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGTATT CTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAATAT GGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCGTATCTAGG GGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGCGT ATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGATAA TACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGCGT TAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATATA GGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG

rabr28 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGA- TTCTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAAT ATGGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTA

206

GGGGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGC GTATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGAT AATACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGC GTTAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATA TAGGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG rabr22 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGA- TTCTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAAT ATGGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTA GGGGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGC GTATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGAT AATACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGC GTTAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATA TAGGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG

rabr24 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGA- TTCTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAAT ATGGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTA GGGGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGC GTATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGAT AATACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGC GTTAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATA TAGGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG rabr43 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCATGTATTGTGTCCCTGA- TTCTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTTTTACTACATTAAT ATGGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTA GGGGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGC GTATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGAT AATACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGC GTTAGACCATATATAATTACTGTACACATGTAATACTATACACGGTACCGAACCATA TAGGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG rabr29 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGA- TTC- ATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAATATGG TTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTAGGGG AAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGCGTAT GTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGATAATA CATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGCGTTA GACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATATAGG TTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG

207

rabr30 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGA- TTTTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAAT ATGGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTA GGGGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGC GTATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGAT AATACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGC GTTAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATA TAGGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG } SampleName="sawmillriver" SampleSize=21 SampleData= { rasm3 14 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGA- TTCTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAAT

ATGGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTA GGGGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGC GTATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGAT AATACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGC GTTAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATA TAGGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG rasm4 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGA- TTCTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAAT ATGGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTA GGGGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGT GTATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGAT AATACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGC GTTAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATA TAGGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG rasm10 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGA- TTCTATCATGCATGATATACCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAAT ATGGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTA GGGGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGC GTATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGAT AATACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGC GTTAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATA TAGGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG rasm16 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGA- TTCTATCATGCATGATATGCCTTATATGATCCGGTTGGTGGTCTCTTACTACATTAAT ATGGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTA

208

GGGGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGC GTATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGAT AATACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGC GTTAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATA TAGGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG rasm13 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGA- TTCTATCATGCATGATATGCCTTATATGATCCGGTTGGTGGTCTCTTACTACATTAAT ATGGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTA GGGGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATAAGC GTATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGAT AATACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGC GTTAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATA TAGGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG

rasm30 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGA- TTTTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAAT ATGGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTA GGGGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGC GTATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGAT AATACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGC GTTAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATA TAGGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG rasm14 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATATTGTGTCCCTGA- TTCTATCATGCATGATATGCCTTATATG- CCCGGTTGGTGGTCTCTTACTACATTAATATGGTTACGTTAAACCTTAGGTGGTGATT TCAAGGAAAGTGTTGAGTGCCATATCTAGGGGAAAAACCTAGTTCCCAGGTTAAAA TAAATTATTTGTGAGTTTTAATGATTAGCGTATGTACGTCTTAGACGTTAGTACTTGC TTTTGGGTTAAGATAAATGAATGGTGATAATACATATATATGCACTAACACAACACA CAATATTACAAAGAATATTATGTGTTGCGTTAGACCATATATAAGTACTGTACACAT GTAATACTATACACGGTACCGAACCATATAGGTTACTATCAGAAGATAGTTTAATTT AGAATTCTGGCTTTGGGAGCTAGGGG rasm23 1 ACCAGATGCCAGGAATAGTTCACAGTGTGCGACCCCCACATAT-GTGTCCCTGA- TTCTATCATGCATGATATGCCTTATATGACCCGGTTGGTGGTCTCTTACTACATTAAT ATGGTTACGTTAAACCTTAGGTGGTGATTTCAAGGAAAGTGTTGAGTGCCATATCTA GGGGAAAAACCTAGTTCCCAGGTTAAAATAAATTATTTGTGAGTTTTAATGATTAGC GTATGTACGTCTTAGACGTTAGTACTTGCTTTTGGGTTAAGATAAATGAATGGTGAT AATACATATATATGCACTAACACAACACACAATATTACAAAGAATATTATGTGTTGC GTTAGACCATATATAAGTACTGTACACATGTAATACTATACACGGTACCGAACCATA TAGGTTACTATCAGAAGATAGTTTAATTTAGAATTCTGGCTTTGGGAGCTAGGGG

209

} [[Structure]] StructureName="2 groups" NbGroups=2 Group={ "bronxriver" } Group ={ "sawmillriver"}

210

Appendix T. Arlequin Data Input File for the Tessellated Darter

[Profile]

Title="mtDNA sequences in Shortnose"

NbSamples=2

GenotypicData=0 DataType=DNA

LocusSeparator=NONE MissingData='?'

[Data]

[[Samples]] SampleName="bronxriver" SampleSize=15 SampleData= { eobr5 1

TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTTTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGAGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCAATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG

211

eobr10 1 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTTTTACCTTTACAAAGAAACATGAAAATTTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT

TT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGAGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCAATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG eobr8 1 TAGGCCTTTCCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGAGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCAATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG

eobr8b 1 TAGGCCTTTGCTTAT- TACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATACCGCCGATATTGCCAC AGCTTTTTCATCTGTTGCTC

212

ACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATATTCATGCCAACGGCG CATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGGCCTGTACTACGGGTC TTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCTCCTATTAGTGATAAT GACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATCATTCTGAGGTGCCAC AGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAATACCCTTGTTCAATGA ATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGGTTCTTCGCTTTTCACT TCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCTTCTTTTCCTTCATGA AACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGACAAAGTAACATTCCA CCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCCTTATTGCTCTAACA GCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACAACTTCACTCCAGCA AATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATTTT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGAGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCAATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG

eobr7 1 TAGGCCTTTGCTTAATTACCCAA- TCCTCACCGGACTCTTCTTAGCCATACATTATACCGCCGATATTGCCACAGCTTTTTC ATCTGTTGCTCACATTTGC CGAGATGTGAACTACGGGTGGCTTATCCGTAATATTCATGCCAACGGCGCATCCTTT TTCTTCATCTGCATTTACCTGCACATTGGACGAGGCCTGTACTACGGGTCTTACCTTT ACAAAGAAACATGAAATATTGGGGTAGTTCTCCTCCTATTAGTGATAATGACCGCCT TTGTGGGGTATGTTCTCCCCTGGGGACAGATATCATTCTGAGGTGCCACAGTCATTA CCAATCTTCTATCTGCAGTACCTTACATTGGTAATACCCTTGTTCAATGAATTTGAGG GGGCTTCTCCGTAGATAACGCCACCCTCACACGGTTCTTCGCTTTTCACTTCCTATTT CCCTTCGTAATTGCAGGGGCCACCCTCATCCACCTTCTTTTCCTTCATGAAACGGGCT CAAATAATCCCCTTGGCTTAAACTCCGACGCTGACAAAGTAACATTCCACCCCTATT TCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCCTTATTGCTCTAACAGCCCTTGC CCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACAACTTCACTCCAGCAAATCCGCT AGTGACACCGCCCCATATTAAACCTGAGTGATATTTT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGAGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCAATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGAcGT TGCCATCCTCAcCTGAATTGGAGGAATGCCCG eobr6 2 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC

213

AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGGGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG

eobr14 2 TAGGCCTTTGCTTA- TTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATACCGCCGATATTGCCAC AGCTTTTTCATCTGTTGCT CACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATATTCATGCCAACGGC GCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGGCCTGTACTACGGGT CTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCTCCTATTAGTGATAA

TGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATCATTCTGAGGTGCCA CAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAATACCCTTGTTCAATG AATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGGTTCTTCGCTTTTCAC TTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCTTCTTTTCCTTCATGA AACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGACAAAGTAACATTCCA CCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCCTTATTGCTCTAACA GCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACAACTTCACTCCAGCA AATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATTTT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGGGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG eobr13 2 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGGGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATCAAAACAGC

214

GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG eobr26 4 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA

ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TTTCTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGGGTTTTGG CCTTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATCAAAACA GCGAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGAC GTTGCCATCCTCACCTGAATTGGAGGAATGCCCG } SampleName="sawmillriver" SampleSize=17 SampleData= { eosm12 1 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TTTCTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGGGTTTTGG CCTTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATCAAAACA GCGAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGAC GTTGCCATCCTCACCTGAATTGGAGGAATGCCCG eosm13 1 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC

215

CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATGACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TTTCTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGGGTTTTGG CCTTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATCAAAACA GCGAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGAC GTTGCCATCCTCACCTGAATTGGAGGAATGCCCG

eosm14 1 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TTTCTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGGGTTTTGG CCTTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATCAAAACA GCGAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGAC GTTGCCATCCTCACCTGAATTGGAGGAATGCCCG eosm15 1 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG

216

TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGGATTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCAATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG eosm16 3 TAGGCCTTTGCTTA- TTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATACCGCCGATATTGCCAC AGCTTTTTCATCTGTTGCT CACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATATTCATGCCAACGGC GCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGGCCTGTACTACGGGT

CTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCTCCTATTAGTGATAA TGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATCATTCTGAGGTGCCA CAGTCATTACCAATCTTCTATCTGCAGTACCTTATATTGGTAATACCCTTGTTCAATG AATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGGTTCTTCGCTTTTCAC TTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCTTCTTTTCCTTCATGA AACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGACAAAGTAACATTCCA CCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCCTTATTGCTCTAACA GCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACAACTTCACTCCAGCA AATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATTTT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGG- TTTTGGCCTTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATC AAAACAGCGAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATC GCAGACGTTGCCATCCTCACCTGAATTGGAGGAATGCCCG

eosm27 1 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TT-

217

CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGGGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG eosm22 2 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC

AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAATTAGGGGGGGTTTTGGCCT TACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG

eosm21 1 TAGGCCTTTGCTTA- TTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATACCGCCGATATTGCCAC AGCTTTTTCATCTGTTGCT CACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATATTCATGCCAACGGC GCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGGCCTGTACTACGGGT CTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCTCCTATTAGTGATAA TGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATCATTCTGAGGTGCCA CAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAATACCCTTGTTCAATG AATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGGTTCTTCGCTTTTCAC TTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCTTCTTTTCCTTCATGA AACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGACAAAGTAACATTCCA CCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCCTTATTGCTCTAACA GCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACAACTTCACTCCAGCA AATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATTTT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGAGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCAATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG

218

eosm23 1 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTATATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGGGTTTTGGCC

TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG

eosm20 1 TAGGCCTTTGCTTA- TTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATACCGCCGATATTGCCAC AGCTTTTTCATCTGTTGCT CACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATATTCATGCCAACGGC GCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGGCCTGTACTACGGGT CTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCTCCTATTAGTGATAA TGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATCATTCTGAGGTGCCA CAGTCATTACCAATCTTCTATCTGCAGTACCTTATATTGGTAATACCCTTGTTCAATG AATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGGTTCTTCGCTTTTCAC TTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCTTCTTTTCCTTCATGA AACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGACAAAGTAACATTCCA CCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCCTTATTGCTCTAACA GCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACAACTTCACTCCAGCA AATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATTTT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGGGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG eosm24 1 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT

219

CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGGGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCGATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGACGT TGCCATCCTCACCTGAATTGGAGGAATGCCCG eosm25 1 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC

CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATAACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC AAAGTAACATTCCACCCCTATTTCTCCTATAAAGATCTCCTGGGCTTTGCCGTGCTCC TTATTGCTCTAACAGCCCTTGCCCTCTTCTCCCCAAATCTCCTAGGAGACCCGGACA ACTTCACTCCAGCAAATCCGCTAGTGACACCGCCCCATATTAAACCTGAGTGATATT TT- CTCTTTGCCTACGCAATTCTACGCTCCATTCCGAACAAACTAGGGGGAGTTTTGGCC TTACTGGCCTCAATTCTAGTCCTAATAGTAGTCCCAATTCTTCATACATCAAAACAGC GAGGAATCACATTTCGCCCTCTCTCCCAATTCCTCTTCTGGACTTTAATCGCAGAcGT TGCCATCCTCAcCTGAATTGGAGGAATGCCCG

eosm26 1 TAGGCCTTTGCTTAATTACCCAAATCCTCACCGGACTCTTCTTAGCCATACATTATAC CGCCGATATTGCCACAGCT TTTTCATCTGTTGCTCACATTTGCCGAGATGTGAACTACGGGTGGCTTATCCGTAATA TTCATGCCAACGGCGCATCCTTTTTCTTCATCTGCATTTACCTGCACATTGGACGAGG CCTGTACTACGGGTCTTACCTTTACAAAGAAACATGAAATATTGGGGTAGTTCTCCT CCTATTAGTGATAATGACCGCCTTTGTGGGGTATGTTCTCCCCTGGGGACAGATATC ATTCTGAGGTGCCACAGTCATTACCAATCTTCTATCTGCAGTACCTTACATTGGTAAT ACCCTTGTTCAATGAATTTGAGGGGGCTTCTCCGTAGATGACGCCACCCTCACACGG TTCTTCGCTTTTCACTTCCTATTTCCCTTCGTAATTGCAGGGGCCACCCTCATCCACCT TCTTTTCCTTCATGAAACGGGCTCAAATAATCCCCTTGGCTTAAACTCCGACGCTGAC

220

"sawmillriver" } Appendix U. Arlequin Data Input File for the White Sucker

[Profile] Title="mtDNA sequences in Shortnose"

NbSamples=2

GenotypicData=0 DataType=DNA LocusSeparator=NONE MissingData='?'

[Data]

221

Appendix U. Data Input File for the White Sucker

[[Samples]] SampleName="bronxriver" SampleSize=17 SampleData= { ccbr1 3 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC ACACGCGCACCGAGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA

CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATTATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAGTATTTCTGAGCTTAAATATACGCTGGTGTAGCTTATATAG ccbr4 2 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC ACACGCGCACCGAGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATTATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAGTATTTCTGAGCTTAAATATACGCTGGTGTAGCTTATATAG

222

ccbr18 2 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTTTGCCCATGCGCTGCCCC ACACGCGCACCGAGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATTATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGCTGTAGTTAGTGT

TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAATATTTCTGAGCTTAAATATACGCTGGTGTAGCTGGTGTAG

ccbr19 1 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC ACACGCGCACCGAGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATTATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAATATTTCTGAGCTTAAATATACGCTGGTGTAGCTGGTGTAG ccbr7 1 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC ACACGCGCACCGGGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAAATTAAACTCAGGATAAAATCCAACG

223

AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATGATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAATATTTCTGAGCTTAAATATACGCTGGTGTAGCTGGTGTAG ccbr13 1

CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC ACACGCGCACCGGGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATGATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAATATTTCTGAGCTTAAATATACGCTGGTGTAGCTGGTGTAG ccbr12 4 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTTTGCCCATGCGCTGCCCC ACACGCGCACCGGGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT

224

GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATGATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAATATTTCTGAGCTTAAATATACGCTGGTGTAGCTGGTGTAG ccbr16 3 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC ACACGCGCACCGGGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA

AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATGATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAATATTTCTGAGCTTAAATATACGCTGGTGTAGCTGGTGTAG } SampleName="sawmillriver" SampleSize=20 SampleData= { ccsm12 14 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC ACACGCGCACCGGGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATGATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT

225

TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAATATTTCTGAGCTTAAATATACGCTGGTGTAGCTGGTGTAG ccsm26 1 CCTGCCCCCAAAGACAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC ACACGCGCACCGGGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA

CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATGATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAATATTTCTGAGCTTAAATATACGCTGGTGTAGCTGGTGTAG ccsm3 1 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC ACACGCGCACCGAGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATTATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAGTATTTCTGAGCTTAAATATACGCTGGTGTAGCTGGTGTAG

226

ccsm19 1 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC ACACGCGCACTGAGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATTATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT

TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAGTATTTCTGAGCTTAAATATACGCTGGTGTAGCTGGTGTAG ccsm20 1 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC ACACGCGCACCGAGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATTATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAGTATTTCTGAGCTTAAATATACGCTAGTGTAGCTGGTGTAG ccsm4 1 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC ACACGCGCACCGAGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA

227

TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATTATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCCGGAATAC TAATATTTCTGAGCTTAAATATACGCTGGTGTAGCTGGTGTAG ccsm15 1 CCTGCCCCCAAAGCCAGAATTCTAAAACTAAACTATTTTCTGCCCATGCGCTGCCCC

ACACGCGCACCGAGCTGCCGGTATGGTTTAGTACATAATATGCATAATATTACATTA ATGCATTAGTACATTAATGTATAATCACCAAGTAACTATATGGACCATAAAGCAAGT ACTAAATTCTAAGGTATACATAAGCATAAAATTAAAACTCAGGATAAAATCCAACG AAACTGGAACGGCGAATAATCAGTATATTATCCATTTAAAATTCTCCCTCGCAGAGA TCAACTAAGATTTTCAGAGAGATAATTAATGTAGTAAGAAACCACCAACCAGTATA AATAATTGCATAATATTAATGATAGGTCAGGGACAATGATTGTGGGGGTTGCACATG GTGAACTATTACTGGCATCTGGTTCCTATTTCAGGTACATAACTGTAGAATCCCACC CTCGGATAATTATACTGGCATCTGATTAATGGTGGAGTACATATGTCTCGTTACCCA CCTAGCCGAGCATTCTCTTATATGCATAACGTTCTCTTTTTTTGGTTGCCTTTCACTTT GCATCTCACAGTGCAGGCTCAAAGCAAATTCAAGGTAGTTCATTTAGACCTGGCATA AATAATATAGGTTAATTATTGAAAGTCATTACTTAAGAATTACATAACTTTAATTCA AGTGCATAAGCTATCCATTACTTGATCCAATATTACAGTTATACCCCCTTTTGTTTTT TGCGCGACAAACCCCCTTACCCCCTACGCCCAGCGAATCCGGTTATTCTTGTCAAAC CCCAAAAGCAAGAAAGATCCGACGGACGTATCAAGTCAACGAGTTGTAGTTAGTGT TGACTATGCCCACCACGTATTATATATATAACATATATAAATTTATTTCCTGAATTAA AAATGTTGATTAGCTCAAAACCCACGACTAAAAATTGCAAAAATATGCACGGAATA CTAGTATTTCTGAGCTTAAATTACGCTGGTGTAGCTGGTGTAG } [[Structure]] StructureName="2 groups" NbGroups=2 Group={ "bronxriver" } Group ={ "sawmillriver" }

228

229