AMBER CODON TRANSLATION AS PYRROLYSINE IN METHANOSARCINA SPP.

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree of Doctor of

Philosophy in the Graduate School of The Ohio State University

By

Sherry Kathleen Blight, B.S. *****

The Ohio State University 2006

Dissertation Committee: Approved by

Dr. Joseph A. Krzycki, Adviser Dr. Charles J. Daniels

Dr. Kurt L. Fredrick Adviser Dr. Tina M. Henkin Graduate Program in Microbiology

ABSTRACT

The genes encoding the methylamine methyltransferases in Methanosarcina spp.

each have an in-frame amber stop codon that is translated as pyrrolysine. This

dissertation deals with various aspects of how this genetic encoding takes place.

PylS is an aminoacyl-tRNA synthetase and Chapter 2 demonstrates that it is in

fact a pyrrolysyl-tRNA synthetase. The pylS gene was cloned and its protein product was

purified. Both in vitro and in vivo experiments have subsequently shown that PylS has the ability to directly charge its cognate tRNA, tRNAPyl, with free pyrrolysine. PylS

ligated only pyrrolysine to tRNAPyl, even when incubated with the twenty canonical

amino acids, demonstrating its specificity for pyrrolysine. In addition, no charging was

apparent when PylS was incubated with pyrrolysine in the presence of either of the two

lysyl-tRNA species, demonstrating that PylS is specific for tRNAPyl. The two lysyl-tRNA

synthetases found in M. acetivorans, LysS and LysK, were tested for their ability to charge tRNAPyl with pyrrolysine, and when incubated either separately or in combination,

none was detectable. Also, these lysyl-tRNA synthetases did not demonstrate an ability

to charge tRNAPyl with lysine. Therefore, the PylS/tRNAPyl pairing is the first example

of a naturally occurring aminoacyl-tRNA synthetase/tRNA pair that can insert a non- canonical amino acid into protein.

ii In Chapter 3, an in vivo approach was developed in M. acetivorans in order to test

whether a proposed 3' downstream cis-acting element, termed the PYLIS element, is

required for translation of the UAG codon. The PYLIS element was deleted from mtmB1

and this mutant gene, driven by a constitutive promoter, was introduced into M.

acetivorans on an expression vector. This strain, along with other strains bearing

directed mutations of mtmB1, still produced MtmB1 that contained pyrrolysine.

Although the amounts of MtmB1 production were lower than those seen in a strain

bearing wild-type plasmid-based mtmB1, the lower amounts indicate that the PYLIS

element may enhance, but is not essential for, UAG translation. This is the first

experimental evidence that the PYLIS element is not required for amber codon

readthrough in M. acetivorans.

In order to determine whether any cis-acting elements are absolutely required for

UAG translation, the E. coli uidA gene, encoding β-glucuronidase (GUS), was employed as a reporter of UAG translation. Integrating variations of uidA into the genome created

three different strains of M. acetivorans. One strain contained wild type uidA, and the

other two other strains contained mutants of uidA, where a lysine codon at position 286

was changed to either a TAA or a TAG codon. Translation of the uidA genes with either

TAA or TAG substitutions gave dramatically different results, with TAG serving as a

stop codon as well as a sense codon. The full-length protein was analyzed by mass

spectrometry and pyrrolysine was found at the position corresponding to the TAG codon.

The expression of UAG within a foreign gene indicates relaxed context for UAG

translation. These results, along with the results from the PYLIS element deletion study,

iii indicate that there is a high background of UAG readthrough in M. acetivorans, with a

further enhancement of UAG translation in the presence of the PYLIS element.

Finally, the Appendix will describe an attempt to develop an anaerobic in vitro

translation system for M. barkeri. This assay was originally developed in order to

determine what, if any, cis-acting elements are required for UAG translation, as well as to

establish whether additional factors may be involved in readthrough of the amber codon.

Translation initiation appeared to occur correctly on the transcripts, but completion of

translation was not observed. Although this is the first example of in vitro translation

using specific transcripts from M. barkeri, because translation termination was never

observed, no conclusions could be formed about context-dependent readthrough of the

amber codon.

This work demonstrates that the translation of UAG as pyrrolysine is different from the translation of UGA as selenocysteine. The considerable differences between the genetic encoding of selenocysteine and pyrrolysine are clearly revealed by both the presence of an aminoacyl-tRNA synthetase/tRNA pair that is cognate for pyrrolysine and

the lack of an absolute requirement for a signal that directs pyrrolysine incorporation into

protein.

iv

This work is dedicated to my wonderful husband Andrew. This never would have been accomplished without you.

v ACKNOWLEDGMENTS

I would like to thank my parents for their unconditional love and guidance over

the course of my graduate career. I give my abundant thanks to the members of my

committee, Dr. Tina Henkin, Dr. Charles Daniels and Dr. Kurt Fredrick, for all of their

helpful advice and suggestions on this project. Also, I never could have done this

without the members of the Krzycki laboratory, both past and present, who are like a second family to me. I cannot thank you enough for all the generous advice, support and friendship over the years. I especially want to thank David Longstaff and Ross Larue for their generous assistance with some of the experiments in this document. It would have been a much longer road to my Ph.D. without you. Finally, I wish to thank my adviser

Dr. Joe Krzycki, whose support, understanding, and wisdom made this possible.

vi VITA

October 21, 1977…………………………………Born, Flint, Michigan

1999………………………………………………B.S. in Microbiology, Michigan State University 1999-2005………………………………………..Graduate Teaching and Research Associate, The Ohio State University

PUBLICATIONS

1. Blight, S. K., Larue, R. C., Mahapatra, A., Longstaff, D. G., Chang, E., Zhao, G., Kang, P. T., Green-Church, K. B., Chan, M. K., and J. A. Krzycki. (2004) Direct Charging of tRNACUA with Pyrrolysine In Vitro and In Vivo. Nature. 431, 333- 335. 2. Snyder, L., Blight, S., and J. Auchtung. (2003) Regulation of Translation of the Head Protein of T4 Bacteriophage by Specific Binding of EF-Tu to a Leader Sequence. J. Mol. Biol. 334, 349-361. 3. Bingham, R., Ekunwe, S.I.N., Falk, S., Snyder, L. and C. Kleanthous. (2000) The Major Head Protein of Bacteriophage T4 Binds Specifically to Elongation Factor Tu. J. Biol. Chem. 275, 23219-23226.

FIELDS OF STUDY

Major Field: Microbiology

vii TABLE OF CONTENTS

Page Abstract………………………………………………………………………………….ii Dedication……………………………………………………………………………….v Acknowledgments………………………………………………………………………vi Vita……………………………………………………………………………………...vii List of Tables……………………………………………………………………………xi List of Figures…………………………………………………………………………...xii List of Abbreviations……………………………………………………………………xv

Chapters:

1. Introduction………………………………………………………………………1 1.1 Methanogens………………………………………………………………1 1.1.1 Introduction……………………………………………………...1 1.1.2 Methanogenesis from methanol and methylamines……………..4 1.1.3 The methylamine-specific methyltransferase genes contain an in-frame stop codon……………………………………………..7 1.2 Unusual decoding of mRNA during translation…………………………..9 1.2.1 Standard termination of translation……………………………..9 1.2.2 Reprogramming of translation: frameshifting and bypassing….13 1.2.3 Reprogramming of translation: translational redefinition……...16 1.2.4 Selenocysteine………………………………………………….18 1.2.5 Pyrrolysine……………………………………………………...23 1.3 Aminoacyl-tRNA synthetases…………………………………………….25 1.3.1 Introduction……………………………………………………..25 1.3.2 tRNA recognition by aaRS……………………………………..27 1.3.3 Discrimination of amino acids by aaRSs……………………….29 1.3.4 Indirect pathways of aminoacylation…………………………...31 1.3.5 Noncanonical aminoacyl-tRNA synthetases……………………33 1.4 Conclusions……………………………………………………………….35 1.5 Overview of this work…………………………………………………….36

viii

2. Cloning, purification and initial characterization of the pyrrolysyl-tRNA synthetase, PylS…………………………………………………………………38 2.1 Introduction……………………………………………………………….38 2.2 Materials and Methods……………………………………………………40 2.2.1 Recombinant proteins…………………………………………..40 2.2.2 PylS substrates………………………………………………….42 2.2.3 Aminoacylation and alkaline hydrolysis assays………………..44 2.3 Results…………………………………………………………………….45 2.3.1 A recombinant PylS-His6 can charge in vitro transcribed tRNACUA as well as native tRNACUA…………………………...45 2.3.2 PylS ligates only pyrrolysine on tRNACUA……………………...50 2.3.3 PylS specifically charges tRNACUA and LysS and LysK only charge tRNALys in vitro…………………………………………53 2.4 Discussion………………………………………………………………....58

3. In vivo characterization of UAG translation in Methanosarcina: role of the proposed “PYLIS” element……………………………………………………..63 3.1 Introduction……………………………………………………………….63 3.2 Materials and Methods……………………………………………………67 3.2.1 Construction of C-terminally his-tagged mtmB and PYLIS mutants………………………………………………………….67 3.2.2 Deletion of PYLIS from pDL05C………………………………69 3.2.3 Western blotting of MtmB constructs…………………………..70 3.2.4 ELISA analysis of PYLIS mutants……………………………..71 3.2.5 PCR screens of the strain containing pMetDL05C for possible chromosomal recombination………………………….71 3.2.6 Quantitative PCR……………………………………………….72 3.2.7 Construction of uidA strains for insertion into the hpt locus of M. acetivorans……………………………………………….....72 3.2.8 PCR screening and Southern blotting of uidA strains………….73 3.2.9 Isolation and activity of β-glucuronidase from M. acetivorans..74 3.2.10 Western blotting of uidA strains………………………………..74 3.2.11 Construction of pWM311-based uidA and its derivatives……...75 3.2.12 Isolation and analysis of the GUS proteins produced from pGUS 286AAA and pGUS 286TAG…………………………...76 3.3 Results…………………………………………………………………….78 3.3.1 UAG translation occurs with mtmB1 transcripts lacking the PYLIS element…………………………………………………78 3.3.2 UAG is translated as pyrrolysine in mtmB1 lacking the PYLIS element………………………………………………………….87 3.3.3 Synonymous mutations within the PYLIS element have varied but limited effects on UAG translation…………………………89

ix 3.3.4 UAG acts as an ambiguous codon within a foreign gene expressed in M. acetivorans…………………………………….96 3.4 Discussion………………………………………………………………..108

4. Conclusion……………………………………………………………………...114

Appendix A: UAG readthrough in Methanosarcina: an in vitro approach……………127 A.1 Introduction……………………………………………………………..127 A.2 Materials and Methods………………………………………………….129 A.2.1 Design and construction of vectors…………………………...129 A.2.2 Preparation of cell-free extracts……………………………….132 A.2.3 Preparation of salt-washed crude and column purified ribosomes……………………………………………………..133 A.2.4 Preparation of mRNA substrates……………………………...135 A.2.5 In vitro translation assays……………………………………..135 A.3 Results…………………………………………………………………. 137 A.3.1 In vitro translation assays work with polyuridylic acid as a substrate………………………………………………………137 A.3.2 Translation initiation occurs on methanogen-based transcripts in vitro…………………………………………………………142 A.3.3 Further attempts to increase efficiency of message completion relative to initiation……………………………………………149 A.3.4 Attempting to stabilize the transcripts had no positive effect on translation……………………………………………………..153 A.3.5 Using higher amounts of transcript resulted in higher amounts of translated product……………………………………………..158 A.4 Discussion………………………………………………………………165

List of References……………………………………………………………………...171

x LIST OF TABLES

Table Page 3.1 Summary of sequences obtained from PCR analysis of mtmB1 genes in M. acetivorans transformed with pMetDL05C bearing the modified metH/mtmB1 gene derived from M. barkeri mtmB1…………………….…………………………86

3.2 List of b- and y-ions identified in a CID spectrum of the m/z 5433+ peptide fragment ion observed in chymotryptic digests of the MetH/MtmB-His protein…...89

3.3 Strains created by mutating sense codons to TAG codons within the uidA gene in pWM311…………………………………………………………..98

3.4 Specific activities seen for each M. acetivorans strain harboring pWM311 with wild-type uidA or its derivatives…………………………………….99

3.5 Mutations found in each pWM311-based plasmid bearing uidA or its variants……………………………………………………………………………..101

3.6 Both the unmutated uidA M. acetivorans strain and the uidA-286TAG strain possess GUS activity……………………………………………………………….105

3.7 List of b- and y-ions identified in a CID spectrum of the m/z 489.42+ peptide fragment ion observed in chymotryptic digests of the GUS286TAG protein……..108

A.1 3H-phenylalanine incorporation is greater than 3H-lysine and 14C-histidine incorporation…………………………………………………….156

xi LIST OF FIGURES

Figure Page

1.1 The 16S rRNA phylogenetic tree showing the distribution of methanogens within the archaeal domain…………………………………………………….4 1.2 Protein components initiating methylamine-dependent methanogenesis……...7 1.3 The structure of pyrrolysine deduced from the crystallography of MtmB and the residue mass of the UAG-encoded residue in MtmB, MtbB and MttB…………………………………………………………………………..24 2.1 Single column purification of PylS…………………………………………...47

2.2 PylS aminoacylates a maximum of 50% of tRNACUA with pyrrolysine as determined by acid-urea gel shifts...…….………………………….………...48 2.3 Aminoacylation of in vitro transcribed tRNACUA with pyrrolysine by PylS-His6……………………………………………………………………..49

2.4 Alkaline hydrolysis of pyrrolysyl-tRNACUA formed in vitro by PylS-His6….50

2.5 Aminoacylation of tRNACUA by PylS using differing amino acid substrates..51

2.6 Aminoacylation of tRNACUA using differing enzyme preparations………….52

2.7 Aminoacylation of tRNACUA by N-terminally His-tagged PylS……………..53 2.8 Coomassie-stained 12% SDS-PAGE gel showing LysS and LysK enriched from protein extracts…………………………………………………………54 2.9 LysS or LysK, but not PylS, can aminoacylate tRNALys………………..…...56

2.10 Only charging of tRNACUA with pyrrolysine by PylS is detectable…………57

2.11 Charging of pyrrolysine or lysine onto tRNACUA by a combination of LysS and LysK is not detectable…………………………………………….58 3.1 Changes made to the PYLIS element within mtmB1 in pDL05C…………...79 3.2 Western blot analysis showing that the chimeric MetH/MtmB-His protein is produced in M. acetivorans……………………………………………….82

xii 3.3 ELISA midpoint analysis of the relative amounts of the MetH/MtmB-His and MtmB-His proteins………………………………………………………83 3.4 The pMetDL05C vector contains the mtmB1 gene from M. barkeri MS under control of the mcr promoter…………………………………………...84 3.5 Agarose gels showing that only single products are obtained from PCR reactions designed to screen for recombination of pMetDL05C into the M. acetivorans chromosome…………………………………………………….85 3.6 Sequence coverage of the MetH/MtmB-His chimeric protein after chymotryptic digestion………………………………………………………88 3.7 Anti-MtmB Western blot of all pPYLIS plasmids showing that some variation in MtmB-His production is present between the strains…………..93

3.8 Anti-his6 Western blot of all pPYLIS-containing strains……………………94

3.9 Anti-his6 Western blot of titrations of extracts from the pPYLIS 4 strain and the pDL05C strain……………………………………………………….94 3.10 Midpoint titration analysis of an ELISA comparing pDL05C with the pPYLIS plasmids…………………………………………………………….95 3.11 Anti-β-glucuronidase Western blot of strains bearing pWM311-based uidA and its derivatives……………………………………………………...100 3.12 Southern blot confirming proper insertion of the uidA gene and its variants into M. acetivorans..………………………………………………..103 3.13 Anti-β-glucuronidase Western blot of total soluble protein from Methanosarcina acetivorans strains harboring the uidA-286AAA, uidA- 286TAA, or the uidA-286TAG gene………………………………………...104

3.14 Enrichment of GUS286TAG after passing a partially enriched fraction from a nickel-chelating column over a Mono-Q column……………………107 4.1 The pyl gene clusters (in color) in M. barkeri Fusaro and D. hafniense…….115 A.1 The use of the S100 lower fraction plus the column-purified ribosomes results in the highest phenylalanine incorporation in the in vitro translation assay…………………………………………………………………………139 A.2 In vitro polyphenylalanine synthesis is dependent upon polyU and ATP/GTP…….……………………………………………………………...140 A.3 Aerobic in vitro assay conditions work as well as anaerobic assay conditions……………………………………………………………………141 A.4 Time course using polyU as substrate, showing 3H-phenylalanine incorporation over 30 minutes………………………………………………142

xiii

A.5 Design of the reporter construct, pSFH, used for in vitro translation assays………………………………………………………………………..143 A.6 Optimization of magnesium concentrations in the in vitro translation assay…………………………………………………………………………146 A.7 Optimization of ammonium chloride concentrations in the in vitro translation assay……………………………………………………………..147 A.8 Optimization of spermidine concentrations in the in vitro translation assay…………………………………………………………………………148 A.9 Time course showing that 3H-phenylalanine incorporation is occurring with each transcript, but with almost no completion of translation…………149 A.10 In vitro translation assay demonstrating that using the dialyzed S100 pellet results in the lowest background as monitored by 3H-phenylalanine incorporation………………………………………………………………...152 A.11 In vitro translation assay demonstrating that increasing amounts of tRNA inhibit translation……………………………………………………………153 A.12 The addition of an RNase inhibitor to the in vitro translation assay appears to increase the amount of protein produced………………………………...155 A.13 The addition of polyG as a carrier mRNA appears to inhibit in vitro translation……………………………………………………………………157 A.14 Titration of corrected amounts of mRNA levels in the in vitro translation assay…………………………………………………………………………160 A.15 In vitro translation assay comparing messages from all four transcription vectors……………………………………………………………………….161 A.16 Refolding of the transcript prior to adding it to the assay appears to increase the amount of 3H-phenylalanine product, but not the amount of 14C-histidine product………………………………………………………...162 A.17 3H-phenylalanine incorporation can be observed in the transcripts derived from uidA, but still no significant 14C-histidine incorporation is detectable………………………………………………………………..…..164 A.18 Time course of translation of transcripts made from pSFH-MTK and pSFH-BGK………………………………………………………………….165

xiv LIST OF ABBREVIATIONS

aaRS aminoacyl-tRNA synthetase

ATP adenosine triphosphate bp base pair

CoB coenzyme B

CoM coenzyme M

DMA dimethylamine

DTT dithiothreitol

E. coli Escherichia coli

ELISA enzyme-linked immunosorbent assay

GUS β-glucuronidase

GTP guanosine triphosphate

H4MPT tetrahydromethanopterin

KCl potassium chloride kDa kilodaltons

M. acetivorans Methanosarcina acetivorans

M. barkeri Methanosarcina barkeri

MgCl2 magnesium chloride

MCR methyl-CoM reductase

xv MMA monomethylamine

MOPS 3-[N-morpholino]propanesulfonic acid mRNA messenger RNA

NaCl sodium chloride

NH4Cl ammonium chloride nt nucleotide

OD optical density

PCR polymerase chain reaction

PEP phospho(enol)pyruvate

PYLIS pyrrolysine insertion sequence

PylS pyrrolysyl-tRNA synthetase

RF release factor

SECIS selenocysteine insertion sequence

TCA trichloroacetic acid

TMA trimethylamine tRNA transfer RNA

xvi CHAPTER 1

INTRODUCTION

1.1 Methanogens

1.1.1 Introduction

Cellular life on Earth consists of three domains: Eukarya, Bacteria and Archaea.

The archaeal domain is currently comprised of three phylogenetically distinct groups, the

Crenarchaeota, the Korarchaeota and the Euryarchaeota (Woese et al., 1990; Barns et al.,

1996). The Crenarchaeota consists of thermophilic and thermoacidophilic organisms while the Korarchaeota is comprised of uncultivable microbes from terrestrial hot springs. Methanogens, along with the halophilic archaea, are members of the last kingdom, the Euryarchaeota.

Methanogenic organisms are found in diverse and widespread oxygen-free

environments such as the rumen, the lower intestinal tract of humans, sewage digesters,

landfills, freshwater sediments of lakes and rivers, rice paddies, hydrothermal vents,

coastal marine sediments, and tundra areas (Ferry, 1999; Deppenmeier, 2004).

Methanogens, along with other anaerobic organisms, play a large part in the global carbon cycle where they remineralize the great quantities of organic matter that enter the anoxic marine and freshwater environments (Ferry, 1992).

1 Methane and CO2 are the major products of methanogenesis. Methane is the end product for all three major pathways of methanogenesis, while CO2 is produced from two

of the pathways. These gases are released from the oxygen-free environments and can

then reenter the global carbon cycle (Deppenmeier, 2004). Roughly two-thirds of the

methane diffuses into zones containing oxygen and is then oxidized by methanotrophic

bacteria. Of the last one-third, a few percent of methane is buried, creating methane

deposits, but the majority of it escapes into the atmosphere where it is photochemically

converted to carbon dioxide (Conrad, 1996). Although the methanogens created most of the natural gas that can be used as energy sources for domestic and/or industrial use,

methane is one of the most important greenhouse gases and contributes a great amount to

global warming (Khalil and Rasmussen, 1994; Reay, 2003).

Producing methane from complex organic matter is performed by four major

trophic groups of microbes. First, polysaccharides, proteins, nucleic acids and lipids are

degraded to monomers by hydrolytic microorganisms. Next, fermentative bacteria

degrade these organic compounds to ketones, simple carboxylic acids, alcohols and other compounds such as H2 and CO2. The acetogenic or syntrophic bacteria then oxidize the

higher acids to acetate and one-carbon compounds (Diekert and Wohlfarth, 1994; Drake et al., 1997; Schink 1997). The methane-producing microorganisms are in the final set in this grouping, and use these substances as carbon and energy sources, resulting in the formation of CH4 and CO2 (Zinder, 1993).

Methanogenesis is the only way these organisms can obtain energy for growth

and the methanogens are the only organisms known to produce methane as a catabolic

end product (Thauer, 1998). Nonetheless, methanogens are a very diverse group and one

2 example of this is their morphological features. Methanogens can be cocci, rods or

spirilla and some can aggregate in clusters, forming sarcina packages (Deppenmeier,

2002). The cell wall composition also varies greatly between species. Methanogens can

be surrounded by pseudomurein, heteropolysaccharides or protein subunits (Jones et al.,

1987). Peptidoglycan, which is used by bacteria, is not used by methanogens, providing

insensitivity to antibiotics that inhibit bacterial cell wall synthesis.

Greater than 80 species of methanogens have been described, including

psychrophilic, mesophilic, thermophilic and extremely thermophilic organisms (Garcia et

al., 2000). These species are classified into five different orders, which are only distantly

phylogenetically related to one another (Figure 1.1). The five orders are

Methanobacteriales, Methanococcales, Methanomicrobiales, Methanopyrales and

Methanosarcinales. The first four orders are denoted as hydrogenotrophic organisms,

since they use H2 plus CO2 as substrate. Most of these can also use formate as a substrate to produce methane (Thauer, 1998; Deppenmeier, 2002). The fifth order, the

Methanosarcinales, contains the most versatile methanogens, where many species can not only use H2 + CO2 as a substrate, but can also use acetate, carbon monoxide, methanol, and other methylated C1 compounds such as methylamines (mono-, di- or

trimethylamine) or methylated thiols (dimethylsulfide, methylmercaptopropionate or

methanethiol) (Deppenmeier, 2002; Rother and Metcalf, 2004). This is in contrast to the

other orders of methanogens, which possess a single pathway for methanogenesis, and

where most representatives can utilize no more than two substrates (Galagan et al., 2002).

3

Figure 1.1. The 16S rRNA phylogenetic tree showing the distribution of methanogens within the archaeal domain. Boxed in red are four of the five methanogen orders that belong to the Euryarchaeota kingdom.

1.1.2 Methanogenesis from methanol and methylamines

There are three major types of methanogenesis, hydrogenotrophic, acetoclastic, and methylotrophic. The hydrogenotrophic pathway involves the reduction of carbon dioxide to methane, and the oxidation of hydrogen gas is used as the electron donor. The acetoclastic pathway occurs through a dismutation of acetate, where acetate is first activated to acetyl-CoA. The carbonyl group is then oxidized to CO2, and the methyl

4 group is transferred to tetrahydromethanopterin (H4MPT), where it is subsequently

reduced to methane. Finally, the methylotrophic pathway involves the disproportionation

of C1 compounds (methanol, methylamines, methylthiols) to carbon dioxide and methane

(Galagan et al., 2002; Welander and Metcalf, 2005). Only the methylotrophic pathway will be described in detail here.

The most widely used methanogenic substrates are H2 + CO2 and acetate, but in

marine and brackish environments methylated compounds are thought to predominate.

The methylamine and methylthiols arise from the anaerobic breakdown of common

cellular osmolytes such as betaine, trimethylamine-N-oxide and

dimethylsulfoniopropionate, which are from marine phytoplankton and certain plants

(Deppenmeier, 2002). Only members of the Methanosarcinacea have the ability to

utilize methanol or methylamines as a sole source of energy (Blaut, 1994).

Methanogenesis from methylamines or methanol involves four substrate

molecules. The methyl group of one substrate molecule is oxidized to CO2, which

provides six electrons for the reduction of three other methyl moieties from substrate

molecules to methane. The oxidation of the methyl group to CO2 occurs via the reverse

CO2-reduction pathway (Deppenmeier, 2002). Both the oxidative and reductive pathways involve a soluble methyltransferase system and result in the formation of a centrally important intermediate, methyl-coenzyme M (methyl-mercaptoethanesulfonate or CoM), but only in the reductive branch is this then reductively cleaved by a methyl-

CoM reductase, resulting in the formation of methane (Blaut, 1994; Deppenmeier, 2002;

Deppenmeier, 2004).

5 Studies using Methanosarcina barkeri showed that analogous enzyme systems

initiate methanogenesis from methanol (van der Meijden et al., 1984; Sauer and Thauer,

1998), trimethylamine (TMA; Ferguson et al., 1996; Ferguson and Krzycki, 1997),

dimethylamine (DMA; Ferguson et al., 2000) and monomethylamine (MMA; Burke and

Krzycki, 1995; 1997). In each of these pathways, a methyltransferase specific for one of

these substrates methylates a cognate corrinoid protein, which is then used to methylate

coenzyme M to form methyl-CoM (Figure 1.2). For TMA, the substrate-specific

methyltransferase and corrinoid protein are designated MttB and MttC, respectively. For

DMA, they are MtbB and MtbC, for MMA, they are MtmB and MtmC, and for methanol, they are MtaB and MtaC. The methylated corrinoid proteins of the methylamine

pathways are the substrates of a single CoM methylase, MtbA, a methylcobamide:

coenzyme M methyltransferase (Grahame, 1989; Burke and Krzycki, 1995; Ferguson et

al., 1996; 2000; Ferguson and Krzycki, 1997). A different CoM methylating enzyme,

MtaA, is used for the methanol pathway (van der Meijden et al., 1983; Harms and

Thauer, 1996). After methylation by either CoM methylase, a methyl-CoM reductase

(MCR) then catalyzes the reduction of the methylthioether using

mercaptoheptanoylthreonine phosphate (HS-HTP) as the electron donor, forming CoM-

S-S-HTP (heterodisulfide) and methane (DiMarco et al., 1990). This reduction is the

major energy-conserving step of methanogenesis (Thauer, 1998).

6

Figure 1.2. Protein components initiating methylamine-dependent methanogenesis. The substrate (CH3-R) enters the pathway, where a substrate-specific methyltransferase transfers the methyl group to its cognate corrinoid protein (the corrinoid cofactor is shown in red). The methyl moiety is then transferred from the corrinoid protein to CoM via a second methyltransferase, MtbA, which is specific for methylamine dependent methanogenesis. CH3-CoM is subsequently reduced, leading to the formation of heterodisulfide and methane. A UAG codon is found in each of the genes encoding the methyltransferases that transfer the methyl group to the corrinoid proteins, and is discussed in section 1.1.3.

1.1.3 The methylamine-specific methyltransferase genes contain an in-frame stop

codon

Although the TMA, DMA and MMA methyltransferases in M. barkeri are

functionally analogous, the proteins themselves are nonhomologous. However, one

unusual feature shared by all of the genes encoding each of the methylamine

7 methyltransferases is the presence of a single in-frame amber (TAG) codon within their open reading frames (Burke et al., 1998; Paul et al., 2000). Interestingly, this feature is not shared by the functionally analogous methanol methyltransferase genes (Sauer et al.,

1997; Deppenmeier et al., 2002; Galagan et al., 2002).

Multiple and nearly identical copies of the genes encoding the TMA, DMA and

MMA methyltransferases have been found in Methanosarcina spp. Two mttB methyltransferase gene copies have been found in M. acetivorans (Galagan et al., 2002), while three mtbB gene copies and two gene copies encoding the MMA methyltransferase are present in M. barkeri MS (Paul et al., 2000; Burke et al., 1998). The two genes encoding the MMA methyltransferase in M. barkeri MS are designated mtmB1 and mtmB2, and share 98% identity at the deduced amino acid level. Both genes have an in- frame amber codon at codon 202 and a downstream TAA stop codon at position 458. In addition to M. barkeri, Methanosarcina mazei, Methanosarcina acetivorans and

Methanococcoides burtonii have recently been sequenced and each of their methylamine methyltransferases also contain a single in-frame amber stop codon (Deppenmeier et al.,

2002; Galagan et al., 2002; Saunders et al., 2003). Furthermore, an mttB homolog has been found in a Gram-positive bacterium, Desulfitobacterium hafniense. This gene also has an in-frame amber codon found at the same position as the other mttB genes found in the methanogens (Srinivasan et al., 2002). The amber codon is found at the same position in all known methanogen homologs of a gene encoding each methylamine methyltransferase (Burke et al., 1998; Paul et al., 2000; Galagan et al., 2002;

Deppenmeier et al., 2002; Saunders et al., 2003).

8 The amber codons, if read as stop codons, would result in truncated proteins of 23

kDa (MtmB), 38 kDa (MtbB) and 32 kDa (MttB). For each gene, another stop codon,

either UAA or UGA, follows the in-frame amber codon, where if translation stopped at

that stop codon, each gene would produce protein products of approximately 50 kDa.

The 50 kDa size corresponds to the approximate molecular mass of the isolated and

characterized TMA, DMA and MMA methyltransferase polypeptides (James et al.,

2001). Additionally, little or no UAG-truncated mtmB gene product is detectable in cells

(James et al., 2001). Taken together, these data indicate that the internal amber codons of

the methylamine methyltransferase genes do not stop translation during production of the

50 kDa proteins.

1.2 Unusual decoding of mRNA during translation

1.2.1 Standard termination of translation

The process of protein synthesis can be divided into four main elements. The first element, initiation, is where the ribosomal subunits join the mRNA and locate the AUG initiator codon. The second element is elongation, where sense codons are decoded and the bulk of the polypeptide is made. The third element is termination, where a stop codon directs the release of the completed polypeptide from the ribosome. The fourth and final element is the recycling of the ribosomal subunits so that they can be used in another round of initiation.

The termination of translation occurs in response to the presence of a stop codon,

UAA, UAG or UGA, when in the ribosomal A site. The completed polypeptide is

released from the ribosome only after hydrolysis of the ester bond linking the polypeptide

9 to the tRNA in the ribosomal P site has occurred (Kapp and Lorsch, 2004). The

hydrolysis reaction is thought to be catalyzed by the peptidyl transferase center of the

ribosome (Kapp and Lorsch, 2004). This reaction is carried out in response to the

combined activity of class 1 and class 2 release factors (RFs). Class 1 release factors decode stop codons presented in the ribosomal A site, while class 2 release factors are

GTPases that stimulate the activity of class 1 release factors regardless of which stop codon the class 1 factor has recognized (Kapp and Lorsch, 2004). In vitro, class 2 release factors are not essential for termination when all three stop codons are present at high concentrations (Frolova et al., 1994), but are required for the class 1 release factor activity at lower levels of the stop codons (Zhouravleva et al., 1995). This same general scheme of translation termination was originally assumed to apply to all living kingdoms, but it is now clear that each domain terminates translation in different ways.

Translation termination in bacteria is the most like the scheme mentioned above.

Three release factors are necessary for translation termination in bacteria. The two class

1 RFs, RF1 and RF2, have overlapping codon specificity where RF1 recognizes UAA

and UAG, and RF2 also recognizes UAA, but also recognizes UGA (Scolnick et al.,

1968). A putative peptide “anticodon” has been identified within each RF; PAT in RF1 and SPF in RF2 are employed for the recognition of a stop codon (Ito et al., 2000). The

peptide anticodon and the stop codon are thought to form an interaction that is analogous

to the codon:anticodon pairing between mRNA and tRNA (Kapp and Lorsch, 2004).

However, although both the crystal structures for the eukaryotic release factor (eRF1) and

the bacterial release factor (RF2) appear to mimic a tRNA structure, this mimicry in

bacterial RF2 is thought to be incorrect (Nakamura and Ito, 2003). The crystal structure

10 of RF2 was determined using an isolated protein, while cryo-EM experiments show a different structure of RF2 in the presence of the ribosomal complex (Nakamura and Ito,

2003). Finally, structures present in other domains are thought to help define the codon recognition ability of each factor, possibly by influencing the structure of the region containing the “anticodon” in each release factor (Kapp and Lorsch, 2004).

A class 2 RF, called RF3, is also present in bacteria. This factor stimulates the

activities of RF1 and RF2 and is also required to eject them from the ribosome following

peptidyl-tRNA hydrolysis (Grentzmann et al., 1994; Mikuni et al., 1994; Freistroffer et

al., 1997).

Translation termination is carried out by a single class 1 factor in eukaryotes,

eRF1 (Konecki et al., 1977; Frolova et al., 1994). This single factor can promote the

hydrolysis of the ester bond linking the polypeptide to the tRNA in the ribosomal P site

with any of the three stop codons.

As in bacteria, eukaryotes also possess a class 2 release factor, eRF3

(Zhouravleva et al., 1995; Frolova et al., 1996). This release factor can bind GTP

independently of eRF1, while stimulation of its GTPase activity requires eRF1 plus the

ribosome, but not the presence of a stop codon (Zhouravleva et al., 1995; Frolova et al.,

1996). In contrast to bacterial RF3, a role for eRF3 in triggering the release of eRF1

from the ribosome following peptidyl-tRNA hydrolysis has not been verified (Kapp and

Lorsch, 2004). Additionally, eRF3 has shown to be essential in eukaryotes, while RF3 is

dispensable in bacteria (Grentzmann et al., 1994; Mikuni et al., 1994).

In archaea, translation termination appears to be similar to that of eukaryotes.

Based on the homology of the class 1 archaeal release factor, aRF1, to eRF1, the

11 mechanism of stop codon recognition and peptidyl-tRNA hydrolysis appears to be

comparable to the eukaryotic system (Dontsova et al., 2000). No gene encoding an

archaeal homolog of eRF3 has yet been identified. One theory is that a process of

reductive evolution of the translational apparatus occurred during the divergence of

archaea, which may have made the factor unnecessary (Lecompte et al., 2002).

There appears to be only one conserved sequence motif among the class 1 RFs,

called the GGQ motif, which is required for the activation of peptidyl-tRNA hydrolysis

(Seit-Nebi, et al., 2001; Frolova et al., 1999). Along with this, the conservation among all domains of the core ribosomal proteins and rRNA suggests that the peptidyl-tRNA hydrolysis reaction mechanism is conserved (Ramakrishnan, 2002; Lecompte et al.,

2002). Due to lack of any further similarity among the RFs, however, the mechanism of

stop codon decoding may not be conserved (Kapp and Lorsch, 2004).

Finally, studies have shown that termination signal strength is strongly influenced

by the sequences downstream of the stop codon (Buckingham, 1994; McCaughan et al.,

1995). The termination signal in both bacteria and eukaryotes consists not only of a

three-base codon, but includes the base following the stop codon (termed the +4 position)

as well (Brown et al., 1990a; Brown et al., 1990b; Poole et al., 1998; Ozawa et al., 2002).

This base determines the efficiency with which the RF decodes the stop signal in both

mammalian and bacterial systems in vivo (Tate et al., 1995). Studies using bacterial RF2

have shown that as many as three nucleotides following the stop codon triplet may

contact the release factor and have roles as termination efficiency determinants (Bertram

et al., 2001). The sequence downstream of the stop codon also affects the efficiency and

12 probability of events alternative to termination such as frameshifting and stop codon

readthrough (Buckingham, 1994).

1.2.2 Reprogramming of translation: frameshifting and bypassing

Although a universal genetic code and translational machinery able to interpret it

is present in all organisms, not all genes conform to the standard rules of decoding. Most

of the sequence of these genes is interpreted conventionally, but at certain sites the

translational machinery is reprogrammed to read the code differently. This

reprogramming of translation includes three different types of events: programmed

frameshifting, translational bypassing and redefinition (Herr et al., 2000).

Sometimes specialized components in translation assist in the recoding, but the rule changes are programmed in the mRNA sequences themselves, and so are under

genetic control (Gesteland and Atkins, 1996). These recoding sites usually reprogram the

ribosome to do something different from what is specified by the usual translation of a

triplet of codons, where either the linearity of the readout is changed, or the definition of

the triplet is changed. Additionally, cell physiology can be affected by recoding in a

variety of ways, and cellular processes can be regulated as well (Namy et al., 2004).

The principles of programmed frameshifting have largely been elucidated from

studies of viruses, retrotransposons and insertional elements (Namy et al., 2004). Both

+1 and –1 examples of programmed frameshifting have been observed. In both types of frameshifting, during elongation, ribosomes switch to an alternative reading frame at a specific shift site (Baranov et al., 2002). Generally, signals within the mRNA are required for the ribosomes to shift reading frames. One signal is a slippery sequence in the mRNA where tRNA movement or misalignment can occur. The other trigger for

13 frameshifting is a stimulator, such as an uncommon codon triplet, a stop codon, or a

structure within the mRNA, such as a stem-loop or a pseudoknot. These stimulators act

to pause translating ribosomes, and translation continues after shifting into one of the

alternative frames (Namy et al., 2004). Recognition of a pseudoknot by the translational

machinery seems to involve the folded structure, the primary sequence of the signal and

sometimes spacing between the pseudoknot and the recoded stop codon as well

(Gesteland and Atkins, 1996). However, these signals are not interchangeable and so

cannot individually direct any recoding event. For example, the mouse mammary tumor

virus (MMTV) pseudoknot, which directs frameshifting and is structurally similar to the

Mo-MuLV pseudoknot, cannot functionally substitute for the Mo-MuLV structure

(Gesteland and Atkins, 1996).

One common example of programmed frameshifting is the decoding of E. coli

RF2 (Craigen et al., 1985). The prfB gene encoding RF2 is interrupted by a UGA stop codon approximately 26 codons downstream of the initiation codon. About half of the

ribosomes translating this mRNA do not terminate at this UGA, but instead shift to the

+1 frame and continue translating, resulting in a full-length RF2 protein (Baranov et al.,

2002). At high concentrations of RF2, the competition between frameshifting and translation termination is in favor of termination, which leads to a decrease of RF2 in the cell. As levels of RF2 decrease, frameshifting begins to predominate, which raises the

RF2 levels (Namy et al., 2004).

The dnaX gene, encoding the γ and τ subunits of DNA polymerase III holoenzyme, is one of the few examples of –1 frameshifting in prokaryotes. Synthesis of the γ protein from the dnaX gene is the result of a –1 frameshifting event that directs

14 ribosomes to a premature stop codon. The standard decoding of dnaX results in the

synthesis of the τ protein (Namy et al., 2004).

In translational bypassing, also known as hopping, jumping or sliding, ribosomes

suspend translation at a specific site and then resume translation downstream without

translating the set of intermediate nucleotides, producing a single protein (Baranov et al.,

2002). Bypassing is also frame independent, meaning that it may or may not result in a change of translational reading frame (Baranov et al., 2002).

Bypassing has three stages, take-off, scanning and landing (Herr et al., 2000). At

a specific GGA codon, the P-site pairing dissociates. After dissociation, the mRNA

appears to slide through the P-site as the peptidyl-tRNA scans the mRNA for a suitable

complementary codon. Translation resumes following peptidyl-tRNA pairing to a second

GGA codon at the beginning of the second open reading frame (Herr et al., 2001).

The only well-studied example of translational bypassing is in gene 60 of

bacteriophage T4. In translation of this gene, complex cis- and trans-acting signals allow

a 50 nt stretch of mRNA to be bypassed at high efficiency, where four cis-acting signals

are known to be required for efficient bypassing (Herr et al., 2000). One is a stop codon

just 3′ of the take-off site, the second is an optimal spacing distance between the two

GGA codons, the third is a stem-loop 5′ of the coding gap (which includes the take-off

site GGA), and the fourth is a stretch of the nascent peptide which is both basic and

hydrophobic (Gesteland and Atkins, 1996; Herr et al., 2000). The stem loop is thought to

initiate bypassing by preventing translation termination at the internal stop codon, while

it has been suggested that the nascent peptide signal may promote dissociation of the

peptidyl-tRNA-mRNA pairing in the P-site (Herr et al., 2001).

15 1.2.3 Reprogramming of translation: translational redefinition

The last type of translational reprogramming is called redefinition. In this case, a

different meaning for a codon can either be temporarily assigned in specific genes or

permanently assigned throughout a genome. All cases so far involve stop codon

redefinition to sense codons, which results in longer polypeptides than would be

predicted from an mRNA sequence containing the stop codon. This process is called

readthrough, and even in the absence of signals for recoding, each of the three stop

codons has a different readthrough efficiency. In E. coli UAA is under the tightest

control for termination, and so highly expressed genes use this codon (Gesteland and

Atkins, 1996). UAG is less efficient, and UGA is naturally leaky at levels around 1-3%

(Gesteland and Atkins, 1996).

Termination efficiency can be influenced by a number of factors, including the

nucleotide context of the stop codon, the identity of the final two amino acids

incorporated into the polypeptide chain, and the presence of stimulatory elements

downstream (Namy et al., 2004). All of these factors help in determining whether a

tRNA rather than a release factor will decode a stop codon.

The tRNAs that recognize stop codons are termed suppressor tRNAs and can

recognize the termination codon even if its anticodon is not an exact match for the

termination codon. The affinity of the suppressor tRNA for the stop codon along with the

A-site termination environment (versus the affinity of the RF) determine the frequency of stop codon readthrough (Bertram et al., 2001). There are two types of suppressor tRNAs: wild-type cellular tRNAs which are miscognate for the stop codons and wobble base pair with the stop codon, or tRNAs which are cognate for a stop codon, either through

16 mutation or a universal redefinition of the stop codon that has occurred in the organism

(Bertram et al., 2001). Some examples of global recoding include mitochondria and

Mycoplasma spp. where the stop codon UGA encodes tryptophan (Namy et al., 2004;

Bertram et al., 2001), Euplotes species where UGA encodes cysteine (Meyer et al., 1991) and Paramecium and Tetrahymena genera where UAA and UAG encode glutamine

(Caron and Meyer, 1985).

The readthrough of in-frame stop codons is driven by cis-acting signals. These

signals frequently include a stop codon context that is not optimal for release factor

recognition in translation termination, but can also include RNA secondary structure

elements that enhance readthrough. The codon context can simply consist of only 1-6

nucleotides at the 3′ (or sometimes the 5′) side of the suppressed stop codon, or may

involve more complex signals like stem-loop or pseudoknot structures (Beier and Grimm,

2001).

Many RNA viruses use redefinition to make elongated proteins. In some cases,

the signal is simple. For example, sindbis, an animal virus, uses redefinition of a UGA codon and the signal for this is essentially the nucleotide C, which is positioned 3′ to the

UGA (Gesteland and Atkins, 1996). Another example is Tobacco Mosaic Virus (TMV), where the sequence directing redefinition of a UAG stop codon is CAR YYA, which is directly 3′ to the UAG codon (Gesteland and Atkins, 1996). No RNA secondary structures have been found in the stop codon environments, and so it seems that the 3′ stop codon context alone directs readthrough (Bertram et al., 2001).

Other RNA viruses use structural components in the RNA to direct readthrough.

Moloney murine leukemia virus (Mo-MuLV) is a mammalian retrovirus that uses

17 readthrough of a UAG stop codon to express its gag and gag-pol fusion proteins

(Yoshinaka et al., 1985). Cis-acting elements downstream of the stop codon direct insertion of glutamine to produce the fusion protein. The sequence downstream of the

UAG codon has the ability to form an RNA pseudoknot structure, which directs the suppression of the stop codon (Bertram et al., 2001). Pseudoknots are also found in retrotransposons from Candida albicans and Dictyostelium discoideum which direct

UGA readthrough to produce a Gag-Pol fusion protein (Bertram et al., 2001).

1.2.4 Selenocysteine

One common example of redefinition is selenocysteine, which is considered to be

the 21st amino acid. Selenium is an essential dietary trace element that is incorporated

into selenoproteins as the amino acid selenocysteine (Sec; Hoffmann and Berry, 2005).

The recoding of the stop codon UGA as selenocysteine is conserved in all three domains of life, as is the requirement for a UGA-decoding tRNA (tRNASec), a specialized

translation elongation factor to deliver the selenocysteine-charged tRNA, and a cis-acting

element in the selenoprotein mRNA that forms a stem-loop structure. Beyond these

general conditions, the mechanisms for Sec insertion differ dramatically between the

domains.

Selenoproteins are involved in catabolic processes in both prokaryotes and

archaea, and utilize selenium to catalyze various redox reactions (Stadtman, 1996). The

selenium-containing proteins in eukaryotes participate in antioxidant and anabolic

processes (Hatfield and Gladyshev, 2002). Structurally, Sec is identical to cysteine

(Cys), except that it contains selenium instead of sulfur. The two elements share many

18 similar chemical properties, but Sec has a functional advantage because the selenol group

is more fully ionized than the thiol group of Cys at physiological pH (Stadtman, 1996).

Therefore, when Sec is replaced with Cys, the catalytic efficiency of a selenoenzyme is

reduced (Driscoll and Copeland, 2003). There are no known selenoproteins in yeast, and

in these organisms the corresponding proteins contain Cys rather than Sec (Driscoll and

Copeland, 2003).

The biosynthesis of selenocysteine is distinctive from the canonical 20 amino acids in that its synthesis always occurs on its tRNA (Hatfield and Gladyshev, 2002). In prokaryotes, tRNASec is initially aminoacylated with serine by the normal seryl-tRNA

synthetase (Driscoll and Copeland, 2003). Sec synthase then converts the Ser-tRNASec to

Sec-tRNASec in a two-step reaction that involves removal of a hydroxyl group and the addition of selenium (Hatfield and Gladyshev, 2002). Monoselenophosphate, which is synthesized by selenophosphate synthase, is the selenium donor (Hatfield and Gladyshev,

2002; Driscoll and Copeland, 2003). The Sec synthesis pathway is not fully characterized in eukaryotes, although it is likely similar to that in bacteria. The Sec synthase has not been identified in mammals, and two selenophosphate synthetases, Sps1 and Sps2, have been identified (Low et al., 1995).

In prokaryotes, Sec insertion is carried out by a novel GTP-dependent elongation factor, SelB, which is specific for Sec-tRNASec (Forchhammer et al., 1989). SelB

specifically interacts with Sec-tRNASec, but not with Ser-tRNASer or Ser-tRNASec

(Copeland, 2003). SelB contains an elongation factor domain similar to those found in

the standard elongation factors, EF-Tu and EF-1α (Berry, 2005). In addition to this

domain, a C-terminal extension of SelB was shown to bind the cis-acting mRNA stem

19 loop, termed selenocysteine insertion sequence (SECIS, or in bacteria, bSECIS) elements.

This stem loop is found immediately 3' of the UGA codon in bacteria and in the 3' UTR

in eukaryotes and archaea. The C-terminal extension of SelB is not found in EF-Tu

(Driscoll and Copeland, 2003). Upon binding, the SelB-tRNA complex is recruited to the

adjacent UGA codon, thus allowing selenocysteine insertion into protein (Berry, 2005).

The cotranslational incorporation of selenocysteine in prokaryotes requires the

formation of a quaternary complex. SelB forms a complex with GTP, Sec-tRNASec and the bSECIS element, which is located directly 3′ of the UGA codon in the mRNA (Heider et al., 1992). When SelB binds to the bSECIS element, the protein undergoes a conformational change, which allows it to associate with the ribosome (Driscoll and

Copeland, 2003). The presence of the ribosome stimulates the GTPase activity of SelB, but only when it is bound to the bSECIS element (Huttenhofer and Böck, 1998). The affinity of SelB for the bSECIS is decreased after release of Sec-tRNASec to the

ribosomal A-site, causing the dissociation of the quaternary complex (Thanbichler et al.,

2000).

The bSECIS element is the indicator that distinguishes the UGA codon as a Sec- insertion signal versus a stop signal. This mRNA will also redefine UAA, UAG, and a

UGC sense codon if the anticodon of the tRNASec is mutated to recognize these codons

(Gesteland and Atkins, 1996). Completely deleting the bSECIS abolishes Sec insertion

(Zinoni et al., 1990), and any change in the distance between UGA and bSECIS is

detrimental for selenocysteine insertion (Cobucci-Ponzano et al., 2005). Additionally, in

studies of the fdhF SECIS RNA, nucleotides U17, G23 and U24 are the only RNA

sequence elements critical for high-affinity binding of SelB to the SECIS mRNA

20 (Fourmy et al., 2002). Also, only a scaffold formed by four Watson-Crick base pairs in

the SECIS stem, along with an additional Watson-Crick base pair found in the loop, is

necessary for proper recognition of the three conserved nucleotides (Fourmy et al., 2002).

Shortening of the stem by one base pair is deleterious to SelB mRNA binding (Fourmy et

al., 2002).

In eukaryotes, the SECIS element is not located in the coding region of the UGA- containing mRNA. Instead, it is located in the 3′ UTR of the mRNA (Gesteland and

Atkins, 1996). The distance between the UGA/Sec codon and the SECIS element in eukaryotic mRNAs can range between 60 to 4000 nucleotides (Hoffmann and Berry,

2005). As with the bSECIS, the eukaryotic SECIS elements are not highly conserved at the nucleotide level, but they all form a similar stem-loop structure, which is composed of

two helices separated by an internal loop (Driscoll and Copeland, 2003). There is a

SECIS core that lays at the junction of helix 2 and the internal loop, and this contains a

quartet of non-Watson-Crick base pairs (Driscoll and Copeland, 2003). The center of this

quartet forms a G-A/A-G base pair tandem, and this is conserved in all eukaryotic

selenoprotein mRNAs (Driscoll and Copeland, 2003). Additionally, all eukaryotic

SECIS elements have a conserved AAR motif, which can be found in either the apical

loop or in an internal loop (Copeland, 2003). One exception to this rule is found in the

mammalian selenoprotein M SECIS, which possesses a CCC in place of AAR (Copeland,

2003).

Another difference between prokaryotes and eukaryotes is the presence of a

SECIS-binding protein (SBP2) in eukaryotes. SBP2 is a protein that binds specifically to

the SECIS core as well as to ribosomes (Copeland, 2003). This protein has been shown

21 to be required for selenocysteine incorporation in vitro (Copeland et al., 2000). SBP2 has no homology to elongation factors, and has been shown to bind to the mammalian selenoprotein elongation factor, EFsec (Hoffmann and Berry, 2005). The exact role of

SBP2 is still unknown, but it is hypothesized that the eukaryotic SECIS elements recruit

SBP2 to form a tight complex, while at the same time SBP2 can bind to EFsec (Hatfield and Gladyshev, 2002). This, in turn, recruits Sec-tRNASec, resulting in the insertion of

Sec into nascent polypeptides in response to UGA codons (Hatfield and Gladyshev,

2002). EFsec is specific for Sec and is different from EF-1A, and is also different from bacterial SelB since it cannot bind the eukaryotic SECIS on its own (Driscoll and

Copeland, 2003).

Archaea incorporate selenocysteine by a mechanism that seems to be a hybrid between those in bacteria and eukaryotes. As in the eukaryotes, the archaeal SECIS element is located in the 3′ UTR (Wilting et al, 1997), but has no sequence or structural homology to the eukaryal or bacterial SECIS elements. In contrast, the archaeal SelB, aSelB, appears to be functionally homologous to bacterial SelB (Cobucci-Ponzano et al.,

2005), but the M. jannaschii SelB is similar to the eukaryal factor (Fagegaltier et al.,

2000). Additionally, SBP2 homologs have not been found in the archaea (Cobucci-

Ponzano et al., 2005). This supports the model where the aSelB/Sec-tRNASec complex interacts directly with the SECIS element, although the element is located in the 3′ UTR

(Cobucci-Ponzano et al., 2005).

22 1.2.5 Pyrrolysine

Selenocysteine provides the closest analogy to how the in-frame amber codons of the methylamine methyltransferase genes are translated, since UAG is decoded as a sense

codon for a novel amino acid in these genes. Translational alternatives, such as ribosomal hopping, as to how the amber codon may be bypassed were eliminated by

Edman degradation and tandem mass spectrometry of tryptic fragments of MtmB1 (Paul et al., 2000; James et al., 2001).

These analyses confirmed that the in-frame UAG of mtmB1 is translated at the

ribosome, and both methods indicated that the UAG-encoded amino acid had an elution

time and mass of lysine. However, the harsh conditions necessary for the peptide

isolation left open the possibility that the lysyl residue may have had some modifications

that were stripped off during the isolation.

The crystal structure of MtmB1 from M. barkeri MS has been determined at 1.55-

2.0 Å resolution (Hao et al., 2002). Lysine was revealed at the UAG position, but with

εN in amide linkage with (4R, 5R)-4-substituted-pyrroline-5-carboxylate. This confirmed an early proposal that UAG could encode a specialized residue (Burke et al., 1998). The

identity of the C-4 substituent was determined as either a methyl, hydroxyl or amine

group, but could not be determined further with any certainty. Additional analysis of the derivatized residue in MtmB crystals led to the assignment of the C-4 substituent as a

methyl group (Hao et al., 2002; Hao et al., 2004). Recently, tandem mass spectrometry

confirmed that the UAG-encoded residue has the exact mass predicted for the structure of

pyrrolysine with the C-4 substituent as a methyl group (Soares et al., 2005). This novel

amino acid is now termed pyrrolysine and is considered the 22nd amino acid (Figure 1.3).

23

Figure 1.3. The structure of pyrrolysine deduced from the crystallography of MtmB and the residue mass of the UAG-encoded residue in MtmB, MtbB and MttB.

Mass spectrometry further demonstrated that MttB and MtbB in M. barkeri MS

also have UAG-encoded pyrrolysyl residues. In addition, proteomic evidence supports

the hypothesis that the UAG-encoded position in MttB from Methanococcoides burtonii is translated as pyrrolysine (Goodchild et al., 2004).

The current hypothesis is that pyrrolysine functions to activate and orient mono-,

di- or trimethylamines for methyl cation transfer (Hao et al., 2002; Hao et al., 2004;

Krzycki, 2004). Pyrrolysine is the first example of a genetically encoded electrophilic

residue, a property previously found only in protein prosthetic groups or post- translationally modified residues (Krzycki, 2004).

24 So far, pyrrolysine has been found in a few methanogenic archaea and one

bacterium (Srinivasan et al., 2002; Galagan et al., 2002). In these organisms, a cluster of

genes, called the pyl operon, has been found. A specific tRNA (tRNAPyl), encoded by the

pylT gene, has the CUA anticodon required to translate the UAG codon in methylamine

methyltransferase genes (Srinivasan et al., 2002). This gene is cotranscribed with three

downstream ORFs, pylS, pylB and pylC (Srinivasan et al., 2002). The pylB and pylC

genes, along with an adjacent gene, pylD, are thought to participate in the biosynthesis of pyrrolysine, while the pylS gene encodes a putative aminoacyl-tRNA synthetase, PylS

(Srinivasan et al., 2002).

1.3 Aminoacyl-tRNA synthetases

1.3.1 Introduction

Aminoacyl-tRNA synthetases (aaRSs) are essential components of the translation

process. Their main role within cells is to catalyze the attachment of individual transfer

RNAs (tRNAs) to their cognate amino acid. Each aaRS is usually specific for one amino acid and one or more isoaccepting tRNA. The reaction catalyzed by the aaRSs is called aminoacylation and after it has occurred, the aminoacyl-tRNAs function as substrates in

protein synthesis. As a result, the identity of an amino acid inserted at a particular

position during translation is determined by the pairing of a codon in mRNA with a

particular aminoacyl-tRNA, making the faithful synthesis of proteins dependent on the

presence of a complete set of correctly aminoacylated tRNAs.

The aminoacylation reaction is a two-step process that occurs in a single active

site within the aaRS. In the first step, the amino acid is activated by a nucleophilic attack

25 of a molecule of ATP at the α-phosphate, which results in the formation of inorganic

pyrophosphate and the aminoacyl-adenylate, which is a relatively stable, enzyme-bound

intermediate (Arnez and Moras, 1997; Cusack 1997). In the second step, the amino acid is transferred to either the 2´- or the 3´-hydroxyl of the terminal adenosine of its cognate tRNA. This results in the 3´-esterification of the tRNA with the amino acid moiety and generates AMP as the leaving group. Release of the product then follows (Arnez and

Moras, 1997; Ibba and Söll, 2000). All aaRSs have been shown to catalyze this same

activation reaction with their cognate amino acids (Arnez and Moras, 1997; Ibba and

Söll, 2000). Most aaRSs do not do not require tRNA for the amino acid activation reaction. The only four aaRSs to require the presence of tRNA are GlnRS, ArgRS,

GluRS and class I LysRS (Ibba and Söll, 2000). In these cases, tRNA binding causes induced-fit changes within the aaRS so that amino acid activation can occur (Francklyn et al., 2002).

Despite their conserved mechanisms of catalysis, the aaRSs differ in size and

have limited sequence homology (Eriani et al., 1990). Based on mutually exclusive

sequence motifs in their active sites, the aminoacyl-tRNA synthetases are divided into

two unrelated classes, class I and class II (Eriani et al., 1990). Class I aaRSs share

sequence motifs HIGH and KMSKS, which form part of the ATP binding domain, and

their active sites contain a Rossmann dinucleotide-binding domain, which is made up of

alternating α-helices and β-strands (Arnez and Moras, 1997; Schimmel and Ribas de

Pouplana, 2000). Class II aaRSs share different conserved sequence motifs called motifs

1, 2 and 3. These motifs make up a seven-stranded antiparallel β structure with three α-

helices in a barrel-like structure (Schimmel and Ribas de Pouplana, 2000). One result of

26 the difference in active site structure is that class I enzymes bind ATP in an extended conformation like that of other proteins containing a Rossmann fold, while class II enzymes bind ATP in a bent, or compact, conformation (Arnez and Moras, 1997).

Another difference between the two classes of the aaRSs is their quaternary

structures. Class I aaRSs are mostly monomeric, although two of them are dimers. On

the other hand, class II aaRSs are usually obligate dimers, with a subset that forms as

tetramers (Arnez and Moras, 1997).

Aminoacyl-tRNA synthetases are modular enzymes, and more domains other than

the catalytic one make up the aaRSs. Therefore, the two classes of aaRS are further

divided into subclasses. The subclasses not only depend on the presence of common

domains, but also are loosely correlated with the type of amino acid that is charged onto

the cognate tRNA by the aaRS (Arnez and Moras, 1997). Class I is made up of

subclasses Ia (containing the arg, cys, ile, leu, met, val and lysI aaRSs), Ib (containing the

gln and glu aaRSs) and Ic (containing the trp and tyr aaRSs), and class II consists of

subclasses IIa (containing the gly, his, pro, thr and ser aaRSs), IIb (containing the asn, asp

and lysII aaRSs) and IIc (containing the ala, gly and phe aaRSs).

1.3.2 tRNA recognition by aaRS

Another major difference between the two aaRS classes is in their binding of

tRNA. In both classes, the aaRSs mostly specifically interact with one or more of the

following elements of the tRNA: the discriminator base (N73), the acceptor stem and the

anticodon loop (Ibba and Söll, 2000). However, the acceptor arm and the 3´-terminal

CCA of tRNA are bound in a mirror-symmetric fashion by class I and class II aaRSs.

27 Class I enzymes bind the acceptor stem of tRNA from the minor groove side, while the

class II enzymes bind the stem from the major groove side. Because of this, the variable

loop of the tRNA faces the solvent in the case of class I aaRSs, while it faces the

synthetase with class II enzymes (Arnez and Moras, 1997; Ibba and Söll, 2000). Also,

due to the mirror-symmetrical construction of the class I and class II enzymes, the

aminoacylation of the tRNA has opposite stereochemistries for each class. Class I aaRSs

bring the 2´-OH of the 3´-terminal ribose into a position to attack the carbonyl of the

aminoacyl-adenylate, whereas class II enzymes place the 3´-OH in the reactive position

(Arnez and Moras, 1997).

The structural diversity presented by the different combinations of bases, both modified and unmodified, in tRNAs ensures that the cognate molecules can be specifically selected from the cellular pool by the appropriate aaRS (Fersht, 1979). Not only is the accuracy of the selection process dependent on recognition, but it is also enhanced by the stabilization of the transition state for tRNA charging in cognate tRNA- aaRS complexes and the existence of antideterminants in certain tRNAs that prevent interaction with noncognate aaRSs (Ibba and Söll, 2000). A sequential process with multiple steps is likely to be necessary in the recognition of tRNA by an aaRS (Eriani and

Gangloff, 1999; Moulinier et al., 2001). The first step involves formation of an encounter complex, which is driven mainly by interactions with the anticodon of the tRNA (Bovee et al., 1999). Next is a repositioning step where the acceptor end of the tRNA is moved into the active site, followed by proper orientation of the CCA end (Francklyn et al.,

2002). The presence of the adenylate serves to order the tRNA acceptor end and enforce tRNA selection (Cusack et al., 1996).

28 Binding of the tRNA to the aaRS can induce sequence-dependent conformational

changes in the tRNA itself (Ibba and Söll, 2000). Structural rearrangements in the tRNA

anticodon are often seen and can provide a general means of optimizing recognition in both classes of aaRS (Ibba and Söll, 2000). In general, the conserved catalytic domain contains regions near to the active site where the acceptor stem is bound, but a separate and distinct domain binds the anticodon when it is recognized (Ibba and Söll, 2000).

Additionally, both classes of aaRS have flexible loops that change their conformation upon binding of the tRNA. In the class I aaRSs, the loop is called the MSK loop (Perona et al., 1993), while the class II aaRSs have a “flipping loop,” which is located between motifs 1 and 2 and opens up when the correct tRNA is bound (Arnez and Moras, 1997).

1.3.3 Discrimination of amino acids by aaRSs

The ability of an aaRS to discriminate between amino acids is potentially more

problematic than discriminating between tRNAs since the amino acids are considerably

less complex than tRNAs in structure. The amino acid binding pockets of class I aaRSs are open and relaxed, while amino acids are bound by specific rigid templates in the pockets of class II enzymes (Arnez and Moras, 1997). Most amino acids, such as cysteine, are different enough from each other that they can be easily selected by their cognate aminoacyl-tRNA synthetase. Other amino acids, such as valine and isoleucine, which differ by only a single methyl group, cannot be discriminated properly, and could cause potential errors during translation. However, the overall error rate for aminoacyl- tRNA synthetases is only about 1 in 10,000 (Ibba and Söll, 2000). Intrinsic proofreading

29 properties of aaRSs that serve to eliminate amino acids recognized by a noncognate aaRS

are the reason why errors occur at such a low frequency.

During the aminoacylation process, two different types of proofreading of an

amino acid can occur by the aaRS. The first type is called pre-transfer editing, where proofreading occurs at the enzyme-bound aminoacyl-adenylate step, and the second type is called post-transfer editing, where proofreading occurs when the aminoacyl-tRNA is

still enzyme-bound (Ibba and Söll, 2000; Geslain and Ribas de Pouplana, 2004). These

mechanisms enable the enzymes to independently check the products of the two steps of

the reaction.

The molecular mechanisms underlying these proofreading activities have been

termed the “double sieve” model of editing (Fersht, 1977). The idea for this model

comes from steric repulsion, where a smaller substrate can always fit into a larger cavity,

but it is energetically difficult to fit a larger substrate into a cavity built for a smaller one

(Fersht, 1998). According to the double sieve model, at the initial binding step (or first

sieve) at the active site for aminoacylation, amino acids larger than the cognate substrate

are eliminated, whereas smaller amino acids can still bind the aaRS and form the

aminoacyl-adenylate intermediate. The second sieve then acts at the editing site to

hydrolyze the misactivated and/or misacylated tRNAs (Fersht, 1998).

Cis-acting editing domains within the aaRSs have been found. These domains are essential for viability of a cell. Isoleucyl-, valyl- and leucyl-tRNA synthetases are class I aaRSs that contain one type of editing domain named connecting peptide 1 (CP1), which is found in the aminoacylation domain (Geslain and Ribas de Pouplana, 2004). Some class II aaRSs, the prolyl-, alanyl- and threonyl-tRNA synthetases, contain a second type

30 of editing domain. This domain is found in all AlaRSs, in bacterial and eukaryal ThrRSs and in a majority of the ProRSs (Geslain and Ribas de Pouplana, 2004). The archaeal

ThrRSs also perform an editing reaction, but the domain does not seem to be related to other ThrRSs (Beebe et al., 2004; Korencic et al., 2004).

The cooperation of other, separate proteins (acting in trans) has also been observed during aminoacylation (Ibba et al., 1997b). For example, paralogs of parts of

ProRS, AlaRS and ThrRS have been noted that are able to sufficiently hydrolyze misacylated tRNA substrates (Ahel et al., 2003).

1.3.4 Indirect pathways of aminoacylation

Originally, it was thought that each aminoacyl-tRNA was synthesized by a unique aaRS, and therefore the cell should contain 20 aaRSs (Crick, 1958). This hypothesis was confirmed in the following years when the 20 aaRSs were discovered in Escherichia coli, humans and yeast. Early on, however, the absence of some of the aaRSs was noted in many taxa of bacteria, and the sequencing of the genomes of the archaeal organisms

Methanocaldococcus jannaschii and Methanothermobacter thermoautotrophicus also revealed absences of some of the aaRSs (Ibba and Söll, 2000). M. jannaschii and M. thermoautotrophicus were shown to lack asparaginyl- (AsnRS) and glutaminyl-tRNA synthetases (GlnRS), and were also shown to lack the cysteinyl- (CysRS) and lysyl-tRNA synthetases (LysRS) (Tumbula et al., 1999; Francklyn et al., 2002).

Many bacterial and archaeal taxa lack GlnRS, AsnRS or both, but are still able to synthesize Gln-tRNAGln and Asn-tRNAAsn by using indirect pathways (Ibba and Söll,

2000). Nondiscriminating GluRS and AspRS enzymes are able to aminoacylate tRNAGln

31 and tRNAAsn with glutamate and aspartate, respectively. Conversion of these precursors to Gln-tRNAGln and Asn-tRNAAsn is catalyzed by amidotransferases specific for the

mischarged species of tRNA (GluAdT or AspAdT, respectively). The noncognate

species do not represent a threat to the fidelity of translation since they are not recognized by EF-Tu (Ibba and Söll, 2004). In addition to this, the formation of Gln-tRNA is not conserved throughout the three kingdoms. Eukaryotes use direct acylation of tRNAGln by

GlnRS, whereas most prokaryotes and archaea use the transamidation route. However,

bacteria and archaea use different forms of the amidotransferase enzyme. Bacteria use a

heterotrimeric Asp/Glu-tRNA amidotransferase, and the archaea use a related

heterodimeric enzyme (Ibba and Söll, 2004).

Additionally, all organisms use a special methionine tRNA to initiate protein

synthesis. Bacteria, mitochondria and chloroplasts require formylmethionyl-tRNAfMet as

the initiator (Ibba and Söll, 2000). The tRNAfMet is first charged by methionyl-tRNA

synthetase (MetRS) with methionine, which is then formylated to yield formylmethionyl-

tRNAfMet (Ibba and Söll, 2004). This reaction is highly specific in the protein-tRNA recognition process, since the formylation reaction occurs with only the Met-tRNAfMet among all the aminoacyl-tRNAs (Ibba and Söll, 2000). Formylmethionine is not considered an amino acid outside of the canonical 20 because the N-formyl group is removed from mature proteins by peptide deformylase (Giglione and Meinnel, 2001), leaving a canonical methionine at the N terminus of the protein (Ibba and Söll, 2004).

Another example of an indirect route of aminoacylation is selenocysteine, which represents the first known true expansion of the genetic code. As discussed in section

1.2.4, the tRNASec is first misacylated with serine by SerRS. Next, the seryl residue is

32 converted to selenocysteine by selenocysteine synthase, which results in Sec-tRNASec

(Cobucci-Ponzano et al., 2005). SelB (the specialized elongation factor for Sec-tRNASec) only recognizes tRNASec as a substrate when the tRNA is charged with selenocysteine

and not serine (Prætorius-Ibba and Ibba, 2003). It is thought that the specialized structure

of tRNASec contributes to the recognition by selenocysteine synthase and SelB, as well as

the rejection by EF-Tu (Blanquet et al., 2000).

1.3.5 Noncanonical aminoacyl-tRNA synthetases

The route of aminoacylation for tRNACys has long been in question for some archaea, which lack the CysRS necessary for providing Cys-tRNACys for translation. A

noncognate aaRS, O-phosphoseryl-tRNA synthetase (SepRS), has recently been

identified and can specifically form Sep-tRNACys from O-phosphoserine (Sauerwald et al., 2005). Sep-tRNACys is then converted to Cys-tRNACys. This reaction is catalyzed by

a Sep-tRNA:Cys-tRNA synthase (SepCysS; Sauerwald et al., 2005). Furthermore, it is

possible that this pathway can also act as the sole route for cysteine biosynthesis in these

organisms (Sauerwald et al., 2005).

The assignment of an aaRS to one or other of the classes is almost completely

conserved throughout the domains. To date, the only known exception is found among

the lysyl-tRNA synthetases (LysRSs). LysRSs are found as a class II enzyme in

eukaryotes, most bacteria and some archaea and as a class I enzyme in some bacteria and

most archaea (Ibba et al., 1997a; Ambrogelly et al., 2002). Functional and structural

studies show that the class I and class II LysRS enzymes are functionally equivalent, but

structurally unrelated (Prætorius-Ibba and Ibba, 2003). Each form of LysRS behaves as a

33 standard member of its respective class and despite their lack of sequence similarity, both

classes of LysRS are able to recognize the same substrates, tRNALys and lysine. The two

classes of LysRS approach tRNALys from opposite sides, but recognize the same regions

of the tRNA, specifically the anticodon, acceptor stem and discriminator base (Ibba et al.,

1999). However, the importance of particular nucleotides in recognition of tRNALys varies for the two classes of LysRS (Prætorius-Ibba and Ibba, 2003).

Differences in lysine recognition are also present for the two LysRSs. Like all class II enzymes and most class I aaRSs, the class II LysRS does not require tRNALys in

order to generate the aminoacyl-adenylate, whereas the class I LysRS requires tRNALys

binding before generation of the aminoacyl-adenylate (Ibba et al., 1999).

The two classes of LysRS are almost never found together in one organism, but

the only two well-documented exceptions are the Methanosarcineae in the archaea (Jester

et al., 2003) and some Bacilli in bacteria (Ataide et al., 2005). The reason for the

presence of two LysRSs in one organism is as yet unknown.

The C-terminal catalytic domain of PylS resembles those of the class II

synthetases, whereas the N-terminal domain of PylS contains negligible sequence identity

to other known aaRS, but may be involved in tRNAPyl recognition (Krzycki, 2005). PylS

was shown to aminoacylate tRNAPyl with lysine, and so was thought to be a lysyl-tRNA

synthetase (Srinivasan et al., 2002). However, it has been reported that lysyl-tRNAPyl can

be formed by the combined action of the two classes of LysRS enzymes present in the

Methanosarcinaceae, LysRS1 and LysRS2 (Polycarpo et al., 2003). It is also possible

that this activity may be a secondary path to pyrrolysyl-tRNAPyl formation, or used in regulation of pyrrolysine metabolism (Krzycki, 2005). Either way, how pyrrolysine is

34 finally inserted into a nascent peptide was still in question at the time the work described in this thesis was undertaken. Three leading possibilities have emerged. The first is that

LysRS1 and LysRS2 charge tRNAPyl with lysine, and then the proteins encoded by the pylB, pylC, pylD and pylS genes (or some variation therein) subsequently modify lysine to pyrrolysine (Ibba and Söll, 2004). The second possibility is that the ligation of lysine onto tRNAPyl is catalyzed by PylS, and lysine is then modified to pyrrolysine via the pylB, pylC, and pylD protein products (Srinivasan et al., 2002). The third main possibility is that pyrrolysine is ligated directly onto tRNAPyl by an unknown route (Srinivasan et al.,

2002).

1.4 Conclusions

Since selenocysteine was the only model for how a non-canonical amino acid could be incorporated into protein, the mechanism of pyrrolysyl incorporation was thought to be similar. As discussed in section 1.2.4, selenocysteine insertion into protein requires a specialized element in mRNA called the SECIS element. Without this stem- loop, only termination of translation is seen at the UGA codons. Although comparisons between selenocysteine and pyrrolysine insertion have been made, so far there is no experimental proof that an mRNA element directs the insertion of pyrrolysine into protein. One stem loop, now termed the PYLIS (pyrrolysine insertion sequence), has been identified in the monomethylamine and trimethylamine methyltransferase genes and it has been predicted that this element will be required for pyrrolysine insertion

(Pottenplackel, 1999; Namy et al., 2004; Ibba and Söll, 2004). It is likely that an mRNA element directing pyrrolysine insertion will be required, but the predicted PYLIS element

35 is not conserved in the genes encoding the dimethylamine methyltransferase (Zhang et

al., 2005).

Although pyrrolysine and selenocysteine do share some common traits, such as

the genetic encoding by a canonical stop codon and the decoding by a dedicated tRNA,

differences are beginning to emerge. So far, unlike selenocysteine, which is found in all

domains of life, pyrrolysine has been found only in the Methanosarcina spp.,

Methanococcoides burtonii and Desulfitobacterium hafniense. Also, selenocysteine

insertion into protein is directed by a dedicated elongation factor. In vitro experiments

have shown that in terms of a specialized elongation factor, EF-Tu can bind lys-tRNAPyl,

which implies that pyrrolysyl-tRNAPyl should also be recognized by EF-Tu, therefore

negating the need for a specialized elongation factor (Théobald-Dietrich et al., 2004).

At present, it is still unknown as whether UAG can serve as a stop codon in

Methanosarcinaceae genomes. No obvious example of UAG serving as a stop codon

was found using a bioinformatics study of Methanosarcina genomes, whereas clear

examples of UAG serving as a stop could be found in D. halfniense (Zhang et al., 2005).

Therefore, it is possible that the archaea have globally recoded UAG as a sense codon to

decode pyrrolysine.

1.5 Overview of this work

This work will examine two main points of pyrrolysine insertion into protein: the

charging of pyrrolysine onto tRNAPyl catalyzed by the pyrrolysyl-tRNA synthetase, PylS, and the signal/s (or lack thereof) that direct pyrrolysine insertion into protein. The following chapters will cover: a study of PylS which demonstrates that it can charge fully

36 formed pyrrolysine directly onto tRNAPyl (Chapter 2); one of the first experimental

studies to demonstrate that the proposed PYLIS element is not essential for the direction

of pyrrolysine insertion into growing polypeptides (Chapter 3); and, in the Appendix, the first in vitro translation assay to use methanogen mRNA to study readthrough of the

UAG codon in Methanosarcina barkeri MS.

37 CHAPTER 2

CLONING, PURIFICATION AND INITIAL CHARACTERIZATION OF THE

PYRROLYSYL-tRNA SYNTHETASE, PYLS

2.1 Introduction

As discussed in Chapter 1, the pylT and pylS genes were first found in

Methanosarcina barkeri Fusaro in an operon (termed the pyl operon) near the genes

involved in methanogenesis from monomethylamine (Srinivasan et al., 2002). The pylT

gene has a predicted tRNA product with a CUA anticodon (designated tRNACUA), and an

RNA the size of the expected tRNA was seen in M. barkeri MS (Srinivasan et al., 2002).

The pylS gene is predicted to encode a protein similar to a class II aminoacyl-tRNA synthetase. Because the predicted products of these genes appear to be a novel amber- decoding tRNA and a putative aminoacyl-tRNA synthetase, and are not known to be involved in the insertion of the other canonical amino acids into protein, they are predicted to be involved in the insertion of pyrrolysine into growing peptides.

Two possibilities exist regarding the charging of tRNACUA. The first possibility is

that lysine is first charged to the amber tRNA and then modified to pyrrolysine, which is analogous to the system of selenocysteine charging. The second possibility is that fully

38 synthesized pyrrolysine is directly ligated onto the amber tRNA, which is analogous to

the charging of the 20 canonical amino acids.

There is experimental evidence that is consistent with pyrrolysine synthesis on tRNACUA. In initial studies, as assayed by acid precipitation of tRNA ligated to

radioactive lysine, PylS was shown to charge tRNACUA with lysine (Srinivasan et al.,

2002). However, other workers using the assay have not seen this activity (Polycarpo et

al., 2003). Another study has proposed that the two lysyl-tRNA synthetases found in M.

barkeri, LysRS1 and LysRS2, form a ternary complex with tRNACUA to charge lysine onto the amber tRNA (Polycarpo et al., 2003). The authors stated that LysRS2 predominantly catalyzes the aminoacylation reaction, while LysRS1 acts as a type of

chaperone that stabilizes and/or refolds tRNACUA into a conformation required for

aminoacylation (Polycarpo et al., 2003). They postulated that after aminoacylation lysine

is then modified to pyrrolysine by an unknown pathway, which may involve PylS.

Because lysine could be charged onto tRNACUA, a system analogous to that of

selenocysteine was predicted for the insertion of pyrrolysine into protein. However,

pyrrolysine had not yet been synthesized or isolated from the cell, and so no experimental

evidence was available for whether pyrrolysine could be directly charged onto tRNACUA.

Synthetic pyrrolysine was subsequently produced (Hao et al., 2004), and its structure was that of the free amino acid corresponding to the residue found in MtmB

(Hao et al., 2002; Soares et al., 2005). The production of pyrrolysine allowed PylS to be tested as a pyrrolysyl-tRNA synthetase. One problem still was that the N-terminally hexahistidine-tagged PylS protein product used was unstable and often precipitated,

39 which made it difficult to store and so it required frequent isolation. A new clone of M.

barkeri pylS was made, this time adding a C-terminal hexahistidine tag upon expression.

This chapter will describe experiments that demonstrate that PylS-His6 can

directly ligate free pyrrolysine on tRNACUA. This was accomplished using both

tRNACUA transcribed in vitro and cellular pools of tRNA from M. acetivorans in the acid-

urea gel shift aminoacylation assay. Direct charging of pyrrolysine onto tRNA contrasts

with that of selenocysteine, which is synthesized only on tRNA. However, the current

data indicate that pyrrolysine is encoded in DNA using the general mechanism employed

for the common set of 20 amino acids.

2.2 Materials and Methods

2.2.1 Recombinant proteins

The M. barkeri MS and M. acetivorans pylS genes were amplified from isolated genomic DNA (gifts of Gayathri Srinivasan and Anirban Mahapatra, respectively) by

polymerase chain reaction (PCR) using primers M. barkeri MS F: 5'-

CATATGGATAAAAAACCATTAGATG-3', M. barkeri MS R: 5'-

CTCGAGTAGATTGGTTGAAATCCCATTATAG-3', M. acetivorans F: 5'-

CATATGGATAAAAAACCGCTAGACACTC-3' and M. acetivorans R: 5'-

CTCGAGCAGGTTTGTGGAAATCCCGTTAT-3'. The resulting PCR products were

then cloned into pET 22b (Novagen, Madison, WI) to create two strains containing

ppylSH6, which produce PylS with a hexahistidine tag at the C terminus (PylS-His6) in E. coli BL21 (DE3) (Stratagene, La Jolla, CA). The two strains containing ppylSH6 were each grown in 500 mL of LB broth at 37°C to an OD600 of approximately 0.6 and induced

40 with IPTG at a concentration of 1 mM. After induction, cultures were grown for four

hours at 37°C, and then cells were isolated at 5,000 x g for ten minutes. Cell pellets were

rinsed and resuspended in 10 mL of 20 mM sodium phosphate, pH 7.4, 500 mM NaCl, 10 mM imidazole, and then cells were lysed at 20,000 psi. Lysed extracts were then spun at

27,000 x g for twenty minutes. The pellets were discarded and DNase I was added to the supernatants at a final concentration of 2 μg/mL. Five milliliters (or approximately 175 mg of total protein) of supernatant was then loaded onto a 1 mL Ni-activated trap chelating HP column (Amersham Biosciences Corp., Piscataway, NJ). PylS-His6 elutes at 240 mM imidazole during the application to the column of a 40 mL gradient of 10 to

500 mM imidazole in the same sodium phosphate buffer. Eighty 0.5 mL fractions were collected, and peaks observed during elution were screened via SDS-PAGE to determine purity of the protein. Size standards for the SDS-PAGE gels were obtained from

Amersham Biosciences and consisted of myosin (220 kDa), phosphorylase b (97 kDa), albumin (66 kDa), ovalbumin (45 kDa), carbonic anhydrase (30 kDa), trypsin inhibitor

(20.1 kDa) and lysozyme (14.3 kDa).

His6-PylS with a hexahistidine N-terminal tag was also used in some aminoacylation experiments. Extracts of the N-terminally his-tagged PylS were made as stated above. The protein was purified under the same conditions as above, except the

column gradient was 20 mL instead of 40 mL. One milliliter fractions were collected.

These fractions were not observed to precipitate. Enriched fractions of His6-PylS elute

immediately upon application of the gradient.

The lysS gene from M. barkeri MS was cloned by Gayathri Srinivasan

(Srinivasan, 2003) for the recombinant expression of LysS with an N-terminal

41 hexahistidine sequence (His6-LysS). The lysK gene from M. barkeri MS was also cloned

by Gayathri Srinivasan (Srinivasan, 2003) for the recombinant expression of LysK with

an N-terminal hexahistidine sequence (His6-LysK). Both sets of extracts were made

exactly the same way as ppylSH6 and both proteins were purified like PylS-His6 with the

only difference being that during elution, 1 mL fractions were collected. LysS elutes

from the 1 mL nickel-affinity column at approximately 130 mM imidazole, while LysK

elutes at about 310 mM imidazole. A typical yield for both proteins isolated from the nickel column is approximately 1 mg at a concentration of 0.2 mg/mL. The identities of both proteins were then verified by Western blot using anti-his6 antibodies (Immunology

Consultants Laboratory, Newberg, OR).

2.2.2 PylS substrates

L-Pyrrolysine was synthesized and characterized with the use of 13C and 1H NMR

(Hao et al., 2004). TLC analysis revealed no other amino acids (Hao et al., 2004). The pyrrolysine used in charging experiments was further analyzed by electrospray mass spectrometry and revealed two predominant peaks with m/z 256.16 (M + H) and 278.14

(M + Na), where M is L-pyrrolysine (work performed by Ross Larue and Kari Green-

Church).

The cellular tRNA pool was generously isolated by Ross Larue following the

basic method of Jester et al. (2003) from M. acetivorans C2A (OD600 0.6–0.7) growing

on trimethylamine at 37°C in DSM 304 medium (Sowers and Schreier, 1995;

modifications to this medium are listed in Mahapatra et al., 2006). The culture (100 mL

to 200 mL aliquots) was pelleted anaerobically at 15,300 x g for 10 minutes at 4°C. The

42 supernatant was quickly decanted and the pellet washed with 300 µl of cold 0.3 M

sodium acetate, pH 4.5 plus 10 mM EDTA. The pellet was then resuspended in 300 µl of

the wash buffer. An equal volume of cold acid phenol:chloroform (5:1 solution at pH

4.5; Ambion Inc., Austin, TX) was added and the solution was vortexed 4 times for 30

seconds each. In between vortexing, the solution was incubated on ice. The solution

was then centrifuged at 18,000 x g for 15 minutes at 4°C, and was followed by a second

phenol extraction and subsequent centrifugation. Three volumes of cold 100% ethanol

were added to the aqueous phase and the solution was centrifuged at 18,000 x g for 25

minutes at 4°C. The pellet was resuspended in 60 µl of cold 0.3 M sodium acetate, pH

4.5, followed by resuspension in 400 µl 100% ethanol and centrifugation 18,000 x g for

25 minutes at 4°C. The liquid was decanted and the pellet was dried in air. The pellet was then resuspended in 40 µl cold 10 mM sodium acetate, pH 4.5, and quantified by spectrophotometric analysis at 260 nm. As necessary, the tRNA was deacylated by addition of an equal volume of 100 mM Tris-HCl and 100 mM NaCl at pH 9.5 and incubated at 70°C for 30 minutes. This tRNA was then exchanged into 10 mM HEPES

(pH 7.2) using a 1 ml prepared G-25 column from Amersham Biosciences. Agarose-gel electrophoresis indicated that 30% of the ethidium bromide staining material in the preparation was tRNA (the other 70% was mRNA and rRNA). M. barkeri Fusaro tRNACUA transcribed in vitro was produced with the DNA template described previously

(Srinivasan et al., 2002) and the T7-MEGAshortscript transcription kit (Ambion Inc.).

The M. acetivorans gene encoding tRNACUA differs from the pylT gene in M. barkeri MS

by only two bases and is identical in sequence to tRNACUA in M. barkeri Fusaro

(Srinivasan et al., 2002). Therefore, tRNACUA from these different sources could be used

43 with the M. barkeri MS PylS enzyme without noticeably decreasing the efficiency of

aminoacylation.

2.2.3 Aminoacylation and alkaline hydrolysis assays

The assay for aminoacylation of tRNACUA (in a volume of 25 μl) contained 0.8–

1.7 μM purified PylS-His6, 50 mM KCl, 1 mM MgCl2, 5 mM ATP, 0.5 mM DTT and 50

mM synthetic pyrrolysine in 10 mM HEPES buffer pH 7.2, and 8 μg M. acetivorans

tRNA pool preparation or 40 nM of tRNACUA transcript. The reaction was terminated after 5 to 30 minutes at 37°C by addition of an equal volume of 0.3 M sodium acetate, 8

M urea pH 5.0. Ross Larue performed the Northern blotting procedure where charged and uncharged tRNA were separated by acid-urea acrylamide gel electrophoresis (Jester et al., 2003), blotted to nitrocellulose and probed with a 5' 32P-end-labelled, 72-base oligonucleotide complementary to full-length M. acetivorans tRNACUA (Mahapatra et al.,

2006). The probe for the LysS reactions was the full-length 77 nt complement of

lys tRNAUUU (tRNA ) obtained from the genomic M. acetivorans sequence (Genbank

accession number NC 003552) and the probe for the LysK reactions was the full-length

lys 74 nt complement of tRNACUU (tRNA ) also obtained from the genomic M. acetivorans

sequence. LysK or LysS was used in aminoacylation reactions at a concentration of 0.6

μM. Radioactivity was analyzed with a STORM Phosphorimager (Amersham

Biosciences).

In order to test for alkaline hydrolysis, a single reaction was split into two equal

12.5 μl aliquots. One aliquot was immediately placed into 12.5 μl 0.3 M sodium acetate,

7 M urea, pH 5.0 and kept on ice, while the second received 12.5 μl of 100 mM Tris-HCl,

100 mM NaCl, pH 9.5 and incubated for 20 minutes at 70°C. The second aliquot was

44 then mixed with 25 μL of 0.3 M sodium acetate, 7 M urea, pH 5.0. The entire volume of

each treated aliquot was loaded onto an acid-urea acrylamide gel electrophoresis and

aminoacyl-tRNACUA and tRNACUA then detected by Northern blotting.

2.3 Results

2.3.1 A recombinant PylS-His6 can charge in vitro transcribed tRNACUA as well as

native tRNACUA.

Previously, the original pylS clone was engineered so that the gene product would

have an N-terminal his6-tag to be used for purification purposes (Srinivasan et al., 2002).

Unfortunately, the protein product was unstable, and frequently precipitated immediately after purification. This precipitation of N-terminally his-tagged PylS was required to achieve a purified enzyme, and only with the precipitated preparations was a lysyl-tRNA synthetase activity of PylS observed (Srinivasan, 2003). The pylS gene was recloned, and this time, a C-terminal his6-tag was used for purification of the PylS product. The pylS genes from both M. acetivorans and M. barkeri were cloned in case one protein was

easier to isolate than the other. Upon purification, only PylS from M. barkeri could be

purified in a single step, whereas PylS from M. acetivorans required further purification.

Because of this, only the M. barkeri PylS was used in further experimentation. The mass

of this protein was approximated at 50 kDa, which matches that predicted from the pylS

sequence (Figure 2.1). A typical yield of PylS-His6 from the nickel column averaged

around 1.6 mg at a concentration of 0.4 mg/mL. Also, the PylS-His6 protein did not

precipitate upon isolation and could be stored in 40% glycerol for approximately a month

at -20°C. After that, there was approximately a 50% loss in activity.

45 Because radioactive pyrrolysine was not yet available, and acid precipitation

assays can only be done using a radioactive amino acid, all analyses of the PylS-His6

protein were performed using gel shifts. In this analysis, charged and uncharged tRNA

species can be separated by electrophoresis in a denaturing acid-urea polyacrylamide gel

(Ho and Kan, 1987; Varshney et al., 1991) and tRNACUA was specifically detected by

Northern blotting with an oligonucleotide probe that is complementary to tRNACUA. This oligonucleotide can hybridize to a tRNA in the pool of tRNAs isolated from wild-type M. acetivorans, but not to a tRNA in the tRNA pool from a pylT deletion mutant of M. acetivorans, demonstrating that it is specific for tRNACUA (Mahapatra et al., 2006). In

this chapter, Ross Larue performed all Northern blotting, while I cloned pylS, purified the

gene product and performed all the assays used in the Northern blotting procedures.

Initial assays were performed in order to determine whether PylS-His6 could

catalyze the charging of tRNACUA. First, a time course assay was done using synthetic

pyrrolysine (Hao et al., 2004) and tRNACUA (in the isolated tRNA pool from M.

acetivorans) as substrates. Both tRNACUA and aminoacyl-tRNACUA were detected,

demonstrating that PylS-His6 charged tRNACUA with pyrrolysine (Figure 2.2A). Over the

course of 40 minutes, approximately 50% of tRNACUA was charged with pyrrolysine,

showing that 1 μg of PylS can catalyze the charging of tRNACUA in a time-dependent

manner. Additionally, in a separate 40 minute assay, increasing the amount of enzyme

from 0.2 μg to 2 μg demonstrated that the amount of charged tRNACUA was dependent on

PylS, and also showed that the charging did not significantly increase when the amount

of PylS was increased from 1 μg to 2 μg (Figure 2.2B).

46

Figure 2.1. Single column purification of PylS. Coomassie-stained 12% SDS-PAGE gel of: 1, protein standards for mass determination, masses are indicated to the left in kilodaltons (kDa); 2, cell extract (100 μg protein) of E. coli transformed with ppylSH6; and 3, affinity purified PylS-His6 (5 μg).

In vitro transcribed tRNACUA was also aminoacylated with synthetic pyrrolysine by PylS-His6 in an ATP-dependent reaction. We observed that PylS-His6 aminoacylated

a maximum of 43% of in vitro transcribed tRNACUA with pyrrolysine during the course

of our experiments (Figure 2.3). This is near the 50% charging that is seen with reactions

containing M. acetivorans pool tRNA.

47

Figure 2.2. PylS aminoacylates a maximum of 50% of tRNACUA with pyrrolysine as determined by acid-urea gel shifts. M. acetivorans pool tRNA was used. A) A time course over 40 minutes shows increasing amounts of charged tRNACUA. 1 μg of PylS was used in each reaction. B) Using a fixed timepoint assay performed over 30 minutes, the amount of PylS was raised from 1 μg (lane 3) to 2 μg (lane 4), and no dramatic increase of the amount of pyrrolysyl-tRNACUA was seen. Lane 1 contains 0.2 μg PylS and lane 2 contains 0.5 μg PylS. In A) and B), upper arrows indicate the charged species of tRNACUA, while lower arrows indicate the uncharged species. The increases discussed here reflect the final percent of pyrrolysine-charged tRNACUA, and do not imply that the rate of the reaction increased.

Additionally, alkaline hydrolysis showed that the shifts in the Northern blots are

due to aminoacylation of tRNACUA. Both tRNACUA and aminoacyl-tRNACUA were

detectable in the isolated cellular tRNA pool. In order to test for alkaline hydrolysis, at

the end of aminoacylation reactions either containing or not containing pyrrolysine, the

reactions were split into two equal aliquots. One aliquot was terminated as usual and the

second aliquot was deacylated in the presence of 70ºC heat and alkaline (pH 9.5)

48 conditions. After acid urea gel electrophoresis and Northern blotting, maximal

conversion of deacylated tRNACUA to a species that migrated with the same

electrophoretic mobility as the aminoacyl-tRNACUA present in the extracted cellular

tRNA pool was seen in the reaction containing pyrrolysine (Figure 2.4).

Figure 2.3. Aminoacylation of in vitro transcribed tRNACUA with pyrrolysine by PylS-His6. PylS-His6 aminoacylated a maximum of 43% of in vitro transcribed tRNACUA with pyrrolysine. The reaction was incubated at 37°C for either: 1, 0 minutes; or 2, 5 minutes before being terminated.

49

Figure 2.4. Alkaline hydrolysis of pyrrolysyl-tRNACUA formed in vitro by PylS-His6. ATP and PylS-His6 were incubated in 2 separate reactions in the presence or absence of pyrrolysine, then either analyzed as usual or subjected to alkaline hydrolysis. M. acetivorans pool tRNA was used. The upper arrow indicates the charged species of tRNACUA, while the lower arrow indicates the uncharged species.

2.3.2 PylS ligates only pyrrolysine on tRNACUA.

Having shown that pyrrolysine is a substrate for PylS, the next question was

whether pyrrolysine is the only substrate for PylS. Figure 2.5 shows that aminoacylated

tRNACUA was not formed by PylS-His6 in the presence of a mixture of the 20 canonical

amino acids each at 50 μM, or in the presence of only 50 μM lysine, but was formed after

the further addition of synthetic pyrrolysine to these reactions. PylS-His6 aminoacylation of tRNACUA is therefore specific for pyrrolysine as a substrate, even in the presence of

other amino acids.

50

Figure 2.5. Aminoacylation of tRNACUA by PylS using differing amino acid substrates. All reactions were assayed as described in Materials in Methods except that the amino acid substrate (each at 50 μM) was varied. M. acetivorans pool tRNA was used. Each lane represents reactions with the following: 1, complete reaction; 2, no amino acid; 3, no ATP plus pyrrolysine; 4, pyrrolysine but lacking PylS-His6; 5, pyrrolysine plus a mixture of the 20 canonical amino acids; 6, a mixture of the 20 canonical amino acids only; 7, pyrrolysine plus lysine; 8, lysine only; 9, complete reaction. Lane 3 (-ATP, + enzyme) shows a minor shift. This is most likely due to ATP contamination within the PylS preparation. The upper arrow indicates the charged species of tRNACUA, while the lower arrow indicates the uncharged species.

Additionally, no contaminating pyrrolysyl-tRNA synthetase activity was seen in

extracts of cells containing the pylS cloning vector, pET 22b. E. coli bearing ppylSH6 or

only the cloning vector were induced with IPTG and the extracts were tested for

pyrrolysyl-tRNA synthetase activity. Both purified PylS and the extract of E. coli

bearing ppylS catalyzed the aminoacylation of tRNACUA, but no activity was detectable

in extracts of E. coli bearing only pET22b (Figure 2.6).

51

Figure 2.6. Aminoacylation of tRNACUA using differing enzyme preparations. No aminoacylation of the tRNA pool was detectable in the preparation containing the vector only (lanes 1 and 2), while both the PylS extract (lanes 3 and 4) and purified PylS (lanes 5 and 6) aminoacylated tRNACUA when incubated with pyrrolysine. M. acetivorans pool tRNA was used. The upper arrow indicates charged tRNACUA, while the lower arrow indicates the uncharged species of tRNACUA.

Finally, we previously observed an aminoacylation activity with N-terminally

His-tagged PylS (His6-PylS) as assayed by acid precipitation of radioactive lysine ligated on tRNA (Srinivasan et al., 2002). However, no lysyl-tRNA synthetase activity was detectable with His6-PylS using the gel-shift aminoacylation assay, in agreement with a recent report (Polycarpo et al., 2003). In contrast, His6-PylS does have pyrrolysyl-tRNA synthetase activity as demonstrated by the gel-shift aminoacylation assay (Figure 2.7).

52

Figure 2.7. Aminoacylation of tRNACUA by N-terminally His-tagged PylS. A lysate of E. coli expressing PylS as an N-terminally His-tagged protein was passed over a nickel affinity column, and the eluent collected upon application of the imidazole gradient was tested for pyrrolysyl-tRNA synthetase activity using the M. acetivorans tRNA pool as substrate.

Lys 2.3.3 PylS specifically charges tRNACUA and LysS and LysK only charge tRNA in

vitro.

M. barkeri possesses two lysyl-tRNA synthetases, termed LysK and LysS. These

enzymes have been reported to carry out the in vitro lysylation of tRNACUA (Polycarpo et

al., 2003), and therefore we tested the possibility that they could also carry out the

aminoacylation of tRNACUA with pyrrolysine. E. coli strains bearing expression vectors

carrying lysK or lysS (modified so as to produce N-terminally his-tagged proteins) were prepared previously by Gayathri Srinivasan (Srinivasan, 2003). The two strains were induced with IPTG and the synthetases were isolated from extracts (Figure 2.8). As

53 shown in Figure 2.9, PylS-His6 was tested alongside His6-LysS and His6-LysK to see any detectable charging of both tRNALys species with either lysine or pyrrolysine. The

Northern blots were probed with oligonucleotides complimentary to both species of

Lys Lys tRNA , and His6-LysS and His6-LysK were shown to recognize and charge tRNA with lysine (Figure 2.9A). However, charging by His6-LysS or His6-LysK of either lysyl-

tRNA species with pyrrolysine was not detectable. In addition, no charging activity by

PylS was evident with either substrate (Figure 2.9B).

Figure 2.8. Coomassie-stained 12% SDS-PAGE gel showing LysS and LysK enriched from protein extracts. Lane 1 is 5 μg LysS, lane 2 is 5 μg LysK and lane 3 is the molecular weight standard.

54 Furthermore, recombinant LysS and LysK were tested for their ability to

recognize and charge tRNACUA with either lysine or pyrrolysine. His6-LysS and His6-

LysK were tested individually as well as together. As seen in Figure 2.10, no aminoacylated tRNACUA was detectable in either situation. Only charging of tRNACUA by PylS-His6 was detectable, and this reaction occurred with pyrrolysine and not lysine.

Finally, His6-LysS and His6-LysK were combined and, over an extended assay

period, were tested for any ability to charge tRNACUA. The assay was conducted over 80 minutes and lysine and pyrrolysine were each tested as potential substrates. PylS-His6

was also tested for an ability to charge tRNACUA when supplemented with 100 mM

lysine, but all other reaction conditions remained unchanged. Using either lysine or

pyrrolysine as a substrate, no charging of tRNACUA by LysK and LysS in combination

was evident (Figure 2.11). In addition, charging of tRNACUA by PylS-His6 was only

detectable with pyrrolysine as a substrate, even when tRNACUA and PylS-His6 were

incubated with elevated levels of lysine over an extended period of time.

55

Lys Figure 2.9. LysS or LysK, but not PylS, can aminoacylate tRNA . A) His6-LysS Lys (lanes 1-3) and His6-LysK (lanes 4-6) charge tRNA with lysine, but charging is not evident with pyrrolysine. The upper arrow indicates the charged species of tRNA, while the lower arrow indicates the uncharged tRNA species. B) PylS (lanes 1-3) does not detectably charge tRNALys with either lysine or pyrrolysine. The arrow represents the uncharged species of tRNA. Both A) and B) were probed with an oligonucleotide complementary to tRNAUUU. Results were the same when the blots were probed with an oligonucleotide complimentary to tRNACUU.

56

Figure 2.10. Only charging of tRNACUA with pyrrolysine by PylS is detectable. The blot was probed by an oligonucleotide complementary to tRNACUA. The upper band seen in lane 10 is the charged species of tRNACUA, and all other bands represent the uncharged species of tRNACUA.

57

Figure 2.11. Charging of pyrrolysine or lysine onto tRNACUA by a combination of LysS and LysK is not detectable. An extended 80 minute assay demonstrates that only PylS charging of tRNACUA with pyrrolysine is evident. The blot was probed with an oligonucleotide complementary to tRNACUA. Assays were performed as stated in Materials and Methods, except in Lane 2 where 100 mM lysine was added. The upper arrow indicates the charged species of tRNACUA while the lower arrow indicates the uncharged species.

2.4 Discussion

The hypothesis that PylS can directly ligate pyrrolysine onto tRNACUA was not directly testable until synthetic pyrrolysine became available (Hao et al., 2004). With the synthesis of pyrrolysine, a new pylS clone, and the acid-urea gel shift assay, we have now been able to prove that pyrrolysine is ligated onto tRNACUA by PylS, where it is then inserted into protein (Blight et al., 2004). These data clearly demonstrate that PylS can

58 act in vitro as a pyrrolysyl-tRNA synthetase, and this is the first example found in nature of specific aminoacylation of a tRNA with a non-canonical amino acid.

Previously, different laboratories had disagreed as to the role that PylS played in

tRNACUA charging. The thought at the time was that lysine was charged on tRNACUA, and was then modified to pyrrolysine either before or after insertion into protein. This was the expected scheme, since selenocysteine is ligated on the selenocysteinyl-tRNA as a serine, and then modified to selenocysteine (Forchhammer et al., 1991; Forchhammer and Böck, 1991; Stadtman, 1996). Our laboratory proposed that PylS could charge tRNACUA with lysine (Srinivasan et al., 2002). However, in our hands, N-terminally his-

tagged PylS was extremely unstable and often precipitated. The misfolding that likely

occurred during this precipitation is potentially why PylS demonstrated a lysyl-tRNA

synthetase activity. Because His6-PylS is so unstable, it is possible that even during

“successful” rounds of purification where there was no apparent precipitation, some

precipitated protein was present and used in the acid precipitation assays. This precipitated protein could have even been contaminated with an E. coli LysRS, and so could have charged lysine onto tRNACUA.

In contrast to our proposition, Dieter Söll’s laboratory proposed that the two

lysyl-tRNA synthetases, LysRS1 and LysRS2, can charge tRNACUA with lysine, and PylS

may only be supplemental in pyrrolysyl formation (Polycarpo et al., 2003). However, we

have not been able to replicate the phenomenon of charging of tRNACUA by the two

lysyl-tRNA synthetases (either separately or in combination) using the acid-urea gel shift

assays, even during extended assay incubations and with high amounts of amino acid

added to the reactions. In addition, we see no evidence of ligation of pyrrolysine onto

59 tRNALys by LysRS1 and LysRS2. The acid-urea gel shift is sensitive enough to detect

down to approximately 10% charged tRNA, but only one turnover per hour is observed

with the two lysyl-tRNA synthetases (Polycarpo et al., 2003). It is possible that charging

was occurring but was not detected because the charging reaction happens so slowly.

Finally, strains of M. acetivorans that contain a deletion of either lysK or lysS have no

discernible phenotype from that of wild-type M. acetivorans (Mahapatra et al.,

manuscript in preparation). No decrease in the levels of pyrrolysylated tRNACUA was seen in either strain when compared to wild-type M. acetivorans (Mahapatra et al., manuscript in preparation). Nonetheless, this activity might play a role as an ancillary path to pyrrolysyl-tRNA formation.

Because the gel-shift aminoacylation assay shows that PylS-His6 is a pyrrolysyl-

tRNA synthetase, other activities should also be present in this enzyme, such as a pyrophosphate:ATP exchange activity dependent on pyrrolysine. PylS-His6 has been

tested in our laboratory using a 32P-pyrophosphate exchange assay. As a prerequisite to

tRNA aminoacylation, an aminoacyl-adenylate and pyrophosphate are formed from the

amino acid and ATP by an aminoacyl-tRNA synthetase (Schimmel and Söll, 1979). This

reversible activation reaction can be assayed by the isotopic exchange of 32P-

pyrophosphate into ATP, which is dependent on the addition of the cognate amino acid for the aminoacyl-tRNA synthetase in question (Cole and Schimmel, 1970). PylS-His6

catalyzes a pyrophosphate-ATP isotopic exchange reaction on the addition of synthetic

pyrrolysine and no other amino acid (Blight et al., 2004). As with most reactions

involving class II aminoacyl-tRNA synthetases (Francklyn et al., 2002), this reaction is

not dependent on the addition of cellular tRNA.

60 While the charging of tRNACUA with pyrrolysine by PylS-His6 has now been proven in vitro, one question that still remained was whether this aminoacylation activity could be seen in vivo. To answer this question, an untagged pylS gene was introduced into E. coli in order to see whether it could allow the translation of UAG codons, and whether this would be dependent on the presence of pyrrolysine. The mtmB1 gene was then introduced into the pylS-bearing E. coli BL21 (DE3) strain as a reporter of UAG translation as a sense codon. Finally, the pylT gene was cloned into this same E. coli

strain and the expression of mtmB1 was monitored in the presence and absence of

exogenously added pyrrolysine. Only the strain that had exogenously added pyrrolysine

produced above background levels of pyrrolysine-containing full-length MtmB, showing

that UAG readthrough is dependent on the presence of pyrrolysine (Blight et al., 2004).

Our laboratory then tested the strain lacking either the pylS or pylT genes, and

demonstrated that either little or no full-length MtmB was detectable (Blight et al., 2004).

This experiment showed that in the presence of pyrrolysine, only pylT and pylS are required for its insertion into protein in a recombinant system. This also verifies that

PylS can act as a pyrrolysyl-tRNA synthetase in vivo.

The in vivo data are corroborated by other in vitro data showing that EF-Tu from

T. thermophilus can bind lysyl-tRNACUA (Théobald-Dietrich et al., 2004). The in vitro

data demonstrate that there is no obvious problem with the aminoacylated tRNACUA that

would prevent it from interacting with EF-Tu. This likely means that there is no required

dedicated translation factor for pyrrolysyl-tRNACUA, but does not rule out the possibility.

Again, this differs from the selenocysteine insertion model, since selenocysteinyl-

61 tRNASec is not recognized by EF-Tu (Förster et al., 1990), and instead does require a

dedicated selenocysteine translation factor (SelB; Commans and Böck, 1999).

To date, PylS has only been found in Methanosarcina and Methanococcoides spp.

and a single Gram-positive organism, Desulfitobacterium hafniense. Interestingly, the

pylS gene in D. halfniense is split into two parts within the pyl operon, a carboxy-terminal

(pylSc) and an amino-terminal (pylSn) gene, which sandwich the pylBCD genes that are

thought to be involved in pyrrolysine biosynthesis (Srinivasan et al., 2002). A notable

divergence occurs in the archaeal PylS sequences in the region corresponding to the split

between the pylSn and pylSc genes, which suggests that there are two domains within

PylS (Krzycki, 2005). Alignments of the PylS proteins show that the carboxy-terminal domain has the characteristic catalytic residues of the active site common to class II aminoacyl-tRNA synthetases (motifs 1, 2 and 3), whereas the amino-terminal domain is not recognizably related to those of known aminoacyl-tRNA synthetases, but might be involved in tRNACUA recognition (Krzycki, 2005). However, PylS appears to be closely

related to the phenylalanyl- and class II lysyl-tRNA synthetases.

Since the discovery of the original twenty amino acids, pyrrolysine is the first example of a natural amino acid that is inserted into protein using a cognate aminoacyl- tRNA synthetase/tRNA pair. Even selenocysteine, the 21st amino acid, is never found

free in solution and requires a canonical seryl-tRNA synthetase for charging. Thus, the

st PylS/tRNACUA pairing is only the 21 to be found in nature.

62 CHAPTER 3

IN VIVO CHARACTERIZATION OF UAG TRANSLATION IN METHANOSARCINA:

ROLE OF THE PROPOSED “PYLIS” ELEMENT

3.1 Introduction

Pyrrolysine is the 22nd amino acid found to have entered the natural genetic code. An amber (UAG) codon was initially identified within the reading frame of the mtmB1 gene encoding MtmB, a methyltransferase initiating methanogenesis from monomethylamine (Burke et al., 1998; Paul et al., 2000). However, rather than serving as a stop codon during formation of the full-length product, the amber codon is translated

(Paul et al., 2000; James et al., 2001). Crystallography of MtmB demonstrated that UAG is translated as pyrrolysine (Hao et al., 2002). Mass spectrometry confirmed pyrrolysine as the UAG-encoded residue of MtmB, and further demonstrated that in-frame UAG codons within the trimethylamine and dimethylamine methyltransferases genes also encoded pyrrolysine (Soares et al., 2005). Genes that encode pyrrolysine have been found in Methanosarcina spp. (Deppenmeier et al., 2002; Galagan et al., 2002), the closely related Methanococcoides burtonii (Saunders et al., 2003), and the Gram-positive bacterium Desulfitobacterium hafniense (Srinivasan et al., 2002).

63 The use of a canonical stop codon to encode an amino acid has precedent in the

genetic encoding of another atypical amino acid, selenocysteine, with UGA codons. It was anticipated that the genetic encoding of pyrrolysine would be much like that of selenocysteine. Indeed, both amino acids have their own dedicated tRNA species with the appropriate anticodons to decode UGA or UAG as sense codons. However, here the mechanisms by which pyrrolysine and selenocysteine have gained entrance to the genetic code deviate. Selenocysteinyl-tRNASec is formed indirectly from seryl-tRNASec, which is made by seryl-tRNA synthetase (Forchhammer et al., 1991; Forchhammer and Böck,

Pyl 1991; Stadtman, 1996). However, tRNACUA (now termed tRNA ) has been shown by

both in vitro and in vivo evidence to be charged directly with free pyrrolysine by a

dedicated pyrrolysyl-tRNA synthetase (Blight et al., 2004; Polycarpo et al., 2004).

The genetic encoding of pyrrolysine or selenocysteine entails the additional

problem of how to suppress the typical stop function of codons such as UAG or UGA

while encouraging their translation as sense codons. For selenocysteine, this problem is

resolved by a cis-acting element formed from a selenocysteine insertion sequence

(SECIS) found 3' to the UGA codon (Zinoni et al., 1990). The placement of SECIS

elements within selenoprotein transcripts differs in organisms from different domains.

SECIS elements are found immediately 3' of the UGA codon in Bacteria (Zinoni et al.,

1990), but within the 3' untranslated region (UTR) of the transcript in Archaea (Wilting et

al., 1997) and Eucarya (Berry et al., 1991). SECIS elements form stem-loop secondary

structures that function in direct or indirect binding of selenocysteinyl-tRNASec specific

elongation factors. This binding increases the local concentration of the UGA-decoding

tRNA and allows a more effective competition with release factors. SECIS elements are

64 absolutely essential for translation of a selenoprotein transcript, and translation of UGA as selenocysteine can occur in a transcript in which UGA is normally a stop only if a

SECIS element has been introduced (Shen et al., 1993; Kollmus et al., 1996).

The question of requirements for analogous cis-acting elements for UAG

translation as pyrrolysine has not been addressed by direct in vitro or in vivo examination.

Largely, this has been due to the difficulty of genetic approaches with the slow-growing

and strictly anaerobic methanogenic Archaea. Primarily bioinformatic approaches have

gleaned what information is available from the sequenced genomes. A putative

pyrrolysine insertion element (PYLIS), which is highly conserved among known mtmB

genes in Methanosarcina spp., was identified downstream of the UAG codon within the

mtmB1 gene (Pottenplackel, 1999; Ibba and Söll, 2004; Namy et al, 2004). Structure

probing of in vitro transcribed mtmB1 has now shown that the PYLIS element does exist

in solution, although with a slightly different secondary structure than was originally

proposed (Théobald-Dietrich et al., 2005). A similar structure with conserved sequence

elements is also present in the mttB gene from Methanosarcina barkeri and an mttB

homolog in D. hafniense (Pottenplackel, 1999; Ibba and Söll, 2004). A stem-loop is

found downstream of the UAG within the mtbB1 gene encoding the DMA

methyltransferase, but it has no discernable similarity to the mtmB1 PYLIS element

(Pottenplackel, 1999; Zhang et al., 2005). It has been argued that the lack of any

similarity between downstream elements indicates that selenocysteine and pyrrolysine

might use dissimilar coding strategies (Zhang et al., 2005). Indeed, examination of

genome sequences from several Methanosarcina spp. left doubt as to whether the

65 canonical function of UAG as a stop codon was in fact conserved within these Archaea

(Zhang et al., 2005).

In order to help resolve these seemingly opposing views derived from genomic

sequence information, we report here the first direct examination of the in vivo

requirements for cis-acting elements within transcripts for UAG translation as

pyrrolysine. Previously, using a plasmid-based construct called pDL05C, our laboratory

found that there is no absolute need for the untranslated regions (UTRs) of natural mtmB1

transcripts (personal communication). The M. barkeri mtmB1 gene was introduced into

pWM311, thus creating pDL05C. This is a medium-copy number plasmid carrying the

pac gene, which encodes the puromycin resistance cassette. Transcription of mtmB1 was

driven by the M. voltae methyl-CoM reductase promoter (Pmcr), which is responsible for

the constitutive transcription of the genes encoding methyl-CoM reductase. A

hexahistidine encoding sequence was ligated to the mtmB1 reading frame to produce M.

barkeri MtmB with a C-terminal his-tag (MtmB-His).

The requirement of the PYLIS element for full-length MtmB production could

then be focused upon since the UTRs in the mtmC1B1 or mtmC1B1P transcripts from M. barkeri are not required for pyrrolysine insertion. In this chapter, using the newly

developed genetic techniques for M. acetivorans, we show there is no absolute need for the putative PYLIS element for UAG translation as pyrrolysine. Additionally, we demonstrate that an amber codon in a foreign gene does act as a translation stop, but also acts efficiently as a sense codon for pyrrolysine. These results suggest minimal context is required within messages in which UAG is translated as pyrrolysine, and that a phenomenon akin to amber suppression might underlie UAG translation as pyrrolysine.

66 This scenario greatly contrasts with the mechanism by which selenocysteine, another

non-canonical amino acid, is incorporated at UGA codons.

3.2 Materials and Methods

3.2.1 Construction of C-terminally his-tagged mtmB and PYLIS mutants

The plasmid pDL05C was designed and constructed by David Longstaff. The M.

barkeri methyl-CoM reductase promoter was taken from plasmid pJK60 (a gift from

William Metcalf) using the restriction enzymes Xba I and Nde I, where the promoter was then ligated to the 5' end of the mtmB1 gene from M. barkeri in pCJ09 (James et al.,

2001). This mtmB1 fragment did not contain the 5' and 3' untranslated regions. The promoter and gene were amplified to add a C-terminal hexahistidine tag to mtmB1 using primers:

F 5'-GGCCAGGACCCAACGCTGCCCG-3' 5'- R TTATTATTATTATTAGTGGTGGTGGTGGTGGTGTCCTCCGAATACAAGTCCCAGGTCTTC- 3'

An adenosine was added to the 3' end of the product and the product was then

ligated into the TA vector pGEM-T (Promega Corp., Madison, WI). Two orientations of

the insert were possible at this stage and these were named pDL02 and pDL03. The

reverse orientation construct, pDL03, was used to move the mtmB1 + promoter into the

Methanosarcina acetivorans shuttle vector pWM311 (a gift from William Metcalf) using

Sph I sites located in the PMCR region and downstream of the mtmB1 gene in pGEM-T.

This ligation resulted in the construction of pDL05C.

67 To make the PYLIS mutants, five sets of mutations were introduced via mutagenesis into the predicted PYLIS element in the mtmB1-containing plasmid pDL05

(Fisher and Pei, 1997). Constructs were fully sequenced to ensure no other mutations had occurred within the gene.

Primers used to construct the mutants are as follows (listed 5' to 3'):

Primer Primer Sequence PYLIS 1F TAGGGCCCAGAGACATCACTGTCCGCTCAGGGA PYLIS 1R TCCCTGAGCGGACAGTGATGTCTCTGGGCCCTA PYLIS 2F CCCAGAGACCTCCCTCTCAGCTCAGGGAAACATT PYLIS 2R AATGTTTCCCTGAGCTGAGAGGGAGGTCTCTGGG PYLIS 3F TCAGGGAAACATTTCAGCAGACTGTACCGGCGGAATG PYLIS 3R CATTCCGCCGGTACAGTCTGCTGAAATGTTTCCCTGA PYLIS 4F TTCCGCTGATTGTACAGGGGGTATGACCTGCACGGAC PYLIS 4R GTCCGTGCAGGTCATACCCCCTGTACAATCAGCGGAA PYLIS 5F GACCTGCACGGACAGTCATGAGGTATCGCAACTAAACGAA PYLIS 5R TTCGTTTAGTTGCGATACCTCATGACTGTCCGTGCAGGTC

All constructs were then introduced into M. acetivorans using liposome-mediated

transformation and colonies were screened for the correct plasmid DNA. Strains were

grown on HSMA (high salt buffer plus methanol and acetate; previously described in

Metcalf et al., 1997) to mid-log phase, and harvested by centrifuging 10 ml of culture, then rapidly rinsing the pellet in 50 mM Mops buffer, pH 7.0. Cells were osmotically lysed by adding approximately 0.4 ml 50 mM Mops buffer, pH 7.0 to the pellet and homogenizing. The lysate was centrifuged and the supernatant was stored at -20˚C.

68 3.2.2 Deletion of PYLIS from pDL05C

A PYLIS knockout was engineered by first using the method of Fisher and Pei

(1997) to mutate pDL05 in order to introduce an Spe I site approximately 90 bp

downstream of the TAG codon within mtmB.

Primers used were:

F 5'-GGACAGCCACGAGGTCTCGCAACTAGTCGAACTCAAGATTGATCTTGATGC-3' R 5'-GCATCAAGATCAATCTTGAGTTCGACTAGTTGCGAGACCTCGTGGCTGTCC-3'

After digesting the mutated pDL05 with Apa I and Spe I, a portion of the metH coding sequence from E. coli DH5α was inserted. This was done by first using PCR to amplify the MetH coding region between amino acid residues 434 and 458 using primers that would introduce an Apa I site at the 5' end of the fragment and an Spe I site at the 3' end. The nucleotide sequence of metH from E. coli K12 (Genbank Accession J04975) and the secondary structures of the protein product were obtained from Evans et al.

(2004). Primers used were:

F 5'-GGGCCCCTCCTCAAAATGGGACGTCATTGAA-3' R 5'-ACTAGTGAGATAGAGTTAACAATGCCTTTGCC-3'

This product was then cloned into the pCR-Blunt II-TOPO vector (Invitrogen

Corp., Carlsbad, CA) where it was digested with Apa I and Spe I and ligated into the

mutated and digested pDL05 vector, thus creating pMetDL05C. This construct was fully

sequenced to verify that no base changes, insertions or deletions had occurred. The

construct was then transformed into M. acetivorans. Puromycin-resistant colonies were

then screened for the correct plasmid DNA by extraction of the DNA from liquid cultures

69 and subsequent retransformation into E. coli. Sequence analysis of the metH region was

then done to confirm the construct.

3.2.3 Western blotting of MtmB constructs

Two hundred micrograms of cellular protein for each strain was electrophoresed at approximately 100 V overnight on an SDS-PAGE 12.5% gel following the method of

Laemmli (1970). Size standards for the SDS-PAGE gels were obtained from Amersham

Biosciences and were myosin (220 kDa), phosphorylase b (97 kDa), albumin (66 kDa), ovalbumin (45 kDa), carbonic anhydrase (30 kDa), trypsin inhibitor (20.1 kDa) and

lysozyme (14.3 kDa). The gel was then presoaked and transblotted in CAPS buffer, pH

11.0 at 40 volts for 3 hours to a PVDF membrane as in Sambrook et al. (1989). The

membrane was washed briefly in deionized H2O, and then blocked for two hours using

5% milk powder solution. Anti-MtmB rabbit IgG, affinity purified as in James et al.

(2001), was added directly to the blocking solution at a dilution of 1:600 and incubated

overnight. When anti-his6 Western blots were performed, rabbit anti-his6 IgG

(Immunology Consultants Laboratory, Newberg, OR) was used at a 1:2000 dilution. The blot was then washed three times for ten minutes each with 0.9% NaCl in 10 mM Tris-

HCl, pH 7.4. Anti-rabbit Ig-linked horseradish peroxidase from donkey (Amersham

Biosciences Corporation, Piscataway, NJ) was added to the washing solution at a 1:2000 dilution and incubated with the blot for two hours. The blot was washed as before and developed using 4-chloro-1-naphthol/H2O2 (Sigma-Aldrich, St. Louis, MO).

70 3.2.4 ELISA analysis of PYLIS mutants

ELISA analysis was performed based on the antibody capture assay listed in

Harlow and Lane (1988) in 96-well microtiter plates (Nalge Nunc, Rochester, NY). Anti- his6 antibodies (Immunology Consultants Laboratory) were used at a concentration of

1:6400 and anti-rabbit Ig-linked horseradish peroxidase from donkey (Amersham) was used at a concentration of 1:1000. ELISAs were developed using 0.1 mg 3,3',5,5'- tetramethylbenzidine (predissolved in DMSO) in 10 mL 100 mM sodium acetate, pH

6.0/0.01% H2O2. After 2-5 minutes, 1 M H2SO4 was added to terminate reactions and plates were read at 450 nm.

3.2.5 PCR screens of the strain containing pMetDL05C for possible chromosomal recombination

Each PCR screen used primers at a concentration of 2 pM and all reactions used

Ex-taq HS DNA polymerase (Takara Mirus Bio, Madison, WI). Reactions were performed on an Eppendorf Mastercycler gradient PCR machine (Fisher) and used 25 cycles, with an annealing temperature of 73ºC (for one minute) and an extension temperature of 68ºC (for 2 minutes). Primers used are as in Figure 3.4 and have the sequences:

A (PMCR) 5'-GAGTGCAAAGGCACTCGAGTAGGTG-3' B (R) 5'-CTTCTCCCATCATCCTGGCTTCC-3' C (His6) 5'-TTATTAGTGGTGGTGGTGGTGGTG-3' D (MTMC) 5'-CGCTGCCGAAGCTGCAAAAGTTGC-3'

71 3.2.6 Quantitative PCR

Quantitative real-time PCR analysis was performed on the pDL05, pMetDL05C,

PYLIS 4 and PYLIS 5 strains. All strains were grown up in duplicate on HSMA media to an OD600 between 0.5 and 0.6. Total cellular DNA was purified as in Mahapatra et al.

(2006), and then quantified using the Quant-iT PicoGreen dsDNA kit (Invitrogen). The amount of pDL05C derivative present in the DNA samples was estimated by quantitative

PCR employing the BioRad iCycler iQ Real-time PCR Detection System and iQ Sybr

Green Supermix (Bio-Rad laboratories, Hercules, CA). The primers used specifically amplify the pac gene. Primer sequences are

F 5'-CCGACCACCAGGGCAAGG-3' R 5'-CGGCGGTGACGGTGAAGC-3'

All reactions were done in triplicate.

3.2.7 Construction of uidA strains for insertion into the hpt locus of M. acetivorans

The uidA gene under control of the M. barkeri Fusaro methyl CoM reductase promoter (Pmcr) was obtained from pJK65 (a gift from William Metcalf). Constructs were made using either the unmutated uidA (uidA-286AAA) within pJK65 or with uidA variants having the AAA codon encoding K286 replaced with TAA (uidA-286TAA) or

TAG (uidA-286TAG) using the QuikChange Site-Directed Mutagenesis kit (Stratagene,

La Jolla, CA). Mutagenic primers are as follows:

For F: 5'- mutagenesis of GGGCGAACAGTTCCTGATTAACCACTAACCGTTCTACTTTACTGG-3' K286 to TAA R: 5'- CCAGTAAAGTAGAACGGTTAGTGGTTAATCAGGAACTGTTCGCCC-3'

72 For F: 5'- mutagenesis of GGGCGAACAGTTCCTGATTAACCACTAGCCGTTCTACTTTACTGG-3' K286 to TAG R: 5'- CCAGTAAAGTAGAACGGCTAGTGGTTAATCAGGAACTGTTCGCCC-3'

All pJK65-based constructs were digested with Xba I and Asp 718 and subsequently

cloned into pUC 19. These were then digested with Pst I and Kpn I and cloned into

pMP42 (a gift from William Metcalf), an hpt insertion vector for M. acetivorans. All

three constructs were independently introduced into M. acetivorans using the method of

Metcalf et al. (1997) and selection for hpt integrants was performed as in Meuer et al.

(2002). Insertion of the genes into the hpt locus was confirmed by Southern blotting and

by sequencing of genomic PCR products. Activities were assayed as described below.

3.2.8 PCR screening and Southern blotting of uidA strains

PCR amplification was done as an initial screen for potential integrants. A single

0.4 kb band was visible on a 0.8% agarose gel. Primers used were:

F 5'-GGAACTGCACAACCACTTCTGTCCCGGAG-3' R 5'-TCCCATTCCCGCTCTCCAAGCACGATCTC-3'

Any positive PCR reactions were then verified by Southern blotting.

Candidate integrants were then screened by Southern blotting (Mahapatra et al.,

2006) of Pst I or Bgl II digested genomic DNA using a probe with a sequence

complementary to the outside of the crossover region. Reactions were visualized with a

STORM Phosphorimager (Amersham). Wild-type M. acetivorans fragment sizes of 4.8 kb (Bgl II) and 1.7 kb (Pst I) were visualized, and 1.4 kb Pst I and 3.4 kb Bgl II fragments

73 were observed in transformants. The 32P-labeled probe used was 5'-

GGAACTGCACAACCACTTCTGTCCCGGAG-3'.

3.2.9 Isolation and activity of β-glucuronidase from M. acetivorans

All strains were grown to an OD600 of 1.3-1.7 in high salt medium containing either methanol/acetate or trimethylamine as growth substrates. Strains were harvested as described for the mtmB1 constructs, except that the buffer contained 10 mM dithiothreitol

(DTT). Specific activities were determined by assaying 20 μl of supernatant in 100 mM

β-mercaptoethanol and 1.25 mM p-nitrophenol-glucuronide (Sigma-Aldrich) in 20 mM potassium phosphate, pH 7.0. GUS activity was assayed at 37˚C and production of the nitrophenol anion was monitored at 405 nm.

3.2.10 Western blotting of uidA strains

Two hundred micrograms of cellular extract for each strain was electrophoresed at approximately 100 V for four hours on an SDS-PAGE 12.5% gel according to the method of Laemmli (1970). The gel was then presoaked and transblotted overnight in

CAPS buffer, pH 11.0 to a PVDF membrane as in Sambrook et al. (1989). The membrane was washed briefly in deionized H2O, and then blocked for one hour using

Western Breeze chromogenic blocker/diluent (Invitrogen). Anti-β-glucuronidase rabbit

IgG (Molecular Probes, Eugene, OR) at a 1:200 dilution was added directly to the blocking solution and incubated for two hours. The blot was then washed three times for

10 minutes each with 0.9% NaCl in 10 mM Tris-HCl, pH 7.4. A 1:2000 dilution of Anti- rabbit Ig-linked horseradish peroxidase from donkey (Amersham) was added to the 74 chromogenic/blocker mix and incubated with the blot for two hours. The blot was

washed as described above and developed using 4-chloro-1-naphthol/H2O2 (Sigma-

Aldrich).

3.2.11 Construction of pWM311-based uidA and its derivatives

A C-terminal hexahistidine encoding sequence was added to the unmutated uidA gene using PCR. The gene, along with its Pmcr, was amplified from pJK65 using:

F 5'-GGGCGAATTGGGCCCTCTAGAT-3' R 5'-TTATTATTAGTGGTGGTGGTGGTGGTGTCCTCCTTGTTTGCCTCCCTGCTGCGGTTTTTC-3'

subcloned into pGEM-T, and digested with Sph I in order to insert into pWM311,

creating pGUS 286AAA. After the correct clone was verified, site-directed mutagenesis was performed in order to change the wild-type lysine at position 286 to a TAG or TAA using the same primers listed in Materials and Methods section 3.2.7, creating pGUS

286TAG or pGUS 286TAA, respectively. Site directed mutagenesis was performed on pGUS 286AAA in order to change other sense codons in uidA to TAGs as well. The

codons changed to TAGs were 201, 231, 366 and 434. Each mutation resulted in a

different construct, called pGUS 201TAG, pGUS 231TAG, pGUS 366TAG and pGUS

434TAG. One double mutant was constructed where pGUS 286TAG was mutated so

that a second TAG codon was introduced at position 201, resulting in pGUS

201/286TAG. The primers used to mutagenize pGUS 286AAA are as follows (listed 5'

to 3'):

Primer Primer Sequence 201F GACTGTAACCACGCGTAGGTTGACTGGCAGGTG

75 201R CACCTGCCAGTCAACCTACGCGTGGTTACAGTC 231F GCAACTGGACAAGGCACTTAGGGGACTTTGCAAGTGGTG 231R CACCACTTGCAAAGTCCCCTAAGTGCCTTGTCCAGTTGC 366F CTCTTTAGGCATTGGTTTCTAGGCGGGCAACAAGCCG 366R CGGCTTGTTGCCCGCCTAGAAACCAATGCCTAAAGAG 434F GGAAGCAACGCGTTAGCTCGACCCGACGC 434R GCGTCGGGTCGAGCTAACGCGTTGCTTCC

The mutagenized constructs were sequenced to verify the mutation, and then both

tagged uidA vectors were introduced into M. acetivorans via liposome-mediated

transformation. The plasmids from puromycin resistant colonies were recovered by introduction into E. coli, and the uidA and uidA-derivatized genes were confirmed by sequencing.

3.2.12 Isolation and analysis of the GUS proteins produced from pGUS 286AAA

and pGUS 286TAG

Both strains were grown in 15 L vessels using modified DSM 304 media (Sowers

and Schreier, 1995; modifications are listed in Mahapatra et al., 2006) containing 40 mM

trimethylamine as the substrate and 2 μg/mL of puromycin. After seven days, the cells

were harvested, and cellular extracts were made using approximately 8 g of cells. Cells

were resuspended and lysed in 50 mM Mops plus 10 mM DTT, pH 7.0. Wild-type GUS,

or GUS-His, and GUS286TAG were isolated from extracts by loading 15 mls of extract

(98 mg/ml protein) onto a 1 ml nickel-activated HisTrap HP (Amersham) column

equilibrated with 500 mM NaCl and 10 mM imidazole in 20 mM sodium phosphate, pH

7.4. Both GUS proteins eluted at 180 mM imidazole during the application of 10 to 500

76 mM imidazole in the same buffer to the column (40 mL total volume). As monitored by

12.5% SDS-PAGE, wild-type GUS eluted as an enriched protein, while GUS286TAG was partially pure. GUS286TAG was subsequently diluted 1:10 into 50 mM Mops, pH

7.0 and loaded onto a Mono-Q column (Amersham) pre-equilibrated with 5 mM DTT and 10 mM NaCl in 50 mM Mops, pH 7.0. GUS286TAG eluted at 300 mM NaCl during the application of 10-500 mM NaCl gradient in the same buffer (160 mL total volume) to the same column. Protein fractions were checked for β-glucuronidase activity at each column step. A total of 0.16 mg of enriched wild-type GUS was recovered at a concentration of 0.08 mg/mL. Specific activity for wild-type GUS was 20 μmol/min·mg.

A total of 0.13 mg of enriched GUS286TAG was ultimately recovered at a concentration

of 0.34 mg/mL.

For mass spectrometry (analysis done by the Ohio State Campus Chemical

Instrument Center), an aliquot of the GUS286TAG protein was subjected to

chymotrypsin digestion in solution following desalting on a syringe protein trap

(Michrom BioResources, Auburn, CA). Cysteines were sequentially reduced and

carboxyamidomethylated with dithiothreitol and iodoacetamide in 100 mM ammonium

bicarbonate buffer followed by chymotrypsin digestion in 25 mM ammonium bicarbonate

and 5% acetonitrile for 4 hours at 37°C before acidification with 0.1% trifluoroacetic

acid. The sequence of the pyrrolysyl-peptide was then determined by tandem mass

spectrometry (Soares et al., 2005).

77 3.3 Results

3.3.1 UAG translation occurs with mtmB1 transcripts lacking the PYLIS element.

A substitution of the PYLIS element within the mtmB1 gene of pDL05C was engineered in order to test if the PYLIS element found immediately 3' to the UAG codon of mtmB1 could play a role in UAG translation (Figure 3.1). As it is possible that insertion of a foreign sequence within MtmB-His could compromise the structural integrity of the protein, the PYLIS element was replaced with a sequence derived from E. coli methionine synthetase (metH). The metH protein product contains a methyltransferase domain that is a structural homolog of MtmB and so the tertiary structure of the resulting chimeric MtmB should resemble that of wild-type MtmB. This should protect the chimeric MtmB from misfolding and subsequent degradation. The

TAG codon (nucleotides 604-606) of mtmB1 was left intact, while nucleotides 612-701 of mtmB1 in pDL05C were replaced with the metH sequence that forms the structural element corresponding to the deleted MtmB sequence. The resulting gene was designated met/mtmB and the plasmid carrying it was designated pMetDL05C.

78

Figure 3.1. Changes made to the PYLIS element within mtmB1 in pDL05C. The in- frame UAG codon is underlined. Arrows indicate which bases were mutated and lowercase letters show the changes that were made. Numbers with brackets specify mutations performed simultaneously. The sequence listed below the PYLIS element is the metH coding sequence that replaced the PYLIS element in pDL05C, thus creating the met/mtmB gene. The bottom bracket indicates where the PYLIS sequence was deleted and the metH sequence was inserted. The italicized bases were maintained in the met/mtmB gene and define where the metH sequence was inserted.

79 M. acetivorans bearing pMetDL05C produced the chimeric MetH/MtmB-His

protein, as evidenced by production of a his-tagged protein that migrated in SDS-PAGE with an apparent mass of 48 kDa, and which did not appear in cells transformed with pWM311 (Figure 3.2). In anti-MtmB Western blots, the down-regulation of the chromosomal mtmB genes in cells growing on methanol or methanol/acetate was exploited. Under such conditions, our laboratory had previously observed lower levels of

M. acetivorans chromosomal mtmB expression in log phase cells. This allows the detection of the over-expressed M. barkeri mtmB1 using antibodies raised against the M. barkeri MtmB protein with minimized interference from host genes. However, anti-

MtmB immunoblots do not reliably detect the 25-kDa mtmB1 amber-termination product when soluble protein from strains bearing pMetDL05C or pDL05C is used (Figure 3.2A).

In addition to detection by anti-MtmB antibodies, the his-tag present on pDL05C

allows specific detection of all plasmid-borne M. barkeri mtmB1 gene products by use of

anti-his epitope antibodies. Therefore, in order to estimate the relative amounts of

MetH/MtmB-His and MtmB-His produced, we analyzed dilutions of extracts of cells bearing pMetDL05C or pDL05C and compared anti-His immunoblots under conditions where the signal was not saturated (Figure 3.2B). These experiments indicated that the

MetH/MtmB-His signal intensity was 40 +/- 6% of that observed for MtmB-His.

We also compared the relative amounts of the MetH/MtmB-His and MtmB-His

proteins by enzyme-linked immunosorbent assay (ELISA) employing the anti-

hexahistidine antibody. Midpoint analysis of titrations of extracts of cells bearing either

pDL05C or pMetDL05C indicated that when compared to the MtmB-His protein the

80 abundance of the MetH/MtmB-His protein was on average 25%, but varied from 10% to

40% (Figure 3.3).

The above results clearly indicate that the PYLIS element is not essential for

UAG translation within MtmB. However, recombination between the plasmid and

chromosomal mtmB genes could also explain this result. The unmodified M. barkeri

mtmB1 gene on pDL05C averages an 84.5% identity to the M. acetivorans chromosomal

mtmB1 and mtmB2 genes. Stretches of up to 38 nucleotides with 100% identity present

between the genes make recombination a possibility. Therefore, the strain bearing

pMetDL05C was examined for evidence of such recombination using PCR analysis. We

employed primers specific for the Pmcr promoter, the 3' hexahistidine encoding

sequence, the chromosomal sequence found upstream of the chromosomal mtmB1 and mtmB2 and an internal primer which would hybridize to either the chromosomal or plasmid-borne mtmB genes (Figure 3.4). These primers were used in combinations that would amplify specific intact genes, as well as potential recombination products. In each case a single PCR product of the size predicted for the intact pMetDL05C or chromosomal mtmB sequences was obtained (Figure 3.5). The PCR products were cloned, and a number of clones from each PCR fragment were sequenced. In all cases, sequence that was consistent only with the preserved integrity of the introduced plasmid

copy of met/mtmB1 as well as the chromosomal copies of mtmB1 and mtmB2 was obtained (Table 3.1). The lack of detectable recombination between the various mtmB

genes is in keeping with a previous study that also could not detect recombination

between introduced M. barkeri genes and their M. acetivorans chromosomal homologs

(Boccazzi et al., 2000).

81

Figure 3.2. Western blot analysis showing that the chimeric MetH/MtmB-His protein is produced in M. acetivorans. A. Anti-MtmB Western blot showing that soluble extracts of pMetDL05C or pDL05C strains do not produce significantly different amounts of the 25-kDa mtmB1 amber-termination product. Our laboratory later found that a substantial pool of insoluble amber termination product is found in these strains, and the pool is higher in the met/mtmB strain relative to the pDL05C containing strain. The lanes contain strains bearing the following plasmids: lane 1, pMetDL05C; lane 2, pDL05C; lane 3, pWM311; lane 4, purified MtmB standard (5 μg); lane 5, molecular weight standard; lane 6, E. coli extract showing the amber-termination product, serving as a control. Lanes 1-3 had approximately 100 μg extract loaded. The arrows on the left indicate the positions of full-length MtmB, the amber-terminated 25 kDa MtmB and a 38 kDa degradation product seen in all cultures bearing a recombinant mtmB gene. B. Anti- his6 Western blot of titrations of protein produced from strains bearing pDL05C or pMetDL05C. Lanes 1-4 contain pDL05C extracts and lanes 5-9 contain pMetDL05C extracts. The amount of extract added was: lanes 1 and 5, 1 μg; lane 2, 3 μg; lanes 3 and 6, 5 μg; lanes 4 and 7, 10 μg; lane 8, 20 μg; and lane 9, 30 μg. Lane 10 contains the molecular weight standard and lane 11 is purified MtmB standard (5 μg).

82

Figure 3.3. ELISA midpoint analysis of the relative amounts of the MetH/MtmB-His and MtmB-His proteins. The abundance of the MetH/MtmB-His protein was on average 25% of the MtmB-His protein. In this figure, the abundance was approximately 10%, where other repeats of this ELISA resulted in either 20% or 40% abundance. Both replicates from the strain bearing pMetDL05C are shown in the graph. The strain bearing pWM311 was used to estimate background levels of protein reactive to the hexahistidine antibody in the assays.

83

Figure 3.4. The pMetDL05C vector contains the mtmB1 gene from M. barkeri MS under control of the mcr promoter. The putative PYLIS element was deleted and replaced with a region of the metH gene from E. coli, and a his6 tag was introduced on the 3' portion of the mtmB1 gene. The location of the TAG codon is shown. The TAG codons and intact PYLIS elements in the M. acetivorans chromosome are also shown. Uppercase letters above horizontal arrows indicate the locations of primers used to screen for chromosomal recombination, and the arrows indicate the primer directionality. Primer A corresponds to the PMCR region, primer B corresponds to the 3' region of all of the mtmB genes (vector-based or chromosomal), primer C corresponds to the his6 region and primer D corresponds to both copies of chromosomal mtmC.

84

Figure 3.5. Agarose gels showing that only single products are obtained from PCR reactions designed to screen for recombination of pMetDL05C into the M. acetivorans chromosome. PCR reactions were performed with the primer pairs listed in Table 3.1 and as illustrated in Figure 3.4. A) Agarose gel of the PCR reaction in which primers A and C were used. Lane 1 contains the size standards (in kb) where pertinent bands are listed next to the arrows. Lane 2 contains 1 μl of cell lysate from the pMetDL05C strain as template. B) Agarose gel of product from a PCR reaction containing 2 μl lysed cells from the pMetDL05C strain as template. The reaction in lane 1 contained primers A and B. Lane 2 is a molecular weight standard and the sizes (in kb) of the bands are listed next to the arrows. C) Agarose gel of product from a PCR reaction containing 2 μl lysed cells from the pMetDL05C strain as template. The reaction in lane 1 contained primers B and D. Lane 2 had no reaction loaded, but some spillover occurred from lane 1. Lane 3 contains the molecular weight standard and the sizes (in kb) of the pertinent bands are listed next to the arrows.

85

Total Recombination number of Primers Intact gene gene product clones Genes Recombined Reaction Used in potentially potentially sequenced identified sequences PCR amplified amplified from PCR product 5' and 3' plasmid Plasmid- Plasmid-borne mtmB with internal 1 A, C 13 borne ND metH/mtmB1 genomic mtmB metH/mtmB1 sequence 5' PMCR promoter Plasmid- Plasmid-borne 2 A, B with 3' genomic 8 borne ND metH/mtmB1 mtmB sequence metH/mtmB1 5' genomic Genomic Genomic 9 sequence with 3' mtmB1 3 B, D mtmB ND plasmid mtmB Genomic sequences 11 sequence. mtmB2

Table 3.1. Summary of sequences obtained from PCR analysis of mtmB1 genes in M. acetivorans transformed with pMetDL05C bearing the modified metH/mtmB1 gene derived from M. barkeri mtmB1. PCR reactions were performed with the primer pairs listed above as illustrated in Figure 3.4. Gels of each PCR reaction products are shown in Figure 3.5. In reactions 1 and 2, 100% of the mtmB gene sequences were covered in the sequencing reactions, whereas 78% of the mtmB gene sequences were covered in reaction 3. Each gene sequence was initially identified by BLAST analysis, followed by manual inspection for any evidence of recombination between M. barkeri and M. acetivorans sequences. No evidence of any recombination could be found in the sequenced products. ND = not detected.

86 3.3.2 UAG is translated as pyrrolysine in mtmB1 lacking the PYLIS element.

It was possible that the UAG codon within the metH/mtmB1 gene is not translated as pyrrolysine, but rather as some other amino acid. To address this directly, the

MetH/MtmB-His chimeric protein was analyzed by mass spectrometry. The protein was first isolated by nickel affinity. Approximately 1% of the total soluble protein within the extract was recovered as the MetH/MtmB-His protein. Densitometry analysis indicated that the fraction that contained MetH/MtmB-His was approximately 80% pure.

Following in-gel digestion with chymotrypsin, protein fragments were analyzed by tandem mass spectrometry using the methods previously outlined (Blight et al., 2004;

Soares et al., 2005). Sequence coverage of the chimeric protein was 55% (Figure 3.6).

Two peptide ions with m/z values of 5423+ and 547.893+ had masses expected for the sequence AGRPGMGVOGPSSKW, where O is pyrrolysine, while a peptide ion with m/z= 812.682+ ion was identified whose predicted mass corresponded to the same peptide but with an oxidized methionine. A final m/z= 5272+ ion was identified whose mass is consistent with the sequence GVOGPSSKW. In each case, collision induced dissociation

(CID) of these ions yielded b-ion and/or y-ion series that confirmed the assigned sequence. This further revealed the mass of the UAG encoded residue as 237.1 Da, which is not significantly different than the determined mass of pyrrolysine in native

MtmB, or the pyrrolysyl-proteins MtbB and MttB (Table 3.2). Additionally, these resulting sequences are further proof that the PYLIS element was successfully deleted in the pMetDL05C construct.

87

Figure 3.6. Sequence coverage of the MetH/MtmB-His chimeric protein after chymotryptic digestion. Peptides that were identified by tandem mass spectrometry are listed in bold. The residues encoded by the metH sequence, which replaced the PYLIS element, are indicated in italics. The pyrrolysyl residue, O, is underlined.

88

Table 3.2. List of b- and y-ions identified in a CID spectrum of the m/z 5433+ peptide fragment ion observed in chymotryptic digests of the MetH/MtmB-His protein. The sequence matches that predicted for the metH/mtmB1 gene product from the pMetDL05C plasmid. The sequence also includes the first four residues (italics) encoded by the metH sequence, which replaced the PYLIS element. The mass of individual residues is indicated by Δm, the difference between a y- or b-ion and the next smaller peptide ion observed in either series.

3.3.3 Synonymous mutations within the PYLIS element have varied but limited

effects on UAG translation.

Although replacement of the PYLIS element indicates that it is not essential for

relatively efficient UAG translation, it is notable that lower amounts of the resultant

89 MtmB derivative protein were observed. This indicates some contribution of the PYLIS element to promoting UAG translation as pyrrolysine, but may also be due to changes in stability of the chimeric MetH/MtmB-His protein. To address this question, five sets of mutations in the mtmB1-his gene carried on pDL05C were constructed. These mutations were predicted to change the PYLIS sequence and structure, while leaving the MtmB primary sequence unchanged. The resultant pDL05C derivatives were designated

pPYLIS 1 through pPYLIS 5 (Figure 3.1).

All strains bearing a pPYLIS plasmid produced higher amounts of MtmB relative

to a strain bearing pWM311, as was previously observed with pDL05C (Figure 3.7).

However, all of the strains bearing a pPYLIS plasmid produced slightly lower amounts of

full-length MtmB relative to those bearing pDL05C as judged by densitometric analysis

of anti-MtmB immunoblots (Figure 3.7). The relative amounts of 50 kDa MtmB

produced from pDL05C plasmid or pPYLIS derivatives were estimated by image

analysis of the anti-His immunoblots (Figure 3.8). Three independent anti-his Westerns

were performed, each using protein extracted from freshly grown cultures. Image

analyses revealed that the pPYLIS 1 mutant strain had the least effect on mtmB-his

translation, resulting in an average 92 +/- 9% MtmB-His produced relative to pDL05C.

Strains bearing pPYLIS 2, 3 or 5 had intermediate relative amounts of translation of

mtmB-his, resulting in 77 +/- 4%, 75 +/- 10%, and 64 +/- 9% MtmB-His produced

relative to pDL05C, respectively. The strain bearing pPYLIS 4 appeared to have the

most effect on mtmB translation, with only 49 +/- 14% of MtmB-His being produced

relative to wild-type. The pPYLIS 4 and pPYLIS 5 results were compared using an

unpaired t test, and the resulting two-tailed P value equaled 0.1935. This is a high P

90 value, which may signify that there is no significant difference between the two results.

However, when the pPYLIS 4 results were compared with those from pDL05C, the

resulting two-tailed P value equaled 0.0337. This P value indicates a significant

difference between the two results.

Further analysis of the strain transformed with pPYLIS 4 was then performed. In

order to obtain a more accurate estimate of the amounts of MtmB-His produced, dilutions

of extracts from cells bearing pPYLIS 4 or pDL05C were analyzed using anti-His6 immunoblots under conditions where the signal was not saturated. The result from this experiment agreed with the initial finding in that the production of MtmB-His was lowered in the pPYLIS 4 strain, where this strain produced approximately 60% of MtmB-

His relative to the pDL05C-bearing strain (Figure 3.9).

Independent of immunoblot analysis, the relative amounts of full-length MtmB-

His were also compared by ELISA, which employed the same anti-His6 epitope antibody as was used in the anti-His6 Western blots (Figure 3.10). Comparison of the midpoint

responses for antigen titrations of extracts of M. acetivorans bearing pPYLIS1, pPYLIS2, pPYLIS3, pPYLIS4, or pPYLIS5 respectively contained 70%, 70%, 60%, 30%, or 70% relative to the cells transformed with pDL05C. As with the ELISA comparing the strains bearing pDL05C and pMetDL05C, these numbers are somewhat lower than the immunoblot analysis results.

A concern in employing pDL05C and derivatives to compare efficiencies of UAG

translation within modified MtmB is that the plasmids might be present in different

relative copy numbers that could influence the total gene dosage of mtmB1-his within the

cell, thereby affecting total amounts of MtmB-His produced in different strains. In order

91 to test for this possibility, the amount of plasmid present in total DNA extracted from

strains bearing various pDL05C derivatives were quantitated by real-time PCR. Strains

bearing pDL05C, pMetDL05C, or pPYLIS4 were found to contain 10, 11, or 11 pg of

plasmid per total ng of cellular DNA, respectively. This indicates that pDL05C and derivatives were not present at dramatically different copy numbers within cells, signifying gene dosage effects do not underlie the differences of MtmB-His and

derivatives produced from these plasmids. This result indicates that the role of the

PYLIS element is not essential, but it may serve to enhance UAG translation.

92

Figure 3.7. Anti-MtmB Western blot of all pPYLIS plasmids showing that some variation in MtmB-His production is present between the strains. Lane 1, pPYLIS 1 extract; lane 2, pPYLIS 2 extract; lane 3, pPYLIS 3 extract; lane 4, pPYLIS 4 extract; lane 5, pPYLIS 5 extract; lane 6, truncated MtmB control; lane 7, pWM311 extract; lane 8, wild-type M. acetivorans extract; lane 9, molecular weight standard (with sizes in kDa listed to the right of the gel); lane 10, pDL05C extract. Lanes 1-5, 7,8 and 10 contained 200 μg total soluble protein extracted from mid-log phase HSMA cultures. Lanes 1-6 and 7-10 are from different parts of the same Western blot. The upper arrow corresponds to the size of full-length MtmB, while the lower arrow corresponds to the size of the 25 kDa truncated MtmB product.

93

Figure 3.8. Anti-his6 Western blot of all pPYLIS-containing strains. The production of MtmB-His is variable in the pPYLIS strains when compared to the pDL05C strain. Lane 1, purified MtmB standard (5 μg); lane 2, pPYLIS 1 extract; lane 3: pPYLIS 2 extract; lane 4, pPYLIS 3 extract; lane 5, pPYLIS 4 extract; lane 6, pPYLIS 5 extract; lane 7, pDL05C extract. Lanes 2-7 contained 30 μg total soluble protein extracted from mid-log phase HSMA cultures.

Figure 3.9. Anti-his6 Western blot of titrations of extracts from the pPYLIS 4 strain and the pDL05C strain. The strain bearing pPYLIS 4 produces approximately 40% less full- length MtmB than the strain bearing pDL05C. Lane 1, 1 μg PYLIS 5 extract; lane 2, 3 μg PYLIS 5 extract; lane 3, 5 μg PYLIS 5 extract; lane 4, 10 μg PYLIS 5 extract; lane 5, 1 μg pDL05 extract; lane 6, 5 μg pDL05 extract; lane 7, 10 μg pDL05 extract; lane 8, molecular weight standard; lane 9, purified MtmB standard (5 μg).

94

Figure 3.10. Midpoint titration analysis of an ELISA comparing pDL05C with the pPYLIS plasmids. Although with slightly overall lower amounts of response for the MtmB-His proteins, this analysis agrees with the Western blots in that of all the mutants, the PYLIS 4 mutations seem to have the most effect on MtmB-His production.

95 3.3.4 UAG acts as an ambiguous codon within a foreign gene expressed in M.

acetivorans.

The preceding results indicated that conventional recoding strategies employed in

the translation of UGA as selenocysteine play at best a limited role in UAG translation as

pyrrolysine in Methanosarcina acetivorans. This raises two questions: whether UAG is

actually a stop codon within Methanosarcina spp.; and further, if message context is

sufficiently relaxed such that pyrrolysine could be inserted into a foreign gene that should

lack any contextual elements evolved specifically to enhance UAG translation as

pyrrolysine. To answer these questions, we employed the E. coli uidA gene encoding β-

glucuronidase (GUS), which has recently been used as a reporter gene within M.

acetivorans (Pritchett et al., 2004).

In preliminary attempts to use this reporter, various pWM311-derived uidA expression vectors under control of the Pmcr were made. Seven constructs were made in total (Table 3.3), two of which were controls where pWM311 contained either wild-type uidA or uidA with the codon at position 286 mutated to a TAA stop codon. Codon 286 was chosen since it is likely to encode a surface-exposed residue, is not highly conserved among uidA genes, and is 5' of codons encoding active site residues of GUS. The other five constructs contained uidA with the codons at positions 201, 231, 286, 366 and 434 changed to single, in-frame UAG codons. The resulting plasmids were named pGUS

286AAA (containing wild-type uidA), pGUS 286TAA (containing uidA with codon 286

changed to a TAA), pGUS 201TAG, pGUS 231TAG, pGUS 286TAG, pGUS 366TAG

and pGUS 434TAG.

96 The catalytically active residues within GUS are E413, Y416, Y420 and E503.

However, another laboratory has deleted the central portion of uidA, leaving only the

E503 catalytic residue when translated (E. coli strain BW25141), and GUS activity

remained (Datsenko and Wanner, 2000). Therefore, this should ensure that all the uidA

mutants (including the strain with the mutation at position 434 in GUS) will have β-

glucuronidase activity only if their respective TAG codons are translated.

Activity assays demonstrated that active GUS protein was produced in four of the

five strains with a UAG-containing uidA gene (Table 3.4), but when expression was

monitored via anti-GUS immunoblot, varying results were seen. In the strain containing

pGUS 286AAA, GUS was produced in such high amounts that non-specific degradation products complicated analysis of the immunoblots. In most of the other strains, truncated uidA was detectable, but full-length GUS was almost never visualized (Figure 3.11).

Only strains containing pGUS 366TAG and pGUS 434TAG showed any marked levels of UAG readthrough. Further analysis of the plasmids revealed that a few base changes in the uidA coding region had occurred, possibly adding to the problems in expression

(Table 3.5).

Consequently, in order to minimize non-specific degradation of this non-Archaeal

gene product, we introduced a single copy of uidA under control of the Pmcr promoter

into the M. acetivorans chromosome at the hpt locus using the integration vector pMP42

(Metcalf et al., 1997; Meuer et al., 2002).

97 GUS strain Mutation Truncated kDa

GUS 286AAA None N/A

GUS 201TAG Ser 201TAG 22.3

GUS 231TAG Ser 231TAG 25.7

GUS 286TAG Lys 286TAG 31.8

GUS 286TAA Lys 286TAA 31.8

GUS 366TAG Glu 366TAG 40.7

GUS 434TAG Lys 434TAG 48.2

Table 3.3. Strains created by mutating sense codons to TAG codons within the uidA gene in pWM311. If TAG is read as a stop codon, the expected size of the truncated protein product produced from each mutated uidA differs depending on the location of the TAG codon. If TAG is read as a sense codon, the size of the full length GUS will be the same in each strain. N/A=not applicable.

98 GUS Strain Activity (μmol/min•mg)

GUS 286AAA 1.70

GUS 201TAG ND

GUS 231TAG 0.005

GUS 286TAG 0.148

GUS 286TAA ND

GUS 366TAG 0.125

GUS 434TAG 0.338

GUS 201/286TAG 0.086

Table 3.4. Specific activities seen for each M. acetivorans strain harboring pWM311 with wild-type uidA or its derivatives. The only strains with no detectable (ND) GUS activity were the control strain where uidA harbored a TAA stop codon and the strain with a TAG at position 201 in uidA. Strain GUS 201/286TAG refers to a double mutant in which two TAG codons are present in a single uidA gene.

99

Figure 3.11. Anti-β-glucuronidase Western blot of strains bearing pWM311-based uidA and its derivatives. Truncated GUS can be visualized in most lanes, but full-length GUS is rarely seen. High amounts of degradation can also be seen in the strains that appear to overproduce uidA or its variants. Lane 1, GUS standard (5 μg); lane 2, molecular weight standard; all other lanes are extracts of strains bearing the plasmids: lane 3, pGUS 201TAG; lane 4, pGUS 231TAG; lane 5, pGUS 286TAG; lane 6, pGUS 366TAG; lane 7, pGUS 434TAG; lane 8, pGUS 286TAA; lane 9, pGUS 286AAA. Lanes 3-9 contained 50 μg of cellular extract. Molecular mass standards are listed on the left. The upper arrow indicates the position of full-length GUS, while the lower arrow indicates the position of truncated GUS produced by strains bearing pGUS 286TAA and pGUS 286TAG (31.8 kDa).

100 GUS Plasmid Mutation Ala to Ala silent at position 56, Tyr to pGUS 286AAA (Wild-type) Asn at position 533 pGUS 201TAG Same as pGUS 286AAA Same as pGUS 286AAA, plus Leu to pGUS 231TAG Leu silent at position 510 pGUS 286TAG Same as pGUS 286AAA Same as pGUS 286AAA, plus an Asp pGUS 366TAG to Asp silent at position 117 and an Asn to Ser at position 238 Same as pGUS 286AAA, plus a Gln to pGUS 434TAG Gln silent at position 558

Table 3.5. Mutations found in each pWM311-based plasmid bearing uidA or its variants. All plasmids have the mutations found in pGUS 286AAA, but the pGUS 231TAG, pGUS 366TAG and pGUS 434TAG plasmids have additional point mutations.

Three strains of M. acetivorans with a chromosomally integrated uidA were

employed. The uidA-286AAA strain had unmodified uidA, whereas in the uidA-286TAG

or uidA-286TAA strain the AAA (lysine) codon at position 286 was respectively mutated

to either a TAG or a TAA codon. These mutations were the same as the ones that were

introduced into the plasmid genes as listed above, but they did not contain the

unintentional mutations from which the plasmids suffered. The presence of the desired

uidA variant in each strain was verified by sequencing of chromosomal PCR fragments

amplified with primers to the sequence flanking the hpt locus and confirmed by Southern

blot (Figure 3.12). Cell extracts of each strain were then analyzed by immunoblot

101 employing anti-β-glucuronidase primary antibody. Immunoblots of the uidA-286AAA

strain revealed only a 63-kDa protein that reacted with anti-GUS antibody and co- migrated with authentic full-length GUS protein (Figure 3.13). No such protein was

observed in immunoblots of wild type M. acetivorans. Strain uidA-286TAA did not

produce full-length GUS protein, and instead produced a truncated 32-kDa protein

detectable with anti-GUS antibody, as expected from the introduction of the canonical

TAA stop codon into the uidA reading frame at codon 286. In contrast, strain uidA-

286TAG produced two products reacting with the anti-GUS antibody. One of these co- migrated with the truncated GUS formed in strain uidA-286TAA, indicating that the introduced UAG in the uidA transcript had been recognized as a stop codon. In addition

to the truncated GUS protein, strain uidA-286TAG also produced a full-length GUS

protein that co-migrated with the full-length GUS protein produced in strain uidA-

286AAA. This result indicates that the TAG codon inserted at position 286 in the uidA

gene was also translated.

GUS activity assays were performed on all three uidA strains (Table 3.6). No

activity was detectable in untransformed M. acetivorans, or in the uidA-286TAA strain.

In contrast, extracts of the uidA-286AAA strain possessed GUS activity of 1.0

μmol/min•mg total protein. The GUS made by the uidA-286TAG strain via UAG

translation was also active, and the specific activity of this protein was 0.3 μmol/min•mg

total protein. This result is consistent with approximately 30% UAG translation within

uidA-286TAG. These activities were initially measured with cells grown on methanol as

a substrate, but when these same strains were grown on trimethylamine, a growth

102 condition that obligately requires UAG translation as pyrrolysine, identical GUS specific activities were obtained.

Figure 3.12. Southern blot confirming proper insertion of the uidA gene and its variants into M. acetivorans. Twenty micrograms of genomic DNA was loaded from the wild- type strain before (lanes 1-3) and after transformation with uidA-286AAA (lanes 4-6), uidA-286TAA (lanes 7-9) and uidA-286TAG constructs (lanes 10-12). Genomic DNA preparations were either not restricted (lanes 1, 4, 7, 10), or restricted with Bgl II (lanes 2, 5, 8, 11) or with Pst I (lanes 3, 6, 9, 12). The digests were then electrophoresed and probed with an oligonucleotide complementary to DNA in the 5' sequence flanking the hpt gene.

103

Figure 3.13. Anti-β-glucuronidase Western blot of total soluble protein from Methanosarcina acetivorans strains harboring the uidA-286AAA, uidA-286TAA, or the uidA-286TAG gene. Production of both truncated and full length GUS is observed in the uidA-286TAG strain, demonstrating that UAG is used as a stop codon within Methanosarcina acetivorans. The upper arrow represents the position of full-length GUS and the lower arrow represents the position of truncated GUS. Lane 1, 2 μg purified GUS standard; lane 2, extract of uidA-286TAG strain; lane 3, extract of uidA-286TAA strain; lane 4, extract of uidA-286AAA strain. Two hundred micrograms of total soluble protein was loaded in lanes 2-4.

104 Strain Medium Specific Activity (μmole/min·mg) uidA-286AAA Methanol 1.00

uidA-286AAA Trimethylamine 1.06

uidA-286TAA Methanol ND

uidA-286TAA Trimethylamine ND

uidA-286TAG Methanol 0.300

uidA-286TAG Trimethylamine 0.280

Wild-type Methanol ND

Wild-type Trimethylamine ND

Table 3.6. Both the unmutated uidA M. acetivorans strain and the uidA-286TAG strain possess GUS activity. The uidA-286TAG strain possesses approximately one-third the activity of the unmutated uidA strain. All uidA strains were grown on either methanol or trimethylamine; protein was extracted and tested for GUS activity. ND = none detectable.

In order to test if pyrrolysine was incorporated into GUS produced by the uidA-

286TAG strain, the pGUS 286TAG expression vector was employed. In this construct, a

C-terminal hexahistidine tag is added to the gene product. Even though the gene product was not initially visualized on anti-GUS immunoblots (Figure 3.11), the extract did have

GUS activity (Table 3.4), and so the strain was cultured in large amounts in order to obtain enough protein to analyze. The GUS286TAG protein was purified from cells

105 transformed with this plasmid using a nickel-affinity column, followed by further chromatography with a Mono-Q column. This resulted in a protein preparation that yielded a single band after electrophoresis (Figure 3.14) and had a specific activity of 46

μmol/min·mg when assayed for β-glucuronidase activity. The pool of enriched

GUS286TAG was subsequently digested with chymotrypsin for analysis by tandem mass spectrometry. A m/z= 489.42+ ion was identified whose mass is consistent with that of the GUS286TAG peptide 282LINHOPF288 (predicted m/z=489.32+), where O is pyrrolysine encoded by UAG286. A CID table of this ion produced b-and y-series ions consistent with this sequence assignment (Table 3.7) and which allowed an estimate of the mass of the UAG encoded residue as 237.3 Da, a mass that is not statistically distinct from that established for pyrrolysine.

106

Figure 3.14. Enrichment of GUS286TAG after passing a partially enriched fraction from a nickel-chelating column over a Mono-Q column. Coomassie-stained 12% SDS-PAGE gel of: lanes 1-4, fractions of a protein peak from the Mono-Q column (approximately 1 μg of each protein fraction/lane); lane 5, molecular size standards with sizes listed to the right. The arrow indicates the size of full-length GUS. Fractions were pooled, concentrated and analyzed for the presence of pyrrolysine.

107 Observed Observed y-ion ∆m Mass Sequence Mass Ion ∆m type (M + H) (M + H) Leu 113.13 y-6 864.85 Ile 227.28 b-2 251.20 y-5 751.72 Asn 341.41 b-3 114.13 His 478.54 b-4 157.13 237.26 y-3 500.52 Pyl 715.71 b-5 237.27 y-2 263.26 Pro Phe

Table 3.7. List of b- and y-ions identified in a CID spectrum of the m/z 489.42+ peptide fragment ion observed in chymotryptic digests of the GUS286TAG protein. The mass of individual residues is indicated by Δm, the difference between a y- or b-ion and the next smaller peptide ion observed in either series.

3.4 Discussion

It has now been shown that the predicted PYLIS element is not necessary for

UAG translation as pyrrolysine. Using a tractable genetic system within M. acetivorans, the proposed PYLIS element was deleted, and production of pyrrolysine-containing recombinant MtmB1 still occurred. This is very significant, as context is a required feature of UGA codons being translated as selenocysteine. This result demonstrates that in yet another way, the method of pyrrolysine insertion into protein greatly varies from that of selenocysteine.

108 All experiments in this chapter were carried out using only the pDL05C construct,

but a second pWM311-based construct (pDL05N) was made in which a hexahistidine

encoding sequence was appended to the mtmB1 reading frame to produce M. barkeri

MtmB with an N-terminal his6-tag (His-MtmB). The pDL05N construct was made in order to detect truncated as well as full-length MtmB protein in anti-his immunoblots.

However, this construct could not be used because the N-terminal MtmB protein could not be visualized with anti-His antibodies. This may be due to processing or a lack of translation of the his-tag.

Fortunately, recombinant MtmB expression levels from the pDL05C-containing

strains remained constant throughout growth phases and gave a high level of expression.

The pDL05C strain produced MtmB1 equally well on trimethylamine and methanol and mtmB1-his was expressed at significantly higher levels than the chromosomal copies.

Using this strain, it has now been proven that neither the 5' UTR nor the 3' UTR is

necessary for translation of the UAG codon. This is significant, since in eukaryotes and in archaea, the SECIS element directs selenocysteine insertion from the UTRs (Berry et al., 1991; Wilting et al., 1997).

In the metH/mtmB strain, decreased amounts of MetH/MtmB-His protein (as

compared with MtmB1-His production) were observed, which could indicate that the

PYLIS element makes some contribution to promoting UAG translation as pyrrolysine,

but may also indicate changes in stability of the chimeric MetH/MtmB-His protein. The

predicted PYLIS element within mtmB1 in pDL05C was mutated in a way designed to

disrupt the stem loop base pairings and conserved sequences within the element, but keep

the amino acid sequence the same as in the wild-type PYLIS element. The amino acid

109 sequence was conserved in order to keep MtmB stable, since the cell could view an

MtmB molecule with any amino acid changes as defective, and cause it to be degraded.

The largest difference in translation of the mtmB1 derivatives was in the pPYLIS 4- containing strain, which produced approximately 60% MtmB-His as compared to the

DL05C-containing strain. This was only slightly higher than the production of MtmB from the pMetDL05C-containing strain. Taken together, these data indicate that the

PYLIS element is not required for UAG readthrough in M. acetivorans, but does appear

to be needed for high efficiency translation of the UAG codon. This is the first

experimental proof that neither the PYLIS element nor the UTRs are essential, and so if

any crucial context exists, it must be very different than that observed with

selenocysteine, where the lack of a SECIS element, either in the untranslated regions or

the coding region of the gene itself, would result in no full-length protein being made

(Shen et al., 1993; Kollmus et al., 1996). It is feasible that another stem loop within the

metH/mtmB1 transcript could form that may resemble the PYLIS element. As predicted

by Mfold (Zuker, 2003; Mathews et al., 1999), there is a potential stem loop after the

UAG in the metH/mtmB1 transcript. However, this stem loop has no significant

structural or sequential homology to the PYLIS element; RNA also frequently forms stem

loops and simply the presence of a stem loop within the metH/mtmB1 mRNA is not

unusual.

In the PYLIS deletion strain as well as the strains bearing the directed mutations

to the PYLIS element, a 25 kDa MtmB amber-termination product was occasionally

visualized in the immunoblots. Within this study, the focus was solely upon readthrough

and the production and quantitation of full-length products. Only the soluble protein

110 fractions were analyzed, which always possessed variable amounts of amber termination

product. Recent experiments have shown that in addition to these results, large amounts

of truncated product are present as apparent inclusion bodies in all the mutant strains

examined here and are in higher amounts than in the strain bearing pDL05C. These

findings complement the analyses done in this work, because visualizing the amber-

terminated protein products demonstrates that the PYLIS element is in all probability

required for UAG translation at high efficiencies.

A UAG codon was then introduced into a gene foreign to M. acetivorans in order

to see whether pyrrolysine could be inserted into the resulting protein. The E. coli uidA

gene was chosen as a reporter since it is foreign to M. acetivorans, but can be expressed

without its product being degraded. A UAG codon was introduced into the middle of the

reading frame, so that to obtain a full-length protein product, UAG would have to be

accommodated by the cell, either by translation as pyrrolysine (or a different amino acid)

or by another mechanism that could bypass the UAG codon. Indeed, the UAG was

translated, and the full-length product was isolated and analyzed by mass spectrometry, with a pyrrolysyl residue found at the corresponding UAG position. Also, the gene product, GUS, was shown to be active as a β-glucuronidase, having approximately one third the activity of wild-type GUS. These findings are important because they indicate that UAG can be translated without evolved context within the message. As with the metH/mtmB1 transcript, Mfold does predict a stem loop downstream of the UAG codon in the uidA transcript. Again, this stem loop has no sequential or structural homology to the PYLIS element.

111 Finally, whether or not UAG could still signal the termination of translation in M. acetivorans was in question, but no experimental data had been available until now.

Truncated as well as full-length GUS was produced in the uidA-TAG strain, demonstrating that UAG can be recognized as a stop codon within the cell. The uidA-

TAG gene is present as a single copy within the chromosome and so should not overpower the translational system, but it is possible that the system is being overwhelmed at the UAG position, and not enough pyrrolysyl-tRNAPyl is being presented to the ribosomes. This would cause the ribosomes to stall, and could explain why there is not closer to 100% readthrough of the UAG, if UAG is not a stop codon. However, the data imply that there is a competition occurring between pyrrolysine insertion and translation termination, and when the PYLIS element, or other unknown contextual elements, are absent, only about 30% UAG translation occurs.

As discussed in Zhang et al. (2005), almost half of all UAG codons in pyrrolysine-utilizing archaea are followed within 30 nt by additional non-UAG stop signals. This could mean that UAG is sometimes read as a stop signal and if pyrrolysine is accidentally inserted, it may not be as harmful to the cell since it is at the end of the protein. In addition, only 5% of genes are predicted to end in UAG, and it has yet to be shown experimentally whether any protein within these methanogens actually terminates at a UAG codon. However, the results discussed here are most like that of an amber suppressing organism.

Thus far, UAG decoding as pyrrolysine does not seem to be defined by a system similar to selenocysteine. This does not mean that there is no contextual mechanism for insertion of pyrrolysine. Although it does appear that the PYLIS element is an element

112 that enhances readthrough rather than termination, it is still possible that another structure

or sequence within the mtmB1 reading frame will be required for UAG translation, and so

further experimentation is necessary.

To date, no conserved secondary structure has been found in any

methyltransferase transcript to indicate that there is a conserved mechanism for

pyrrolysine insertion during translation. The PYLIS element studied here was the most

conserved structure found in mtmB transcripts throughout the methanogen genomes, and

even this element could not be detected in the dimethylamine methyltransferase

transcripts. Taken together with the fact that the UTRs do not appear necessary for UAG translation, this seems to indicate that relatively efficient translation is occurring in the absence of context, but is still enhanced by local contextual elements.

113 CHAPTER 4

CONCLUSION

Until recently, the genetic code was thought to be fairly strict in its makeup of 64 unique triplet codons, which encode 20 amino acid building blocks from which all proteins are composed. Some proteins require additional elements to carry out their functions, such as post-translational modifications or cofactors. Since the cell can readily supply these elements, it is usually unnecessary for a protein to require a novel genetically encoded amino acid in order to function properly. However, the discoveries of selenocysteine and pyrrolysine are prime examples in demonstrating that organisms do occasionally need to evolve novel translational machinery in response to the call for additional or enhanced chemistries within certain proteins.

The genetic traces of the twenty-second amino acid, pyrrolysine, have so far only been seen in the Methanosarcinales and one Gram-positive organism, Desulfitobacterium hafniense (Srinivasan et al., 2002). The sole difference between the pyl operons in the methanogens and D. hafniense is that in D. hafniense, the pylS gene is split into a carboxy-terminal (pylSc) and an amino-terminal (pylSn) gene, which surround the pylBCD genes (Figure 4.1). It is doubtful that two such diverse organisms would evolve

114 an almost identical operon, and so it is possible that horizontal gene transfer has occurred

between the two species.

Figure 4.1. The pyl gene clusters (in color) in M. barkeri Fusaro and D. hafniense. The location of the in frame amber codon (TAG) in each mtmB gene copy is indicated. A 4.2-kilobase transcript was detectable in M. barkeri using probes for pylT, pylS, pylB, and pylC (Srinivasan et al., 2002), indicating possible cotranscription of these genes.

The argument can be made that the decoding of UAG as pyrrolysine will be found more widely distributed in nature. It is possible, however, that there are various routes of pyrrolysylation of tRNAPyl involving genes other than the pyl genes. For example, the

115 two lysyl-tRNA synthetases from M. barkeri, LysRS1 and LysRS2, have been shown to

lysylate tRNAPyl (Polycarpo et al., 2003). It is possible that this route exists in other

organisms. This role may explain why pyrrolysine has not yet been discovered

elsewhere; if this (or a similar pathway) is instead the primary pathway in other

organisms, then searches for the pyl operon may not be fruitful, when in reality pyrrolysine is more prevalent than previously thought. For instance, selenocysteine insertion in eukaryotes is very different from that in prokaryotes, and so selenocysteine- containing genes have to be searched for in different ways based on the organism.

Finally, it is possible that the methanogens and D. hafniense are the first organisms to genetically encode pyrrolysine and the pyl operon has not yet been transferred to or evolved by other organisms.

Although pyrrolysine may eventually be discovered in more organisms, one

immediate point of speculation is why only organisms containing genes that promote the

utilization of methylamines would evolve new translational machinery. One possible

reason for evolving a new amino acid and the translational machinery for its encoding is

to gain an advantage in energy production. A current hypothesis regarding the presence

of pyrrolysine in the methylamine methyltransferases is that it functions to position a

methylammonium species in the active sites of the proteins for methyl transfer to the

corresponding corrinoid proteins. Perhaps the presence of pyrrolysine in the

methylamine methyltransferases allows the organisms to thrive in the environmental

niches where the methylamine substrates are found. Thus, the evolution of the

aminoacyl-tRNA synthetase/tRNA pair would be required to utilize the methylamines in

these niches. The organisms that evolved the pylS and pylT genes would have the

116 advantage, and greater amounts of the methylamine methyltransferases could be produced in order to make more energy. In fact, for anaerobic environments like those occupied by the methanogens, no other anaerobic methylamine utilizers are known.

Why is pyrrolysine genetically encoded rather than simply modifying a canonical

lysine residue? There are hundreds of examples of post-translational modifications in

proteins, and the evolution of an aminoacyl-tRNA synthetase/tRNA pair used for the insertion of pyrrolysine is a huge step for any organism. The modification of a lysine to pyrrolysine would require a few steps (and multiple enzymes) and pyrrolysine is usually buried deep in a pocket in these methylamine methyltransferases. The access into this pocket would not necessarily be easy for a modifying enzyme, and so if pyrrolysine were genetically encoded, the residue would already be inserted during synthesis of the

protein, and then folding could occur quickly, easily and properly. This again would

allow greater amounts of correctly synthesized methylamine methyltransferases to be produced, which would allow the organism to make more energy. As mentioned in

Chapter 3, MtmB makes up greater than 2-3% of the protein levels in M. acetivorans by itself, and so with the large quantities of methyltransferases being made, it may require less energy for the cells to translationally insert pyrrolysine instead of modifying a lysine residue every time these proteins are produced.

Now that the direct ligation of pyrrolysine onto tRNAPyl by PylS has been

demonstrated both in vitro (Chapter 2; Blight et al., 2004) and in vivo (Blight et al, 2004),

it has led to speculation that pyrrolysine is formed as a free metabolite within the cell

(Srinivasan et al., 2002; Blight et al., 2004). It has been proposed that pyrrolysine may

be synthesized in the cell through the actions of the pylB, pylC and pylD gene products

117 (Figure 1; Srinivasan et al., 2002). The pylB gene product has a 49% similarity to biotin synthase, which may reflect an involvement in the formation of the five-membered heterocyclic ring in pyrrolysine (Srinivasan et al., 2002). The pylC gene product is

similar to D-ala-D-ala ligase and carbamoyl phosphate synthase, which suggests a role in

forming the amide bond in pyrrolysine. Finally, because PylD is similar to several types of dehydrogenases, it may function in the double bond formation within the pyrrolysyl ring. The functions of these three gene products need to be verified in order to prove their potential roles in pyrrolysine biosynthesis.

If the evolution of novel translational machinery is beneficial to an organism,

more non-canonical amino acids and aaRSs may be found in nature. More genomes are

being sequenced by the day, and searches of these genomic sequences may reveal clues

(such as novel tRNAs, aaRSs or translation elongation factors) that aid in the discovery

of additional novel amino acids. Theoretical analysis of the genetic code in 2002

predicted the presence of a novel amino acid encoded by UAG (Balakrishnan, 2002).

This analysis was released just before the discovery of pyrrolysine was reported. The

analysis went on to predict that another unique amino acid with properties similar to

lysine or arginine would be encoded by UAA. Whether or not this prediction turns out to

be accurate, as the genome searches continue, along with the help of proteomics and

confirmation by laboratory analysis, it seems likely that more amino acids will be

discovered.

Since the discovery of pyrrolysine, it was predicted that an mRNA element would

be found that is required to direct pyrrolysine insertion into protein at UAG codons. With

genetic approaches now available for M. acetivorans, the PYLIS element, found 3' of the

118 UAG codon in the mtmB and mttB transcripts (Pottenplackel, 1999; Ibba and Söll, 2004;

Namy et al., 2004), can now be studied. As stated in Chapter 3, when the PYLIS element

was deleted, recombinant MtmB (rMtmB) was still produced, and contained pyrrolysine.

Strains containing plasmids with mutations in the PYLIS element also resulted in the

production of rMtmB. The levels of MtmB produced in these mutant strains were lower

as compared to amounts of MtmB produced in M. acetivorans transformed with plasmids

bearing wild-type mtmB. Although these results demonstrate that the PYLIS element is

not required for UAG decoding as pyrrolysine, this finding does leave room for the possibility that the PYLIS element enhances UAG translation. In fact, truncated 25 kDa

protein was seen during Western analysis of these mutant strains, adding to the idea that

the PYLIS element is required for complete readthrough of UAG codons in these

organisms.

Although it could be interpreted that M. acetivorans has conducted a genome-

wide recoding event in which all UAG codons now are sense codons for pyrrolysine, our

experiments show that UAG can still be recognized as a stop codon within the organism.

Thus, it does not seem likely that global redefinition has yet occurred in this organism. It

is possible that we are seeing one step in evolution, where a global redefinition of UAG

will occur, but the release factors have not yet lost the ability to recognize UAG codons.

This would result in a competition during translation between the release factors and the

pyrrolysine-inserting machinery. High levels of pyrrolysine insertion at UAG codons

may be achieved by the presence of a structure (possibly the PYLIS element) within the

mRNA that may pause translating ribosomes. Another possibility is that conditions within the cell dictate whether UAG is read as a sense codon at an elevated frequency.

119 High concentrations of substrate, such as monomethylamine, may signal strong

expression of the pyl operon, which would favor pyrrolysine insertion at UAG codons.

The increased expression of the pyl operon would generate higher concentrations of

pyrrolysyl-tRNAPyl, which in turn would favor pyrrolysine insertion rather than translation termination at UAG codons. The experiments in Chapter 3 argue against this hypothesis since similar amounts of GUS286TAG protein were made under growth on

TMA or methanol, but further studies using varying amounts of substrates would be

required to completely rule out this possibility.

Interestingly, two release factors have been found in M. acetivorans and M.

barkeri, but not in the other Methanosarcinales (Krzycki, 2005; Zhang et al., 2005).

Sequence analysis of the release factors from all pyrrolysine-containing archaea show

that there are amino acid changes in the region surrounding the NIKS motif, which is

central in stop codon recognition (Zhang et al., 2005). In the case of M. acetivorans and

M. barkeri, there are additional amino acid changes in the NIKS motif itself in one of the

two translation release factors (Zhang et al., 2005). This could mean that one of the

release factors can no longer recognize UAG as a stop signal, but the other one still does.

Although a global recoding event would be attractive, as demonstrated by the

experiments in this document, it is more likely that UAG codons code for pyrrolysine as

well as translation termination. Bioinformatic analyses reveal that within D. hafniense,

UAG may function as a stop codon as well as a sense codon (Zhang et al., 2005). This

means that the organism has developed a way to signal translating ribosomes when a

UAG codon needs to be decoded as pyrrolysine. If this is the case, it needs to be

determined how the translation machinery distinguishes between termination and sense

120 codons. A putative PYLIS element has been found in the mttB transcript in D. hafniense

(Ibba and Söll, 2004). In D. hafniense, perhaps the element is absolutely required for

UAG decoding as pyrrolysine, while the PYLIS element was retained in the archaea to

allow a higher efficiency of translation during competition between pyrrolysyl-tRNAPyl

and translation release factors.

The possibility that the methanogen transcripts require a cis-acting element other

than the PYLIS for signaling the insertion of pyrrolysine into protein still needs to be

examined. The 5' and 3' UTRs have been shown to be unnecessary in the encoding of

UAG as pyrrolysine in the translation of MtmB1 (David Longstaff, personal

communication). This is unlike selenocysteine insertion in archaea and eukaryotes,

where the SECIS element is found in the 3' UTR (Wilting et al., 1997; Berry et al., 1991).

Although the UTRs may be required to obtain 100% readthrough of UAG codons, this

finding means that any cis-acting sequence necessary for UAG decoding as pyrrolysine is

contained solely in the coding regions of a gene.

The amino acids 5' to stop codons have been shown to influence the efficiency of

termination at UGA codons (Mottagui-Tabar et al., 1994). If one examines the

methylamine methyltransferase proteins, one can see that there is a glycine residue at the

–2 position before the pyrrolysyl residue in 28 out of 35 of the proteins, and in six of the

remaining seven proteins, the glycine has been replaced by an alanine, which is structurally similar to glycine. Interestingly, higher than normal readthrough of UGA codons occurs when glycine codons are located at the –2 position (Mottagui-Tabar et al.,

1994), but this study did not state how this compares to readthrough of UAG codons. It

is possible that the presence of this –2 residue in the methyltransferases stimulates UAG

121 translation, since sequences 5' to the UAG codon have not yet been studied for their

requirement in UAG recognition as pyrrolysine. However, the –2 residue before the

pyrrolysine in GUS is an asparagine, so the presence of a glycine (or alanine) residue is

not the entire reason why UAG codons are translated in M. acetivorans. Some context is

expected, though, since the results in Chapter 2 demonstrate a requirement for the PYLIS

element in the efficiency of UAG translation.

The nucleotides surrounding stop codons, specifically the base following the stop codon (termed the +4 position), have also been reported to influence the efficiency of translation termination in E. coli and mammals (Tate et al., 1999; Poole et al., 1998;

McCaughan et al., 1995). The reports are varied as to the +4 nucleotide that best influences UAG readthrough, but most reports agree that a C at the +4 position seems to

promote the highest amount of readthrough (Martin et al., 1993; Poole et al., 1995;

McCaughan et al., 1995). The genes encoding the methylamine methyltransferases differ

in the nucleotide that is at the +4 position after the UAG, where the mtmB genes have a

G, the mtbB genes have an A and the mttB genes have a T. It thus seems doubtful that during translation of these genes the +4 base has much effect on the efficiency of termination versus readthrough.

Additional trans-acting factors could also be necessary for the efficient translation of UAG as pyrrolysine. In eukaryotes, a SECIS-binding protein, SBP2, is required for selenocysteine incorporation in vitro (Copeland et al., 2000). SBP2 binds specifically to the SECIS core, ribosomes, and the mammalian EFSec (Copeland, 2003; Hoffmann and

Berry, 2005). This binding allows the insertion of selenocysteine at specific UGA codons. A factor or factors like SBP2 could be required in UAG translation as well.

122 Because the efficiency of UAG translation is reduced when the PYLIS element is mutated or deleted, this may mean that the element is required for the recruitment of other factors in UAG translation. In this regard, it was noted that the genomes of

Methanosarcina spp. contain a truncated SelB homolog that could participate in binding pyrrolysyl-tRNAPyl (Ibba and Söll, 2004). This protein may function as a specialized

elongation factor for pyrrolysine insertion into protein, or could function in PYLIS

element binding and recognition. In either case, this still would not be an essential

protein and should only function in enhancing UAG translation.

In the future, it is likely that more pyrrolysine-containing proteins will be found,

both in the organisms where pyrrolysine has already been found, as well as in new

organisms. This should aid in the study of pyrrolysine insertion, and allow more focus on any contextual elements required for UAG translation. This may also offer more insight into PylS and tRNAPyl and help us to understand why these organisms evolved a

specialized UAG translation system. Some searches for more pyrrolysine-containing

proteins have already begun, with one search resulting in a new computational scheme for predicting selenocysteine and pyrrolysine residues in proteins from microbes whose genomes have been completely sequenced (Chaudhuri and Yeates, 2005). This scheme predicted a number of new potential candidates for pyrrolysine-containing proteins, including a homolog of the cobalamin biosynthesis protein, CobN (Chaudhuri and

Yeates, 2005). The bioinformatic searches for pyrrolysine-containing proteins have proven to be more difficult than searches for selenocysteine-containing proteins. For example, selenocysteine is often replaced by cysteine in homologous sequences, and so the Sec/Cys pair found in these sequences is a feature that is used for identification of

123 selenoproteins in genomic databases (Zhang et al., 2005; Chaudhuri and Yeates, 2005).

However, a similar pairing is not found in pyrrolysine-containing proteins. So far,

pyrrolysine has only been replaced in a few MttB homologs, and the amino acids that

replaced it were varied (Zhang et al., 2005; Chaudhuri and Yeates, 2005).

With in vitro analysis and the development of a high-functioning genetics system

for Methanosarcina species that allows experimentation in vivo, these chapters have

addressed some of the major puzzles of pyrrolysine insertion. We now know how UAG

is translated and we have learned the beginnings of how UAG stop codon function is

circumvented. However, this is still only the beginning of the study of UAG translation

in archaea, with many more exciting developments to come.

Future Directions

A closer look at PylS will now be necessary in order to determine its specificity

for tRNAPyl. Crystallization of the synthetase will not only expose its structure, but will

also be informative about how it interacts with the tRNA and pyrrolysine. The structure

will point to what residues in the aminoacyl-tRNA synthetase are important in binding

tRNA as well as discriminating against other tRNAs. To truly determine this, a co-

crystal structure of PylS bound to tRNAPyl would be the most informative, and mutation of any potentially important residues would then be necessary.

Furthermore, a crystal structure of PylS complexed with pyrrolysine would help reveal the residues most likely involved in amino acid recognition and binding. After the crystal structure has been obtained, the residues within PylS could be mutated in order to help discern how the aaRS recognizes and discriminates against noncognate amino acids.

124 The use of pyrrolysine analogs would also assist in the study of the kinetic parameters for optimal PylS function.

Additionally, a knockout of pylT in the uidA-TAG strain would be another way in demonstrating that UAG can still be read as a translation termination codon. This deletion is also an additional approach to show that pyrrolysine is being inserted during translation of the UAG in uidA. Without this gene product, no translation past the UAG site should occur, with only truncated GUS being visualized on immunoblots. This will help confirm that UAG termination and translation are competing events within M. acetivorans.

The study of each translation release factor (RF) within M. acetivorans will also be helpful. New strains of M. acetivorans can be made in which one RF has been knocked out. This may show that only one of the two RFs in M. acetivorans has retained the ability to recognize UAG as a stop codon. If this happens, then the sequences and structures of the two release factors can be compared and a better view of the role of the release factor in UAG translation may develop.

In addition, further study into the PYLIS element needs to be done. If the PYLIS element is inserted into the uidA-TAG strain downstream of the UAG codon, this may result in higher levels of UAG readthrough. If this occurs, it may mean that the PYLIS element functions in recruiting additional factors to obtain high amounts of amber codon translation. If these factors can be isolated, a more complete picture of how UAG translation occurs in M. acetivorans will begin to develop.

Finally, simply by incorporating the pylS and pylT genes into an organism of interest, it should now be possible to generate proteins with the 22nd amino acid

125 incorporated at UAG-targeted sites. This could occur in any species that can incorporate

exogenously added pyrrolysine, and would add a unique natural amino acid with

electrophilic properties to an organism. Several other systems have been recently

developed in order to expand and manipulate the genetic code to generate recombinant

proteins containing unnatural amino acids as well (Wang et al., 2001; Döring et al., 2001;

Kiick et al., 2001; Chin et al., 2003). These systems demonstrate the ability of organisms to adapt to and tolerate changes in the genetic code. This ability again raises the possibility that more naturally occurring novel amino acids will be discovered.

126 APPENDIX A

UAG READTHROUGH IN METHANOSARCINA: AN IN VITRO APPROACH

A.1 Introduction

The incorporation of an unusual amino acid at what is usually considered a stop

codon has precedent with the discovery of selenocysteine, the 21st amino acid. Certain

cellular requirements, like a selenocysteine-specific tRNA, a dedicated elongation factor

(SelB) and specific stem loops within mRNA are necessary for selenocysteine

incorporation into a protein (Rother et al., 2001). Context plays a very important part in

selenocysteine incorporation, and it is hypothesized that it will be required for

pyrrolysine as well. The question for Methanosarcina species is whether these same

features are necessary for pyrrolysine incorporation. The amber-decoding tRNACUA

(now termed tRNAPyl) and pyrrolysyl-tRNA synthetase, PylS, have been shown to be required for pyrrolysine insertion into protein, and so the next step is to see whether any

cis- or trans-acting factors in the mtmB1 transcripts are necessary in order to obtain

readthrough of the UAG codon. An in vitro translation system can be used in order to

identify potential factors.

Most of the cell-free translation systems that have been developed for the Archaea

are used with thermophiles (Ishikawa et al., 2005; Uzawa et al., 2002; Londei et al.,

127 1991) or halophiles (Uzawa et al., 2002; Gropp and Oesterhelt, 1989; Londei et al.,

1986). Very few cell-free translation systems have been used with methanogens, but one has been designed and employed with various methanogens, including Methanosarcina barkeri (Elhardt and Böck, 1982; Hummel et al., 1985). In this study, tritiated poly- phenylalanine synthesis was used as a reporter to show the effects of various antibiotics on methanogen ribosomes (Elhardt and Böck, 1982; Hummel et al., 1985).

From these reports, it was possible to initiate our own in vitro translation studies using polyuridylic acid (polyU) translation as poly-phenylalanine as the reporter.

Tritiated poly-phenylalanine synthesis was used initially for optimization of the system and specific transcripts made from M. barkeri genes were subsequently employed. These transcripts were utilized in order to determine whether context was necessary for UAG translation. Here, we show a system that is able to translate specific mRNAs under anaerobic conditions, with elongation rates comparable to Escherichia coli batch translation systems. This is the first example of the use of specific transcripts containing methanogen genes, with previous reports relying solely on polyuridylic acid as the message. Ultimately, translation termination was never detected using this system, and so, the search for cis- or trans-acting factors in UAG translation as pyrrolysine could not be completed with this system. The genetic system that has allowed us to study

Methanosarcina acetivorans in vivo became available to our laboratory as the experiments in this chapter were underway. As discussed in Chapter 3, this genetic system was used successfully to study the signal that is thought to enhance UAG readthrough as pyrrolysine. However, it is possible that other researchers may be able to

128 resolve the translation termination issues with the in vitro translation system, and so it is

important to discuss the development and aspects of this system here.

A.2 Materials and Methods

A.2.1 Design and construction of vectors

The plasmid pSFH was designed so that, during transcription, 10 phenylalanine

codons and 15 histidine codons will be respectively added to the 5' and 3' ends of a

transcript from any gene cloned into this vector. To achieve this, two different inserts

were cloned into the plasmid pGEM-3Z (Promega Corp., Madison, WI), which contains a

T7 promoter. The inserts were made by phosphorylating the 5' ends of oligomers (F1: 5'-

GATCCAAATATTCGGAGGTTATAAAAATGGCAAAA(TTC)10T-3', R1: 5'-

CTAGA(GAA)10TTTTGCCATTTTTATAACCTCCGAATATTTG-3', F2: 5'-

CTAGA(TTC)4AGATCT(CAC)15TAATAAA-3' and R2: 5'-

AGCTTTTATTA(GTG)15AGATCT(GAA)4T-3'), and annealing F1+R1 and F2+R2.

One hundred picomoles of each oligo was phosphorylated using polynucleotide kinase

(Roche, Indianapolis, IN) plus ATP at a final concentration of 10 μM. The reactions

were then ethanol precipitated and each oligomer was brought up to a concentration of 10

pmoles/μl in distilled water. The oligomers were annealed by combining 100 pmoles of

each in the reaction. The annealing reactions were then heated to 95°C for ten minutes

and slow cooled to room temperature.

The plasmid pGEM-3Z was digested with BamH I and Xba I. The digestion was electrophoresed on a 1% agarose gel, and the 3 kb product resulting from the digestion

129 was excised, then extracted from the gel using a modified freeze-squeeze method in

which the gel slice was crushed using a sterile spatula and then frozen at -80°C for 20

minutes, followed by thawing at 37°C. The crushed slice was then transferred to an

Amicon Ultrafree-MC centrifugal filter device (Millipore, Billerica, MA) and centrifuged

for five minutes at 7,000 x g. The eluate volume was made up to 500 μl with distilled

water, extracted with phenol and then chloroform, and subsequently ethanol precipitated

and resuspended in distilled water. The double stranded oligomers F1+R1 were ligated to

the BamH I/Xba I digested plasmid. After the clone containing the insert was verified, it

was digested with Xba I and Hind III and the resulting approximate 3 kb product was

purified as described above. After purification, the annealed oligomers F2+R2 were

ligated to the digested plasmid, thus creating pSFH.

The mtmB1 gene was cloned into pSFH by first amplifying the mtmB1 gene from the vector CJ09 (containing wild-type mtmB1; James et al., 2001) or QC1A (containing mtmB1 with the TAG codon changed to AAG lysine; James et al., 2001) via PCR. The primers used were mtmBforward: 5'-TCTAGAACCGATACCCACAGAATCGT-3' and mtmBreverse: 5'-AGATCTGCCGTCAAGGTGCCAACTTG-3'. The PCR fragments

were purified from reaction components using the Qiagen PCR clean-up kit (Qiagen,

Valencia, CA), and an adenosine was added to the 3' ends using Taq polymerase

(Invitrogen Corp., Carlsbad, CA). The products were then cloned into pGEM-T

(Promega), creating either pMT (containing the wild-type mtmB1) or pMTK (harboring

the mutated mtmB1). The vectors pSFH, pMT and pMTK were digested with Xba I and

Bgl II. The digestions were electrophoresed on a 1% agarose gel and the products were

excised and purified as described for pGEM-3Z. The mtmB1 genes were ligated into

130 pSFH, and the verified clones were designated pSFH-MT and pSFT-MTK. The mtmB1

gene with a TAA at the TAG position was made using pSFH-MT as a template and

followed instructions from the Stratagene QuikChange mutagenesis kit (La Jolla, CA).

The primers used were: TAAF: 5'-

GGGTAGGCCTGGCATGGGTGTCTAAGGCCCAGAGACCTCCCTG-3' and TAAR:

5'-CAGGGAGGTCTCTGGGCCTTAGACACCCATGCCAGGCCTACCC-3'. The

verified construct was designated pSFH-MTX.

William Metcalf generously gave the uidA gene to our laboratory in the vector

pJK65. The uidA gene was first mutagenized so that the AAA lysine codon at amino acid

position 286 was changed to either a TAA or TAG. The primers used were: TAAF: 5'-

GGGCGAACAGTTCCTGATTAACCACTAACCGTTCTACTTTACTGG-3', TAAR:

5'-CCAGTAAAGTAGAACGGTTAGTGGTTAATCAGGAACTGTTCGCCC-3',

TAGF: 5'-GGGCGAACAGTTCCTGATTAACCACTAGCCGTTCTACTTTACTGG-3'

and TAGR: 5'-

CCAGTAAAGTAGAACGGCTAGTGGTTAATCAGGAACTGTTCGCCC-3'.

Approximately 650 bp of all three genes, including the mutated codon, were then PCR

amplified with primers containing Xba I and Bgl II sites. The primers used were:

GUSIVF: 5'-TCTAGAGCGTCTGTTGACTGGCAG-3' and GUSIVR: 5'-

AGATCTTTTGTCACGCGCTATCAG-3'. The PCR fragments were purified from

reaction components using the Qiagen PCR clean-up kit, a 3' adenosine was added using

Taq polymerase (Invitrogen Corp.), and the products were cloned into pGEM-T

(Promega), creating pBGK (wild-type uidA), pBG (uidA with a TAG) and pBGX (uidA with a TAA). The vectors pSFH, pBG, pBGX and pBGK were digested with Xba I and

131 Bgl II. The digestions were electrophoresed on a 1% agarose gel and the products were

excised and purified as described for pGEM-3Z. The uidA genes were ligated into pSFH,

where correct constructs were verified by sequencing and were subsequently designated

pSFH-BG, pSFH-BGX and pSFH-BGK.

A.2.2 Preparation of cell-free extracts

Methanosarcina barkeri MS cells were grown in 15 Liter culture vessels to

approximately mid-log phase on a modified DSM 304 medium (Sowers and Schreier,

1995; for modifications, see Mahapatra et al., 2006) with trimethylamine as substrate.

Cells were then harvested anaerobically as in Pottenplackel (1999), frozen in liquid

nitrogen and stored at -80°C until needed.

Approximately 40 grams of frozen cells were used to make extracts. Cells were

first ground in a mixer with occasional additions of liquid nitrogen to keep the cells

frozen. The cells were then thawed, with stirring, during exposure to vacuum and N2/H2

(95%/5%) cycles and brought into an anaerobic chamber containing 95% N2 and 5% H2.

In the chamber, 1 mL anaerobic Buffer A (20 mM Tris-Cl, pH 7.5, 10 mM MgCl2, 30 mM NH4Cl, 2 mM DTT) was added for every 1 g of cells used. The cells were then anaerobically lysed in a large French pressure cell at 20,000 psi and DNase I (Sigma-

Aldrich, St. Louis, MO) was added to the pooled lysate to a final concentration of 2

μg/mL. The lysate was then harvested anaerobically at 30,000 x g for one hour at 4°C.

Approximately half the supernatant (S30) was saved in anaerobic bottles at -80°C for use in assays. The remaining S30 was centrifuged anaerobically in an ultracentrifuge at

100,000 x g for 3 hours at 4°C. At this point, three phases could be observed in the

132 centrifuge tube: an upper layer closest to the cap, designated S100 upper; a darker layer

next to the pellet, termed S100 lower; and the crude ribosomal pellet, termed the S100

pellet. The S100 upper layer was saved as four 3 mL aliquots, the S100 lower layer was

saved as approximately forty 200 μl aliquots and the S100 pellet was resuspended in

approximately 4 mL Buffer A. All layers were saved at -80°C until needed. Before use,

the S100 pellet containing the crude ribosomes (and for some experiments, the S100

lower fraction) was dialyzed anaerobically at 4°C, with stirring, against 1 L Buffer A for

2 hours with four changes of buffer. Aliquots of 150 μl were saved at -80°C until

needed.

A.2.3 Preparation of salt-washed crude and column purified ribosomes

For preparation of crude salt-washed ribosomes, the S100 pellet was resuspended

in anaerobic Buffer C (20 mM Tris-Cl, pH 8.0, 10 mM MgCl2, 40 mM KCl, 500 mM

NH4Cl, 2 mM DTT) using a glass homogenizer. The resuspended pellet was then anaerobically spun in an ultracentrifuge for 1.5 hours at 100,000 x g at 4°C. The supernatant was kept at -80°C, and the pellet, or salt-washed ribosomes, was resuspended in anaerobic Buffer B (20 mM Tris-Cl, pH 8.0, 10 mM MgCl2, 40 mM KCl, 100 mM

NH4Cl, 2 mM DTT). Aliquots were stored at -80°C until needed.

For preparation of column-purified salt-washed ribosomes, the S30 was prepared

as written above, but instead of preparing the S100 extracts, ammonium sulfate was

added to the S30. This was done in an anaerobic chamber, with constant stirring, so that

210 mg was added to every 1 mL of S30. The pH was adjusted to 8.0 by the addition of

5 M KOH. The solution was stirred for 30 minutes and then centrifuged at 30,000 x g for

133 30 minutes at 4°C. The supernatant was collected and saved at -80°C until the

purification column could be run.

A size-exclusion column using Sephacryl S300HR (Sigma-Aldrich) as the matrix

was used to purify the ribosomes. The matrix bed was approximately 200 mL, and the

column dimensions were approximately 1.6 x 70 cm. The matrix was equilibrated in

aerobic Buffer C and degassed with agitation. After the column was poured, it was brought into the anaerobic chamber, where anaerobic Buffer C was run through it for approximately 20 hours at 0.5 mL/minute. The ammonium sulfate solution was thawed anaerobically, and 5 mL of this solution was applied to the column at 0.5 mL/minute.

Anaerobic Buffer C was run through the column at 0.5 mL/minute and 1.25 mL fractions were collected. Ribosomes elute in the excluded volume, or beginning at approximately

1 hour 35 minutes after the run was started. Eleven fractions were pooled for a total of

13.75 mL. After pooling, 0.1 g of PEG 8000 (Sigma-Aldrich) was added per 1 mL of pool, and the solution was stirred for 30 minutes. The solution was then anaerobically centrifuged at 20,000 x g for 15 minutes at 4°C. The pellet was kept and suspended in 2 mL anaerobic Buffer A, and dialyzed overnight at 4°C, with stirring, against 2 liters

Buffer A in a pressurized sidearm flask (in order to maintain an anaerobic atmosphere).

Aliquots of 100 μl were taken, anaerobic glycerol was added to 5%, and were stored at -

80°C until needed. An average yield of column-purified ribosomes was 3.5 mg at a concentration of 1.1 mg/mL.

134 A.2.4 Preparation of mRNA substrates

For the assays using polyU as substrate, polyuridylic acid was obtained from MP

Biochemicals (Irvine, CA). Polyguanylic acid (polyG) was obtained from Sigma-

Aldrich. For the generation of specific mRNA, all plasmid constructs had a Hind III

restriction site on the 3' end of the DNA, which was used to linearize the template and

generate runoff transcripts. After linearization, the DNA was electrophoresed on a 1%

agarose gel, the 3 kb product was excised from the gel and the DNA was extracted as

listed above. The mRNA was made using the RiboMAX large scale RNA production

system for T7 polymerase (Promega Corp.). The only variations made to the protocol

were that the mRNA pellet was precipitated using one volume isopropanol and the

resulting pellet was air-dried for approximately 20 minutes instead of being dried under vacuum. After suspending the pellet in nuclease-free water, it was subjected to size exclusion in a MicroSpin G-25 column (GE Healthcare, Piscataway, NJ). To check

integrity, all transcripts were visualized on a 1% agarose gel and subsequently quantitated

by reading the absorbance at 260 nm. All A260/A280 ratios were between 1.8 and 2.0, and

the average recovery from a 100 μl transcription reaction was 250 μg of transcript.

A.2.5 In vitro translation assays

Standard translation assays (in a volume of 100 μl) for polyU substrate contained

40 mM Tris-Cl, pH 7.5, 20 mM MgCl2, 200 mM NH4Cl, 80 mM KCl, 0.4 mM

spermidine, 0.32 mg/mL polyU, 120 μM amino acid mixture -phenylalanine (containing

19 cold amino acids), 90 nM L-phenylalanine-[ring-2,6-3H(N)] (56 Ci/mmol; Sigma-

Aldrich), 5 mM phosphoenolpyruvate (PEP; Sigma-Aldrich), 0.3 units pyruvate kinase

135 (Calbiochem, San Diego, CA), 1 mM ATP, 100 μM GTP, 9 mM β-mercaptoethanol, 50

μg of column-purified salt-washed ribosomes and 200 μg of the S100 lower fraction.

Translation assays (in a volume of 100 μl) for specific transcript substrates contained 40 mM Tris-Cl, pH 7.5, 10 mM MgCl2, 100 mM NH4Cl, 80 mM KCl, 0.2 mM spermidine, 20 μg in vitro transcribed mRNA, 120 μM amino acid mixture (containing 18 cold amino acids), 15 μM L-phenylalanine-[ring-2,6-3H(N)] (56 Ci/mmol), 15 μM L-[U-

14C] histidine (315 mCi/mmol; GE Heathcare) , 5 mM phospho(enol)pyruvate, 0.3 units pyruvate kinase, 1 mM ATP, 100 μM GTP, 9 mM β-mercaptoethanol, 22 μg of M. acetivorans tRNA pool grown on TMA (gift from Gayathri Srinivasan and isolated as in

Chapter 2), 100 μg of the dialyzed S100 pellet and 400 μg of the S100 lower fraction.

Occasionally 15 μM L-[4,5-3H]lysine monohydrochloride (72 Ci/mmol; GE Heathcare) was used in the assays as well.

All in vitro translation assays were performed anaerobically in oxygen-free vials.

The Tris-Cl, MgCl2, NH4Cl, spermidine, PEP, polyU, pyruvate kinase, ATP, GTP and β- mercaptoethanol were all combined and made anaerobic by flush/evacuation with 100%

N2. This combination was termed Mixture I. The non-radiolabeled amino acid mixture was made anaerobic in a separate vial at the same time as Mixture I, and the ribosomes and S100 lower fraction were thawed anaerobically under a gentle stream of nitrogen.

Anaerobic Mixture I was then combined with the other anaerobic fractions and anaerobic deionized water was added as required. Aerobic transcript was added as needed, and reactions were initiated by the addition of the aerobic radioactive amino acid(s).

Reactions were incubated at 37°C for 40 minutes, and 20 μl time points were taken. To stop the reaction, aliquots were added to 180 μl 1 N NaOH and mixed. This mixture was

136 then added to 180 μl 1 N HCl and mixed, and the entire combination was then added to 2 mL 10% trichloroacetic acid (TCA)/1% casamino acids preheated to 95°C. The 2 mL mixtures were added to GF/A filters (Whatman, Florham Park, NJ) pre-soaked in 5%

TCA/1% casamino acids and subjected to vacuum filtration on a Millipore sampling manifold. Filters were rinsed with 5% TCA, taken off the manifold, heated to 100°C for

20 minutes and added to scintillation fluid where the disintegrations per minute (dpms)

incorporated into TCA precipitable material were counted in a scintillation counter.

A.3 Results

A.3.1 In vitro translation assays work with polyuridylic acid as a substrate

In vitro translation assays were performed as listed in the Materials and Methods, but protein components were added in different combinations in order to determine which of the components should be added to obtain the optimal translation of polyuridylic acid.

Combinations of the proteins from S100 supernatants and ribosomes were tested. The

S100 fractions contain components used in translation, where the S100 upper fraction

(the upper two-thirds of the S100 supernatant) contains most of the soluble components and the S100 lower fraction (the lower one-third of the S100 supernatant) is rich in translation factors. S30 extracts were not tested, since they were previously shown not to work as well as the S100 extracts (Elhardt and Böck, 1982). As shown in Figure A.1, the

S100 lower fraction plus the addition of column-purified ribosomes gave the highest amount of translated product. When column-purified ribosomes were used without the

S100 protein extract, no phenylalanine incorporation was detectable. Because polyU translation had the largest dependence on ribosomes plus the S100 lower extract, all

137 subsequent in vitro translation assays were performed using these two protein components.

Endogenous mRNA was found within the protein fractions and could be giving

false positive results. Therefore, the requirement for polyU in the translation system was

tested. A dependence on both polyU and ATP/GTP was shown (Figure A.2).

Interestingly, polyU translation was also increased by the addition of an exogenous

amino acid mixture (with phenylalanine present at the regular concentration). The

addition of the 19 amino acids may increase the amount of polyU translation by freeing

any ribosomes still in the process of translating endogenous mRNA.

The in vitro translation system was then tested for its sensitivity to the presence of

oxygen. As usual, the protein components were isolated anaerobically and the assays

were anaerobically assembled. However, before initiation of the protein synthesis

reactions, half the vials were decapped and mixed in order to expose the components to

oxygen. After initiation of translation, the reactions were incubated for one hour in the

presence of oxygen. In agreement with Elhardt and Böck (1982), the reactions worked

equally well in the presence of oxygen as they did when they were anaerobic (Figure

A.3). However, when column-purified ribosomes were prepared in the presence of oxygen and later used in assays exposed to oxygen, no phenylalanine incorporation was observed. Because of the oxygen-sensitivity of the ribosomes, all further assays were performed under anaerobic conditions.

138

Figure A.1. The use of the S100 lower fraction plus the column-purified ribosomes results in the highest phenylalanine incorporation in the in vitro translation assay. All columns are the averaged results of three replicates. The ribosomes in these assays are column-purified, and 200 μg of the S100 upper fraction was used in each assay. Each assay represents product formed over forty minutes of incubation.

139 0.05 0.045 0.04 0.035 0.03 0.025 0.02 0.015 0.01 0.005 0

Phenylalanine Incorporation (pmoles) minus polyU minus GTP/ATP minus 19 amino complete acids reaction

Figure A.2. In vitro polyphenylalanine synthesis is dependent upon polyU and ATP/GTP. The overall low amount of polyphenylalanine incorporation is possibly due to freeze-thawing of the pyruvate kinase prior to performing the assays. All reactions were performed in triplicate. Each assay represents product formed over forty minutes of incubation.

140 1

0.8

0.6

0.4 (pmoles)

0.2

0 Phenylalanine Incorporation Aerobic Anaerobic Assay Conditions

Figure A.3. Aerobic in vitro assay conditions work as well as anaerobic assay conditions. Aerobic reactions were exposed to oxygen prior to initiation and incubated in the presence of oxygen over the course of the translation reaction. Anaerobic reactions were treated as usual. All reactions were done in triplicate, and incorporation of 3H- phenylalanine was monitored. Each assay represents product formed over forty minutes of incubation.

Finally, to complete the optimization of the in vitro system using polyU as substrate, a time course was performed to show increasing tritiated-phenylalanine incorporation into protein over time. Over the span of thirty minutes approximately 1.5 pmoles of phenylalanine was incorporated into protein (Figure A1.4).

141 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0

Phenylalanine Incorporated (pmol) 0 5 10 15 20 25 30 35 Time (min)

Figure A.4. Time course using polyU as substrate, showing 3H-phenylalanine incorporation over 30 minutes. Assays were performed in triplicate.

A.3.2 Translation initiation occurs on methanogen-based transcripts in vitro

After the in vitro translation system was shown to work with polyU as a substrate, mRNA transcribed from methanogen genes was tested. Initially, a short reporter

transcript was designed for use in the system in order to re-optimize the ionic conditions.

The reporter construct, pSFH, contains the ribosome-binding site (RBS) and translation

start region of mttB along with ten TTC (phenylalanine) codons and an Xba I restriction

site, which were inserted after the T7 promoter region of the plasmid pGEM-3Z. The

142 TTC codon was chosen so that nonspecific binding of ribosomes should not occur (Fu

and Parker, 1994; Schwartz and Curran, 1997). If translation in vitro occurs, 3H-phe will be incorporated and can be monitored using a scintillation counter. The same concept was used for the 3' end of the constructs, where a Bgl II restriction site was inserted

before fifteen CAC (histidine) codons, two TAA (stop) codons and a Hind III restriction

site. Using 14C-histidine incorporation as the reporter, completion of translation can be

observed. The design of the reporter system permits any DNA sequence of interest to be

inserted between the Xba I and Bgl II sites, and runoff transcripts can then be made using

the Hind III restriction site and used for in vitro translation. In initial experiments using

the short reporter construct, four TTC (phe) codons were inserted in between the Xba I

and Bgl II sites (Figure A.5).

Figure A.5. Design of the reporter construct, pSFH, used for in vitro translation assays. Xba I and Bgl II sites were incorporated so that any DNA sequence of interest can be cloned in between the sites. A T7 promoter for transcription initiation is just upstream of the Bam HI site in the construct, and Hind III is used to generate templates for runoff transcription. 3H-phenylalanine incorporation measures initiation, while 14C-histidine incorporation indicates complete translation of the transcript. All constructs were fully sequenced to confirm that no deletions, insertions or base changes had occurred.

143 After production of mRNA using the pSFH vector, the ionic concentrations in the

assay were re-optimized in order to get maximal amounts of translation with specific

transcripts. In order to reduce the number of variables in the assays, only 3H- phenylalanine incorporation was monitored. As optimal ionic concentrations were identified, these conditions were incorporated into all subsequent experiments. Varying concentrations of MgCl2 were tested first, where a concentration of 11 mM was

determined to result in the highest amount of phenylalanine translation (Figure A.6).

Assays performed later in order to fine tune the concentrations resulted in a determination

that 10 mM MgCl2 was the optimal concentration for the assay. Ammonium chloride

concentrations were then assayed using the optimized Mg2+ concentrations, and were

again monitored by 3H-phenylalanine incorporation. In conjunction with fine-tuning

experiments performed later, a concentration of 100 mM NH4Cl was found to result in

the highest amount of 3H-phenylalanine incorporation (Figure A.7). Spermidine was the

final component to be optimized. These assays contained the previously optimized Mg2+

+ and NH4 concentrations. A concentration of 0.2 mM was found to have the best effect on in vitro translation of the exogenously added mRNA (Figure A.8).

From assay to assay, the amount of protein produced was variable. This may be

due in part to the low stability of some of the components in the assays, such as the

pyruvate kinase and the ribosomes. Oxygen contamination is also variable from assay to

assay and so could affect the amount of protein produced. In addition, until all the ionic

concentrations were optimized, it was likely that the assays would not operate as

efficiently as possible. Finally, as discussed in section A.3.5, the amounts of mRNA

substrate being added to each assay were also variable and may have affected translation.

144 After optimization of the major ionic conditions in the in vitro translation system, three constructs were designed to monitor readthrough of the UAG codon in the mtmB1 transcript. All DNA was cloned into the Xba I and Bgl II sites of pSFH in order to detect translation initiation and completion of the transcripts. The first construct, pSFH-MT, contains approximately 700 bases surrounding the TAG of the wild-type mtmB1 gene, with 133 codons before the TAG and 100 codons after it. The second and third constructs contain the same amount of surrounding DNA, but with the TAG changed to a

TAA (stop codon), termed pSFH-MTX, or an AAG (lysine), termed pSFH-MTK. The

TAA-containing construct serves as a negative control, which should always terminate protein synthesis at the UAA codon, while the AAG-containing construct serves as a positive control, which should allow protein synthesis to continue.

After the mtmB1 constructs were obtained, time courses were performed using transcripts from pSFH-MT and pSFH-MTK. Translation initiation as well as completion of translation was monitored. As seen in Figure A.9, translation of the regions 5' to the

UAG or AAG codons in the transcripts appears to be efficient, but no significant 14C- histidine incorporation is evident.

145 0.035

0.03

0.025

0.02

0.015

0.01

0.005 Phenylalanine Incorporated (pmoles) Incorporated Phenylalanine

0 -mRNA 5 mM 11 mM 20 mM 30 mM 40 mM Magnesium Concentration (mM)

Figure A.6. Optimization of magnesium concentrations in the in vitro translation assay. Assay conditions for this experiment are as in the polyU assays. Assays using a 3 concentration of 11 mM MgCl2 were found to result in the highest amount of H- phenylalanine incorporation. The low amount of incorporation in this experiment may be because the other ionic conditions in the system had not yet been optimized. After optimization, assays were performed again over a narrower range of Mg2+ to determine the optimal magnesium concentrations for the system, and essentially agreed with the results seen here. All assays were performed in duplicate over forty minutes using transcript produced from the pSFH vector. A control reaction using polyuridylic acid as the substrate resulted in the formation of 0.7 pmoles of product. The reaction lacking transcript contained 10 mM MgCl2.

146 1.2 ) 1

0.8

0.6

0.4

0.2 Phenylalanine Incorporation (pmoles

0 -mRNA 6.3 mM 16.3 mM 30 mM 60 mM 100 mM

NH4Cl Concentration (mM)

Figure A.7. Optimization of ammonium chloride concentrations in the in vitro translation assay. Assays using a concentration of 100 mM NH4Cl were found to result in the highest amount of 3H-phenylalanine incorporation. Later experiments assaying NH4Cl concentrations up to 125 mM agreed with the results seen here. All assays were performed in duplicate using transcript produced from the pSFH vector. A control reaction using polyuridylic acid as the substrate resulted in the formation of 1.8 pmoles of product. Each assay represents product formed over forty minutes of incubation.

147 0.09

0.08

0.07

0.06

0.05

0.04

0.03

0.02

Phenylalanine Incorporation (pmoles) Incorporation Phenylalanine 0.01

0 -mRNA 0 mM 0.2 mM 0.4 mM 0.6 mM 1.0 mM Spermidine Concentration (mM)

Figure A.8. Optimization of spermidine concentrations in the in vitro translation assay. Assays using a concentration of 0.2 mM spermidine were found to result in the highest amount of 3H-phenylalanine incorporation. All assays were performed in duplicate over forty minutes and used transcript produced from the pSFH-MTK vector. A control reaction using polyuridylic acid as the substrate resulted in the formation of 0.06 pmoles of product.

148 12 pSFH-MT Phe Incorporation pSFH-MT His Incorporation 10 pSFH-MTK Phe Incorporation pSFH-MTK His Incorporation 8

6

4

Translated Product (pmoles) 2

0 0 5 10 15 20 30 45 Time (min)

Figure A.9. Time course showing that 3H-phenylalanine incorporation is occurring with each transcript, but almost no 14C-histidine incorporation occurs. Equal concentrations of radioactive isotopes were added to each reaction, so if translation was continuing through to the end of the transcripts, equal or greater amounts of 14C-histidine should be incorporated into the protein product. All assays were done in duplicate.

A.3.3 Further attempts to increase efficiency of message completion relative to initiation

Because amounts of full-length protein synthesis were low compared to apparent

levels of translation initiation, various additions to the in vitro translation assays were

tested. First, in case ribosomes or other translation factors were not present in high

149 enough concentrations within the assays, the concentrations of the protein fractions were

either doubled or tripled. Neither protein concentration appeared to increase the amount

of full-length protein product, since both levels of radioisotope incorporation remained the same as seen in the time courses in Figure A.9.

Next, ribosomes were prepared in different ways and added to the assays to see

whether it would increase the amount of protein produced. The S100 crude ribosomal

pellet was either dialyzed or salt-washed and added to the assays. Also, the supernatant

of the salt-washed ribosomes (which could contain translation factors) was added to the

salt-washed ribosomes to discern whether it increased the amount of protein produced.

As seen in Figure A.10, when assaying for the incorporation of 3H-phenylalanine, no

condition tested increased the amount of protein produced. Only the dialyzed S100 crude

ribosomes seem to lower the background amount of translation occurring with

endogenous mRNA. Therefore, in order to reduce background levels of translation, dialyzed S100 crude ribosomes were used in subsequent assays.

In addition to the different preparations of ribosomes used, tRNA prepared from

M. acetivorans extracts grown on methanol was added to the assays. The tRNA was

added in increasing amounts in order to see whether it stimulated translation efficiency.

As seen in Figure A.11, adding increasing amounts of tRNA seemed to inhibit the

translation reaction. Although adding increasing amounts of tRNA inhibited the

reactions, 22 μg of tRNA prepared from M. acetivorans extracts grown on TMA was added to the assays from this point forward. With the probable low abundance of tRNAPyl, the addition of extra tRNA will most likely be necessary in order to observe

readthrough of the UAG codon within the mtmB1 transcript.

150 Finally, it was possible that the components within the assays were not being reduced enough when they were made anaerobic. In order to test this, titanium citrate, a strong reductant, was added to the in vitro translation assay and all components were made anaerobic using 100% hydrogen. Assays containing 2 mM titanium citrate appeared to produce as much protein as assays not containing the titanium.

Unfortunately, these results were not repeatable, and other assays performed demonstrated complete inhibition of translation in the presence of 2 mM titanium citrate.

This variability may be due to the known ability of this strong reducing agent to generate free radicals from trace amounts of oxygen. Both the radiolabeled amino acids and the transcripts were added aerobically to each reaction and would have introduced oxygen into the reactions.

151 10 8 6 4 2 0 t t e l lle .w. es Phe Incorporated (pmoles) om RNA 0 pel s m ed pe llet+s bo - h ri S10 s .w. ed w. pe pellet-mRNA z t-was s. nu y al mi zed pellet-mRNAs.w. S y pellet+s Dial Dial s.w.

Figure A.10. In vitro translation assay demonstrating that using the dialyzed S100 pellet results in the lowest background as monitored by 3H-phenylalanine incorporation. The high background may be due to the presence of exogenous ribosomes and/or mRNA in the protein preparations. Assays were performed in duplicate over forty minutes and the transcript produced from the pSFH-MTK vector was used as the substrate. Assays contained 100 μg of ribosomes and 10 μg of the protein from the salt-wash fraction when these fractions were used. s.w. = salt-wash

152 5

4

3

2 (pmoles) 1

0 Phenylalanine Incorporated Incorporated Phenylalanine 22 44 110 220 tRNA (micrograms)

Figure A.11. In vitro translation assay demonstrating that increasing amounts of tRNA inhibit translation. All assays were performed in duplicate over forty minutes. The results shown are corrected for the amount of incorporation found with control reactions lacking added mRNA. The transcript produced from the pSFH-MTK vector was used as the substrate and translation was monitored using 3H-phenylalanine incorporation.

A.3.4 Attempting to stabilize the transcripts had no positive effect on translation

Since none of the previous experiments seemed to have an effect on raising the

levels of translation, it was theorized that the mRNA might be getting degraded. This

could result in lowered amounts of protein produced from the in vitro translation

reactions. First, increasing amounts of RNasin, an RNase inhibitor from Promega, was

added to the translation reactions to see whether this promoted transcript stability. It was

chosen because it inhibits eukaryotic RNases and the hope was that it would also inhibit

archaeal RNases since Archaea have been proposed to have a eukaryotic-like exosome

153 for RNA degradation (Bini et al., 2002). Exosomes have emerged as central 3'-5' RNA

processing and degradation machineries in eukaryotes and Archaea (Büttner et al., 2005).

Both translation initiation and completion were monitored, and the addition of 100 units

of the RNase inhibitor increased the amount of 3H-phenylalanine incorporation, while the

addition of 50 units only marginally increased the 14C-histidine incorporation (Figure

A.12). When the assay was repeated with amounts of RNase inhibitor ranging from 0 to

100 units, 3H-phenylalanine incorporation seemed to be suppressed by addition of the

inhibitor and 14C-histidine incorporation was barely detectable. All components used in

the second assay were the same as were used with the first assay.

Next, longer transcripts were prepared as it was possible that 3' exonucleases were

degrading the transcripts. AlwN I was used to digest pSFH-MTK and pSFH-MT, which

is approximately 800 bases downstream of the Hind III site usually used to create

templates for runoff transcripts. This digestion created the longer templates, and after

blunt ends were created on the templates, transcripts were produced as in the Materials

and Methods. The lengths of the extended transcripts were then confirmed by

visualization on formaldehyde agarose gels. These transcripts were then used in the in

vitro translation assays, where no significant increase of translation was detected.

Moreover, only the transcript produced from the pSFH-MT construct resulted in any

significant translation above background levels, with 3.5 pmoles of 3H-phenylalanine

incorporation and 0.8 pmoles of 14C-histidine incorporation occurring. It was possible

that the longer transcripts were folding in a conformation that did not allow efficient translation, and so it was decided to continue the use of the shorter transcripts in the

assays.

154 18 16 Phenylalanine 14 Incorporation 12 Histidine Incorporation 10 8 6 4

Translated Product (pmoles) 2 0 0 50 100 200 400 RNasin added (units)

Figure A.12. The addition of an RNase inhibitor to the in vitro translation assay appears to increase the amount of protein produced. Translation initiation is indicated by 3H- phenylalanine incorporation, while completion of translation is indicated by 14C-histidine incorporation. The results shown are corrected for the amount of incorporation found with control reactions lacking added mRNA. All assays were done in duplicate over forty minutes, and the transcript produced from the pSFH-MTK vector was used as the substrate.

155 In order to address whether translation completion was simply not being detected

properly, a third isotope was used in assays containing transcript made from the pSFH-

MTK vector. 3H-lysine was chosen because if translating ribosomes are making it to the

AAG codon, phenylalanine and lysine incorporation should be approximately equal. As

seen in Table A.1, 3H-lysine incorporation is approximately one-half the amount of 3H- phenylalanine incorporation, but the 3H-lysine incorporation is still three times the amount of 14C-histidine incorporation. This result adds to the evidence that initiation of

translation is occurring, but complete translation of the transcript is not. This result also

suggests that translation is ceasing before ribosomes make it to the AAG codon.

pmoles Number of Number of Incorporated Amino Acid Codons Before Codons After After Forty AAG AAG Minutes 3H Phenylalanine 12 1 6.55 3H Lysine 11 2 3.33 14C Histidine 2 19 1.33

Table A.1. 3H-phenylalanine incorporation is greater than 3H-lysine and 14C-histidine incorporation. Phenylalanine and lysine incorporation should be equal if translating ribosomes are making it to the AAG codon in the transcript made from the pSFH-MTK vector. Also, 14C-histidine incorporation shows that almost no, if any, full translation is occurring. All reactions were done in duplicate.

156 Carrier mRNA was used in a final attempt to determine whether the problem of obtaining full-length translation is due to degradation of the mRNA in the in vitro assays.

Polyguanylic acid (polyG) was used as the carrier mRNA, and was added in increasing amounts to the assays to see whether the specific mRNA would then be protected from degradation. However, as seen in Figure A.13, the addition of polyG seems to inhibit the translation reaction, and appears to offer no protection against degradation of the in vitro transcribed mRNA.

6

Phenylalanine 5 Incorporation Lysine Incorporation 4

3

2

1 Translated Product (pmoles)

0 00.51 polyG added (mg)

Figure A.13. The addition of polyG as a carrier mRNA appears to inhibit in vitro translation. 3H-lysine incorporation was used in order to better detect translation of the mRNA, while 3H-phenylalanine incorporation was used as a control. All reactions were performed in duplicate over forty minutes and the transcript produced from the pSFH- MTK vector was used as the substrate. The results shown are corrected for the amount of incorporation found with control reactions lacking added mRNA.

157 A.3.5 Using higher amounts of transcript resulted in higher amounts of translated product

When none of the experiments that were trying to increase mRNA stability

worked, the mRNA itself was inspected more closely. Up to this point, the integrity of

the mRNA had been checked using agarose gels containing formaldehyde as well as low

percentage acrylamide gels. With this analysis, the mRNA was visible, but was in lower

amounts than what was reported by spectrophotometric analysis. Additionally, a

discrepancy between the apparent amounts of the mRNAs and standard RNAs was seen

on these gels. This led to the thought that the transcripts were not properly quantified.

As a result, after the mRNA was synthesized as usual, it was run through G-25 size

exclusion columns in order to reduce any unincorporated ribonucleotides that may still be

present. Quantitation by A260 of the RNA before and after removal of the low molecular

weight fraction containing unincorporated ribonucleotides indicated that in spite of

isopropanol precipitation, many unincorporated ribonucleotides were indeed still present at the end of the in vitro transcription reactions. Because the amount of mRNA being added to the in vitro translation reactions was not being correctly determined, it is most likely the reason for the irreproducibility seen between the assays (in terms of pmoles incorporated).

Until this point, approximately 20 μg of mRNA (which was really most likely 9

μg, or 43% of the expected 20 μg) was used in the in vitro translation reactions. Now,

after removal of excess ribonucleotides, titration reactions were performed using these

substrates to see if the amount of product was increased. Both translation initiation and

completion were monitored. As seen in Figure A.14, using the corrected amounts of

158 transcript did increase translation rates, but the completion of translation is still approximately one-fourth of the amounts of translation initiation.

The shorter transcript produced from the pSFH template was then tested alongside

the transcripts produced from the pSFH-MT and pSFH-MTK vectors in order to

determine whether only the longer transcripts were not being completely translated. A

transcript made from the pSFH-MTX vector, where the TAG codon is changed to a TAA

stop codon, was used as well. As monitored by 3H-phenylalanine and 14C-histidine

incorporation, the transcripts produced from the pSFH-MT, pSFH-MTK and pSFH-MTX

vectors resulted in approximately the same amount of 5-fold higher translation initiation

than translation completion, while the transcript produced from the pSFH template

resulted in only 2-fold higher translation initiation (Figure A.15). Although this is a

better ratio, the total amount of translation was almost 10X lower than with the other

transcripts. This experiment demonstrates that the in vitro translation assays do not seem

to be efficiently translating to the ends of the transcripts, regardless of which message is

used.

159 100

80

Phenylalanine 60 Incorporation Histidine 40 Incorporation

20

Translated Product (pmoles) 0 0 0.1 1 5 10 20 30 45 mRNA added (micrograms)

Figure A.14. Titration of corrected amounts of mRNA levels in the in vitro translation assay. The amount of protein produced was increased, but the amount of 3H- phenylalanine incorporated is still approximately four times that of 14C-histidine incorporation. All reactions were done in duplicate, and the transcript produced from the pSFH-MTK vector was used as the substrate. The results shown are corrected for the amount of incorporation found with control reactions lacking added mRNA.

160 120 100

80 Phenylalanine Incorporation 60 Histidine Incorporation 40 20 0 Translated Product (pmoles) pSFH- pSFH- pSFH- pSFH MTX MT MTK Transcription Vector Used

Figure A.15. In vitro translation assay comparing messages from all four transcription vectors. No matter which message is assayed, the level of translation initiation was higher than translation completion. The ratio of initiation to completion was higher with the pSFH-based message, but the overall incorporation of 3H-phenylalanine, indicating transcript initiation, was much lower than with the other transcripts. All reactions were done in duplicate over forty minutes, and the results shown are corrected for the amount of incorporation found with control reactions lacking added mRNA.

It was feasible that the transcripts were not folding in their proper conformations, which may result in less access for translating ribosomes when they are added to the translation assays. To test for this possibility, the transcript produced from the pSFH-

MTK vector was heated to 65°C for ten minutes, then slowly cooled to room

161 temperature. The refolding of the transcript seemed to help initiation of translation, but no difference was observed in completion of translation (Figure A.16).

140

120

100 Phenylalanine 80 Incorporated

60 Histidine Incorporated

40

20 Translated Product (pmoles)

0 No Refolding Plus Refolding

Figure A.16. Refolding of the transcript prior to adding it to the assay appears to increase the amount of 3H-phenylalanine product, but not the amount of 14C-histidine product. All reactions were done in duplicate over forty minutes, and the results shown are corrected for the amount of incorporation found with control reactions lacking added mRNA. The transcript produced from the pSFH-MTK vector was used as the substrate.

162 In a final attempt to observe completion of translation in the in vitro translation system, a different message was tested. Approximately 650 bases of the E. coli gene uidA, which encodes β-glucuronidase, was cloned into the pSFH vector, creating pSFH-

BGK. Two other constructs were created, where the AAA lysine codon in the middle of wild-type uidA was mutated to either a TAG codon (creating pSFH-BG) or a TAA stop codon (creating pSFH-BGX). The mRNA was obtained from all three new constructs and their translation was compared with that of the message produced from pSFH-MT in the in vitro translation system. As seen in Figure A.17, the rates of translation initiation with the three new transcripts were almost the same as with the messages produced from the pSFH-MT vector, but again, almost no completion of translation was seen with any of the messages.

It was possible that given enough time, the 14C-histidine incorporation may reach

the levels of the 3H-phenylalanine incorporation in the transcript produced from pSFH-

BGK. However, this was not the case, and the ratios of incorporation between the two isotopes remained the same as in the previous assay (Figure A.18). Overall, translation was not as efficient using the transcript from pSFH-MTK in this experiment as it was previously, but the results for the transcript from pSFH-BGK still show almost 100X less translation completion than translation initiation.

163 200

150 Phenylalanine Incorporation 100 Histidine Incorporation

50

Translated Product (pmoles) 0 pSFH- pSFH- pSFH- pSFH- MT BG BGK BGX Transcription Vector Used

Figure A.17. 3H-phenylalanine incorporation can be observed in the transcripts derived from uidA, but still no significant 14C-histidine incorporation is detectable. All reactions were done in duplicate over forty minutes, and the results shown are corrected for the amount of incorporation found with control reactions lacking added mRNA.

164 200 180 160 MTK-Phe Incorporation 140 120 MTK-His Incorporation 100 BGK-Phe 80 Incorporation 60 BGK-His 40 incorporation 20 Translated Product (pmoles) 0 0 5 10 20 30 40 60 Time (min)

Figure A.18. Time course of translation of transcripts made from pSFH-MTK and pSFH-BGK. Over the course of sixty minutes, no significant amount of 14C-histidine incorporation was observed. Each assay was done in duplicate and contained 10 μg of transcript.

A.4 Discussion

Using this system, we have been able to show translation using defined RNA

messages within M. barkeri MS. Rates of translation up to 7.5 pmoles/min-1mg-1 have

been observed. This is comparable to Escherichia coli in vitro protein synthesis batch

systems, which can typically produce protein at rates of 7.6 pmoles/min-1mg-1 (Jewett and

Swartz, 2004). This is the first examination of an in vitro translation system employing

165 components from Methanosarcina spp. that relies on translation of specific mRNA, since previous reports rely entirely on polyuridylic acid as the message. Unfortunately, equivalent amounts of completion of translation were never observed, even after running a series of experiments designed to troubleshoot common problems that may be occurring in our system. The design of the reporter construct used in this chapter was modified from a construct used in an in vitro translation system designed to monitor readthrough of

UGA codons as tryptophan in Mycoplasma capricolum (Oba et al., 1991). Using this system, M. capricolum was shown to incorporate tryptophan at the UGA codons, while in an E. coli control system, translation was shown to terminate at the UGA codons (Oba et al., 1991). The reporter construct used for these experiments had ten isoleucine codons upstream of two UGA codons and five tyrosine codons downstream from the UGA codons. Incorporation of each of the tritiated amino acids was used to monitor translation of the mRNA. No specific M. capricolum DNA sequences were used to make the mRNA and only the S-30 extracts were tested. The system incorporated approximately 0.8 pmoles of isoleucine and 0.4 pmoles of tyrosine. This is the expected ratio of isotope incorporation for translation initiation versus readthrough of the stop codons.

Additionally, when readthrough of the tryptophan codons occurred, the expected amount of approximately 0.3 pmoles of tryptophan incorporation was seen. This study demonstrates that this type of in vitro translation system has no inherent problems. There are, of course, many differences between this system and our system, which is designed for the anaerobic translation of specific methanogen mRNA, but the general scheme of the two reporter constructs are the same.

166 In our system, the pSFH vector was originally designed using a different reporter

to monitor translation completion, where 15 UGU (cysteine) codons were used instead of

the 15 CAC (histidine) codons. This construct was eventually discarded because the

background levels of 35S-cysteine were extremely high in the in vitro translation assays.

In addition to this, the levels of translation completion were never any higher than the

levels seen with the histidine reporter. After the cysteine reporter was discarded, the next

best choice for the amino acid reporter monitoring translation completion was histidine.

This reporter was chosen because there were few histidine codons before or after the

UAG codon in the mtmB1 transcript, and so if 14C-histidine incorporation was seen, it could be attributed to completion of translation of the transcript. Other codons for potential amino acid reporters were present in higher numbers within the transcripts and so were not logical choices. This is because if any incorporation were detected, it would not be able to be determined whether the incorporation was due to translation before or after the UAG codon. In total, two different reporters for the detection of translation completion were tested, and a full-length protein product was not detectable with either one.

Since this type of reporter system has been used in both M. capricolum and E. coli

(Oba et al., 1991), it should be able to work in M. barkeri as well. Some further

experiments are, however, required to bring this system to completion. Incorporation of

3H-phenylalanine, indicating translation initiation, was observed in our system, but the

dependence of translation on the Shine-Dalgarno sequence and ATG start codon has not

yet been demonstrated. Thus, specific initiation has not yet been shown and it is possible

167 that a type of polyU dependent translation is occurring even with the UUC phenylalanine

codon.

Although specific translation initiation may not be taking place in this system, 3H-

phenylalanine incorporation has been observed, and so translation is occurring. The main question is why full-length protein products were never detectable. Many different

changes to the assays were tested in the hopes that it would result in a higher amount of

translation completion, but higher amounts of 14C-histidine incorporation were not observed. Titrations of 12C-histidine diluting the 14C-his isotope would indicate whether large amounts of endogenous histidine is present in the system and causing lower counts than expected. If the addition of increasing amounts of 12C-histidine does not cause a

predicted drop in counts, then we will know there is already too much endogenous

histidine present to properly assay readthrough.

The folding of the transcripts used in these assays may be inhibiting the

production of full-length protein. Five different transcripts that had the potential to

produce a full-length protein product were tested. Four of these transcripts were

produced from two diverse genes, and the fifth transcript was entirely artificial. The

thought was that at least one of these transcripts should fold in a conformation that would allow ribosomes to complete translation. All ribosomes encounter secondary structures

on the mRNA that they are translating, and so it would be surprising if secondary

structure alone were inhibiting the production of full-length protein in this system.

Also, it is still possible that the mRNA substrates are being degraded before the

ribosomes can finish translating. Northern blots could be performed to see whether the

transcripts are fully intact at the end of an assay. If the mRNA is degraded, this will

168 indicate the presence of RNases, which could not be inhibited by the methods tested here.

The RNases within M. barkeri may be unlike those found in eukaryotes, and so RNase

inhibitors may not function to their full extent in the presence of an extract from the

methanogen.

Additionally, it is possible that the translating ribosomes are stalling on the

transcripts, and so will never finish translating the mRNA. One reason that stalling may

be occurring is because the full-length transcripts are required for translation. Perhaps

the incomplete transcripts fold in such a way that does not allow easy passage for

translating ribosomes. A nuclease protection assay can determine if this is occurring.

Moreover, it is possible that full-length protein is being produced, but is not being

reported by the system. After completion of the assays, SDS-PAGE gels could be run

and then exposed to a phosphor screen in order to detect and examine the size of the

protein product.

Finally, limitation for pyrrolysine is not the main problem with this assay, since

the transcript produced from the pSFH-MTX vector appears to complete translation with

the same efficiency as transcript produced from the pSFH-MTK vector. However, the

addition of exogenous pyrrolysine may be necessary for higher amounts of translation of

these transcripts. At the time these experiments were performed, pyrrolysine had not yet been synthesized and so the assays could not be supplemented.

As it stands, we have developed an in vitro translation system that appears to be

able to initiate translation of specific mRNAs under anaerobic conditions, with elongation

rates comparable to Escherichia coli batch translation systems. This study lays the

foundation of an in vitro system that can be used to understand UAG translation as

169 pyrrolysine, which may prove of some advantage in the future. However, given the utility

of the methods outlined in Chapter 3, it appears that the in vivo approaches are more likely to provide more ready insights in the near future.

170 LIST OF REFERENCES

Ambrogelly, A., Korencic, D., and M. Ibba. 2002. Functional annotation of class I lysyl- tRNA synthetase phylogeny indicates a limited role for gene transfer. J. Bacteriol. 184: 4594–4600.

Arnez, J. G. and D. Moras. 1997. Structural and functional considerations of the aminoacylation reaction. TIBS. 22: 211-216.

Ataide, S., Jester, B. C., Devine, K. M., and M. Ibba. 2005. Stationary-phase expression and aminoacylation of a transfer-RNA-like small RNA. EMBO Rep. 6: 742-747.

Balakrishnan, J. 2002. Symmetry scheme for amino acid codons. Phys. Rev. E. Stat. Nonlin. Soft Matter Phys. 65 (2 Pt 1): 021912.

Baranov, P. V., Gesteland, R. F., and J. F. Atkins. 2002. Recoding: translational bifurcations in gene expression. Gene. 286: 187-201.

Barns, S. M., Delwiche, C. F., Palmer, J. D., and N. R. Pace. 1996. Perspectives on archaeal diversity, thermophily and monophyly from environmental rRNA sequences. Proc. Natl. Acad. Sci. U.S.A. 93: 9188-9193.

Beebe, K., Merriman, E., Ribas de Pouplana, L., and P. Schimmel. 2004. A domain for editing by an archaebacterial tRNA synthetase. Proc. Natl. Acad. Sci. U.S.A. 101: 5958- 5963.

171 Beier, H. and M. Grimm. 2001. Misreading and termination codons in eukaryotes by natural nonsense suppressor tRNAs. Nucleic Acids Res. 29: 4767-4782.

Berry, M. J. 2005. Knowing when not to stop. Nat. Struct. Mol. Biol. 12: 389-390.

Berry, M. J., Banu, L., Chen, Y. Y., Mandel, S. J., Kieffer, J. D., Harney, J. W., and P. R. Larsen. 1991. Recognition of UGA as a selenocysteine codon in type I deiodinase requires sequences in the 3' untranslated region. Nature. 6341: 273-276.

Bertram, G., Innes, S., Minella, O., Richardson, J. P., and I. Stansfield. 2001. Endless possibilities: translation termination and stop codon recognition. Microbiol. 147: 255- 269.

Bini, E., Dikshit, V., Dirksen, K., Drozda, M., and P. Blum. 2002. Stability of mRNA in the hyperthermophilic archaeon Sulfolobus solfataricus. RNA. 8: 1129-1136.

Blanquet, S., Mechulam, Y., and E. Schmitt. 2000. The many routes of bacterial transfer RNAs after aminoacylation. Curr. Opin. Struct. Biol. 10: 95-101.

Blaut, M. 1994. Metabolism of methanogens. Antonie van Leeuwenhoek. 66: 187-208.

Blight, S. K., Larue, R. C., Mahapatra, A., Longstaff, D. G., Chang, E., Zhao, G., Kang, P. T., Green-Church, K. B., Chan, M. K., and J. A. Krzycki. 2004. Direct charging of tRNACUA with pyrrolysine in vitro and in vivo. Nature. 431: 333-335.

Boccazzi, P., Zhang, J. K., and W. W. Metcalf. 2000. Generation of dominant selectable markers for resistance to pseudomonic acid by cloning and mutagenesis of the ileS gene from the Archaeon Methanosarcina barkeri Fusaro. J. Bacteriol. 182: 2611-2618.

172 Bovee, M. L., Yan, W., Sproat, B. S., and C. S. Francklyn. 1999. tRNA discrimination at the binding step by a class II aminoacyl-tRNA synthetase. Biochemistry. 38: 13725- 13735.

Brierley, I., Digard, P. and S. C. Inglis. 1989. Characterization of an efficient coronavirus ribosomal frameshifting signal: requirement for an RNA pseudoknot. Cell. 57: 537-547.

Brown, C. M., Stockwell, P. A., Trotman, C. N., and W. P. Tate. 1990a. Sequence analysis suggests that tetra-nucleotides signal the termination of protein synthesis in eukaryotes. Nucleic Acids Res. 18: 6339-6345.

Brown, C. M., Stockwell, P. A., Trotman, C. N., and W. P. Tate. 1990b. The signal for the termination of protein synthesis in procaryotes. Nucleic Acids Res. 18: 2079-2086.

Buckingham, R. H. 1994. Codon context and protein synthesis: enhancements of the genetic code. Biochimie. 76: 351-354.

Burke, S. A., and J. A. Krzycki. 1995. Involvement of the ‘A’ isozymes of methyltransferase II and the 29-kilodalton corrinoid protein in methanogenesis from methylamine. J. Bacteriol. 177: 4410-4416.

Burke, S. A., and J. A. Krzycki. 1997. Reconstitution of monomethylamine: coenzyme M methyl transfer with a corrinoid protein and two methyltransferases purified from Methanosarcina barkeri. J. Biol. Chem. 272: 16570-16577.

Burke, S. A., Lo, S. L., and J. A. Krzycki. 1998. Clustered genes encoding the methyltransferases of methanogenesis from monomethylamine. J. Bacteriol. 180: 3432- 3440.

173 Büttner, K., Wenig, K., and K.-P. Hopfner. 2005. Structural framework for the mechanism of Archaeal exosomes in RNA processing. Mol. Cell. 20: 461-471.

Caron, F. and E. Meyer. 1985. Does Paramecium primaurelia use a different genetic code in its macronucleus? Nature. 314: 185-188.

Chaudhuri, B. N., and T. O. Yeates. 2005. A computational method to predict genetically encoded rare amino acids in proteins. Genome Biol. 6: R79.

Chin, J. W., Cropp, T. A., Anderson, J. C., Mukherji, M., Zhang, Z. and P. G. Schultz. 2003. An expanded Eukaryotic genetic code. Science. 301: 964-967.

Cobucci-Ponzano, B., Rossi, M., and M. Moracci. 2005. Recoding in Archaea. Mol. Microbiol. 55: 339-348.

Cole, F. and P. R. Schimmel. 1970. On the rate law and mechanism of the adenosine triphosphate-pyrophosphate isotope exchange reaction of aminoacyl-transfer ribonucleic acid synthetases. Biochemistry. 9: 480–489.

Commans, S. and A. Böck. 1999. Selenocysteine inserting tRNAs: an overview. FEMS Microbiol. Rev. 23: 335-351.

Conrad, R. 1996. Soil microorganisms as controllers of atmospheric trace gases (H2, CO, CH4, OCS, N2O and NO). Microbiol. Rev. 60: 609-640.

Copeland, P. 2003. Regulation of gene expression by stop codon recoding: selenocysteine. Gene. 312: 17-25.

Copeland, P. R., Fletcher, J. E., Carlson, B. A., Hatfield, D. L., and D. M. Driscoll. 2000. A novel RNA binding protein, SBP2, is required for the translation of mammalian selenoprotein mRNAs. EMBO J. 19: 306-314.

174 Craigen, W. J., Cook, R. G., Tate, W. P., and C. T. Caskey. 1985. Bacterial peptide chain release factors: conserved primary structure and possible frameshift regulation of release factor 2. Proc. Natl. Acad. Sci. U.S.A. 82: 3616-3620.

Crick, F. H. C. 1958. On protein synthesis. Symp. Soc. Exp. Biol. 12: 138-163.

Cusack, S. 1997. Aminoacyl-tRNA synthetases. Curr. Opin. Struct. Biol. 7: 881-889.

Cusack, S., Yaremchuk, A., and M. Tukalo. 1996. The crystal structure of the ternary complex of T. thermophilus seryl-tRNA synthetase with tRNA(Ser) and a seryl-adenylate analogue reveals a conformational switch in the active site. EMBO J. 15: 2834-2842.

Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97: 6640- 6645.

Deppenmeier, U. 2002. The unique biochemistry of methanogenesis. Prog. Nucleic Acid Res. Mol. Biol. 71: 223-283.

Deppenmeier, U., Johann, A., Hartsch, T., Merkl, R., Schmitz, R. A., Martinez-Arias, R., Henne, A., Weizer, A., Baumer, S., Jacobi, C., Bruggemann, H., Lienard, T., Christmann, A., Bomeke, M., Steckel, S., Bhattacharyya, A., Lykidis, A., Overbeek, R., Klenk, H. P., Gunsalus, R. P., Fritz, H. J., and G. Gottschalk. 2002. The genome of Methanosarcina mazei: evidence for lateral gene transfer between bacteria and archaea. J. Mol. Microbiol. Biotechnol. 4: 453-461.

Deppenmeier, U. 2004. The membrane-bound electron transport system of Methanosarcina species. J. Bioenerg. Biomembr. 36: 55-64.

Diekert, G. and G. Wohlfarth. 1994. Metabolism of homocetogens. Antonie Van Leeuwenhoek. 66: 209-221.

DiMarco, A. A., Bobik, T. A., and R. S. Wolfe. 1990. Unusual coenzymes of methanogenesis. Annu. Rev. Biochem. 59:355-94.

175 Dontsova, M., Frolova, L., Vassilieva, J., Piendl, W., Kisselev, L., and M. Garber. 2000. Translation termination factor aRF1 from the archaeon Methanococcus jannaschii is active with eukaryotic ribosomes. FEBS Lett. 472: 213-216.

Döring, V., Mootz, H. D., Nangle, L. A., Hendrickson, T. L., de Crécy-Lagard, V., Schimmel, P., and P. Marlière. 2001. Enlarging the amino acid set of Escherichia coli by infiltration of the valine coding pathway. Science. 292: 501-504. Drake, H. L., Daniel, S. L., Kusel., K., Matthies., C., Kuhner, C., and S. Braus- Stromeyer. 1997. Acetogenic bacteria: what are the in situ consequences of their diverse metabolic versatilities? Biofactors. 6: 13-24.

Driscoll, D. M. and P. R. Copeland. 2003. Mechanism and regulation of selenoprotein synthesis. Annu. Rev. Nutr. 23: 17-40.

Elhardt, D., and A. Böck. 1982. An in vitro polypeptide synthesizing system from methanogenic bacteria: sensitivity to antibiotics. Mol. Gen. Genet. 188: 128-134.

Eriani, G., Delarue, M., Poch, O., Gangloff, J., and D. Moras. 1990. Partition of tRNA synthetases into two classes based on mutually exclusive sets of sequence motifs. Nature. 347: 203-206.

Eriani, G., and J. Gangloff. 1999. Yeast aspartyl-tRNA synthetase residues interacting with tRNA(Asp) identity bases connectively contribute to tRNA(Asp) binding in the ground and transition-state complex and discriminate against non-cognate tRNAs. J. Mol. Biol. 291: 761-773.

Evans, J. C., Huddler, D. P., Hilgers, M. T., Romanchuk, G., Matthews, R. G., and M. L. Ludwig. 2004. Structures of the N-terminal modules imply large domain motions during catalysis by methionine synthase. Proc. Natl. Acad. Sci. U.S.A. 101: 3729-3736.

Fagegaltier, D., Hubert, N., Yamada, K., Mizutani, T., Carbon, P., and A. Krol. 2000. Characterization of mSelB, a novel mammalian elongation factor for selenoprotein elongation. EMBO J. 19: 4796-4805.

176 Ferguson, D. J., Jr., and J. A. Krzycki. 1997. Reconstitution of trimethylamine- dependent coenzyme M methylation with the trimethylamine corrinoid protein and the isozymes of methyltransferase II from Methanosarcina barkeri. J. Bacteriol. 179: 846- 852.

Ferguson, D. J., Jr., Krzycki, J. A., and D. A. Grahame. 1996. Specific roles of methylcobamide: coenzyme M methyltransferase isozymes in metabolism of methanol and methylamines in Methanosarcina barkeri. J. Biol. Chem. 271: 5189-5194.

Ferguson, D. J., Jr., Gorlatova, N., Grahame, D. A., and J. A. Krzycki. 2000. Reconstitution of dimethylamine: coenzyme M methyl transfer with a discrete corrinoid protein and two methyltransferases purified from Methanosarcina barkeri. J. Biol. Chem. 275: 29053-29060.

Ferry, J. G. 1992. Methane from acetate. J. Bacteriol. 174: 5489-5495.

Ferry, J. G. 1999. Enzymology of one-carbon metabolism in methanogenic pathways. FEMS Microbiol. Rev. 23: 13-38.

Fersht, A. R., 1977. Enzyme structure and mechanism. (Freeman, San Francisco, CA). 283.

Fersht, A. R. 1979. In Transfer RNA: structure, properties and recognition. P. R. Schimmel, D. Söll, J. N. Abelson, (eds.). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 247-254.

Fersht, A. R. 1998. Protein structure: sieves in sequence. Science. 280: 541.

Fisher, C. L., and G. K. Pei. 1997. Modification of a PCR-based site-directed mutagenesis method. Biotechniques. 4: 570-571, 574.

Förster, C., Ott, G., Forchhammer, K., and M. Sprinzl. 1990. Interaction of a selenocysteine-incorporating tRNA with elongation factor Tu from E. coli. Nucleic Acids Res. 18: 487-491.

177 Forchhammer, K., Leinfelder, W., and A. Böck. 1989. Identification of a novel translation factor necessary for the incorporation of selenocysteine into protein. Nature. 342: 453-456.

Forchhammer, K., Leinfelder, W., Boesmiller, K., Veprek, B., and A. Böck. 1991. Selenocysteine synthase from Escherichia coli: nucleotide sequence of the gene (selA) and purification of the protein. J. Biol. Chem. 266: 6318-6323.

Forchhammer, K., and A. Böck. 1991. Selenocysteine synthase from Escherichia coli. Analysis of the reaction sequence. J. Biol. Chem. 266: 6324-6328.

Fourmy, D., Guittet, E., and S. Yoshizawa. 2002. Structure of prokaryotic SECIS mRNA hairpin and its interaction with elongation factor SelB. J. Mol. Biol. 324: 137- 150.

Francklyn, C., Perona, J. J., Puetz, J. and Y.-M. Hou. 2002. Aminoacyl-tRNA synthetases: versatile players in the changing theater of translation. RNA. 8: 1363–1372.

Freistroffer, D. V., Pavlov, M. Y., MacDougall, J., Buckingham, R. H., and M. Ehrenberg. 1997. Release factor RF3 in E. coli accelerates the dissociation of release factors RF1 and RF2 from the ribosome in a GTP-dependent manner. EMBO J. 16: 4126-4133.

Frolova, L., Le Goff, X., Rasmussen, H. H., Cheperegin, S., Drugeon, G., Kress, M., Arman, I., Haenni, A. L., Celis, J. E., Philippe, M., Justesen, J., and L. Kisselev. 1994. A highly conserved eukaryotic protein family possessing properties of polypeptide chain release factor. Nature. 372: 701-703.

Frolova, L., Le Goff, X., Zhouravleva, G., Davydova, E., Philippe, M., and L. Kisselev. 1996. Eukaryotic polypeptide chain release factor eRF3 is an eRF1- and ribosome- dependent guanosine triphosphatase. RNA. 2: 334-341.

Frolova, L. Y., Tsivkovskii, R. Y., Sivolobova, G. F., Oparina, N. Y., Serpinsky, O. I., Blinov, V. M., Tatkov, S. I., and L. L. Kisselev. 1999. Mutations in the highly conserved GGQ motif of class 1 polypeptide release factors abolish ability of human eRF1 to trigger peptidyl-tRNA hydrolysis. RNA. 5: 1014-1020.

178 Fu, C., and J. Parker. 1994. A ribosomal frameshifting error during translation of the argI mRNA of Escherichia coli. Mol. Gen. Genet. 243: 434-441.

Galagan, J. E., Nusbaum, C., Roy, A., Endrizzi, M. G., Macdonald, P., FitzHugh, W., Calvo, S., Engels, R., Smirnov, S., Atnoor, D., Brown, A., Allen, N., Naylor, J., Stange- Thomann, N., DeArellano, K., Johnson, R., Linton, L., McEwan, P., McKernan, K., Talamas, J., Tirrell, A., Ye, W., Zimmer, A., Barber, R. D., Cann, I., Graham, D. E., Grahame, D. A., Guss, A. M., Hedderich, R., Ingram-Smith, C., Kuettner, H. C., Krzycki, J. A., Leigh, J. A., Li, W., Liu, J., Mukhopadhyay, B., Reeve, J. N., Smith, K., Springer, T. A., Umayam, L. A., White, O., White, R. H., Conway de Macario, E., Ferry, J. G., Jarrell, K. F., Jing, H., Macario, A. J. L., Paulsen, I., Pritchett, M., Sowers, K. R., Swanson, R. V., Zinder, S. H., Lander, E., Metcalf, W. W., and B. Birren. 2002. The genome of M. acetivorans reveals extensive metabolic and physiological diversity. Genome Res. 12: 532-542.

Garcia, J.-L., Patel, B. K. C., and B. Ollivier. 2000. Taxonomic, phylogenetic, and ecological diversity of methanogenic Archaea. Anaerobe. 6: 205-226.

Geslain, R., and L. Ribas de Pouplana. 2004. Regulation of RNA function by aminoacylation and editing? Trends Genet. 20: 604-610.

Gesteland, R. F. and J. F. Atkins. 1996. RECODING: Dynamic reprogramming of translation. Annu. Rev. Biochem. 65: 741-768.

Giglione, C., and T. Meinnel. 2001. Organellar peptide deformylases: Universality of the N-terminal methionine cleavage mechanism. Trends Plant Sci. 6: 566-572.

Goodchild, A., Saunders, N. F. W., Ertan, H., Raferty, M., Guilhaus, M., Curmi, P. M. G., and R. Cavicchioli. 2004. A proteomic determination of cold adaptation in the Anarctic archaeon, Methanococcoides burtonii. Mol. Microbiol. 53: 309-321.

Grahame, D. A. 1989. Different isozymes of methylcobalamin: 2- mercaptoethanesulfonate methyltransferase predominate in methanol- versus acetate- grown Methanosarcina barkeri. J. Biol. Chem. 264: 12890-12894.

179 Grentzmann, G., Brechemier-Baey, D., Heurgue, V., Mora, L., and R. H. Buckingham. 1994. Localization and characterization of the gene encoding release factor RF3 in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 91: 5848-5852.

Gropp, R. and D. Oesterhelt. 1989. In vitro translation of halobacterial mRNA. FEBS Lett. 259: 5-9.

Hao, B., Gong, W., Ferguson, T. K., James, C. M., Krzycki, J. A., and M. K. Chan. 2002. A new UAG-Encoded residue in the structure of a Methanogen methyltransferase. Science. 296: 1462-1466.

Hao, B., Zhao, G., Kang, P. T., Soares, J. A., Ferguson, T. K., Gallucci, J., Krzycki, J. A., and M. K. Chan. 2004. Reactivity and chemical synthesis of L-pyrrolysine – the 22nd amino acid. Chem. Biol. 9: 1317-24.

Harlow, E., and D. Lane. 1988. Antibodies: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 574-576.

Harms, U. and R. K. Thauer. 1996. Methylcobalmin: coenzyme M methyltransferase isoenzymes MtaA and MtbA from Methanosarcina barkeri. Eur. J. Biochem. 235: 653- 659.

Hatfield, D. L., and V. N. Gladyshev. 2002. How selenium has altered our understanding of the genetic code. Mol. Cell Biol. 11: 3565-3576.

Heider, J., Baron, C., and A. Böck. 1992. Coding from a distance: dissection of the mRNA determinants required for the incorporation of selenocysteine into protein. EMBO J. 11: 3759-3766.

Herr, A. J., Atkins, J. F. and R. F. Gesteland. 2000. Coupling of open reading frames by translational bypassing. Annu. Rev. Biochem. 69: 343-372.

Herr, A. J., Nelson, C. C., Wills, N. M., Gesteland, R. F., and J. F. Atkins. 2001. Analysis of the roles of tRNA structure, ribosomal protein L9, and the bacteriophage T4 gene 60 bypassing signals during ribosome slippage on mRNA. J. Mol. Biol. 309: 1029- 1048.

180 Ho, Y. S. and Y. W. Kan. 1987. In vivo aminoacylation of human and Xenopus suppressor tRNAs constructed by site-specific mutagenesis. Proc. Natl. Acad. Sci. U.S.A. 84: 2185–2188.

Hoffmann, P. R. and M. J. Berry. 2005. Selenoprotein synthesis: A unique translational mechanism used by a diverse family of proteins. Thyroid. 15: 769-775.

Hummel, H., Bär, U., Heller, G. and A. Böck. 1985. Antibiotic sensitivity pattern of in vitro polypeptide synthesis systems from Methanosarcina barkeri and Methanospirillum hungatei. System. Appl. Microbiol. 6: 125-131.

Huttenhofer, A. and A. Böck. 1998. Selenocysteine inserting RNA elements modulate GTP hydrolysis of elongation factor SelB. Biochemistry (Mosc). 37: 885-890.

Ibba, M., Morgan, S., Curnow, A. W., Pridmore, D. R., Vothknecht, U. C., Gardner, W., Lin, W., Woese, C. R., and D. Söll. 1997a. A euryarchaeal lysyl-tRNA synthetase: resemblance to class I synthetases. Science. 278: 1119–1122.

Ibba, M., Curnow, A. W., and D. Söll. 1997b. Aminacyl-tRNA synthesis: divergent routes to a common goal. TIBS. 22: 39-42.

Ibba, M., Losey, H. C., Kawarabayasi, Y., Kikuchi, H., Bunjun, S. and D. Söll. 1999. Substrate recognition by class I lysyl-tRNA synthetases: a molecular basis for gene displacement. Proc. Natl. Acad. Sci. U.S.A. 96: 418-423.

Ibba, M. and D. Söll. 2000. Aminoacyl-tRNA synthesis. Annu. Rev. Biochem. 69: 617-650.

Ibba, M., Becker, H. D., Stathopoulos, C., Tumbula, D. L., and D. Söll. 2000. The adaptor hypothesis revisited. TIBS. 25: 311-316.

Ibba, M. and D. Söll. 2004. Aminoacyl-tRNAs: setting the limits of the genetic code. Genes Dev. 18: 731-738.

181 Ishikawa, K., Watanabe, M., Kuroita, T., Uchiyama, I., Bujnicki, J. M., Kawakami, B., Tanokura, M., and I. Kobayashi. 2005. Discovery of a novel restriction endonuclease by genome comparison and application of a wheat-germ-based cell-free translation assay: PabI (5'-GTA/C) from the hyperthermophilic archaeon Pyrococcus abyssi. Nucleic Acids Res. 33: e112.

Ito, K., Uno, M., and Y. Nakamura. 2000. A tripeptide 'anticodon' deciphers stop codons in messenger RNA. Nature. 403: 680-684.

James, C. M., Ferguson, T. K., Leykam, J. F., and J. A. Krzycki. 2001. The amber codon in the gene encoding the monomethylamine methyltransferase isolated from Methanosarcina barkeri is translated as a sense codon. J. Biol. Chem. 276: 34252- 34258.

Jester, B. C., Levengood, J. D., Roy, H., Ibba, M., and K. M. Devine. 2003. Nonorthologous replacement of lysyl-tRNA synthetase prevents addition of lysine analogues to the genetic code. Proc. Natl. Acad. Sci. U.S.A. 100: 14351-14356.

Jewett, M. C. and J. R. Swartz. 2004. Substrate replenishment extends protein synthesis with an in vitro translation system designed to mimic the cytoplasm. Biotechnol Bioeng. 87: 465-472.

Jones, W. J., Nagle, D. P., and W. B. Whitman. 1987. Methanogens and the diversity of archaebacteria. Microbiol. Rev. 51: 135-177.

Kapp, L. D. and J. R. Lorsch. 2004. The molecular mechanics of eukaryotic translation. Annu. Rev. Biochem. 73: 657-704.

Khalil, M. A. K. and R. A. Rasmussen. 1994. Global emissions of methane during the last several centuries. Chemosphere. 29: 833-842.

Kiick, K. L.,Weberskirch, R. and D. A. Tirrell. 2001. Identification of an expanded set of translationally active methionine analogues in Escherichia coli. FEBS Lett. 502: 25– 30.

182 Kisselev, L. L. and R. H. Buckingham. 2000. Translational termination comes of age. TIBS. 25: 561-566.

Kollmus, H., Flohé, L., and J. E. G. McCarthy. 1996. Analysis of eukaryotic mRNA structures directing cotranslational incorporation of selenocysteine. Nucleic Acids Res. 24: 1195-1201.

Konecki, D. S., Aune, K. C., Tate, W., and C. T. Caskey. 1977. Release factor binding to ribosome requires an intact 16 S rRNA 3' terminus. J. Biol. Chem. 252: 4514-4520.

Korencic, D., Ahel, I., Schelert, J., Sacher, M., Ruan, B., Stathopoulos, C., Blum, P., Ibba, M., and D. Söll. 2004. A freestanding proofreading domain is required for protein synthesis quality control in Archaea. Proc. Natl. Acad. Sci. U.S.A. 101: 10260-10265.

Krzycki, J. A. 2004. Function of genetically encoded pyrrolysine in corrinoid-dependent methylamine methyltransferases. Curr. Opin. Chem. Biol. 8: 484-491.

Krzycki, J. A. 2005. The direct genetic encoding of pyrrolysine. Curr. Opin. Microbiol. 8: 706-712.

Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227: 680-685.

Lecompte, O., Ripp, R., Thierry, J. C., Moras, D., and O. Poch. 2002. Comparative analysis of ribosomal proteins in complete genomes: an example of reductive evolution at the domain scale. Nucleic Acids Res. 30: 5382-5390.

Londei, P., Altamura, S., Cammarano, P., and L. Petrucci. 1986. Differential features of ribosomes and of poly(U)-programmed cell-free systems derived from sulphur-dependent archaebacterial species. Eur. J. Biochem. 157: 455-462.

Londei, P., Altamura, S., Caprini, E., and A. Martayan. 1991. Translation and ribosome assembly in extremely thermophilic archaebacteria. Biochimie. 73: 1465-1472.

183 Low, S. C., Harney, J. W., and M. J. Berry. 1995. Cloning and functional characterization of human selenophosphate synthetase, an essential component of selenoprotein synthesis. J. Biol. Chem. 270: 21659-21664.

Mahapatra, A., Patel, A., Soares, J. A., Larue, R. C., Zhang, J.-K., Metcalf, W. W. and J. A. Krzycki. 2006. Characterization of a Methanosarcina acetivorans mutant unable to translate UAG as pyrrolysine. Mol. Microbiol. 59: 56-66.

Martin, R., Phillips-Jones, M. K., Watson, F. J. and Hill, L. S. 1993. Codon context effects on nonsense suppression in human cells. Biochem. Soc. Trans. 21: 846-851.

Mathews, D. H., Sabina, J., Zuker, M. and D. H. Turner. 1999. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J. Mol. Biol. 288: 911-940.

McCaughan K. K., Brown, C. M., Dalphin, M. E., Berry, M. J., and W. P. Tate. 1995. Translational termination efficiency in mammals is influenced by the base following the stop codon. Proc. Natl. Acad. Sci. U.S.A. 92: 5431-5435.

van der Meijden, P., Heythuysen, H. J., Pouwels, A., Houwen, F., van der Drift, C., and G. D. Vogels. 1983. Methyltransferases involved in methanol conversion by Methanosarcina barkeri. Arch. Microbiol. 134: 238-242.

van der Meijden, P., te Brömmelstroet, B. W., Poirot, C. M., van der Drift, C., and G. D. Vogels. 1984. Purification and properties of methanol: 5- hydroxybenzimidazolylcobamide methyltransferase from Methanosarcina barkeri. J. Bacteriol. 160: 629-635.

Metcalf, W. W., Zhang, J. K., Apolinario, E., Sowers, K. R., and R. S. Wolfe. 1997. A genetic system for Archaea of the genus Methanosarcina: liposome-mediated transformation and construction of shuttle vectors. Proc. Natl. Acad. Sci. U.S.A. 6: 2626-2631.

Meuer, J., Kuettner, H. C., Zhang, J. K., Hedderich, R., and W. W. Metcalf. 2002. Genetic analysis of the archaeon Methanosarcina barkeri Fusaro reveals a central role for Ech hydrogenase and ferredoxin in methanogenesis and carbon fixation. Proc. Natl. Acad. Sci. U.S.A. 8: 5632-5637.

184 Meyer, F., Schmidt, H. J., Plumper, E., Hasilik, A., Mersmann, G., Meyer, H. E., Engstrom, A., and K. Heckmann. 1991. UGA is translated as cysteine in pheromone-3 of Euplotes octocarinatus. Proc. Natl. Acad. Sci. U.S.A. 88: 3758-3761.

Mikuni, O., Ito, K., Moffat, J., Matsumura, K., McCaughan, K., Nobukini, T., Tate, W., and Y. Nakamura. 1994. Identification of the prfC gene, which encodes peptide-chain- release factor 3 of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 91: 5798-5802.

Mottagui-Tabar, S., Björnsson, A., and L. A. Isaksson. 1994. The second to last amino acid in the nascent peptide as a codon context determinant. EMBO J. 13: 249-257.

Moulinier, L., Eiler, S., Eriani, G., Gangloff, J., Thierry, J. C., Gabriel, K., McClain, W. H., and D. Moras. 2001. The structure of an AspRS-tRNA(Asp) complex reveals a tRNA-dependent control mechanism. EMBO J. 20: 5290-5301.

Nakamura, Y. and K. Ito. 2003. Making sense of mimic in translation termination. Trends Biochem. Sci. 28: 99-105.

Namy, O., Rousset, J.-P., Napthine, S., and I. Brierley. 2004. Reprogrammed genetic decoding in cellular gene expression. Mol. Cell. 13: 157-168.

Oba, T., Andachi, Y., Muto, A., and S. Osawa. 1991. Translation in vitro of codon UGA as tryptophan in Mycoplasma capricolum. Biochimie. 73: 1109-1112.

Ozawa, Y., Hanaoka, S., Saito, R., Washio, T., Nakano, S., Shinagawa, A., Itoh, M., Shibata, K., Carninci, P., Konno, H., Kawai, J., Hayashizaki, Y., and M. Tomita. 2002. Comprehensive sequence analysis of translation termination sites in various eukaryotes. Gene. 300: 79-87.

Paul, L., Ferguson, D. J., Jr., and J. A. Krzycki. 2000. The trimethylamine methyltransferase gene and multiple dimethylamine methyltransferase genes of Methanosarcina barkeri contain in-frame and read-through amber codons. J. Bacteriol. 182: 2520-2529.

185 Perona, J. J., Rould, M. A., and T. A. Steitz. 1993. Structural basis for transfer RNA aminoacylation by Escherichia coli glutaminyl-tRNA synthetase. Biochemistry. 32: 8758-8771.

Polycarpo, C., Ambrogelly, A., Ruan, B., Tumbula-Hansen, D., Ataide, S. F., Ishitani, R., Yokoyama, S., Nureki, O., Ibba, M., and D. Söll. 2003. Activation of the pyrrolysine suppressor tRNA requires formation of a ternary complex with class I and class II lysyl- tRNA synthetases. Mol. Cell. 12: 287-294.

Polycarpo, C., Ambrogelly, A., Bérubé, A., Winbush, S. M., McCloskey, J. A., Crain, P. F., Wood, J. L., and D. Söll. 2004. An aminoacyl-tRNA synthetase that specifically activates pyrrolysine. Proc. Natl. Acad. Sci. U.S.A. 101: 12450–12454.

Poole, E. S., Brown, C. M., and W. P. Tate. 1995. The identity of the base following the stop codon determines the efficiency of in vivo translational termination in Escherichia coli. EMBO J. 14: 151-158.

Poole, E. S., Major, L. L., Mannering, S. A., and W. P. Tate. 1998. Translational termination in Escherichia coli: three bases following the stop codon crosslink to release factor 2 and affect the decoding efficiency of UGA-containing signals. Nucleic Acids Res. 26: 954-960.

Pottenplackel, L. P. 1999. Analysis of the genes encoding the enzymes initiating methanogenesis from methylthiols, trimethylamine and dimethylamine in Methanosarcina barkeri MS. Ph.D. Thesis, The Ohio State University. 153-155.

Prætorius-Ibba, M. and M. Ibba. 2003. Aminoacyl-tRNA synthesis in archaea: different but not unique. Mol. Microbiol. 48: 631-637.

Pritchett, M. A., Zhang, J. K., and W. W. Metcalf. 2004. Development of a markerless genetic exchange method for Methanosarcina acetivorans C2A and its use in construction of new genetic tools for methanogenic archaea. Appl Environ Microbiol. 70: 1425-1433.

Ramakrisnan, V. 2002. Ribosome structure and the mechanism of translation. Cell. 108: 557-572.

186 Reay, D. S. 2003. Sinking methane. Biologist (London). 50: 15-19.

Rosset, R., and L. Gorini. 1969. A ribosomal ambiguity mutation. J. Mol. Biol. 39: 95- 112.

Rother, M. and W. W. Metcalf. 2004. Anaerobic growth of Methanosarcina acetivorans C2A on carbon monoxide: An unusual way of life for a methanogenic archaeon. Proc. Natl. Acad. Sci. U.S.A. 101: 16929-16934.

Rother, M. and W. W. Metcalf. 2005. Genetic technologies for Archaea. Curr. Opin. Microbiol. 8 :745–751.

Rother, M., Resch, A., Gardner, W. L., Whitman, W. B., and A. Böck. 2001. Heterologous expression of Archaeal selenoprotein genes directed by the SECIS element located in the 3’ non-translated region. Mol. Microbiol. 40: 900-908. Sambrook, J., Fritsch, E. F., and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Sauer, K., and R. K. Thauer. 1998. Methanol: coenzyme M methyltransferase from Methanosarcina barkeri--identification of the active-site histidine in the corrinoid- harboring subunit MtaC by site-directed mutagenesis. Eur. J. Biochem. 253: 698-705.

Sauer, K., Harms, U., and R. K. Thauer. 1997. Methanol: coenzyme M methyltransferase from Methanosarcina barkeri. Purification, properties and encoding genes of the corrinoid protein MT1. Eur. J. Biochem. 243: 670-677.

Sauerwald, A., Zhu, W., Major, T. A., Roy, H., Palioura, S., Jahn, D., Whitman, W. B., Yates, 3rd, J. R., Ibba, M., and D. Söll. 2005. Science. RNA-dependent cysteine biosynthesis in archaea. 307: 1969-1972.

Saunders, N. F., Thomas, T., Curmi, P. M., Mattick, J. S., Kuczek, E., Slade, R., Davis, J., Fransmann, P. D., Boone, D., Rusterholtz, K., Feldman, R., Gates, C., Bench, S., Sowers, K., Kadner, K., Aerts, A., Dehal, P., Detter, C., Glavina, T., Lucas, S., Richardson, P., Larimer, F., Hauser, L., Land, M., and R. Cavicchioli. 2003. Mechanisms of thermal adaptation revealed from the genomes of the Antarctic Archaea Methanogenium frigidum and Methanococcoides burtonii. Genome Res. 13: 1580-1588.

187

Schimmel, P. and L. Ribas de Pouplana. 2000. Footprints of aminoacyl-tRNA synthetases are everywhere. Trends Biochem. Sci. 25: 207-209.

Schimmel, P., and D. Söll. 1979. Aminoacyl-tRNA synthetases: general features and recognition of transfer RNAs. Annu. Rev. Biochem. 48: 601–648.

Schink, B. 1997. Energetics of syntrophic cooperation in methanogenic degradation. Microbiol. Mol. Biol. Rev. 61: 262-280.

Schwartz, R., and J. F. Curran. 1997. Analyses of frameshifting at UUU-pyrimidine sites. Nucleic Acids Res. 25: 2005-2011.

Scolnick, E., Tompkins, R., Caskey, T., and M. Nirenberg. 1968. Release factors differing in specificity for terminator codons. Proc. Natl. Acad. Sci. U.S.A. 61: 768-774.

Seit-Nebi, A., Frolova, L., Justesen, J., and L. Kisselev. 2001. Class-1 translation termination factors: invariant GGQ minidomain is essential for release activity and ribosome binding but not for stop codon recognition. Nucleic Acids Res. 29: 3982-3987.

Shen, Q., Chu, F. F., and P. E. Newburger. Sequences in the 3' untranslated region of the human cellular glutathione peroxidase gene are necessary and sufficient for selenocysteine incorporation at the UGA codon. 1993. J. Biol. Chem. 268: 11463- 11469.

Soares, J. A., Zhang, L., Pitsch, R. L., Kleinholz, N. M., Jones, R. B., Wolff, J. J., Amster, J., Green-Church, K. B., and J. A. Krzycki. 2005. The residue mass of L- pyrrolysine in three distinct methylamine methyltransferases. J. Biol. Chem. 280: 36962-36969.

Sowers, K. R., and H. J. Schreier. 1995. Media for methanogens. In Archaea, a Laboratory Manual. K. R. Sowers and H. J. Schreier (eds.). Plainview, NY: Cold Spring Harbor Laboratory Press, 459–489.

188 Srinivasan, G., James, C. M., and J. A. Krzycki. 2002. Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-decoding specialized tRNA. Science. 296: 1459-1462.

Srinivasan, G. 2003. Translation of the amber codon in methylamine methyltransferase genes of a methanogenic archaeon. Ph.D. Thesis, The Ohio State University. 91-92.

Stadtman, T. C. 1996. Selenocysteine. Annu. Rev. Biochem. 65: 83–100.

Tate, W. P., Mansell, J. B., Mannering, S. A., Irvine, J. H., Major, L. L., and D. N. Wilson. 1999. UGA: a dual signal for “stop” and for recoding in protein synthesis. Biochemistry (Mosc). 64: 1342-1353.

Tate, W. P., Poole, E. S., Horsfield, J. A., Mannering, S. A., Brown, C. M., Moffat, J. G., Dalphin, M. E., McCaughan, K. K., Major, L. L., and D. N. Wilson. 1995. Translational termination efficiency in both bacteria and mammals is regulated by the base following the stop codon. Biochem. Cell Biol. 73: 1095-1103.

Thanbichler, M., Böck, A., and R. S. Goody. 2000. Kinetics of interaction of translation factor SelB from Escherichia coli with guanosine nucleotides and SECIS RNA. J. Biol. Chem. 275: 20458-20466.

Thauer, R. K. 1998. Biochemistry of methanogenesis: a tribute to Marjory Stephenson. Microbiol. 144: 2377-2406.

Théobald-Dietrich, A., Giegé, R., and J. Rudinger-Thirion. 2005. Evidence for the existence in mRNAs of a hairpin element responsible for ribosome dependent pyrrolysine insertion into proteins. Biochimie. 87: 813-817.

Théobald-Dietrich, A., Frugier, M., Giegé, R., and J. Rudinger-Thirion. 2004. Atypical archaeal tRNA pyrrolysine transcript behaves towards EF-Tu as a typical elongator tRNA. Nucleic Acids Res. 32: 1091-1096.

Tumbula, D., Vothknecht, U. C., Kim, H-s., Ibba, M., Min, B., Li, T., Pelaschier, J., Stathopoulos, C., Becker, H., and D. Söll. 1999. Archaeal aminoacyl-tRNA synthesis: Diversity replaces dogma. Genetics. 152: 1269-1276.

189 Uzawa, T., Yamagishi, A., and T. Oshima. 2002. Polypeptide synthesis directed by DNA as a messenger in cell-free polypeptide synthesis by extreme thermophiles, Thermus thermophilus HB27 and Sulfolobus tokodaii strain 7. J. Biochem (Tokyo). 131: 849-853.

Varshney, U., Lee, C. P. and U. L. RajBhandary. 1991. Direct analysis of aminoacylation levels of tRNAs in vivo. Application to studying recognition of Escherichia coli initiator tRNA mutants by glutaminyl-tRNA synthetase. J. Biol. Chem. 266: 24712–24718.

Wang, L., Brock, A., Herberich, B. and P. G. Schultz. 2001. Expanding the genetic code of Escherichia coli. Science. 292: 498–500.

Welander, P. V., and W. W. Metcalf. 2005. Loss of the mtr operon in Methanosarcina blocks growth on methanol, but not methanogenesis, and reveals an unknown methanogenic pathway. Proc. Natl. Acad. Sci. U.S.A. 102: 10664-10669.

Wilting, R., Schorling, S., Persson, B. C., and A. Böck. 1997. Selenoprotein synthesis in archaea: identification of an mRNA element of Methanococcus jannaschii probably directing selenocysteine insertion. J. Mol. Biol. 266: 637-641.

Woese, C. R., Kandler, O., and M. L. Wheelis. 1990. Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc. Natl. Acad. Sci. U.S.A. 87: 4576-4579.

Yoshinaka, Y., Katoh, I., Copeland, T. D., and S. Oroszlan. 1985. Murine leukemia virus protease is encoded by the gag-pol gene and is synthesized through suppression of an amber termination codon. Proc. Natl. Acad. Sci. U.S.A. 82: 1618-1622.

Zhang, Y., Baranov, P. V., Atkins, J. F., and V. N. Gladyshev. 2005. Pyrrolysine and selenocysteine use dissimilar decoding strategies. J. Biol. Chem. 280: 20740-20751.

Zhouravleva, G., Frolova, L., Le Goff, X., Le Guellec, R., Inge-Vechtomov, S., Kisselev, L., and M. Philippe. 1995. Termination of translation in eukaryotes is governed by two interacting polypeptide chain release factors, eRF1 and eRF3. EMBO J. 14: 4065-4072.

190 Zinder, S. H. 1993. In Methanogenesis. J. G. Ferry (ed.). Chapman & Hall, New York/London. 128.

Zinoni, F., Heider, J., and A. Böck. 1990. Features of the formate dehydrogenase mRNA necessary for decoding of the UGA codon as selenocysteine. Proc. Natl. Acad. Sci. U.S.A. 87: 4660-4664.

Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31: 3406-3415.

191