J Arthropod-Borne Dis, September 2017, 11(3): 403–413 A Saghafipour et al.: Epidemiological Study on …
Original Article Epidemiological Study on Cutaneous Leishmaniasis in an Endemic Area, of Qom Province, Central Iran
Abedin Saghafipour 1, *Hassan Vatandoost 2,3, *Ali Reza Zahraei-Ramazani 2, Mohammad Reza Yaghoobi-Ershadi 2, Moharram Karami Jooshin 4 ,Yavar Rassi 2, Mohammad Reza Shirzadi 5, Amir Ahmad Akhavan 2, Ahmad Ali Hanafi-Bojd 2
1Department of Medical Entomology and Vector Control, School of Public Health, International Campus (IC -TUMS), Tehran University of Medical Sciences, Tehran, Iran 2Department of Medical Entomology and Vector Control, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran 3Department of Environmental Chemical Pollutants and Pesticides, Institute for Environmental Research, Tehran University of Medical Silences, Tehran, Iran 4Qom Provincial Health Center, Qom University of Medical Sciences, Qom, Iran 5Communicable Diseases Management Center, Ministry of Health and Medical Education, Tehran, Iran
(Received 25 Jan 2016; accepted 2 Oct 2017)
Abstract Background: Cutaneous leishmaniasis (CL) is one of the most important health problems in many areas of Iran. There are two forms of the disease in Iran, anthroponotic and zoonotic CL. This study conducted to assess the epidemiological situation of CL in an endemic area of Qom Province, central Iran from Apr to Nov 2015. Methods: The sticky paper traps and aspirating tubes were used for collecting adult sand flies. Sherman traps and small insect nets were used to capture rodents and small mammals. Giemsa staining was used for preparing the expanded smear and followed by PCR for identifying the causative agent in human, vectors, and reservoirs. In this study, relative frequency of CL was also calculated. Results: Fourteen species of Phlebotomine sand flies were collected. Phlebotomus papatasi (61.74%) was the predom- inant species through the period of activity. Overall, 62 Meriones libycus, 8 Nesokia indica, 4 Mus musculus, 16 Al- lactaga elater and 2 Hemiechinus auritis were caught. PCR technique showed 6 out of 150 P. papatasi (2%), two out of 62 M. libycus (3.23%) and all of suspected human's skin tissue samples (100%) were infected with Leishmania major. The relative frequency of CL was 0.30%. Conclusion: This is the first detection of L. major within P. papatasi, M. libycus and human in Kahak District in Qom Province of Iran. Zoonotic cycle of CL exists in this area, L. major is the causative agent, P. papatasi is the main vector and M. libycus is the main reservoir of the disease.
Keywords: Zoonotic cutaneous leishmaniasis, Leishmania major, Phlebotomus papatasi, ITS1- PCR, Iran
Introduction
Currently, cutaneous leishmaniasis (CL) is major is the causative agent of Zoonotic CL one of the most important vector borne dis- in Iran. Leishmania major, L. (L.) tropica and eases in Iran (1) and still the leading cause of L. (L.) aethiopica cause CL in the Old World considerable morbidity of a large number of (3). The parasite has been isolated and identi- people in the endemic foci characterized by fied from naturally infected P. papatasi, P. chronic skin lesions followed by scars and de- caucasicus, Rhombomys opimus, Meriones formation of the infected tissue (2). libycus and human in such endemic areas (4- Phelebotomus papatasi is the main and 8). The P. papatasi and M. libycus were as proven vector and Leishmania (Leishmania) proven vector and reservoir in Qomrood, Iran
*Corresponding authors: Dr Hassan Vatandoost, 403 E-mail: [email protected], Dr Ali Reza http://jad.tums.ac.ir Zahraei-Ramazani, E-mail: [email protected] Published Online: September 08, 2017
J Arthropod-Borne Dis, September 2017, 11(3): 403–413 A Saghafipour et al.: Epidemiological Study on … district (9) and as probable vector and reser- Materials and Methods voir in Ghanavat district (10). In addition, a big part of the lowland areas of Qom Province Study area provides good ecological niches for P. The Qom Province is bounded by Tehran papatasi and therefore it has higher transmis- Province in the north, Esfahan Province in the sion potential (11). south, Semnan Province in the east, and Markazi In the recent years, molecular methods Province in the west with an area of approxi- have been employed for identification of cer- mately 11240 square kilometers (0.68% total tain species of Leishmania, either isolated from area of Iran) (Fig. 1). This study was per- cultures or from patients (3) as well as in the formed from Apr to Nov 2015 in 3 villages detection of the parasite in individual or (Khor Abad, Sarm, and Ghobadbezan) of pooled Phlebotomine specimens (12). Suc- Kahak rural district (34o09'–35o11' N latitude cessful establishment of the disease in an en- and 50o06'–51o58' E longitude) of Qom Prov- demic area is the outcome of a close associa- ince with the elevation of almost 1500m tion between the Leishmania parasite and its above sea level (20). The average annual min- natural sand fly vector (13). Thus, vector and imum and maximum temperatures were 16.5 parasite identification have great impact on °C and 49 °C in Jan and Jul, respectively. The predicting expansions of the disease in en- total annual rainfall was about 150mm and the demic area, also help authorities to design new average Max and Min monthly Relative humid- strategic programs to limit spreading vectors ity were 84% and 28% in Dec and Jun, re- and disease (14, 15). spectively (21). Molecular methods are increasingly em- ployed for diagnostic and epidemiological Sand fly collection purposes in order to confirm Leishmania in- Sand flies were collected from indoor (bed- fection and to characterize the parasites at the room, bathroom, toilets, hall, and stables) and species or genotype level in hosts and vectors outdoor (rodent burrows) fixed places from (16, 17). The detection of Leishmania para- the first half of Apr 2015 to the first half of sites by PCR methods is highly specific and Nov 2015. To capture the sand flies, 30 Sticky sensitive, with values reaching up to 100%. Paper Traps (castor oil coated white paper Accurate and sensitive diagnostic and identi- 20×32cm) was used twice a month from sun- fication procedures are required to distinguish set to sunrise. The caught sand flies were Leishmania species/strains whose geographic transferred to the laboratory in Qom Health distribution can overlap, which is crucial for Center. To species identification, the head and adequate treatment and appropriate public the last two abdominal segments of the sand health control measures (18). flies were mounted in Puris’ medium (24) and Based on a rapid increase in incidence of identified after 24–72h, using the morpholog- CL reported in an endemic area of Kahak Dis- ical characters (25). Then, they were counted trict of Qom Province in central Iran (19), and and segregated by sex. The rest of the abdo- due to lack of knowledge on the epidemiolog- men, the wings and the legs used for DNA ex- ical situation of CL, this study was conducted traction were stored in 1.5ml sterile micro to determine the epidemiological features of tubes containing 96% ethanol. The females CL including human infection and the reser- were examined for abdominal status and the voir hosts and their putative vector species in numbers of unfed, fresh-blood fed, and gravid this endemic area during 2015. and semi-gravid sand flies were recorded. The parous females were distinguished from nulliparous sand flies by observation of the
404 http://jad.tums.ac.ir Published Online: September 08, 2017
J Arthropod-Borne Dis, September 2017, 11(3): 403–413 A Saghafipour et al.: Epidemiological Study on …
appearance of the accessory glands (26). In 300μl saccharin phenol. After adding this so- order to determine the natural promastigote lution, the tube was centrifuged at 9300 rpm infections of female sand flies, some unfed, for 5min. After transferring upper phase to blood fed, semi-gravid and gravid female sand new tube, 300μl phenol- chloroform should flies (captured from rodent burrows) dissected be added and was centrifuged at 10000rpm in a fresh drop of sterile saline (9/1000) for the for 5min. Again transferred the upper phase presence of promastigotes in alimentary canal to new tube and washed with pure chloro- during Jun and Sep 2015. form. Thirty μl MgCl2 and 1000μl ethanol were added to upper phase and stored at -20 Reservoirs collection and smear prepara- °C for 2h before was centrifuged at 10000rpm tion for 10min and washed down phase by 70% The rodents were captured by Sherman ethanol with TE and was centrifuged at 10000 Live Traps (Fig. 2). Collection of dipodids rpm for 10min and the TE buffer was added. (Rodentia: Dipodidae) was done by using small insect nets. Then the impression smears Polymerase chain reaction-restriction frag- of ears were fixed with absolute methanol and ment length polymorphism (PCR-RFLP) examined by Giemsa staining method. The for detection of Leishmania infection Leishman bodies were observed using light The DNA samples were examined for the microscope and then were subjected to Leishmania species ITS1 by PCR amplifica- molecular technique for identification. Tissue tion using the universal primer pair L5 8S (5´- samples were also taken from the edge of the TgA-TaC-CAC-TTA-TCg-CAC-T-
405 http://jad.tums.ac.ir Published Online: September 08, 2017
J Arthropod-Borne Dis, September 2017, 11(3): 403–413 A Saghafipour et al.: Epidemiological Study on …
places) were collected using sticky paper traps. for Leishmania infection, the result showed Two genera (Phlebotomus and Sergentomyia) 67.33%, and 32.67% dissected sand flies were and 14 species were identified, including Phle- parous and nulli parous, respectively (Table 3). botomus (Phlebotomus) papatasi (61.74%), P. The analysis of physiological status of (Paraphlebotomus) sergenti (6.87%), P. dissected P. papatasi revealed (60%) unfed, (Paraphlebotomus) alexandri (1.00%), P. (20%) blood-fed, (6.67%) semi-gravid and (Paraphlebotomus) caucasicus (2.55%), P. (13.33%) gravid (Table 3). The used Leish- (Paraphlebotomus) caucasicus group (4.13%), mania primers of the PCR technique suc- P. (Larroussius) kandelakii (5.72%), P. cessfully amplified the ITS1 region of the (Larroussius) tobbi (0.10%), P. (Larroussius) strains L. major and L. tropica revealed that major (5.62%), P. (Adlerius) halepensis (0.10%), among 360 specimens sand flies examined by P. (Adlerius) brevis (0.05%), P. adlerius group PCR, 6 parous specimens (2%) were infected (0.31%), Sergentomyia (Ser-gentomyia) sintoni by L. major (Fig. 4, 5). (10.83%), S. (Sergentomyia) theodori (0.91%) Among 92 collected rodents (67.39%), and S. (Rondanomyia) pawlowskii (0.07%) (8.70%), (4.35%), (17.39%) and (2.17%) were (Table 2). identified as M. libycus, Nesokia indica, Mus Two species of P. halepensis and the S. musculus, Allactaga elater and Hemiechinus pawlowskii were not captured from outdoor auritis respectively (Table 4). Leishmania major and indoor respectively. In the rodent burrows, has been detected in 2 (3.23%) out of 62 M. P. papatasi appeared nearly May and dis- libycus by PCR (Fig. 6). Both of the infected appeared in the late Oct and in indoors, it M. libycus were females. appeared in the late Jun and disappeared in All of the 45 human cases, which examined the early Oct. through observation passively, confirmed by The month wise density of P. papatasi in PCR but only 15 numbers of them were posi- rodent burrows and indoors are shown in Fig. 3. tive by light microscope. In this study, the rel- The peak of activity was detected for P. ative frequency of CL patients was 0.30%. papatasi first in the late Jun and the second in Twenty-eight (62.22%) of 45 confirmed the early Aug (Fig. 3). cases were males and 17 (37.78%) were fe- The sex ratio calculates at 83.71 and 62.25 in males. The mean age of patients was 30.78± outdoors and indoors for P. papatasi res- 16.91. The most of the cases 34 (75.60%) oc- pectively as well as 101.5 in outdoors for S. curred in autumn. Eighteen cases (40%) of sintoni. In Aug and Sep 2015 a total of 211 patients had no positive history of traveling to sand flies were collected in the vicinity of leishmaniasis endemic areas during the past rodent burrows including P. papatasi (51.66 %), year. Twenty-two cases (48.89 %) of patients P. caucasicus (10.9%), P. sergenti (18%), had one lesion. The most common location of and S. sintoni (19.44%). lesion was on hands (46%). The results of Two percent of P. papatasi species had PCR-RFLP indicated that 45 (100%) cases promastigote infections. The total of 300 P. were infected as L. major (Fig. 7). papatasi specimens was selected and dissected
Table 1. The sequence of primers used in PCR amplification the first internal transcribed spacer (ITS1)
Primers The sequence Response function LITSR 5´CTGGATCATTTTCCGATG3´ Forward 18bp L5 8S 5´TGATACCACTTATCGCACTT3´ Reverse 20bp
406 http://jad.tums.ac.ir Published Online: September 08, 2017
J Arthropod-Borne Dis, September 2017, 11(3): 403–413 A Saghafipour et al.: Epidemiological Study on …
Table 2. The fauna and the number of collected sand flies from the endemic area in Kahak District, Qom Province, 2015
Site Outdoor Indoor Total Each species of the total Species Male Female Male Female Outdoor Indoor Male Female Total % No. No. No. No. No. No. No. No. No. (%) (%) (%) (%) (%) (%) (%) (%) (%) P. papatasi 915 1093 216 347 2008 563 1131 1440 2571 61.74 (45.57) (54.43) (38.37) (61.63) (78.10) (21.90) (43.99) (56.1) (100) P. sergenti 41 61 131 53 102 184 172 114 286 6.87 (40.20) (59.80) (71.20) (28.80) (35.66) (64.34) (60.14) (39.86) (100) P. alexandri 7 5 11 19 12 30 18 24 42 1.00 (58.33) (41.67) (36.67) (63.33) (28.57) (71.43) (42.86) (57.14) (100) P. caucasicus 45 … 61 … 45 61 106 … 106 2.55 (100) (100) (42.45) (57.55) (100) (100) P. caucasicus … 157 … 15 157 15 … 172 172 4.13 group (100) (100) (91.28) (8.72) (100) (100) P. kandelakii 23 50 35 130 73 165 58 180 238 5.72 (31.51) (68.49) (21.21) (78.79) (30.67) (69.33) (24.37) (75.63) (100) P. tobbi 1 0 0 3 1 3 1 3 4 0.10 (100) (0) (0) (100) (25.00) (75.00) (25.00) (75.00) (100) P. major 6 19 60 149 25 209 66 168 234 5.62 (24.00) (76.00) (28.71) (71.29) (10.68) (89.32) (28.21) (71.79) (100) P. halepensis 0 … 4 … 0 4 4 … 4 0.10 (0) (100) (0) (100) (100) (100) P. brevis 1 … 1 … 1 1 2 … 2 0.05 (100) (100) (50.00) (50.00) (100) (100) P. adlerius … 2 … 11 2 11 … 13 13 0.31 group (100) (100) (15.38) (84.62) (100) (100) S. sintoni 207 204 18 22 411 40 225 226 451 10.83 (50.36) (49.64) (45.00) (55.00) (91.13) (8.87) (49.89) (50.11) (100) S. theodori 15 14 6 3 29 9 21 17 38 0.91 (51.72) (48.28) (66.67) (33.33) (76.32) (23.68) (55.26) (44.74) (100) S. pawlowski 0 3 0 0 3 0 0 3 3 0.07 (0) (100) (0) (0) (100) (0) (0) (100) (100) Total 1261 1608 543 752 2869 1295 1813 2351 4164 100 (43.93) 56.07) (41.92) (58.08) (68.90) (31.10) (43.54) (56.46) (100)
Fig. 1. Map of Iran and Qom Province, highlighting the location of Kahak District, (2) within Qom Province (22, 23)
407 http://jad.tums.ac.ir Published Online: September 08, 2017
J Arthropod-Borne Dis, September 2017, 11(3): 403–413 A Saghafipour et al.: Epidemiological Study on …
Table 3. Natural infection of sand flies with promastigote, Kahak District, Qom Province, 2015
Species Catch place Physiological status Age Group Total Infected I* O** Unfed Blood Semi Gravid Parous Nuli parous specimens fed gravid No % No % No % No % No % No. % No. % No. % No. %
P. papatasi P. 150 50 150 50 180 60 60 20 20 6.67 40 13.33 202 67.33 98 32.67 300 6 2% (100)
P. sergenti P. 20 50 20 50 20 50 20 50 0 0 0 0 31 77.50 9 22.50 40 0 0 (100)
P.caucasicus 10 50 10 50 20 100 0 0 0 0 0 0 18 90 2 10 20 0 0 (100)
*: Indoor, **: Outdoor
Fig. 4. Agarose gel electrophoresis of the first inter- nal transcribed spacer (ITS1) - Polymerase chain re- action (PCR) products. M, 50bp ladder: lane1: Leish- mania major (MRHO/IR/75/ER), 2, 3: Leishmania major in human skin samples, lane 4, 5, 6 Leishmania major in P. papatasi, N: negative control (distilled water), M: Marker
Fig. 2. Specimens of some collected rodents in Kahak district, Qom Province, 2015
Fig. 5. Agarose gel electrophoresis of Polymerase chain reaction-restriction fragment length polymor- phism (HaeIII) products. M, 50bp ladder: lane 1, 2, 3,
Fig. 3. The month wise density of Phlebotomus 4, 5, 6 Leishmania major in P. papatasi, lane 7 posi- papatasi in Kahak District, Qom Province, 2015 tive Leishmania major (MRHO/IR/75/ER), M: Marker
408 http://jad.tums.ac.ir Published Online: September 08, 2017
J Arthropod-Borne Dis, September 2017, 11(3): 403–413 A Saghafipour et al.: Epidemiological Study on …
Fig. 7. Agarose gel electrophoresis of Polymerase
chain reaction-restriction fragment length polymor- Fig. 6. Agarose gel electrophoresis of the first inter- phism (HaeIII) analysis of ITS region for identifica- nal transcribed spacer (ITS1) - Polymerase chain re- tion of Leishmania species using M, 50bp ladder: action (PCR) products. M, 50bp ladder: lane 1, nega- lane1, 2, 3, 4 Leishmania major in human skin sam- tive control (distilled water), lane 2, Leishmania ma- ples, lane 5, 6 Leishmania major isolated from Meri- jor (MRHO/IR/75/ER), lane 3 Leishmania major iso- ones libycus, lane 7, positive Leishmania major lated from Meriones libycus, M: Marker (MRHO/IR/75/ER), M: Marker
Table 4. Molecular detection of Leishmania infection in rodents, Kahak District, Qom Province, 2015
Species No. Rodents No. exanimated No. infected Infected rate,% (ITS1-PCR) N0 % No % Meriones libycus 62 67.39 62 100 2 3.23 Nesokia indica 8 8.70 8 100 0 0 Mus musculus 4 4.35 4 100 0 0 Allactaga elater 16 17.39 4 25 0 0 Hemiechinus auritis 2 2.17 0 0 0 0 Total 92 100 78 84.78 2 2.17
Discussion
We identified L. major in P. papatasi, M. ZCL (29). This paper reviews recent advanc- libycus and human by PCR technique. Previ- es on sand flies vectors, M. libycus and human ous surveys carried out in Qomrood and Gha- of ZCL, using molecular biological approaches. navat districts of Qom Province, Iran showed P. papatasi captured in this study is the main that P. papatasi and M. libycus were proven vector of L. major from animals to man in (in Qomrood) and probable (in Ghanavat) central Asia and appears to be the vector of L. vector and reservoir of ZCL (9, 10). Aware- major in Iran and 21 other countries in old ness of epidemiology of ZCL is an important world (30). measure for management and planning of In this study, P. alexandri was also cap- control (28). The entomological and reser- tured. It has been found naturally infected with voirs (rodents and human) fields and labora- promastigotes and is suspected vector of VL tory surveys accompanied by correct identifica- in Iran (31). Phlebotomus caucasicus group, tion the common agent in their target part of P. kandelaki and P. major were also collected. their bodies is a major component for combat- Phlebotomus caucasicus was naturally infect- ing against disease. ed with promastigotes in a new focus of VL Recently, genetic analyses and genotyp- in north-west of Iran (32). Phlebotomus kan- ing using PCR-RFLP have been applied and delaki is naturally infected with Leishmania performed on vector (s) and reservoir hosts of sp. promastigotes in northwest Iran and is sus-
409 http://jad.tums.ac.ir Published Online: September 08, 2017
J Arthropod-Borne Dis, September 2017, 11(3): 403–413 A Saghafipour et al.: Epidemiological Study on …
pected as probable vector of VL in the region In the present study, based on molecular (33). In Iran, P. major has been found in all results, L. major was found in M. libycus as a area where human cases of VL have been re- reservoir, P. papatasi as a vector and sus- ported and natural promastigote infection of pected patients as incidental host. M. libycus this species has reported in endemic focus VL as the main reservoir host of ZCL has been in Ghir County (Fars Province) South of Iran distributed in the northeastern, central and (34). Moreover, in this area, we captured S. southwestern regions in Iran (42, 43). For the povlovskyi in indoor. This result has been first time in 1996, isolation and characteriza- confirmed with the previous study in Esfahan tion of L. major from M. libycus in Iran, has (35). The identified species were consistent been reported (4). Meriones libycus has pre- with previous study in other parts of Iran (1). viously been infected with L. major parasites Low percentage of collected sand flies in from Golestan, Esfahan and Yazd Provinces indoor shows people prevent sand flies to en- (7, 42, 44-46). Leishmania major was firmly ter their homes. P. papatasi was the predom- identified in M. libycus that indicates this ro- inant species of the genus Phlebotomus in in- dent species can be incriminated as reservoir doors (31.10%) and outdoors (68. 90%). This host of ZCL in this location (47). The results of suggests that P. papatasi is the anthropophilic this study have shown, M. libycus is the main species in this area. In addition, only P. papa- and potential reservoir host of ZCL in Kahak tasi is able to develop L. major in its mid gut district of Qom Province and it has an im- and transfer the parasite to its proboscis to portant role in stable ZCL in this area, which cause ZCL (36). S. sintoni enters the indoors has pay attention to future rodent control pro- because of nearby homes to rodent burrows grams with administrative health center. (37). P. major and P. kandelakii are more dominant sand flies were collected from in- Conclusion door after P. papatasi but due to the low fre- quency. These species do not involve in leish- This study confirms the existence of local maniasis transmission. transmission of zoonotic cycle of CL in In the present study, we distinguished par- Kahak District of Qom Province, and pro- ity of sand flies by observation of the appear- vides that in this cycle, L. major is the causa- ance of the accessory glands (26). Accessory tive agent, P. papatasi is the main vector and glands secretions could not be as an indicator M. libycus is the main reservoir of the disease. for distinguishing parous from nulliparous of P. papatasi females (38). In this study, the Acknowledgments parous rate of P. papatasi was 67.33%, so it is not surprising to see high level of pro- Tehran University of Medical Science mastigote infection among this sand fly spe- through project number funded the study: cies. The same trend of infection is reported 29826. We thank Health workers in Qom Health from north Siani in Egypt (39, 40). The results Center for helping with the field working and of dissection showed that 2% of P. papatasi Masoomeh Dolati for molecular Systematic species were naturally infected with pro- Laboratory. The authors declare that there is mastigote infection. The Leishmania infec- no conflict of interest. tion rate in sand flies is usually very low even in endemic areas (41). The low density of References Leishmania parasites in M. libycus in this area may be due to low sensitivity of this rodent 1. Yaghoobi-Ershadi MR (2012) Phlebotom- compared to R. opimus (4). ine sand flies (Diptera: Psychodidae) in
410 http://jad.tums.ac.ir Published Online: September 08, 2017
J Arthropod-Borne Dis, September 2017, 11(3): 403–413 A Saghafipour et al.: Epidemiological Study on …
Iran and their role on Leishmania trans- A (2010) Molecular epizootiology of Ro- mission. J Arthropod Borne Dis. 6(1): 1–17. dent leishmaniasis in hyperendemic area 2. Yaghoobi-Ershadi MR, Hanafi-Bojd AA, of Iran. Iran J Public Health. 39(1): 1–7. Javadian E, Jafari R, Zahraei-Ramazani AR, 9. Rassi Y, Saghafipour A, Abai MR, Oshaghi Mohebali M (2002) A new cutaneous leish- MA, Rafizadeh S, Mohebai M, Yaghoobi- maniasis caused by L. tropica. Saudi Med Ershadi MR, Mohtarami F, Farzinnia B J. 23(3): 291–294. (2011) Phlebotomus papatasi and Meri- 3. Molyneux DH, Ashford RW (1983) The ones libycus as the vector and reservoir parasites. In DH Molyneux, RW Ashford, host of cutaneous leishmaniasis in Qom- The biology of Trypanosoma and Leish- rood District, Qom Province, central Iran. mania, parasites of man and domestic an- Asian Pac J Trop Med. 4(2): 97–100. imals, 1sted., Taylor and Francis, London, 10. Akhavan AA, Yaghoobi-Ershadi MR, Me- pp. 240–243. hdipour D, Abdoli H, Farzinnia B, Mohe- 4. Yaghoobi-Ershadi MR, Akhavan AA, bali M, Hajjaran H (2003) Epidemic Out- Mohebali M (1996) Meriones libycus and break of Cutaneous Leishmaniasis due to Rhombomys opimus (Rodentia: Gerbilli- Leishmania major in Ghanavat Rural Dis- dae) are the main reservoir hosts in a new trict, Qom Province, Central Iran. Iran J focus of zoonotic cutaneous leishmaniasis Publ Health. 32(4): 35–41. in Iran. Trans R Soc Trop Med Hyg. 90(5): 11. Abedi-Astaneh F, Akhavan AA, Shirzadi 503–504. MR, Rassi Y, Yaghoobi-Ershadia MR, 5. Yaghoobi-Ershadi MR, Hanafi-Bojd AA, Hanafi-Bojd AA, Akbarzadeh K, Nafar- Akhavan AA, Zahrai-Ramazani AR, Shalamzari R, Parsi S, Abbasib A, Raufi Mohebali M (2001) Epidemiological study H (2015) Species diversity of sand flies in a new focus of cutaneous leishmaniosis and ecological niche model of Phleboto- due to Leishmania major in Ardestan Town, mus papatasi in central Iran. Acta Trop. central Iran. Acta Trop. 79(2): 115–121. 149: 246–253. 6. Yaghoobi-Ershadi MR, Jafari R, Zahraei- 12. Silva OSD, Grunewald J (1999) Contribu- aramazani AR, Akhavan AA, Mohebali M tion to the sand fly fauna (Diptera: (2002) Ecology of phlebotomine sandflies Phlebotominae) of Rio Grande do Sul, in an endemic focus of cutaneous leishman- Brazil and Leishmania (Viannia) infections. iasis in Isfahan County. J Shahid Sadoughi Mem. Inst. Oswaldo Cruz. 94(5): 579–582. Unv Med Sci. 9: 42–48 (in Persian). 13. Hamarasheh O (2011) Distribution of 7. Akhavan AA, Mirhendi H, Khamesipour Leishmania major zymodemes to popula- A, Alimohammadian MH, Rassi Y, Bates tions of Phlebotomus papatasi. a review. P, Kamhawi S, Valenzuela JG, Arandian Parasit Vectors. 4: 9–15. MH, Abdoli H, Jalali-Zand N, Jafari R, 14. Kato H, Uezato H, Gomez EH (2007) Es- Shareghi N, Ghanei M, Yaghoobi-Ershadi tablishment of a mass screening method of MR (2010) Leishmania species: Detection sand fly vectors for Leishmania infection and identification by nested PCR assay by molecular biological methods. Am J from skin samples of rodent reservoirs. Trop Med Hyg. 77 (2): 324–329. Exp Parasitol. 126(4): 552–556. 15. Fujita M, Kato H, Hashiguchi W (2012) 8. Akhavan AA, Yaghoobi-Ershadi MR, Mir- Genotyping of sand fly species in Peru- hendi H, Alimohammadian MH, Rassi Y, vian Andes where leishmaniasis is en- Shareghi N, Jafari R, Arandian MH, Abdoli demic. Acta Trop. 121(2): 93–98. H, Ghanei M, Jalalizand N, Khamesipour
411 http://jad.tums.ac.ir Published Online: September 08, 2017
J Arthropod-Borne Dis, September 2017, 11(3): 403–413 A Saghafipour et al.: Epidemiological Study on …
16. Schönian G, Mauricio I, Gramiccia M, 285–300. Cañavate C, Boelaert M (2008) Leish- 26. Añez N, Tang Y (1997) Comparison of maniases in the Mediterranean in the era three methods for age-grading of female of molecular epidemiology. Trends Para- Neotropical phlebotomine sandflies. Med sitol. 24(3): 135–142. Vet Entomol. 11(1): 3–7. 17. Ajaoud M, Es-sette N, Hamdi S, El-Idrissi 27. Schonian G, Nasereddin A, Dinse N, AL, Riyad M, Lemrani M (2013) Detec- Schweynoch C, Schallig HD, Presber W, tion and molecular typing of Leishmania Jaffe CL (2003) PCR diagnosis and char- tropica from Phlebotomus sergenti and acterization of leishmaniain local and im- lesions of cutaneous leishmaniasis in an ported clinical samples. Diagn Microbiol emerging focus of Morocco. Parasit Vec- Infect Dis. 47(1): 349–358. tors. 6: 217–236. 28. Mohammadi Azni S, Nokandeh Z, Khorsan- 18. Lachaud L, Chabbert E, Dubessay P, di AA, Sanei Dehkordi A (2010) Epide- Dereure J, Lamothe J, Dedet JP, Bastien P miology of cutaneous leishmaniasis in (2002) Value of two PCR methods for the Damghan. J Mil Med. 12(3): 131–135 (in diagnosis of canine visceral leishmaniasis Persian). and the detection of asymptomatic carri- 29. Kato H, Gomez A, Cáceres G, Uezato, ers. Parasitol. 125(3): 197–207. Mimori T, Hashiguchi Y (2010) Molecu- 19. Nateghi Rostami M, Saghafipour A, Ve- lar Epidemiology for Vector Research on sali E (2013) A newly emerged cutaneous Leishmaniasis. Int J Environ Res Public leishmaniasis focus in central Iran. Int J Health. 7(3): 814–826. Infect Dis. 17(12): 1198–1206. 30. World Health Organization (2010) Con- 20. Qom Province Government (2012) Prov- trol of the leishmaniasis: report of a meet- ince public affairs office Natural geography ing of the WHO Expert Committee on the in Qom, Iran. Available at: http://www. Control of Leishmaniases, Geneva, 22–26 ostan-qom.ir. March. WHO technical report series, no. 21. Iran Meteorological Organization. Iran 949. (2015) current weather. Available at: http:// 31. Azizi K, Rassi Y, Javadian E, Motazedian www.irimo.ir/index.php?newlang=eng. MH, Rafizadeh E, Yaghoobi-Ershadi MR, 22. Farzinnia B, Saghafipour A, Abai MR Mohebali M (2006) Phlebotomus (Paraph- (2010) Malaria Situation and Anopheline lebotomus) alexandri: a probable vector of Mosquitoes in Qom Province, Central Iran. leishmaniasis infantum in Iran. Ann Trop J Arthropod Borne Dis. 4(2): 61–67. Med Parasitol. 100(1): 63–68. 23. Abai MR, Saghafipour A, Ladonni H, 32. Rassi Y, Kaverizadeh F, Javadian E, Mohe- Jesri N, Omidi S, Azari-Hamidian S bali M (2004) First report on natural pro- (2016) Physicochemical Characteristics mastigote infection of Phlebotomus cau- of Larval Habitat Waters of Mosquitoes casicus in a new focus of visceral leish- (Diptera: Culicidae) in Qom Province, Cen- maniasis in Northwest of Iran. Iran J Pub- tral Iran J Arthropod Borne Dis. 10(1): lic Health. 33(4): 70–72. 65–77. 33. Rassi Y, Javadian E, Nadim A, Zahraei 24. Smart J, Jordan K, Whittick RJ (1965) In- AR, Vatandoost H, Motazedian MH, sects of Medical Importance. 4th ed. Brit- Azizi K, Mohebali M (2005) Phleboto- ish Museum, Natural History, Adlen mus (Larroussius) kandelakii, the princi- Press, Oxford: Alden Press. pp. 286–288. ple and proven vector of visceral leishma- 25. Theodor O, Mesghali A (1964) On the niasis in Northwest of Iran. Pak J Biol Sci. Phlebotomine of Iran. J Med Entomol. 1: 8: 1802–1806.
412 http://jad.tums.ac.ir Published Online: September 08, 2017
J Arthropod-Borne Dis, September 2017, 11(3): 403–413 A Saghafipour et al.: Epidemiological Study on …
34. Sahabi Z, Seyedi-Rashti MA, Nadim A, biol. 5(2): 430–433. Javadian E, Kazemeini M, Abai MR (1992) 41. Sharma U, Singh S (2008) Insect vectors A preliminary report on the natural lep- of Leishmania: distribution, physiology tomonad infection of Phlebotomus major and their control. J Vector Borne Dis. 45 in an endemic focus of Visceral Leish- (4): 255–272. maniasis (VL) in Fars Province, south of 42. Mirzaei A, Rouhani S, Kazerooni PA, Iran. Iran J Publ Health. 21(1–4): 87–93. Farahmand M, Parvizi P (2013) Molecu- 35. Zahraei-Ramazani AR, Yaghoobi-Ershadi lar detection and conventional identifica- MR, Mokhtari AR, Akhavan AA, Abdoli tion of Leishmania species in reservoir H, Arandian MH (2006) Composition of hosts of zoonotic cutaneous leishmaniasis the Phlebotomine Fauna (Diptera: Psy- in Fars Province, south of Iran. Iran J Par- chodidae), in Esfahan City, central Iran, asitol. 8(2): 280–288. First record of Sergentomyia baghdadis, 43. Rouhani S, Mirzaei A, Spotin A, Parviz P S. clydei and S. dentate. J Entomol. 3(4): (2014) Novel identification of Leishma- 319–324. nia major in Hemiechinus auritus and 36. Volf P, Benková I, Myšková J, Sádlová J, molecular detection of this parasite in Campino L, Ravel C (2007) Increased Meriones libycus from an important focus transmission potential of Leishmania major/ of zoonotic cutaneous leishmaniasis in Iran. Leishmania infantum hybrids. Int J Para- J Infect Public Health. 7 (3): 210–217. sitol. 37: 589–593. 44. Mirzaei A, Rouhani S, Taherkhani H, 37. Yaghoobi-Ershadi MR, Javadian E (1995) Farahmand M, Kazemi B, Hedayati M Susceptibility of Phlebotomus papatasi to (2011) Isolation and detection of Leish- DDT in the most important focus of zoon- mania species among naturally infected otic cutaneous leishmaniasis, Isfahan Prov- Rhombomys opimus, a reservoir host of ince Iran. Iran J Publ Health. 24(3–4): 11–20. zoonotic cutaneous leishmaniasis in Tur- 38. Fatemi M, Yaghoobi-Ershadi MR, Mohe- kemen Sahara, North East of Iran. Exp Para- bali M, Saeidi Z, Veysi A, Khamesipour sitol. 129(4): 375–380. A, Akhavan AA (2016) Assessing the 45. Parvizi P, Moradi G, Akbari G, Ready ovarian accessory glands to determine the PD, Farahmand M, Piazak N (2008) PCR parity of Phlebotomus papatasi, vector of Detection and sequencing of parasite ITS zoonotic cutaneous leishmaniasis, under rDNA gene from reservoirs host of zoon- laboratory condition. J Arthropod Borne otic cutaneous leishmaniasis in central of Dis. (in Press). Iran. Parasitol Res. 103 (6): 1273–1278. 39. Hanafi HA, Fryauff DJ, Dykstra EA, 46. Najafzadeh N, Sedaghat MM, Sultan SS, Szumlas DE (2007) Laboratory demon- Spotin A, Zamani A, Taslimian R, stration of the acquisition and develop- Yaghoubinezhad A, Parvizi P (2014) The ment of leishmania major in the sand fly existence of only one haplotype of Leish- Phlebotomus kazeruni (Diptera: Psycho- mania major in the main and potential res- didae). J Egyptian Soci Parasitol. 37 (1): ervoir hosts of zoonotic cutaneous leish- 227–241. maniasis using different molecular mark- 40. Kassiri H, Naddaf SR, Mohebali M, Ja- ers in a focal area in Iran. Rev Soc Bras vadian E (2012) Molecular Characteriza- Med Trop. 47(5): 599–606. tion of Leishmania Infection in Sand flies 47. Killick-Kendrick R, Ward RD (1981) From Sistan and Baluchistan Province, Ecology of the Leishmania. Parasitol. 82: Southeastern Iran. Jundishapur J Micro 143–152.
413 http://jad.tums.ac.ir Published Online: September 08, 2017