Analysis of Pax6 Contiguous Gene Deletions in the Mouse

Analysis of Pax6 Contiguous Gene Deletions in the Mouse, Mus musculus, Identiﬁes Regions Distinct from Pax6 Responsible for Extreme Small-Eye and Belly-Spotting Phenotypes

Jack Favor,*,1 Alan Bradley,† Nathalie Conte,† Dirk Janik,‡ Walter Pretsch,* Peter Reitmeir,§ Michael Rosemann,** Wolfgang Schmahl,‡ Johannes Wienberg†† and Irmgard Zaus* *Institute of Human Genetics, §Institute of Health Management, **Institute of Radiation Biology, Helmholtz Zentrum Mu¨nchen, German Research Center for Environmental Health, Neuherberg D-85764, Germany, †Wellcome Trust Sanger Institute, Hinxton, Cambridge CB10 1SA, United Kingdom, ‡Lehrstuhl fu¨r Allgemeine Pathologie und Neuropathologie, Tiera¨rztliche Fakulta¨t, Ludwig-Maximilians-Universita¨t, Mu¨nchen D-80539, Germany and ††Chrombios GmbH, Raubling D-83064, Germany Manuscript received April 30, 2009 Accepted for publication May 16, 2009

ABSTRACT In the mouse Pax6 function is critical in a dose-dependent manner for proper eye development. Pax6 contiguous gene deletions were shown to be homozygous lethal at an early embryonic stage. Heterozygotes express belly spotting and extreme microphthalmia. The eye phenotype is more severe than in heterozygous Pax6 intragenic null mutants, raising the possibility that deletions are functionally different from intragenic null mutations or that a region distinct from Pax6 included in the deletions affects eye phenotype. We recovered and identified the exact regions deleted in three new Pax6 deletions. All are homozygous lethal at an early embryonic stage. None express belly spotting. One expresses extreme microphthalmia and two express the milder eye phenotype similar to Pax6 intragenic null mutants. Analysis of Pax6 expression levels and the major isoforms excluded the hypothesis that the deletions expressing extreme microphthalmia are directly due to the action of Pax6 and functionally different from intragenic null mutations. A region distinct from Pax6 containing eight genes was identified for belly spotting. A second region containing one gene (Rcn1) was identified for the extreme microphthalmia phenotype. Rcn1 is a Ca12-binding protein, resident in the endoplasmic reticulum, participates in the secretory pathway and expressed in the eye. Our results suggest that deletion of Rcn1 directly or indirectly contributes to the eye phenotype in Pax6 contiguous gene deletions.

ONTIGUOUS gene deletions account for a et al. 1993; Bartsch et al. 1996; Potocki and Shaffer C significant portion of human genetic syndromes. 1996) and the Wilm’s tumor- aniridia- genitourinary The application of fluorescence in situ hybridization abnormalities- mental retardation (WAGR) syndrome (FISH) cytogenetics and array comparative genome (Riccardi et al. 1978; Francke et al. 1979; Hittner hybridization (array-CGH) technologies have enabled et al. 1979; Fryns et al. 1981), respectively. Deletion more accurate localization of deletion breakpoints. analyses were important in identifying genes associated This deletion information combined with the annota- with clinical features of the syndromes: EXT2 for tion of the human genome structure provides critical multiple exostoses and ALX4 for parietal foramina in information to identify genes responsible for particular Potocki–Shaffer syndrome (Ligon et al. 1998; Wu et al. phenotypes associated with a syndrome. For example, 2000; Wakui et al. 2005), WT1 for Wilm’s tumor, and deletions of the 11p11p12 and 11p13 regions on the PAX6 for aniridia in WAGR syndrome (van Heyningen short arm of human chromosome (Chr) 11 have been et al. 1985; Glaser et al. 1986, 1992; Fantes et al. 1992). identified in the Potocki–Shaffer syndrome (Shaffer Deletion analyses have also defined the extent of the deleted region in patients with combined Potocki– Shaffer and WAGR syndromes (McGaughran et al. The mutant allele symbols Del(2)Pax611Neu/1Neu, Del(2)Pax612Neu/ 1995; Bre´mond-Gignac et al. 2005) as well as micro- 13Neu 2Neu and Del(2)Pax6 /3Neu were submitted to and approved by the deletions 39 to PAX6, which prevent expression of PAX6 Mouse Genetic Nomenclature Committee, and assigned the MGI auderdale ‘elia accession ID nos. 3698295, 3698297, and 3710946, respectively. and cause aniridia (L et al. 2000; D et al. Supporting information is available online at http://www.genetics.org/ 2007; Davis et al. 2008). cgi/content/full/genetics.109.104562/DC1. The mouse Chr 2 region homologous to the human 1Corresponding author: Institute of Human Genetics, Helmholtz Zen- WAGR region contains the genes Wt1, Rcn1, Pax6, and trum Mu¨nchen German Research Center for Environmental Health, Ingolsta¨dter Lanstrasse 1 D-85764, Neuherberg, Germany. Elp4. An extensive allelic series at Pax6 has been E-mail: [email protected] identified (Bult et al. 2008). Heterozygote Pax6 in-

Genetics 182: 1077–1088 (August 2009) 1078 J. Favor et al. tragenic null mutants express microphthalmia, iris were obtained from breeding colonies maintained by the anomalies, corneal opacities, lens opacities, and lens- Department of Animal Resources at Neuherberg. corneal adhesions. Homozygotes are anophthalmic and Histology, gross embryo morphology, and slit lamp oberts ogan photography: Pregnant females were killed by cervical dislo- die shortly after birth (R 1967; H et al. cation. Embryos were freed from placentae and embryonic 1986). Five deletions in the region have been identified: membranes in room temperature PBS, phenotyped under a Pax6Sey-Dey, Pax6Sey-H, Pax6Sey-2H, Pax6Sey-3H, Pax6Sey-4H of which dissecting microscope (MZ APO; Leica, Bensheim, Germany), two, Pax6Sey-H (Hogan et al. 1986; Kent et al. 1997; and photographed. Postnatal day 1 (P1) mice were killed by Kleinjan et al. 2002; Webb et al. 2008) and Pax6Sey-Dey decapitation and phenotyped after dissecting away the skin overlying the eyes. P21 mice were phenotyped by slit lamp (Theiler et al. 1978; Hogan et al. 1987; Glaser et al. examination and killed by CO2 asphyxiation. Embryos and 1990), have been well characterized. Heterozygotes for heads of P1 or P21 mice were fixed in 10% buffered formalin. both deletions express belly spotting and a more The heads from P21 mice were demineralized in EDTA. Fixed extreme eye phenotype than that observed for hetero- materials were embedded in paraffin, and serially sectioned zygotes of intragenic Pax6 null mutations. Homozygotes (coronal) at 5 mm. Sections were stained with hematoxylin and eosin, and evaluated by light microscopy (Axioplan; Carl Zeiss, for both deletions are lethal at an early embryonic stage. Hallbergmoos, Germany). Digital photos were acquired (Ax- We were particularly interested in the extreme eye iocam and Axiovision; Carl Zeiss, Hallbergmoos, Germany) phenotype associated with the Pax6 deletions and and imported into Adobe Photoshop CS (Adobe Systems, considered two alternative hypotheses. Either Pax6 Unterschleissheim, Germany). deletions are functionally different from Pax6 intra- P35 mice were anesthetized with 137 mg ketamine and 6.6 mg xylazine per kg body weight and quickly photographed genic null mutations or deletion of a region linked to with a slit lamp microscope (Zeiss SL 120) equipped with a but distinct from the Pax6 structural gene affects the eye compact video camera. Images were captured in Axiovision phenotype. (Zeiss) and imported into Adobe Photoshop CS. After photog- In the present study we identify three new deletions raphy ophthalmic salve (Regepithel, Alcon) was applied to the encompassing the Pax6 region of the mouse. They have eyes of the anesthetized mice to prevent eye injury due to 11Neu dehydration and the animals were caged individually until fully been assigned the mutant allele symbols Del(2)Pax6 / recuperated. 12Neu 13Neu 1Neu, Del(2)Pax6 /2Neu, and Del(2)Pax6 /3Neu Segregation analysis of embryos: Pregnant females were and will be referred to throughout this publication as killed as above between days 14 and 16 p.c. (E14 and E16 Pax611Neu, Pax612Neu,andPax613Neu, respectively. All three stages) of pregnancy. The entire uterus was removed, opened, deletions are homozygous lethal at an early embryonic and the uterine contents classified for live embryos, dead implants (implantation site with an obvious placenta, extra- stage. The deletions differentiate for the extent of the embryonic membranes, and necrotic embryonic tissue), and 11Neu eye abnormality expressed: Pax6 heterozygotes ex- decidua (resorption sites consisting of the remnants of the press extreme microphthalmia similar to that observed decidual reaction tissue due to implantation but subsequent in the Pax6Sey-Dey and Pax6Sey-H deletions. Pax612Neu and early embryonic death). The live embryos were freed from the Pax613Neu heterozygotes express the milder eye abnor- placentae and embryonic membranes and phenotyped. mality seen in heterozygous intragenic null mutants. For Body weight and gross eye morphology: Eye morphology was assessed as previously described (Favor et al. 2001, 2008). all three deletions, heterozygotes do not express belly P35 heterozygous mutant and wild-type littermates were oph- spotting. Genetic, phenotypic, and molecular charac- thalmologically examined by slit lamp microscopy and catego- terization of the deletions allowed us to identify regions rized for the degree of lens/corneal opacity and extreme associated with the array of phenotypes in these contig- microphthalmia. The animals were weighed and killed by uous gene deletions. cervical dislocation. Eyes were enucleated, washed in room temperature PBS, blotted dry on filter paper,and weighed. Data were statistically analyzed by linear mixed model ANOVA employing SAS software release 9.1 (Cary, NC). Differences in group means were assessed by applying the F-test for the MATERIALS AND METHODS contrast derived from the linear model. Deletion analyses at Pax6, MIT-microsatellite markers, and Mutations, animals, and mapping: The original Pax611Neu SNP sites: Pax611Neu and Pax612Neu heterozygotes were mated to and Pax613Neu mutants were found in our breeding colonies. Pax69Neu and Pax64Neu heterozygotes. Pax613Neu heterozygotes The original Pax612Neu mutant was recovered in a mutagenesis were mated to Pax63Neu heterozygotes. Pregnant females were experiment. Ophthalmological examinations were done as prepared as above. E15 Pax611Neu/Pax69Neu, Pax611Neu/Pax64Neu, previously described (Favor 1983). Congenic C3H/HeJ Pax612Neu/Pax69Neu, Pax612Neu/Pax64Neu, and Pax613Neu/Pax63Neu mutant lines were constructed prior to initiating the studies. compound heterozygotes were identified as anophthalmic The mapping of the mutations followed our standard labora- embryos and liver tissue samples were snap frozen on dry ice tory protocol (Favor et al. 1997). For timed pregnancies, for genomic DNA extractions as above. The Pax69Neu allele is a females were mated and checked daily for the presence of a 7-bp deletion in the 59 region of the Pax6 gene, the Pax64Neu vaginal plug. The day at which a vaginal plug was observed was allele is a base-pair substitution in the 39 region of the Pax6 defined as day 0 p.c. (E0). In matings to generate offspring, gene and the Pax63Neu allele is a 1-bp insert in the 59 region of females were checked daily for newborn litters and the day of the Pax6 gene (Favor et al. 2001). The regions containing the birth was defined as postnatal day 0 (P0). Animals were bred Pax69Neu, Pax64Neu, and the Pax63Neu mutant sites were sequenced and maintained in our animal facilities according to the as previously described (Favor et al. 2001) in the compound German law for the protection of animals. All inbred strain heterozygotes. A region was shown to be deleted if, in the C3H/HeJ and C57BL/6El animals used in the present study compound heterozygote, the sequence corresponded to the Mouse Pax6 Contiguous Gene Deletions 1079

Pax69Neu, Pax64Neu, or the Pax63Neu sequence and not to a specific primers within each of these regions was designed, heterozygous sequence containing the wild-type and the and long-range PCR was carried out to amplify across the mutant alleles. deletions using genomic DNA from Pax612Neu or Pax613Neu Pax611Neu, Pax612Neu, and Pax613Neu heterozygotes were created heterozygotes as substrates with the Expand Long Range with either a wild-type Chr 2 from C3H/HeJ or C57BL/6El. dNTPack (Roche Diagnostics, Mannheim, Germany) accord- Genomic DNA was extracted from liver samples as above from ing to the manufacturer’s protocol. Specific amplification the six genotype constructs as well as the inbred strains C3H/ products were isolated and used as substrates for sequencing. HeJ and C57BL/6El. Animals were genotyped for MIT-micro- Analysis of gene transcript levels by real-time PCR: P1 mice satellite markers and SNP sites that are polymorphic between were killed by decapitation. Eyes were enucleated and snap strains C3H/HeJ and C57BL/6El. An MIT-microsatellite or frozen on dry ice. RNA was extracted with the RNeasy kit SNP site was determined to be not deleted when both MIT- (QIAGEN, Hilden, Germany) and concentrations adjusted to microsatellite alleles or both SNP alleles were observed in the 0.25 mg/ml. Reverse transcription was carried out from 1mgof mutant heterozygotes carrying the wild-type Chr 2 from strain RNA as substrate using random hexamere primers and C57BL/6El. An MIT-microsatellite or SNP site was determined SuperScriptII polymerase (Invitrogen, Karlsruhe, Germany), to be deleted when only a single microsatellite allele or a single following the protocol as recommended by the manufacturer. SNP allele was observed in heterozygotes for both wild-type Quantitative real-time RT–PCR was done on a TaqMan 770 Chr 2 constructs, and the allele observed corresponded to the sequence detection system (Applied Biosystems, Foster City, allele carried by the wild-type strain chromosome. CA) using the following probes: Pax6 (Mm00443072_m1), Deletion analysis by array-CGH: Genomic DNA was ex- Elp4 (Mm_00517859_m1), Rcn1 (Mm_00485644_m1), and tracted from liver samples of P35 Pax611Neu /1, Pax612Neu /1, Tbp (Mm_00446973_m1) and TaqMan Universal PCR master and Pax6 1/1 mice as above. Genomic DNA from Pax6Sey-Dey mix (all reagents, Applied Biosystems). The Pax6 probe assays /1 was purchased from The Jackson Laboratory. Genomic a 56-bp amplicon that spans its exon 3–exon 4 junction. The DNA from Pax6Sey-H /1 mice was kindly provided by Sally Elp4 probe assays a 101-bp amplicon spanning its exon 4–exon Cross (MRC, Human Genetics Unit, Edinburgh, UK). A set of 5 junction. The Rcn1 probe assays a 119-bp amplicon that 836 BAC clones covering Chr 2 from position 3 Mb to 181 Mb spans its exon 4–exon 5 junction. was analyzed for copy number variations in the deletion Calibration curves of the real-time RT–PCR for each gene heterozygotes. For details see supporting information, File S1. were generated using eight dilution steps (covering five orders Deletion analysis by FISH cytogenetics: E15 Pax611Neu /1, of magnitude) of a whole-head cDNA pool from an E15 Pax6 Pax612Neu /1, and Pax6 1/1 embryos were obtained from 1/1 embryo. Each dilution was measured twice and the pregnant females as outlined above. Embryos were killed by resulting CT values were linearly fitted against the log10 of the decapitation, skin samples dissected and minced in the dilution ratios. presence of trypsin/EDTA, and cells isolated by filtration The CT values using the cDNA samples from the mutant through a 70-mm BD Falcon cell strainer (BD Biosciences, and wild-type eyes were measured in triplicates for each gene Munich, Germany). Cells were cultured for 3 days in GIBCO and each individual animal, and the relative expression values Dulbecco’s modified Eagle’s medium (Invitrogen, Karlsruhe, normalized to Tbp (as a housekeeping gene) and to the total- Germany) supplemented with 10% fetal calf serum after which head cDNA pool using the calibration curves. Group means chromosome preparations were made according to standard were compared with the Student’s t-test employing the cytogenetic techniques. Continuous series of overlapping software available in Excel. BACs were selected for the regions surrounding the putative Following TaqMan real-time RT–PCR the resulting reaction deletion breakpoints and were used as probes for FISH products were electrophoretically separated on an agarose gel cytogenetic analyses of the deletion-bearing chromosomes. to confirm a single PCR product of the expected size. For details see File S1. Sequencing: Primers (Table S11) were purchased from Localization of the deletion breakpoints by DNA walking Metabion International AG (Martinsried, Germany) or syn- or sequencing across the deletions: The proximal and distal thesized in house. The PCR products were electrophoretically breakpoints of the Pax611Neu, Pax612Neu, and Pax613Neu deletions separated on 1% agarose gels, extracted with a QIAquick gel were more precisely localized by an analysis of SNP or insert/ extraction kit (QIAGEN), and used as templates for sequenc- deletion sites polymorphic between strains C3H/HeJ and ing in both directions with a Taq Dye-Deoxy terminator cycle C57BL/6 (File S1and Table S4, Table S5, Table S6, Table S7, sequencing kit on an ABI 3730 DNA sequencer (Applied Table S8, Table S9, and Table S10). We sequenced across the Biosystems). BAC alignment and inspection of sequencing Pax611Neu deletion using genomic DNA from a Pax611Neu hetero- results of the regions utilized the Ensembl database build 44. zygote as substrate, with the Seegene DNA walking Speedup premix kit (BioCat, Heidelberg, Germany) according to the manufacturer’s protocol. The first, second and third genomic- specific primers were all within the nondeleted region defined RESULTS by the BAC RP23-8C14: first specific primer, AGCCTGGCA TCGTCACACTG; second specific primer, TGTGAAGGTGTG Eye morphology, belly spotting, and mapping: We GAGAGTTGGAGG; third specific primer, TCAGTGTTCCAA compared the eye abnormalities associated with the GGAGGGCTGT. The chimeric sequence jumped from the Pax611Neu and Pax612Neu mutations in E15 embryos (Fig- sequence defined by the BAC RP23-8C14 to a distal region 12Neu defined by the BAC RP23-431C3. The results were confirmed ure 1). Pax6 heterozygotes expressed microphthal- by sequencing across the presumed deletion using genome mia with a triangular-shaped pupil (gross morphology) specific primers, i.e., the third specific primer from the region with a thickened cornea, lens-corneal adhesions, persis- defined by the BAC RP23-8C14 as above, and a genome specific tence of epithelial cells in the cornea, and the absence primer from the sequence defined by the BAC RP23-431C3 of the anterior chamber (histology). Pax611Neu hetero- (TGCTGCAGACGTGCCAAAGAAC). On the basis of the analysis of polymorphic sites of the zygotes expressed an extreme eye phenotype, not Pax612Neu and the Pax613Neu deletions the adjacent proximal and typical for Pax6 intragenic mutations, and comparable distal nondeleted regions were identified. A group of genome- to the phenotype observed in the Pax6Sey-Dey and Pax6Sey-H 1080 J. Favor et al.

Figure 1.—Eye morphology and histology in E15 embryos. (A–C) Gross morphology. (A) Pax6 1/1 with well-developed eye. (B) Pax612Neu /1 with the typical eye phenotype associated with Pax6 null mutations; microphthalmia and triangular shaped pupil. Iris pigmentation is normal. (C) Pax611Neu /1 expressing microphthalmia, reduced iris pigmentation and iris coloboma (arrowhead). (D–F) Eye histology. (D) Pax6 1/1 with well-developed cornea (co), lens (le), retina (ret), and an intact retinal pigmented epithelium (arrowhead). There is a distinct anterior chamber separating the cornea and the anterior surface of the lens. (E) Pax612Neu /1 with a thickened cornea, adhesion of the lens to the cornea resulting in the absence of an anterior chamber, remnants of epithelial cells in the cornea (arrow) and vacuoles in the anterior region of the lens (arrowhead). The retinal pigmented epithelium is normal. (F) Pax611Neu /1 with a thickened cornea, adhesion of the lens to the cornea, and absence of the anterior chamber. Posterior coloboma is present, indicated by an interruption of the retinal pigmented epithelium in the region between the arrows. The orientation of the eye is rotated 45° ventrally. (G–I) Head overview documenting the eye orientation. (G) Pax6 1/1 and (H) Pax612Neu /1 in which the medial-lateral eye axes are perpendicular to the dorsal-ventral axis of the head. (I) Pax611Neu /1 in which the medial- lateral axes of both eyes are orientated at a 45° angle to the dorsal-ventral axis of the head. ( J–L) Higher magniﬁcation of F. ( J) The extent of the retinal pigmented epithelium in the ventral region is indicated by the arrows. (K and L) The retinal pigmented epithelium in the dorsal region is indicated by the arrows. Bars in D–K, 200 mm; bar in L, 100 mm.

13Neu deletions (Theiler et al. 1978; Hogan et al. 1986; Curto (t279 ¼ 40.06, P , 0.0001) and Pax6 (t279 ¼ 42.34, P , et al. 2007): microphthalmia, iris coloboma, and re- 0.0001) heterozygotes. Pax611Neu, Pax612Neu, and Pax613Neu duced iris pigmentation (gross morphology) with thick- heterozygotes expressed a slight and significant reduc- ened cornea, lens-cornea adhesion, absence of the tion in body weight as compared to their wild-type anterior chamber, posterior coloboma, and the orien- littermates. However, there were no significant differ- tation of the eyes was rotated such that the medial- ences in body weight among the Pax611Neu, Pax612Neu, and lateral eye axis was at a 45° angle to the dorsal-ventral Pax613Neu heterozygotes, indicating that the extreme axis of the head (histology). However, at this embryonic microphthalmia observed in Pax611Neu heterozygotes is stage the eye size was not extremely reduced. not due to a reduction in general growth (data not At P35 the differences in the eye phenotypes observed shown). in the Pax611Neu, Pax612Neu, and Pax613Neu heterozygotes Since Pax6 function is also critical for brain morpho- were more extreme (Figure 2, Table 1). Pax611Neu genesis (Schmahl et al. 1993), we evaluated brain heterozygotes were clearly associated with extreme morphology in Pax611Neu /1, Pax612Neu /1, Pax63Neu microphthalmia. By contrast, the eye phenotype in /1, and Pax6 1/1 P1 and P21 mice. Heterozygotes of Pax612Neu and Pax613Neu heterozygotes was similar to that all three Pax6 mutations expressed hypoplasia of the of heterozygote intragenic Pax6 null mutations (Favor telencephalic frontal area, increased diameters of the et al. 2001) with a median eye opacity of 75%. For all ventricular and subventricular zones, and reduced three mutant lines the eye weight in heterozygotes was diameter of the marginal zone in the dorsal pallial significantly lower than that of wild-type littermates: region of the forebrain. However, there were no differ- Pax611Neu: /1,4.61mg6 0.15, n ¼ 125; 1/1, 18.27 mg 6 ences in the degree of abnormality expressed in 12Neu 11Neu 0.16, n ¼ 120; t279 ¼ 61.97, P , 0.0001. Pax6 : /1, Pax6 heterozygotes as compared to the phenotypes 14.59 mg 6 0.20, n ¼ 78; 1/1, 18.08 mg 6 0.21, n ¼ 68, expressed by Pax612Neu or Pax63Neu heterozygotes (data 13Neu t279 ¼ 12.20, P , 0.0001. Pax6 : /1, 15.25 mg 6 not shown). 0.20, n ¼ 76; 1/1, 18.92 mg 6 0.18, n ¼ 94; t279 ¼ 13.76, Heterozygotes were examined at weaning for the P , 0.0001. The eye weight of Pax611Neu heterozygotes presence of belly spotting: 542 Pax611Neu /1, 256 was significantly less than the eye weights in Pax612Neu Pax612Neu /1, and 381 Pax613Neu /1. No animals Mouse Pax6 Contiguous Gene Deletions 1081

and embryos expressing microphthalmia were observed in an 1:2 ratio (Pax611Neu x2 ¼ 0.56, 0.50 . P . 0.10; Pax612Neu x2 ¼ 0.15, 0.90 . P . 0.50; Pax613Neu x2 ¼ 0.02, 0.975 . P . 0.90), and there was an increase in the number of decidua (Table 2). Thus we hypothesized the mutations to be homozygous lethal at an early post- implantation stage. To determine if the Pax6 gene was affected, we crossed Pax611Neu, Pax612Neu,orPax613Neu heterozygotes with heterozygotes for Pax6 intragenic mutations. In these complementation tests with Pax6, embryos with the typical anophthalmic phenotype were observed (Table 2), which indicates that (a) the Pax611Neu, Pax612Neu, and Pax613Neu mutations do not complement the Pax6 intragenic null mutations for the homozygous anophthalmia phenotype, and (b) the intragenic Pax6 null mutations complement the Pax611Neu, Pax612Neu,and Figure 2.—Slit lamp microscopy documenting eye pheno- Pax613Neu mutations for early embryonic lethality. Finally, types in P35 mice. (A) Pax6 1/1. (B) Pax63Neu /1, an intra- we crossed Pax611Neu, Pax612Neu,andPax613Neu heterozy- genic null mutation expressing microphthalmia, a central 12Neu gotes with each other. We observed wild-type and micro- opacity, lens-corneal adhesion and corneal opacity. (C) Pax6 11Neu 12Neu /1 expressing microphthalmia and total lens opacity. phthalmic embryos in an 1:2 ratio (Pax6 3 Pax6 2 11Neu 13Neu 2 The degree of eye abnormality is similar to that observed in x ¼ 0.11, 0.90 . P . 0.50; Pax6 3 Pax6 x ¼ 0.21, Pax63Neu heterozygotes. (D) Pax611Neu /1 expressing extreme 0.90 . P . 0.50; Pax612Neu 3 Pax613Neu x2 ¼ 0.01, 0.975 . microphthalmia. All eyes were photographed at 323 magni- P . 0.90). There were no anophthalmic embryos and fication. there was an increase in the number of decidua (Table 2). Taken together, the results suggest that the Pax611Neu, expressed belly spotting. All mutations mapped to Chr 2 Pax612Neu,andPax613Neu mutations are multilocus dele- with the locus order (frequency of recombinants be- tions affecting Pax6 and a linked gene or genes respon- tween adjacent loci in parentheses) from the combined sible for early embryonic lethality. results: D2Mit249–(4/308)-Mut-(62/308)-agouti. Microdeletion analysis within the Pax6 region: To Segregation analyses in embryonic stages and com- PCR amplify and sequence across the deletions we first plementation tests among Pax611Neu, Pax612Neu, Pax613Neu, needed to more accurately localize the deletion break- and Pax6 intragenic mutant lines: On the basis of ge- points. Analyses to define the Pax611Neu, Pax612Neu, and nomic position and the eye phenotype associated with Pax613Neu deleted regions were carried out with poly- the mutations, we hypothesized Pax6 to be the affected morphic microsatellite marker sites and the Pax6 gene, gene. We established inter se matings of heterozygotes in FISH cytogenetics, array-CGH, and polymorphic SNP or the Pax611Neu, Pax612Neu,andPax613Neu presumed Pax6 mu- insert/deletion sites (Table S1, Table S2, Table S3, Table tant lines to generate homozygotes for sequence analysis. S4, Table S5, Table S6, Table S7, Table S8, Table S9, Anophthalmic homozygous Pax6 null mutants are easily Table S10, Figure S1). The results were collated to give identified and survive to the perinatal stage. However, the most accurate localization of the deletion break- from the inter se matings in all three mutant lines no points (Table 3). On the basis of these results we were anophthalmic embryos were recovered. Only wild type able to design primers outside of but close to the

TABLE 1 Degree of lens/corneal opacity in eyes of P35 Pax611Neu /1, Pax612Neu /1, Pax613Neu /1, and 1/1 littermates

Phenotype class Extreme Line Genotype 0% 25% 50% 75% 100% microphthalmia Pax611Neu 1/1 119 0 0 1 0 0 Pax611Neu /1 0 0 1 3 21 101 Pax612Neu 1/1 701300 0 Pax612Neu /1 0101131360 Pax613Neu 1/1 940000 0 Pax613Neu /1 0 6 30 29 11 0 1082 J. Favor et al.

TABLE 2 Segregation analysis in E14–E16 embryos in crosses of Pax6 mutant heterozygotes

Implantation sites Phenotype classes of live embryos Mating Litters (n) Live Dead Decidua Wild type Microphthalmia Anophthalmia Pax611Neu /1 3 Pax611Neu /1 14 89 2 45 33 56 0 Pax612Neu /1 3 Pax612Neu /1 8 52 0 16 16 36 0 Pax613Neu /1 3 Pax613Neu /1 7 31 0 17 10 21 0 Pax611Neu /1 3 Pax6 /1a 12 94 0 11 31 48 15 Pax612Neu /1 3 Pax62Neu /1 21602 5 6 5 Pax613Neu /1 3 Pax63Neu /1 21704 6 7 4 Pax611Neu /1 3 Pax612Neu /1 7 39 0 21 14 25 0 Pax611Neu /1 3 Pax613Neu /1 5 38 0 13 14 24 0 Pax612Neu /1 3 Pax613Neu /1 10 55 0 35 18 37 0 Pax63Neu /1 3 Pax63Neu /1 66408 153613 a The complementation crosses of Pax611Neu heterozygotes were with Pax62Neu, Pax63Neu, and Pax6Sey-Neu. deletion breakpoints to amplify and sequence across the were localized to Chr 2 105.001 and 105.541 Mb, re- deletions. spectively. The Pax611Neu deletion is 540,470 bp long, Localization of deletion breakpoints by sequencing: starts proximal to the Rcn1 gene, includes the entire We designed a DNA walking strategy to sequence across Rcn1 and Pax6 genes, and ends in intron 9–10 of the the Pax611Neu deletion. A chimeric sequence that jumped Elp4 gene. Since the Elp4 gene is oriented tail to tail from the region defined by BAC RP23-8C14 to the with the Pax6 gene, the deletion within the Elp4 gene distal region defined by the BAC RP23-431C3 was ob- results in the loss of the 39 end of intron 9–10 and exon tained (Figure 3). The DNA walking results were con- 10. firmed by PCR amplification and sequencing across the For the Pax612Neu deletion, we designed a group of 59 Pax611Neu deletion using genome-specific primers con- and 39 specific primers in nondeleted regions flanking tained in the RP23-8C14 and RP23-431C3 BACs. By the deletion to amplify across the deletion breakpoints. BAC alignment and inspection of the region in the We obtained a PCR amplification product 8000 bp in Ensembl database the proximal and distal breakpoints length, which was used as substrate to sequence. A

TABLE 3 Localization of Chr 2 deleted regions in the mouse

Pax6 deletions BAC Position (Mb)a Pax6Sey-Dey Pax6Sey-H Pax611Neu Pax612Neu Pax613Neu RP24-334I20 104.37 RP23-124B20 104.40 D RP23-189F6 104.51 D RP23198B6 104.65 DD RP23-86J23 104.84 DD RP23-8C14 104.93 DDD RP23-247F16 105.09 DDD RP24-182O5 105.23 DDDD RP23-403K1 105.44 DDDD RP23-431C3 105.45 DDDDD Pax6 105.47 DDDDD RP23-146D23 105.58 DD DD RP24-244B3 105.59 DD RP24-483E9 107.38 DD RP23-35J22 107.41 D RP23-336F11 111.12 D RP23-35G10 111.30 Based on analyses of microsatellite markers, FISH cytogenetics, array CGH and SNPs (Table S1, Table S2, Table S3, Table S4, Table S5, Table S6, Table S7, Table S8, Table S9, Table S10, Figure S1). Triangles indicate a partially or fully deleted BAC. a Proximal end position of the BAC or gene sequence. Mouse Pax6 Contiguous Gene Deletions 1083

Figure 3.—Chr 2 sequences flanking the Pax611Neu, Pax612Neu, and Pax613Neu deletions. The deleted regions are depicted by the black triangles. Pax611Neu: The chimeric sequence across the Pax611Neu deletion contained in the 59 end a portion of genomic sequence defined by the BAC RP23-8C14 joined in the 39 end to a portion of genomic sequence defined by the BAC RP23-431C3. The proximal deletion breakpoint is after the BAC RP23-8C14 position 20,431, and the distal breakpoint is after the BAC RP23-431C3 position 132,356. Pax612Neu: The chimeric sequence across the Pax612Neu deletion contained in the 59 end a portion of genomic sequence defined by the BAC RP23-290H11 joined in the 39 end to a portion of genomic sequence defined by the BAC RP23-35G10. The proximal deletion breakpoint is after the BAC RP23-290H11 position 2388, and the distal breakpoint is after the BAC RP23-35G10 position 5858. Pax613Neu: The chimeric sequence across the Pax613Neu deletion contained in the 59 end a portion of genomic sequence defined by the BAC RP23-431C3 joined in the 39 end to a portion of genomic sequence defined by the BAC RP23-146D23. The proximal deletion breakpoint is after the BAC RP23-431C3 position 78,814, and the distal breakpoint is after the BAC RP23-146D23 position 148,187. chimeric sequence with a 59 region contained within the deletion could be identified to be 237,725 bp long sequence defined by BAC RP23-290H11 and a 39 region with the proximal and distal breakpoints at Chr 2 contained within the sequence defined by the BAC 105.488 and 105.726 Mb, respectively. The deletion RP23-35G10 was observed (Figure 3). By BAC alignment begins within the Pax6 gene in intron 6–7 (canonical and inspection in the Ensembl database the Pax612Neu isoform, ENSMUST00000090397), includes the entire deletion could be identified to be 6.08 Mb in length with Elp4 gene, and ends in intron 2–3 of the Immp1L gene. the proximal and distal breakpoints at Chr 2 105.299 The extent of the deleted regions relative to Pax6 and 111.380 Mb, respectively. The deletion begins distal and closely linked genes for the Pax611Neu, Pax612Neu, and to the Rcn1 gene, includes the Pax6 and Elp4 genes, as Pax613Neu as well as the previously characterized Pax6Sey-Dey well as 17 genes distal to Elp4 (Immp1L, Dph4, Dcdc5, and Pax6Sey-H mutations is schematically depicted in Mppede2, Fshb, Kcna4, Rpl35a, Hadhb, Mett5d1, Kif18a, Figure 4. Bdnf, Lin7c, Lgr4, Cdc34, Bbox1, Slc5a12, and Muc15) and Transcript levels of Rcn1, Pax6, and Elp4, alternative 18 genes within the Olfr gene cluster at Chr 2 111.06– Pax6 isoforms, and Pax6-Immp1L fusion transcript in 111.90 Mb (Olfr1275–Olfr1281, Olfr1283–Olfr1291, Olfr1294, the eyes of Pax6 deletion or intragenic mutant and Olfr1295). heterozygotes: We next measured the transcript levels A series of 59 and 39 primers in nondeleted regions of Pax6 and affected genes closely linked to Pax6 in the flanking Pax613Neu were designed to amplify across the eyes of Pax611Neu, Pax612Neu, Pax613Neu, and Pax63Neu hetero- deletion breakpoints. We obtained a specific PCR zygotes by quantitative real-time RT–PCR (Table 4). The amplification product of 3700 bp in length, which level of Pax6 transcript was significantly reduced in both 11Neu 12Neu we used as a substrate to sequence. A chimeric sequence Pax6 (t6 ¼ 5.69, P ¼ 0.001) and Pax6 (t5 ¼ 4.87, with a 59 region contained within the sequence de- P ¼ 0.002) heterozygotes when compared to homozy- fined by BAC RP23-431C3 and a 39 region contained gous wild type. The level of Pax6 transcript in Pax613Neu within the sequence defined by the BAC RP23-146D23 and Pax63Neu heterozygotes was similar to wild type. The was observed (Figure 3). By BAC alignment and Pax6 probe used for the quantitative real-time RT–PCR inspection in the Ensembl database the Pax613Neu assay is based on an amplicon spanning the Pax6 exon

Figure 4.—Schematic overview of the deleted regions in the Pax6Sey-Dey, Pax6Sey-H, Pax611Neu, Pax612Neu, and the Pax613Neu deletions. Pax6 and the proximal genes Wt1 and Rcn1 as well as the distal genes Elp4 and Immp1L are shown with their proximal end position in Mb (Ensembl build 51). The Pax6Sey-Dey deletion begins most proximal, includes Wt1, Rcn1, Pax6, and Elp4, and is estimated to be 1.2 Mb. The Pax6Sey-H deletion includes Wt1, Rcn1, Pax6, Elp4, and Immp1L, extends much further distally, and is estimated to be 2.9 Mb. The Pax611Neu deletion begins distal to Wt1 and proximal to Rcn1, extends into Elp4, and is 540 kb. Since the Elp4 gene is orientated tail to tail to the Pax6 gene the 39 end of the Elp4 gene is deleted. The Pax612Neu deletion begins distal to Rcn1 and proximal to Pax6, extends furthest distally, and is 6.08 Mb long. The Pax613Neu deletion is 238 kb, begins within intron 6-7 of Pax6, extends through Elp4, and ends within the 59 region of Immp1L. The critical region responsible for the extreme eye phenotype is marked by the broken lines. 1084 J. Favor et al.

TABLE 4 Transcription levels of Pax6, Rcn1, and Elp4 in eyes of P1 mice relative to the expression of Tbp and to total head mRNA

Pax6 Rcn1 Elp4 Genotype Mean SD n Mean SD n Mean SD n

Pax611Neu /1 4.34** 0.07 4 3.10* 0.31 3 2.91** 0.75 3 Pax612Neu /1 4.25** 0.24 3 4.29 0.44 3 3.94** 0.27 3 Pax613Neu /1 6.38 1.62 3 4.95 0.61 3 3.03** 0.21 3 Pax63Neu /1 6.12 0.14 3 4.39 0.35 3 6.12 0.77 3 1/1 6.15 0.63 3 4.58 0.87 3 5.80 0.49 3 Signiﬁcantly different from 1/1:*P , 0.05; **P , 0.01.

3–exon 4 junction. This site within the Pax6 gene is not product was obtained (Figure 5B), indicating that a deleted in Pax613Neu. The observation that the level of Pax6–Immp1L fusion transcript was present. We de- Pax6 transcript in Pax613Neu heterozygotes was similar to signed a series of overlapping primer pairs to amplify wild type suggests that a stable transcript encoded by the and sequence across the predicted fusion transcript. 59 region of Pax6 from the Pax613Neu partial Pax6 deletion Two isoforms were confirmed to be present. The most was present (see below). The Rcn1 transcript level in abundant form corresponded to Pax6 exons 1–6 with- Pax611Neu heterozygotes was significantly less than that out exon 5a fused to Immp1L exons 3–7. Low levels of observed in homozygous wild types (t4 ¼ 2.78, P ¼ Pax6 exons 1–6 including exon 5a fused to Immp1L 0.025). The levels of Rcn1 transcript in Pax612Neu, exons 3–7 were also observed. The fusion results in an Pax613Neu, and Pax63Neu heterozygotes were not different out-of-frame transcript. Translation is predicted to pro- from homozygous wild types. The Elp4 transcript levels ceed through Pax6 exon 6, followed by two tryptophans 11Neu were significantly reduced in Pax6 (t4 ¼ 5.57, P ¼ and a stop codon. Since normal function of Pax6 12Neu 13Neu 0.002), Pax6 (t4 ¼ 13.38, P ¼ 0.002), and Pax6 requires intact paired-, homeo-, and transactivation (t4 ¼ 5.71, P ¼ 0.002) heterozygotes and not different domains, we conclude that the Pax6 activity is abolished in Pax63Neu heterozygotes, as compared to homozygous in the Pax613Neu mutant gene product. It should be noted wild types. The Elp4 probe used for the quantitative real- time RT–PCR assay is based on an amplicon spanning the Elp4 exon 4–exon 5 junction. This region of Elp4 is not deleted in Pax611Neu. The observation that the transcript level of Elp4 in the Pax611Neu heterozygotes was reduced suggests that a transcript encoded by the nondeleted portion of Elp4 in Pax611Neu was not pro- duced or was unstable. We assayed for the presence of the canonical Pax6 transcript (does not contain exon 5a) and the alternatively spliced Pax6 isoform (containing exon 5a) in Pax611Neu, Pax612Neu, Pax613Neu, and Pax63Neu heterozygotes, and in homozygous wild types. For all genotypes, both Pax6 isoforms were present, which suggests that the mutations did not affect alternative splicing (Figure 5, A Figure 5.—Pax6 isoforms and Pax6-Immp1L fusion tran- and B). script in mutant and wild-type eyes of P1 mice. (A) PCR am- The Pax613Neu deletion begins in intron 6–7 of Pax6 plification products of a region of the Pax6 transcript and ends in intron 2–3 of Immp1L. The resulting spanning exon 5a. In all samples both a shorter 182-bp band, genomic rearrangement juxtaposes the Pax6 exon– which represents the amplification of the canonical Pax6 transcript, and a longer 224-bp band, which represents the ampli- intron structure up to exon 6 to the Immp1L exon– fication of the alternatively spliced Pax6(5a) isoform, are intron structure starting at exon 3, with an intervening present, indicating that alternative splicing was not affected fusion intron consisting of the 59 region of Pax6 intron by the deletions. (Lanes 1–3) Pax611Neu /1. (Lanes 4 and 6–7 and the 39 region of Immp1L intron 2–3. To 5) Pax612Neu /1. (Lanes 6–8) Pax6 1/1. (Lanes 9 and 10) 3Neu determine whether a fusion transcript was expressed, Pax6 /1. (B) Pax6 canonical, Pax6(5a) and Pax6-Immp1L fusion transcripts in Pax613Neu heterozygotes. (Lanes 1–3) 9 9 we used a 5 primer specific for Pax6 and a 3 primer Pax613Neu /1 amplified for the region of Pax6 spanning exon specific for Immp1L to assay by PCR amplification of 5a. (Lanes 4–6) Pax613Neu /1 amplified for the predicted cDNA from P1 eyes of Pax613Neu heterozygotes. A 618-bp Pax6-Immp1L fusion transcript. Mouse Pax6 Contiguous Gene Deletions 1085 that the entire ORF of Immp1L is contained within the ment of the five deletions, we may exclude the region fusion transcript, although 59 nontranslated sequences proximal to the proximal breakpoint in the Pax611Neu contained within Immp1L exons 1 and 2 are deleted. deletion, included in the Pax6Sey-Dey and Pax6Sey-H dele- However, we do not know if translation of Immp1L from tions, as responsible for extreme microphthalmia. the fusion transcript occurs. Similarly, we may exclude the extensive region included in the Pax612Neu and Pax613Neu deletions as responsible for extreme microphthalmia. Thus, on the basis of DISCUSSION the analysis of these five deletions, the region defined by We provide genetic, phenotypic, and molecular the proximal breakpoint of the Pax611Neu deletion up to characterizations of three new Pax6 deletions of the the proximal breakpoint of the Pax612Neu deletion is mouse. We were able to sequence across all three responsible for extreme microphthalmia. The region deletions and could exactly identify the deleted regions. contains one gene, reticulocalbin 1 (Rcn1). Rcn1 is a Ca21- These results extend the allelic series for Pax6 deletions binding protein, resident in the endoplasmic reticulum to include Pax6Sey-Dey, Pax6Sey-H, Pax6Sey-2H, Pax6Sey-3H, Pax6Sey-4H, and implicated in the secretory pathway (Ozawa and Pax611Neu, Pax612Neu, and Pax613Neu. More importantly, we Muramatsu 1993; Weis et al. 1994; Ozawa 1995a,b; introduce the first two deletions that are not associated Tachikui et al. 1997). Rcn1 has been shown to be with extreme microphthalmia and the first three dele- expressed in a number of tissues (Fukuda et al. 2007), tions that do not express belly spotting. With the including the eye (present study). Linkage between available panel of five Pax6 deletions (the previously Pax6 and Rcn1 has been conserved among mouse, man, described Pax6Sey-Dey and Pax6Sey-H, as well as the three and fish (Kent et al. 1997; Miles et al. 1998; Kleinjan deletions from the present study) we were able to define et al. 2008). Unfortunately there are no known in- the Chr 2 regions associated with the extreme eye tragenic mutations of the Rcn1/RCN1 genes in mouse phenotype and belly spotting. or man. We are currently in the process of generating a Extreme eye phenotype in Pax6 microdeletions: mutation of Rcn1 to directly test the hypothesis that Since Pax6 is critical for eye formation, our initial Rcn1, when mutated, is either directly or in conjunction hypothesis considered the differences observed in the with a Pax6 mutation responsible for the extreme eye eye phenotypes expressed in the deletions and the phenotype observed in mouse Pax6 deletions that intragenic null mutations to be directly due to the action include the Rcn1 gene. of Pax6 and that Pax6 deletions are functionally differ- An extensive series of PAX6 intragenic mutations has ent from Pax6 intragenic null mutations. Our observa- been identified in humans (http://pax6.hgu.mrc.ac.uk) tions that the Pax612Neu and Pax613Neu deletions do not and a number of contiguous gene deletions encompass- express extreme microphthalmia and the levels of Pax6 ing the PAX6 region have been characterized (van transcription are similarly reduced in the heterozygous Heyningen et al. 1985; Fantes et al. 1992; Drechsler Pax611Neu (extreme microphthalmia) and Pax612Neu (no et al. 1994; Crolla et al. 1997; Chao et al. 2000; extreme eye phenotype) deletions, allowed us to reject Grønskov et al. 2001; Crolla and van Heyningen the hypothesis. 2002; Robinson et al. 2008). We are unaware of any We also considered the possibility that the deletions studies which have compared the extent of the eye may affect alternative splicing of Pax6. There are two abnormalities expressed by carriers of deletions vs. major isoforms expressed in the eye, Pax6 (canonical) intragenic mutant alleles. Such information would be and Pax6 (5a), and a correct ratio of these isoforms is extremely valuable to further test if the region contain- critical for normal eye development (Epstein et al. 1994; ing the RCN1 gene is associated with a more extreme eye Duncan et al. 2000; Singh et al. 2002). However, we did abnormality in PAX6 multilocus deletions. not observe a disturbance in the canonical/5a isoform The Pax613Neu partial deletion of Pax6 results in the ratios in the Pax611Neu heterozygotes expressing extreme expression of a Pax6–Immp1L chimera transcript. The microphthalmia as compared to the ratios seen in the predicted translation product is a truncated Pax6 pro- Pax612Neu, Pax613Neu, and Pax63Neu heterozygotes express- tein, and indeed the eye phenotype associated with ing the milder eye phenotype. Pax613Neu heterozygotes is similar to heterozygotes for Since the levels of Pax6 expression do not correlate intragenic Pax6 mutations leading to premature termi- with the extent of eye phenotype expressed by the Pax6 nation of translation (Hill et al. 1991; Lyon et al. 2000; deletion heterozygotes, we considered our alternative Favor et al. 2001; Graw et al. 2005). Since we did not initial hypothesis, i.e., that a region linked to but distinct observe any unusual phenotypes associated with the from the Pax6 gene is responsible for the extreme eye Pax613Neu deletion, we conclude that the expressed Pax6– phenotype observed in the deletions. Figure 4 depicts Immp1L chimera transcript is not acting as a dominant the extent of the regions surrounding Pax6 affected in negative. five different deletions. Pax6Sey-Dey, Pax6Sey-H, and Pax611Neu Early embryonic lethality: The five well-characterized heterozygotes express extreme microphthalmia, while mouse Pax6 deletions (Figure 4) are all homozygous Pax612Neu and Pax613Neu heterozygotes do not. By align- lethal at an early embryonic stage (Varnum and 1086 J. Favor et al.

Stevens 1974; Theiler et al. 1978; Hogan et al. 1986; homologs of the mouse genes proximal to Rcn1, which Hogan et al. 1987; present study). There are probably a are deleted in the Pax6Sey-H deletion. number of genes within the region which, if their Belly spotting is an easily identifiable trait, and nu- function were ablated, would lead to lethality of the merous independent mutations have been recovered affected animal. Rcn1 has been previously suggested in breeding colonies as well as in radiation or chemical (Kent et al. 1997). Homozygous Wt1 mutant embryos mutagenesis studies (Bult et al. 2008). The fact that die between E13 and E15 (Kreidberg et al. 1993). Dph4 none were mapped to this region of Chr 2 would imply homozygotes die prior to E14.5 when carried on a C3H/ that either a mutation at a potential single gene target HeH genetic background (Webb et al. 2008). Homozy- within this region has not yet been recovered or that a gous Pax6 intragenic null mutations are lethal shortly potential single gene target does not exist. Cattanach after birth. With the available panel of characterized et al. (1993) have shown that chromosomal imbalance mouse deletions we cannot exclude any genes within due to large multilocus deletions are often associated the region responsible for early embryonic lethality. with belly spotting and growth retardation. This may However, our complementation tests between the imply that a multilocus deletion within the Chr 2 region Pax611Neu, Pax612Neu, and Pax613Neu deletions show that and not the deletion of a single gene results in belly loss of Elp4 alone in the Pax611Neu/Pax613Neu compound spotting. heterozygotes results in early embryonic lethality. Elp4 is We thank Brigitta May, Elenore Samson, and Sylvia Wolf for expert located adjacent to Pax6 with conserved linkage from technical assistance; Bahar Sanli-Bonazzi for quantitative real-time mammals to fish (Kleinjan et al. 2002, 2008). Elp4 PCR analyses; Utz Linzner (Institute of Pathology, Helmholtz Zentrum is one subunit within the elongator complex that Mu¨nchen, National Research Center for Environmental Health, functions in transcript elongation (Winkler et al. Neuherberg, Germany) for the synthesis of primers; and Laure Bally-Cuif for critically reading and making valuable suggestions to 2001) and ELP4/Elp4 has been shown to be ubiquitously the manuscript. Research was partially supported by National Insti- expressed in human and mouse tissues (Winkler et al. tutes of Health grant R0-1EY10321 and contract no. CHRX-CT93-0181 2001; Kleinjan et al. 2002). As differentiation pro- from the Commission of the European Communities. gresses, proper embryonic development becomes more dependent on embryonic-derived transcripts. The function and expression pattern of Elp4 would be consistent LITERATURE CITED with our observation that loss of Elp4 leads to early Bartsch, O., W. Wuyts,W.Van Hul,J.T.Hecht,P.Meinecke et al., embryonic lethality. 1996 Delineation of a contiguous gene syndrome with multiple Belly spotting: The five Pax6 deletions included in exostoses, enlarged parietal foramina, craniofacial dysostosis, and mental retardation, caused by deletions in the short arm our comparisons (Figure 4) differentiate for the belly- of chromosome 11. Am. J. Hum. Genet. 58: 734–742. spotting trait. Pax6Sey-Dey and Pax6Sey-H heterozygotes ex- Bre´mond-Gignac, D., J. A. Crolla,H.Copin,A.Guichet,D. press belly spotting, while the Pax611Neu, Pax612Neu, and Bonneau et al., 2005 Combination of WAGR and Potocki- Pax613Neu heterozygotes do not. By alignment of the Shaffer contiguous deletion syndromes in a patient with an 11p11.2-p14 deletion. Eur. J. Hum. Genet. 13: 409–413. deleted regions from the five mutations we may exclude Bult, C. J., J. T. Eppig,J.A.Kadin,J.E.Richardson,J.A.Blake et al., the extensive region between the proximal breakpoint 2008 The Mouse Genome Database (MGD): mouse biology and 11Neu model systems. Nucleic Acids Res. 36: D724–D728. of the Pax6 deletion and the distal breakpoint of the attanach urtenshaw asberry vans 12Neu C , B. M., M. D. B ,C.R and E. P. E , Pax6 deletion to be responsible for belly spotting. 1993 Large deletions and other gross forms of chromosome im- Similarly, we may exclude the region defined by the balance compatible with viability and fertility in the mouse. Nat. proximal breakpoint of the Pax6Sey-Dey deletion through Genet. 3: 56–61. hao uff trong aunders to the proximal breakpoint of the Pax6Sey-H deletion. C , L. Y., V. H ,L.C.S and G. F. S , 2000 Mutation in the PAX6 gene in twenty patients with aniri- Thus, the region responsible for belly spotting is dia. Hum. Mutat. 15: 332–339. between the proximal breakpoint of the Pax6Sey-H de- Crolla, J. A., and V. van Heyningen, 2002 Frequent chromosome letion and the proximal breakpoint of the Pax611Neu aberrations revealed by molecular cytogenetic studies in patients with aniridia. Am. J. Hum. Genet. 71: 1138–1149. deletion. Consistent with this conclusion is the observa- Crolla, J. A., J. E. Cawdery,C.A.O ley,I.D.Young,J.Gray et al., tion that a yeast artificial chromosome containing the 1997 A FISH approach to defining the extent and possible clin- human PAX6 gene as well as the genomic regions 200 kb ical significance of deletions at the WAGR locus. J. Med. Genet. upstream and 200 kb downstream of PAX6 rescues the 34: 207–212. Curto, G. G., J. M. Lara,M.Parrilla,J.Aijoń and A. Velasco, small-eye phenotype but not the belly-spotting pheno- 2007 Modifications of the retina neuronal populations of the type of Pax6Sey-H heterozygotes (Kleinjan et al. 2001, heterozygous mutant small eye mouse, the SeyDey. Brain Res. 2002). Inspection of the genome organization in the 1127: 163–176. D‘Elia, A. V., L. Pellizzari,D.Fabbro,A.Pianta,M.T.Divizia human PAX6 region indicates that the Y593-1 YAC et al., 2007 A deletion 39 to the PAX6 gene in familial aniridia extends upstream of PAX6 to the vicinity of the RCN1 cases. Mol. Vis. 13: 1245–1250. gene. The eye phenotype in Pax6Sey-H heterozygotes was Davis, L. K., K. J. Meyer,D.S.Rudd,A.L.Librant,E.A.Epping rescued by the PAX6 gene contained within the YAC. et al., 2008 Pax6 39 deletion results in aniridia, autism and men- Sey-H tal retardation. Hum. Genet. 123: 371–378. The belly-spotting phenotype was not rescued in Pax6 Drechsler, M., E. J. Meijers-Heijboer,S.Schneider,B.Schurich, heterozygotes because the YAC does not contain the C. Grond-Ginsbach et al., 1994 Molecular analysis of aniridia Mouse Pax6 Contiguous Gene Deletions 1087

patients for deletions involving the Wilms‘ tumor gene. Hum. Kent, J., M. Lee,A.Schedl,S.Boyle,J.Fantes et al., 1997 The re- Genet. 94: 331–338. ticulocalbin gene maps to the WAGR region in human and to the Duncan, M. K., Z. Kozmik,K.Cveklova,J.Piatigorsky and A. Small eye Harwell deletion in mouse. Genomics 42: 260–267. Cvekl, 2000 Overexpression of PAX6(5a) in lens fiber cells re- Kleinjan, D. A., A. Seawright,A.Schedl,R.A.Quinlan,S.Danes sults in cataract and upregulation of a5b1 integrin expression. et al., 2001 Aniridia-associated translocations, DNase hypersen- J. Cell Sci. 113(Pt 18): 3173–3185. sitivity, sequence comparison and transgenic analysis redefine Epstein, J. A., T. Glaser,J.Cai,L.Jepeal,D.S.Walton et al., the functional domain of PAX6. Hum. Mol. Genet. 10: 2049– 1994 Two independent and interactive DNA-binding subdo- 2059. mains of the Pax6 paired domain are regulated by alternative Kleinjan, D. A., A. Seawright,G.Elgar and V. van Heyningen, splicing. Genes Dev. 8: 2022–2034. 2002 Characterization of a novel gene adjacent to PAX6, reveal- Fantes, J. A., W. A. Bickmore,J.M.Fletcher,F.Ballesta,I.M. ing synteny conservation with functional significance. Mamm. Hanson et al., 1992 Submicroscopic deletions at the WAGR lo- Genome 13: 102–107. cus, revealed by nonradioactive in situ hybridization. Am. J. Hum. Kleinjan, D. A., R. M. Bancewicz,P.Gautier,R.Dahm,H.B. Genet. 51: 1286–1294. Schonthaler et al., 2008 Subfunctionalization of duplicated ze- Favor, J., 1983 A comparison of the dominant cataract and reces- brafish pax6 genes by cis-regulatory divergence. PLoS Genet. 4: e29. sive specific-locus mutation rates induced by treatment of male Kreidberg, J. A., H. Sariola,J.M.Loring,M.Maeda,J.Pelletier mice with ethylnitrosourea. Mutat. Res. 110: 367–382. et al., 1993 WT-1 is required for early kidney development. Cell Favor, J., P. Grimes,A.Neuhaüser-Klaus,W.Pretsch and 74: 679–691. auderdale ilensky liver alton D. Stambolian, 1997 The mouse Cat4 locus maps to chro- L , J. D., J. S. W ,E.R.O ,D.S.W and laser mosome 8 and mutants express lens-corneal adhesion. Mamm. T. G , 2000 39 deletions cause aniridia by preventing PAX6 Genome 8: 403–406. gene expression. Proc. Natl. Acad. Sci. USA 97: 13755–13759. igon otocki haffer tickens Favor, J., H. Peters,T.Hermann,W.Schmahl,B.Chatterjee et al., L , A. H., L. P ,L.G.S ,D.S and G. A. vans 2001 Molecular characterization of Pax62Neu through Pax610Neu: E , 1998 Gene for multiple exostoses (EXT2) maps to an extension of the Pax6 allelic series and the identification 11(p11.2p12) and is deleted in patients with a contiguous gene syndrome. Am. J. Med. Genet. 75: 538–540. of two possible hypomorph alleles in the mouse Mus musculus. yon ogani oyd uillot avor Genetics 159: 1689–1700. L , M. F., D. B ,Y.B ,P.G and J. F , Favor, J., C. J. Gloeckner,A.Neuhaüser-Klaus,W.Pretsch,R. 2000 Further genetic analysis of two autosomal dominant andulache mouse eye defects, Ccw and Pax6coop. Mol. Vis. 6: 199–203. S et al., 2008 Relationship of Pax6 activity levels to c aughran ard vans the extent of eye development in the mouse, Mus musculus. M G , J. M., H. B. W and D. G. E , 1995 WAGR syndrome and multiple exostoses in a patient with del(11) Genetics 179: 1345–1355. Francke, U., L. B. Holmes,L.Atkins and V. M. Riccardi, (p11.2p14.2). J. Med. Genet. 32: 823–824. Miles, C., G. Elgar,E.Coles,D.J.Kleinjan,V.van Heyningen 1979 Aniridia-Wilms’ tumor association: evidence for specific et al., 1998 Complete sequencing of the Fugu WAGR region deletion of 11p13. Cytogenet. Cell Genet. 24: 185–192. from WT1 to PAX6: dramatic compaction and conservation of Fryns, J. P., J. Beirinckx,E.De Sutter,J.Derluyn,J.Francois synteny with human chromosome 11p13. Proc. Natl. Acad. Sci. et al., 1981 Aniridia-Wilms’ tumor association and 11p intersti- USA 95: 13068–13072. tial deletion. Eur. J. Pediatr. 136: 91–92. Ozawa, M., 1995a Cloning of a human homologue of mouse retic- Fukuda, T., H. Oyamada,T.Isshiki,M.Maeda,T.Kusakabe et al., ulocalbin reveals conservation of structural domains in the novel 2007 Distribution and variable expression of secretory path- endoplasmic reticulum resident Ca21-binding protein with mul- way protein reticulocalbin in normal human organs and non- tiple EF-hand motifs. J. Biochem. 117: 1113–1119. neoplastic pathological conditions. J. Histochem. Cytochem. Ozawa, M., 1995b Structure of the gene encoding mouse reticulo- 55: 335–345. calbin, a novel endoplasmic reticulum-resident Ca21-binding pro- Glaser, T., W. H. Lewis,G.A.Bruns,P.C.Watkins,C.E.Rogler tein with multiple EF-hand motifs. J. Biochem. 118: 154–160. et al., 1986 The beta-subunit of follicle-stimulating hormone is Ozawa, M., and T. Muramatsu, 1993 Reticulocalbin, a novel endo- deleted in patients with aniridia and Wilms’ tumour, allowing a plasmic reticulum resident Ca21-binding protein with multiple further definition of the WAGR locus. Nature 321: 882–887. laser ane ousman EF-hand motifs and a carboxyl-terminal HDEL sequence. J. Biol. G , T., J. L and D. H , 1990 A mouse model of the Chem. 268: 699–705. aniridia-Wilms tumor deletion syndrome. Science 250: 823–827. otocki haffer laser alton aas P , L., and L. G. S , 1996 Interstitial deletion of G , T., D. S. W and R. L. M , 1992 Genomic structure, 11(p11.2p12): a newly described contiguous gene deletion syn- evolutionary conservation and aniridia mutations in the human drome involving the gene for hereditary multiple exostoses PAX6 gene. Nat. Genet. 2: 232–239. raw o¨ster uk unster aubst (EXT2). Am. J. Med. Genet. 62: 319–325. G , J., J. L ,O.P ,D.M ,N.H et al., Riccardi, V. M., E. Sujansky,A.C.Smith and U. Francke, 2005 Three novel Pax6 alleles in the mouse leading to the same 1978 Chromosomal imbalance in the Aniridia-Wilms’ tumor as- small-eye phenotype caused by different consequences at target sociation: 11p interstitial deletion. Pediatrics 61: 604–610. promoters. Invest. Ophthalmol. Vis. Sci. 46: 4671–4683. Roberts, R. C., 1967 Small eyes—a new dominant eye mutant in the rønskov lsen and edersen arlsen G , K., J. H. O ,A.S ,W.P ,N.C et al., mouse. Genet. Res. 9: 121–122. 2001 Population-based risk estimates of Wilms tumor in spo- Robinson,D.O.,R.J.Howarth,K.A.Williamson,V.van Heyningen, radic aniridia. A comprehensive mutation screening procedure S. J. Beal et al., 2008 Genetic analysis of chromosome 11p13 of PAX6 identifies 80% of mutations in aniridia. Hum. Genet. and the PAX6 gene in a series of 125 cases referred with aniridia. 109: 11–18. Am.J.Med.Genet.146A: 558–569. Hill, R. E., J. Favor,B.L.Hogan,C.C.Ton,G.F.Saunders et al., Schmahl, W., M. Knoedlseder,J.Favor and D. Davidson, 1991 Mouse Small eye results from mutations in a paired-like 1993 Defects of neuronal migration and the pathogenesis of homeobox-containing gene. Nature 354: 522–525. cortical malformations are associated with Small eye (Sey) in Hittner, H. M., V. M. Riccardi and U. Francke, 1979 Aniridia the mouse, a point mutation at the Pax-6-locus. Acta Neuropa- caused by a heritable chromosome 11 deletion. Ophthalmology thol. 86: 126–135. 86: 1173–1183. Shaffer, L. G., J. T. Hecht,D.H.Ledbetter and F. Greenberg, Hogan, B. L., G. Horsburgh,J.Cohen,C.M.Hetherington,G. 1993 Familial interstitial deletion 11(p11.12p12) associated Fisher et al., 1986 Small eyes (Sey): a homozygous lethal muta- with parietal foramina, brachymicrocephaly, and mental retardation on chromosome 2 which affects the differentiation of both tion. Am. J. Med. Genet. 45: 581–583. lens and nasal placodes in the mouse. J. Embryol. Exp. Morphol. Singh, S., R. Mishra,N.A.Arango,J.M.Deng,R.R.Behringer 97: 95–110. et al., 2002 Iris hypoplasia in mice that lack the alternatively Hogan , B. L., C. M. Hetherington and M. F. Lyon, 1987 Allelism spliced Pax6 (5a) isoform. Proc. Natl. Acad. Sci. USA 99: 6812–6815. of small eyes (Sey) with Dickie’s small eye (Dey) on Chromosome Tachikui, H., A. F. Navet and M. Ozawa, 1997 Identification of 2. Mouse News Lett. 77: 135–138. the Ca21-binding domains in reticulocalbin, an endoplasmic re- 1088 J. Favor et al.

ticulum resident Ca21-binding protein with multiple EF-hand Webb, T. R., S. H. Cross,L.McKie,R.Edgar,L.Vizor et al., motifs. J. Biochem. 121: 145–149. 2008 Diphthamide modification of eEF2 requires a J-domain Theiler, K., D. S. Varnum and L. C. Stevens, 1978 Development of protein and is essential for normal development. J. Cell. Sci. Dickie’s small eye, a mutation in the house mouse. Anat. Embry- 121: 3140–3145. eis riffiths amond ol. 155: 81–86. W , K., G. G and A. I. L , 1994 The endoplasmic van Heyningen, V., P. A. Boyd,A.Seawright,J.M.Fletcher,J.A. reticulum calcium-binding protein of 55 kDa is a novel EF-hand Fantes et al., 1985 Molecular analysis of chromosome 11 dele- protein retained in the endoplasmic reticulum by a carboxyl-terminal His-Asp-Glu-Leu motif. J. Biol. Chem. 269: 19142–19150. tions in aniridia-Wilms tumor syndrome. Proc. Natl. Acad. Sci. Winkler, G. S., T. G. Petrakis,S.Ethelberg,M.Tokunaga,H. USA 82: 8592–8596. rdjument romage arnum tevens E -B et al., 2001 RNA polymerase II elongator V , D., and L. C. S , 1974 Dickie’s small eye (Dey). holoenzyme is composed of two discrete subcomplexes. J. Biol. Mouse News Lett. 50: 43. Chem. 276: 32743–32749. akui regato allif lotzbach ailey W , K., G. G ,B.C.B ,C.D.G ,K.A.B Wu, Y. Q., J. L. Badano,C.McCaskill,H.Vogel,L.Potocki et al., et al., 2005 Construction of a natural panel of 11p11.2 deletions 2000 Haploinsufficiency of ALX4 as a potential cause of parietal and further delineation of the critical region involved in Potocki- foramina in the 11p11.2 contiguous gene-deletion syndrome. Shaffer syndrome. Eur. J. Hum. Genet. 13: 528–540. Am. J. Hum. Genet. 67: 1327–1332.

Supporting Information http://www.genetics.org/cgi/content/full/genetics.109.104562/DC1

Analysis of Pax6 Contiguous Gene Deletions in the Mouse, Mus Musculus, Identifies Regions Distinct from Pax6 Responsible for Extreme Small-Eye and Belly-Spotting Phenotypes

Jack Favor, Alan Bradley, Nathalie Conte, Dirk Janik, Walter Pretsch, Peter Reitmeir, Michael Rosemann, Wolfgang Schmahl, Johannes Wienberg and Irmgard Zaus

2 SI J. Favor et al.

FILE S1

Extended Material and Methods, and Results

Deletion analysis by array comparative genomic hybridization (array-CGH): An array of 836 overlapping BACs covering Chr 2 from position Mb 3 to Mb 181 was analysed to characterise the Pax6 deletions. The complete tile path array clone set and detailed information are available at the Sanger website (www.ensembl.org). This array was made and array

CGH was performed essentially as described (Chung et al 2004, Genome Res 14, 188-196).

Briefly, reference and test genomic DNAs were labelled with Cy3-dCTP or Cy5-dCTP using random-primer labelling with a

BioPrime DNA Labeling Kit (Invitrogen, Carlsbad, CA). Un-incorporated nucleotides were removed on sephadex G-50 columns (GE Healthcare BioScience Corp., Piscataway, NJ). Labelled reference and test DNAs were combined, mixed with

250 µg of mouse Cot-1 DNA (Invitrogen) and yeast tRNA (1.2 mg), and precipitated. The samples were resuspended in

ULTRAhyb hybridization buffer (Ambion/Applied Biosystems, Austin, TX), denatured at 70° for 10 min, and incubated at

37° for 60 min. The labelled genomic DNA was added to the slide with a coverslip and was placed in a Slidebooster hybridisation station (Advalytix, Concord, MA) at 37° for 24 hours. Slides were washed in PBS/0.1% Tween 20 for 10 min at room temperature, in 0.1XSSC for 30 min at 55°, and in PBS for 10 min at room temperature and then dried by centrifugation at 150 × g for 5 min.

Hybridised microarrays were scanned using a Packard Biochip ScanArray 5000XL scanner (Packard BioScience, Berkshire,

UK). We performed all CGH experiments in a fluorochrome-reversed pair of two-color hybridizations. For all data points, we obtained quadruple measurements derived from duplicate spots on arrays from both hybridizations. Spot positions were automatically located with Bluefuse software (BlueFuse for microarrays, BlueGnome Ltd, Cambridge, UK). Data transformations were performed using the same software. The log2 ratio of the signal from mutant relative to the signal from wildtype was normalised using the block lowess function. Some spots were excluded based on quality control (QC) values or excessive variability between replicates. Spots with a QC value (defined by Bluefuse) below 0.3 were excluded. Spots in replicates within an array, with a SD greater than 0.2, were excluded. Spots among the replicates of the dye swap experiments with a SD greater than 0.4 were also excluded. Copy number variations were called using a CGH smoothing algorithm (Jong et al 2004, Bioinformatics 20, 3636-3637). The log2 ratio thresholds for calling copy number variation were -

0.3 and 0.3.

Deletion analysis by FISH cytogenetics: BAC clones carried in E. coli from the RP23 and RP24 libraries were used in the FISH experiments. BACs mapping to the Pax6 region were identified from the Ensembl database (Build 35.5, www.ensembl.org) and were purchased from CHORI BacPac Resources (Oakland, CA). A continuous series of overlapping

BACs were selected for the region of about 1 Mb around the Pax6 locus. For mapping of the breakpoint at the distal region of the Pax612Neu deletion an initial series of BACs was selected with 1 Mb distances between neighboring BACs. After narrowing down the breakpoint to 1 Mb further contiguous overlapping BACs were selected for FISH.

A standard DNA extraction from BACs was done by alkaline lysis. About 1 µg of each DNA was labeled either with Biotin- J. Favor et al. 3 SI

dUTP or with Digoxigenin-dUTP by a standard nick translation procedure (90 min, 15°). Probe length was analyzed on a

1% agarose gel. The probes showed the optimal average length of about 300 bp after nick translation. About 100 ng from two alternatively labeled BAC DNAs were co-precipitated together with 1 µg mouse Cot-1 DNA (Roche Biochemicals) and dissolved in 10 µl hybridization buffer (50% formamide, 2xSSC, 10% dextransulfate). The DNA was applied to the chromosomes fixed on a slide, mounted with a cover slip and sealed with rubber cement. Probe DNA and chromosomes were denatured together at 72° for 3 min on a hot plate, and hybridized over night at 37° in a wet chamber.

After hybridization the cover slips were carefully removed and the slides were washed in 2xSSC for 8 min. Slides were then incubated at 70° in 0.4xSSC/0.1% Tween for 1 min and then washed shortly in 4xSSC/0.1% Tween/5% BSA at room temperature. Probe detection used an anti-Digoxigenin antibody coupled with rhodamin and Avidin-FITC, respectively.

Incubation with the antibody and Avidin was for 30 min at 37° in 4xSSC/0.1% Tween/5% BSA followed by washes in

4xSSC/0.1% Tween two times for 10 min. Slides were then stained in DAPI (4',6-Diamidino-2-phenylindole) for 10 min. For microscopy the slides were mounted in antifade solution (Vectashield).

In situ hybridization signals were analyzed on a Zeiss Axioplan II microscope. Each image plane (blue, green and red) was recorded separately with a b/w CCD camera (SenSys, Photometrics). Chromosomes and FISH signals were then displayed in false colors and images were merged on the computer. Camera control, image capture and merging were done with

SmartCapture X software (Digital Scientific, Cambridge, UK).

Deletion analyses with polymorphic SNP sites: We identified a series of SNP or insert/deletion sites which are polymorphic between the strains C3H/HeJ and C57BL/6EL and surround the 5’ and 3’ deletion breakpoints. Briefly, we retrieved the NCBI sequence data of Chr 2 regions defined by a series of BAC ends surrounding the breakpoints as indicated from the array-CGH and FISH results, and designed primers to sequence the BAC ends from genomic DNA of both strain

C3H/HeJ and C57BL/6El. Sites polymorphic between the strains were then sequenced from Pax611Neu and Pax612Neu heterozygotes, in which the deletion mutations were carried over both a wildtype bearing Chr 2 from strain C57BL/6El and a wildtype bearing Chr 2 from strain C3H/HeJ. A site was determined to be not deleted if a double peak at the position of the polymorphic site was observed in the sequence from the mutation heterozygote carried over the wildtype bearing Chr 2 from strain C57BL/6El. A polymorphic site was shown to be deleted if a single peak was observed in the sequence results for the mutation carried over both the C57BL/6El and C3H/HeJ wildtype bearing Chr 2, and the allele observed at the site always corresponded to the allele from the wildtype bearing Chr 2 in the heterozygote construct. The deletion analysis using

BAC end sequences above yielded a more accurate localisation of the deletion breakpoints.

We identified BAC sequences which covered the critical regions of the deletion breakpoints (i.e. one end sequence deleted and the other end sequence not deleted), sequenced regions across each of these BACs from strains C3H/HeJ and

C57BL6/J, and identified sites polymorphic between the inbred strains. For the Pax613Neu mutation we sequenced regions across a series of BACs covering the Pax6 gene and the neighboring 5’ and 3’ regions to identify polymorphic sites between the strains C3H/HeJ and C57BL/6. Sites polymorphic between the strains were then sequenced from Pax611Neu, Pax612Neu and

Pax613Neu heterozygotes, in which the deletion mutations were carried over both a wildtype bearing Chr 2 from strain 4 SI J. Favor et al.

C57BL/6El and a wildtype bearing Chr 2 from strain C3H/HeJ, and assessed as being deleted or not deleted as above.

Explanation of the results for the deletion analyses with polymorphic SNP sites: The proximal and distal breakpoints of the Pax611Neu deletion were localized by first sequencing for polymorphic sites contained within BAC end sequences over the Chr 2 region Mb 104.83 – 105.76. The proximal breakpoint was shown to be in the region Chr 2 Mb

104.93 – 104.96 defined by the BAC RP23-8C14 for which the 5’ end sequence was not deleted and the 3’ end was deleted

(data not shown). By sequencing for a series of polymorphic sites across the sequence defined by the BAC RP23-8C14, the proximal breakpoint could be more accurately localized to a 634 base region between the polymorphic sites at position

19,723 and 20,357 (Table S4). The distal breakpoint of the Pax611Neu deletion was shown to be within the Chr 2 region Mb

105.43 – 105.76 defined by the BAC RP23-431C3 for which the 5’ end was deleted and the 3’ end was not deleted (data not shown). By sequencing for a series of polymorphic sites contained within the genomic sequence defined by the BAC RP23-

431C3, the distal breakpoint was localized within a 462 base region between the polymorphic sites at positions 132,729 and

133,191 (Table S5).

The proximal and distal breakpoints of the Pax612Neu deletion were localized by sequencing for polymorphic sites contained within BAC end sequences over the Chr 2 region Mb 105.12 – 112.54. The proximal breakpoint was shown to be within the

Chr 2 region Mb 105.30 – 105.46, defined by the BAC RP23-444H3 3’ end sequence not deleted (position of the most 3’

SNP site was at 179692) and the BAC RP23-290H11 3’ end sequence deleted. We sequenced for a series of polymorphic sites contained within the sequence defined by the BAC RP23-290H11 and determined that the most 5’ polymorphic site to be deleted was at position 2397 (Table S6). The sequencing results 5’ to this site were problematical and apparently due to unspecific amplification products. By BAC alignment and inspection of the region in the Ensembl database we could conclude that the proximal deletion breakpoint is contained within a 2548 base region defined by the polymorphic site in

RP23-444H3 at position 179692 (not deleted) and the polymorphic site at position 2397 in RP23-290H11 (deleted). The results to localise the distal breakpoint of the Pax612Neu deletion from the FISH cytogenetics and array-CGH were contradictory. The FISH cytogenetic analysis indicated that the genomic sequence defined by the BAC RP23-336F11 was deleted whereas the array-CGH results indicated this region to be not deleted. We analysed polymorphic sites over the sequence defined by this BAC and results indicated that the Pax612Neu deletion covered all polymorphic sites analysed (Table

S7). An analysis of polymorphic sites in the neighboring distal genomic region defined by the BAC RP23-35G10 indicated that all polymorphic sites were not deleted (Table S8). By BAC alignment and inspection in the Ensembl database the distal breakpoint of the Pax612Neu deletion could be localised within a 9275 base sequence defined by the last polymorphic site in the

BAC RP23-336F11 shown to be deleted (position 210,658) and the first polymorphic site in the BAC RP23-35G10 shown to be not deleted (position 9,097).

The proximal breakpoint of the Pax613Neu deletion was localized by sequencing for a series of polymorphic sites across the genomic sequences defined by the BACs RP23-290H11 (Chr 2 Mb 105.25 – 105.46) and RP23-431C3 (Chr 2 Mb 105.43 –

105.76). All polymorphic sites in the genomic region defined by the BAC RP23-290H11 were shown to be not deleted (data not shown). The proximal breakpoint was shown to be in the sequence defined by BAC RP23-431C3 within a 583 base J. Favor et al. 5 SI

region between the polymorphic sites at positions 76,948 and 77,531 (Table S9). The distal breakpoint of the Pax613Neu deletion was localized to a 511 base region in the genomic sequence defined by BAC RP23-146D23 (Chr 2 Mb 105.58 –

105.78) between the polymorphic sites at positions 148,218 and 148,729 (Table S10).

6 SI J. Favor et al.

FIGURE S1.—CGH plots of the log2 of the ratio of the hybridization signal of genomic DNA to mouse Chr 2 BACs from heterozygous Pax6 deletion mutants relative to the hybridization signal from C3H wildtype. For all four Pax6 deletion mutants analysed a distinct region surrounding the Pax6 Chr 2 region displayed a series of overlapping BACs with log2 ratios lower than the copy number call threshold of -0.3. The Pax612Neu deletion was estimated to be the longest (~5.8 Mb) and the Pax611Neu deletion the shortest (~ 450 kb) of the four deletions analysed. J. Favor et al. 7 SI

TABLE S1

Deletion analysis of the mouse Pax611Neu, Pax612Neu and Pax613Neu mutations for Pax6 and flanking Chr 2

microsatellite markers

Marker Locationa Pax6 Deletionsb Pax611Neu Pax612Neu Pax613Neu

D2Mit42 104.41 not deleted not deleted not deleted D2Mit387 105.06 ∆ not deleted not deleted D2Mit44 105.11 ∆ not deleted not deleted D2Mit442 105.16 ∆ not deleted not deleted D2Mit185 105.30 ∆ not deleted not deleted Pax6 105.47 ∆ ∆ ∆ D2Mit128 106.12 not deleted ∆ not deleted D2Mit100 106.34 not deleted ∆ not deleted D2Mit58 108.06 not deleted ∆ not deleted D2Mit480 109.75 not deleted ∆ not deleted D2Mit482 110.89 not deleted ∆ not deleted D2Mit163 111.10 not deleted ∆ not deleted D2Mit207 111.99 not deleted not deleted not deleted

a Ensembl build 42 Chr 2 location (Mb). b ∆ = deleted. 8 SI J. Favor et al.

TABLE S2

FISH cytogenetic analysis of Chr 2 in homozygous wildtype or heterozygous Pax611Neu and Pax612Neu mouse

mutants

BAC ID Start (Mb)a End (Mb)a Pax6 Allelesb WT Pax611Neu Pax612Neu

RP23-60E18 3.000 3.245 + + + RP23-74F20 3.890 4.105 + + +

RP23-394K13 104.237 104.404 + + + RP24-313N13 104.367 104.523 + + + RP23-450K1 104.504 104.674 + + + RP23-198B6 104.647 104.844 + + + RP23-232D1 104.831 104.983 + + + RP24-388E5 104.978 105.138 + ∆ + RP24-362E10 105.257 105.426 + ∆ ∆ RP24-371A16 105.291 105.472 + ∆ ∆ RP24-325K21 105.428 105.608 + ∆ ∆ RP23-146D23 105.578 105.774 + + ∆ RP24-387K4 105.799 105.954 + + ∆ RP23-50K11 105.957 106.156 + + ∆ RP23-306B16 106.445 106.653 + nd ∆ RP23-467P7 106.538 106.718 + nd ∆ RP23-416L9 106.664 106.857 + + ∆ RP23-35K10 107.692 107.915 + nd ∆ RP23-206C1 109.046 109.241 + nd ∆ RP23-239G1 110.648 110.835 + nd ∆ RP23-9A5 110.830 111.071 + nd ∆ RP23-303N16 110.862 111.036 + nd ∆ RP23-336F11 111.163 111.376 + nd ∆ RP23-35G10 111.304 111.506 + nd + RP23-88C15 111.506 111.774 + nd + RP24-405C9 111.625 111.796 + nd + RP23-353B17 111.713 111.921 + nd + RP23-63C10 111.904 112.156 + nd + RP23-208E23 112.072 112.282 + + +

a Ensembl build 42 Chr 2 location (Mb). b + = not deleted; ∆ = deleted; nd = not determined. J. Favor et al. 9 SI

TABLE S3

Log2 of the CGH hybridization signals to mouse Chr 2 BACs of genomic DNA from heterozygous Pax6

deletions relative to C3H wildtype

BAC Starta Enda Pax6 Deletionsb

Pax612Neu Pax611Neu Pax6Sey-H Pax6Sey-Dey

RP23-394K13 104.24 104.41 0 0 0 0 RP24-334I20 104.37 104.51 0 0 0 0 RP23-124B20 104.40 104.63 0 0 0 -0.61 RP23-189F6 104.51 104.70 0 0 0 -0.61 RP23-198B6 104.65 104.84 0 0 -0.63 -0.61 RP23-232D1 104.83 104.98 0 0 -0.63 -0.61 RP24-86J23 104.84 105.04 0 0 -0.63 -0.61 RP23-8C14 104.93 105.18 0 -0.56 -0.63 -0.61 RP24-460B2 104.98 105.24 0 -0.56 -0.63 -0.61 RP23-444H3 105.09 105.33 0 -0.56 EXC -0.61 RP23-247F16 105.12 105.30 0 -0.56 -0.63 -0.61 RP24-182O5 105.23 105.46 -0.48 -0.56 -0.63 -0.61 RP23-290H11 105.25 105.46 -0.48 -0.56 -0.63 -0.61 RP23-431C3 105.41 105.59 -0.48 -0.56 -0.63 -0.61 RP23-403K1 105.44 105.65 -0.48 0 -0.63 -0.61 RP24-244B3 105.58 105.77 EXC 0 EXC 0 RP23-146D23 105.59 105.74 -0.48 0 -0.63 0 RP24-86A17 105.67 105.89 -0.48 0 -0.63 0 RP24-225B15 105.70 105.87 -0.48 0 -0.63 0 RP23-245K23 105.76 105.98 -0.48 0 -0.63 0 RP23-191A18 105.92 106.16 -0.48 0 EXC 0 RP23-50K11 105.96 106.16 -0.48 0 -0.63 0 RP23-415G15 106.05 106.25 -0.48 0 -0.63 0 RP23-173C23 106.09 106.29 -0.48 0 -0.63 0 RP23-253D15 106.17 106.38 -0.48 0 -0.63 0 RP24-461O8 106.22 106.35 -0.48 0 -0.63 0 RP23-300H23 106.25 106.51 -0.48 0 -0.63 0 RP24-100A4 106.26 106.48 -0.48 0 -0.63 0 RP23-140I23 106.45 106.63 EXC 0 -0.63 0 RP23-306B16 106.45 106.65 -0.48 0 -0.63 0 RP23-148F7 106.58 106.77 -0.48 0 -0.63 0 RP23-416L9 106.66 106.86 -0.48 0 -0.63 0 RP23-12N7 106.67 106.87 EXC 0 EXC 0 RP23-359M23 106.77 106.95 -0.48 0 -0.63 0 RP23-417K1 107.02 107.22 -0.48 0 -0.63 0 RP24-369N16 107.21 107.36 -0.48 0 -0.63 0 RP24-294K11 107.26 107.42 -0.48 0 -0.63 0 10 SI J. Favor et al.

RP24-483E9 107.38 107.59 -0.48 0 -0.63 0 RP23-35J22 107.41 107.62 EXC 0 0 0 RP23-454N6 107.63 107.79 -0.48 0 0 0 RP23-193A4 107.69 107.92 -0.48 0 0 0 RP24-71G5 107.79 108.03 -0.48 0 0 0 RP24-496D7 107.82 108.00 EXC 0 0 0 RP23-266F4 108.12 108.40 EXC 0 0 0 RP23-176P20 108.14 108.30 -0.48 0 0 0 RP23-444A4 108.28 108.46 -0.48 0 0 0 RP23-226E14 108.38 108.57 -0.48 0 0 0 RP24-170C23 108.41 108.72 -0.48 0 0 0 RP24-135N15 108.42 108.58 -0.48 0 0 0 RP23-405K7 108.61 108.80 -0.48 0 0 0 RP23-469G4 108.76 108.93 -0.48 0 0 0 RP23-450P5 108.88 109.07 -0.48 0 0 0 RP23-206C1 109.05 109.24 -0.48 0 0 0 RP23-248F18 109.14 109.38 -0.48 0 0 0 RP23-70G24 109.25 109.49 -0.48 0 0 0 RP23-393E8 109.40 109.67 -0.48 0 0 0 RP23-207C2 109.52 109.73 -0.48 0 0 0 RP23-184O20 109.68 109.90 -0.48 0 0 0 RP23-431J22 109.75 109.96 -0.48 0 0 0 RP23-300M9 109.90 110.13 -0.48 0 0 0 RP24-331J23 110.41 110.56 EXC 0 0 0 RP23-48D8 110.45 110.68 -0.48 0 0 0 RP23-239G1 110.65 110.84 -0.48 0 0 0 RP23-92H5 110.73 110.91 -0.48 0 0 0 RP24-383G18 111.09 111.27 -0.48 0 0 0 RP23-336F11 111.16 111.38 0 0 0 0 RP23-35G10 111.30 111.51 0 0 0 0

a Ensembl build 42 Chr 2 location (Mb). b EXC denotes excluded. See Material and Methods. J. Favor et al. 11 SI

TABLE S4

Identification of non-deleted and deleted polymorphic sites within the genomic region defined by the BAC

RP23-8C14 (AL672153) to localise the proximal breakpoint of the Pax611Neu deletiona

Site position C57BL/6 C3H/HeJ Pax611Neu -/+

10 239 C A C/A 10 366 A G A/G after 12 146 - insG het 12 218 T A T/A 12 232 G T G/T 12 246 C T C/T 12 258 T Δ het 12 338 T A T/A 12 420 T G T/G 12 423 A T A/T 12 427 A TGA het 12 437 G A G/A 12 456 G T G/T 12 473 T G T/G 12 490 A G A/G 12 546 A G A/G 14 267 C A C/A after 14 312 - insCCGAA het 14 418 A C A/C 14 524 T C T/C 16 281 T Δ het 16 503 C T C/T 16 511 G A G/A 16 531 A T A/T 16 560 T G T/G 16 621 G A G/A 16 639 A G A/G 18 754-55 CA AG het 18 821-22 CC AA het 18 825 T C T/C 18 855 G T G/T 18 898 C T C/T 18 968 A G A/G 18 992 A C A/C 19 107 G A G/A 19 129 T A T/A 19 268 T C T/C 12 SI J. Favor et al.

19 360 C T C/T 19 723 T C T/C 20 357 T A T 20 359 T C T 20 947 T G T 21 156 G A G 21 250 C G C 25 208 C G C after 25 244 - insCTA - 25 264 C A C after 25 300 - insTGA - 25 318 C T C 25 332 T G T 25 523 A G A 25 578 A C A 25 631 A G A 30 365 A T A 30 436 T C T after 30 579 - insA - 30 627 G A G 30 649 G A G 35 147 T C T 35 172 G A G 35 173 C Δ C 35 334 G A G after 35 337 - insACAG -

a A Pax611Neu heterozygote was constructed over a wildtype bearing Chr 2 from strain

C57BL/6. Non-deleted polymorphic sites (positions 10,239 to 19,723) were identified as

carrying the alleles from both C3H/HeJ and C57BL/6. Deleted polymorphic sites (positions

20,357 to 35,337) carry only the C57BL/6 allele. The deleted sites were confirmed by

performing the same analysis of a Pax611Neu heterozygote constructed over a wildtype bearing

Chr 2 from strain C3H/HeJ. In this analysis all deleted sites yielded the C3H/HeJ allele (data

not shown). J. Favor et al. 13 SI

TABLE S5

Identification of non-deleted and deleted polymorphic sites within the genomic region defined by the BAC

RP23-431C3 (AL512589) to localise the distal breakpoint of the Pax611Neu deletiona

Site position C57BL/6 C3H/HeJ Pax611Neu -/+

91 061 C G C 91 066-67 CT Δ CT 91 094 C T C 91 919 C G C after 91 926 - insCAT - 91 964-65 TG CA TG 91 970 T C T 91 978 C T C 91 999 C T C after 92 003 - insGTA - 92 063 C T C 92 152 A G A 92 305 T C T 92 516 C T C after 92 684 - insA - 94 007 G A G 99 941 A G A 100 015 A G A 100 059 T G T 100 155 C T C 106 672 C A C 106 813 G A G 115 885 G C G 115 913 T G T 115 975 A Δ A 116 120 A G A after 131 084 - insC - 132 213 C T C 132 729 A G A 133 191 A G A/G 133 213-14 AA CC het 133 451 G A G/A after 134 264 - insCTGCTG het TGTCTCC 134 309 T C T/C 134 369 C T C/T 134 373 T C T/C 135 168 A G A/G 14 SI J. Favor et al.

135 429 C T C/T 135 440 G A G/A 140 496 C T C/T 140 503 G A G/A 140 540 G A G/A 140 591 C G C/G 140 627 C T C/T 146 363 T G T/G 156 688 T C T/C 156 732 G A G/A 156 742-43 CC Δ het 158 721 G A G/A 158 835-38 ATGT Δ het 163 247 T C T/C 163 284 G A G/A 169 253 T C T/C

a A Pax611Neu heterozygote was constructed over a wildtype bearing Chr 2 from strain C57BL/6. Non-deleted

polymorphic sites (positions 133,191 to 169,253) were identified as carrying the alleles from both C3H/HeJ and

C57BL/6. Deleted polymorphic sites (positions 91,061 to 132,729) carry only the C57BL/6 allele. The deleted

sites were confirmed by performing the same analysis of a Pax611Neu heterozygote constructed over a wildtype

bearing Chr 2 from strain C3H/HeJ. In this analysis all deleted sites yielded the C3H/HeJ allele (data not shown). J. Favor et al. 15 SI

TABLE S6

Identification of non-deleted and deleted polymorphic sites within the genomic region defined by the BAC

RP23-290H11 (AL512582) to localise the proximal breakpoint of the Pax612Neu deletiona

Site position C57BL/6 C3H/HeJ Pax612Neu -/+

2 397 T C T 2 481 T C T 2 505 G A G 2 509 A T A 2 606 G A G 2 636 A C A 2 674 T C T 2 691 C T C 2 755 - insT - 2 781 G A G 2 814 C A C 2 823 G T G 3 060 T C T 3 066 T G T 3 177 T C T 3 307 T A T 3 354 G A G 5 205 G A G 5 240 T C T 5 329 G T G 5 342 T A T 5 432 T C T 6 298 A G A 6 306 G A G 6 348 A G A 6 434-37 ACCA Δ ACCA 6 459 T C T 6 576 G C G 6 652 C T C 6 990 A G A 7 038 A G A after 7 083 - insC - 7 168 G C G 7 189 C A C 10 503-04 TA Δ TA 10 551 C A C 10 573 T C T 16 SI J. Favor et al.

10 591 G A G 10 699 C T C 20 334 T A T 20 349 G C G 30 435 A G A 30 552 A G A 30 566 A C A 30 841 A G A 50 424 - ins - 60 433 A G A 80 623 G A G 80 643 G A G 80 982 G A G 91 031 C T C 101 071 T C T 101 215 G T G 101 217 A G A 101 228 G Δ G 101 314 A G A 101 340 C A C 101 464-65 TT GC TT 101 505 T C T 101 535 T C T 101 546 A G A 110 876 G A G 110 944 A G A 110 995 G T G 111 020 G C G

a A Pax612Neu heterozygote was constructed over a wildtype bearing Chr 2 from strain C57BL/6. Deleted

polymorphic sites carry only the C57BL/6 allele, starting from position 2397 through to the last 3’ site at

position 111,020. The deleted sites were confirmed by performing the same analysis of a Pax612Neu

heterozygote constructed over a wildtype bearing Chr 2 from strain C3H/HeJ. In this analysis all deleted

sites yielded the C3H/HeJ allele (data not shown). J. Favor et al. 17 SI

TABLE S7

Identification of non-deleted and deleted polymorphic sites within the genomic region defined by the BAC

RP23-336F11 (AL731699) to localise the distal breakpoint of the Pax612Neu deletiona

Site position C57BL/6 C3H/HeJ Pax612Neu -/+

21 399 A C A 21 491 G C G 21 589 A G A 31 103 T G T 31 139 G A G 31 167 A G A 31 215 G Δ G 109 911 T A T 110 134 T C T 110 153 A C A 118 585 T A T 118 656 T A T after 118 669 - insA - after 118 884 TTT Δ TTT 118 963 A G A 141 170 A G A after 141 402 - insAC - after 168 829 - insA - 176 859 T Δ T 176 889 A G A 177 071 C G C 177 126 G T G 177 230 C A C 177 338 A T A 184 798 A T A 184 877 T C T 184 981 T G T 184 987 A G A 185 036 A G A 185 045 A C A 185 084 T A T 185 335 T C T 185 344 G A G 193 779 A T A 193 789-90 GT TC GT 193 957 G A G 193 993 C T C 18 SI J. Favor et al.

193 995-96 AG GA AG 193 998 C A C 194 080 A G A 194 101 G T G 194 146 G A G 194 161 G A G 194 173 A G A 194 187 A G A 194 237 A Δ A 194 251 A G A 194 253 A G A 194 263 G A G 194 277 G T G 194 285 T A T 194 295 C G C 194 319 C T C 194 386 A T A 194 427 A G A 194 453 G C G 194 467 A T A 194 471 A C A 199 322 A G A 199 405 A G A after 199 446 ACAGAGAG Δ ACAGAGAG AG AG 199 572 C G C after 199 603 - insTC - 203 787-88 CC TT CC 203 924 A G A 204 053 C T C 204 282 G C G 208 548 G A G 208 584 G A G 208 625 T C T 208 635 T C T 208 666 C T C 208 781 A G A 208 825 G T G 208 861 T C T 208 926 A C A 209 120 T C T 209 193 G A G 210 220 A T A 210 307 A T A 210 315 A T A 210 388 C T C J. Favor et al. 19 SI

210 456 C T C 210 638 C T C 210 658 A T A

a A Pax612Neu heterozygote was constructed over a wildtype bearing Chr 2 from strain C57BL/6. All polymorphic sites carry only the C57BL/6 allele, indicating that the Pax612Neu deletion covers the entire BAC

RP23-336F11. The deleted sites were confirmed by performing the same analysis of a Pax612Neu heterozygote constructed over a wildtype bearing Chr 2 from strain C3H/HeJ. In this analysis all deleted sites yielded the

C3H/HeJ allele (data not shown). 20 SI J. Favor et al.

TABLE S8

Identification of non-deleted and deleted polymorphic sites within the genomic region defined by the BAC

RP23-35G10 (AL732496) to localise the distal breakpoint of the Pax612Neu deletiona

Site position C57BL/6 C3H/HeJ Pax612Neu -/+

9 097 A G A/G 9 098 A T A/T 9 115 T G T/G after 9 464 - insA het 9 527 G A G/A 9 547 C T C/T 9 587-90 GTTT Δ het after 9 850 - insTTTG het 9 874 A T A/T 9 879 A C A/C 14 957 A C A/C 15 010 G A G/A 15 016 T A T/A 15 033 G A G/A 15 188 G A G/A 15 190 G A G/A 15 211 A T A/T after 15 444 - insT het 15 490 G C G/C 15 556 A C A/C 15 569 A T A/T 26 466 G A G/A 26 536 T C T/C 26 547 T G T/G 26 587 C A C/A 26 816 A C A/C 26 876 A T A/T 38 145 A G A/G 38 287 A G A/G 38 314 A C A/C 38 322 T A T/A 38 387 G T G/T 38 509 A G A/G 38 559 A G A/G 38 616 A G A/G after 38 690 - insT het 38 729 T Δ het J. Favor et al. 21 SI

38 792 T C T/C 38 840 T A T/A 38 873 A C A/C 38 910 T G T/G 38 923 A C A/C 38 963 T Δ het 49 608 G A G/A 49 647 A G A/G 49 649 C T C/T 49 682 C T C/T 49 871 A Δ het 49 925 G A G/A 57 790 T A T/A 57 791-93 TTT Δ het 57 802 C A C/A 57 819 G T G/T 57 927 C T C/T 57 937 C T C/T 57 954 C T C/T 58 095 C A C/A 58 108 A G A/G 58 116 G A G/A 58 143 G A G/A 58 175 C T C/T 58 201 G A G/A 58 237 T A T/A 58 239 G A G/A 58 318 T C T/C 58 347 G A G/A

a A Pax612Neu heterozygote was constructed over a wildtype bearing Chr 2 from strain C57BL/6. All polymorphic sites were shown to be not deleted, starting from position 9097 through to the last 3’ site at position 58,347. 22 SI J. Favor et al.

TABLE S9

Identification of non-deleted and deleted polymorphic sites within the genomic region defined by the BAC

RP23-431C3 (AL512589) to localise the proximal breakpoint of the Pax613Neu deletiona

Site position C57BL/6 C3H/HeJ Pax613Neu -/+

63 038 G A G/A 63 406 C T C/T 63 792 T C T/C 64 790 C T C/T 65 497 T G T/G 65 787 C A C/A 66 269 A G A/G 66 384 A G A/G 67 207 G del het 67 216 G A G/A 69 221 G A G/A 70 709 G T G/T 71 003 T G T/G 71 127 G A G/A 73 104 A G A/G 73 916 G A G/A 75 953 - insTA het 76 243 C T C/T 76 839 T C T/C 76 948 G T G/T 77 531 T C T 77 552 C T C 82 699 C T C 82 734 A G A 82 792 A G A 82 862 C del C 87 277 A G A 87 323 T C T 87 454 A G A 87 529 A C A 87 563 C T C 87 567 G A G 87 721 A G A 88 648/49 AA del AA 89 156 A C A 89 237 G A G 90 479 G C G 90 545 A G A J. Favor et al. 23 SI

90 578 A T A 91 061 C G C 91 066-67 CT Δ CT 91 094 C T C 91 919 C G C after 91 926 - insCAT - 91 964-65 TG CA TG 91 970 T C T 91 978 C T C 91 999 C T C after 92 003 - insGTA - 92 063 C T C 92 152 A G A 92 305 T C T 92 516 C T C after 92 684 - insA - 94 007 G A G 99 941 A G A 100 015 A G A 100 059 T G T 100 155 C T C 140 496 C T C 140 503 G A G 140 540 G A G 140 591 C G C 140 627 C T C

a A Pax613Neu heterozygote was constructed over a wildtype bearing Chr 2 from strain C57BL/6. Non- deleted polymorphic sites (positions 63,038 to 76,948) were identified as carrying the alleles from both

C3H/HeJ and C57BL/6. Deleted polymorphic sites (positions 77,531 to 140,627) carry only the

C57BL/6 allele. The deleted sites were confirmed by performing the same analysis of a Pax613Neu heterozygote constructed over a wildtype bearing Chr 2 from strain C3H/HeJ. In this analysis all deleted sites yielded the C3H/HeJ allele (data not shown). 24 SI J. Favor et al.

TABLE S10

Identification of non-deleted and deleted polymorphic sites within the genomic region defined by the BAC

RP23-146D23 (AL590380) to localise the distal breakpoint of the Pax613Neu deletiona

Site position C57BL/6 C3H/HeJ Pax613Neu -/+

3 535 T C T 5 230 G A G 10 165 T C T 13 897 C T C 13 972 C T C 20 673 T C T 21 173 G A G 21 188 A T A 54 564 C T C after 54 580 - ins 19 bp - 54 608 A T A after 54 614 - ins T - 54 816 T C T 100 343 T G T 100 416 C G C 127 262 G A G 127 437 A G A 127 531 G del G 127 710 G A G 139 841 C T C 139 910 A G A 139 966 C T C 139 980 T C T 140 001 A G A 140 086-94 ACACACATA del ACACACATA 140 128 A T A 140 133-38 ATAAAT del ATAAAT 140 329 T A T 145 745 T C T 146 029 C A C after 147 117 - ins A - 147 190 T G T 147 217 C T C 147 432 C T C 147 637 G A G 148 064 T C T 148 218 A G A J. Favor et al. 25 SI

148 729 G A G/A 149 080 G A G/A 150 395 T C T/C 150 521 A G A/G 150 592 G A G/A 151 284 T C T/C

a A Pax613Neu heterozygote was constructed over a wildtype bearing Chr 2 from strain C57BL/6. Non- deleted polymorphic sites (positions 148,729 to 151,284) were identified as carrying the alleles from both

C3H/HeJ and C57BL/6. Deleted polymorphic sites (positions 3,535 to 148,218) carry only the C57BL/6 allele. The deleted sites were confirmed by performing the same analysis of a Pax613Neu heterozygote constructed over a wildtype bearing Chr 2 from strain C3H/HeJ. In this analysis all deleted sites yielded the C3H/HeJ allele (data not shown). 26 SI J. Favor et al.

TABLE S11

Primers used for PCR amplification and sequencing

Region Primer pair Sequence Locationa

RP23-8C14 1L AGCCAGGTTTGGCATCTGGAG 10043 1R CCATTCCCTTTCCTTCTTCCAACC 10672 2L CACTGGTTGTCTCCAACCTCTGG 12076 2R TCCATCTTTGTCCCTGCATTCC 12600 3L GAGATGCCCTGGAAGTCATTGG 14097 3R GGATTTAAATGGAGGGCAGAGCC 14609 4L TGATGGGTACAGCAATCTTGGTTG 16190 4R GCCCAATGGTTGGCTGTGAGTAG 16802 5L TGTGAAGGTGTGGAGAGTTGGAGG 18668 5R TGTGCCTGGCTCCTTTCACTTAG 19147 6L GCTGACCGTGGAAATGTTCAAGTG 19022 6R CCCAGTGCTCTGTCCCAGGC 19811 7L CAGTGGGAGGGATGGCAACTAG 19647 7R AAGTCTCGGGCCTGCAAAGAC 20401 8L GTTTCACTCCCAGATGCCCAGC 20870 8R GCTGTGGGAATGGAGGCTCAAG 21313 9L TGGTGATTCAAATTCAGGTCCTTGG 25173 9R GGAGGTGAGCATCTGCCTCTGC 25636 10L CATTGGCACCAGGCTCTTCAC 30159 10R CCCTTATTGAGGGCAAGGCAGAC 30651 11L TCCTGGCTTTGCATCTTGGGAG 35068 11R TACTTCACCACTGCCGCCAAC 35520

RP23-431C3 49L AGGAGTCAGTCCCTGGCCCTTC 62768 49R CTCGTGGTGTAGAGTGGCGCTG 63920 50L AAGAGGGTGCTAATCCACTGG 64705 50R GAAGTAGTGGAAGCCTGAGGGTGG 65872 51L CCTGGAGGCCCTCTTCGG 66195 51R AAGAGGCATCCTCTCTTTCGTCG 67316 52L TGTGTTCCCTGTCCTGTGGACTC 68148 52R TGCTCTTGGGTAAACCTGCTAGGC 68789 53L GGAGACTCAGACCTTGTGGCCTTG 69106 53R TCATGTCGCGAACAGATACCTCAC 69762 54L GAGCTGAGAGATGGACTGTGGG 70661 54R GATCTCACACATCTGCTCACCGC 71200 55L GGCGCATAATCATCGCCACTG 72907 55R AATTGACTCCAGGAGCCTGTGC 73878 56L TTTCAAAGGCAAATGTTATCCACTCC 75753 56R CCTAAGCCTTCCAGGATTGTACCC 77386 J. Favor et al. 27 SI

57L AAAGCAACAGATGGGCGCAGAC 77167 57R AACCCACCCGCTCTTCTTCCTG 77907 58L TTAGTGAACTCTCCGCCGTCTCTC 82134 58R TCGCATCTGAGCTTCATCCGAG 82998 59L AGTCAGAGCTGGACAGTGAGGGTC 87091 59R CGTGCCTTCTGTACGCAAAGGTC 87893 60L TCACAGTCCAATCATTTTGTGCATC 88520 60R CAGAGTTGGGAGTCAGTGAAGTGCC 89691 61L ACATGCACCCTAGAGAGATGAGCTG 90415 61R TCACCTAAAGCAGCGTTCTCAACC 90903 12L CAGGTGAATCACTCTAGGGCAGTGG 90663 12R TCACCATCAATAGGGTCCGAATTAAG 91298 13L TGTGTGTGTGTTAGCATTTTGAAGGC 91800 13R CCTGCTGTCCTCTAATGGGTTGTG 92410 14L CACCTGATGGCCTCACACTTCC 92273 14R GCCCAGTGTAGCATAAACACGCAC 92828 15L CACAAGTCACCATCATCCCATTGC 93721 15R TGATGGTAATGGGCTCCGTCG 94344 63L GGGATAGGGGATTTTCAGGGG 99781 63R GCAGATGCCTGAAGAGGCCAG 100244 64L TGCATATTCCTTGAACCTTGCTCAG 140425 64R GGGAGACAACCTTTGGTTGGAATC 140887

RP23-290H11 16L GACAGCATTTGCTGTCACCTGAG 1645 16R GGTTCAATTGGTGGTCAACAAGTAG 2404 17L ACTTGTTGACCACCAATTGAACCAG 2406 17R AAACCCCACAAGATCATTAGATGCTG 3424 18L TGTAGTTTCCCTCCTTGTGTTGGAG 5133 18R CCTTCCTGTTTCTGACTGCACCC 5573 19L GGCACACATTTGTAACCACAGAACAG 6208 19R GGGTGGATTCTAGGAAGGGTTCAG 6836 20L TCCTAAATTGTGATCCCTCCCAGTG 6662 20R CCTCTAGGAGAGGAGCGATTGGC 7269 21L GCCCTGTTTCCTGGGACTCCTATC 10396 21R CCTTTGTAGCAGGCAACAGAAGTAACC 10872 22L AGGGCCCCTTGCTTTGAGG 20243 22R TGATTGCCTGTCAGCTACACATAAGG 20783 23L CCCAGGGATGTGTGACATGGAC 30412 23R TGTCAGGCAAAGGGTGCGAAG 30877 24L CCTCCTAACGCTTCCTCCCTTC 50135 24R CCTTGGCCAGAGGAGCAAATTC 50814 25L ACCTGGATGGATGTCTCCTCTCC 60057 25R TTCCAAGGCTCTGATACCACGG 60643 26L CATCCAGTGCAGTGGTCAGGTAAG 80481 26R CCTGAGAGGTTAGCTTTCTCTGCG 91412 27L GGCTCTGCCTGAAACTATTCAGATTC 100995 28 SI J. Favor et al.

27R GGAGAGATTGAGCAGCGGGTAAC 101598 28L TGGATTCAAATCAGGATTCCACAGAC 110566 28R ACAGCTGCCAATGGAAACCCAC 111129

RP23-146D23 65L TGCTGCATTTTGTTTCACTCACTGG 3325 65R TCACTCAGATGCTGGGGCAGAC 3915 66L CCCAGCAGCTTGCAATAGGAAC 5129 66R GGAGTGAATTTGAGACTGGCCTGAG 5743 67L GCCCGAGGGAGAGTCAGCAAG 10098 67R TGAGTCATGCCAGTTTGCCTTTG 10701 68L TGCACATGATCATTCTACTTTGGGC 13619 68R GCAGCCAGTTCTTCAGGCAGG 14069 69L ATATGGCCACTGGCGCTCAGAC 20600 69R GACAGCTGGGTAGGAAGCTTGGC 21275 70L CCCAGGGAACTCATGCACAAGG 54336 70R GGTCTCGTCGTCACGATTTGG 55258 71L TGGGAAGTGAGTCTCAACTGAGGG 100128 71R CAAATTTGCACAGCAATGGCC 101057 72L CCTCTGTCAGGGCAGGTCATCC 127105 72R GCCAACTCGCAGTGGCTTTAG 127839 73L TCCCTGTGAATTTGAGGGCAG 139734 73R CAGCTCCTGTGAGGATAGCACAAATG 140591 74L GACTGTTGGTAGCTAGAGCCCAAGG 145566 74R TGTTTGCAGTCCTGGACCATCC 146447 75L AAGGTGTGCACCACCACCGTC 146889 75R CCCACTGACCAATCATAAGCGG 147717 76L CATCCTCGCTGCGGTCCTTC 147625 76R CAAACTCAGCCAAACATCAAATTCC 148618 77L AACTCTCCAGCTCAAGGGTGGC 150477 77R GTCCACGGGAAGAGCGTACCAG 151094 78L TCACCCAGGCCCACTTTGATATG 150546 78R CCCTCCTGCCTAATCACCTGG 151448

RP23-35G10 42L TGAACCATCCCTGCATCCCTG 9036 42R GGAACAGCCCTTTCATTCTCTTTGG 9964 43L TGGTGGTTTCTCGGTGACTGGAG 14888 43R GGGTTGTTAGGTTCTCTGGAATGCAC 15643 44L GGAAATGCCAGAGCCAGGAAG 26160 44R CACAACACGTACACAAAGCCACAG 27060 45L CCCAAATAGTCCAATAACCTTGTCAGC 38090 45R TCTTGGCTTATTGCCAAGTGATGG 38992 46L TGCCAAAGAACAAGGCAACCAC 49267 46R GCCATGAATTAGGAAGACACATGAAGG 50170 47L AAGGGAGAGAAAGAGGGCCAGAG 57715 47R TGGCACAAGTGAGTAAAGTGGGC 58403

J. Favor et al. 29 SI

Pax6 cDNA 80L ATCGTAGAGCTAGCTCACAGCGG 369 80R TGGGCTATTTTGCTTACAACTT 593

Pax6-Immp1L cDNA Pax6 81L CCGGTTGTCAGATCTGCTACTTCC 56 Immp1L 81R CAGAACACATTACAACACCACCAACG 299 Pax6 82L CTCCATCAGACCCAGGGCAATC 518 Immp1L 82R CATCAGAAAATCTCTGGCCATTTGG 684

Pax611Neu deletion site RP23-8C14 83L TCAGTGTTCCAAGGAGGGCTGT 20177 RP23-431C3 83R TGCTGCAGACGTGCCAAAGAAC 132806

Pax612Neu deletion site RP23-290H11 84L CGGTGCTTCTTAGCTCTTCAAATTTCC 1963 RP23-35G10 84R TGCTCCAAAAACAAGGGCAGCC 6525

Pax613Neu deletion site RP23-431C3 85L GTCCAGGCATCTCCGGTGTC 78621 RP23-146D23 85R CAAACTCAGCCAAACATCAAATTCC 148618

a Location of the initial 5’ base of the primer in the BAC, Pax6 or the Immp1L cDNA sequence.