DOCSLIB.ORG

MAFB Promotes Cancer Stemness and Tumorigenesis In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
MAFB Promotes Cancer Stemness and Tumorigenesis In Published OnlineFirst March 31, 2020; DOI: 10.1158/0008-5472.CAN-19-1764 CANCER RESEARCH | MOLECULAR CELL BIOLOGY MAFB Promotes Cancer Stemness and Tumorigenesis in Osteosarcoma through a Sox9-Mediated Positive Feedback Loop Yanyan Chen1, Tao Wang2, Mengxi Huang1, Qin Liu2, Chao Hu3, Bin Wang2, Dong Han4, Cheng Chen1, Junliang Zhang5, Zhiping Li4, Chao Liu6, Wenbin Lei7, Yue Chang1, Meijuan Wu1, Dan Xiang1, Yitian Chen1, Rui Wang1, Weiqian Huang5, Zengjie Lei1, and Xiaoyuan Chu1 ABSTRACT ◥ Despite the fact that osteosarcoma is one of the most common back activation of MAFB was pivotal to tumorsphere-forming and primary bone malignancies with poor prognosis, the mechanism tumor-initiating capacities of osteosarcoma stem cells. Moreover, behind the pathogenesis of osteosarcoma is only partially known. expression of MAFB and Sox9 was highly correlated in osteosar- Here we characterized differentially expressed genes by extensive coma and associated with disease progression. Combined detection analysis of several publicly available gene expression profile datasets of both MAFB and Sox9 represented a promising prognostic and identified musculoaponeurotic fibrosarcoma oncogene homo- biomarker that stratified a subset of patients with osteosarcoma log B (MAFB) as a key transcriptional regulator in osteosarcoma with shortest overall survival. Taken together, these findings reveal a progression. MAFB was highly expressed in tumor tissues and MAFB–Sox9 reciprocal regulatory axis driving cancer stemness and required for proliferation and tumorigenicity of osteosarcoma cells. malignancy in osteosarcoma and identify novel molecular targets MAFB expression was elevated in osteosarcoma stem cells to that might be therapeutically applicable in clinical settings. maintain their self-renewal potential in vitro and in vivo through upregulation of stem cell regulator Sox9 at the transcriptional level. Significance: Transcription factors MAFB and Sox9 form a Sox9 in turn activated MAFB expression via direct recognition of its positive feedback loop to maintain cell stemness and tumor growth sequence binding enrichment motif on the MAFB locus, thereby in vitro and in vivo, revealing a potential target pathway for forming a positive feedback regulatory loop. Sox9-mediated feed- therapeutic intervention in osteosarcoma. Introduction outcomes of patients with osteosarcoma, with the 5-year survival rate up to 60% to 70%, whereas 20% of patients with osteosarcoma with Osteosarcoma is one of the most common primary malignant bone metastasis continue to have poor prognosis (2). tumors with two incidence peaks, one in adolescence and another in Increasing clinical and experimental evidence indicates that oste- the elderly population, especially those above 75 years of age (1). osarcoma stem cells, which derive from mesenchymal stem cells, may Chemotherapy combined with surgery has greatly improved clinical be the cellular origin of osteosarcomas (3). Cancer stem cells (CSC) share many similar properties with normal stem cells and are primarily responsible for tumorigenesis in many cancers (4, 5). For example, a 1Department of Medical Oncology, Affiliated Jinling Hospital, Medical School of subpopulation of self-renewing osteosarcoma cells, namely CSCs, are 2 Nanjing University, Nanjing, Jiangsu Province, P.R. China. Department of endowed with intrinsic capacities for tumor initiation and drug Gastroenterology, Daping Hospital, Third Military Medical University (Army resistance (3, 6). These CSCs are regulated by several key transcription Medical University), Chongqing, P.R. China. 3Department of Orthopedics, 904 Hospital of PLA, North Xingyuan Road, Beitang District, Wuxi, Jiangsu, P.R. factors and signal pathways, such as Oct3/4, Sox2, Nanog, and China. 4Department of Medical Oncology, Jinling Hospital, Nanjing Clinical Notch (7). Compared with differentiated cancer cells, CSCs are School of Southern Medical University, Nanjing, Jiangsu Province, P.R. China. generally more malignant and are critical determinants of the response 5Department of Orthopedics, Affiliated Jinling Hospital, Medical School of to chemotherapy and radiotherapy, and therefore the eradication of 6 Nanjing University, Nanjing, Jiangsu Province, P.R. China. Department of osteosarcoma stem cells may be an effective treatment strategy (8, 9). Medical Oncology, Jinling Hospital, Nanjing Clinical School of Nanjing Medical V-maf avian musculoaponeurotic fibrosarcoma oncogene homolog University, Nanjing, Jiangsu Province, P.R. China. 7Department of Orthopedics, Tianshui Cooperation of Chinese and Western Medicine Hospital, Tianshui, B (MAFB) is a member of the MAF transcription factor family, fi Gansu Province, P.R. China. containing basic leucine zipper domains that bind to speci c DNA elements (10). The seven MAF members are separated into two classes Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). (small and large MAFs). Small MAF proteins (MAFF, MAFG, and MAFK) have been shown to regulate antioxidant responses (11) Y. Chen, T. Wang, M. Huang, Q. Liu, and C. Hu contributed equally as the co-senior whereas large MAFs (MAFA, c-MAF, and MAFB) each contain a authors of this article. similar transactivation domain and are strongly oncogenic (12, 13). In Corresponding Authors: Zengjie Lei, Jinling Hospital, School of Medicine, the hematopoietic system, MAFB induces myelomonocytic differen- Nanjing University, Nanjing, Jiangsu Province 210000, China. Phone: 8625- 8086-0131; E-mail: [email protected]; and Xiaoyuan Chu, tiation in immortalized myoblasts and macrophage differentiation and [email protected] maturation in mice (14). In podocyte differentiation and the main- tenance of progression, aberrant podocyte foot process formation is Cancer Res 2020;80:2472–83 observed in a MAFB-mutant zebrafish embryo model (14). There is doi: 10.1158/0008-5472.CAN-19-1764 also evidence that MAFB regulates osteoclast genesis and epidermal Ó2020 American Association for Cancer Research. keratinocyte differentiation (15, 16). Upregulation of MAFB increases AACRJournals.org | 2472 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2020 American Association for Cancer Research. Published OnlineFirst March 31, 2020; DOI: 10.1158/0008-5472.CAN-19-1764 MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness the risk of various human pathologies, such as diabetes and athero- Multiple early-passage frozen stocks of each cell line in this study sclerotic disorders (17, 18). In addition, MAFB has been shown to were stored under liquid nitrogen: all cell lines were used in exper- promote tumorigenesis, especially in the transformation of pancreatic imentation for no longer than 10 passages from thaw. Cells were used b cells (13, 19). MAFB chromosomal translocations occur more in the described experiments for approximately 6 months. All cell lines frequently in human myeloma cells, and high expression of MAFB were routinely tested for Mycoplasma contamination using MycoP- is observed in patients with acute leukemia blast, hepatocellular robe Mycoplasma Detection Kit (R&D Systems, Inc.), and any con- carcinoma, and colorectal carcinoma (14, 17). Finally, MAFB has taminated cell line was treated with Plasmocin treatment (InvivoGen), been shown to promote nasopharyngeal carcinoma cell proliferation confirmed by negative detection of Mycoplasma before being used and migration (20). again. The most recent testing was 3 months ago. Here, through high-throughput bioinformatic analysis of publicly available transcriptome datasets we identified MAFB as a novel Lentivirus vectors and cell infection regulator of osteosarcoma tumorigenesis. We demonstrate that MAFB The target gene sequence of small hairpin RNA (shRNA; shMAFB-a: promotes tumorigenesis and self-renewal of osteosarcoma stem cells TACTGGATGGCGAGCAACTACCAGCAGAT, shMAFB-b: TCA via a Sox9-mediated feedback activation loop, which could be CCAAGGACGAGGTGATCCGCCTGAAG, shSox9-a: GTGCGCG- exploited to eliminate the culprit cells in osteosarcoma. TCAACGGCTCCAGCAAGAACAA, shSox9-b: CAGCGAACGCA- CATCAAGACGGAGCAGCT) was cloned into the pLVT-Vector (SBO Medical Biotechnology) and was used for the generation of Materials and Methods lentiviruses, which were mixed with lentiviral transfection enhancer Collection and processing of microarray gene expression data (Sigma-Aldrich) and applied to indicated cell lines. Puromycin was Microarray gene expression data of 10 normal and 107 osteosar- then used to select and establish stable expression or knockdown coma tissue samples were extracted from six datasets in the gene cell lines. expression omnibus (GEO) database: GSE14359, GSE16088, GSE16091, GSE14827, GSE12865, and GSE73166. The intersection Western blotting genes of these three platforms were identified (11,808 genes). Combat Total protein was extracted from osteosarcoma cell lines and clinical function was used for removing batch effects in high-throughput samples using M-PER Mammalian Protein Extraction Reagent experiments, the robust multiarray average (RMA) method was used (Thermo Fisher Scientific). Whole cell lysates were separated by for data normalization using R software (R Foundation), and the SDS-PAGE and transferred to nitrocellulose membrane (Bio-Rad). limma package (R Foundation) was used to analyze differently Membranes were blocked with 5% skim milk or BSA and then expressed genes. incubated with primary antibodies (see Supplementary Table S1A) and subsequently with secondary antibodies
Load more

Recommended publications
  • Loss of Mafb and Maf Distorts Myeloid Cell Ratios and Disrupts Fetal Mouse Testis Vascularization and Organogenesisǂ
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Loss of Mafb and Maf distorts myeloid cell ratios and disrupts fetal mouse testis vascularization and organogenesisǂ 5 Shu-Yun Li1,5, Xiaowei Gu1,5, Anna Heinrich1, Emily G. Hurley1,2,3, Blanche Capel4, and Tony DeFalco1,2* 1Division of Reproductive Sciences, Cincinnati Children’s Hospital Medical Center, Cincinnati, 10 OH 45229, USA 2Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 3Department of Obstetrics and Gynecology, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 15 4Department of Cell Biology, Duke University Medical Center, Durham, NC 27710 USA 5These authors contributed equally to this work. ǂThis work was supported by the National Institutes of Health (R37HD039963 to BC, R35GM119458 to TD, R01HD094698 to TD, F32HD058433 to TD); March of Dimes (1-FY10- 355 to BC, Basil O’Connor Starter Scholar Award 5-FY14-32 to TD); Lalor Foundation 20 (postdoctoral fellowship to SL); and Cincinnati Children’s Hospital Medical Center (Research Innovation and Pilot funding, Trustee Award, and developmental funds to TD). *Corresponding Author: Tony DeFalco E-mail: [email protected] 25 Address: Division of Reproductive Sciences Cincinnati Children’s Hospital Medical Center 3333 Burnet Avenue, MLC 7045 Cincinnati, OH 45229 USA Phone: +1-513-803-3988 30 Fax: +1-513-803-1160 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021.
    [Show full text]
  • RBP-J Signaling − Cells Through Notch Novel IRF8-Controlled
    Sca-1+Lin−CD117− Mesenchymal Stem/Stromal Cells Induce the Generation of Novel IRF8-Controlled Regulatory Dendritic Cells through Notch −RBP-J Signaling This information is current as of September 25, 2021. Xingxia Liu, Shaoda Ren, Chaozhuo Ge, Kai Cheng, Martin Zenke, Armand Keating and Robert C. H. Zhao J Immunol 2015; 194:4298-4308; Prepublished online 30 March 2015; doi: 10.4049/jimmunol.1402641 Downloaded from http://www.jimmunol.org/content/194/9/4298 Supplementary http://www.jimmunol.org/content/suppl/2015/03/28/jimmunol.140264 http://www.jimmunol.org/ Material 1.DCSupplemental References This article cites 59 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/194/9/4298.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 25, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Sca-1+Lin2CD1172 Mesenchymal Stem/Stromal Cells Induce the Generation of Novel IRF8-Controlled Regulatory Dendritic Cells through Notch–RBP-J Signaling Xingxia Liu,*,1 Shaoda Ren,*,1 Chaozhuo Ge,* Kai Cheng,* Martin Zenke,† Armand Keating,‡,x and Robert C.
    [Show full text]
  • Lncrna MAFG-AS1 Promotes the Aggressiveness of Breast Carcinoma Through Regulating Mir-339-5P/MMP15
    European Review for Medical and Pharmacological Sciences 2019; 23: 2838-2846 LncRNA MAFG-AS1 promotes the aggressiveness of breast carcinoma through regulating miR-339-5p/MMP15 H. LI1, G.-Y. ZHANG2, C.-H. PAN3, X.-Y. ZHANG1, X.-Y. SU4 1Department of Obstetrics and Gynecology, Shandong Jiyang Public Hospital, Ji’nan, Shandong, China 2Department of Anesthesiology, Shandong Jiyang Public Hospital, Ji’nan, Shandong, China 3Department of Obstetrics and Gynecology, LanCun central hospital, Jimo, Shandong, China 4Department of Critical Care Medicine, Tai’an Central Hospital, Tai’an, Shandong, China Abstract. – OBJECTIVE: The main purposes of and is the leading cause of cancer-related deaths this study are to investigate the possible effects worldwide1. Recently, treatment strategies, such of long noncoding RNAs (lncRNAs) MAFG-AS1 on as chemotherapy, radiotherapy and molecular tar- the growth and metastasis of breast carcinoma. PATIENTS AND METHODS: geting treatment significantly improve the thera- The quantitative 2 Real Time-Polymerase Chain Reaction (qRT- peutic outcome of patients . However, the clinical PCR) assay was used to assess the MAFG-AS1 outcome of patients with breast cancer needs to level in breast cancer tissues and cells. The improve. The metastasis of cancer cells is one ma- wound healing and transwell invasion analy- jor difficulty of overcoming the poor prognosis of sis were applied to explore the invasion and mi- breast cancer patients. The epithelial-mesenchy- gration of breast cancer cell in vitro. The ex- mal transition (EMT) process of cancer cells is a pressions of epithelial-mesenchymal transition 3,4 (EMT) related markers were determined by West- crucial step during metastasis .
    [Show full text]
  • Reconstruction of the Global Neural Crest Gene Regulatory Network in Vivo
    Reconstruction of the global neural crest gene regulatory network in vivo Ruth M Williams1, Ivan Candido-Ferreira1, Emmanouela Repapi2, Daria Gavriouchkina1,4, Upeka Senanayake1, Jelena Telenius2,3, Stephen Taylor2, Jim Hughes2,3, and Tatjana Sauka-Spengler1,∗ Supplemental Material ∗Lead and corresponding author: Tatjana Sauka-Spengler ([email protected]) 1University of Oxford, MRC Weatherall Institute of Molecular Medicine, Radcliffe Department of Medicine, Oxford, OX3 9DS, UK 2University of Oxford, MRC Centre for Computational Biology, MRC Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK 3University of Oxford, MRC Molecular Haematology Unit, MRC Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK 4Present Address: Okinawa Institute of Science and Technology, Molecular Genetics Unit, Onna, 904-0495, Japan A 25 25 25 25 25 20 20 20 20 20 15 15 15 15 15 10 10 10 10 10 log2(R1_5-6ss) log2(R1_5-6ss) log2(R1_8-10ss) log2(R1_8-10ss) log2(R1_non-NC) 5 5 5 5 5 0 r=0.92 0 r=0.99 0 r=0.96 0 r=0.99 0 r=0.96 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 log2(R2_non-NC) log2(R2_5-6ss) log2(R3_5-6ss) log2(R2_8-10ss) log2(R3_8-10ss) 25 25 25 25 25 20 20 20 20 20 15 15 15 15 15 10 10 10 10 10 log2(R1_5-6ss) log2(R2_5-6ss) log2(R1_8-10ss) log2(R2_8-10ss) log2(R1_non-NC) 5 5 5 5 5 0 r=0.94 0 r=0.96 0 r=0.95 0 r=0.96 0 r=0.95 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 log2(R3_non-NC) log2(R4_5-6ss) log2(R3_5-6ss) log2(R4_8-10ss) log2(R3_8-10ss)
    [Show full text]
  • Tomo-Seq Identifies SOX9 As a Key Regulator of Cardiac Fibrosis During Ischemic Injury
    myocardial myocardial Eva van ◼ osis fibr SOX9 transcription ◼ PhD* PhD PhD PhD MSc, PhD naarden, MSc, PhD naarden, PhD* ventricular remodeling Correspondence to: Correspondence Rooij, MSc, PhD, Hubrecht Department of Institute, KNAW University Medical Cardiology, Uppsalalaan 8, Center Utrecht, The Netherlands. 3584CT Utrecht, E-mail [email protected] of Funding, see page 1408 Sources Key Words: ischemia ◼ © 2017 American Heart Association, Inc. *Drs. Lacraz and Junker contributed equally. Grégory P.A. Lacraz, MSc, P.A. Grégory MSc, Jan Philipp Junker, Monika M. Gladka, MSc, MSc Bas Molenaar, Scholman, MSc Koen T. MSc Marta Vigil-Garcia, BS Danielle Versteeg, BS Hesther de Ruiter, MSc, Vermunt, Marit W. MSc, Creyghton, Menno P. Manon M.H. Huibers, Nicolaas de Jonge, MD Alexander van Oude- Eva van Rooij, MSc, PhD 2017;136:1396–1409. DOI: 10.1161/CIRCULATIONAHA.117.027832 DOI: 2017;136:1396–1409. Circulation. blunted the cardiac fibrotic fibrotic blunted the cardiac Sox9 ). Subsequent correlation analysis allowed). Subsequent correlation Serca2 Editorial, see p 1410 , and Nppa Based on the exact local expression cues, tomo-seq can Based on the exact local expression Cardiac ischemic injury induces a pathological remodeling ischemic injury induces a pathological remodeling Cardiac , Although genome-wide transcriptome analysis on diseased tissues Tracing transcriptional differences with a high spatial resolution with a high spatial resolution transcriptional differences Tracing Col1a2 October 10, 2017 October 10, 1396 CONCLUSIONS: novel genes and key transcription factors involved in specific serve to reveal able to unveil the Using tomo-seq, we were remodeling. aspects of cardiac pointing fibrosis, of cardiac of SOX9 as a key regulator unknown relevance fibrosis.
    [Show full text]
  • SGS-Safeguards 04910- Minimum Wages Increased in Jiangsu -EN-10
    SAFEGUARDS SGS CONSUMER TESTING SERVICES CORPORATE SOCIAL RESPONSIILITY SOLUTIONS NO. 049/10 MARCH 2010 MINIMUM WAGES INCREASED IN JIANGSU Jiangsu becomes the first province to raise minimum wages in China in 2010, with an average increase of over 12% effective from 1 February 2010. Since 2008, many local governments have deferred the plan of adjusting minimum wages due to the financial crisis. As economic results are improving, the government of Jiangsu Province has decided to raise the minimum wages. On January 23, 2010, the Department of Human Resources and Social Security of Jiangsu Province declared that the minimum wages in Jiangsu Province would be increased from February 1, 2010 according to Interim Provisions on Minimum Wages of Enterprises in Jiangsu Province and Minimum Wages Standard issued by the central government. Adjustment of minimum wages in Jiangsu Province The minimum wages do not include: Adjusted minimum wages: • Overtime payment; • Monthly minimum wages: • Allowances given for the Areas under the first category (please refer to the table on next page): middle shift, night shift, and 960 yuan/month; work in particular environments Areas under the second category: 790 yuan/month; such as high or low Areas under the third category: 670 yuan/month temperature, underground • Hourly minimum wages: operations, toxicity and other Areas under the first category: 7.8 yuan/hour; potentially harmful Areas under the second category: 6.4 yuan/hour; environments; Areas under the third category: 5.4 yuan/hour. • The welfare prescribed in the laws and regulations. CORPORATE SOCIAL RESPONSIILITY SOLUTIONS NO. 049/10 MARCH 2010 P.2 Hourly minimum wages are calculated on the basis of the announced monthly minimum wages, taking into account: • The basic pension insurance premiums and the basic medical insurance premiums that shall be paid by the employers.
    [Show full text]
  • C/EBP Creates Elite Cells for Ipsc Reprogramming by Upregulating
    ARTICLES C/EBPα creates elite cells for iPSC reprogramming by upregulating Klf4 and increasing the levels of Lsd1 and Brd4 Bruno Di Stefano1,2,8,9,10, Samuel Collombet3,8, Janus Schou Jakobsen4,5,6,8, Michael Wierer7, Jose Luis Sardina1,2, Andreas Lackner1,2,9, Ralph Stadhouders1,2, Carolina Segura-Morales1,2, Mirko Francesconi1,2, Francesco Limone1,2, Matthias Mann7, Bo Porse4,5,6, Denis Thieffry3 and Thomas Graf1,2,10 Reprogramming somatic cells into induced pluripotent stem cells (iPSCs) is typically inefficient and has been explained by elite-cell and stochastic models. We recently reported that B cells exposed to a pulse of C/EBPα (Bα0 cells) behave as elite cells, in that they can be rapidly and efficiently reprogrammed into iPSCs by the Yamanaka factors OSKM. Here we show that C/EBPα post-transcriptionally increases the abundance of several hundred proteins, including Lsd1, Hdac1, Brd4, Med1 and Cdk9, components of chromatin-modifying complexes present at super-enhancers. Lsd1 was found to be required for B cell gene silencing and Brd4 for the activation of the pluripotency program. C/EBPα also promotes chromatin accessibility in pluripotent cells and upregulates Klf4 by binding to two haematopoietic enhancers. Bα0 cells share many properties with granulocyte/macrophage progenitors, naturally occurring elite cells that are obligate targets for leukaemic transformation, whose formation strictly requires C/EBPα. The ability to reprogram somatic into pluripotent cells has revolu- complex process, where multiple players synergistically establish new tionized stem cell research with major implications for almost all transcriptional networks and remove epigenetic barriers14. Among the fields of modern biology.
    [Show full text]
  • Picosecond-Hetero-FRET Microscopy to Probe Protein-Protein Interactions in Live Cells
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector 3570 Biophysical Journal Volume 83 December 2002 3570–3577 Picosecond-Hetero-FRET Microscopy to Probe Protein-Protein Interactions in Live Cells Marc Tramier,* Isabelle Gautier,* Tristan Piolot,† Sylvie Ravalet,‡ Klaus Kemnitz,† Jacques Coppey,* Christiane Durieux,* Vincent Mignotte,‡ and Maı¨te´ Coppey-Moisan* *Institut Jacques Monod, UMR 7592, CNRS, Universite´s P6/P7, 75251 Paris Cedex 05, France; †EuroPhoton GmbH, D-12247, Berlin, Germany; and ‡ICGM, Department of Hematology, Maternite´ Port-Royal, 75014 Paris, France ABSTRACT By using a novel time- and space-correlated single-photon counting detector, we show that fluorescence resonance energy transfer (FRET) between cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) fused to herpes simplex virus thymidine kinase (TK) monomers can be used to reveal homodimerization of TK in the nucleus and cytoplasm of live cells. However, the quantification of energy transfer was limited by the intrinsic biexponential fluorescence decay of the donor CFP (lifetimes of 1.3 Ϯ 0.2 ns and 3.8 Ϯ 0.4 ns) and by the possibility of homodimer formation between two TK-CFP. In contrast, the heterodimerization of the transcriptional factor NF-E2 in the nucleus of live cells was quantified from the analysis of the fluorescence decays of GFP in terms of 1) FRET efficiency between GFP and DsRed chromophores fused to p45 and MafG, respectively, the two subunits of NF-E2 (which corresponds to an interchromophoric distance of 39 Ϯ 1 Å); and 2) fractions of GFP-p45 bound to DsRed-MafG (constant in the nucleus, varying in the range of 20% to 70% from cell to cell).
    [Show full text]
  • The Versatile Functions of Sox9 in Development, Stem Cells, And
    Genes & Diseases (2014) 1, 149e161 HOSTED BY Available online at www.sciencedirect.com ScienceDirect journal homepage: http://ees.elsevier.com/gendis/default.asp REVIEW ARTICLE The versatile functions of Sox9 in development, stem cells, and human diseases Alice Jo a, Sahitya Denduluri a, Bosi Zhang a, Zhongliang Wang a,b, Liangjun Yin a,b, Zhengjian Yan a,b, Richard Kang a, Lewis L. Shi a, James Mok a, Michael J. Lee a, Rex C. Haydon a,* a Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, IL 60637, USA b Departments of Orthopaedic Surgery, The Affiliated Hospitals of Chongqing Medical University, Chongqing 400046, China Received 3 September 2014; accepted 6 September 2014 Available online 16 October 2014 KEYWORDS Abstract The transcription factor Sox9 was first discoveredinpatientswithcampomelic Development; dysplasia, a haploinsufficiency disorder with skeletal deformities caused by dysregulation of Sox9; Sox9 expression during chondrogenesis. Since then, its role as a cell fate determiner during Stem cells; embryonic development has been well characterized; Sox9 expression differentiates cells Transcription factor derived from all three germ layers into a large variety of specialized tissues and organs. How- ever, recent data has shown that ectoderm- and endoderm-derived tissues continue to express Sox9 in mature organs and stem cell pools, suggesting its role in cell maintenance and speci- fication during adult life. The versatility of Sox9 may be explained by a combination of post- transcriptional modifications, binding partners, and the tissue type in which it is expressed. Considering its importance during both development and adult life, it follows that dysregula- tion of Sox9 has been implicated in various congenital and acquired diseases, including fibrosis and cancer.
    [Show full text]
  • 2014 ANNUAL REPORT 1 BANK of NINGBO Co.,Ltd 2 2014 ANNUAL REPORT 3 BANK of NINGBO Co.,Ltd 1
    2014 ANNUAL REPORT 1 BANK OF NINGBO Co.,Ltd 2 2014 ANNUAL REPORT 3 BANK OF NINGBO Co.,Ltd 1 Chapter One Important Notes The Board of Directors, Board of Supervisors, directors, supervisors and senior managers of the Company ensure the authenticity, accuracy and completeness of contents, and guarantee no fraulds, misleading statements or major omissions in this report. They are willing to burden any individual and joint legal responsibilities. All the directors, supervisors and senior managers are able to guarantee the authenticity, accuracy and completeness of this report without any objection. The 6th meeting of the 5th Board of Directors of the company approval the text and abstract of 2014 Annual Report on 24 April 2015. 15 out of 17 directors were present. Director Li Hanqiong authorize director Chen Guanghua to vote. Director Ben Shenglin authorize director Zhu Jiandi to vote. Part of supervisors attended this meeting as well. The Company's profit distribution plan was passed by the Board of Directors as follows: taking the total share capital on 31 Dec. 2014 as the base number, cash bonus of RMB 4.5 yuan (including tax) per 10 shares was distributed to all shareholders, and 2 shares for every 10 shares were given by converting capital reserve into share capital. This plan will be submitted to 2014 general meeting of stockholders for further approval. The Chairman of the board Mr. Lu Huayu, the president Mr. Luo Mengbo, the vice president Mr. Luo Weikai, who is in charge of accounting, and the general manager of accounting department Ms. Sun Hongbo hereby declare to pledge the authenticity, accuracy and completeness of financial statements in the annual report.
    [Show full text]
  • Prox1regulates the Subtype-Specific Development of Caudal Ganglionic
    The Journal of Neuroscience, September 16, 2015 • 35(37):12869–12889 • 12869 Development/Plasticity/Repair Prox1 Regulates the Subtype-Specific Development of Caudal Ganglionic Eminence-Derived GABAergic Cortical Interneurons X Goichi Miyoshi,1 Allison Young,1 Timothy Petros,1 Theofanis Karayannis,1 Melissa McKenzie Chang,1 Alfonso Lavado,2 Tomohiko Iwano,3 Miho Nakajima,4 Hiroki Taniguchi,5 Z. Josh Huang,5 XNathaniel Heintz,4 Guillermo Oliver,2 Fumio Matsuzaki,3 Robert P. Machold,1 and Gord Fishell1 1Department of Neuroscience and Physiology, NYU Neuroscience Institute, Smilow Research Center, New York University School of Medicine, New York, New York 10016, 2Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, 3Laboratory for Cell Asymmetry, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan, 4Laboratory of Molecular Biology, Howard Hughes Medical Institute, GENSAT Project, The Rockefeller University, New York, New York 10065, and 5Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Neurogliaform (RELNϩ) and bipolar (VIPϩ) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been eluci- dated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP).
    [Show full text]
  • Clinical Utility of Recently Identified Diagnostic, Prognostic, And
    Modern Pathology (2017) 30, 1338–1366 1338 © 2017 USCAP, Inc All rights reserved 0893-3952/17 $32.00 Clinical utility of recently identified diagnostic, prognostic, and predictive molecular biomarkers in mature B-cell neoplasms Arantza Onaindia1, L Jeffrey Medeiros2 and Keyur P Patel2 1Instituto de Investigacion Marques de Valdecilla (IDIVAL)/Hospital Universitario Marques de Valdecilla, Santander, Spain and 2Department of Hematopathology, MD Anderson Cancer Center, Houston, TX, USA Genomic profiling studies have provided new insights into the pathogenesis of mature B-cell neoplasms and have identified markers with prognostic impact. Recurrent mutations in tumor-suppressor genes (TP53, BIRC3, ATM), and common signaling pathways, such as the B-cell receptor (CD79A, CD79B, CARD11, TCF3, ID3), Toll- like receptor (MYD88), NOTCH (NOTCH1/2), nuclear factor-κB, and mitogen activated kinase signaling, have been identified in B-cell neoplasms. Chronic lymphocytic leukemia/small lymphocytic lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, Burkitt lymphoma, Waldenström macroglobulinemia, hairy cell leukemia, and marginal zone lymphomas of splenic, nodal, and extranodal types represent examples of B-cell neoplasms in which novel molecular biomarkers have been discovered in recent years. In addition, ongoing retrospective correlative and prospective outcome studies have resulted in an enhanced understanding of the clinical utility of novel biomarkers. This progress is reflected in the 2016 update of the World Health Organization classification of lymphoid neoplasms, which lists as many as 41 mature B-cell neoplasms (including provisional categories). Consequently, molecular genetic studies are increasingly being applied for the clinical workup of many of these neoplasms. In this review, we focus on the diagnostic, prognostic, and/or therapeutic utility of molecular biomarkers in mature B-cell neoplasms.
    [Show full text]