MAFB Promotes Cancer Stemness and Tumorigenesis In

Published OnlineFirst March 31, 2020; DOI: 10.1158/0008-5472.CAN-19-1764

CANCER RESEARCH | MOLECULAR CELL BIOLOGY

MAFB Promotes Cancer Stemness and Tumorigenesis in Osteosarcoma through a Sox9-Mediated Positive Feedback Loop Yanyan Chen1, Tao Wang2, Mengxi Huang1, Qin Liu2, Chao Hu3, Bin Wang2, Dong Han4, Cheng Chen1, Junliang Zhang5, Zhiping Li4, Chao Liu6, Wenbin Lei7, Yue Chang1, Meijuan Wu1, Dan Xiang1, Yitian Chen1, Rui Wang1, Weiqian Huang5, Zengjie Lei1, and Xiaoyuan Chu1

ABSTRACT ◥ Despite the fact that osteosarcoma is one of the most common back activation of MAFB was pivotal to tumorsphere-forming and primary bone malignancies with poor prognosis, the mechanism tumor-initiating capacities of osteosarcoma stem cells. Moreover, behind the pathogenesis of osteosarcoma is only partially known. expression of MAFB and Sox9 was highly correlated in osteosar- Here we characterized differentially expressed genes by extensive coma and associated with disease progression. Combined detection analysis of several publicly available gene expression profile datasets of both MAFB and Sox9 represented a promising prognostic and identified musculoaponeurotic fibrosarcoma oncogene homo- biomarker that stratified a subset of patients with osteosarcoma log B (MAFB) as a key transcriptional regulator in osteosarcoma with shortest overall survival. Taken together, these findings reveal a progression. MAFB was highly expressed in tumor tissues and MAFB–Sox9 reciprocal regulatory axis driving cancer stemness and required for proliferation and tumorigenicity of osteosarcoma cells. malignancy in osteosarcoma and identify novel molecular targets MAFB expression was elevated in osteosarcoma stem cells to that might be therapeutically applicable in clinical settings. maintain their self-renewal potential in vitro and in vivo through upregulation of stem cell regulator Sox9 at the transcriptional level. Significance: Transcription factors MAFB and Sox9 form a Sox9 in turn activated MAFB expression via direct recognition of its positive feedback loop to maintain cell stemness and tumor growth sequence binding enrichment motif on the MAFB locus, thereby in vitro and in vivo, revealing a potential target pathway for forming a positive feedback regulatory loop. Sox9-mediated feed- therapeutic intervention in osteosarcoma.

Introduction outcomes of patients with osteosarcoma, with the 5-year survival rate up to 60% to 70%, whereas 20% of patients with osteosarcoma with Osteosarcoma is one of the most common primary malignant bone metastasis continue to have poor prognosis (2). tumors with two incidence peaks, one in adolescence and another in Increasing clinical and experimental evidence indicates that oste- the elderly population, especially those above 75 years of age (1). osarcoma stem cells, which derive from mesenchymal stem cells, may Chemotherapy combined with surgery has greatly improved clinical be the cellular origin of osteosarcomas (3). Cancer stem cells (CSC) share many similar properties with normal stem cells and are primarily responsible for tumorigenesis in many cancers (4, 5). For example, a 1Department of Medical Oncology, Affiliated Jinling Hospital, Medical School of subpopulation of self-renewing osteosarcoma cells, namely CSCs, are 2 Nanjing University, Nanjing, Jiangsu Province, P.R. China. Department of endowed with intrinsic capacities for tumor initiation and drug Gastroenterology, Daping Hospital, Third Military Medical University (Army resistance (3, 6). These CSCs are regulated by several key transcription Medical University), Chongqing, P.R. China. 3Department of Orthopedics, 904 Hospital of PLA, North Xingyuan Road, Beitang District, Wuxi, Jiangsu, P.R. factors and signal pathways, such as Oct3/4, Sox2, Nanog, and China. 4Department of Medical Oncology, Jinling Hospital, Nanjing Clinical Notch (7). Compared with differentiated cancer cells, CSCs are School of Southern Medical University, Nanjing, Jiangsu Province, P.R. China. generally more malignant and are critical determinants of the response 5Department of Orthopedics, Affiliated Jinling Hospital, Medical School of to chemotherapy and radiotherapy, and therefore the eradication of 6 Nanjing University, Nanjing, Jiangsu Province, P.R. China. Department of osteosarcoma stem cells may be an effective treatment strategy (8, 9). Medical Oncology, Jinling Hospital, Nanjing Clinical School of Nanjing Medical V-maf avian musculoaponeurotic fibrosarcoma oncogene homolog University, Nanjing, Jiangsu Province, P.R. China. 7Department of Orthopedics, Tianshui Cooperation of Chinese and Western Medicine Hospital, Tianshui, B (MAFB) is a member of the MAF transcription factor family, fi Gansu Province, P.R. China. containing basic leucine zipper domains that bind to speci c DNA elements (10). The seven MAF members are separated into two classes Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). (small and large MAFs). Small MAF proteins (MAFF, MAFG, and MAFK) have been shown to regulate antioxidant responses (11) Y. Chen, T. Wang, M. Huang, Q. Liu, and C. Hu contributed equally as the co-senior whereas large MAFs (MAFA, c-MAF, and MAFB) each contain a authors of this article. similar transactivation domain and are strongly oncogenic (12, 13). In Corresponding Authors: Zengjie Lei, Jinling Hospital, School of Medicine, the hematopoietic system, MAFB induces myelomonocytic differen- Nanjing University, Nanjing, Jiangsu Province 210000, China. Phone: 8625- 8086-0131; E-mail: [email protected]; and Xiaoyuan Chu, tiation in immortalized myoblasts and macrophage differentiation and [email protected] maturation in mice (14). In podocyte differentiation and the maintenance of progression, aberrant podocyte foot process formation is Cancer Res 2020;80:2472–83 observed in a MAFB-mutant zebrafish embryo model (14). There is doi: 10.1158/0008-5472.CAN-19-1764 also evidence that MAFB regulates osteoclast genesis and epidermal 2020 American Association for Cancer Research. keratinocyte differentiation (15, 16). Upregulation of MAFB increases

AACRJournals.org | 2472

MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness

the risk of various human pathologies, such as diabetes and athero- Multiple early-passage frozen stocks of each cell line in this study sclerotic disorders (17, 18). In addition, MAFB has been shown to were stored under liquid nitrogen: all cell lines were used in exper- promote tumorigenesis, especially in the transformation of pancreatic imentation for no longer than 10 passages from thaw. Cells were used b cells (13, 19). MAFB chromosomal translocations occur more in the described experiments for approximately 6 months. All cell lines frequently in human myeloma cells, and high expression of MAFB were routinely tested for Mycoplasma contamination using MycoP- is observed in patients with acute leukemia blast, hepatocellular robe Mycoplasma Detection Kit (R&D Systems, Inc.), and any con- carcinoma, and colorectal carcinoma (14, 17). Finally, MAFB has taminated cell line was treated with Plasmocin treatment (InvivoGen), been shown to promote nasopharyngeal carcinoma cell proliferation confirmed by negative detection of Mycoplasma before being used and migration (20). again. The most recent testing was 3 months ago. Here, through high-throughput bioinformatic analysis of publicly available transcriptome datasets we identified MAFB as a novel Lentivirus vectors and cell infection regulator of osteosarcoma tumorigenesis. We demonstrate that MAFB The target gene sequence of small hairpin RNA (shRNA; shMAFB-a: promotes tumorigenesis and self-renewal of osteosarcoma stem cells TACTGGATGGCGAGCAACTACCAGCAGAT, shMAFB-b: TCA via a Sox9-mediated feedback activation loop, which could be CCAAGGACGAGGTGATCCGCCTGAAG, shSox9-a: GTGCGCG- exploited to eliminate the culprit cells in osteosarcoma. TCAACGGCTCCAGCAAGAACAA, shSox9-b: CAGCGAACGCA- CATCAAGACGGAGCAGCT) was cloned into the pLVT-Vector (SBO Medical Biotechnology) and was used for the generation of Materials and Methods lentiviruses, which were mixed with lentiviral transfection enhancer Collection and processing of microarray gene expression data (Sigma-Aldrich) and applied to indicated cell lines. Puromycin was Microarray gene expression data of 10 normal and 107 osteosar- then used to select and establish stable expression or knockdown coma tissue samples were extracted from six datasets in the gene cell lines. expression omnibus (GEO) database: GSE14359, GSE16088, GSE16091, GSE14827, GSE12865, and GSE73166. The intersection Western blotting genes of these three platforms were identified (11,808 genes). Combat Total protein was extracted from osteosarcoma cell lines and clinical function was used for removing batch effects in high-throughput samples using M-PER Mammalian Protein Extraction Reagent experiments, the robust multiarray average (RMA) method was used (Thermo Fisher Scientific). Whole cell lysates were separated by for data normalization using R software (R Foundation), and the SDS-PAGE and transferred to nitrocellulose membrane (Bio-Rad). limma package (R Foundation) was used to analyze differently Membranes were blocked with 5% skim milk or BSA and then expressed genes. incubated with primary antibodies (see Supplementary Table S1A) and subsequently with secondary antibodies (see Supplementary Patient specimens and IHC staining Table S1A). Protein bands were visualized using the Immobilon All osteosarcomas and adjacent tissues were collected from patients Western Chemiluminescent HRP Substrate detection reagent (Milli- who were diagnosed as overall survival (OS) at the department of pore). GraphPad Prism 5.0 was used to measure the gray intensity of Department of Surgery of Daping Hospital and Jinling Hospital. All OS protein bands and normalized the expression of control protein tissue was obtained from individual patients with written informed (b-actin). consent. The protocols used in this study conformed to the ethical guidelines of the 1975 Declaration of Helsinki and were approved by RT-PCR assays the Ethical Review Committees of Daping Hospital and Jinling Hos- Total RNA was isolated from osteosarcoma cell lines and clinical pital. Blocked tissue samples were cut into 5 mm sections and stained samples using TRizol reagent (Invitrogen) and then treated with with hematoxylin and eosin, then incubated with primary antibodies. DNase. Using a PrimeScript RT Kit (Takara), RNA was reverse Tumor staging was estimated according to the criteria for histologic transcribed into cDNA to detect relative mRNA levels using qPCR classification proposed by the International Union Against Cancer. (Bio-Rad). The fold changes of target genes were normalized to We followed a previously described protocol to quantify staining b-actin. The primer sequences for qPCR are provided in Supplemen- intensity (21). Five representative fields of a section were evaluated tary Table S1B. All experiments were repeated three times. by two double-blinded pathologists. Final score of MAFB and Sox9 in each sample was obtained by multiplying the strength score by the Cell Counting Kit-8 assay distribution score. The cutoff score in various analyses was 8 for both Cells were seeded in a 96-well plate with a density of 3,000 cells per anti-MAFB and anti-MAFB staining intensity (high expression, IHC well and treated with indicated conditions. At 24 hours intervals, the scoring ≥8; low expression, IHC scoring <8). medium was removed and then incubated with CCK8 (Dojindo Molecular Technologies) for 60 minutes. The absorbance was deter- Cell culture mined at 450 nm using a Varioskan Flash (Thermo Fisher Scientific). Human osteoblast cell lines (hFOB1.19) and osteosarcoma cell lines (MG63, U-2OS, 143B, HOS) were purchased from the Shanghai Cell Colony formation assay Collection. All cell lines were characterized by short tandem repeat For colony formation assays, approximately 500 cells were plated (STR) profiling within 6 months. 143B and MG63 were maintained in into 60 mm culture dishes and incubated for 14 days. Colonies were MEM medium, whereas HOS and U-2OS was maintained in stained with 0.5% Crystal Violet in 6% glutaraldehyde solution. The RPMI1640 and MoCoy's 5a media respectively. hFOB1.19 was main- diameter of colonies consisting of ≥300 mm were counted. tained in DMEM medium. All medium (HyClone) contained high glucose, 10% FBS (HyClone) and 1% antibiotic/antimycotic solution Soft agar colony formation assay (Sigma-Aldrich). All cells were cultured at 37C in a humidified Cells were harvested and suspended as single cells in culture 5 atmosphere containing 5% CO2. medium (10 cells/mL). 60-mm dishes were precoated with 0.75%

AACRJournals.org Cancer Res; 80(12) June 15, 2020 2473

Chen et al.

agar in culture medium, and single cell suspensions were mixed with injected subcutaneously into nude mice. The tumor-initiating cell 0.35% agarose in culture medium and seeded into precoated 60-mm frequency was calculated using ELDA software (http://bioinf.wehi. dishes. After 12 to 30 days of incubation at 37 C, in 5% CO2, colonies edu.au/software/elda/; ref. 22). Data representing the number were stained, photographed, and counted. of cells in each culture, number of cultures tested and number of positive cultures was entered to determine the “tumor-initiating cell RNA sequencing and analysis frequency.” The cut-off value for determining tumor formation was Total RNA was extracted using using TRizol reagent (Invitrogen) 100 mm3 (23). and sequenced with the cBot Cluster Generation System using a All animal experiments were approved by the Institutional Animal TruSeq PE Cluster Kit v3-cBot-HS (Illumina). Raw reads were mapped Care and Use Committee of the Jinling Hospital and the Army Medical to the aligned reference genome using Hisat2, version 2.0.5 (https:// University. ccb.jhu.edu/software/hisat2/index.shtml) and read counts for each transcript were calculated using featureCounts, version 1.5.0-p3 Immunofluorescence and confocal microscopy (https://www.rdocumentation.org/packages/Rsubread/versions/ Approximately 104 cells were grown on cover glass and cultured 1.22.2/topics/featureCounts). Differential gene expression analysis overnight, and then fixed with 4% paraformaldehyde. After permea- was performed using the DESeq2 R package. Gene ontology (GO) bilization of membranes using 0.5% Triton X-100, nonspecific anti- analysis was performed using the clusterProfiler R package. body binding was blocked by preincubation with 1% BSA. Specific antibodies were then incubated overnight followed by fluorescein Flow cytometric analysis isothiocyanate-conjugated secondary antibodies and visualized using Trypsin digestion was used to produce individual cell suspensions, confocal microscopy. followed by incubation in blocking solution (PBS þ 1% BSA þ 10% FBS). Cells were then centrifuged, and pellets were resuspended and Availability of data and materials incubated with primary antibody (see Supplementary Table S1A). Microarray gene expression data of ten normal and 107 osteosar- Cells were then analyzed or sorted using a BDAria II Sorter (BD coma tissue samples were extracted from six datasets in the GEO Biosciences). database: https://www.ncbi.nlm.nih.gov/geo/. R software (R Founda- tion) is a free software environment for statistical computing and Sox9 and MAFB promoter and luciferase activity assays graphics (https://www.r-project.org). The datasets and the computer Cells were transfected with a firefly reporter vector containing code used and analyzed during the current study are available from the MAFB or Sox9 promoter, and the Renilla luciferase reporter vector corresponding author upon request. (pRL-TK) using Lipofectamine 2000 (Invitrogen). Cell samples were collected after 48 hours and both MAFB or Sox9 firefly luciferase and Statistical analysis Renilla luciferase activities were detected using a Dual-Luciferase All experiments were performed three or more times indepen- Reporter Assay Kit (BMG Labtech). The Renilla luciferase fluorescence dently under similar conditions. Statistical analyses were performed intensity was utilized as an internal control. using SPSS statistical software for Windows, version 17.0 (SPSS). Data were expressed as the mean SD or percentage, and analyzed Chromatin immunoprecipitation using Student t test, x2 test,orANOVA.Survivaldatawere Cells were cross-linked with 1% formaldehyde, lysed, and estimated using the Kaplan–Meier method and analyzed using the sonicated into DNA fragments between 200 and 1,000 bp. The log-rank test. The association between factors for survival was DNA fragments were immunoprecipitated with antibodies against determined by univariate and multivariate analyses using Cox MAFB or Sox9, and PCR with specific primers to detect the regression analysis. A value of P < 0.05 was considered statistically relative sequence binding enrichment (SBE) motifs were used significant. (Supplementary Table S1B).

Tumor sphere formation assay Results Osteosarcoma cells were isolated in ultra-low attachment 24-well Elevated expression of MAFB in osteosarcoma plates (Corning) with 200 cells per well and cultured in stem cell To better characterize the molecular underpinnings of osteosarco- medium [DMEM/F12 medium (Thermo Fisher Scientific) containing ma tumorigenesis, we systemically analyzed mRNA expression pro- 20 ng/mL of EGF, 20 ng/mL FGF, and 10 ng/mL of HGF (PeproTech), files from osteosarcomas and normal tissues. Expression profiles of 10 B27 supplement (Invitrogen), 4 mg/mL of insulin (Sigma-Aldrich), and normal and 107 osteosarcoma samples were extracted from six 1% methyl cellulose (Sigma-Aldrich)] for 2 weeks. Fresh medium was datasets in the GEO database: GSE14359, GSE16088, GSE16091, exchanged every 4 days, and the average diameters of tumor spheres GSE14827, GSE12865, and GSE73166. Because these data were from were determined using a microscope. three different platforms, we intersected the detected genes and found 11,808 genes in common. Combat function was used for removing Tumorigenicity in vivo and limiting dilution assay batch effects in high-throughput experiments, and the RMA method Nude mice, 4 weeks of age, were injected subcutaneously with stable was used for data normalization using R software. Using the limma clones of cell suspensions in Matrigel (1:1; 106 cells/mouse). Xenografts package, we identified 1,833 differentially expressed genes (DEG) with were allowed to grow for 5 weeks before being harvested for further P values < 0.05 and fold changes >1.5 (Supplementary Table S2A), and analysis. The tumor volumes were then measured and calculated using shown in a volcano plot (Fig. 1A). We listed the top 100 upregulated the formula: V ¼ (length width2)/2. The tumors were stored in 10% and downregulated genes (Supplementary Fig. S1A). Using GO buffered formalin for further analysis. enrichment and pathway enrichment analysis of these DEGs (Sup- For limiting dilution assay (LDA) of tumorigenicity in vivo, cells plementary Figs. S1B and S1C; Fig. 1B), we found that the DEGs were were diluted at defined doses (106 cells/100 mLto103 cells/100 mL) and closely associated with transcriptional activity. Among these DEGs,

2474 Cancer Res; 80(12) June 15, 2020 CANCER RESEARCH

MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness

Figure 1. Expression levels of MAFB is higher in osteosarcoma tissues compared with normal tissues. A, Volcano plot of DEGs between 10 normal and 107 osteosarcoma samples from the GEO database. Blue, DEGs with P < 0.05 and fold changes >1.5. Red, not significant DEGs, with P ≥ 0.05 or fold change ≤1.5 (DESeq2, R software). B, GO enrichment analysis of the molecular functions of these 1,833 DEGs. C, Heatmap of the top 10 upregulated and downregulated transcription factors represented in the set of identified DEGs. D, The mRNA expression levels of MAFB in 10 normal and 107 osteosarcoma samples from the GEO database. E and F, The mRNA levels (E) or the protein levels (F) of MAFB in 15 paired tumor and adjacent tissue samples from patients with osteosarcoma. The Western blotting bands were quantified and normalized to b-actin to indicate relative levels of MAFB expression. , P < 0.05.

there were 112 transcription factors (Supplementary Table S2B), with MAFB is highly expressed in osteosarcoma tumors isolated from the top 10 upregulated and downregulated transcription factors in patients. these DEGs shown in Fig. 1C. Previous studies revealed that SATB2 and HEY1 were related to MAFB promotes growth and tumorigenicity of osteosarcoma osteosarcoma migration and metastasis (24, 25), TRPS1 was associated cells with multidrug resistance of osteosarcoma, and HMGB2 suppressed To test whether MAFB plays a role in the pathophysiology of p53 transcriptional activity in osteosarcoma cells (26, 27). However, osteosarcoma, we ﬁrst examined the expression of MAFB in osteo- less is known about the role of MAFB in osteosarcomas, therefore we sarcoma cell lines. We found that MAFB protein levels were higher in focused on the role of MAFB in osteosarcoma tumorigenesis. MAFB 143B and HOS cells, but lower in U-2OS and MG63 cells (Supple- was highly expressed in osteosarcoma samples utilized in the GEO mentary Fig. S2A). Depletion of MAFB led to impaired colony datasets analyzed above (Fig. 1D). From samples collected from formation capacity of cells suspended in soft agar (Fig. 2A and B; patients with osteosarcoma, we observed a similar pattern of elevated Supplementary Figs. S2B–S2D), as well as cell proliferation in two- MAFB expression in tumor tissue compared with adjacent normal dimensional culture conditions (Fig. 2C and D; Supplementary tissue (Fig. 1E and F). Together, these ﬁndings demonstrate that Fig. S2E). Consistently, depletion of MAFB in these cells induced

AACRJournals.org Cancer Res; 80(12) June 15, 2020 2475

Chen et al.

Figure 2. Overexpression of MAFB enhances malignant growth of osteosarcoma cells in vitro and in vivo. A, Protein levels of MAFB were detected in HOS and 143B cells expressing control shRNA (shGFP), shMAFB (shMAFB-a, shMAFB-b), or vehicle (Blank ctrl). Numbers above blots are quantiﬁcation of MAFB protein expression normalized to b-actin. B, The cell proliferation capacity detected by the soft agar assay in HOS cells expressing control shRNA (shGFP), shMAFB (shMAFB-a, shMAFB-b), or vehicle (Blank ctrl). C, Cell Counting Kit-8 assays indicate proliferation of HOS and 143B cells was inhibited following MAFB depletion. D, Colony formation assay in HOS cells transfected with control shRNA (shGFP), shMAFB (shMAFB-a, shMAFB-b), or vehicle (Blank ctrl). E, In vivo subcutaneous xenograft tumor formation performed on 4-week nude mice with cells expressing control shRNA (shGFP) or shMAFB (shMAFB-b). Tumors were harvested after 5 weeks and representative images are shown (left) and tumor volumes were analyzed (right; n ¼ 6 per group). F, Protein levels of MAFB were detected in MG63 and U-20S cells stably expressing Lv-ctrl, Lv-MAFB, or vehicle (Blank). Numbers above blots are quantiﬁcation of MAFB protein expression normalized to b-actin. G, Cell proliferation capacity was detected using soft agar assay in MG63 cells expressing Lv-ctrl, Lv-MAFB, or vehicle (Blank). H, Cell Counting Kit-8 assay showing proliferation of MG63 and U-20S cells was promoted by MAFB overexpression. I, Colony formation assay showing cell proliferation capacity of MG63 cells expressing Lv-ctrl, Lv-MAFB, or vehicle (Blank). J, In vivo subcutaneous xenograft tumor formation was conducted using cells expressing Lv-ctrl or Lv-MAFB. Representative images are shown (left) and the tumor volumes were analyzed (right; n ¼ 6 per group). , P < 0.05; , P < 0.01.

2476 Cancer Res; 80(12) June 15, 2020 CANCER RESEARCH

MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness

smaller subcutaneous tumors in nude mice (Fig. 2E; Supplementary Sox9 forms a feedback loop to enhance the transcriptional Fig. S2F). activity of MAFB To further validate a potential oncogenic role of MAFB in osteo- Sox9 is also a transcription factor and upregulated in aggressive sarcoma, we ectopically expressed MAFB in MG63 and U-2OS osteosarcoma tissues with poor prognoses (29), therefore we specu- cells (Figs. 2F; Supplementary Fig. S2G). MAFB-overexpressing in lated that MAFB and Sox9 may regulate one another and form a these cells led to increased colony formation in soft agar (Fig. 2G; reciprocal feedback loop, as shown in other similar circumstances such Supplementary Fig. S2H) and were more proliferative in anchorage- as GATA3/ZEB2 or p53/SET (30, 31). To this end, we established cell dependent growth conditions (Fig. 2H and I; Supplementary Fig. S2I). lines with Sox9 either depleted or overexpressed (Supplementary Figs. Consequently, MAFB-overexpressing cells show an increased ability to S3I and S3J). Using these cell lines, we found that MAFB levels induce the formation of solid tumors in mice (Fig. 2J). Expression of positively correlated with Sox9. MAFB protein and mRNA levels were MAFB in these subcutaneous tumors was validated by IHC analysis of decreased upon depletion of Sox9 (Supplementary Fig. S3K) and the dissected tumors (Supplementary Figs. S2F and S2J). Together, increased upon ectopic expression of Sox9 (Supplementary Fig. S3L). these results demonstrate that MAFB plays an important oncogenic To examine whether MAFB was directly regulated by Sox9, we role in osteosarcoma in vitro and in vivo. analyzed the Sox9 ChIP-seq dataset from HT29 human colorectal cancer cells (GEO dataset GSE63629) and retrieved positive Sox9 MAFB binds to, and activates, the Sox9 promoter binding peaks on the promoter of MAFB (Fig. 3G). Moreover, we also CSCs have been identified as the “cell-of-origin” of osteosar- found that there were six potential SBEs in the promoter domain of comas (28), thus we hypothesized that a significant increase of MAFB (Supplementary Fig. S3M). We generated six constructs with tumorigenicity in MAFB-expressing cells may be due to a higher different promoter sequences of MAFB upstream of luciferase. and ratio of CSCs. To assess the potential effects of MAFB on cancer found that the luciferase activity of P1, P2, and P3 were increased in the cell stemness, we performed RNA-seq analysis of MAFB-depleted presence of ectopic Sox9 (Fig. 3H), but significantly decreased in the and control cells. DEGs between these two groups are shown in a Sox9-depleted cells (Supplementary Fig. S3N). These results were volcano plot (Fig. 3A; Supplementary Table S2C). According to further confirmed by ChIP assays showing that the binding of Sox9 GO analysis, we defined a list of markers related to CSC popu- to SBE1 and SBE5 were significantly decreased following depletion of lation maintenance (Supplementary Table S2D). Six CSC markers Sox9 (Fig. 3I) and increased with ectopically expressed Sox9 (Fig. 3J). were differentially expressed after depletion of MAFB (Fig. 3B). In Thus, Sox9 bound to SBE1 and SBE5 of the MAFB promoter sequence the analyses of GEO datasets, we found 18 CSC markers differ- and promoted MAFB expression. entially expressed among osteosarcoma and normal samples; Furthermore, we detected transcriptional activity of both the MAFB with the top five upregulated markers being CD24, SPARC, Sox9, and Sox9 promoters by luciferase report assay with overexpression of KDR, and Sox4 (Supplementary Fig. S3A). Because the only CSC either MAFB or Sox9. Not only the transcript activity of Sox9 promoter marker showing differential expression both in GEO datasets and increased after MAFB overexpression, but also the expression levels of RNA-seq analysis was Sox9 (Fig. 3C), we anticipated that Sox9 MAFB were induced by overexpression MAFB itself (Fig. 3K). Sim- may be a key downstream target of MAFB to control cancer cell ilarly, both Sox9 and MAFB promoter activity were enhanced by Sox9 stemness. overexpression (Fig. 3K). Given that both proteins are able to bind the Consistent with this notion, ectopic expression of MAFB in promoters of each other, we concluded that MAFB and Sox9 consti- MG63 cells led to increased mRNA levels of Sox9, as well as CD44 tuted positive transcriptional regulatory loop in osteosarcoma cells. and CD24, but not other CSC markers of osteosarcoma stem cells (Supplementary Figs. S3B and S3C). Western blotting confirmed The MAFB-Sox9 reciprocal regulatory axis maintains cancer that overexpression of MAFB increased the protein levels of CD44, stemness and tumorigenicity CD24, and Sox9 (Supplementary Fig. S3D). Conversely, depleting In light of the essential role of Sox9 in CSCs, we suspected that MAFB in HOS cells significantly downregulated both the mRNA MAFB may regulate cancer stemness through upregulating Sox9 and protein levels of CD44, CD24, and Sox9 (Supplementary Figs. expression in osteosarcoma. To support this notion, both MAFB and S3E and S3F). Sox9 were highly expressed and colocalized in the nuclei of þ þ We next determined whether there were any binding motifs of CD44 CD24 osteosarcoma stem cells compared with CD44 CD24 MAFB in the promoter sequence of the Sox9 gene. As shown in differentiated cells (Fig. 4A and B). Moreover, ectopic expression of SupplementaryFig.S3G,thereweresixpotentialSBEmotifsforthe MAFB in CD44 CD24 cells promoted sphere formation, resulting in MAFB transcription factor in the human Sox9 gene within the first an increase in both sphere number and size, whereas this phenotype 2kb upstream to the transcription start site. To confirm which SBEs was inhibited by depleting Sox9 (Fig. 4C and D; Supplementary Figs. was directly recognized by MAFB, we generated six constructs with S4A–S4C). Consistently, ectopic expression of MAFB induced an þ þ Sox9 modified promoter sequences (P1–P6) upstream of luciferase. expansion of CD44 CD24 cells, while depleting Sox9 minimized We found that the relative luciferase activities of P1, P3, P4, and P5 the stem cell pool (Fig. 4E; Supplementary Fig. S4D). Moreover, using were increased in the presence of MAFB (Fig. 3D), whereas xenograft tumor formation and LDAs in vivo, we found that MAFB- depletion of MAFB significantly decreased the activities of the same expressing cells formed larger tumors with higher tumor-initiating cell promoter sequences (Supplementary Fig. S3H). These four con- frequencies, a phenotype that was dependent, in part, on its down- structs shared each contained the SBE1 element. Using chromatin stream target Sox9 (Fig. 4F and G; Supplementary Fig. S4E). immunoprecipitation (ChIP), we found that binding of MAFB to To further validate the potential roles of the MAFB and its down- þ þ SBE1 and SBE3 elements was decreased in HOS cells after depletion stream target Sox9 in CSCs, we depleted MAFB in CD44 CD24 cells of MAFB (Fig. 3E). This was further confirmed in Lv-MAFB MG63 using two independent shRNAs (Supplementary Figs. S4F and S4G). cells (Fig. 3F). These data suggests that MAFB binds to SBE1 and Loss of MAFB in CSCs led to impaired sphere formation capacity while SBE3 of the Sox9 promoter to transcriptionally activate Sox9 re-introducing Sox9 rescued this stem cell function (Fig. 4H and I; expression. Supplementary Fig. S4H). Moreover, flow cytometry analysis revealed

AACRJournals.org Cancer Res; 80(12) June 15, 2020 2477

Chen et al.

Figure 3. MAFB and Sox9 form a transcriptional feedback loop to co-elevate their expression. A, Volcano plot of DEGs analyzed by RNA-seq between cells expressing control shRNA (shGFP) or shMAFB (shMAFB-b; n ¼ 3 per group). B, Heatmap of expression levels of CSC markers identiﬁed in DEGs between cells expressing control shRNA (shGFP) or shMAFB (shMAFB-b; n ¼ 3 per group). C, Venn diagrams of the common CSC markers between GEO datasets and RNA-seq. D, Luciferase assays showing promoter activities of six Sox9 promoter sequences in MG63 cells expressing Lv-ctrl or Lv-MAFB. E and F, ChIP assay measuring MAFB binding to Sox9 SBEs in HOS cells expressing control shRNA (shGFP), or shMAFB (shMAFB-b; E) and MG63 cells expressing Lv-ctrl or Lv-MAFB (F). G, ChIP-seq of Sox9 in HT29 human colorectal cancer cells from the GEO dataset, GSE63629. H, Luciferase assays showing different promoter activities of six MAFB promoter sequences in MG63 cells transfected with Lv-ctrl or Lv-Sox9. I and J, ChIP assay of Sox9 binding to MAFB SBEs in HOS cells expressing control shRNA (Kd-ctrl) or shSox9 (shSox9-b; I) and MG63 cells expressing Lv-ctrl or Lv-Sox9 (J). K, Luciferase assays of Sox9 promoter and MAFB promoter in the MAFB overexpressing cells (left) or Sox9 overexpressing cells (right). , P < 0.05.

þ þ that the pool of CD44 CD24 cells were reduced upon depletion of dilution tumor formation assays, we found that depleting MAFB in MAFB and recovered upon overexpression of Sox9 (Fig. 4J; Supple- CSCs inhibited tumor formation and self-renewing potential, which mentary Fig. S4I). Using in vivo xenograft tumor growth and limiting could be restored by reintroducing Sox9 (Fig. 4K; Supplementary Figs.

2478 Cancer Res; 80(12) June 15, 2020 CANCER RESEARCH

MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness

Figure 4. MAFB promotes stemness and tumorigenicity of osteosarcoma cells in part through activating its downstream target Sox9. A, Immunofluorescence of MAFB and Sox9 in CD44þCD24þ or CD44CD24 cells sorted MG63 cells. B, Protein levels of MAFB were detected in CD44þCD24þ or CD44CD24 MG63, U-2OS, 143B, and HOS cells. Numbers above blots are quantification of MAFB protein expression normalized to b-actin. C and D, The average sphere diameter (C) and number (D) generated by CD44CD24 MG63 or U-2OS cells expressing Lv-ctrl, Lv-MAFB, and shSox9-b individually or together. E, Flow cytometry analysis of the percentage of CD44þCD24þ cells in CD44CD24 MG63 cells expressing Lv-ctrl, Lv-MAFB, and shSox9-b individually or together. F, Quantification of volumes of subcutaneous xenograft tumors formed by CD44CD24 MG63 cells expressing Lv-ctrl, Lv-MAFB, and shSox9-b individually or together (n ¼ 6 per group). G, Quantification of tumor-initiating cell frequency generated by MG63 CD44CD24 cells expressing Lv-ctrl, Lv-MAFB, shSox9-b individually or together (n ¼ 6 per group). H and I, The average diameters (H) and numbers (I) of spheres generated by CD44þCD24þ MG63 or U-2OS cells expressing control shRNA (shGFP), shMAFB (shMAFB-b), Lv- Sox9 individually, or together. J, Flow cytometry analysis of the percentage of CD44þCD24þ cells in CD44þCD24þ MG63 or U-2OS cells expressing control shRNA (shGFP), shMAFB (shMAFB-b), Lv-Sox9 individually, or together. K, Quantification of volumes of subcutaneous xenograft tumors formed by CD44þCD24þ MG63 cells transfected with control shRNA (shGFP), shMAFB (shMAFB-b), Lv-Sox9 individually, or together (n ¼ 6 per group). , P < 0.05; , P < 0.01.

AACRJournals.org Cancer Res; 80(12) June 15, 2020 2479

Chen et al.

S4J and S4K). IHC staining of xenograft tumor tissues conﬁrmed that Furthermore, we examined whether the MAFB–Sox9 feedback MAFB and Sox9 enhanced expression of both MAFB and Sox9 in vivo regulatory axis contributed to chemoresistance, a hallmark of CSCs. (Supplementary Figs. S4L and S4M), which was consistent with the We found that enforced expression of either MAFB or Sox9 in model that MAFB and Sox9 form a functional regulatory loop in CD44 CD24 cells conferred resistance to Cisplatin, a commonly osteosarcoma stem cells. used chemotherapy agent (Supplementary Fig. S5E). Consistently, þ þ We next asked how Sox9-mediated feedback activation of MAFB Cisplatin treatment enriched CD24 CD44 CSCs that expressed high contributed to CSC maintenance. To this end, introducing Sox9 in levels of MAFB and Sox9 (Fig. 6A; Supplementary Fig. S5F). Together, CD44 CD24 cells enhanced sphere formation and self-renewal in a these data demonstrate that reciprocal regulation between MAFB and LDA, as well as expansion of the CSC pool, while depleting MAFB Sox9 in osteosarcoma stem cells to maintain their stemness potential, attenuated these stemness properties (Fig. 5A–C; Supplementary Figs. chemoresistance, and tumorigenicity. þ þ S5A–S5D). Moreover, depleting endogenous Sox9 in CD44 CD24 cells inhibited tumorsphere formation and self-renewing capacity of MAFB expression levels correlate with Sox9 in a subgroup of CSCs, which was partially recovered by reintroducing MAFB human osteosarcoma tissues (Fig. 5D–F), suggesting that Sox9 functions in a MAFB-dependent To further validate the correlation between MAFB and Sox9 manner to sustain stemness properties of osteosarcoma cells. expression in CSCs, immunoﬂuorescence staining revealed that both

Figure 5. Sox9-mediated feedback activation of MAFB maintains stem-like properties of osteosarcoma cells. A and B, Average sphere diameter (A) and number (B) generated by CD44CD24 MG63 or U-2OS cells expressing Lv-ctrl, Lv-Sox9, and shMAFB-b alone or both lv-Sox9 and shMAFB-b. Representative images of spheres are shown (A, left). C, Quantiﬁcation of tumor-initiating cell frequency generated by CD44CD24 MG63 or U-2OS cells expressing Lv-ctrl, Lv-Sox9, and shMAFB-b individually or together (n ¼ 6 per group). D and E, Average sphere diameter (D) and number (E) generated by CD44þCD24þ MG63 or U-2OS cells expressing Lv-ctrl, Lv-MAFB, and shSox9-b individually or together. Representative images of spheres are shown (D, left). F, Quantiﬁcation of tumor-initiating cell frequency generated by CD44þCD24þ MG63 or U-2OS cells expressing Lv-ctrl, Lv-MAFB, shSox9-b individually or both (n ¼ 6 per group; three repeats). , P < 0.01.

2480 Cancer Res; 80(12) June 15, 2020 CANCER RESEARCH

MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness

Figure 6. MAFB expression levels were positively correlated with Sox9 in a subgroup of osteosarcoma tissues. A, Immunoﬂuorescence analysis of MAFB and Sox9 in MG63 cells from subcutaneous xenografts. B, The mRNA levels of Sox9 in 10 normal and 107 osteosarcoma samples from the GEO database. C, IHC analysis of MAFB and Sox9 in tumor tissue and adjacent normal tissue from patients. D, IHC score of Sox9 expression was positively correlated with MAFB levels (n ¼ 83). E, Kaplan–Meier survival analysis of overall survival in MAFB high-expressed patients and MAFB low-expressed patients (n ¼ 83). F, Kaplan–Meier survival analysis of overall survival in Sox9 high-expressed patients and Sox9 low-expressed patients (n ¼ 83). G, Kaplan–Meier survival analysis of overall survival in MAFBlowSox9low and MAFBhighSox9high patients. H, Summary of the MAFB–Sox9 positive feedback loop and its effects in promoting cancer stem cell stemness and promoting xenograft tumor growth invivo. , P < 0.01; , P < 0.001.

MAFB and Sox9 were highly expressed and colocalized in a subset with low-grade tumors (G1 and G2 patients; Supplementary of human osteosarcoma cells in vivo (Fig. 6A). Analysis of datasets Table S3A). Furthermore, higher expression levels of either MAFB from the GEO database also demonstrated that the mRNA levels of or Sox9 in osteosarcoma is associated with shorter patient survival Sox9washigherintumorscomparedwithnormaltissue(Fig. 6B). (Fig. 6E and F; Supplementary Table S3B). For subgroup analysis, Consistently, the protein levels of both Sox9 and MAFB were co- patients were divided into four subgroups according to the expression elevated in osteosarcoma compared with adjacent normal tissues. levels of MAFB and Sox9. Owing to the limit numbers of Moreover, expression of MAFB positively correlated with Sox9 in patient samples with MAFBlowSox9high and MAFBhighSox9low,we osteosarcoma specimens (Fig. 6C and D). Immunoﬂuorescence were unable to draw statistically signiﬁcant conclusions from these staining of primary tumor tissues also revealed that MAFB and two subgroups (Fig. 6G; Supplementary Fig. S5H). However, patients Sox9 were coexpressed by a subset of tumor cells (Supplementary with MAFBhighSox9high tumors show poor survival compared with Fig. S5G). patients with MAFBlowSox9low tumors (Fig. 6H). Taken together, Clinical pathologic analyses revealed that both the expression of MAFB and Sox9 form a positive feedback loop fueling CSC self- MAFB and Sox9 were correlated with higher histologic grades. More- renewal to support malignant growth and tumorigenesis (Fig. 6H), over, increased expression of MAFB and Sox9 was observed in patients suggesting that this regulatory axis maybe a unique therapeutic with high-grade tumors (G3 and G4 patients) compared with those vulnerability for a subgroup of osteosarcoma.

AACRJournals.org Cancer Res; 80(12) June 15, 2020 2481

Chen et al.

Discussion IHC analyses of osteosarcoma tissues revealed that MAFB expression positively correlates with Sox9. More importantly, expression of both Osteosarcoma remains a major challenge due to poorly defined MAFB and Sox9 were associated with poor outcomes of these patients. mechanisms of tumorigenesis and limited treatment options. Here, we Strikingly, the patients with MAFBhigh Sox9high tumors displayed the identified a critical role of MAFB in osteosarcoma tumorigenesis via a shortest survival, as compared with those with MAFBlowSox9low Sox9-mediated positive feedback loop, which reciprocally promote tumors. MAFBlowSox9high or MAFBhighSox9low tumors also show a expression of MAFB to induce cell proliferation, maintenance of CSCs, trend towards better survival compared with MAFBhigh Sox9high, and tumorigenesis. MAFB was highly expressed and positively cor- although the small sample size precluded a statistically robust analysis. related with osteosarcoma progression, as revealed by analysis of GEO Thus, combined detection of the MAFB-Sox9 feedback loop represents datasets and paired clinical osteosarcoma samples. Previous studies a potential alternative method by which to stratify patients with demonstrated that other large MAF family members, such as MAFA, osteosarcoma with increased prognostic ability of disease progression c-MAF, and NRL, also regulate tumorigenesis in humans (10). For and mortality. example, c-MAF enhances cell proliferation and metastasis in lym- In conclusion, our study identifies a MAFB–Sox9 reciprocal regu- phoma and breast cancer (17, 32). Moreover, MAFB promotes cell- latory loop that sustains stem cell properties of osteosarcoma cells cycle progression and tumor growth in multiple myeloma, nasopha- in vitro and in vivo. Given their essential roles in maintaining ryngeal carcinoma, hepatocellular carcinoma, and colorectal carcino- osteosarcoma CSCs, this signaling axis could be exploited to design ma (14, 20, 33, 34). Consistent with these studies, MAFB supports novel therapeutic strategies against this deadly bone malignancy. proliferation and colony formation of osteosarcoma cells in vitro and Moreover, simultaneous examination of MAFB and Sox9 expression tumor growth in vivo in nude mice, suggesting a previously unrec- status may help provide prognostic value in clinical settings. ognized oncogenic role in human osteosarcoma. Our study identifies Sox9 as a functional downstream transcriptional target of MAFB. Sox9 is known to play versatile roles in Disclosure of Potential Conflicts of Interest tumorigenesis. It is upregulated in lung, breast, and liver cancers and No potential conflicts of interest were disclosed. its expression levels are frequently associated with poor clinical outcomes (35–38). However, Sox9 also inhibits tumorigenesis in Authors’ Contributions melanoma (39). For osteosarcomas, Sox9 expression is upregulated Conception and design: Y. Chen, B. Wang, T. Wang, W. Lei, D. Xiang, Z. Lei, X. Chu and associated with disease progression and poor prognosis (29). Development of methodology: C. Hu, W. Lei, D. Xiang, Z. Lei, X. Chu However, it remains unclear how Sox9 expression is regulated by Acquisition of data (provided animals, acquired and managed patients, provided upstream mechanisms. In this study, we identified that Sox9 is facilities, etc.): Y. Chen, C. Hu, Q. Liu, D. Han, J. Zhang, Z. Li, W. Lei, D. Xiang, transcriptionally activated by MAFB through direct binding to the R. Wang, W. Huang, Z. Lei, X. Chu Sox9 Analysis and interpretation of data (e.g., statistical analysis, biostatistics, SBE1 and SBE3 elements on the promoter. Moreover, Sox9 could computational analysis): Y. Chen, M. Huang, T. Wang, C. Chen, Z. Li, C. Liu, also promote MAFB expression by directly binding to the SBE4 W. Lei, Y. Chang, M. Wu, D. Xiang, Y. Chen, Z. Lei element on the MAFB promoter, thereby generating a reciprocally Writing, review, and/or revision of the manuscript: Y. Chen, B. Wang, M. Huang, regulated positive feedback loop in osteosarcoma cells. T. Wang, D. Han, C. Chen, C. Liu, W. Lei, Y. Chang, M. Wu, Y. Chen, Z. Lei, X. Chu We demonstrate that the MAFB–Sox9 feedback loop as an essential Administrative, technical, or material support (i.e., reporting or organizing data, signaling node controlling self-renewal and tumorigenicity of osteo- constructing databases): Y. Chen, W. Lei, W. Huang, X. Chu Study supervision: Y. Chen, B. Wang, W. Lei, D. Xiang, Z. Lei sarcoma stem cells. Sox9 is a transcription factor that plays important roles in normal stem cells and CSCs. Sox9, as well as two additional CSC markers, CD24 and CD44, were elevated upon ectopic expression Acknowledgments of MAFB, suggesting that the MAFB–Sox9 feedback loop may be an This work was supported by the National Natural Science Foundation of China important regulatory pathway of cancer stemness in osteosarcoma. To (81572457 and 81872042 to X. Chu; 81702442 to Z. Lei; 81822032 to B. Wang; fi 81972332 to Y. Chen), the Natural Science Foundation of Jiangsu province test this hypothesis, we puri ed osteosarcoma stem cells using CD24 (BK20170623 to Z. Lei), the Jiangsu Planned Projects for Postdoctoral Research and CD44 as biomarkers (2, 40) and detected elevated expression levels Funds (2018K090B to Z. Lei), the Natural Science Foundation Project of CQ CSTC þ þ of MAFB in CD24 CD44 CSCs. By overexpressing or knocking (cstc2019jcyjjqX0027 to B. Wang), and the funding from the Army Medical Uni- down MAFB expression, we found that MAFB maintains tumor versity (Nos. 2019XQY19, 2018XLC2023, and 2019CXLCA001 to B. Wang; Nos. sphere formation and tumor initiation capacity of CSCs in vitro and 2018XLC3059 and 2019CXLCC005 to T. Wang). in vivo through activating it downstream target Sox9. Moreover, we observed that Sox9-associated self-renewal of osteosarcoma stem cells The costs of publication of this article were defrayed in part by the payment of page were largely dependent on MAFB. Thus, coordinated reciprocal charges. This article must therefore be hereby marked advertisement in accordance activation between MAFB and Sox9 represents an essential mechanism with 18 U.S.C. Section 1734 solely to indicate this fact. underlying stemness maintenance in human osteosarcoma. Furthermore, both MAFB and Sox9 may serve as potential bio- Received June 5, 2019; revised February 6, 2020; accepted March 24, 2020; markers to inform clinical outcomes of patients with osteosarcoma. published first March 31, 2020.

References 1. Isakoff MS, Bielack SS, Meltzer P, Gorlick R. Osteosarcoma: current treatment 3. Brown HK, Tellez-Gabriel M, Heymann D. Cancer stem cells in osteosarcoma. and a collaborative pathway to success. J Clin Oncol 2015;33:3029–35. Cancer Lett 2017;386:189–95. 2. Otoukesh B, Boddouhi B, Moghtadaei M, Kaghazian P, Kaghazian M. Novel 4. Wang T, Wu H, Liu S, Lei Z, Qin Z, Wen L, Liu K, et al. SMYD3 controls a Wnt- molecular insights and new therapeutic strategies in osteosarcoma. Cancer Cell responsive epigenetic switch for ASCL2 activation and cancer stem cell main- Int 2018;18:158. tenance. Cancer Lett 2018;430:11–24.

2482 Cancer Res; 80(12) June 15, 2020 CANCER RESEARCH

MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness

5. Lytle NK, Ferguson LP, Rajbhandari N, Gilroy K, Fox RG, Deshpande A, et al. A 24. Seong BK, Lau J, Adderley T, Kee L, Chaukos D, Pienkowska M, et al. SATB2 multiscale map of the stem cell state in pancreatic adenocarcinoma. Cell 2019; enhances migration and invasion in osteosarcoma by regulating genes involved 177:572–86. in cytoskeletal organization. Oncogene 2015;34:3582–92. 6. Takahashi N, Nobusue H, Shimizu T, Sugihara E, Yamaguchi-Iwai S, Onishi 25. Tsuru A, Setoguchi T, Matsunoshita Y, Nagao-Kitamoto H, Nagano S, Yokouchi N, et al. ROCK inhibition induces terminal adipocyte differentiation and M, et al. Hairy/enhancer-of-split related with YRPW motif protein 1 promotes suppresses tumorigenesis in chemoresistant osteosarcoma cells. Cancer Res osteosarcoma metastasis via matrix metallopeptidase 9 expression. Br J Cancer 2019;79:3088–99. 2015;112:1232–40. 7. Cooper J, Giancotti FG. Integrin signaling in cancer: mechanotransduction, 26. Jia M, Hu J, Li W, Su P, Zhang H, Zhang X, et al. Trps1 is associated with the stemness, epithelial plasticity, and therapeutic resistance. Cancer Cell 2019;35: multidrug resistance of osteosarcoma by regulating MDR1 gene expression. 347–67. FEBS Lett 2014;588:801–10. 8. Yan G-N, Lv Y-F, Guo Q-N. Advances in osteosarcoma stem cell research and 27. Stros M, Ozaki T, Bacikova A, Kageyama H, Nakagawara A. HMGB1 and opportunities for novel therapeutic targets. Cancer Lett 2016;370:268–74. HMGB2 cell-specifically down-regulate the p53- and p73-dependent sequence- 9. Miao Y, Zhang H, Pan Y, Ren J, Ye M, Xia F, et al. Single-walled carbon nanotube: specific transactivation from the human Bax gene promoter. J Biol Chem 2002; One specific inhibitor of cancer stem cells in osteosarcoma upon downregulation 277:7157–64. of the TGFbeta1 signaling. Biomaterials 2017;149:29–40. 28. Dean M, Fojo T, Bates S. Tumor stem cells and drug resistance. Nat Rev Cancer 10. Pai EL, Vogt D, Clemente-Perez A, McKinsey GL, Cho FS, Hu JS, et al. Mafb and 2005;5:275–84. c-Maf have prenatal compensatory and postnatal antagonistic roles in cortical 29. Zhu H, Tang J, Tang M, Cai H. Upregulation of SOX9 in osteosarcoma and its interneuron fate and function. Cell Rep 2019;26:1157–73. association with tumor progression and patients' prognosis. Diagn Pathol 2013; 11. Blank V. Small Maf proteins in mammalian gene control: mere dimerization 8:183. partners or dynamic transcriptional regulators? J Mol Biol 2008;376:913–25. 30. Si W, Huang W, Zheng Y, Yang Y, Liu X, Shan L, et al. Dysfunction of 12. Nishizawa M, Kataoka K, Vogt PK. MafA has strong cell transforming ability but the reciprocal feedback loop between GATA3- and ZEB2-nucleated repression is a weak transactivator. Oncogene 2003;22:7882–90. programs contributes to breast cancer metastasis. Cancer Cell 2015;27:822–36. 13. Pouponnot C, Sii-Felice K, Hmitou I, Rocques N, Lecoin L, Druillennec S, 31. Wang D, Kon N, Lasso G, Jiang L, Leng W, Zhu WG, et al. Acetylation-regulated et al. Cell context reveals a dual role for Maf in oncogenesis. Oncogene 2006; interaction between p53 and SET reveals a widespread regulatory mode. Nature 25:1299–310. 2016;538:118–22. 14. Yang L, Liu Y, Zhu L, Xiao M. DNMT3A R882 mutation is associated with 32. Pavlovic M, Arnal-Estape A, Rojo F, Bellmunt A, Tarragona M, Guiu M, et al. elevated expression of MAFB and M4/M5 immunophenotype of acute myeloid Enhanced MAF oncogene expression and breast cancer bone metastasis. J Natl leukemia blasts. Leuk Lymphoma 2015;56:2914–22. Cancer Inst 2015;107:djv256. 15. Smink JJ, Begay V, Schoenmaker T, Sterneck E, de Vries TJ, Leutz A. Tran- 33. Yu H, Jiang HL, Xu D, Jin JZ, Zhao ZM, Ma YD, et al. Transcription factor MAFB scription factor C/EBPbeta isoform ratio regulates osteoclastogenesis through promotes hepatocellular carcinoma cell proliferation through up-regulation of MafB. EMBO J 2009;28:1769–81. cyclin D1. Cell Physiol Biochem 2016;39:700–8. 16. Miyai M, Hamada M, Moriguchi T, Hiruma J, Kamitani-Kawamoto A, 34. Yang LS, Zhang XJ, Xie YY, Sun XJ, Zhao R, Huang QH. SUMOylated MAFB Watanabe H, et al. Transcription factor MafB coordinates epidermal promotes colorectal cancer tumorigenesis. Oncotarget 2016;7:83488–501. keratinocyte differentiation. J Invest Dermatol 2016;136:1848–57. 35. Drivdahl R, Haugk KH, Sprenger CC, Nelson PS, Tennant MK, Plymate 17. Pettersson AM, Acosta JR, Bjork C, Kratzel J, Stenson B, Blomqvist L, et al. MAFB SR. Suppression of growth and tumorigenicity in the prostate tumor cell as a novel regulator of human adipose tissue inflammation. Diabetologia 2015; line M12 by overexpression of the transcription factor SOX9. Oncogene 58:2115–23. 2004;23:4584–93. 18. Hamada M, Nakamura M, Tran MT, Moriguchi T, Hong C, Ohsumi T, et al. 36. Zhou CH, Ye LP, Ye SX, Li Y, Zhang XY, Xu XY, et al. Clinical significance of MafB promotes atherosclerosis by inhibiting foam-cell apoptosis. Nat Commun SOX9 in human non-small cell lung cancer progression and overall patient 2014;5:3147. survival. J Exp Clin Cancer Res 2012;31:18. 19. Tsuchiya M, Misaka R, Nitta K, Tsuchiya K. Transcriptional factors, Mafs and 37. Riemenschnitter C, Teleki I, Tischler V, Guo W, Varga Z. Stability and their biological roles. World J Diabetes 2015;6:175–83. prognostic value of Slug, Sox9 and Sox10 expression in breast cancers treated 20. Li Y, Min D, Wang K, Yin S, Zheng H, Liu L. MicroRNA152 inhibits cell with neoadjuvant chemotherapy. SpringerPlus 2013;2:695. proliferation, migration and invasion by directly targeting MAFB in nasopha- 38. Guo X, Xiong L, Sun T, Peng R, Zou L, Zhu H, et al. Expression features of SOX9 ryngeal carcinoma. Mol Med Rep 2017;15:948–56. associate with tumor progression and poor prognosis of hepatocellular carci- 21. Qin ZY, Wang T, Su S, Shen LT, Zhu GX, Liu Q, et al. BRD4 promotes gastric noma. Diagn Pathol 2012;7:44. cancer progression and metastasis through acetylation-dependent stabilization 39. Passeron T, Valencia JC, Namiki T, Vieira WD, Passeron H, Miyamura Y, of snail. Cancer Res 2019;79:4869–81. et al. Upregulation of SOX9 inhibits the growth of human and mouse 22. Hu Y, Smyth GK. ELDA: extreme limiting dilution analysis for comparing melanomas and restores their sensitivity to retinoic acid. J Clin Invest depleted and enriched populations in stem cell and other assays. J Immunol 2009;119:954–63. Methods 2009;347:70–8. 40. La Noce M, Paino F, Mele L, Papaccio G, Regad T, Lombardi A, et al. HDAC2 23. Castano~ Z, San Juan BP, Spiegel A, Pant A, DeCristo MJ, Laszewski T, et al. IL-1b depletion promotes osteosarcoma's stemness both in vitro and in vivo: a inflammatory response driven by primary breast cancer prevents metastasis- study on a putative new target for CSCs directed therapy. J Exp Clin Cancer initiating cell colonization. Nat Cell Biol 2018;20:1084–97. Res 2018;37:296.

AACRJournals.org Cancer Res; 80(12) June 15, 2020 2483

MAFB Promotes Cancer Stemness and Tumorigenesis in Osteosarcoma through a Sox9-Mediated Positive Feedback Loop

Yanyan Chen, Tao Wang, Mengxi Huang, et al.

Cancer Res 2020;80:2472-2483. Published OnlineFirst March 31, 2020.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-19-1764

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2020/03/31/0008-5472.CAN-19-1764.DC1

Cited articles This article cites 40 articles, 4 of which you can access for free at: http://cancerres.aacrjournals.org/content/80/12/2472.full#ref-list-1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/80/12/2472. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.