MAFB Promotes Cancer Stemness and Tumorigenesis In

MAFB Promotes Cancer Stemness and Tumorigenesis In

Published OnlineFirst March 31, 2020; DOI: 10.1158/0008-5472.CAN-19-1764 CANCER RESEARCH | MOLECULAR CELL BIOLOGY MAFB Promotes Cancer Stemness and Tumorigenesis in Osteosarcoma through a Sox9-Mediated Positive Feedback Loop Yanyan Chen1, Tao Wang2, Mengxi Huang1, Qin Liu2, Chao Hu3, Bin Wang2, Dong Han4, Cheng Chen1, Junliang Zhang5, Zhiping Li4, Chao Liu6, Wenbin Lei7, Yue Chang1, Meijuan Wu1, Dan Xiang1, Yitian Chen1, Rui Wang1, Weiqian Huang5, Zengjie Lei1, and Xiaoyuan Chu1 ABSTRACT ◥ Despite the fact that osteosarcoma is one of the most common back activation of MAFB was pivotal to tumorsphere-forming and primary bone malignancies with poor prognosis, the mechanism tumor-initiating capacities of osteosarcoma stem cells. Moreover, behind the pathogenesis of osteosarcoma is only partially known. expression of MAFB and Sox9 was highly correlated in osteosar- Here we characterized differentially expressed genes by extensive coma and associated with disease progression. Combined detection analysis of several publicly available gene expression profile datasets of both MAFB and Sox9 represented a promising prognostic and identified musculoaponeurotic fibrosarcoma oncogene homo- biomarker that stratified a subset of patients with osteosarcoma log B (MAFB) as a key transcriptional regulator in osteosarcoma with shortest overall survival. Taken together, these findings reveal a progression. MAFB was highly expressed in tumor tissues and MAFB–Sox9 reciprocal regulatory axis driving cancer stemness and required for proliferation and tumorigenicity of osteosarcoma cells. malignancy in osteosarcoma and identify novel molecular targets MAFB expression was elevated in osteosarcoma stem cells to that might be therapeutically applicable in clinical settings. maintain their self-renewal potential in vitro and in vivo through upregulation of stem cell regulator Sox9 at the transcriptional level. Significance: Transcription factors MAFB and Sox9 form a Sox9 in turn activated MAFB expression via direct recognition of its positive feedback loop to maintain cell stemness and tumor growth sequence binding enrichment motif on the MAFB locus, thereby in vitro and in vivo, revealing a potential target pathway for forming a positive feedback regulatory loop. Sox9-mediated feed- therapeutic intervention in osteosarcoma. Introduction outcomes of patients with osteosarcoma, with the 5-year survival rate up to 60% to 70%, whereas 20% of patients with osteosarcoma with Osteosarcoma is one of the most common primary malignant bone metastasis continue to have poor prognosis (2). tumors with two incidence peaks, one in adolescence and another in Increasing clinical and experimental evidence indicates that oste- the elderly population, especially those above 75 years of age (1). osarcoma stem cells, which derive from mesenchymal stem cells, may Chemotherapy combined with surgery has greatly improved clinical be the cellular origin of osteosarcomas (3). Cancer stem cells (CSC) share many similar properties with normal stem cells and are primarily responsible for tumorigenesis in many cancers (4, 5). For example, a 1Department of Medical Oncology, Affiliated Jinling Hospital, Medical School of subpopulation of self-renewing osteosarcoma cells, namely CSCs, are 2 Nanjing University, Nanjing, Jiangsu Province, P.R. China. Department of endowed with intrinsic capacities for tumor initiation and drug Gastroenterology, Daping Hospital, Third Military Medical University (Army resistance (3, 6). These CSCs are regulated by several key transcription Medical University), Chongqing, P.R. China. 3Department of Orthopedics, 904 Hospital of PLA, North Xingyuan Road, Beitang District, Wuxi, Jiangsu, P.R. factors and signal pathways, such as Oct3/4, Sox2, Nanog, and China. 4Department of Medical Oncology, Jinling Hospital, Nanjing Clinical Notch (7). Compared with differentiated cancer cells, CSCs are School of Southern Medical University, Nanjing, Jiangsu Province, P.R. China. generally more malignant and are critical determinants of the response 5Department of Orthopedics, Affiliated Jinling Hospital, Medical School of to chemotherapy and radiotherapy, and therefore the eradication of 6 Nanjing University, Nanjing, Jiangsu Province, P.R. China. Department of osteosarcoma stem cells may be an effective treatment strategy (8, 9). Medical Oncology, Jinling Hospital, Nanjing Clinical School of Nanjing Medical V-maf avian musculoaponeurotic fibrosarcoma oncogene homolog University, Nanjing, Jiangsu Province, P.R. China. 7Department of Orthopedics, Tianshui Cooperation of Chinese and Western Medicine Hospital, Tianshui, B (MAFB) is a member of the MAF transcription factor family, fi Gansu Province, P.R. China. containing basic leucine zipper domains that bind to speci c DNA elements (10). The seven MAF members are separated into two classes Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). (small and large MAFs). Small MAF proteins (MAFF, MAFG, and MAFK) have been shown to regulate antioxidant responses (11) Y. Chen, T. Wang, M. Huang, Q. Liu, and C. Hu contributed equally as the co-senior whereas large MAFs (MAFA, c-MAF, and MAFB) each contain a authors of this article. similar transactivation domain and are strongly oncogenic (12, 13). In Corresponding Authors: Zengjie Lei, Jinling Hospital, School of Medicine, the hematopoietic system, MAFB induces myelomonocytic differen- Nanjing University, Nanjing, Jiangsu Province 210000, China. Phone: 8625- 8086-0131; E-mail: [email protected]; and Xiaoyuan Chu, tiation in immortalized myoblasts and macrophage differentiation and [email protected] maturation in mice (14). In podocyte differentiation and the main- tenance of progression, aberrant podocyte foot process formation is Cancer Res 2020;80:2472–83 observed in a MAFB-mutant zebrafish embryo model (14). There is doi: 10.1158/0008-5472.CAN-19-1764 also evidence that MAFB regulates osteoclast genesis and epidermal Ó2020 American Association for Cancer Research. keratinocyte differentiation (15, 16). Upregulation of MAFB increases AACRJournals.org | 2472 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2020 American Association for Cancer Research. Published OnlineFirst March 31, 2020; DOI: 10.1158/0008-5472.CAN-19-1764 MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness the risk of various human pathologies, such as diabetes and athero- Multiple early-passage frozen stocks of each cell line in this study sclerotic disorders (17, 18). In addition, MAFB has been shown to were stored under liquid nitrogen: all cell lines were used in exper- promote tumorigenesis, especially in the transformation of pancreatic imentation for no longer than 10 passages from thaw. Cells were used b cells (13, 19). MAFB chromosomal translocations occur more in the described experiments for approximately 6 months. All cell lines frequently in human myeloma cells, and high expression of MAFB were routinely tested for Mycoplasma contamination using MycoP- is observed in patients with acute leukemia blast, hepatocellular robe Mycoplasma Detection Kit (R&D Systems, Inc.), and any con- carcinoma, and colorectal carcinoma (14, 17). Finally, MAFB has taminated cell line was treated with Plasmocin treatment (InvivoGen), been shown to promote nasopharyngeal carcinoma cell proliferation confirmed by negative detection of Mycoplasma before being used and migration (20). again. The most recent testing was 3 months ago. Here, through high-throughput bioinformatic analysis of publicly available transcriptome datasets we identified MAFB as a novel Lentivirus vectors and cell infection regulator of osteosarcoma tumorigenesis. We demonstrate that MAFB The target gene sequence of small hairpin RNA (shRNA; shMAFB-a: promotes tumorigenesis and self-renewal of osteosarcoma stem cells TACTGGATGGCGAGCAACTACCAGCAGAT, shMAFB-b: TCA via a Sox9-mediated feedback activation loop, which could be CCAAGGACGAGGTGATCCGCCTGAAG, shSox9-a: GTGCGCG- exploited to eliminate the culprit cells in osteosarcoma. TCAACGGCTCCAGCAAGAACAA, shSox9-b: CAGCGAACGCA- CATCAAGACGGAGCAGCT) was cloned into the pLVT-Vector (SBO Medical Biotechnology) and was used for the generation of Materials and Methods lentiviruses, which were mixed with lentiviral transfection enhancer Collection and processing of microarray gene expression data (Sigma-Aldrich) and applied to indicated cell lines. Puromycin was Microarray gene expression data of 10 normal and 107 osteosar- then used to select and establish stable expression or knockdown coma tissue samples were extracted from six datasets in the gene cell lines. expression omnibus (GEO) database: GSE14359, GSE16088, GSE16091, GSE14827, GSE12865, and GSE73166. The intersection Western blotting genes of these three platforms were identified (11,808 genes). Combat Total protein was extracted from osteosarcoma cell lines and clinical function was used for removing batch effects in high-throughput samples using M-PER Mammalian Protein Extraction Reagent experiments, the robust multiarray average (RMA) method was used (Thermo Fisher Scientific). Whole cell lysates were separated by for data normalization using R software (R Foundation), and the SDS-PAGE and transferred to nitrocellulose membrane (Bio-Rad). limma package (R Foundation) was used to analyze differently Membranes were blocked with 5% skim milk or BSA and then expressed genes. incubated with primary antibodies (see Supplementary Table S1A) and subsequently with secondary antibodies

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    13 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us