Interplay Between P53 and Epigenetic Pathways in Cancer

Home , Cancer epigenetics, DPF2, Retinoid receptor

University of Pennsylvania ScholarlyCommons

Publicly Accessible Penn Dissertations

2016

Jiajun Zhu University of Pennsylvania, [email protected]

Follow this and additional works at: https://repository.upenn.edu/edissertations

Part of the Biology Commons, Cell Biology Commons, and the Molecular Biology Commons

Recommended Citation Zhu, Jiajun, "Interplay Between P53 and Epigenetic Pathways in Cancer" (2016). Publicly Accessible Penn Dissertations. 2130. https://repository.upenn.edu/edissertations/2130

This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2130 For more information, please contact [email protected]. Interplay Between P53 and Epigenetic Pathways in Cancer

Abstract The human TP53 gene encodes the most potent tumor suppressor protein p53. More than half of all human cancers contain mutations in the TP53 gene, while the majority of the remaining cases involve other mechanisms to inactivate wild-type p53 function. In the first part of my dissertation research, I have explored the mechanism of suppressed wild-type p53 activity in teratocarcinoma. In the teratocarcinoma cell line NTera2, we show that wild-type p53 is mono-methylated at Lysine 370 and Lysine 382. These post-translational modifications contribute ot the compromised tumor suppressive activity of p53 despite a high level of wild-type protein in NTera2 cells. This study provides evidence for an epigenetic mechanism that cancer cells can exploit to inactivate p53 wild-type function. The paradigm provides insight into understanding the modes of p53 regulation, and can likely be applied to other cancer types with wild-type p53 proteins. On the other hand, cancers with TP53 mutations are mostly found to contain missense substitutions of the TP53 gene, resulting in expression of full length, but mutant forms of p53 that confer tumor-promoting “gain-of-function” (GOF) to cancer. In the second section of my dissertation, I have investigated the mechanism of this GOF property by examining genome-wide p53 binding profiles in multiple cancer cell lines bearing p53 mutations. This reveals an epigenetic mechanism underlying mutant p53 GOF. Various GOF p53 mutants bind to and upregulate genes including MLL1, MLL2, and MOZ, leading to genome-wide changes of histone modifications. These studies also demonstrate a critical functional role of the MLL pathway in mediating mutant p53 GOF cancer phenotypes, and that genetic or pharmacological perturbation of MLL function can achieve specific inhibition of GOF p53 cell proliferation. Overall, studies described in this dissertation demonstrate the crosstalk between p53 signaling and chromatin regulatory pathways, contribute to our knowledge of p53 cancer biology with respect to epigenetic regulation, and in the long term suggest new therapeutic opportunities in targeting cancers according to their p53 mutational status.

Degree Type Dissertation

Degree Name Doctor of Philosophy (PhD)

Graduate Group Cell & Molecular Biology

First Advisor Shelley L. Berger

Keywords cancer, chromatin, epigenetics, genomics, p53

Subject Categories Biology | Cell Biology | Molecular Biology

This dissertation is available at ScholarlyCommons: https://repository.upenn.edu/edissertations/2130

INTERPLAY BETWEEN p53 AND EPIGENETIC PATHWAYS

IN CANCER

Jiajun Zhu

A DISSERTATION in Cell and Molecular Biology Presented to the Faculties of the University of Pennsylvania in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy 2016

Supervisor of Dissertation

______

Shelley L. Berger , Ph.D.

Daniel S. Och University Professor

Graduate Group Chairperson

______

Daniel S. Kessler, Ph.D.

Associate Professor of Cell and Developmental Biology

Dissertation Committee:

Roger A. Greenberg, M.D., Ph.D., Associate Professor of Cancer Biology

Gerd A. Blobel, M.D., Ph.D., Professor of Pediatrics

F. Bradley Johnson, M.D., Ph.D., Associate Professor of Pathology and Laboratory Medicine

Xiaolu Yang, Ph.D., Professor of Cancer Biology

To my parents, Sudan Li and Feili Zhu

For their love and support

ACKNOWLEDGMENT

First and foremost, I owe my deepest gratitude to my thesis advisor Dr. Shelley L. Berger, for her unreserved support and mentorship throughout my graduate studies. Her enthusiasm for scientific discoveries and immense knowledge across research fields have guided me along the way of becoming an independent scientist. I am also thankful for the vibrant laboratory environment

Shelley has created. I appreciate collaboration as well as friendship with all past and present members in the Berger lab.

Special thanks to Morgan A. Sammons, who since my rotation in the Berger lab has led my journey in formulating scientific questions and conducting experiments; Zhixun Dou, who is always passionate for science and inspiring to me, has offered enormous intellectual and technical ideas and assistance to me; Greg Donahue, without whom it would be impossible for me to learn any of the powerful computational skills that have helped my research projects tremendously.

It is also my honor to be under the mentorship of a fantastic thesis committee, Drs. Roger A.

Greenberg, Gerd A. Blobel, F. Bradley Johnson, and Xiaolu Yang. They have been inspiring and suggestive with their own knowledge and experiences, and supportive towards building up my own career.

I would like to extend my appreciation to collaborators outside the Berger lab. Dr. Michael A.

Tainsky for generously sharing the Li-Fraumeni Syndrome cells; Drs. Cheryl H. Arrowsmith and

Xianxin Hua for kind support, enabling me to utilize MLL1 pharmacological inhibitors; and Dr. iii

Ali Shilatifard for access to MLL1 cDNA plasmids. Without these and all other collaborative efforts, I could not have achieved anything in my graduate studies.

I also want to acknowledge the Cancer Biology program in the Cell and Molecular Biology graduate group. The relaxing yet interactive and critical scientific environment, and the efficient and helpful administrative efforts all make it a big warm family based on which my graduate life has been more colorful and fruitful.

There are far more people and support I am grateful for. I apologize to those names I could not list due to a limited space. But I wish to convey my thankfulness all the same, and I do appreciate them being along with me in the journey, with great moments I will always memorize.

ABSTRACT

INTERPLAY BETWEEN p53 AND EPIGENETIC PATHWAYS IN CANCER

Jiajun Zhu

Thesis advisor: Shelley L. Berger, Ph.D.

The human TP53 gene encodes the most potent tumor suppressor protein p53. More than half of all human cancers contain mutations in the TP53 gene, while the majority of the remaining cases involve other mechanisms to inactivate wild-type p53 function. In the first part of my dissertation research, I have explored the mechanism of suppressed wild-type p53 activity in teratocarcinoma.

In the teratocarcinoma cell line NTera2, we show that wild-type p53 is mono-methylated at

Lysine 370 and Lysine 382. These post-translational modifications contribute to the compromised tumor suppressive activity of p53 despite a high level of wild-type protein in NTera2 cells. This study provides evidence for an epigenetic mechanism that cancer cells can exploit to inactivate p53 wild-type function. The paradigm provides insight into understanding the modes of p53 regulation, and can likely be applied to other cancer types with wild-type p53 proteins. On the other hand, cancers with TP53 mutations are mostly found to contain missense substitutions of the TP53 gene, resulting in expression of full length, but mutant forms of p53 that confer tumor- promoting “gain-of-function” (GOF) to cancer. In the second section of my dissertation, I have investigated the mechanism of this GOF property by examining genome-wide p53 binding profiles in multiple cancer cell lines bearing p53 mutations. This reveals an epigenetic mechanism underlying mutant p53 GOF. Various GOF p53 mutants bind to and upregulate genes including

MLL1, MLL2, and MOZ, leading to genome-wide changes of histone modifications. These studies v

also demonstrate a critical functional role of the MLL pathway in mediating mutant p53 GOF cancer phenotypes, and that genetic or pharmacological perturbation of MLL function can achieve specific inhibition of GOF p53 cell proliferation. Overall, studies described in this dissertation demonstrate the crosstalk between p53 signaling and chromatin regulatory pathways, contribute to our knowledge of p53 cancer biology with respect to epigenetic regulation, and in the long term suggest new therapeutic opportunities in targeting cancers according to their p53 mutational status.

TABLE OF CONTENTS

Dedication ...... ii Acknowledgement ...... iii Abstract ...... v Table of contents ...... vii List of tables...... ix List of figure ...... x

Chapter 1: General introduction ...... 1 Figures ...... 23

Chapter 2: Materials and methods ...... 28 Tables ...... 36

Chapter 3: Lysine methylation represses wild-type p53 activity in teratocarcinoma cells ...... 39 3.1 Abstract ...... 40 3.2 Introduction ...... 41 3.3 Results ...... 43 3.3a NTera2 exhibits high levels of Smyd2 and Pr-Set7 ...... 43 3.3b Characterization of p53 methylation specific antibodies ...... 44 3.3c p53 is mono-methylated at K370 and K382 in NTera2 cells .... 45 3.3d Smyd2 and Pr-Set7 knockdown activate p53 transcription activity and promote a differentiation feature of NTera2 cells ...... 45 3.4 Discussion ...... 47 3.4a Methylation-deficient p53 mutants ...... 47 3.4b p53 methylation levels between teratocarcinoma cells and other wild-type p53 cancer cells ...... 48 Figures ...... 50

vii

Chapter 4: Gain-of-function p53 mutants co-opt chromatin pathways to drive cancer growth ...... 55 4.1 Abstract ...... 56 4.2 Introduction ...... 57 4.3 Results ...... 58 4.3a Genome-wide binding of mutant p53 ...... 58 4.3b GOF mutant p53 targets chromatin regulators...... 59 4.3c GOF p53 regulates MLL, MOZ, and histone modifications ..... 61 4.3d MLL1 is essential for cancer phenotype of GOF p53 ...... 63 4.3e COMPASS inhibitors reduce GOF p53 cell growth ...... 65 4.3f TCGA analysis ...... 66 4.4 Discussion ...... 68 Tables ...... 70 Figures ...... 71

Chapter 5: Future directions ...... 99 5.1 Summary ...... 100 5.2 Future directions ...... 101 5.2a Post-translational modifications of p53 in cancer ...... 101 5.2b How does p53 methylation repress p53 activity? ...... 102 5.2c GOF p53 activates MLL1 – in vivo significance? ...... 103 5.2d Downstream targets of MLL and MOZ in GOF p53 tumors .. 105 5.2e Other chromatin regulators targeted by GOF p53 ...... 106 5.2f Ribosomal synthesis and protein translation ...... 107 5.2g GOF p53 interacts with ETS family proteins ...... 109 Tables ...... 111 Figures ...... 112

Bibliography ...... 115

viii

LIST OF TABLES

Table 2.1 ChIP-qPCR primers ...... 36

Table 2.2 RT-qPCR primers ...... 37

Table 2.3 shRNA and sgRNA targeted sequences ...... 38

Table 4.1 p53 R273H targets GO terms ...... 70

Table 5.1 Ribosomal synthesis and protein translation genes targeted by GOF p53 ...... 111

LIST OF FIGURES

Figure 1.1 p53 structural domains ...... 24

Figure 1.2 Downstream pathways of p53 ...... 25

Figure 1.3 Major mechanisms of mutant p53 “gain-of-function” ...... 26

Figure 1.4 The MLL1 COMPASS complex ...... 27

Figure 3.1 Western blot analysis and quantification of protein levels between NTera2, IMR90, U2OS, MCF7, A549 and A498 cells ...... 50

Figure 3.2 The p53K370me1 and p53K382me1 antibodies recognize wild-type, but not methylation-deficient forms of p53 ...... 51

Figure 3.3 Peptide competition assay for p53K370me1 and p53K382me1 antibodies ...... 52

Figure 3.4 p53 is mono-methylated at K370 and K382 in NTera2 cells ...... 53

Figure 3.5 Smyd2 and Pr-Set7 knockdown increases p53 target gene expression ...... 54

Figure 4.1 Genome-wide binding patterns comparing WT p53 and GOF p53 ...... 71

Figure 4.2 ETS2 interacts with GOF p53 but not WT p53 ...... 73

Figure 4.3 ETS family ChIP-seq peaks overlapping GOF p53 or WT p53 TSS-proximal peaks ...... 75

Figure 4.4 GOF p53 mutants target chromatin regulators ...... 76

Figure 4.5 ChIP-qPCR validation of GOF p53 binding to chromatin regulatory genes ...... 77

Figure 4.6 ETS2 mediates GOF p53 binding at chromatin regulatory genes ...... 79

Figure 4.7 p53 knockdown decreases expression of MLL1, MLL2 and MOZ ...... 80

Figure 4.8 ETS2 knockdown decreases MLL1, MLL2 and MOZ expression levels ...... 81

Figure 4.9 Histone PTM changes upon GOF p53 knockdown ...... 83

Figure 4.10 Mll1 expression levels in MEFs with wild-type p53, GOF p53 or p53null ...... 84

Figure 4.11 Histone modifications in MEFs bearing wild-type p53, GOF p53 or p53 null ...... 85

Figure 4.12 Knockdown of MLL reduces growth of GOF p53 but not wild-type p53 cancer cells ...... 87

Figure 4.13 MLL1 knockdown reduces the tumor phenotype of GOF p53 cancer cells ...... 88

Figure 4.14 Mll1 knockdown reduces proliferation of MEFs bearing GOF p53R172H ...... 90

Figure 4.15 MLL1 knockdown reduces proliferation of GOF p53 Li-Fraumeni Syndrome cells ...... 92

Figure 4.16 COMPASS inhibitors specifically reduce growth of GOF p53 but not p53 null LFS cells ...... 94

Figure 4.17 OICR9429 specifically reduces growth of GOF p53 but not p53 null MEFs ...... 95

Figure 4.18 TCGA analysis in combined cancer types ...... 96

Figure 4.19 TCGA analysis in brain lower grade glioma ...... 97

Figure 4.20 TCGA analysis in head and neck squamous cell carcinoma ...... 98

Figure 5.1 NTera2 differentiation and examination of p53 PTMs ...... 112

Figure 5.2 ChIP-qPCR validation of GOF p53 mutants binding to genes encoding chromatin regulators ...... 113

Figure 5.3 Genome browser track views of GOF p53 (R273H) binding at genes encoding for protein translation regulators ...... 114

CHAPTER 1

General introduction

This chapter is background introduction to the dissertation work. It provides an overview of the p53 tumor suppressor, “gain-of-function” p53 mutations, and epigenetic regulatory pathways.

Our current knowledge of their roles in human cancer is the primary focus of this chapter, with particular emphasis on aspects directly related to this dissertation.

- 1 -

1.1 Wild-type p53 is a potent tumor suppressor

1.1a Discovery of p53 – from tumor antigen to tumor suppressor

In 1979, Lane and Crawford (Lane and Crawford, 1979) and Linzer and Levine (Linzer and

Levine, 1979) reported that the SV40 large tumor antigen was bound to a 53 kD (kilodalton) human cellular protein which thereby acquired the name p53. This observation and others following had soon become the first explanation as to how SV40 tumor antigen transform cells, and p53 was therefore initially recognized as an oncogenic protein (DeLeo et al., 1979)

In the following years, many groups simultaneously worked on cloning the p53 gene, and had obtained multiple clones independently. Among these were the Oren’s clone (Moshe Oren) from a mouse liver genomic library (Bienz et al., 1984; Oren and Levine, 1983) and the Pennica’s clone (Dianne Pennica) from mouse F9 teratocarcinoma cells (Pennica et al., 1984), for example.

People were keen to test if p53 was truly an oncogene that could transform cells, as suggested by its discovery as a tumor antigen. However, results were contradictory depending on which specific p53 clone was used to perform the transformation experiments (Eliyahu et al., 1984;

Jenkins et al., 1984; Parada et al., 1984).

Finally, after almost ten years’ effort from the initial discovery, the field eventually came to appreciate that p53, in its wild-type form, acts as an anti-oncogenic or tumor suppressor protein

(Baker et al., 1989; Finlay et al., 1989; Finlay et al., 1988), whereas other clones of p53 that only differ by one amino acid from the wild-type form, when overexpressed, could act as an oncogenic protein (Ben David et al., 1988; Hinds et al., 1989; Munroe et al., 1988). Interestingly, the Oren’s clone, which was based on the mouse liver genomic library (Bienz et al., 1984) turned out to be a

- 2 -

mutant form of p53, whereas the Pennica’s clone derived from mouse F9 teratocarcinoma cells

(Pennica et al., 1984) is wild-type. In fact, many transformed cell lines in culture contain a diverse set of mutant p53 but most teratocarcinoma cell lines or tumors contain wild-type p53 protein (Lutzker and Levine, 1996).

The first ten years of p53 discovery, from its original identification as a tumor antigen until finally recognized as a tumor suppressor, although dramatic and torturous, has demonstrated typical progress of scientific advance. More important, these findings opened up whole new avenues of investigations of p53 biology and our understanding of human cancer. The debate around p53 being oncogenic or tumor suppressive in the context of teratocarcinoma and other cancers also provided direct rationale for studies discussed in this dissertation, as detailed below.

1.1b Wild-type p53 functions as a transcription factor

The realization of p53’s function as a tumor suppressor has prompted the search for its mechanism. Soon people came to recognize p53 as a transcription factor along with the identification of its consensus DNA binding motif (el-Deiry et al., 1992; Funk et al., 1992) as 5′-

RRRCWWGYYY-3′ (R = guanine or adenine, G or A; W = thymine or adenine, T or A; Y = cytosine or thymine, C or T). Studies have also revealed structural features of the p53 protein. p53 is divided into several domains (Figure 1.1): an amino-terminus containing two tandem transcriptional activation regions (residues 1-42 and residues 43-92) (Brady et al., 2011; Candau et al., 1997; Unger et al., 1992); a sequence-specific core DNA-binding domain (residues 101-

300) (Bargonetti et al., 1993; Halazonetis and Kandil, 1993; Pavletich et al., 1993; Wang et al.,

1993); a tetramerization domain required for oligomerization of the proteins (residues 326-356)

- 3 -

(Pavletich et al., 1993; Sturzbecher et al., 1992; Wang et al., 1993); and a carboxyl-terminus regulatory region (residues 364-393) (Wang et al., 1993).

These findings pointed to p53’s major cellular role as a transcriptional factor. Over decades, people have identified many transcriptional target genes of p53, among which are: p21 (also known as CDKN1A) (el-Deiry et al., 1993); MDM2 (Momand et al., 1992; Wu et al., 1993);

PUMA (also known as BBC3) (Nakano and Vousden, 2001); BAX (Miyashita and Reed, 1995);

GADD45A (Kastan et al., 1992); and many others. Collectively, they have revealed downstream pathways that p53 dictates (Figure 1.2), including DNA damage checkpoint (Kastan et al., 1992), cell cycle arrest (el-Deiry et al., 1993), senescence (Lin et al., 1998; Serrano et al., 1997), apoptosis (Miyashita and Reed, 1995; Nakano and Vousden, 2001), metabolism (Vousden and

Ryan, 2009), differentiation (Almog and Rotter, 1997; Stiewe, 2007) and most recently, iron- dependent ferroptosis (Jiang et al., 2015).

These pathways overall contribute to the tumor suppressive function of p53, yet how p53 mechanistically distinguishes among these choices is still largely undetermined, as many outcomes are mutually exclusive from each other. One possible explanation is that p53 utilizes chromatin environmental information to instruct the activation of context-specific genes. This is supported by a number of studies showing that co-factors or local chromatin features can bias p53’s target gene activation, particularly the decisions between cell cycle arrest and apoptosis pathways (Desantis et al., 2015; Espinosa and Emerson, 2001; Gomes and Espinosa, 2010;

Samuels-Lev et al., 2001). Post-translational modifications (PTMs) have also been shown as a mechanism to modulate p53 target selection (Smeenk et al., 2011; Tang et al., 2006), in addition to serving as integrators of cellular stress signals to control p53 activity, as detailed below and in

Chapter 3. - 4 -

1.2 Hotspot p53 mutations and the “gain-of-function” (GOF) hypothesis

1.2a Formulation of the GOF hypothesis

Soon after the discovery of p53, it became clear that p53 is the most frequently mutated gene in all human cancers. Typically one allele of p53 contains a missense mutation while the other allele is rearranged or deleted – a process known as “loss of heterozygosity”. It results in expression of a mutant form of p53 in the absence of wild-type protein. This idea is also supported by findings from the Li-Fraumeni Syndrome (LFS) families, where patients are born with p53 germline mutations and are highly susceptible to developing cancers later in their lives (Malkin et al.,

1990). These early observations and others have collectively led to the recognition that during tumor progression, cancer cells are selecting for p53 missense alterations, or in other words, p53 missense mutations may confer growth advantage to tumors (Levine et al., 1991; Prives and

Manfredi, 1993).

More detailed analyses of specific animo acid residues that are most frequently substituted uncovered four regions (residues 117-142, 171-181, 234-258, and 270-286) in the DNA-binding domain of p53 protein wherein mutations primarily occur. Accumulating clinical evidence now has revealed several hotspot residues of mutation, including R175, R245, R248, R249, R273, and

R282 (Freed-Pastor and Prives, 2012; Olivier et al., 2010; Soussi et al., 1990). Structural studies provide explanations for the prevalence of mutational clusters. These regions provide either direct

DNA contacts, or structural scaffolding supports for DNA binding (Cho et al., 1994). Notably, structural and biochemical analyses also suggest that mutations in certain residues or regions could alter the p53 protein conformation, and therefore may provide the possibility for mutant

- 5 -

p53 novel functions beyond loss of wild-type direct DNA-contact-based transcription (Cho et al.,

1994).

While mutant p53 could exert both “dominant-negative” and “gain-of-function” effects, the latter is supported by the initial mis-recognition of p53 (mutant forms) as an oncogene, as well as some early findings showing that introducing mutant p53 into an otherwise p53 deficient background enhanced the tumorigenic phenotype (Dittmer et al., 1993; Wolf et al., 1984). Later on with the advent of mouse genetics, mutant p53 knock-in mice were generated, providing direct demonstration of the GOF hypothesis. Specifically, with the knock-in of p53 R172H or p53

R270H (equivalent to human R175H and R273H, respectively) into the endogenous p53 gene loci, mice develop different spectra of cancers with higher metastatic capacity compared to the p53 knock-out counterparts. Further, ex vivo mouse embryonic fibroblasts (MEFs) from these knock-in mice grow more rapidly than the MEFs from the knock-out mice (Lang et al., 2004;

Olive et al., 2004). Questions remain, including whether different hotspot mutations of p53 share common GOF mechanisms while retaining distinct mutant-specific functions. The complexity is further supported by evidence that different tissues have different preferences for p53 mutations, and that different mutant p53 knock-in mice seem to have different extents of “gain-of-function” phenotypes (Levine et al., 1991; Xu et al., 2014; Yoshikawa et al., 2010). Some of these points will be revisited and further detailed in Chapter 4.

1.2b Mechanisms and targets of GOF p53 mutants

The tumorigenic advantage of mutant p53 over the simple loss of wild-type activity has now been tested by numerous experiments, providing insights into the downstream targets mediating “gain- of-function”. For example, GOF p53 can increase chemotherapy resistance. In p53-null H1299

- 6 -

lung adenocarcinoma cells, introduction of certain p53 mutants can lead to cells becoming more resistant to etoposide or cisplatin treatment (Blandino et al., 1999). Mutant p53 also enhances resistance to drugs such as doxorubicin or cisplatin in M1/2 myeloid cells by interfering with apoptosis pathways (Li et al., 1998). Moreover, as shown in Li-Fraumeni Syndrome fibroblasts, mutant p53 transcriptionally activates TDP2, a 5’-tyrosyl DNA phosphodiesterase involved in

DNA damage repair, to promote etoposide resistance (Do et al., 2012). GOF mutant p53 also contributes to elevated metastasis and invasiveness. For example, acquisition of mutant p53 in p53-negative background results in increased metastatic potential and tissue invasiveness in cervical cancer and lymphoblastic leukemia (Crook and Vousden, 1992; Hsiao et al., 1994). In mouse models of pancreatic ductal adenocarcinomas following an initiating activating mutation in KRAS, mutant p53, as compared with genetic loss of p53, specifically promotes metastasis

(Morton et al., 2010).

Along with these and many other phenotypic observations, mechanisms of mutant p53 “gain-of- function” have also started to emerge. One set of evidence points to mutant p53 functioning to abrogate the tumor-suppressive activities of p53 family members p63 and p73 (Figure 1.3A). A number of mutant p53 proteins bind to and interfere with the function of multiple isoforms of p63

(p63 α and -γ; ΔNp63 α and -γ) and p73 (p73 α, -β, -γ, -δ), thereby blocking p63 or p73 induced apoptosis. The efficiency of mutant p53 binding to p63 and p73 correlates with the inhibition of p63 and p73 function (Gaiddon et al., 2001; Marin et al., 2000; Strano et al., 2000). In a mouse model of pancreatic cancer, a highly metastatic disease that frequently displays p53 mutations, mutant p53 inhibits p73/NF-Y complex which otherwise represses the expression of platelet derived growth factor receptor β (PDGFRβ), a necessary and sufficient factor to maintain the prometastatic phenotype (Weissmueller et al., 2014). This paradigm can also crosstalk with other signaling pathways. For instance, mutant p53 and p63 protein complex can serve as an essential - 7 -

platform to further form a ternary complex with Smad proteins. Through this mechanism, mutant p53 empowers the switch of TGFβ signaling from early stage tumor suppressive to become prometastatic factors in advanced cancers (Adorno et al., 2009).

In addition to the inhibitory role of mutant p53 to p63/p73 functions, another large set of findings support a more direct “gain-of-function” role of mutant p53, where an intact transactivation domain of mutant p53 is required. For example, mutant p53 is recruited by the SREBP transcription factors to activate the mevalonate pathway in breast cancer cells, and therefore disrupts the three-dimensional tissue architecture and promotes tumorigenesis (Freed-Pastor et al.,

2012). Mutant p53 can also physically and functionally interact with vitamin D receptor (VDR) and modulate VDR-regulated genes – augmenting expression of some genes while relieving the repression of others, and overall contributing to an anti-apoptotic phenotype (Stambolsky et al.,

2010). Mutant p53 can also bind ETS family proteins and activate genes contributing to cancer cell migration and invasion, as well as drug resistance (Do et al., 2012; Xiong et al., 2014). In addition, “gain-of-function” of mutant p53 has been attributed to association with promoter regions of certain micro RNAs and hence to activate these tumorigenic non-coding RNAs. It is not yet clear how mutant p53 binds to these genomic regions encoding the micro RNAs, but it is likely through interaction with other cofactors (Donzelli et al., 2014; Masciarelli et al., 2014;

Wang et al., 2013).

Collectively, these studies provide evidence for alternative mechanisms where mutant p53 can be directed, through interaction with other transcription factors, to novel genes, and functionally activate pro-tumorigenesis pathways (Figure 1.4B). In fact, the unleashed ability of mutant p53 to associate with novel regulatory factors has been suggested from the structural study of wild-type p53, as mentioned above (Cho et al., 1994). Biochemical assays have also started to reveal critical - 8 -

interaction mechanisms of mutant p53 with different partners (Do et al., 2012; Zhao et al., 2015).

Uncovering these binding details offers potent therapeutic opportunities to specifically target tumors with “gain-of-function” mutant p53. Some of these points will again be revisited and further detailed in Chapter 4 and Chapter 5.

- 9 -

1.3 Chromatin pathways and epigenetics

It has now been well established that genomic and chromatin features play key, if not decisive roles on gene expression outcomes of associated transcription factors (Kouzarides, 2002, 2007).

The potent transcription factor p53 is subject to tight modulation by local epigenetic characteristics. On the other hand, the effect of transcription factors can also manifest through broad epigenetic changes. This section discusses basics of chromatin pathways, with particular emphasis on topics directly related to later chapters in this dissertation.

1.3a Histone modifications and gene transcription

In all eukaryotic cells, the genetic information DNA is highly compacted into the chromatin structure by histones and nonhistone proteins. Nucleosomes are the basic repeating unit of chromatin, each consisting of 146 base pairs (bp) of DNA, or roughly two helical turns of DNA wrapping around a core histone protein octamer – an H3-H4 tetramer and two H2A-H2B dimers

(Luger et al., 1997). These histones are small basic proteins with core globular domains, and relatively unstructured amino-terminal tails that are subject to heavy post-translational modifications.

Covalent post-translational modifications on histones represent an important component of potentially heritable, but reversible changes in gene expression that occur without alterations in

DNA sequences (Jenuwein and Allis, 2001). Elegant genetic experiments in Saccharomyces cerevisiae and Drosophila melanogaster provided some of the earliest findings of covalent histone modifications. These studies were largely based on the observation known as position- effect variegation (PEV), which indicates that the epigenetic “on-and-off” transcriptional states are greatly dependent on the position of a gene within euchromatic (accessible) or

- 10 -

heterochromatic (inaccessible) chromatin environment. Genetic screens in flies identified a class of genes that suppress the variegation phenomenon, or the Su(var) group. This group of genes turns out to be members of the histone deacetylases (HDACs), histone methyl-transferases, protein phosphatases, and chromatin associated components such as the heterochromatin protein

HP1. Deletion of genes in this group rescues the variegation phenotype (Eissenberg et al., 1990;

Wallrath, 1998). On the other hand, these genetic screens also identified another class of PEV modifiers that enhance the variegation phenomenon, or the E(var) group, several members of which turn out to be components of adenosine triphosphate (ATP) – dependent chromatin remodeling complexes (Kal et al., 2000; Tsukiyama and Wu, 1997), the other family of chromatin modifiers in addition to covalent histone post-translational modifications. Further extensions of these discoveries in Su(var) and E(var) revealed critical and conserved structural and catalytic domains including the bromo-, chromo- and SET domains. These domains are universally shared by other chromatin regulators, for example, SNF2, Su(var)3-9, and the Polycomb and trithorax groups (Dhalluin et al., 1999; Tschiersch et al., 1994; van Lohuizen, 1999), and have therefore largely expanded our understanding of chromatin pathways.

Until now, there are at least eight different classes of covalent modifications identified, involving at least 60 distinct modification sites on histones. These modifications include: lysine acetylation, lysine and arginine methylation, serine and threonine phosphorylation, lysine ubiquitylation, lysine sumoylation, glutamate poly-ADP ribosylation, arginine deamination and proline isomerization. All of these modifications are functionally related to gene transcription, in addition to other biological processes such as DNA repair, replication and chromatin condensation

(Bannister and Kouzarides, 2011; Kouzarides, 2007; Tessarz and Kouzarides, 2014). The chemical modifications and vast array of modifiable sites in numerous canonical and variant histones give chromatin enormous potential for functional responses. Further, the dynamic feature - 11 -

of most of the modifications brings in extra complexity as well as more refined spatial and temporal gene regulation.

There are two categories of well-characterized mechanisms for the influence of histone modifications on gene regulation and other biological processes. The first mechanism involves alteration of intra- and internucleosomal histone/DNA contacts via steric or charge changes (also known as “cis” mechanism); and the second mechanism involves recruitment or occlusion of non-histone proteins, or “readers” of specific modifications (also known as “trans” mechanism).

The “trans” mechanism seems to be more universal to most of the chromatin associated biological processes (Wang et al., 2007).

Lysine acetylation and methylation are best studied for their roles in gene transcriptional regulation. Acetylation is almost invariably associated with transcription activation (Sterner and

Berger, 2000), whereas the output of lysine methylation can be either activation or repression to transcription (Bannister and Kouzarides, 2005). Methylation on histone H3 Lysine 4, Lysine 36 and Lysine 79 (H3K4, H3K36 and H3K79, respectively) has generally been implicated in activation of gene transcription. For example, H3K4 tri-methylation (H3K4me3) localizes to the promoter region of active genes and is associated with the initiated form of RNA polymerase II

(Pol II, phosphorylated at serine 5). H3K36 tri-methylation (H3K36me3) is enriched in the gene body and usually associates with the elongating form of RNA Pol II (phosphorylated at serine 2).

On the other hand, methylation on histone H3 Lysine 9, Lysine 27 (H9K9, H3K27, respectively) and histone H4 Lysine 20 (H4K20) is linked to transcription repression. For example, H3K9 tri- methylation (H3K9me3) is involved in forming silent heterochromatin and recruiting HP1 to promoter regions of repressed genes. These histone modifications and the associated chromatin factors cooperate with transcription factors to orchestrate gene expression. - 12 -

1.3b Chromatin pathways and cancer – example of the MLL1 gene rearrangement in leukemia

In addition to genetic alterations, epigenetic aberrations contribute to the initiation and progression of human cancers (Wang et al., 2007).This is certainly not surprising, given the global impact of chromatin pathways on gene transcription. In this section, the example of

H3K4me3 and the mixed lineage leukemia (MLL1, also known as MLL or KMT2A) gene rearrangement is illustrated in the context of human leukemia. This discussion is also related to content in Chapter 4.

The MLL1 gene was first identified because of its recurrent translocations in human leukemia, accounting for about 80% of infant leukemia and 5-10% of adult acute myeloid leukemia (AML) or lymphoid leukemia (Biondi et al., 2000; Huret et al., 2001). Later on, MLL1 was found to be the gene encoding for a methyltransferase specific for H3K4 methylation (Milne et al., 2002;

Nakamura et al., 2002). The gene product MLL1 normally resides and functions in a complex termed the COMPASS (complex associated with set1), together with other core complex components including WDR5, RBBP5 and ASL2, as well as other associated factors such as menin (also known as MEN1) (Figure 1.4). In human, there are six members of the COMPASS complex family, each with a distinct core enzyme and variable associated components. The proper assembly of the MLL1 COMPASS complex has been shown to be essential for the efficient enzymatic activity of MLL1 as a H3K4 methyltransferase (Shilatifard, 2012).

There are two major mechanisms characterized for MLL1 mediated leukemia. The first one involves the partial tandem duplication of MLL1 (MLL-PTD), which is the most prevalent form of

- 13 -

MLL1 rearrangement in AML (Hess, 2004; Krivtsov and Armstrong, 2007; Shih et al., 2006).

The duplicated region contains the in-frame sequence of MLL1 exon 4 to 11. Even though this is not a direct duplication of the MLL1 enzymatic SET domain (which resides towards the carboxyl-terminus of MLL1 protein), a mouse model has demonstrated that MLL-PTD facilitates

H3K4me3, as well as H3 and H4 acetylation within the Hox gene clusters – major MLL1 targets in normal hematopoietic development and aberrantly activated in leukemia. The enhancement of acetylation is possibly due to increased recruitment of the acetyltransferases CBP and p300

(Dorrance et al., 2006).

The second class of MLL1 gene rearrangement are MLL1 fusions, where a part of MLL1 gene is translocated and aberrantly fused with other partner genes. At least 50 different MLL1 fusion partners have been identified in leukemia, of which the fusions with the nuclear proteins AF4,

AF9, AF10, ENL and ELL account for most cases. These translocation fusions usually lose the carboxyl-terminal SET domain of MLL1, however, novel transactivation activity is acquired through partnering with fusion components to reinsure, or even further enhance the expression of

Hox genes (Krivtsov and Armstrong, 2007). For example, a subset of fusion proteins, including

AF9, AF10 and ENL, directly or indirectly facilitate the recruitment of the DOT1L methyltransferase and enhance H3K79me3 over Hox genes (Erfurth et al., 2004; Okada et al.,

2005; Zeisig et al., 2005). In addition, the MLL1-EEN fusion is shown to recruit the histone arginine methyltransferase (PRMT1) to MLL1 target genes (Cheung et al., 2007). These and other lines of evidence suggest that the loss of H3K4me3 catalyzing ability in cases of MLL1 fusions is in part compensated by other histone modification mechanisms, with further perturbed local transcriptional control, to sustain activation of Hox clusters and other genes. Of course these translocation fusion partners also assist in assembling additional transcription machineries such as the “super elongation complex” family, contributing to dire tumorigenesis (Luo et al., 2012). - 14 -

The perturbation of histone modifications and chromatin pathways in cancer certainly goes beyond leukemia and the MLL1 regulation. Various genetic and signaling alterations in multiple cancer types have evolved to co-opt chromatin pathways in cancer initiation and progression. As a result, targeting key components in the pathways have emerged as effective epigenetic therapeutics in treating cancer.

1.3c Post-translational modifications on p53

Post-translational modifications can also occur on non-histone proteins, and the first characterized and best studied such protein is p53. As mentioned above, p53 contains a central DNA binding domain as well as relatively unstructured amino-terminal and carboxyl-terminal regions. This very much resembles the unstructured histone tails. Indeed, both the amino-terminus and the carboxyl-terminus are subject to heavy post-translational modifications. There have been more than 50 distinct modifications discovered on p53, including phosphorylation, ubiquitination, neddylation, sumolation, acetylation, and methylation, and, again, the majority of them occur at the amino- or carboxyl-terminal end (Meek and Anderson, 2009). Phosphorylation and ubiquitination will be briefly introduced below, while more details will be discussed below regarding acetylation and methylation, as they are more relevant to content in Chapter 3.

The p53 protein contains an array of serine and threonine phosphorylation sites that are mostly concentrated within the amino-terminal transactivation domain (Dai and Gu, 2010). The majority of these sites are rapidly phosphorylated following cellular stress such as DNA damage to help stabilize p53, to recruit coactivators and to enhance transcription activity (Matsumoto et al., 2006;

Toledo and Wahl, 2006). On the other hand, polyubiquitination primarily targets p53 for

- 15 -

proteasomal degradation. MDM2 is a canonical target of p53, the gene product of which is a pivotal E3 ubiquitin ligase and negative regulator of p53. MDM2 can polyubiquitinate six lysine residues within the carboxyl-terminal regulatory domain of p53. Upon cellular stress, the stabilization of p53 is largely mediated through its dissociation from MDM2 by serine 15 phosphorylation (Shieh et al., 1997).

In addition to ubiquitination, the lysine residues in the p53 carboxyl-terminus can be alternatively acetylated or methylated, resulting in drastically different outcomes. A total of nine acetylation sites have been discovered on p53 (Dai and Gu, 2010). Six lysine residues (K370, K372, K373,

K381, K382 and K386) in the carboxyl-terminal region are acetylated mainly by CBP/p300

(Kruse and Gu, 2008). Acetylation on K320 in the tetramerization domain is catalyzed by PCAF

(p300/CBP-associated factor) (Liu et al., 1999). Two additional acetylation sites, K120

(acetylated by TIP60/hMOF) and K164 (acetylated by CBP/p300) are in the DNA binding domain (Sykes et al., 2006; Tang et al., 2006; Tang et al., 2008). Similar to acetylation on histone tails, p53 acetylation generally serves as a mechanism to activate p53 function, with slight differences between different residues (Dai and Gu, 2010). For example, p53 K120 acetylation is necessary for the activation of genes mediating apoptosis but not genes activating the cell cycle arrest pathway (Sykes et al., 2006; Tang et al., 2006). In contrast, K320 acetylation favors cell survival by promoting p21 activation while negatively regulating apoptosis (Chao et al., 2006;

Knights et al., 2006).

Methylation of p53 occurs on arginines or lysines. PRMT5 (protein arginine N-methyltransferase

5) can target R333, R335 and R337, therefore affecting the target gene choice of p53 (Jansson et al., 2008). Lysine methylation has been more well characterized than arginine methylation on p53. The functional outcomes can be either activation or repression (Berger, 2010; Dai and Gu, - 16 -

2010). Mono-methylation at K370 (K370me1, catalyzed by Smyd2, also known as KMT3C) and mono-methylation at K382 (K382me1, catalyzed by Pr-Set7, also known as SETD8 or KMT5A) are repressive to p53 transcriptional activity (Huang et al., 2006; Shi et al., 2007); whereas K372 mono-methylation (K372me1, catalyzed by SET7/9, also known as KMT7) activates p53

(Chuikov et al., 2004). Di-methylation at K373 (K373me2) by G9A and GLP (also known as

KMT1C and KMT1D, respectively) negatively regulates p53 (Huang et al., 2010), whereas K370 di-methylation (K370me2), recently found to be catalyzed by SETDB1 (Fei et al., 2015), was shown to promote p53 function upon DNA damage by facilitating the association with the coactivator 53BP1 (Huang et al., 2007).

Post-translational modifications also occur on mutant p53, which may have similar functions as they do on wild-type p53. However, more precise mechanistic details remain to be further studied

(Nguyen et al., 2014).

- 17 -

1.4 Genome-wide binding of p53

1.4a Genome-wide binding of wild-type p53

To date, there have been a number of studies carried out to assess genome-wide binding properties of p53, mostly with chromatin immunoprecipitation followed by sequencing (ChIP- seq). These unbiased genome-wide examinations have revealed novel targets and functions of p53, at least under specific experimental conditions. For example, in mouse embryonic stem cells

(mES cells), p53 associates with differentiation genes at their promoter regions and acts as a transactivator. However, p53 also binds distal regions of a gene group related to self-renewal and pluripotency to functionally repress these genes. Therefore, upon stress induced mES cell differentiation, p53 enhances expression of differentiation genes but represses ES cell-enriched genes (Li et al., 2012). In another study in primary mouse embryonic fibroblasts (MEFs), a set of autophagy genes were identified as direct p53 targets, and contributing to p53’s tumor suppressive function (Kenzelmann Broz et al., 2013).

One key question in the field concerns whether upon different types of stress, p53 is stimulated to associate with the genome differently and therefore activate distinct gene expression profiles. In

MCF7 breast cancer cells, treatment with nutlin3a (inhibitor of MDM2 and p53 interaction),

RITA (reactivating of p53 and inducing tumor apoptosis), or chemotherapeutic drug 5-FU (5- fluorouracil) resulted in similar binding patterns of p53 to its major binding sites, despite different biological outcomes by these compounds (Nikulenkov et al., 2012). In contrast, other studies indicate that different stimuli may lead to distinct p53 binding patterns (Akdemir et al., 2014;

Menendez et al., 2013). However, upon careful analysis of all so far published genome-wide p53 binding datasets (unpublished data from Morgan A. Sammons in our laboratory), most of the

- 18 -

differences observed in previous studies are likely the result of ChIP-seq peak-calling limitations

(peaks: significant regions of enrichment in ChIP-seq experiments). Indeed, when examining the enrichment levels regardless of peak calling cutoffs, the binding features of p53 under different treatments are minimally different. In fact, in the study comparing nutlin3a, RITA and 5-FU, when increasing the peak-calling stringency, the common overlap is also greatly improved into a core set of binding sites (Nikulenkov et al., 2012), suggesting a common binding program of p53 among various stimuli as well as subtle stimulus-specific deviations that are also more sensitive to experimental instabilities.

Nonetheless, the transcriptional outcome goes beyond simple p53 binding, indicating more complex layers of regulation. The local genomic and epigenetic environment may provide one such mechanism. In a recently published study that I have participated in, we carefully characterized genome-wide p53 binding and associated it with the genome-wide patterns of a number of histone modification marks, in primary lung fibroblasts IMR90 treated with nutlin3a

(Sammons et al., 2015). Consistent with most previously known p53 targets, one set of p53 binding sites occur near gene promoter regions (this set constitutes slightly less than one third of total p53 binding sites), characterized by histone modification features of gene promoter, including high levels of H3K4me3 and relatively low amount of H3K4me1. Another one third of binding sties localize relatively farther away from annotated genes and are associated with high

H3K4me1 and low H3K4me3 signals, therefore demarcating gene enhancer features. Of note, the remaining more than one third total p53 binding events do not seem to harbor specific histone modification features, at least not H3K4me1 or H3K4me3, yet the binding strength of p53 at these sites is as strong as that in the previous two groups, and the distance of these binding sites to nearest genes resembles that of the enhancer-like group. Further analysis revealed that this third group of binding sites fall into regions of closed chromatin, as assessed by DNase I - 19 -

hypersensitivity analysis; whereas the enhancer-like group correlate with more open and DNase I sensitive genomic regions. Therefore, this last set of p53 binding sites is referred to as “proto- enhancers”. Intriguingly, these epigenetically inaccessible “proto-enhancers” in IMR90 fibroblasts may correspond to true gene enhancer regions in other cell types, in particular epithelial lineage cells, as these regions reflect open accessible chromatin in epithelial cells as measured by DNase I sensitivity. These findings collectively support the model that the local chromatin environment largely affects the functional output of p53, and that the differential establishment of chromatin features confers another layer of cell type specific and potentially stress signal specific regulation of p53 transcriptional network.

1.4b Genome-wide binding of mutant p53

Recently, the investigation of mutant p53 genome-wide binding patterns has also started to gain interest, as accumulating evidence shows that the transactivation domain of mutant p53 is critical in mediating “gain-of-function” (discussed in more detail above in 1.2b of this chapter).

Comparing ChIP-on-chip and ChIP-seq analyses in Li-Fraumeni Syndrome MDAH087 cells bearing the p53 R248W mutation, it appears that the p53 R248W mutant binding associates with the ETS (E26 transformation-specific) family transcription factor motif. This is likely due to increased binding affinity of the ETS family member ETS2 with mutant p53 than with wild-type p53 (Do et al., 2012). The genome-wide association with ETS family transcription factor motif is further confirmed by ectopically expressing mutant p53 R273H in p53 negative H1299 cells

(Vaughan et al., 2014), suggesting different p53 mutations may have similar features in genome- wide binding.

- 20 -

Assessment of mutant p53 genome-wide locations has also been informative to mutant p53 GOF mechanisms. We have also taken similar approaches and uncovered new pathways underlying mutant p53, as discussed below in Chapter 4.

- 21 -

1.5 Hypotheses and objectives

TP53 is the most critical tumor suppressor gene encoding the potent transcription factor p53.

Upon various cellular stress signals, p53 activates a number of downstream target genes and tumor suppressive pathways. The importance of p53 is also manifested by the fact that it is altered in more than half of all human cancers, while a large part of the remaining half of all cancers inactivate other parts of the p53 signaling pathway.

Testicular teratocarcinoma has long been recognized as a type of cancer that rarely bears p53 mutations, even though the mechanism of the absence of p53 mutation selection power remains elusive. Recent advances in identifying numerous post-translational modifications on p53, especially repressive p53 methylation marks, have informed new mechanisms to regulate wild- type p53 activity. We hypothesize a repressive role of p53 methylation, specifically at K370me1 and K382me1, in suppressing p53 transcriptional activity in teratocarcinoma. In Chapter 3, we examine p53 methylation levels in the NTera2 teratocarcinoma cell line, and test the effects of perturbing p53 methylation on these cancer cells.

On the other hand, it is now well accepted that mutant p53, in particular “hotspot” missense mutations of p53, can confer selective cancer growth advantage in addition to loss of wild-type p53 activity. However the mechanism remains poorly understood, therefore impeding specific therapeutic interventions of tumors bearing GOF p53 mutations. In Chapter 4, we investigate the genome-wide binding properties of multiple GOF p53 mutants in an unbiased way, and reveal novel epigenetic pathways targeted by GOF p53. We characterize the functional importance and

- 22 -

cancer relevance of epigenetic pathways downstream of GOF p53, and infer possibilities of targeting chromatin regulators in treating cancers with GOF p53 mutations.

In addition, Chapter 2 describes all materials and methods implemented this dissertation. Chapter

5 briefly summarizes both studies and discusses future directions in detail.

- 23 -

Figure 1.1

Figure 1.1 | p53 structural domains

(Residue numbers from amino-terminus to carboxyl-terminus)

- 24 -

Figure 1.2

Figure 1.2 | Downstream pathways of p53

Upon various stress signals, p53 can activate one, or multiple downstream pathways that collectively contribute to tumor suppression.

- 25 -

Figure 1.3

Figure 1.3 | Major mechanisms of mutant p53 “gain-of-function”

A. Mutant p53 interferes with p63 and/or p73 function to abrogate their tumor suppressive function.

B. Mutant p53 can be directed by other transcription factors to novel genes and activate tumorigenesis pathways.

- 26 -

Figure 1.4

Figure 1.4 | The MLL1 COMPASS complex

Major components of the MLL1 COMPASS complex are shown. Common subunits of all six

COMPASS complexes include RBBP5, ASH2 and WDR5. Others are variable among different complexes. For example, this MLL1 complex has Menin, LEDGF and others (not shown).

- 27 -

CHAPTER 2

Materials and methods

This chapter provides information regarding all experimental materials and methods employed in this dissertation.

- 28 -

Cell lines

NTera2, MCF7, MDA-MB-175VII, HCC70, BT-549, and MDA-MB-468 cell lines were obtained from American Type Culture Collection (ATCC) and were cultured in a 37 °C incubator at 20% oxygen. NTera2 cells were maintained in standard tissue culture medium (DMEM with 10%

FBS, 100 units per ml penicillin and 100 mg per ml streptomycin) supplied with sodium pyruvate. MCF7, MDA-MB-175VII, HCC70, BT-549, and MDA-MB-468 cells were cultured in standard tissue culture medium supplied with non-essential amino acids. Li-Fraumeni Syndrome cell lines MDAH087 and MDAH041 were obtained from Michael A. Tainsky (Wayne State

University, Detroit, MI) as a gift, and were cultured in a 37 °C incubator at 3% oxygen, in standard tissue culture medium. R172H knock-in mice were generated by Tyler Jacks

(Massachusetts Institute of Technology) and obtained from the NCI Mouse Repository. Primary

MEFs from 13.5-day embryos were generated as previously described (Lee et al., 2010), and cultured in standard tissue culture medium in a 37 °C incubator at 3% oxygen condition.

NTera2 cell differentiation

NTera2 cells were plated 4×10 cells per 10cm plate or 1×10 cells per 6cm plate, together with 10μM retinoic acid. Retinoic acid is refreshed every two days. The differentiation time course is usually 4 days.

Western blot and antibodies

Cells were lysed in modified RIPA buffer containing 150 mM NaCl, 1% NP-40, 50 mM Tris-Cl, pH 8.0, and 1% SDS, supplemented with protease inhibitors (Life Technologies, number 78446) before use. Protein concentration was determined by BCA protein assay (Life Technologies, number 23227), following which equal amount of proteins were loaded and separated in

- 29 -

polyacrylamide gels. Proteins were then transferred to nitrocellulose membrane. Antibodies used in this study were as follows: Smyd2 (abcam, ab108712), Pr-Set7 (abcam, ab3798), Nanog

(abcam 21624), Oct4 (abcam ab19857), p21 (abcam, ab7960), PUMA (Cell Signaling

Technology, number 4976), p53 monoclonal antibody DO-1 (Calbiochem EMD); p53 polyclonal antibody FL393 (Santa Cruz Biotechnology, sc-6243). Flag (Sigma, M2, F1804), HA (Rockland,

600-401-384), histone H3 (abcam, ab1791), H3K4me1 (abcam, ab8895), H3K4me2 (Active

Motif, 39142), H3K4me3 (abcam, ab8580), H3K9ac (Active Motif, 39137), H3K14ac (Active

Motif, 39616), H3K27ac (abcam, ab4729), H3K36me3 (abcam, ab9050), ETS2 (Santa Cruz

Biotechnology, sc-351), MLL1 (Bethyl Laboratories, A300-086A), MOZ (Novus Biologicals,

21620002), mouse p53 antibody for ChIP experiments (Santa Cruz Biotechnology, sc-1312 (M-

19)), mouse p53 antibody for western blot analysis (Cell Signaling Technology, number 2524),

RNA polymerase II (abcam, ab817).

Co-immunoprecipitation

Flag tagged ETS2 protein was transfected (Life Technologies, number 11668019) and expressed in HEK293T cells and then subjected to immunoprecipitation with Flag antibody conjugated protein G Dynabeads (Life Technologies, number 10004D). Following stringent washes, HA tagged wild-type p53 or GOF p53 (generated by in vitro translation (Thermo, number 88881)) was added to co-immunoprecipitate with Flag-ETS2 in buffer containing: 20 mM Tris, pH 8.0,

137 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 1% NP-40, and protease inhibitors. Endogenous co- immunoprecipitation experiments were performed in buffer containing: 20 mM Tris, pH 8.0, 137 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 1% NP-40, 10% glycerol, with protease and phosphatase inhibitors, and 12.5 U ml-1 benzonase (Novagen, 70746).

- 30 -

Peptide competition

Prior to immunoblotting, p53 methylation specific antibodies were pre-incubated with 10ng/ml or

100ng/ml peptide (mono-methylated or unmodified) in 3% BSA in TBST. Peptide corresponding to K370me1 is based on p53 protein sequence from amino acid 361 to 381, with mono- methylation at K370. Peptide corresponding to K382me1 is based on p53 protein sequence from amino acid 367 to 388, with mono-methylation at K382.

Bacterial expression and GST pulldown

GST-tagged ETS2 constructs were transformed and expressed in BL21-CodonPlus E. coli.

Bacterial lysates were incubated with glutathione beads (Life Technologies, number G2879) at 4

°C for 2h, and washed four times with buffer containing 50mM Tris, pH 7.5, 150 mM NaCl, 1%

Triton, 1 mM DTT, supplemented with 100 mM PMSF. The in vitro translated (Thermo, number

88881) HA tagged wild-type p53 or GOF p53 proteins were pre-cleared with GST at 4 °C for 1 h and the resulting supernatant was subjected to GST pulldown with GST or GST-ETS2. The product was then washed and subjected to western blot analysis.

RT-qPCR, ChIP-qPCR and ChIP-sequencing

RNA was isolated from cells using RNeasy kit (Qiagen, number 74106). RNA was then reverse transcribed to cDNA (Life Technologies, number 4387406), then qPCR was performed for quantification using standard procedures on a 7900HT Fast-Real-Time PCR platform (ABI).

ChIP was performed as previously described (Shah et al., 2013), with modifications. In brief, cells were crosslinked in 1% formaldehyde (Thermo, number 28906) in PBS for 10 min at room temperature. After glycine quenching, cell pellets were collected and lysed as previously described (Shah et al., 2013), and then subjected to sonication using the Covaris sonicator (S220).

- 31 -

The supernatant was then diluted in the same sonication buffer but without N-lauroylsarcosine, and subjected to immunoprecipitation with corresponding antibodies at 4 °C overnight. The beads were then washed and DNA was reverse-crosslinked and purified. Following ChIP, DNA was quantified by qPCR using standard procedures on a 7900HT Fast-Real-Time PCR platform

(ABI), or sequencing libraries were prepared using NEBNext Ultra library preparation procedure, and then sequenced on Illumina Hi-Seq platform at the Next Generation Sequence Core at

University of Pennsylvania, or on Illumina Next-Seq platform in the Epigenetics Program at the

University of Pennsylvania. All qPCR primer sequences used in this dissertation are available in

Table 2.1 and Table 2.2.

Growth curve measurement

200,000 cells were seeded on 950 mm2 surface area (one well of 6-well plate) on day 0. Cell number was measured every two days with Countess automated cell counter (Life Technologies) following standard procedures and default parameter settings, after which 200,000 cells were plated back for the next count. For shRNA-mediated knockdown experiments, cells were seeded

7 days after the initial infection of shRNA-containing lentivirus, during which puromycin selection was completed and cells were returned to normal growth medium. For small compound inhibitor treatment experiments, inhibitors or DMSO vehicle control were added on day 0 as cells were seeded, and refreshed every other day as cells were counted and replated. All short hairpin sequences used in this dissertation are available in Table 2.3.

Colony-formation assay

After lentiviral infection of shRNA constructs and puromycin selection, 2,000 cells were seeded per well in 6-well plates. After three weeks, cell colonies were fixed with 1% paraformaldehyde

- 32 -

and stained with 0.1% crystal violet (for 15 min). For quantification, the crystal violet dye was released into 10% acetic acid and measured at A590nm (OD590).

Tumor xenograft assay

A total of four male and four female mice (Mus musculus, strain NOD.Cg-Prkdcscid

Il2rgtm1Wjl/SzJ, Jackson Labs (stock number 005557)) between the ages of 38 and 45 days old were used per treatment for tumour xenograft experiments. All animal experiments described adhere to policies and practices approved by the University of Pennsylvania Institutional

Biosafety Committee (IBC) and the Institutional Animal Care and Use Committe (IACUC). Cells were collected after shRNA (MLL1 or non-targeting control) mediated knockdowns. Then 1.5 million cells were injected subcutaneously per mouse. Tumor size was measured by calipers 10 weeks after subcutaneous injection. Tumor size was measured in two dimensions, and tumor volume was calculated as 0.5 × ℎ× ℎ. All mice were euthanized 20 weeks after subcutaneous injection. Tumors were then excised and photographed.

ChIP-sequencing and RNA-sequencing analysis

Human cell sequencing reads were aligned to human genome hg18 using Bowtie2 (Langmead and Salzberg, 2012). For p53 ChIP-seq, peaks were called using HOMER (Salk Institute, http://homer.salk.edu). For area under the curve analysis, ChIP-seq tags from each cell line were counted at TSS proximal peaks (200 bp around peak centers) of every cell line (including itself) as indicated. Heat maps of p53 enrichment across a 5 kb region (±2.5 kb from peak center, bin =

10) in MCF7, MDA-MB-175VII, MDA-MB-468, HCC70, BT-549 cell lines were generated using HOMER and visualized using JavaTreeView. Sequencing reads from MEFs ChIP-seq experiments were aligned to the mouse reference genome mm9 using Bowtie2. Strand-specific

- 33 -

mouse RNA-seq experiments were aligned to the mm9 reference genome and reference transcriptome. FPKM expression values were counted for each exon and merged into a single gene model using HOMER.

Motif analysis

To determine associated sequence motifs for wild-type p53 or GOF p53 peaks, all TSS proximal peaks (filtered to remove peaks overlapping with satellite DNA) were pared down to the central

50 bp and used as input to MEME and the SeqPos utility in Cistrome (central 100 bp as required by SeqPos). MEME was instructed to search for the top 10 motifs appearing 0 or more times in each sequence, and SeqPos was run with default parameters.

Gene ontology analysis

GO terms associated with wild-type p53 or GOF p53 binding sites were determined in the following way. ChIP-seq TSS proximal peaks were associated with the nearest ENSEMBL transcript and processed using DAVID. The FDR was controlled at 1% and GO terms with fewer than 5 associated transcripts or a fold-enrichment over the genomic background under fivefold were discarded.

Intersection with ENCODE transcription factor datasets

Transcription factor peak coordinates (hg18 assembly) were obtained from the ENCODE project repository (http://www.encodeproject.org) in BED format. TSS proximal p53 ChIP-seq peak regions were intersected with all transcription factor binding-site data using BEDTools, with overlap inferred if a minimum of a single base pair was in common.

- 34 -

The Cancer Genome Atlas (TCGA) analysis

Exome sequencing and RNA sequencing datasets were obtained from TCGA (https://tcga- data.nci.nih.gov/tcga/). Based on p53 mutational status from the exome sequencing data sets, we grouped tumor samples into: (1) wild type (tumors without detectable p53 mutation); (2) GOF

(tumors with p53 single missense mutation of R175H, R248Q, R248W, R249S or R273H); and

(3) null (tumors with p53 nonsense mutations or frameshift truncations). Tumors with other types of p53 mutations (other missense mutations, inframe insertion/ deletion, or splicing mutations) were not included in further analysis, due to an unpredictable effect on the downstream chromatin regulators. Cancer types that include more than 5% samples in group 2 were included for the combined analysis, in which RNA expression values were normalized to the wild-type group median. For individual cancer type analysis, original RNA expression values (normalized read counts or RPKM values) from TCGA datasets were used.

OICR-9429 WDR5-MLL1 inhibitor

OCIR-9429 was developed using structure-guided medicinal chemistry and peptide displacement assays starting from “Compound 3” previously reported (Senisterra et al., 2013), as part of the

Chemical Probe Program of the Structural Genomics Consortium. OICR-9429 is highly specific for WDR5 and was shown to have >100-fold selectivity over 300 other chromatin “reader” domains, methyltransferases, and other non-epigenetic targets. The details of its structure, discovery and characterization are described in (Grebien et al., 2015).

- 35 -

Table 2.1

ChIP-qPCR primers (sequences targeting humam genome unless otherwise denoted) Sequence Name TTTTCCCGAGCAATGCCTC MLL1 peak F ACCTGGATAACTGCATGCCC MLL1 peak R AGGTCCCTATACTGCCAGCCA MLL1 down peak F GGTAGAGGGTGGAGGTGAAGG MLL1 down peak R CCAGAGCTGAGTGCAACCTG MLL1 up peak F ATTTGGGAAGGAGGGAGAGG MLL1 up peak R ATCCCGCCCTCTCGGAG MLL2 peak F GCGTGTGCGTAGAACTGCAG MLL2 peak R CTATTTCCCCATCCCTGCAG MLL2 down peak F TGGGAATCAGCATTGGGATC MLL2 down peak R AGATGCCCCAAACTGACACG MOZ peak F CGGCTGGAGCTCACTGTCTC MOZ peak R TGCAGTGAACTATGATCGCCA MOZ up peak F TCTTGCTGTGTCTCTCAGGCTG MOZ up peak R GACCAGCAGCAAAATCGGAG (Mouse) p21 BS F CCCAGGACTGAACAGACCCA (Mouse) p21 BS R ACCTGGATAAGTGCATGCCC (Mouse) MLL1 peak F TCTTCCCTGGCGCTGCCGC (Mouse) MLL1 peak R TTCCACGAGGCACCAAACA (Mouse) Hoxa9 TSS F CAGTCCTTGCAGCTTCCAGTC (Mouse) Hoxa9 TSS R CGTGACTAATGTGCAGCTTGC (Mouse) Hoxa5 TSS F CCGCTCAGCCCCAGATCTA (Mouse) Hoxa5 TSS R TTTCTTGGCCGCCTTCTTCT (Mouse) Hoxa2 TSS F CTGCAGCCGCCTGAGTATC (Mouse) Hoxa2 TSS R ATGGGATGGATCTCAGCGTC (Mouse) Hoxb5 TSS F CAAAGTGGCTGGAGGAGGC (Mouse) Hoxb5 TSS R GTCCGACTGCGCACAGG (Mouse) Hoxb6 TSS F TTCTGCTCCTCGGTCTCTCC (Mouse) Hoxb6 TSS R TCGATCATAAGTCACGAGAGCG (Mouse) Hoxb9 TSS F CGAAGGAAACTTGGCTGGAG (Mouse) Hoxb9 TSS R GGCTGGTGGCTATTTTGTCC p21 BS F CCCCTTCCTCACCTGAAAACA p21 BS R

- 36 -

Table 2.2

RT-qPCR primers (sequences targeting humam genome unless otherwise denoted) Sequence Name TCTCACATCCTGCACCAGCA MLL1 RT F TTCTTGGCTCGGGAACACAT MLL1 RT R GCATTGGTGGTTTCATGGTG MLL2 RT F TTTTCGTGCGTGTGTGGG MLL2 RT R CTCACACGCAGAGATTGCAAG MOZ RT F TGGAAATGTGCCCCTTCACT MOZ RT R AGAAGTGCCAACAGGCTTGG ETS2 RT F TCACAGTTGGCGGAGTCATG ETS2 RT R AATATAGGTGGCCCAGAAGGC (Mouse) Hoxa5 RT F GTAGCGAGTGTAGGCCGTCC (Mouse) Hoxa5 RT R AATAAAATTTGCGAAGGAAGCG (Mouse) Hoxb9 RT F GTTGGTTTGATCCGGCCTC (Mouse) Hoxb9 RT R GTCCACCTCACGGACAGACA (Mouse) Hoxa10 RT F CATCCTGCGATTCTGAAACCA (Mouse) Hoxa10 RT R CGGGCTCATCAACGATAAGC (Mouse) Mll1 RT F CAGGCCCAGATGTCAGGTG (Mouse) Mll1 RT R AGCGATGGAACTTCGACTTTG p21 RT F CGAAGTCACCCTCCAGTGGT p21 RT R AGATCAAGCGCCAGAATGGA Lamin A/C RT F GTGGGAACCGGTAAGTCAGC Lamin A/C RT R CCAGAAAACCTACCAGGGCA p53 RT F GAATGCAAGAAGCCCAGACG p53 RT R AAATGAATCCCCCCCTTCC MDM2 F CACGAAGGGCCCAACATCT MDM2 R GTAACCCGTTGAACCCCATT 18S rRNA F CCATCCAATCGGTAGTAGCG 18S rRNA R

- 37 -

Table 2.3

shRNA and sgRNA targeted sequences Sequence Name GTCCAGATGAAGCTCCCAGAA (shRNA) (Human) p53 GCTGTGATGAGTCAAGCCTTA (shRNA) (Human) ETS2 #20 CCAACCATGTCTTTCAAGGAT (shRNA) (Human) ETS2 #21 TTAAATTAGGATAATACCGCG (shRNA) (Human and Mouse) MLL1 CGGGCGTAAACGCTTCGAGAT (shRNA) (Mouse) p53 #54549 CCGACCTATCCTTACCATCAT (shRNA) (Mouse) p53 #12359 GCTCTGTGTTTGAGGACAGTA (shRNA) (Human) Smyd2 #70313 CGATATTTCCTGATGTTGCAT (shRNA) (Human) Smyd2 #70314 CGCAACAGAATCGCAAACTTA (shRNA) (Human) Pr-Set7 ACTGAGTTCTCTTCCTGAA (sgRNA) (Human) Pr-Set7

- 38 -

CHAPTER 3

Lysine methylation represses wild-type p53 activity

in teratocarcinoma cells

Jiajun Zhu, Arnold J. Levine, and Shelley L. Berger

The text, figures, and legends in this chapter were the work of Jiajun Zhu. Part of this chapter is still ongoing work towards final publication. Current results are discussed in the Results (3.3) section, and remaining work underway is detailed in the Discussion (3.4) section.

- 39 -

3.1 Abstract

Testicular teratocarcinoma cells retain high expression levels of wild-type p53, yet the transcriptional activity of p53 is kept repressed compared to other cancer cells bearing wild-type p53. Here we report that p53 in the teratocarcinoma cell line NTera2 is subject to lysine methylation at the carboxyl-terminus, post-translational modifications that are previously known to repress p53 transcriptional activity. We show that reduction of the cognate methyltransferases reactivates p53 activity and promotes the differentiation phenotype of NTera2 cells. Our results provide one of the first lines of evidence that lysine methylation functions to suppress p53 activity in cancer cells, and suggest new possibilities of targeting testicular teratocarcinoma.

- 40 -

3.2 Introduction

Teratocarcinoma consists of embryonal carcinoma and various layers of differentiated cells. It is one type of germ cell tumor, and therefore indicates true pluripotent cells have become cancerous.

Teratocarcinoma has been historically linked to p53 because it is a cancer type known to express high levels of p53. In fact, when p53 was initially misinterpreted as an oncogenic tumor antigen, teratocarcinoma served as an illustration of cancer with elevated oncogene expression (Bartkova et al., 1991; Chandrasekaran et al., 1982; Oren et al., 1982; Reich et al., 1983). It is now well recognized that p53 is the most potent tumor suppressor and yet p53 is rarely mutated in teratocarcinoma (Lutzker and Levine, 1996). It turns out that p53 is transcriptionally compromised in teratocarcinoma despite its high expression level. Therefore there does not seem to be selection power for p53 mutations. However, upon DNA damage or retinoic acid (RA) induced differentiation of the embryonal carcinoma component, p53 is rapidly activated (Curtin et al., 2001; Lutzker and Levine, 1996), suggesting an otherwise suppressed basal state that can be switched on or overcome by stress signals. Although several explanations have been proposed indicating a repressive domain of p53 that acts in trans (Curtin and Spinella, 2005), or micro

RNAs that function to interfere with p53 downstream pathways (Voorhoeve et al., 2006), the mechanism of p53 repression in teratocarcinoma remains largely elusive.

A number of post-translational modifications have been identified to occur on p53, providing an additional layer of transcriptional modulation. These modifications can either be activating or repressing to p53 transcriptional activity (Berger, 2010; Dai and Gu, 2010). Among them, methylation of carboxyl-terminal lysines, in particular, mono-methylation at K370 (K370me1, catalyzed by Smyd2) and mono-methylation at K382 (K382me1, catalyzed by Pr-Set7) have been associated with p53 repression (Huang et al., 2006; Shi et al., 2007). A recent study using single

- 41 -

cell imaging revealed an important physiological role of p53 methylation in response to transient genomic stress such as DNA replication. p53 exhibits dynamic pulses upon intrinsic damages, but lysine methylation keeps p53 functionally compromised and prevents it from activating the cell- cycle arrest pathway unnecessarily (Loewer et al., 2010). This mode of regulation demonstrates the importance of p53 methylation and may infer other physiological and pathological roles of p53 methylation. We hypothesized that lysine methylation is exploited by teratocarcinoma cancer cells as a mechanism to suppress wild-type p53 activity.

- 42 -

3.3 Results

3.3a NTera2 exhibits high protein levels of Smyd2 and Pr-Set7

We first performed western blot analyses in the teratocarcinoma cell line NTera2, and compared protein levels in parallel with those in multiple other cell lines bearing wild-type p53. As previously noted, the teratocarcinoma cell line NTera2 has a higher protein level of p53 than that in most other wild-type p53 cell lines we examined, including a primary lung fibroblast line

IMR90 and cancer cell lines U2OS, MCF7, A549 and A498 from various tissues of origin (with the exception of A498 cells having comparable amount of p53 expression level). However, the expression levels of canonical p53 targets, including p21 and PUMA, are the lowest in NTera2 when compared with these other cell lines (Figure 3.1). This observation is consistent with previous reports, and again indicates high levels but transcriptionally compromised wild-type p53 in teratocarcinoma cells.

We then examined protein levels of the p53 methyltransferases Smyd2 and Pr-Set7 (correspond to K370me1 and K382me1, respectively) in NTera2 cells. Interestingly, among all these cell lines we examined, NTera2 cells appear to have the highest expression level of Pr-Set7 (Figure 3.1).

Similarly, the amount of Smyd2 protein in NTera2 cells is higher than that in most other cell lines, except for a comparable amount in A498 cells (Figure 3.1). Together, elevated p53 methyltransferases protein levels in NTera2 cells suggest a potential role of corresponding p53 methylation in regulating p53 activity.

- 43 -

3.3b Characterization of p53 methylation specific antibodies

In order to examine p53 methylation in the teratocarcinoma cell line NTera2, we characterized the specificity of the antibodies against p53K370me1 and p53K382me1. We first tested the antibodies by overexpressing Flag tagged wild-type p53 or p53 with lysine residues mutated to arginine at K370 or K382. After ectopic expression in HEK293T cells and immunoprecipitation by Flag antibody, only wild-type p53, but not the mutant forms K370A or K370R, was recognized by the p53 K370me1 antibody (Figure 3.2A). Notably, ectopically expressed wild- type p53, but not the mutants, were subject to K370 mono-methylation by endogenous Smyd2 in

HEK293T cells. Moreover, when Smyd2 was transfected and expressed together with Flag tagged p53, the p53K370me1 signal was further enhanced against wild-type p53, but neither of the mutant forms (Figure 3.2A). These results indicate that the p53K370me1 antibody does not cross- react with p53 that has lost the K370 residue. Likewise, by performing a similar experiment using wild-type p53 or the p53 K382R mutant and an antibody against p53K382me1, we also verified the specificity of this K382 mono-mehylation antibody (Figure 3.2B).

To further demonstrate the specificity and to test the reactivity of the methylation antibodies against methylated products over unmodified counterparts, we performed the following peptide competition experiment. Flag tagged p53 was ectopically expressed in HEK293T cells and then immunoprecipitated as described above. Wild-type p53 was subject to methylation by endogenous enzymes whereas the lysine to arginine mutant form was not. Prior to immunoblotting, the p53K370me1 or p53K381me1 antibody was pre-incubated with peptide corresponding to p53 amino acid sequences bearing K370me1 or K382me1, respectively. Indeed, pre-incubation of the antibody with mono-methylated p53 peptide resulted in a decrease of immunoblotting signal compared to when the antibody was pre-incubated with the unmodified

- 44 -

counterpart (Figure 3.3A and 3.3B). In addition, a larger decrease in the signal was observed when the peptide concentration was increased (Figure 3.3A and 3.3B). These results again indicate that the antibodies against p53K370me1 and p53K382me1 specifically recognize methylated p53 but have much less reactivity with the unmodified p53 protein.

3.3c p53 is mono-methylated at K370 and K382 in NTera2 cells

Given the elevated protein levels of Smyd2 and Pr-Set7 in NTera2 cells, we next examined whether p53 is correspondingly mono-methylated at K370 and K382. We separated the nuclear fraction from the cytosolic fraction of NTera2 cells, and found p53 is predominantly in the nuclear part (Figure 3.4A), consistent with previous reports (Lutzker and Levine, 1996). We then immunoprecipitated total p53 and detected both K370me1 and K382me1 signals in the nuclear fraction (Figure 3.4B). In addition, we decreased the protein level of Smyd2 in NTera2 cells by short-hairpin RNA (shRNA) mediated gene knockdown, and observed a concomitant reduction of p53 K370me1 signal (Figure 3.4C). Together, these results support the hypothesis that p53 is methylated in NTera2 cells, and that p53 methylation is dependent upon the methyltransferase protein level.

3.3d Smyd2 and Pr-Set7 knockdown activate p53 transcription activity and promote a differentiation feature of NTera2 cells

To investigate the functional importance of methylation to p53 transcription activity, we examined how decreasing the level of p53 methyltransferases affects the expression of p53 downstream targets. Reduction of Smyd2 protein level by two independent shRNA constructs both resulted in increased expression of canonical p53 target genes p21 and PUMA (Figure

3.5A), indicative of enhanced p53 transcription activity. Meanwhile, when Smyd2 level was

- 45 -

reduced, we observed decreases in expression of pluripotent genes Nanog and Oct4 (gene names

NANOG and POU5F1, respectively), suggesting a precocious lost of cell stemness that is consistent with the increased p53 activity (Figure 3.5A). Similarly, we also tested the effect of Pr-

Set7 knockdown by shRNA, and observed increased p21 expression and decreased Nanog protein level (Figure 3.5B). To further demonstrate the role of Pr-Set7 and to rule out off-target effects one single shRNA construct may have, we utilized the CRISPR/Cas9 system (Cong et al., 2013) to achieve genome editing and gene “knockdown” at a cell population level (gene knockout in a subpopulation of the entire pool of cells). Along with the reduction of Pr-Set7 at the average level, p21 was also elevated and Nanog level was slightly decreased when compared a control small guide RNA (sgRNA) targeting a silent gene PRM2 (Figure 3.5C). The results showed consistency with the shRNA mediated knockdown experiment, and further supported the role of

Pr-Set7 in p53 suppression, which may in turn contribute to sustain the pluripotent state of

NTera2 cells.

- 46 -

3.4 Discussion

These results provide evidence that the teratocarcinoma cell line NTera2 expresses high levels of the p53 methyltransferases Smyd2 and Pr-Set7, when compared to other cell lines bearing wild- type p53. In NTera2 cells, Smyd2 and Pr-Set7 contribute to mono-methylation of p53 at K370 and K382, respectively. Reduction of Smyd2 or Pr-Set7 results in increased expression of p53 target genes p21 and PUMA, whereas levels of pluripotent marker genes Nanog and Oct4 are lowered. Collectively, these results support the hypothesis that carboxyl-terminal lysine methylation suppresses p53 activity, and contributes to the pluripotent status of teratocacinoma cells.

Below we discuss additional approaches that can add direct support to the paradigm, and even further extensions of this hypothesis are detailed in Chapter 5.

3.4a Methylation-deficient p53 mutants

While results from the Smyd2 and Pr-Set7 knockdown experiments are in line with the suppressive role of p53 methylation, the effect of Smyd2 and Pr-Set7 reduction on p53 target gene and pluripotency gene expression may be caused by mechanisms other than p53 methylation level changes. To acquire further evidence of a major role resulting from p53 methylation, the following experiment is proposed taking advantage of the K370R and K382R mutations on p53 that cannot be methylated. Using the CRISPR/Cas9 genome editing system, we have generated a population of NTera2 cells that have non-detectable p53 protein levels (indicating most cells in the population are effectively p53 gene knockout). Correspondingly, p21 and PUMA levels have also been greatly reduced (data not shown). To examine the transcriptional activity of wild-type p53 and p53 with lysine to arginine mutation at K370 or K382, we will ectopically express these

- 47 -

different forms of p53 in the CRISPR-engineered p53 “deficient” NTera2 cells and compare their effects on p53 target gene expression as well as the pluripotency genes.

In fact, the differential effect of wild-type and methylation-deficient p53 on target gene transcription has been previously inferred from experiments in p53-null H1299 cells (Huang et al,

2006). Introducing the K370R mutant form p53 resulted in two-fold more expression of p21 than that induced by the wild-type form p53, and full activation in the wild-type group is achieve by additional knockdown of the Smyd2 enzyme (Huang et al, 2006). A larger difference between methylation-deficient p53 and wild-type p53 on target gene transcription is expected in NTera2 cells, given the hypothesis that p53 methylation serves as a major mechanism of p53 repression.

In addition, the combination of K370R and K382R mutations may synergize to activate p53 transcription activity.

One caveat of this experiment concerns the ectopic expression level of exogenous p53. Ideally, the K370R and/or K382R mutations can be knocked-in to the endogenous p53 gene locus using the CRISPR/Cas9 system. However this genetic engineering involves an essential clonal selection and expansion step where NTera2 cells are easily subject to self-differentiation. Alternatively, we will titrate the amount of ectopically introduced constructs and achieve close to endogenous p53 expression level.

3.4b p53 methylation levels between teratocarcinoma cells and other wild-type p53 cancer cells

Teratocarcinoma is unique in that it always retains a high expression level of wild-type p53 with compromised transcription activity. We propose lysine methylation on p53 as a mechanism to

- 48 -

keep p53 activity repressed. Our experimental results are in support of this hypothesis that

NTera2 cells express higher protein levels of the p53 methyltransferases Smyd2 and Pr-Set7 compared with other cell lines bearing wild-type p53. A further comparison can be made directly assessing p53 methylation levels in NTera2 cells and other wild-type p53 cells. For example,

NTera2 cells express similar amount of p53 protein, but a much higher Pr-Set7 protein level compared to MCF7 cells and A498 cells. A critical role of p53 methylation in NTera2 cells should predict a higher level of p53 K382me1 when compared to the other two cell lines.

Moreover, the clinical significance can also be partially assessed by examining patient tumor samples from The Cancer Genome Atlas (TCGA). Teratocarcinoma represents a subtype of testicular cancers, which similarly often retain expression of wild-type p53 that is transcriptionally inactive. Analysis of RNA-sequencing profiles from TCGA and comparison of p53 methyltransferase levels between testicular cancer and other cancers may further demonstrate an important repressive function of p53 methylation specifically in testicular cancer.

- 49 -

Figure 3.1

Figure 3.1 | Western blot analysis and quantification of protein levels between NTera2,

IMR90, U2OS, MCF7, A549 and A498 cells.

Equal amount of total protein was loaded for each cell line. For quantification, protein levels in the NTera2 cells were set to 1 for each given blot.

- 50 -

Figure 3.2

Figure 3.2 | The p53K370me1 and p53K382me1 antibodies recognize wild-type p53 (subject to modifications by endogenous enzymes) but not p53 with K to R mutations.

A and B. HEK293T cells were transfected with indicated expression plasmids and were subject to Flag immunoprecipitation followed by antibodies against (A) p53K370me1 and (B) p53K382me1. F-: Flag tagged.

- 51 -

Figure 3.3

Figure 3.3 | Peptide competition assay for p53K370me1 and p53K382me1 antibodies.

A. Prior to immunoblotting with Flag tagged wild-type p53 or p53K370R, the p53K370me1 antibody was incubated with different concentration of peptide corresponding to p53 amino acid

361-381, mono-methylated at K370 or unmodified.

B. Prior to immunoblotting with Flag tagged wild-type p53 or p53K382R, the p53K382me1 antibody was incubated with different concentration of peptide corresponding to p53 amino acid

367-388, mono-methylated at K382 or unmodified. - 52 -

Figure 3.4

Figure 3.4 | p53 is methylated at K370 and K382 in NTera2 cells.

A and B. p53 immunoprecipitation followed by westerns with p53 K370me1 or p53 K382me1 antibodies.

C. p53 K370me1 immunoprecipitation followed by western with p53 upon control (ctrl) or

Smyd2 shRNA knockdown.

- 53 -

Figure 3.5

Figure 3.5 | Smyd2 and Pr-Set7 knockdown increases p53 target gene expression.

A. Western analysis of NTera2 cells upon Smyd2 reduction by two independent shRNA constructs mediated knockdown.

B and C. Western analysis of NTera2 cells upon Pr-Set7 reduction by (B) shRNA mediated knockdown and (C) CRISPR/Cas9 mediated expression decrease. - 54 -

CHAPTER 4

Gain-of-function p53 mutants co-opt chromatin pathways

to drive cancer growth

Jiajun Zhu, Morgan A. Sammons, Greg Donahue, Zhixun Dou, Masoud Vedadi,

Matthäus Getlik, Dalia Barsyte-Lovejoy, Rima Al-awar, Bryson W. Katona, Ali Shilatifard,

Jing Huang, Xianxin Hua, Cheryl H. Arrowsmith & Shelley L. Berger

Published in Nature, 2015, 525(7568):206-11.

The text, figures, and legends in this chapter were the work of Jiajun Zhu with the following exceptions. Morgan A. Sammons performed the heatmap analysis, H4K3me3 ChIP-seq and

RNA-seq analysis in MEFs. Greg Donahue performed the gene ontology analysis.

- 55 -

4.1 Abstract

TP53 (which encodes p53 protein) is the most frequently mutated gene among all human cancers.

Prevalent p53 missense mutations abrogate its tumor suppressive function and lead to a “gain-of- function” (GOF) that promotes cancer. Here we show that p53 GOF mutants bind to and upregulate chromatin regulatory genes, including the methyltransferases MLL1 (also known as

KMT2A), MLL2 (also known as KMT2D), and acetyltransferase MOZ (also known as KAT6A or

MYST3), resulting in genome-wide increases of histone methylation and acetylation. Analysis of

The Cancer Genome Atlas shows specific upregulation of MLL1, MLL2, and MOZ in p53 GOF patient-derived tumors, but not in wild-type p53 or p53 null tumors. Cancer cell proliferation is markedly lowered by genetic knockdown of MLL1 or by pharmacological inhibition of the MLL1 methyltransferase complex. Our study reveals a novel chromatin mechanism underlying the progression of tumors with GOF p53, and suggests new possibilities for designing combinatorial chromatin-based therapies for treating individual cancers driven by prevalent GOF p53 mutations.

- 56 -

4.2 Introduction

Most mutant forms of p53 are caused by single amino acid substitutions mapping to the DNA- binding domain (Lawrence et al., 2014). These mutations result in expression of full-length p53 protein, but loss of wild-type (WT) tumor suppressive function (Freed-Pastor et al., 2012; Lang et al., 2004; Olive et al., 2004). The high prevalence of missense substitutions, particularly certain

“hotspot” mutations, suggests a selective advantage during cancer progression. Indeed, these mutants gain neomorphic oncogenic functions, including altered cancer spectrum (Lang et al.,

2004; Olive et al., 2004), deregulated metabolic pathways (Freed-Pastor et al., 2012; Zhang et al.,

2013), increased metastasis (Subramanian et al., 2015; Weissmueller et al., 2014) and enhanced chemotherapy resistance (Do et al., 2012). Evidence from recent studies points to one potential mechanism of GOF p53, functioning through association with other transcription factors and driving gene transcription in oncogenic pathways, such as the mevalonate pathway (Freed-Pastor et al., 2012) and etoposide-resistance pathway (Do et al., 2012). A transcriptional mechanism is further supported by the importance of retaining an intact transactivation domain for oncogenic

GOF p53 function (Freed-Pastor et al., 2012; Scian et al., 2004). Nevertheless, how GOF p53 contributes to major changes of the cancer genome and transcriptome remains to be elucidated

(Garritano et al., 2013; Scian et al., 2004). Altered chromatin pathways have been implicated in various aspects of cancer (Dawson and Kouzarides, 2012; Tam and Weinberg, 2013), given their regulation of genome-wide transcription programs (Kouzarides, 2007; Li et al., 2007). However, to our knowledge, to date there has not been evidence of direct crosstalk between GOF p53 mutants and chromatin regulation.

- 57 -

4.3 Results

4.3a Genome-wide binding of mutant p53

To get insights into the regulatory mechanisms of gain-of-function p53 mutants, we carried out

ChIP-seq to determine genome-wide binding locations of both WT p53 and GOF p53 in a panel of breast cancer cell lines: MCF7 (wild-type p53), MDA-MB-175VII (wild-type p53), HCC70

(p53R248Q), BT-549 (p53R249S), and MDA-MB-468 (p53R273H). Similar number of sequencing reads were obtained for each cell line, as well as comparable number of identified

ChIP-seq peaks using the same criterion (data not shown).

We first compared the overall binding patterns between WT p53 and GOF p53. By area under the curve analysis, we found that the binding of p53 to gene-proximal regions (less than 10 kilobases

(kb)) of transcription start sites (TSS) in the two wild-type p53 cell lines strongly resembled each other, whereas these wild-type p53 peaks were highly dissimilar from the peaks in any of the

GOF p53 mutants. More interestingly, p53 binding patterns in the three GOF p53 cell lines were similar when compared to each other (Figure 4.1A). This is further confirmed by a heatmap analysis of all WT p53 and GOF p53 peaks, and assessing their enrichment in each cell lines

(Figure 4.1B). Again, the two wild-type p53 cell lines displayed similar enrichment patterns between each other, whereas the three GOF p53 cell lines share common p53 binding regions.

In order to investigate the mechanism of GOF p53 binding, we performed motif analysis for TSS- proximal peaks of the p53R273H mutant that predicted the E26 transformation-specific (ETS) motif as the most enriched. This motif is clearly distinct from the wild-type p53 consensus DNA- binding motif. One ETS family member, ETS2, has been shown to consistently associate with

- 58 -

mutant p53 (Do et al., 2012). Using in vitro expressed p53 proteins and HEK293T expressed Flag tagged ETS2 protein, we confirmed that ETS2 interacts with various GOF p53 mutants, but interacts to a much lesser extent with wild-type p53 (Figure 4.2A), as previously noted (Do et al.,

2012). This was also validated with bacterial expressed GST tagged ETS2 and in vitro translated p53 (Figure 4.2B). Furthermore, co-immunoprecipitation at endogenous protein levels demonstrated that ETS2 interacts with GOF p53, but not with wild-type p53 (Figure 4.2C and

4.2D). In addition, we analyzed ChIP-seq datasets from the ENCODE project for all transcription factors (Consortium, 2012; Gertz et al., 2013), and observed that, compared to other transcription factors, ETS family proteins have significantly higher overlap with GOF p53 TSS-proximal peaks, but not with wild-type p53 TSS-proximal peaks (Figure 4.3A and 4.3B). Notably, in both wild-type and GOF p53 cases, RNA polymerase II (Pol II) group has the highest percentage overlap with p53 peaks, indicative of transcriptional activity. The extent of Pol II overlap is similar to the ETS group in GOF p53 cells, but much higher than the ETS group in wild-type p53 cells (Figure 4.3A and 4.3B).

4.3b GOF mutant p53 targets chromatin regulators

To determine specific functional categories, we performed gene ontology (GO) analysis on TSS- proximal peaks. As expected, DNA damage response pathways were most enriched in wild-type p53 targets. In contrast, p53R273H bound to genes related to translation and ribosomal synthesis

(Figure 4.4A), which was reasonable given the rapid growth rate of these cells. We were particularly intrigued by GOF p53 binding to a group of genes functionally related to histone methylation (Figure 4.4A). This was seen in UCSC Genome Browser views at MLL1 (KMT2A) and MLL2 (KMT2D), genes encoding methyltransferases of histone H3 lysine 4 (H3K4) (Figure

4.4B) that are components of alternative forms of the COMPASS complex. The other two GOF

- 59 -

p53 mutants that we examined, as well as p53R248W from LFS MDAH087 cells, all showed similar binding at MLL1 and MLL2 (data not shown). UCSC Genome Browser views confirmed binding of GOF p53 to a gene encoding a common subunit of COMPASS complexes, RBBP5

(data not shown). In contrast, wild-type p53 did not appear to bind any of these genes, although as expected it bound promoter regions of its canonical targets, including CDKN1A (which encodes p21 protein), MDM2 and BBC3 (also known as PUMA) (Figure 4.4B and data not shown). We then analyzed a large set of 600 chromatin regulators for potential GOF p53 binding, and found an additional group of chromatin regulatory genes that showed peak enrichment. Of particular interest among these was MOZ (KAT6A), a histone acetyltransferase, and UCSC Genome

Browser views confirmed the presence of GOF p53 but not wild-type p53 (Figure 4.4B).

Using ChIP-quantitative PCR (ChIP-qPCR), we validated the binding of GOF p53 to MLL1,

MLL2, and MOZ genes, but not adjacently upstream or downstream of the peak regions (Figure

4.5A, 4.5B and 4.5C). Moreover, we confirmed GOF p53 binding to all other targets in the

“histone methylation” GO category (RBBP5, OGT and PPP1CC), and to a few additional chromatin factors (including SMARCD2 and DCAF10), in all three GOF p53 cell lines (data not shown). We verified the ChIP-qPCR results with a second p53 polyclonal antibody, FL393

(Figure 4.5D). In parallel experiments with both p53 antibodies, wild-type p53 showed binding to the CDKN1A and MDM2 canonical binding sites, but not to any of the GOF p53 targets tested

(Figure 4.5E). We also examined a pancreatic cancer cell line, PANC-1 (p53R273H), and observed a similar binding pattern (Figure 4.5F), suggesting a general phenomenon in various cancer types.

Furthermore, the ChIP-qPCR signal of GOF p53 was attenuated upon p53 knockdown (Figure

4.6A). Knockdown of ETS2 also led to reduced binding of GOF p53 over MLL1 and MOZ, and to - 60 -

a lesser extent, over the MLL2 peak region (Figure 4.6B). To test the association of GOF p53 near

Mll1 in a non-tumor background, we performed ChIP-qPCR in primary mouse embryonic fibroblasts (MEFs) with GOF p53 or wild-type p53, and consistently, mouse GOF p53 showed significant enrichment over the Mll1 promoter region (Figure 4.6C). As expected, wild-type p53 bound promoter region of Cdkn1a, but not Mll1 (Figure 4.6C).

4.3c GOF p53 regulates MLL, MOZ, and histone modifications

To examine whether GOF p53 is required for expression of the chromatin regulators, we reduced

GOF p53 levels in human cancer cells and found that the mRNA levels of MLL1, MLL2 and MOZ were also decreased (Figure 4.7A); whereas no change was detected when the level of wild-type p53 was reduced (data not shown). MLL1 protein levels were also decreased in the GOF p53 knockdown (Figure 4.7B), but not by wild-type p53 knockdown (data not shown), as was also observed for MOZ protein levels (Figure 4.7C). Reduction of ETS2 levels led to decreased expression of MLL1 and MOZ, and to a lesser extent, MLL2 (Figure 4.8A and 4.8B), which was in accordance with the relative binding changes of GOF p53 to these genes (Figure 4.6B). We verified the ETS2 knockdown result in another GOF p53 cell line, BT-549, and detected similarly decreased expression of MLL1 and MOZ, and to a lesser extent, MLL2 (Figure 4.8C and 4.8D).

We performed Pol II ChIP-qPCR and observed concomitantly decreased Pol II occupancy specifically over MLL1, MLL2, and MOZ TSS regions upon ETS2 knockdown (Figure 4.8E). We examined the importance of another ETS family member, ETS1. By contrast, ETS1 knockdown had no effect on the expression of MLL1, MLL2 or MOZ, nor did it alter GOF p53 or Pol II binding (data not shown). As ETS family proteins consist of 28 members (Hollenhorst et al.,

2011), it is likely that additional ETS protein(s) other than ETS1 may be involved. Nevertheless, our observations are consistent with previous studies showing that ETS2, but not ETS1, is

- 61 -

important in mediating GOF p53 function (Do et al., 2012; Xiong et al., 2014).

The regulation of histone-modifying enzymes led to investigation of the cognate histone post- translational modifications (PTMs). We observed a global decrease in histone H3 lysine 9 acetylation (H3K9ac, catalyzed by MOZ (Voss et al., 2009)) in response to knockdown of GOF p53, whereas other histone acetylation marks did not show notable changes (Figure 4.9 and data not shown). The reduction of H3K9ac was also observed when the level of MOZ itself was decreased by short hairpin RNA (shRNA) (data not shown). In contrast, H3K4 tri-methylation and H3K4 mono-methylation (H3K4me3 and H3K4me1, catalyzed by MLL1 and MLL2, respectively (Shilatifard, 2012)) showed only a slight global reduction upon GOF p53 knockdown

(Figure 4.9). This is reasonable, however, given that H3K4 is methylated by six members of the

COMPASS complexes (Shilatifard, 2012), and previous studies showed that inhibiting or knocking one of them out did not substantially change global H3K4 methylation (Cao et al.,

2014; Wang et al., 2009).

We further validated the regulation of Mll1, Mll2, and Moz by GOF p53 in the knock-in MEFs.

We found significantly higher expression of these genes in GOF p53 MEFs than in wild-type p53

MEFs or in MEFs derived from p53 (gene Trp53) knockout mice (p53 null MEFs) (Figure 4.10A,

4.10B and data not shown). Furthermore, when GOF p53 was reduced, Mll1 expression was also lowered (Figure 4.10C), and ectopically expressing GOF p53 in p53 null MEFs enhanced Mll1 expression (data not shown). GOF p53 MEFs also showed higher global level of H3K9ac, and a slight elevation of H3K4me3, compared with wild-type p53 or p53 null MEFs (Figure 4.11A).

Notably, other histone modifications associated with active gene transcription, including

H3K27ac and H3K36me3, remained at comparable levels (Figure 4.11A). In addition, H3K4me3 or H3K9ac did not change upon knockdown of wild-type p53, even though cell growth was - 62 -

increased as expected (data not shown). Together, these data suggest that changes in H3K4me3 and H3K9ac are specific to GOF p53 directly activating MLL1 and MOZ enzymes.

The modest global change in H3K4me3 in the presence of GOF p53 prompted investigation of local changes in H3K4 methylation. We performed RNA-seq and H3K4me3 ChIP-seq in MEFs with endogenous wild-type p53 or GOF p53. Compared with the genome-wide average, known

MLL1 target genes (Wang et al., 2009) were more highly expressed and displayed higher

H3K4me3 enrichment in GOF p53 MEFs (Figure 4.11B). For example, we observed increased

H3K4me3 level and RNA expression within the Hoxa gene cluster (Figure 4.11C and 4.11D), a well-studied target of MLL1 and commonly upregulated in leukaemia (Milne et al., 2002;

Nakamura et al., 2002). Conversely, wild-type p53 targets, such as Cdkn1a, showed decreased

RNA expression and TSS-associated H3K4me3 in GOF p53 MEFs (data not shown). Notably,

H3K4me3 enrichment at the TSS of genes in GOF p53 MEFs was slightly, but significantly higher at a genome-wide level than in wild-type p53 MEFs (Figure 4.11E), consistent with the slight global increase of H3K4me3 (Figure 4.11A). We validated the H3K4me3 ChIP-seq and

RNA-seq results by ChIP-qPCR and RT-qPCR, respectively, observing significantly higher

H3K4me3 enrichment in GOF p53 MEFs, and higher expression of Hox genes, than in wild-type p53 or p53 null MEFs (Figure 4.11F and 4.11G).

4.3d MLL1 is essential for cancer phenotype of GOF p53

Previous studies have revealed that cells expressing GOF p53 rely on it for cell growth and survival (Alexandrova et al., 2015; Lim et al., 2009). GOF p53 knockdown in cancer cells led to a strong decrease in cell proliferation (Figure 4.12A). By contrast, lowering of wild-type p53 levels resulted in elevated growth (Figure 4.12B). To investigate the function of GOF p53 driving

- 63 -

chromatin regulators, we carried out the same time course, and found that the reduction of MLL1 or MLL2 in GOF p53 cancer cells led to a striking loss of cell growth (Figure 4.12C), phenocopying the knockdown of GOF p53 itself. By contrast, knockdown of MLL1 or MLL2 had a minimal effect on wild-type p53 cancer cells (Figure 4.12D).

We addressed the importance of this pathway to tumor-relevant phenotypes, first by examining the ability of cancer cells to form colonies. Reduction of MLL1 led to a decreased colony formation ability of MDA-MB-468 cells (p53R273H) (Figure 4.13A), but had little effect on the colony formation efficiency of MCF7 cells (wild-type p53) (Figure 4.13B). Similar results were observed in breast cancer cells BT-549 (p53R249S) and pancreatic cancer cells PANC-1

(p53R273H) (data not shown). We further confirmed the tumor formation phenotype in anchorage-independent growth assays in soft agar, showing that decreasing MLL1 specifically reduced the growth and colony size of GOF p53 cancer cells, but not wild-type p53 cancer cells

(data not shown). We also investigated tumor growth on NOD-scid-gamma (NSG) immunodeficient mice. Knockdown of MLL1 led to strongly reduced tumor formation ability in

GOF p53 cells, as compared to GOF p53 cells with a non-targeting scrambled control knockdown

(Figure 4.13C and 4.13E). In contrast, MLL1 knockdown did not alter the tumour formation ability of wild- type p53 cancer cells (Figure 4.13D and 4.13E), again supporting a specific role for MLL1 in cancers with GOF p53, but not wild-type p53.

To further explore a critical role that these chromatin regulators may play in supporting growth of

GOF p53 cells, and to rule out possible confounding factors in established cancer cell lines, we performed Mll1 knockdown in the primary MEFs with knock-in GOF p53. Consistently, MLL1 reduction resulted in decreased proliferation of GOF p53 MEFs (Figure 4.14A). Importantly, re- expression of MLL1 in GOF p53 MEFs with p53 knockdown partially rescued the growth defects - 64 -

(Figure 4.14B and 4.14C); partial rescue probably results from GOF p53 driving expression of multiple downstream targets, as described above. These results strongly indicate a direct role of

MLL1, functioning downstream of GOF p53 in maintaining proliferation of GOF p53 cells. We also performed MLL1 knockdown in human non-cancer LFS cells – MDAH087 (p53R248W) and

MDAH041 (p53 null (Zhu et al., 2001)). Similar to the results obtained in cancer cells and in

MEFs, MLL1 knockdown reduced the growth rate of GOF p53 LFS cells (Figure 4.15A), again phenocopying the knockdown of GOF p53 itself (Figure 4.15B), but did not reduce the growth of either p53 null LFS cells (Figure 4.15C), nor primary non-cancer cells with wild-type p53

(IMR90 lung fibroblasts, Figure 4.15D). Re-expression of MLL1 again partially rescued the growth reduction by GOF p53 knockdown in LFS cells (Figure 4.15E). In addition, MLL2 knockdown also decreased GOF p53 LFS cell proliferation, but not p53 null LFS cells (data not shown).

4.3e COMPASS inhibitors reduce GOF p53 cell growth

Chromatin regulators have emerged as promising targets of small molecule compounds in various human diseases including cancer (Dawson and Kouzarides, 2012; Dawson et al., 2012). Menin is a scaffold protein of the COMPASS complex, directly interacting with the amino-terminal of

MLL1 (Caslini et al., 2007; Huang et al., 2012; Yokoyama et al., 2004), and is crucial for MLL1 activity and for maintenance of a subtype of leukaemia (Thiel et al., 2012; Yokoyama et al.,

2005). We treated both GOF p53 and p53 null LFS cells with the previously reported menin antagonist, MI-2-2 (Grembecka et al., 2012; Shi et al., 2012). In agreement with the MLL1 genetic knockdown experiments, MI-2-2 showed a dose-dependent inhibition of GOF p53 cell growth (Figure 4.16A), but had very little effect on p53 null cells (Figure 4.16B).

- 65 -

Recently, inhibition of MLL1 function has also been demonstrated by targeting its interaction with the WDR5 subunit of the COMPASS complex (Karatas et al., 2010; Karatas et al., 2013). As a second approach to pharmacological inhibition of MLL1 activity, we used OICR-9429, a newly characterized antagonist of interaction of WDR5 with MLL1 (Grebien et al., 2015). This non- peptide, drug-like molecule binds to WDR5 in the MLL1 binding site of WDR5 ( = 93±

28 ), and disrupts the assembly of the WDR5/MLL1/ RbBP5 complex in cells with half- maximum inhibitory concentration (IC50) values below 1 μM (Grebien et al., 2015). In striking similarity to MI-2-2, we found a dose-dependent inhibition by OICR-9429 of GOF p53 LFS cell growth (Figure 4.16C), and, again, little effect on p53 null LFS cells (Figure 4.16D). Moreover, in the genetically controlled MEF cells, we observed similar results, that OICR-9429 specifically inhibits cell proliferation of GOF p53 MEFs (Figure 4.17A and 4.17B), but not when GOF p53 is reduced (Figure 4.17A) or in p53 null MEFs (Figure 4.17B). These results provide strong evidence for a specific growth inhibitory effect of pharmacological drugs in targeting MLL

COMPASS complex activity downstream of GOF p53.

4.3f TCGA analysis

We examined the significance of our findings in the context of human tumor samples, by analyzing The Cancer Genome Atlas (TCGA). Based on p53 mutational status, we grouped tumor samples into: (1) wild type (no detectable p53 mutation); (2) GOF (missense mutation of R175H,

R248Q, R248W, R249S or R273H); or (3) p53 null (p53 nonsense mutations or frameshift truncations). Tumors with other types of p53 mutations (other missense mutations, inframe insertion/deletion, or splicing mutations) were not included in further analysis, due to an unpredictable effect on the downstream chromatin regulators. We also focused our analysis on cancer types that include more than 5% of samples in the group comprising GOF p53. We first

- 66 -

combined all samples from these cancer types, and observed significantly higher RNA expression of MLL1, MLL2 and MOZ in GOF p53 tumors, compared to either wild-type p53 or p53 null tumors (Figure 4.18, top panels). As controls, expression levels of housekeeping genes including actin (ACTB) and GAPDH are consistent across the three groups (Figure 4.18, middle panels), whereas expression levels of wild-type p53 targets CDKN1A, MDM2 and PUMA are significantly higher in the wild-type p53 group than the GOF p53 or p53 null group (Figure 4.18, lower panels). Next, we examined individual cancer types and observed similar gene expression patterns as the combination of all cancers (Figure 4.19, 4.20 and data not shown). Notably, given the heterogeneous population of tumor samples, and the small sample size of certain groups, not all pairwise comparisons are statistically significant, although the same trends always hold that

GOF p53 tumors express higher levels of MLL1, MLL2, and MOZ than the other two groups. This is also true with canonical wild-type p53 targets, that is, although not all comparisons are statistically significant, the wild-type p53 groups always show higher levels of CDKN1A, MDM2 and PUMA than the GOF p53 or p53 null tumor groups.

- 67 -

4.4 Discussion

Our results indicate that distinct prevalent GOF p53 mutants bind to a common newly identified group of gene targets genome-wide, to drive expression of genes comprising a chromatin signature. The GOF p53 mapping occurs immediately associated with ETS motifs, and GOF p53 binds directly to ETS2, indicating that the substitutions in the DNA-binding domain of p53 unleash a latent interaction with ETS family transcription factors, as previously suggested (Do et al., 2012). Within this chromatin signature gene group targeted by GOF p53, the COMPASS methyltransferase pathway appears to be particularly well represented, but the new binding includes other chromatin regulators, such as the acetyltransferase MOZ. We find that expression of these modifying enzymes is dependent on GOF p53, which in turn elevates activating histone modifications, including H3K4me3 and H3K9ac. Our evidence points to MLL downstream pathways as key targets of GOF p53. Thus, as is the case in leukemia bearing translocations of

MLL, MLL pathways may contribute to GOF p53 oncogenic phenotypes and therefore cancer progression.

Importantly, our findings in both human cancer cells and LFS cells show that GOF p53 cells lose growth and tumor formation potential with similar timing kinetics upon knockdown of MLL1 as they do with knockdown of GOF p53. A key comparison – to cancer and LFS cells that express wild-type p53 or are null for p53 – shows very little response to MLL1 knockdown. Hence, GOF p53 cells appear particularly dependent for growth on the MLL1 pathway. We provide further evidence of GOF p53 cell growth dependence on the COMPASS complex, by analyzing cell sensitivity to two different pharmacological small compound inhibitors. These compounds target menin or WDR5 interaction with MLL1, and inhibit proliferation of LFS cells and MEFs

- 68 -

expressing GOF p53 but not p53 null. The effects of the inhibitors are thus analogous to direct knockdown of MLL1. Hence, we conclude that a large cohort of GOF-p53-driven cancers, the growth of which was not previously known to be dependent on chromatin pathways, may be amenable to epigenetic therapeutics.

- 69 -

Table 4.1

p53 R273H targets GO terms (corresponding to Figure 4.4A)

GO Term P-Value GO:0003735~structural constituent of ribosome 2.83E-04 GO:0044445~cytosolic part 6.58E-04 GO:0006412~translation 1.19E-09 GO:0005840~ribosome 1.05E-06 GO:0033279~ribosomal subunit 2.32E-04 GO:0022626~cytosolic ribosome 1.27E-04 GO:0008135~translation factor activity, nucleic acid binding 6.02E-06 GO:0006414~translational elongation 9.23E-07 GO:0003743~translation initiation factor activity 3.17E-05 GO:0006413~translational initiation 6.19E-06 GO:0034708~methyltransferase complex 4.31E-05 GO:0035097~histone methyltransferase complex 4.31E-05

- 70 -

Figure 4.1

Figure 4.1 | Genome-wide binding patterns comparing WT p53 and GOF p53

A. Area under the curve analysis showing p53 enrichment (ChIP/input) in five cell lines over

TSS-proximal peak regions identified in each cell line. Mann-Whitney U-tests were performed to compute significance for combined WT and GOF p53 peaks: MCF7 ( = 2.78×10), MDA-

- 71 -

MB-175VII ( = 2.15×10), MDA-MB-468 ( < 2.2×10 ), HCC70 ( = 1.09×10),

BT-549 ( = 3.7×10).

B. Heat maps showing the enrichment of p53 peaks (±2,500 bp around peak center) identified from each cell line (rows) in all five cell lines (columns) examined by ChIP-seq.

- 72 -

Figure 4.2

Figure 4.2 | ETS2 interacts with GOF p53 but not WT p53

A. Co-immunoprecipitation of HEK293T cell-expressed Flag-ETS2 with in vitro-expressed GFP or HA-tagged p53, followed by western blot.

- 73 -

B. GST pulldown of bacterially expressed GST or GST-ETS2 with in vitro translated wild-type p53 or GOF p53R175H.

C and D. Co-immunoprecipitation at endogenous protein levels of ETS2 and GOF p53R273H

- 74 -

Figure 4.3

Figure 4.3 | ETS family ChIP-seq peaks overlapping GOF p53 or WT p53 TSS-proximal peaks

A and B. Box plots showing overlap of GOF p53 (A) TSS-proximal peaks from MDA-MB-468 cells or wild-type p53 (B) TSS-proximal peaks from MCF7 cells, with ETS family proteins

(blue), all other transcription factors (grey) or Pol II (white) peaks from ENCODE ChIP-seq data sets. Whiskers on the box plots represent the inter-quartile range. Mann-Whitney U-tests were performed to compute significance.

- 75 -

Figure 4.4

Figure 4.4 | GOF p53 mutants target chromatin regulators

A. GO analysis of p53R273H TSS-proximal peaks (statistics are shown in Table 4.1).

B. UCSC Genome Browser views of p53 occupancy over promoter regions of MLL1, MLL2,

MOZ and CDKN1A.

- 76 -

Figure 4.5

- 77 -

Figure 4.5 | ChIP-qPCR validation of GOF p53 binding to chromatin regulatory genes

A, B and C. ChIP–qPCR showing p53 (DO-1 antibody) or IgG (mouse) enrichment (ChIP/input) over MLL1, MLL2 and MOZ peak regions, in MDA-MB-468 (A), BT-549 (B) and HCC70 (C) cells.

D. ChIP–qPCR showing p53 (FL393 antibody) or IgG (rabbit) enrichment (ChIP/input) over

MLL1, MLL2 and MOZ peak regions in MDA-MB-468 cells.

E. ChIP–qPCR showing p53 (DO-1 antibody) or IgG (mouse) enrichment (ChIP/input) over

CDKN1A, MDM2, MLL1, MLL2 and MOZ gene regions in MDA-MB-175VII cells.

F. ChIP–qPCR showing p53 (DO-1 antibody) or IgG (mouse) enrichment (ChIP/input) over

MLL1, MLL2 and MOZ peak regions in PANC-1 cells.

Error bars represent mean ±s.e.m.; n=3; two-tailed Student’s t-test: *P<0.05; **P<0.01;

***P<0.001.

- 78 -

Figure 4.6

Figure 4.6 | ETS2 mediates GOF p53 binding at chromatin regulatory genes

A and B. ChIP–qPCR showing p53 enrichment changes upon reduction of p53 (A) or ETS2 (B) by shRNA-mediated knockdown.

C. ChIP–qPCR showing p53 or IgG enrichment in MEFs bearing wild-type p53 or p53R172H.

Error bars represent mean ±s.e.m.; n=3; two-tailed Student’s t-test: *P<0.05; **P<0.01;

***P<0.001. - 79 -

Figure 4.7

Figure 4.7 | p53 knockdown decreases expression of MLL1, MLL2 and MOZ

A. RT-qPCR measuring mRNA level changes upon shRNA-mediated p53 knockdown.

B and C. Western blot of MLL1 (B) and MOZ (C) protein level changes upon p53 knockdown.

Error bars represent mean ±s.e.m.; n=3; two-tailed Student’s t-test: *P<0.05; **P<0.01;

***P<0.001.

- 80 -

Figure 4.8

Figure 4.8 | ETS2 knockdown decreases MLL1, MLL2 and MOZ expression levels

A and B. Protein (A) and mRNA (B) levels of MLL1, MLL2 and MOZ upon ETS2 knockdown in

- 81 -

MDA-MB-468 cells.

C and D. Protein (C) and mRNA (D) levels of MLL1, MLL2 and MOZ upon ETS2 knockdown in

BT-549 cells.

E. PolII occupancy over MLL1, MLL2 and MOZ promoter regions upon ETS2 knockdown in

MDA-MB-468 cells.

Error bars represent mean ±s.e.m.; n=3; two-tailed Student’s t-test: *P<0.05; **P<0.01;

***P<0.001.

- 82 -

Figure 4.9

Figure 4.9 | Histone PTM changes upon GOF p53 knockdown

Western blot showing histone modification changes upon GOF p53 knockdown over time.

- 83 -

Figure 4.10

Figure 4.10 | Mll1 expression levels in MEFs with wild-type p53, GOF p53 or p53null

A. RT–qPCR analysis comparing Mll1 expression levels between MEFs bearing wild-type p53,

GOF p53R172H, and p53 null.

B. Western blot (left) and quantification (right) of endogenous MLL1 protein levels in MEFs with wild-type p53, p53R172H or p53 null.

C. Western blot indicating MLL1 level changes upon p53 knockdown in MEFs with p53R172H.

Error bars represent mean ±s.e.m.; n=3; two-tailed Student’s t-test: *P<0.05; **P<0.01;

***P<0.001.

- 84 -

Figure 4.11

- 85 -

Figure 4.11 | Histone modifications in MEFs bearing wild-type p53, GOF p53 or p53 null

A. Western blot measuring endogenous histone modification levels in MEFs bearing wild-type p53, p53R172H or p53 null.

B. Box plot analysis of RNA levels (left) and H3 normalized H3K4me3 levels (right) at previously discovered MLL1 target genes.

C. Overlaid UCSC Genome Browser views of H3K4me3 and RNA levels in MEFs with p53 WT or R172H, over Hoxa gene cluster.

D. Box plot analysis of RNA levels (left) and H3 normalized H3K4me3 levels (right) at Hoxa gene cluster.

E. Box plot of H3 normalized H3K4me3 levels over all gene TSSs, from H3K4me3 ChIP-seq in

MEFs with wild-type p53 or GOF p53R172H.

F. ChIP-qPCR showing H3K4me3 enrichment (H3K4me3 ChIP/H3 ChIP) in MEFs with wild- type p53, p53R172H or p53 null.

G. RT-qPCR analysis comparing Hox gene expression levels between MEFs bearing wild-type p53, GOF p53R172H, and p53 null.

For all bar graphs, two-tailed Student’s t-test; *P<0.05; ** P<0.01; ***P<0.001. Error bars represent mean ±s.e.m.; n=3. For all box plots, Mann-Whitney U-test; *P<0.05; **P<0.01;

***P<0.001.

- 86 -

Figure 4.12

Figure 4.12 | Knockdown of MLL reduces growth of GOF p53 but not wild-type p53 cancer cells

A and B. Growth curve analysis of MDA-MB-468 (A) and MDA-MB-175VII (B) cells with either non-targeting control shRNA or p53 shRNA knockdown.

C and D. Growth curve analysis of MDA-MB-468 (C) and MDA-MB-175VII (D) cells with non- targeting control shRNA, MLL1 shRNA, or MLL2 shRNA knockdown.

Error bars represent mean ±s.e.m.; n=3. - 87 -

Figure 4.13

Figure 4.13 | MLL1 knockdown reduces the tumor phenotype of GOF p53 cancer cells

A and B. Colony formation (left) and quantification (right) in MDA-MB-468 (A) or MCF7 (B) cells with non-targeting control (Ctrl) or MLL1 knockdown (KD). Two-tailed Student’s t-test;

**P<0.01; NS, P>0.05; n=3.

C and D. Excised xenograft tumors 20 weeks after NSG immunodeficient mice were subcutaneously injected with MDA-MB-468 (C) or MCF7 (D) cells carrying control or MLL1 knockdown. Two representative images out of four total in each group are shown. - 88 -

E. Xenograft tumor volumes measured 10 weeks after initial injection described in C and D.

Palpable tumors at a size below 4 mm3 were recorded as 4 mm3 due to difficulties in measurement. Zeros indicate that the mouse did not have a palpable tumor. Red horizontal lines shown as average tumor volume of all four mice in each group. Mann-Whitney U-test;

***P<0.001; NS, P>0.05.

- 89 -

Figure 4.14

Figure 4.14 | Mll1 knockdown reduces proliferation of MEFs bearing GOF p53R172H

A. Growth curve analysis of GOF p53R172H MEFs with either non-targeting control shRNA or two different Mll1 shRNA knockdowns.

B. Western blot in p53R172H MEFs with control or p53 knockdown, and vector control (Vec) or

MLL1 overexpression.

- 90 -

C. Growth curve analysis p53R172H MEFs with control or p53 knockdown, and vector control

(Vec) or MLL1 overexpression.

Error bars represent mean ±s.e.m.; n=3.

- 91 -

Figure 4.15

- 92 -

Figure 4.15 | MLL1 knockdown reduces proliferation of GOF p53 Li-Fraumeni Syndrome cells

A and B. Growth curve analysis of LFS MDAH087 cells upon MLL1 (A) knockdown or p53 (B) knockdown.

C. Growth curve analysis of LFS MDAH041 cells upon MLL1 knockdown.

D. Western blot analysis of MLL1 level (left) and growth curve analysis (right) of proliferation upon shRNA-mediated MLL1 knockdown in IMR90 cells.

E. Growth curve analysis of LFS MDAH087 cells with non-targeting control shRNA plus empty vector, p53 shRNA plus vector, and p53 shRNA plus MLL1 expressing vector.

Error bars represent mean ±s.e.m.; n=3.

- 93 -

Figure 4.16

Figure 4.16 | COMPASS inhibitors specifically reduce growth of GOF p53 but not p53 null

LFS cells.

A and B. Growth curve analysis of LFS MDAH087 (A) and MDAH041 (B) cells treated with

DMSO, and 10 μM or 20 μM MI-2-2.

C and D. Growth curve analysis of LFS MDAH087 (C) and MDAH041 (D) cells treated with

DMSO, and 2 μM or 4 μM OICR-9429.

Error bars represent mean ±s.e.m.; n=3.

- 94 -

Figure 4.17

Figure 4.17 | OICR9429 specifically reduces growth of GOF p53 but not p53 null MEFs.

A. Growth analysis of p53R172H MEFs carrying control or p53 knockdown, treated with DMSO or 4 μM OICR-9429.

B. Growth analysis of p53R172H or p53 null MEFs treated with DMSO or 4 μM OICR-9429.

Two-tailed Student’s t-test; ** P<0.01. Error bars represent mean ±s.e.m.; n=3.

- 95 -

Figure 4.18

Figure 4.18 | TCGA analysis in combined cancer types

Box plots of TCGA RNA expression profiles in combined tumors with wild-type p53, p53 GOF or p53 null. Mann-Whitney U-tests were performed to compute significance; NS, P>0.05.

- 96 -

Figure 4.19

Figure 4.19 | TCGA analysis in brain lower grade glioma

Box plots of TCGA RNA expression profiles in glioma tumors with wild-type p53, p53 GOF or p53 null. Mann-Whitney U-tests were performed to compute significance; NS, P>0.05.

- 97 -

Figure 4.20

Figure 4.20 | TCGA analysis in head and neck squamous cell carcinoma

Box plots of TCGA RNA expression profiles in head and neck tumors with wild-type p53, p53

GOF or p53 null. Mann-Whitney U-tests were performed to compute significance; NS, P>0.05.

- 98 -

CHAPTER 5

Future directions

This chapter summarizes previous studies and provides perspectives into future directions of

Chapter 3 and Chapter 4.

- 99 -

5.1 Summary

The study of lysine methylation on wild-type p53 provides evidence that post-translational modifications can modulate p53 activity in the context of cancer. In teratocarcinoma, lysine methylation (K370me1 and K382me1) likely contributes to the repression of p53 transcriptional activity at basal state, therefore preventing teratocarcinoma cells from differentiation in the presence a high level of wild-type p53 protein.

The analysis of “hotspot” mutant p53 genome-wide binding reveals an epigenetic mechanism underlying the progression of cancers with p53 “gain-of-function” mutations. Mutant p53 binds to a group of novel genes compromising an epigenetic signature. Chromatin regulators including

MLL1, MLL2 and MOZ are specifically upregulated in tumors bearing p53 “hotspot” mutations, and are critical in mediating mutant p53 “gain-of-fucntion”.

- 100 -

5.2 Future directions

5.2a Post-translational modifications of p53 in cancer

During retinoic acid (RA) induced differentiation of teratocarcinoma cells, p53 protein level does not change but its transcriptional activity is greatly enhanced (Curtin et al., 2001; Lutzker and

Levine, 1996). p53 methylation is likely one mechanism to repress p53 activity in teratocarcinoma cells at basal undifferentiated state. Therefore, one possibility is that during differentiation, p53 methylation is reduced, or even switched to activating modifications such as acetylation. We tested this hypothesis by comparing p53 methylation level before and after RA induced differentiation of NTera2 cells. While p53 protein level did not change upon RA treatment, the level of its target gene p21 increased with time (Figure 5.1A and data not shown), consistent with previous reports (Curtin et al., 2001; Lutzker and Levine, 1996). However, neither p53 K370me1 nor K382me1 level seems to change upon differentiation (Figure 5.1B and 5.1C).

We also examined p53 acetylation at K382 and did not observe any increase after RA treatment

(Figure 5.1C). Therefore, although p53 methylation contributes to the repression of p53 activity under basal condition, it appears that other mechanisms induced by differentiation signaling can overcome this suppression effect and reactivate p53.

Interestingly, we tested p53 Serine 15 phosphorylation (S15phos), another modification marker that corresponds to activation status of p53, and it showed an increase upon RA induced differentiation of NTera2 cells (data not shown). Nonetheless, only a few p53 post-translational modification sites have been examined, and the investigation of p53 methylation in teratocarcinoma has been restricted to mono-methylation of K370 and K382 due to limited availability of specific antibodies to other sites. In addition to K370me1 and K382me1, di-

- 101 -

methylation at K373 by methyltransferases G9A and GLP has also been involved in repression of p53 activity with implications in cancer (Huang et al., 2010). There are likely other modification sites yet to be discovered that also negatively regulate p53 transcription activity. Modifications other than methylation may also alter upon differentiation to regulate p53 activity. Therefore, a more comprehensive and unbiased approach can be taken to investigate post-translational modifications of p53 in teratocarcinoma and corresponding changes upon differentiation. For example, modification status of p53 can be examined by mass spectrometry to infer p53 modification changes at the global level. Alternatively, genome-wide RNA sequencing can be performed to help identify expression changes of p53 modifying enzymes during teratocarcinoma cell differentiation. The comparison of gene expression profiles will also reveal changes beyond p53 post-translational modification pathways, and will suggest key signaling events that can also contribute to p53 transcriptional activation.

5.2b How does p53 methylation repress p53 activity?

The suppressive role of p53 methylation likely applies to other cancer types and p53 methylation also has normal physiological functions, however, there has been very little knowledge of how methylation represses p53. One possible mechanism is that methylation may result in decreased

DNA binding ability of p53, because the carboxyl-terminus of p53 has been previously implicated in regulation of DNA binding affinity (Luo et al., 2004). To test this, p53 binding strengths at target genes can be examined by ChIP-qPCR, and changes in p53 methylation levels can be induced by manipulating methyltransferase expression levels. Alternatively, a more direct assessment of DNA association affinity can be inferred from in vitro DNA binding assays. It is now possible to specifically incorporate mono-methylated lysine into a particular site of bacterially expressed protein, using the expanded genetic code and orthogonal synthetase/tRNA

- 102 -

pairs (Chin, 2011, 2014). Ideally, p53 mono-methylated at K370 or K382 can be generated together with the wild-type counterpart, and their affinity to bind DNA sequences compromising canonical p53 binding sites can be compared.

Another possible mechanism to explain the repressive role of p53 methylation, especially if methylation does not change the DNA binding ability of p53, is that methylation of p53 may help to recruit co-factors that are repressive to gene transcription. This scenario would resemble the case with repressive histone methylation. Identification of these co-factors is therefore critical to understanding the mechanism of p53 methylation mediated transcription suppression. Approaches such as mass spectrometry can be taken to examine binding partners of methylated p53 from co- immunoprecipitation of p53 K370me1 or p53 K382me1. Or instead, comparison of the co- immunoprecipitates from wild-type p53, mono-methylated p53 and p53 lysine to arginine mutations generated from the above mentioned bacterial expression system can also identify unique interaction factors of methylated p53.

Overall, revealing the mechanism of methylation mediated p53 repression will provide insights into p53 signaling regulation. The knowledge could also provide therapeutic opportunities to reactivate wild-type p53 in cancer.

5.2c GOF p53 activates MLL1 – in vivo significance?

We concluded that the MLL1 pathway has a critical role in mediating mutant p53 GOF, by ways of cell proliferation, colony-formation, as well as tumor xenograft assays. Using genetic knockdown of the MLL1 enzyme, or pharmacological inhibition of the MLL1 COMPASS complex, we were able to specifically reduce the growth and tumor phenotype of cancer cells

- 103 -

bearing GOF p53. In order to further demonstrate the significance in an in vivo context, I propose the following experiment in a mouse esophageal cancer model.

After chronic exposure (around 16 weeks) to the chemical carcinogen 4-NQO (4-Nitroquinoline

1-oxide) in daily drinking water, mice are prone to developing esophageal tumors that pathologically resemble the human esophageal cancer (unpublished data, Dr. A. Rustgi lab,

University of Pennsylvania). Gain-of-function p53 mutations have been shown to contribute to a more aggressive tumor phenotype and worse prognosis in human esophageal cancer (Dent, 2013;

McCabe and Dlamini, 2005; Wong et al., 2013). This is also recapitulated in the 4-NQO mouse cancer model, with L2-cre driving the expression of p53 R172H (mouse equivalent of human

R175H) specifically in esophagus tissues (unpublished data, Dr. A. Rustgi lab, University of

Pennsylvania).

On the other hand, a new generation of the menin-MLL1 interaction inhibitor, MI-503, has recently been developed and shown to be effective when orally delivered to mice of MLL1- rearranged leukemia models (Borkin et al., 2015). In collaboration with Dr. J. Grembacka lab at

University of Michigan, we have obtained the MI-503 inhibitor. A pilot experiment will be performed in ex vivo cultured cells isolated from tumors of the 4-NQO cancer model. The effect of MI-503 on ex vivo cancer cells bearing GOF p53 R172H will be examined and compared with that of wild-type p53 or p53 null ex vivo cancer cells. Furthermore, we will examine the effect of

MI-503 in vivo by combining it with the 4-NQO treatment. Administration of MI-503 either together with 4-NQO or after tumorigenesis may also help to dissect the best effect of MLL1 pathway inhibition in early versus late stage in cancer development.

- 104 -

5.2d Downstream targets of MLL and MOZ in GOF p53 tumors

Another important question remaining to be explored is to investigate genes that are in turn targeted by MLL1, MLL2 or MOZ in cancers bearing GOF p53. MLL and MOZ may target and aberrantly activate distinct downstream genes in different cancer types. However, there could also be a set of common targets that are important in mediating mutant p53 “gain-of-function”.

In an effort to identify and characterize downstream targets of MLL1 in GOF p53 cancer, we performed H3K4me3 ChIP-seq in the breast cancer cell line MDA-MB-468 (p53 R273H) upon shRNA-mediated knockdown of p53 versus a non-targeting scrambled control. Genes where decreases of H3K4me3 occur may reflect targets of MLL1 enzymatic activity. We examined

H3K4me3 changes at a genome-wide level, comparing control and p53 knockdown, and found that the top 5% decrease of H3K4me3 signal occurs at genes compromising ras/rho signaling functional categories (unpublished data). This preliminary result suggests a role of growth- promoting ras/rho signaling downstream of GOF p53 and MLL1 pathway. Additional experiments including examination of MLL1 binding and functional characterization of ras/rho pathway genes can further test this hypothesis and demonstrate important targets of MLL1 downstream of GOF p53.

To further define genes downstream of GOF p53, I performed analyses of TCGA datasets, looking for all genes that are significantly upregulated in GOF p53 tumors, compared to wild- type p53 and p53 null tumor samples. This set of differentially expressed genes may contain downstream targets of the chromatin regulators MLL and MOZ, as well as gene mis-regulations that are due to pathways independent of MLL or MOZ or secondary effects of GOF p53.

Therefore, a more careful analysis of genes from the list including their expression correlations

- 105 -

with MLL and/or MOZ levels will be even more informative. Again, this analysis can be complemented with the examination of genome-wide MLL and MOZ binding.

5.2e Other chromatin regulators targeted by GOF p53

In addition to MLL1, MLL2 and MOZ, the GOF p53 ChIP-seq analysis has revealed additional chromatin genes targeted by mutant p53. These genes include additional components in the histone methyltransferase functional category (Figure 4.4A), as well as genes in other epigenetic pathways. I have confirmed the binding of GOF p53 to these genes encoding chromatin regulators, by performing ChIP-qPCR in multiple cancer cell lines (Figure 5.2).

Interestingly, two of these targets have been functionally associated with MLL1 activity.

Retinoblastoma binding protein 5 (RBBP5) is an essential component of the COMPASS complex

(Krivtsov and Armstrong, 2007; Shilatifard, 2012); whereas SMARCD2 was recently found to be important in the chromatin-remodeling of MLL1 rearranged leukemia (Cruickshank et al., 2015).

These results further indicate a critical role of the MLL1 pathway, which GOF p53 specifically activates to drive cancer growth. On the other hand, some genes have also been implicated in other aspects of cancer. For example, the O-GlcNAcylation Transferase (OGT) has been shown to promote tumor invasion and regulate metabolic survival signals of cancer cells (Ferrer et al.,

2014; Zhang and Chen, 2015; Zhang et al., 2015a; Zhang et al., 2015b). Examination and further characterization of these chromatin regulators will reveal a more comprehensive regulatory network of GOF p53.

The discovery of various chromatin regulators targeted by GOF p53 suggests the important role of epigenetic pathways in mediating mutant p53 “gain-of-function”. It also provides the

- 106 -

possibility of designing combinatorial chromatin-based therapy in treating tumors with GOF p53 mutations, in line with the recent concept of personalized precision medicine (Aronson and Rehm,

2015; Biankin et al., 2015; Khoury et al., 2015). Different cancer types, different cancer patients, or cancers with different GOF p53 mutations may rely on different pathways or various components of the same pathway. Therefore, a more tailored epigenetic therapy will likely to be most effective.

5.2f Ribosomal synthesis and protein translation

Even though the “histone methyltransferase complex” functional terms turn out to be the most enriched category over the genome, many more gene ontology terms are functionally annotated as

“ribosomal synthesis” and “protein translation” (Figure 4.4A). Genome browser views shown in

Figure 5.3 are examples of GOF p53 binding at promoter regions of some of these genes. A full list of all protein translation related genes targeted by GOF p53 is shown in Table 5.1. Compared to gene transcription, protein translation regulation has long been an overlooked aspect of cancer progression, however is now being increasingly appreciated.

Genetically, numerous genes encoding for components of the ribosome and protein translation machinery, when mutated, have been correlated with increased cancer susceptibility (Ruggero,

2013). For example, a number of genes encoding for translation initiation factors (including but not limited to eIF3, eIF4G, eIF4E and eIF5A2) are amplified or overexpressed in various types of cancer. These alterations, mostly overexpression, are associated with advanced tumor stages and poor prognosis (Doldan et al., 2008a; Doldan et al., 2008b; Nupponen et al., 1999; Saramaki et al.,

2001). On the other hand, genetic mutations of the ribosomal components occur in syndromes known as the ribosomopathies, which are also highly susceptible to cancer development. One

- 107 -

form of ribosomophathies, the X-linked dyskeratosis congenital, involves mutations in the DKC1 gene, which encodes a key ribosomal RNA (rRNA) modifying enzyme Dyskerin (Heiss et al.,

1998; Ruggero et al., 2003). It turns out that specific uridine modifications on rRNA are particularly important for the proper translation of a set of mRNAs including many transcribed from tumor suppressor genes. Therefore the lack of rRNA modification renders the patients with impaired tumor suppressive mechanisms (Graber and Holcik, 2007; Komar and Hatzoglou, 2011).

Interestingly, in addition to mutations in ribosome and the protein translation apparatus, many oncogenic signaling pathways, including PI3K-AKT-mTOR, Ras-MAPK and oncogenic Myc, have been found to tap into protein translation control to favor cancer growth (Frederickson et al.,

1992; Hannan et al., 2011; Waskiewicz et al., 1999; Zeller et al., 2006).

Given the preliminary data from analyzing ChIP-seq results, it is likely that oncogenic GOF p53 can also directly target genes encoding for protein translation regulators. Further validations are needed to illustrate the direct activating role of GOF p53 on these gene targets, and to demonstrate the functional importance of protein translation control in tumors with p53 GOF mutations. Nonetheless, a paradigm emerges that on one hand, GOF p53 co-opts chromatin regulators which in turn mediate changes of the epigenome to activate gene transcription; on the other hand, GOF p53 potentially also upregulates protein synthesis regulators and therefore enhance the protein translation process. Both arms are likely to contribute to cancer progression of tumors with GOF p53 mutations.

- 108 -

5.2g GOF p53 interacts with ETS family proteins

GOF mutations abrogate the ability of p53 to directly bind DNA. However, a large part of the

“gain-of-function” properties are mediated through novel interactions with other transcription factors and thereby indirectly access DNA and activate tumorigenic target genes. Studying the mechanisms of GOF p53 interaction with these transcription factors not only is critical to understanding mutant p53 “gain-of-function”, but also holds promise for therapies in treating tumors with GOF p53. Targeting the interaction of GOF p53 with these novel partners appears to be very specific in therapeutic practice, as the interaction does not occur in normal cells with wild-type p53.

The ETS family protein ETS2 is one such transcription factor that mediates mutant p53 “gain-of- function”. GOF p53 activation of MLL and MOZ is at least partially dependent on the presence of ETS2 protein. Based on experimental results in this dissertation and previous reports (Do et al,

2012; Xiong et al, 2014), ETS2 is also important in recruiting GOF p53 to many other sites. This interaction seems to be restricted to GOF p53 as the association of ETS2 with wild-type p53 is minimal. We are very interested in exploring the detailed mechanism of GOF p53 interacting with ETS2, and why such mechanism is absent in the wild-type p53 scenario even though only one amino acid is replaced. We have preliminary results suggesting part of the p53 DNA binding domain is critical for the interaction. This particular portion in the DNA binding domain may correspond to a region structurally buried in the wild-type protein but becomes exposed due to conformational changes introduced in the mutant protein (unpublished data). It is therefore clear that revealing the binding details between ETS2 and GOF p53 can guide the design of small peptide or small molecule inhibitors of the interaction, and may ultimately serve as therapeutic drug against GOF p53 tumors.

- 109 -

Furthermore, in addition to ETS2, a number of other ETS family proteins are able to bind multiple GOF p53 proteins to various extents (unpublished data). This begs the question of whether different ETS proteins, along with other transcription factors, preferentially mediate distinct pathways of the mutant p53 “gain-of-function”. Since some ETS family members have tissue-specific expression patterns, it is also possible that differential expression of distinct ETS proteins can partially explain tissue-specific cancer phenotypes with the same GOF p53 mutation.

Many more aspects of GOF p53 binding to the ETS family factors remain to be understood with regard to the context specific properties of mutant p53 “gain-of-function”.

- 110 -

Table 5.1

Ribosomal synthesis and protein translation genes targeted by GOF p53 EIF2D RPS7 EIF2B3 EIF3G RPL38 MRPL44 MRPL39 RPL37 EEF1A1 RPL29 EIF3D RPS20 MTIF2 MRPS23 EIF4A2 TEFM RPL26 RPL27

- 111 -

Figure 5.1

Figure 5.1 | NTera2 differentiation and examination of p53 PTMs

A. Western analysis of RA induced NTera2 cell differentiation time course.

B and C. IP-western analysis of p53 PTM changes upon RA induced NTera2 differentiation.

- 112 -

Figure 5.2

Figure 5.2 | ChIP-qPCR validation of GOF p53 mutants binding to genes encoding chromatin regulators

A, B and C. ChIP-qPCR analysis of (A) p53 R249S, (B) p53 R248Q and (C) p53 R273H binding signals at promoter regions (peak), or upstream of promoter regions (up) of OGT, PPP1CC,

RBBP5, SMARCD2, DCAF10. Two-tailed Student’s t-test; *P<0.05; ** P<0.01; ***P<0.001.

Error bars represent mean ±s.e.m.; n=3. - 113 -

Figure 5.3

Figure 5.3 | Genome browser track views of GOF p53 (R273H) binding at genes encoding for protein translation regulators.

- 114 -

BIBLIOGRAPHY

Adorno, M., Cordenonsi, M., Montagner, M., Dupont, S., Wong, C., Hann, B., Solari, A., Bobisse, S., Rondina, M.B., Guzzardo, V., et al. (2009). A Mutant-p53/Smad complex opposes p63 to empower TGFbeta-induced metastasis. Cell 137, 87-98.

Akdemir, K.C., Jain, A.K., Allton, K., Aronow, B., Xu, X., Cooney, A.J., Li, W., and Barton, M.C. (2014). Genome-wide profiling reveals stimulus-specific functions of p53 during differentiation and DNA damage of human embryonic stem cells. Nucleic acids research 42, 205- 223.

Alexandrova, E.M., Yallowitz, A.R., Li, D., Xu, S., Schulz, R., Proia, D.A., Lozano, G., Dobbelstein, M., and Moll, U.M. (2015). Improving survival by exploiting tumour dependence on stabilized mutant p53 for treatment. Nature 523, 352-356.

Almog, N., and Rotter, V. (1997). Involvement of p53 in cell differentiation and development. Biochimica et biophysica acta 1333, F1-27.

Aronson, S.J., and Rehm, H.L. (2015). Building the foundation for genomics in precision medicine. Nature 526, 336-342.

Baker, S.J., Fearon, E.R., Nigro, J.M., Hamilton, S.R., Preisinger, A.C., Jessup, J.M., vanTuinen, P., Ledbetter, D.H., Barker, D.F., Nakamura, Y., et al. (1989). Chromosome 17 deletions and p53 gene mutations in colorectal carcinomas. Science 244, 217-221.

Bannister, A.J., and Kouzarides, T. (2005). Reversing histone methylation. Nature 436, 1103- 1106.

Bannister, A.J., and Kouzarides, T. (2011). Regulation of chromatin by histone modifications. Cell Res 21, 381-395.

Bargonetti, J., Manfredi, J.J., Chen, X., Marshak, D.R., and Prives, C. (1993). A proteolytic fragment from the central region of p53 has marked sequence-specific DNA-binding activity when generated from wild-type but not from oncogenic mutant p53 protein. Genes & development 7, 2565-2574.

Bartkova, J., Bartek, J., Lukas, J., Vojtesek, B., Staskova, Z., Rejthar, A., Kovarik, J., Midgley, C.A., and Lane, D.P. (1991). p53 protein alterations in human testicular cancer including pre- invasive intratubular germ-cell neoplasia. International journal of cancer Journal international du cancer 49, 196-202.

Ben David, Y., Prideaux, V.R., Chow, V., Benchimol, S., and Bernstein, A. (1988). Inactivation of the p53 oncogene by internal deletion or retroviral integration in erythroleukemic cell lines induced by Friend leukemia virus. Oncogene 3, 179-185.

Berger, S.L. (2010). Keeping p53 in check: a high-stakes balancing act. Cell 142, 17-19.

- 115 -

Biankin, A.V., Piantadosi, S., and Hollingsworth, S.J. (2015). Patient-centric trials for therapeutic development in precision oncology. Nature 526, 361-370.

Bienz, B., Zakut-Houri, R., Givol, D., and Oren, M. (1984). Analysis of the gene coding for the murine cellular tumour antigen p53. The EMBO journal 3, 2179-2183.

Biondi, A., Cimino, G., Pieters, R., and Pui, C.H. (2000). Biological and therapeutic aspects of infant leukemia. Blood 96, 24-33.

Blandino, G., Levine, A.J., and Oren, M. (1999). Mutant p53 gain of function: differential effects of different p53 mutants on resistance of cultured cells to chemotherapy. Oncogene 18, 477-485.

Borkin, D., He, S., Miao, H., Kempinska, K., Pollock, J., Chase, J., Purohit, T., Malik, B., Zhao, T., Wang, J., et al. (2015). Pharmacologic inhibition of the Menin-MLL interaction blocks progression of MLL leukemia in vivo. Cancer cell 27, 589-602.

Brady, C.A., Jiang, D., Mello, S.S., Johnson, T.M., Jarvis, L.A., Kozak, M.M., Kenzelmann Broz, D., Basak, S., Park, E.J., McLaughlin, M.E., et al. (2011). Distinct p53 transcriptional programs dictate acute DNA-damage responses and tumor suppression. Cell 145, 571-583.

Candau, R., Scolnick, D.M., Darpino, P., Ying, C.Y., Halazonetis, T.D., and Berger, S.L. (1997). Two tandem and independent sub-activation domains in the amino terminus of p53 require the adaptor complex for activity. Oncogene 15, 807-816.

Cao, F., Townsend, E.C., Karatas, H., Xu, J., Li, L., Lee, S., Liu, L., Chen, Y., Ouillette, P., Zhu, J., et al. (2014). Targeting MLL1 H3K4 methyltransferase activity in mixed-lineage leukemia. Molecular cell 53, 247-261.

Caslini, C., Yang, Z., El-Osta, M., Milne, T.A., Slany, R.K., and Hess, J.L. (2007). Interaction of MLL amino terminal sequences with menin is required for transformation. Cancer research 67, 7275-7283.

Chandrasekaran, K., Mora, P.T., Nagarajan, L., and Anderson, W.B. (1982). The amount of a specific cellular protein (p53) is a correlate of differentiation in embryonal carcinoma cells. Journal of cellular physiology 113, 134-140.

Chao, C., Wu, Z., Mazur, S.J., Borges, H., Rossi, M., Lin, T., Wang, J.Y., Anderson, C.W., Appella, E., and Xu, Y. (2006). Acetylation of mouse p53 at lysine 317 negatively regulates p53 apoptotic activities after DNA damage. Molecular and cellular biology 26, 6859-6869.

Cheung, N., Chan, L.C., Thompson, A., Cleary, M.L., and So, C.W. (2007). Protein arginine- methyltransferase-dependent oncogenesis. Nature cell biology 9, 1208-1215.

Chin, J.W. (2011). Reprogramming the genetic code. The EMBO journal 30, 2312-2324.

Chin, J.W. (2014). Expanding and reprogramming the genetic code of cells and animals. Annu Rev Biochem 83, 379-408.

- 116 -

Cho, Y., Gorina, S., Jeffrey, P.D., and Pavletich, N.P. (1994). Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations. Science 265, 346-355.

Chuikov, S., Kurash, J.K., Wilson, J.R., Xiao, B., Justin, N., Ivanov, G.S., McKinney, K., Tempst, P., Prives, C., Gamblin, S.J., et al. (2004). Regulation of p53 activity through lysine methylation. Nature 432, 353-360.

Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823.

Consortium, E.P. (2012). An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74.

Crook, T., and Vousden, K.H. (1992). Properties of p53 mutations detected in primary and secondary cervical cancers suggest mechanisms of metastasis and involvement of environmental carcinogens. The EMBO journal 11, 3935-3940.

Cruickshank, V.A., Sroczynska, P., Sankar, A., Miyagi, S., Rundsten, C.F., Johansen, J.V., and Helin, K. (2015). SWI/SNF Subunits SMARCA4, SMARCD2 and DPF2 Collaborate in MLL- Rearranged Leukaemia Maintenance. PloS one 10, e0142806.

Curtin, J.C., Dragnev, K.H., Sekula, D., Christie, A.J., Dmitrovsky, E., and Spinella, M.J. (2001). Retinoic acid activates p53 in human embryonal carcinoma through retinoid receptor-dependent stimulation of p53 transactivation function. Oncogene 20, 2559-2569.

Curtin, J.C., and Spinella, M.J. (2005). p53 in human embryonal carcinoma: identification of a transferable, transcriptional repression domain in the N-terminal region of p53. Oncogene 24, 1481-1490.

Dai, C., and Gu, W. (2010). p53 post-translational modification: deregulated in tumorigenesis. Trends in molecular medicine 16, 528-536.

Dawson, M.A., and Kouzarides, T. (2012). Cancer epigenetics: from mechanism to therapy. Cell 150, 12-27.

Dawson, M.A., Kouzarides, T., and Huntly, B.J. (2012). Targeting epigenetic readers in cancer. The New England journal of medicine 367, 647-657.

DeLeo, A.B., Jay, G., Appella, E., Dubois, G.C., Law, L.W., and Old, L.J. (1979). Detection of a transformation-related antigen in chemically induced sarcomas and other transformed cells of the mouse. Proceedings of the National Academy of Sciences of the United States of America 76, 2420-2424.

Dent, P. (2013). Non-canonical p53 signaling to promote invasion. Cancer biology & therapy 14, 879-880.

- 117 -

Desantis, A., Bruno, T., Catena, V., De Nicola, F., Goeman, F., Iezzi, S., Sorino, C., Gentileschi, M.P., Germoni, S., Monteleone, V., et al. (2015). Che-1 modulates the decision between cell cycle arrest and apoptosis by its binding to p53. Cell death & disease 6, e1764.

Dhalluin, C., Carlson, J.E., Zeng, L., He, C., Aggarwal, A.K., and Zhou, M.M. (1999). Structure and ligand of a histone acetyltransferase bromodomain. Nature 399, 491-496.

Dittmer, D., Pati, S., Zambetti, G., Chu, S., Teresky, A.K., Moore, M., Finlay, C., and Levine, A.J. (1993). Gain of function mutations in p53. Nature genetics 4, 42-46.

Do, P.M., Varanasi, L., Fan, S., Li, C., Kubacka, I., Newman, V., Chauhan, K., Daniels, S.R., Boccetta, M., Garrett, M.R., et al. (2012). Mutant p53 cooperates with ETS2 to promote etoposide resistance. Genes & development 26, 830-845.

Doldan, A., Chandramouli, A., Shanas, R., Bhattacharyya, A., Cunningham, J.T., Nelson, M.A., and Shi, J. (2008a). Loss of the eukaryotic initiation factor 3f in pancreatic cancer. Mol Carcinog 47, 235-244.

Doldan, A., Chandramouli, A., Shanas, R., Bhattacharyya, A., Leong, S.P., Nelson, M.A., and Shi, J. (2008b). Loss of the eukaryotic initiation factor 3f in melanoma. Mol Carcinog 47, 806- 813.

Donzelli, S., Strano, S., and Blandino, G. (2014). microRNAs: short non-coding bullets of gain of function mutant p53 proteins. Oncoscience 1, 427-433.

Dorrance, A.M., Liu, S., Yuan, W., Becknell, B., Arnoczky, K.J., Guimond, M., Strout, M.P., Feng, L., Nakamura, T., Yu, L., et al. (2006). Mll partial tandem duplication induces aberrant Hox expression in vivo via specific epigenetic alterations. The Journal of clinical investigation 116, 2707-2716.

Eissenberg, J.C., James, T.C., Foster-Hartnett, D.M., Hartnett, T., Ngan, V., and Elgin, S.C. (1990). Mutation in a heterochromatin-specific chromosomal protein is associated with suppression of position-effect variegation in Drosophila melanogaster. Proceedings of the National Academy of Sciences of the United States of America 87, 9923-9927. el-Deiry, W.S., Kern, S.E., Pietenpol, J.A., Kinzler, K.W., and Vogelstein, B. (1992). Definition of a consensus binding site for p53. Nature genetics 1, 45-49. el-Deiry, W.S., Tokino, T., Velculescu, V.E., Levy, D.B., Parsons, R., Trent, J.M., Lin, D., Mercer, W.E., Kinzler, K.W., and Vogelstein, B. (1993). WAF1, a potential mediator of p53 tumor suppression. Cell 75, 817-825.

Eliyahu, D., Raz, A., Gruss, P., Givol, D., and Oren, M. (1984). Participation of p53 cellular tumour antigen in transformation of normal embryonic cells. Nature 312, 646-649.

Erfurth, F., Hemenway, C.S., de Erkenez, A.C., and Domer, P.H. (2004). MLL fusion partners AF4 and AF9 interact at subnuclear foci. Leukemia 18, 92-102.

- 118 -

Espinosa, J.M., and Emerson, B.M. (2001). Transcriptional regulation by p53 through intrinsic DNA/chromatin binding and site-directed cofactor recruitment. Molecular cell 8, 57-69.

Fei, Q., Shang, K., Zhang, J., Chuai, S., Kong, D., Zhou, T., Fu, S., Liang, Y., Li, C., Chen, Z., et al. (2015). Histone methyltransferase SETDB1 regulates liver cancer cell growth through methylation of p53. Nature communications 6, 8651.

Ferrer, C.M., Lynch, T.P., Sodi, V.L., Falcone, J.N., Schwab, L.P., Peacock, D.L., Vocadlo, D.J., Seagroves, T.N., and Reginato, M.J. (2014). O-GlcNAcylation regulates cancer metabolism and survival stress signaling via regulation of the HIF-1 pathway. Molecular cell 54, 820-831.

Finlay, C.A., Hinds, P.W., and Levine, A.J. (1989). The p53 proto-oncogene can act as a suppressor of transformation. Cell 57, 1083-1093.

Finlay, C.A., Hinds, P.W., Tan, T.H., Eliyahu, D., Oren, M., and Levine, A.J. (1988). Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life. Molecular and cellular biology 8, 531-539.

Frederickson, R.M., Mushynski, W.E., and Sonenberg, N. (1992). Phosphorylation of translation initiation factor eIF-4E is induced in a ras-dependent manner during nerve growth factor- mediated PC12 cell differentiation. Mol Cell Biol 12, 1239-1247.

Freed-Pastor, W.A., Mizuno, H., Zhao, X., Langerod, A., Moon, S.H., Rodriguez-Barrueco, R., Barsotti, A., Chicas, A., Li, W., Polotskaia, A., et al. (2012). Mutant p53 disrupts mammary tissue architecture via the mevalonate pathway. Cell 148, 244-258.

Freed-Pastor, W.A., and Prives, C. (2012). Mutant p53: one name, many proteins. Genes & development 26, 1268-1286.

Funk, W.D., Pak, D.T., Karas, R.H., Wright, W.E., and Shay, J.W. (1992). A transcriptionally active DNA-binding site for human p53 protein complexes. Molecular and cellular biology 12, 2866-2871.

Gaiddon, C., Lokshin, M., Ahn, J., Zhang, T., and Prives, C. (2001). A subset of tumor-derived mutant forms of p53 down-regulate p63 and p73 through a direct interaction with the p53 core domain. Molecular and cellular biology 21, 1874-1887.

Garritano, S., Inga, A., Gemignani, F., and Landi, S. (2013). More targets, more pathways and more clues for mutant p53. Oncogenesis 2, e54.

Gertz, J., Savic, D., Varley, K.E., Partridge, E.C., Safi, A., Jain, P., Cooper, G.M., Reddy, T.E., Crawford, G.E., and Myers, R.M. (2013). Distinct properties of cell-type-specific and shared transcription factor binding sites. Molecular cell 52, 25-36.

Gomes, N.P., and Espinosa, J.M. (2010). Gene-specific repression of the p53 target gene PUMA via intragenic CTCF-Cohesin binding. Genes & development 24, 1022-1034.

Graber, T.E., and Holcik, M. (2007). Cap-independent regulation of gene expression in apoptosis. Mol Biosyst 3, 825-834.

- 119 -

Grebien, F., Vedadi, M., Getlik, M., Giambruno, R., Grover, A., Avellino, R., Skucha, A., Vittori, S., Kuznetsova, E., Smil, D., et al. (2015). Pharmacological targeting of the Wdr5-MLL interaction in C/EBPalpha N-terminal leukemia. Nature chemical biology 11, 571-578.

Grembecka, J., He, S., Shi, A., Purohit, T., Muntean, A.G., Sorenson, R.J., Showalter, H.D., Murai, M.J., Belcher, A.M., Hartley, T., et al. (2012). Menin-MLL inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia. Nature chemical biology 8, 277-284.

Halazonetis, T.D., and Kandil, A.N. (1993). Conformational shifts propagate from the oligomerization domain of p53 to its tetrameric DNA binding domain and restore DNA binding to select p53 mutants. The EMBO journal 12, 5057-5064.

Hannan, K.M., Sanij, E., Hein, N., Hannan, R.D., and Pearson, R.B. (2011). Signaling to the ribosome in cancer--It is more than just mTORC1. IUBMB Life 63, 79-85.

Heiss, N.S., Knight, S.W., Vulliamy, T.J., Klauck, S.M., Wiemann, S., Mason, P.J., Poustka, A., and Dokal, I. (1998). X-linked dyskeratosis congenita is caused by mutations in a highly conserved gene with putative nucleolar functions. Nat Genet 19, 32-38.

Hess, J.L. (2004). MLL: a histone methyltransferase disrupted in leukemia. Trends in molecular medicine 10, 500-507.

Hinds, P., Finlay, C., and Levine, A.J. (1989). Mutation is required to activate the p53 gene for cooperation with the ras oncogene and transformation. Journal of virology 63, 739-746.

Hollenhorst, P.C., McIntosh, L.P., and Graves, B.J. (2011). Genomic and biochemical insights into the specificity of ETS transcription factors. Annu Rev Biochem 80, 437-471.

Hsiao, M., Low, J., Dorn, E., Ku, D., Pattengale, P., Yeargin, J., and Haas, M. (1994). Gain-of- function mutations of the p53 gene induce lymphohematopoietic metastatic potential and tissue invasiveness. The American journal of pathology 145, 702-714.

Huang, J., Dorsey, J., Chuikov, S., Perez-Burgos, L., Zhang, X., Jenuwein, T., Reinberg, D., and Berger, S.L. (2010). G9a and Glp methylate lysine 373 in the tumor suppressor p53. The Journal of biological chemistry 285, 9636-9641.

Huang, J., Gurung, B., Wan, B., Matkar, S., Veniaminova, N.A., Wan, K., Merchant, J.L., Hua, X., and Lei, M. (2012). The same pocket in menin binds both MLL and JUND but has opposite effects on transcription. Nature 482, 542-546.

Huang, J., Perez-Burgos, L., Placek, B.J., Sengupta, R., Richter, M., Dorsey, J.A., Kubicek, S., Opravil, S., Jenuwein, T., and Berger, S.L. (2006). Repression of p53 activity by Smyd2- mediated methylation. Nature 444, 629-632.

Huang, J., Sengupta, R., Espejo, A.B., Lee, M.G., Dorsey, J.A., Richter, M., Opravil, S., Shiekhattar, R., Bedford, M.T., Jenuwein, T., et al. (2007). p53 is regulated by the lysine demethylase LSD1. Nature 449, 105-108.

- 120 -

Huret, J.L., Dessen, P., and Bernheim, A. (2001). An atlas of chromosomes in hematological malignancies. Example: 11q23 and MLL partners. Leukemia 15, 987-989.

Jansson, M., Durant, S.T., Cho, E.C., Sheahan, S., Edelmann, M., Kessler, B., and La Thangue, N.B. (2008). Arginine methylation regulates the p53 response. Nature cell biology 10, 1431-1439.

Jenkins, J.R., Rudge, K., and Currie, G.A. (1984). Cellular immortalization by a cDNA clone encoding the transformation-associated phosphoprotein p53. Nature 312, 651-654.

Jenuwein, T., and Allis, C.D. (2001). Translating the histone code. Science 293, 1074-1080.

Jiang, L., Kon, N., Li, T., Wang, S.J., Su, T., Hibshoosh, H., Baer, R., and Gu, W. (2015). Ferroptosis as a p53-mediated activity during tumour suppression. Nature 520, 57-62.

Kal, A.J., Mahmoudi, T., Zak, N.B., and Verrijzer, C.P. (2000). The Drosophila brahma complex is an essential coactivator for the trithorax group protein zeste. Genes & development 14, 1058- 1071.

Karatas, H., Townsend, E.C., Bernard, D., Dou, Y., and Wang, S. (2010). Analysis of the binding of mixed lineage leukemia 1 (MLL1) and histone 3 peptides to WD repeat domain 5 (WDR5) for the design of inhibitors of the MLL1-WDR5 interaction. Journal of medicinal chemistry 53, 5179-5185.

Karatas, H., Townsend, E.C., Cao, F., Chen, Y., Bernard, D., Liu, L., Lei, M., Dou, Y., and Wang, S. (2013). High-affinity, small-molecule peptidomimetic inhibitors of MLL1/WDR5 protein-protein interaction. Journal of the American Chemical Society 135, 669-682.

Kastan, M.B., Zhan, Q., el-Deiry, W.S., Carrier, F., Jacks, T., Walsh, W.V., Plunkett, B.S., Vogelstein, B., and Fornace, A.J., Jr. (1992). A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell 71, 587-597.

Kenzelmann Broz, D., Spano Mello, S., Bieging, K.T., Jiang, D., Dusek, R.L., Brady, C.A., Sidow, A., and Attardi, L.D. (2013). Global genomic profiling reveals an extensive p53-regulated autophagy program contributing to key p53 responses. Genes & development 27, 1016-1031.

Khoury, M.J., Iademarco, M.F., and Riley, W.T. (2015). Precision Public Health for the Era of Precision Medicine. American journal of preventive medicine.

Knights, C.D., Catania, J., Di Giovanni, S., Muratoglu, S., Perez, R., Swartzbeck, A., Quong, A.A., Zhang, X., Beerman, T., Pestell, R.G., et al. (2006). Distinct p53 acetylation cassettes differentially influence gene-expression patterns and cell fate. The Journal of cell biology 173, 533-544.

Komar, A.A., and Hatzoglou, M. (2011). Cellular IRES-mediated translation: the war of ITAFs in pathophysiological states. Cell Cycle 10, 229-240.

Kouzarides, T. (2002). Histone methylation in transcriptional control. Current opinion in genetics & development 12, 198-209.

- 121 -

Kouzarides, T. (2007). Chromatin modifications and their function. Cell 128, 693-705.

Krivtsov, A.V., and Armstrong, S.A. (2007). MLL translocations, histone modifications and leukaemia stem-cell development. Nature reviews Cancer 7, 823-833.

Kruse, J.P., and Gu, W. (2008). SnapShot: p53 posttranslational modifications. Cell 133, 930-930 e931.

Lane, D.P., and Crawford, L.V. (1979). T antigen is bound to a host protein in SV40-transformed cells. Nature 278, 261-263.

Lang, G.A., Iwakuma, T., Suh, Y.A., Liu, G., Rao, V.A., Parant, J.M., Valentin-Vega, Y.A., Terzian, T., Caldwell, L.C., Strong, L.C., et al. (2004). Gain of function of a p53 hot spot mutation in a mouse model of Li-Fraumeni syndrome. Cell 119, 861-872.

Langmead, B., and Salzberg, S.L. (2012). Fast gapped-read alignment with Bowtie 2. Nature methods 9, 357-359.

Lawrence, M.S., Stojanov, P., Mermel, C.H., Robinson, J.T., Garraway, L.A., Golub, T.R., Meyerson, M., Gabriel, S.B., Lander, E.S., and Getz, G. (2014). Discovery and saturation analysis of cancer genes across 21 tumour types. Nature 505, 495-501.

Lee, K.H., Li, M., Michalowski, A.M., Zhang, X., Liao, H., Chen, L., Xu, Y., Wu, X., and Huang, J. (2010). A genomewide study identifies the Wnt signaling pathway as a major target of p53 in murine embryonic stem cells. Proceedings of the National Academy of Sciences of the United States of America 107, 69-74.

Levine, A.J., Momand, J., and Finlay, C.A. (1991). The p53 tumour suppressor gene. Nature 351, 453-456.

Li, B., Carey, M., and Workman, J.L. (2007). The role of chromatin during transcription. Cell 128, 707-719.

Li, M., He, Y., Dubois, W., Wu, X., Shi, J., and Huang, J. (2012). Distinct regulatory mechanisms and functions for p53-activated and p53-repressed DNA damage response genes in embryonic stem cells. Molecular cell 46, 30-42.

Li, R., Sutphin, P.D., Schwartz, D., Matas, D., Almog, N., Wolkowicz, R., Goldfinger, N., Pei, H., Prokocimer, M., and Rotter, V. (1998). Mutant p53 protein expression interferes with p53- independent apoptotic pathways. Oncogene 16, 3269-3277.

Lim, L.Y., Vidnovic, N., Ellisen, L.W., and Leong, C.O. (2009). Mutant p53 mediates survival of breast cancer cells. British journal of cancer 101, 1606-1612.

Lin, A.W., Barradas, M., Stone, J.C., van Aelst, L., Serrano, M., and Lowe, S.W. (1998). Premature senescence involving p53 and p16 is activated in response to constitutive MEK/MAPK mitogenic signaling. Genes & development 12, 3008-3019.

- 122 -

Linzer, D.I., and Levine, A.J. (1979). Characterization of a 54K dalton cellular SV40 tumor antigen present in SV40-transformed cells and uninfected embryonal carcinoma cells. Cell 17, 43-52.

Liu, L., Scolnick, D.M., Trievel, R.C., Zhang, H.B., Marmorstein, R., Halazonetis, T.D., and Berger, S.L. (1999). p53 sites acetylated in vitro by PCAF and p300 are acetylated in vivo in response to DNA damage. Molecular and cellular biology 19, 1202-1209.

Loewer, A., Batchelor, E., Gaglia, G., and Lahav, G. (2010). Basal dynamics of p53 reveal transcriptionally attenuated pulses in cycling cells. Cell 142, 89-100.

Luger, K., Mader, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. (1997). Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251-260.

Luo, J., Li, M., Tang, Y., Laszkowska, M., Roeder, R.G., and Gu, W. (2004). Acetylation of p53 augments its site-specific DNA binding both in vitro and in vivo. Proc Natl Acad Sci U S A 101, 2259-2264.

Luo, Z., Lin, C., and Shilatifard, A. (2012). The super elongation complex (SEC) family in transcriptional control. Nature reviews Molecular cell biology 13, 543-547.

Lutzker, S.G., and Levine, A.J. (1996). A functionally inactive p53 protein in teratocarcinoma cells is activated by either DNA damage or cellular differentiation. Nat Med 2, 804-810.

Malkin, D., Li, F.P., Strong, L.C., Fraumeni, J.F., Jr., Nelson, C.E., Kim, D.H., Kassel, J., Gryka, M.A., Bischoff, F.Z., Tainsky, M.A., et al. (1990). Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 250, 1233-1238.

Marin, M.C., Jost, C.A., Brooks, L.A., Irwin, M.S., O'Nions, J., Tidy, J.A., James, N., McGregor, J.M., Harwood, C.A., Yulug, I.G., et al. (2000). A common polymorphism acts as an intragenic modifier of mutant p53 behaviour. Nature genetics 25, 47-54.

Masciarelli, S., Fontemaggi, G., Di Agostino, S., Donzelli, S., Carcarino, E., Strano, S., and Blandino, G. (2014). Gain-of-function mutant p53 downregulates miR-223 contributing to chemoresistance of cultured tumor cells. Oncogene 33, 1601-1608.

Matsumoto, M., Furihata, M., and Ohtsuki, Y. (2006). Posttranslational phosphorylation of mutant p53 protein in tumor development. Medical molecular morphology 39, 79-87.

McCabe, M.L., and Dlamini, Z. (2005). The molecular mechanisms of oesophageal cancer. International immunopharmacology 5, 1113-1130.

Meek, D.W., and Anderson, C.W. (2009). Posttranslational modification of p53: cooperative integrators of function. Cold Spring Harbor perspectives in biology 1, a000950.

Menendez, D., Nguyen, T.A., Freudenberg, J.M., Mathew, V.J., Anderson, C.W., Jothi, R., and Resnick, M.A. (2013). Diverse stresses dramatically alter genome-wide p53 binding and transactivation landscape in human cancer cells. Nucleic acids research 41, 7286-7301.

- 123 -

Milne, T.A., Briggs, S.D., Brock, H.W., Martin, M.E., Gibbs, D., Allis, C.D., and Hess, J.L. (2002). MLL targets SET domain methyltransferase activity to Hox gene promoters. Molecular cell 10, 1107-1117.

Miyashita, T., and Reed, J.C. (1995). Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80, 293-299.

Momand, J., Zambetti, G.P., Olson, D.C., George, D., and Levine, A.J. (1992). The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation. Cell 69, 1237-1245.

Morton, J.P., Timpson, P., Karim, S.A., Ridgway, R.A., Athineos, D., Doyle, B., Jamieson, N.B., Oien, K.A., Lowy, A.M., Brunton, V.G., et al. (2010). Mutant p53 drives metastasis and overcomes growth arrest/senescence in pancreatic cancer. Proceedings of the National Academy of Sciences of the United States of America 107, 246-251.

Munroe, D.G., Rovinski, B., Bernstein, A., and Benchimol, S. (1988). Loss of a highly conserved domain on p53 as a result of gene deletion during Friend virus-induced erythroleukemia. Oncogene 2, 621-624.

Nakamura, T., Mori, T., Tada, S., Krajewski, W., Rozovskaia, T., Wassell, R., Dubois, G., Mazo, A., Croce, C.M., and Canaani, E. (2002). ALL-1 is a histone methyltransferase that assembles a supercomplex of proteins involved in transcriptional regulation. Molecular cell 10, 1119-1128.

Nakano, K., and Vousden, K.H. (2001). PUMA, a novel proapoptotic gene, is induced by p53. Molecular cell 7, 683-694.

Nguyen, T.A., Menendez, D., Resnick, M.A., and Anderson, C.W. (2014). Mutant TP53 posttranslational modifications: challenges and opportunities. Human mutation 35, 738-755.

Nikulenkov, F., Spinnler, C., Li, H., Tonelli, C., Shi, Y., Turunen, M., Kivioja, T., Ignatiev, I., Kel, A., Taipale, J., et al. (2012). Insights into p53 transcriptional function via genome-wide chromatin occupancy and gene expression analysis. Cell death and differentiation 19, 1992-2002.

Nupponen, N.N., Porkka, K., Kakkola, L., Tanner, M., Persson, K., Borg, A., Isola, J., and Visakorpi, T. (1999). Amplification and overexpression of p40 subunit of eukaryotic translation initiation factor 3 in breast and prostate cancer. Am J Pathol 154, 1777-1783.

Okada, Y., Feng, Q., Lin, Y., Jiang, Q., Li, Y., Coffield, V.M., Su, L., Xu, G., and Zhang, Y. (2005). hDOT1L links histone methylation to leukemogenesis. Cell 121, 167-178.

Olive, K.P., Tuveson, D.A., Ruhe, Z.C., Yin, B., Willis, N.A., Bronson, R.T., Crowley, D., and Jacks, T. (2004). Mutant p53 gain of function in two mouse models of Li-Fraumeni syndrome. Cell 119, 847-860.

Olivier, M., Hollstein, M., and Hainaut, P. (2010). TP53 mutations in human cancers: origins, consequences, and clinical use. Cold Spring Harbor perspectives in biology 2, a001008.

- 124 -

Oren, M., and Levine, A.J. (1983). Molecular cloning of a cDNA specific for the murine p53 cellular tumor antigen. Proceedings of the National Academy of Sciences of the United States of America 80, 56-59.

Oren, M., Reich, N.C., and Levine, A.J. (1982). Regulation of the cellular p53 tumor antigen in teratocarcinoma cells and their differentiated progeny. Molecular and cellular biology 2, 443-449.

Parada, L.F., Land, H., Weinberg, R.A., Wolf, D., and Rotter, V. (1984). Cooperation between gene encoding p53 tumour antigen and ras in cellular transformation. Nature 312, 649-651.

Pavletich, N.P., Chambers, K.A., and Pabo, C.O. (1993). The DNA-binding domain of p53 contains the four conserved regions and the major mutation hot spots. Genes & development 7, 2556-2564.

Pennica, D., Goeddel, D.V., Hayflick, J.S., Reich, N.C., Anderson, C.W., and Levine, A.J. (1984). The amino acid sequence of murine p53 determined from a c-DNA clone. Virology 134, 477-482.

Prives, C., and Manfredi, J.J. (1993). The p53 tumor suppressor protein: meeting review. Genes & development 7, 529-534.

Reich, N.C., Oren, M., and Levine, A.J. (1983). Two distinct mechanisms regulate the levels of a cellular tumor antigen, p53. Molecular and cellular biology 3, 2143-2150.

Ruggero, D. (2013). Translational control in cancer etiology. Cold Spring Harb Perspect Biol 5.

Ruggero, D., Grisendi, S., Piazza, F., Rego, E., Mari, F., Rao, P.H., Cordon-Cardo, C., and Pandolfi, P.P. (2003). Dyskeratosis congenita and cancer in mice deficient in ribosomal RNA modification. Science 299, 259-262.

Sammons, M.A., Zhu, J., Drake, A.M., and Berger, S.L. (2015). TP53 engagement with the genome occurs in distinct local chromatin environments via pioneer factor activity. Genome research 25, 179-188.

Samuels-Lev, Y., O'Connor, D.J., Bergamaschi, D., Trigiante, G., Hsieh, J.K., Zhong, S., Campargue, I., Naumovski, L., Crook, T., and Lu, X. (2001). ASPP proteins specifically stimulate the apoptotic function of p53. Molecular cell 8, 781-794.

Saramaki, O., Willi, N., Bratt, O., Gasser, T.C., Koivisto, P., Nupponen, N.N., Bubendorf, L., and Visakorpi, T. (2001). Amplification of EIF3S3 gene is associated with advanced stage in prostate cancer. Am J Pathol 159, 2089-2094.

Scian, M.J., Stagliano, K.E., Ellis, M.A., Hassan, S., Bowman, M., Miles, M.F., Deb, S.P., and Deb, S. (2004). Modulation of gene expression by tumor-derived p53 mutants. Cancer research 64, 7447-7454.

Senisterra, G., Wu, H., Allali-Hassani, A., Wasney, G.A., Barsyte-Lovejoy, D., Dombrovski, L., Dong, A., Nguyen, K.T., Smil, D., Bolshan, Y., et al. (2013). Small-molecule inhibition of MLL activity by disruption of its interaction with WDR5. The Biochemical journal 449, 151-159.

- 125 -

Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D., and Lowe, S.W. (1997). Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88, 593-602.

Shah, P.P., Donahue, G., Otte, G.L., Capell, B.C., Nelson, D.M., Cao, K., Aggarwala, V., Cruickshanks, H.A., Rai, T.S., McBryan, T., et al. (2013). Lamin B1 depletion in senescent cells triggers large-scale changes in gene expression and the chromatin landscape. Genes & development 27, 1787-1799.

Shi, A., Murai, M.J., He, S., Lund, G., Hartley, T., Purohit, T., Reddy, G., Chruszcz, M., Grembecka, J., and Cierpicki, T. (2012). Structural insights into inhibition of the bivalent menin- MLL interaction by small molecules in leukemia. Blood 120, 4461-4469.

Shi, X., Kachirskaia, I., Yamaguchi, H., West, L.E., Wen, H., Wang, E.W., Dutta, S., Appella, E., and Gozani, O. (2007). Modulation of p53 function by SET8-mediated methylation at lysine 382. Molecular cell 27, 636-646.

Shieh, S.Y., Ikeda, M., Taya, Y., and Prives, C. (1997). DNA damage-induced phosphorylation of p53 alleviates inhibition by MDM2. Cell 91, 325-334.

Shih, L.Y., Liang, D.C., Fu, J.F., Wu, J.H., Wang, P.N., Lin, T.L., Dunn, P., Kuo, M.C., Tang, T.C., Lin, T.H., et al. (2006). Characterization of fusion partner genes in 114 patients with de novo acute myeloid leukemia and MLL rearrangement. Leukemia 20, 218-223.

Shilatifard, A. (2012). The COMPASS family of histone H3K4 methylases: mechanisms of regulation in development and disease pathogenesis. Annu Rev Biochem 81, 65-95.

Smeenk, L., van Heeringen, S.J., Koeppel, M., Gilbert, B., Janssen-Megens, E., Stunnenberg, H.G., and Lohrum, M. (2011). Role of p53 serine 46 in p53 target gene regulation. PloS one 6, e17574.

Soussi, T., Caron de Fromentel, C., and May, P. (1990). Structural aspects of the p53 protein in relation to gene evolution. Oncogene 5, 945-952.

Stambolsky, P., Tabach, Y., Fontemaggi, G., Weisz, L., Maor-Aloni, R., Siegfried, Z., Shiff, I., Kogan, I., Shay, M., Kalo, E., et al. (2010). Modulation of the vitamin D3 response by cancer- associated mutant p53. Cancer cell 17, 273-285.

Sterner, D.E., and Berger, S.L. (2000). Acetylation of histones and transcription-related factors. Microbiol Mol Biol Rev 64, 435-459.

Stiewe, T. (2007). The p53 family in differentiation and tumorigenesis. Nature reviews Cancer 7, 165-168.

Strano, S., Munarriz, E., Rossi, M., Cristofanelli, B., Shaul, Y., Castagnoli, L., Levine, A.J., Sacchi, A., Cesareni, G., Oren, M., et al. (2000). Physical and functional interaction between p53 mutants and different isoforms of p73. The Journal of biological chemistry 275, 29503-29512.

- 126 -

Sturzbecher, H.W., Brain, R., Addison, C., Rudge, K., Remm, M., Grimaldi, M., Keenan, E., and Jenkins, J.R. (1992). A C-terminal alpha-helix plus basic region motif is the major structural determinant of p53 tetramerization. Oncogene 7, 1513-1523.

Subramanian, M., Francis, P., Bilke, S., Li, X.L., Hara, T., Lu, X., Jones, M.F., Walker, R.L., Zhu, Y., Pineda, M., et al. (2015). A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis. Oncogene 34, 1094-1104.

Sykes, S.M., Mellert, H.S., Holbert, M.A., Li, K., Marmorstein, R., Lane, W.S., and McMahon, S.B. (2006). Acetylation of the p53 DNA-binding domain regulates apoptosis induction. Molecular cell 24, 841-851.

Tam, W.L., and Weinberg, R.A. (2013). The epigenetics of epithelial-mesenchymal plasticity in cancer. Nat Med 19, 1438-1449.

Tang, Y., Luo, J., Zhang, W., and Gu, W. (2006). Tip60-dependent acetylation of p53 modulates the decision between cell-cycle arrest and apoptosis. Molecular cell 24, 827-839.

Tang, Y., Zhao, W., Chen, Y., Zhao, Y., and Gu, W. (2008). Acetylation is indispensable for p53 activation. Cell 133, 612-626.

Tessarz, P., and Kouzarides, T. (2014). Histone core modifications regulating nucleosome structure and dynamics. Nat Rev Mol Cell Biol 15, 703-708.

Thiel, A.T., Huang, J., Lei, M., and Hua, X. (2012). Menin as a hub controlling mixed lineage leukemia. BioEssays : news and reviews in molecular, cellular and developmental biology 34, 771-780.

Toledo, F., and Wahl, G.M. (2006). Regulating the p53 pathway: in vitro hypotheses, in vivo veritas. Nature reviews Cancer 6, 909-923.

Tschiersch, B., Hofmann, A., Krauss, V., Dorn, R., Korge, G., and Reuter, G. (1994). The protein encoded by the Drosophila position-effect variegation suppressor gene Su(var)3-9 combines domains of antagonistic regulators of homeotic gene complexes. The EMBO journal 13, 3822- 3831.

Tsukiyama, T., and Wu, C. (1997). Chromatin remodeling and transcription. Current opinion in genetics & development 7, 182-191.

Unger, T., Nau, M.M., Segal, S., and Minna, J.D. (1992). p53: a transdominant regulator of transcription whose function is ablated by mutations occurring in human cancer. The EMBO journal 11, 1383-1390. van Lohuizen, M. (1999). The trithorax-group and polycomb-group chromatin modifiers: implications for disease. Current opinion in genetics & development 9, 355-361.

Vaughan, C.A., Deb, S.P., Deb, S., and Windle, B. (2014). Preferred binding of gain-of-function mutant p53 to bidirectional promoters with coordinated binding of ETS1 and GABPA to multiple binding sites. Oncotarget 5, 417-427.

- 127 -

Voorhoeve, P.M., le Sage, C., Schrier, M., Gillis, A.J., Stoop, H., Nagel, R., Liu, Y.P., van Duijse, J., Drost, J., Griekspoor, A., et al. (2006). A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors. Cell 124, 1169-1181.

Voss, A.K., Collin, C., Dixon, M.P., and Thomas, T. (2009). Moz and retinoic acid coordinately regulate H3K9 acetylation, Hox gene expression, and segment identity. Developmental cell 17, 674-686.

Vousden, K.H., and Ryan, K.M. (2009). p53 and metabolism. Nature reviews Cancer 9, 691-700.

Wallrath, L.L. (1998). Unfolding the mysteries of heterochromatin. Current opinion in genetics & development 8, 147-153.

Wang, G.G., Allis, C.D., and Chi, P. (2007). Chromatin remodeling and cancer, Part I: Covalent histone modifications. Trends Mol Med 13, 363-372.

Wang, P., Lin, C., Smith, E.R., Guo, H., Sanderson, B.W., Wu, M., Gogol, M., Alexander, T., Seidel, C., Wiedemann, L.M., et al. (2009). Global analysis of H3K4 methylation defines MLL family member targets and points to a role for MLL1-mediated H3K4 methylation in the regulation of transcriptional initiation by RNA polymerase II. Molecular and cellular biology 29, 6074-6085.

Wang, W., Cheng, B., Miao, L., Mei, Y., and Wu, M. (2013). Mutant p53-R273H gains new function in sustained activation of EGFR signaling via suppressing miR-27a expression. Cell death & disease 4, e574.

Wang, Y., Reed, M., Wang, P., Stenger, J.E., Mayr, G., Anderson, M.E., Schwedes, J.F., and Tegtmeyer, P. (1993). p53 domains: identification and characterization of two autonomous DNA- binding regions. Genes & development 7, 2575-2586.

Waskiewicz, A.J., Johnson, J.C., Penn, B., Mahalingam, M., Kimball, S.R., and Cooper, J.A. (1999). Phosphorylation of the cap-binding protein eukaryotic translation initiation factor 4E by protein kinase Mnk1 in vivo. Mol Cell Biol 19, 1871-1880.

Weissmueller, S., Manchado, E., Saborowski, M., Morris, J.P.t., Wagenblast, E., Davis, C.A., Moon, S.H., Pfister, N.T., Tschaharganeh, D.F., Kitzing, T., et al. (2014). Mutant p53 drives pancreatic cancer metastasis through cell-autonomous PDGF receptor beta signaling. Cell 157, 382-394.

Wolf, D., Harris, N., and Rotter, V. (1984). Reconstitution of p53 expression in a nonproducer Ab-MuLV-transformed cell line by transfection of a functional p53 gene. Cell 38, 119-126.

Wong, G.S., Lee, J.S., Park, Y.Y., Klein-Szanto, A.J., Waldron, T.J., Cukierman, E., Herlyn, M., Gimotty, P., Nakagawa, H., and Rustgi, A.K. (2013). Periostin cooperates with mutant p53 to mediate invasion through the induction of STAT1 signaling in the esophageal tumor microenvironment. Oncogenesis 2, e59.

Wu, X., Bayle, J.H., Olson, D., and Levine, A.J. (1993). The p53-mdm-2 autoregulatory feedback loop. Genes & development 7, 1126-1132.

- 128 -

Xiong, S., Tu, H., Kollareddy, M., Pant, V., Li, Q., Zhang, Y., Jackson, J.G., Suh, Y.A., Elizondo-Fraire, A.C., Yang, P., et al. (2014). Pla2g16 phospholipase mediates gain-of-function activities of mutant p53. Proceedings of the National Academy of Sciences of the United States of America 111, 11145-11150.

Xu, J., Qian, J., Hu, Y., Wang, J., Zhou, X., Chen, H., and Fang, J.Y. (2014). Heterogeneity of Li- Fraumeni syndrome links to unequal gain-of-function effects of p53 mutations. Scientific reports 4, 4223.

Yokoyama, A., Somervaille, T.C., Smith, K.S., Rozenblatt-Rosen, O., Meyerson, M., and Cleary, M.L. (2005). The menin tumor suppressor protein is an essential oncogenic cofactor for MLL- associated leukemogenesis. Cell 123, 207-218.

Yokoyama, A., Wang, Z., Wysocka, J., Sanyal, M., Aufiero, D.J., Kitabayashi, I., Herr, W., and Cleary, M.L. (2004). Leukemia proto-oncoprotein MLL forms a SET1-like histone methyltransferase complex with menin to regulate Hox gene expression. Molecular and cellular biology 24, 5639-5649.

Yoshikawa, K., Hamada, J., Tada, M., Kameyama, T., Nakagawa, K., Suzuki, Y., Ikawa, M., Hassan, N.M., Kitagawa, Y., and Moriuchi, T. (2010). Mutant p53 R248Q but not R248W enhances in vitro invasiveness of human lung cancer NCI-H1299 cells. Biomedical research 31, 401-411.

Zeisig, D.T., Bittner, C.B., Zeisig, B.B., Garcia-Cuellar, M.P., Hess, J.L., and Slany, R.K. (2005). The eleven-nineteen-leukemia protein ENL connects nuclear MLL fusion partners with chromatin. Oncogene 24, 5525-5532.

Zeller, K.I., Zhao, X., Lee, C.W., Chiu, K.P., Yao, F., Yustein, J.T., Ooi, H.S., Orlov, Y.L., Shahab, A., Yong, H.C., et al. (2006). Global mapping of c-Myc binding sites and target gene networks in human B cells. Proc Natl Acad Sci U S A 103, 17834-17839.

Zhang, C., Liu, J., Liang, Y., Wu, R., Zhao, Y., Hong, X., Lin, M., Yu, H., Liu, L., Levine, A.J., et al. (2013). Tumour-associated mutant p53 drives the Warburg effect. Nature communications 4, 2935.

Zhang, N., and Chen, X. (2015). Potential role of O-GlcNAcylation and involvement of PI3K/Akt1 pathway in the expression of oncogenic phenotypes of gastric cancer cells in vitro. Biotechnology and applied biochemistry.

Zhang, P., Wang, C., Ma, T., and You, S. (2015a). O-GlcNAcylation enhances the invasion of thyroid anaplastic cancer cells partially by PI3K/Akt1 pathway. OncoTargets and therapy 8, 3305-3313.

Zhang, X., Ma, L., Qi, J., Shan, H., Yu, W., and Gu, Y. (2015b). MAPK/ERK signaling pathway- induced hyper-O-GlcNAcylation enhances cancer malignancy. Molecular and cellular biochemistry 410, 101-110.

- 129 -

Zhao, Y., Zhang, C., Yue, X., Li, X., Liu, J., Yu, H., Belyi, V.A., Yang, Q., Feng, Z., and Hu, W. (2015). Pontin, a new mutant p53-binding protein, promotes gain-of-function of mutant p53. Cell death and differentiation 22, 1824-1836.

Zhu, Q., Wani, G., Wani, M.A., and Wani, A.A. (2001). Human homologue of yeast Rad23 protein A interacts with p300/cyclic AMP-responsive element binding (CREB)-binding protein to down-regulate transcriptional activity of p53. Cancer research 61, 64-70.

- 130 -