Phylogenetic Relationship of Wild and Cultivated Vigna (Subgenus Ceratotropis, Fabaceae) from Myanmar Based on Sequence Variations in Non-Coding Regions of Trnt-F

Breeding Science 57 : 271–280 (2007)

Phylogenetic Relationship of Wild and Cultivated Vigna (Subgenus Ceratotropis, Fabaceae) from Myanmar Based on Sequence Variations in Non-coding Regions of trnT-F

Ye Tun Tun and Hirofumi Yamaguchi*

Laboratory of Economic Botany and Biodiversity, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen, Sakai, Osaka 599-8531, Japan

For clarifying the phylogenetic diversity of fifteen species of the subgenus Ceratotropis, including seven wild and three cultivated Vigna species collected from Myanmar, sequence variations in three trnT-F non-coding regions of the chloroplast genome were analyzed. The Myanmar materials were clustered into two well differentiated groups, the azuki bean group and the mung bean group. Six Myanmar species were clustered into the azuki bean group, and four species into the mung bean group. The azuki bean group consisted of three subclades: angularis-nepalensis subclade, minima subclade and riukiuensis-nakashimae-umbellata- hirtella-exilis subclade. No clear lineage differentiation was found among the three races of V. angularis and V. nepalensis. An accession from Myanmar, which showed similar morphological features to those of wild azuki bean, shared a 51-bp deletion with V. angularis and V. nepalensis. Three V. minima accessions showed a distinct clade. V. riukiuensis showed a nested relationship with V. nakashimae sistered to V. hirtella, V. umbellata and V. exilis. The mung bean group consisted of five radiated subclades. In the mung bean group, V. trinervia from Myanmar was clustered with V. reflexo-pilosa, and wild mung bean accessions with their cultivated accessions. A high level of substitution, indel and microsatellite variations in the trnT-F sequences indicated that mung bean (V. radiata) and black gram (V. mungo) are phylogenetically well differentiated in the mung bean group. Myanmar is considered to be an area overlapping two major groups of the subgenus Ceratotropis.

Key Words: azuki bean, Vigna, chloroplast genome, genetic resources, geographical divergence, interspecific relationship.

Introduction the edges of lowland paddy fields (V. stipulacea Kuntze in the central dry area), hilly region (V. radiata var. sublobata The subgenus Ceratotropis of the genus Vigna includes (Roxb.) Verdc. in the Shan highlands) to the subtropical five important legumes, mung bean [Vigna radiata (L.) monsoon area (e.g. V. nakashimae (Ohwi) Ohwi & Ohashi Wilczek], black gram [V. mungo (L.) Hepper], azuki bean in southern Myanmar). These wild Vigna species are consid- [V. angularis (Willd.) Ohwi & Ohashi], rice bean [V. umbellata ered to be important genetic resources for crop improvement (Thunb.) Ohwi & Ohashi], and moth bean [V. aconitifolia and biodiversity conservation. (Jacq.) Maréchal], all of which are cultivated for the produc- The subgenus Ceratotropis is considered to be a morpho- tion of food, bean sprouts, sweet red-bean paste and materi- logically homogeneous group (Baudoin and Maréchal 1988, als for cultural ceremonies in Asia (Lumpkin and McClary Tateishi 1996). However, there have been different taxonom- 1994, Smartt 1990, Yamaguchi 1992). Among ca. 20 species ic treatises on the interspecific grouping in this subgenus, of the subgenus Ceratotropis (Maréchal et al. 1978, Tateishi namely two morphological groups, genus Azukia vs. genus 1985, Tomooka et al. 2002a, Verdcourt 1970), wild relatives Rudua (Maekawa 1955), a monophyletic Azuki bean group of these crops are distributed throughout South Asia to East s. str. and other Ceratotropis species that are hardly recog- Asia. Recently, several wild Vigna species have been col- nized as a monophyletic group (Tateishi 1996), three sections, lected from Myanmar (our collection in 2001, Tomooka et sect. Ceratotropis Tomooka & Maxted, sect. Angulares al. 2003). Many are tropical, and a few are temperate spe- Tomooka & Maxted and sect. Aconitifoliae Tomooka & cies. Wild Vigna species in Myanmar are distributed from Maxted (Tomooka et al. 2002a) (Table 1). In molecular studies, Doi et al. (2002) claimed the presence of three sec- Communicated by J. Abe tional groups based on the results of analyses of the ITS and Received January 9, 2007. Accepted July 6, 2007. atpB-rbcL sequences. In contrast, Goel et al. (2002) who ob- *Corresponding author (e-mail: hyama102@plant.osakafu-u.ac.jp) served a different pattern of interspecific relationship based 272 Tun and Yamaguchi on the analysis of the ITS sequences, recognized two groups Materials and Methods in Ceratotropis. A phylogenetic analysis based on the trnL and trnL-F sequences (Yano et al. 2004) revealed the pres- Plant materials ence of two major clades, the azuki bean group and the mung The conventional taxonomic treatments of the Vigna bean group in Ceratotropis. Furthermore, a molecular phy- species used in the present study are summarized in Table 1. logenetic tree constructed by Yano et al. (2004) was incon- Fifty accessions of 19 taxa representing 15 species from 9 gruent with the other trees (Doi et al. 2002, Goel et al. 2002) countries were used (Table 2). Seventeen accessions of ten in the grouping of V. reflexo-pilosa, which was classified species collected from Myanmar were included. One acces- into the mung bean group rather than the azuki bean group. sion from Myanmar (Azn/01-My-05) was referred to as Despite repeated taxonomic revisions based on field studies V. angularis var. nipponensis aff. because it displayed the and molecular analyses on the subgenus Ceratotropis, the same traits as those of nipponensis for most characters, ex- phylogenetic relationship of several wild Vigna species oc- cept for a floral morphological feature similar to that of curing in South and South East Asia, in particular, V. minima V. tenuicaulis, a member of the subgenus Ceratotropis (Roxb.) Ohwi & Ohashi, V. nakashimae and V. riukiuensis (Tomooka et al. 2002a). V. unguiculata (L.) Walp. and (Ohwi) Ohwi & Ohashi, V. hirtella Ridley and V. nepalensis V. marina (Burman) Merr. of the subgenus Vigna, and Tateishi, is still unclear (Doi et al. 2002, Konarev et al. V. vexillata (L.) A. Rich. of the subgenus Plectotropis were 2002, Tateishi 1985, Tomooka et al. 2002b, 2002c, Yoon et selected as outgroups based on their relationship with the in- al. 2000). In a few studies, limited samples of wild Vigna group described in the previous studies (Fatokun et al. 1993, from Myanmar have been used (Saravanakumar et al. 2004, Goel et al. 2002, Maréchal et al. 1978, Yano et al. 2004, Seehalak et al. 2006). However, genetic relationships of Yasuda and Yamaguchi 1996). Wild, weedy and cultivated wild and cultivated Vigna species in Myanmar with other races were assigned in reference to the reports of Yamaguchi Asian Ceratotropis species have not been fully elucidated. It (1992) and Tomooka et al. (2002b). is necessary to analyze the genetic relationships of Vigna species from Myanmar since Myanmar is located at the DNA sequencing junction of the Indian subcontinent and East Asia. The ob- Total genomic DNA was extracted from fresh leaves by jective of the present study was to investigate the phyloge- the CTAB method (Doyle and Doyle 1987). Three non- netic relationships of 15 Vigna species, including ten species coding regions, trnT-L intergenic spacer, trnL intron and from Myanmar, based on sequence variations in the trnT-F trnL-F spacer, were amplified by trn-a (forward) and trn-b non-coding regions of the chloroplast genome. (reverse), trn-c (forward) and trn-d (reverse), and trn-e (forward) and trn-f (reverse) primers, respectively (Taberlet et al. 1991). Using 25 µl of a reaction mixture containing 2.5 µl of 10 × reaction buffer, 2.5 µl of 25 mM MgCl2, 2.5 µl of 1.25

Table 1. Species or species groups reported by Tateishi (1996) and Tomooka et al. (2002a) Tateishi (1996) Tomooka et al. (2002a) Germination type Species Group Species Section V. angularis var. angularis1) Azuki bean group s. str. V. angularis var. angularis1) Angulares Hypogeal/petiolate V. angularis var. nipponensis Azuki bean group s. str. V. angularis var. nipponensis Angulares Hypogeal/petiolate V. nepalensis Azuki bean group s. str. V. nepalensis Angulares Hypogeal/petiolate V. minima var. minima Azuki bean group s. str. V. minima Angulares Hypogeal/petiolate V. minima var. minor Azuki bean group s. str. V. riukiuensis Angulares Hypogeal/petiolate V. minima var. nakashimae Azuki bean group s. str. V. nakashimae Angulares Hypogeal/petiolate V. exilis Azuki bean group s. str. V. exilis Angulares Hypogeal/petiolate V. umbellata1) Azuki bean group s. str. V. umbellata1) Angulares Hypogeal/petiolate V. hirtella Azuki bean group s. str. V. hirtella Angulares Hypogeal/petiolate V. reflexo-pilosa subsp. reflexo-pilosa Azuki bean group s. str. V. reflexo-pilosa var. reflexo-pilosa Angulares Hypogeal/petiolate V. reflexo-pilosa subsp. glabra Azuki bean group s. str. V. reflexo-pilosa var. glabra Angulares Hypogeal/petiolate V. trinervia var. trinervia Azuki bean group s. str. V. trinervia var. trinervia Angulares Hypogeal/petiolate V. radiata var. radiata2) Mung bean group V. radiata var. radiata2) Ceratotropis Epigeal/sessile V. radiata var. sublobata Mung bean group V. radiata var. sublobata Ceratotropis Epigeal/sessile V. mungo var. mungo2) Mung bean group V. mungo var. mungo2) Ceratotropis Epigeal/sessile V. aconitifolia Mung bean group V. aconitifolia Aconitifoliae Epigeal/petiolate V. stipulacea Mung bean group V. stipulacea Aconitifoliae Epigeal/petiolate V. trilobata Mung bean group V. trilobata Aconitifoliae Epigeal/petiolate 1) Maekawa Azukia group. 2) Maekawa Rudua group. Wild and cultivated Vigna from Myanmar 273

Table 2. Plant materials used for phylogenetic analysis Sequence accession State, division, prefecture or Code Subgenus/species Race Accession no. numbers for trnT-L and province/Country trnL and trnL-F regions Subgenus Ceratotropis Van-1 V. angularis var. angularis Cultivated Aza/88-J-26 Miyazaki/Japan AB302444/AB304026 Van-2 V. angularis var. angularis Cultivated Aza/99-C-04 Shanghai/China AB302445/AB304027 Van-3 V. angularis var. angularis Cultivated Aza/96-B-38 Shemgang/Bhutan AB302446/AB304028 Van-4 V. angularis var. nipponensis Wild Azn/96-B-02 Mongar/Bhutan AB302448/AB304033 Van-5 V. angularis var. nipponensis Wild Azn/96-C-02 Sichuan/China AB302451/AB304032 Van-6 V. angularis var. nipponensis Wild Azn/03-K-04 Gyeongsangbuk/Korea AB302447/AB304029 Van-7 V. angularis var. nipponensis Wild Azn/91-J-14 Nagasaki/Japan AB302450/AB304031 Van-8 V. angularis var. nipponensis aff. Wild Azn/01-My-05 Shan/Myanmar AB302449/AB304030 Van-9 V. angularis Weed Azn/90-J-411) Yamanashi/Japan AB302452/AB304034 Van-10 V. angularis Weed Azn/91-K-011) Gyeongsangnam/Korea AB302453/AB304035 Vne-1 V. nepalensis Wild NI 9702) Himachal Pradesh/India AB302454/AB304036 Vne-2 V. nepalensis Wild NI 9712) Himachal Pradesh/India AB302455/AB304037 Vne-3 V. nepalensis Wild NI 17042) East Nepal/Nepal AB302456/AB304038 Vmn-1 V. minima Wild Azr/01-My-01 Kayin/Myanmar AB303989/AB304039 Vmn-2 V. minima Wild Azr/01-My-03 Mon/Myanmar AB303990/AB304040 Vmn-3 V. minima Wild Azr/01-My-04 Mon/Myanmar AB303991/AB304041 Vri-1 V. riukiuensis Wild Azr/91-O-011,3) Iriomote, Okinawa/Japan AB303992/AB304042 Vri-2 V. riukiuensis Wild YF-05-V10-24) Ishigaki, Okinawa/Japan AB303993/AB304043 Vri-3 V. riukiuensis Wild NI 16352) Yonaguni, Okinawa/Japan AB303994/AB304044 Vnk-1 V. nakashimae Wild Azm/01-My-04 Mon/Myanmar AB303995/AB304046 Vnk-2 V. nakashimae Wild Azm/98-C-01 Guangxi/China AB303996/AB304046 Vnk-3 V. nakashimae Wild Azm/03-K-02 Chungcheongnam/Korea AB303997/AB304047 Vnk-4 V. nakashimae Wild Azm/96-J-011) Nagasaki/Japan AB303998/AB304048 Vxi-1 V. exilis Wild Aze/01-My-01 Mon/Myanmar AB303999/AB304049 Vxi-2 V. exilis Wild Aze/01-My-02 Mon/Myanmar AB304000/AB304050 Vum-1 V. umbellata (twining form) Wild Azu/03-Th-01 Kanchanaburi/Thailand AB304001/AB304053 Vum-2 V. umbellata (twining form) Wild Azu/03-Th-05 Kanchanaburi/Thailand AB304002/AB304054 Vum-3 V. umbellata Cultivated Azu/01-My-04 Shan/Myanmar AB304003/AB304055 Vum-4 V. umbellata Cultivated Azu/94-C-14 Guizhou/China AB304005/AB304056 Vum-5 V. umbellata Cultivated Azu/94-N-011) Nepal AB304004/AB304057 Vhi-1 V. hirtella Wild Azh/01-My-03 Kayin/Myanmar AB304006/AB304051 Vhi-2 V. hirtella Wild Azh/00-My-01 Shan/Myanmar AB304007/AB304052 Vrp-1 V. reflexo-pilosa var. reflexo-pilosa Wild Azp/92-O-011) Okinawa/Japan AB304009/AB304059 Vrp-2 V. reflexo-pilosa var. reflexo-pilosa Wild Azp/02-V-01 Long An/Vietnam AB304008/AB304058 Vrp-3 V. reflexo-pilosa var. glabra Cultivated Azp/03-V-02 Phu Yen/Vietnam AB304010/AB304060 Vtn V. trinervia Wild Aztr/01-My-09 Shan/Myanmar AB304011/AB304061 Vrd-1 V. radiata var. radiata Cultivated Azd/My-004178 Sagaing/Myanmar AB304012/AB304062 Vrd-2 V. radiata var. radiata Cultivated Azd/94-N-03 Nepal AB304013/AB304063 Vrd-3 V. radiata var. sublobata Wild Azd/01-My-01 Mandalay/Myanmar AB304014/AB304064 Vrd-4 V. radiata var. sublobata Wild Azd/00-My-01 Shan/Myanmar AB304015/AB304065 Vmg-1 V. mungo var. mungo Cultivated Azg/My-003935 Magway/Myanmar AB304016/AB304066 Vmg-2 V. mungo var. mungo Cultivated Azg/94-N-011) Nepal AB304017/AB304067 Vmg-3 V. mungo var. mungo Cultivated Azg/95-I-01 Bombay/India AB304018/AB304068 Vac V. aconitifolia Cultivated Azc/95-I-01 Andhra Pradesh/India AB304019/AB304069 Vtb V. trilobata Wild Azt/96-I-01 Rajasthan/India AB304020/AB304072 Vst-1 V. stipulacea Wild Azt/01-My-02 Mandalay/Myanmar AB304021/AB304070 Vst-2 V. stipulacea Wild Azt/01-My-04 Mandalay/Myanmar AB304022/AB304071 Outgroup Subgenus Plectotropis Out-1 V. vexillata var. vexillata Wild Vex/91-J-02 Tsushima/Japan AB304024/AB304073 Subgenus Vigna Out-2 V. unguiculata var. unguiculata Cultivated Vuc/My-4208 Myanmar AB304023/AB304074 Out-3 V. marina Wild Vgm/90-O-011) Okinawa, Iriomote/Japan AB304025/AB304075 1) Same accessions as those used by Yano et al. (2004). 2) Accessions from National Botanical Garden of Belgium. 3) V. riukiuensis, V. minima var. minor in Yano et al. (2004). 4) Herbarium specimen: Coll. by Fukushima & Yamaguchi 2005. 274 Tun and Yamaguchi mM dNTPs, 1.25 µl of each 10 µM primer, 0.1 µl of Taq (5 Results units/µl), 1.0 µl of 10.0 ng/µl genomic DNA and 13.9 µl of dH2O, the trnT-L region was amplified by polymerase chain Sequence variations in non-coding regions of trnT-F reactions in a thermocycler (Gene Amp PCR System 2700, The length of the sequences in the three non-coding re- Applied Biosystems) as follows: initial denaturation for 2 gions of trnT-F ranged from 796 bp to 841 bp for the trnT-L min at 96°C, followed by 35 cycles of denaturation (94°C spacer region, from 539 bp to 543 bp for the trnL intron re- for 1 min), annealing (57°C for 45 sec) and extension (72°C gion, and from 413 bp to 488 bp for the trnL-F spacer region for 2 min), with final extension at 72°C for 5 min in the ther- in the ingroup. In a combined data set of trnT-F, the shortest mocycler. The trnL intron and trnL-F spacer regions were sequence (1,773 bp long) was found in an accession of amplified by using the same protocol as that described by V. angularis var. nipponensis aff. (code, Van-8), and the Yano et al. (2004). Amplified products were purified ac- longest sequence (1,839 bp long) was found in V. reflexo- cording to the instructions included in the manuals of the pilosa (codes, Vrp-1, Vrp-2, Vrp-3). Among the three out- QIA quick Spin PCR Purification Kit (QIAgen, Valencia, group species, V. unguiculata showed the shortest sequence Califonia, USA). The PCR primers were used as sequencing (1,777 bp) for trnT-F. The aligned sequence of the three re- primers. Sequencing was performed using the ABI BigDye gions including the outgroup species was 2,003 bp long with Terminator Cycle v3.1 Sequencing kit and an ABI PRISM 201 variable sites, of which 115 (57%) sites were parsimony- 3100 Genetic Analyzer (Perkin-Elmer, Foster, CA), accord- informative. The trnT-L spacer region was most variable ing to the manufacturer’s instructions. All the sequences and informative among the three non-coding regions. The were registered in DDBJ (http://www.ddbj.nig.ac.jp/) sequence length of the trnT-L spacer region varied widely (Table 2). between the ingroup and outgroup; the shortest sequence was 763 bp long in V. unguiculata, and the longest was 841 bp Phylogenetic tree construction long in V. angularis. More indels were found in the trnT-L Sequences were aligned using ClustalX (Thompson et spacer region compared with the other two regions. Indel al. 1997), with manual adjustments in GeneDoc (Nicholas et size ranged from 1 bp to 59 bp in the aligned sequence. After al. 1997). Ten unambiguous informative gap positions were the exclusion of all the gap positions, the alignment re- coded as binary data (0, 1). To evaluate the combinability of mained 1,610 bp long with 100 parsimony-informative sites: trnT-L spacer, trnL intron and trnL-F spacer sequences, in- 51 for trnT-L, 19 for trnL, and 30 for trnL-F (Table 3). congruence length difference (ILD) tests (Farris et al. 1995) were performed with 100 replications using PAUP v4.0b10 Intraspecific variations (Swofford 2000). Phylogenetic analysis was carried out by Intraspecific sequence variations in the three non- the maximum parsimony method using the PAUP. The most coding regions of trnT-F were more conspicuous in Vigna parsimonious trees were searched using the heuristic option riukiuensis (Vri-1~3), V. nakashimae (Vnk-1~4) and with random addition sequences and branch-swapping algo- V. nepalensis (Vne-1~3) than in the other species (Table 4). rithm set to TBR (tree bisection-reconnection) with 1,000 Three V. riukiuensis accessions showed 12 substitutions and replications. Characters were weighted equally, and charac- 4 microsatellite repeat variations (2 poly (A) repeats and 2 ter states were unordered. For evaluating the clade robust- poly (T) repeats) in the trnT-F sequences. Four accessions ness, bootstrap analyses were performed with 1,000 replica- of V. nakashimae showed 8 substitutions and a repeat vari- tions (Felsenstein 1985). The 50% majority rule consensus ation in one poly (T) microsatellite: (T)9 repeats in the tree was constructed from the most parsimonious trees. Myanmar and Chinese accessions (Vnk-1 and Vnk-2) and (T)10 repeats in the Korean and Japanese accessions (Vnk-3 and Vnk-4). Three V. nepalensis accessions showed 11 substitutions, 3 microsatellite repeat variations and one 8-bp

Table 3. Sequence characteristics of the three non-coding regions of cpDNA trnT-F in the present study Spacers + intron Character trnT-L spacer trnL intron trnL-F spacer combined Sequence length, bp (ingroup) 796–841 539–543 413–488 1773–1839 Sequence length, bp (outgroup) 763–789 565–576 448–449 1777–1808 Aligned length, bp 921 584 498 2003 Variable sites (%) 110 (11.9) 37 (6.3) 54 (10.8) 201 (10.0) Parsimony-informative sites including indels (%) 59 (6.4) 20 (3.4) 36 (7.2) 115 (5.7) Parsimony-informative sites excluding indels (%) 51 (7.3) 19 (3.6) 30 (7.8) 100 (6.2) Mean GC content (%) 19.5 30.5 26.2 24.5 ts: tv ratio 2 : 12 1 : 51 : 73 : 24 Abbreviations: bp, base pairs; GC, guanine and cytosine; ts, transition; tv, transversion; ingroup, subgenus Ceratotropis species. outgroup, V. vexillata, V. unguiculata, V. marina. Wild and cultivated Vigna from Myanmar 275 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 11 10 10 10 10 L-F bp deletionbp deletion (T) bp deletion (T) bp deletion (T) bp deletion (T) bp deletion (T) bp deletion (T) bp deletion (T) bp deletion (T) bp deletion (T) bp deletion (T) bp deletion (T) bp deletion (T) bp insertion (T) (T) bp insertion (T) bp insertion (T) bp insertion (T) bp insertion (T) bp insertion (T) bp insertion (T) bp insertion (T) bp insertion (T) bp insertion (T) bp insertion (T) bp insertion (T) bp insertion (T) bp insertion (T) bp insertion (T) bp insertion (T)

trn TTCGGGTCGG GTTAGG G 51 TTAAG G 51 TTCGG G 51 TTCGG G 51 TTCGG G 51 TTCGG G 51 TTCGG G 51 TTCGG G 51 TTCGG G 51 TTCGG G 51 TTCGG G 51 G 51 51 TTCGGTTCGG –TTCGG – 51 TTCGG – 51 TTCGG – 51 TTCGG – 51 TTCGG – 51 TTCGG – 51 TTCGG – 51 TTCGG – 51 TTCGG – 51 TTCGG – 51 TTCGG – 51 GACAA – 51 TTAGG G 51 TTAGG T 51 T 51 51 2 2 2 2 2 2 2 2 2 2 2 1 2 2 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 L trn CTCCT (T) ATCCT (T) CGCCT (T) CGCCT (T) ATACT (T) ATCCT (T) CTCCT (T) CTCAT (T) CTCCT (T) CTCCT (T) CTCCT (T) CTCCT (T) CTCCT (T) 11111 1 11111 1 1 CTCCTCTCCT (T) CTCCT (T) CTCCA (T) CTCCT (T) CTCCT (T) CTCCT (T) CTCCT (T) CTCCT (T) CTCCT (T) CTCCT (T) CTCCT (T) CTCCT (T) ATCCT (T) CGCCT (T) CGCCT (T) (T) 8 8 8 8 8 8 8 8 8 8 8 8 7 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 T-F non-coding regions (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) trn 3 3 3 3 3 3 3 3 3 3 3 3 3 3 2 3 3 3 3 3 3 3 3 3 3 3 3 3 3 (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) 9 10 10 10 10 10 10 10 10 10 11 10 10 12 11 11 11 11 11 11 10 10 10 10 10 10 10 10 10 (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) (A) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 quence variations in Gene region/Sequence position species revealed by se T-L trn Ceratotropis repeat variation in some 11122233444455678 2 2 3 3 8 8 3 5 7 9 01134 4 55599 7 1754–1804 8 GTTTTAGAATGTGCTAACCAAA –––––––––––GTTTTCGACTGGGCTAACCAAA –––––––– –––––––––––GTTTTAGAATGTGCTAACCAAA –––––––– ––––––––––– –––––GTTTTAGAATGTGCTAACCAAA (TA) –––––––– ––––––––––– –––––GTTTTCGAATGGGCTTAACACA (TA) –––––––– ––––––––––– –––––GTTTTCGAATGGGCTTAACCCA (TA) –––––––– ––––––––––– –––––GTTCTCGAATGGGCTTAACACA (TA) –––––––– ––––––––––– –––––GTTCTCGAATGGGCTTAACAAA (TA) –––––––– ––––––––––– –––––GTTCTCGAATGGGCTTAACACA (TA) –––––––– ––––––––––– –––––GTTCTCGAATGGGCTTAACACA (TA) –––––––– ––––––––––– –––––GTTCTCGAACGGGCCTAACACA (TA) –––––––– ––––––––––– –––––GGTTTATAATTGTCTTGACACA (TA) –––––––– ––––––––––– –––––GGTTTATAATTGTCTTGACACA (TA) –––––––– ––––––––––– ––––– (TA) –––––––– GAAAA GAAAA – (TA) (A) Substitutions, indels and 1245718916658356757390 2–––––––––36156129082347418843043 4––––––5 1 1–––2 9 1 9 3 9 0 7 1 1 42510 1 6 3 57908 6 5 0 84922 3 60455 8 1 0 GTGGTCTAATTGGCTTGAAACA ATAATTTATTT AAGTACTT GAAAA (TA) GTGGTCTAATTGGCTTGAAACA ATAATTTATTTGTGGTCTAATTGGCTTGAAACA AAGTACTT ATAATTTATTTGTGGTCTAATTGGCTTGAAACA AAGTACTT ––––––––––– GAAAAGTGGTCTAATTGGTTTGAAACA (TA) AAGTACTT ––––––––––– GAAAAGTGGTCTAATTGGCTTGAAACA (TA) AAGTACTT ATAATTTATTT GAAAAGTGGTCTAATTGGCTTGAAACA (TA) AAGTACTT ATAATTTATTT –––––GGTTTCTCATTGGCTTGACACC (TA) AAGTACTT ––––––––––– GAAAAGTGGTCTAATTGGCTTGAAACA (TA) –––––––– ATAATTTATTT GAAAAGTGGTCTAATTGGCTTGAAACA (TA) AAGTACTT ATAATTTATTT GAAAAGTTTTCGACTGGTCTAACCACA (TA) AAGTACTT ––––––––––– GAAAAGTGGGCTAATTGGCTTGAAACA (TA) –––––––– ––––––––––– GAAAAGTGGGCTAATTGGCTTGAAACA (TA) AAGTACTT ––––––––––– GAAAATTTTTCGACTGGGCTAACCAAA (TA) AAGTACTT ––––––––––– GAAAAGTTTTAGAATGTGCTAACCAAA (TA) –––––––– ––––––––––– GAAAAGTTTTAGAATGTGCTAACCAAA (TA) –––––––– ––––––––––– ––––– (TA) –––––––– ––––– (TA) ––––– (TA) 4.

Van-1 Code Table Van-2 Van-3 Van-4 Van-5 Van-6 Van-7 Van-8 Van-9 Van-10 Vne-1 Vne-2 Vne-3 Vri-1 Vri-2 Vri-3 Vnk-1 Vnk-2 Vnk-3 Vnk-4 Vxi-1 Vxi-2 Vum-1 Vum-2 Vum-3 Vum-4 Vum-5 Vst-1 Vst-2 276 Tun and Yamaguchi indel. Only two substitutions in the trnT-F sequences were indels and 3 microsatellite variations in the trnT-F regions observed in wild, weedy and cultivated races of V. angularis (Table 5). (Van-1~10), except for the Van-8 accession from Myanmar. Since the partition homogeneity test indicated the phy- The Van-8 accession showed six substitutions, compared logenetic congruence of the three non-coding regions (P = with the other accessions of V. angularis. Moreover, two 0.08), the combined data set was used to determine the inter- indels found in the Van-8 accession were shared with both specific relationship in the subgenus Ceratotropis. A maxi- V. angularis and V. nepalensis accessions: one indel with two mum parsimony analysis yielded 995 equally most parsimo- V. angularis accessions (Van-4 and Van-5) and another with nious trees (251 steps) with a consistency index (CI) of 0.75 one V. nepalensis accession (Vne-1). In the trnT-L spacer, and a retention index (RI) of 0.91. The majority rule consen- the two wild azuki bean accessions from Bhutan and China sus tree in the maximum parsimony analysis revealed the (Van-4 and Van-5) showed a 11-bp (ATAATTTATTT) dele- monophyly of the subgenus Ceratotropis (100% bootstrap tion, and an additional 5-bp (GAAAA) deletion was found value) with two sister outgroup clades, and showed a topol- in the Chinese accession (Van-5). In two accessions of ogy with two major groups, the azuki bean group and the V. stipulacea (Vst-1 and Vst-2) from Myanmar, one acces- mung bean group (Fig. 1). The species of the subgenus sion (Vst-1) displayed a 4-bp (TATA) deletion in the trnT-L Ceratotropis from Myanmar were clustered into the azuki spacer. Two V. exilis accessions (Vxi-1, Vxi-2) collected bean group and mung bean group with high bootstrap values, from Myanmar showed two substitutions, one in the trnT-L 98% and 97%, respectively (Fig. 1). The azuki bean group spacer and one in the trnL intron. Four substitutions were was sub-clustered into three subclades; subclade I, subclade found among the five accessions of V. umbellata (2 in a wild II and subclade III. In subclade I, two accessions of accession from Thailand (Vum-2) and 2 in a Nepalese cul- V. nepalensis (Vne-2 and Vne-3) from India and Nepal tigen (Vum-5)). Three V. minima accessions from Myanmar, showed a closer relationship with three races of V. angularis two V. hirtella accessions from Myanmar and three V. reflexo- (bootstrap value 96%) than the Vne-1 accession of pilosa accessions failed to display any intra-specific varia- V. nepalensis from India (Fig. 1). The clustering of the Vne-1 tion. (V. nepalensis) and Van-8 (V. angularis var. nipponensis aff. from Myanmar) accessions with the other accessions of sub- Interspecific relationships clade I was not supported by bootstrapping (Fig. 1). Sub- V. angularis and V. nepalensis showed similar se- clade II was an independent cluster, and was composed of quences in the trnT-F regions. Most accessions of the three three accessions of V. minima (95% bootstrap value). Sub- races of azuki bean, except for the Van-8 accession, shared a clade III contained V. riukiuensis, V. nakashimae, V. hirtella, specific 8-bp insertion (AAGTACTT) with two accessions V. exilis and wild and cultivated races of V. umbellata of V. nepalensis (Vne-2 and Vne-3) in the trnT-L region. A (71% bootstrap value). Three accessions of V. riukiuensis 51-bp deletion was found in all the accessions of the three were clustered with the V. nakashimae accessions with a races of V. angularis and V. nepalensis in the trnL-F region high bootstrap support (95%). One V. riukiuensis accession (Table 4). V. trinervia showed similar sequences to those of (Vri-1) was clustered with one V. nakashimae accession V. reflexo-pilosa. They differed in one substitution (A to C) (Vnk-2), and two other V. riukiuensis accessions (Vri-2 and at position 577 in the trnT-L spacer and three indels, but Vri-3) were clustered with three V. nakashimae accessions shared three substitutions that were not detected in the other (Vnk-1, Vnk-3 and Vnk-4). The clustering of V. nakashimae, taxa (Data not shown). A high level of interspecific se- V. riukiuensis, V. umbellata and V. hirtella was supported quence variation was observed between V. radiata and by a 58% bootstrap value in subclade III (Fig. 1). The V. mungo. These two species showed 25 substitutions, 2 mung bean group consisted of 7 species with two distinct

Table 5. Interspecific sequence variations in cpDNA trnT-F between V. radiata (mung bean) and V. mungo (black gram) Sequence position trnT-L trnL trnL-F 1111 111111 111 22222 22222222222222222222 233 3 3 4455 5 5 5 6 67 0112 566889 679117 33334 44455555555556666666 756 8 – 9 1956 7 – 9 9 – 0 39 4238 212042 Species Code 617684 67890 78901234567890123456 715 5 3 6595 7 1 3 2 45 8714 739934 V. radiata Vrd-1 AGGCCA ––––– –––––––––––––––––––– TAT (TA)5 GGCA (A)15 (A)5 CC ATAT GGCCCC Vrd-2 AGGCCA ––––– –––––––––––––––––––– TAT (TA)5 GCCA (A)15 (A)5 AC ATAT GGCCCC Vrd-3 AGGCCA ––––– –––––––––––––––––––– TAT (TA)5 GGCA (A)15 (A)5 AC ATAT GGCCCC Vrd-4 AGGCCA ––––– –––––––––––––––––––– TAT (TA)5 GCCA (A)14 (A)5 AC ATAT GGCCCC V. mungo Vmg-1 CTTAAG TAGAA GATATTGAATATAATTTATT CCG (TA)7 TGAC (A)5 (A)10 CA CGGA TTTGAA Vmg-2 CTTAAG TAGAA GATATTGAATATAATTTATT CCG (TA)7 TGAC (A)5 (A)10 AA CGGA TTTGAA Vmg-3 CTTAAG TAGAA GATATTGAATATAATTTATT CCG (TA)7 TGAC (A)5 (A)10 AA CGGA TTTGAA Wild and cultivated Vigna from Myanmar 277

Fig. 1. Phylogenetic relationship of wild and cultivated Ceratotropis species from Myanmar based on trnT-F sequence data. Majority rule consensus tree of 995 most parsimonious tress constructed based on trnT-F sequence data with two major clades, the azuki bean group and mung bean group. Tree length, 251 steps; CI = 0.75; RI = 0.91; I, II, III, IV, V, sub- clades; numbers above branches, bootstrap values; in parentheses, code number and country of origin. subclades (subclade IV and subclade V) and two lineages Discussion (V. aconitifolia and V. stipulacea). The clustering of V. trilobata with V. reflexo-pilosa and V. trinervia in sub- In the present study, the phylogenetic relationships of clade IV and that of V. radiata and V. mungo in subclade V ten Ceratotropis species from Myanmar as well as other spe- were not supported by bootstrapping (Fig. 1). In subclade cies were reported, based on the sequence variations in three IV, V. trinervia was clustered together with allotetraploid trnT-F non-coding regions of chloroplast genome. The tree V. reflexo-pilosa with a 95% bootstrap support (Fig. 1). The clearly showed the presence of two major groups, the azuki V. radiata clade in subclade V included its wild and culti- bean group and mung bean group, which was supported by vated counterparts from Myanmar and Nepal. V. aconitifolia 12 apormorphic mutations (Fig. 1 and Fig. 2). This evidence, and V. stipulacea, together with the species of subclade IV along with the radiated clustering of three species and subclade V, equally radiated from the node of the mung (V. trilobata, V. aconitifolia and V. stipulacea) belonging bean group. Among the outgroup species, V. unguiculata to section Aconitifoliae within the Ceratotropis clade, sug- (subgenus Vigna) showed a closer similarity to V. vexillata gested that the divergence of the subgenus Ceratotropis into (subgenus Plectotropis) than to V. marina (subgenus Vigna) the two groups had occurred long time ago. (Fig. 1). Six Vigna species from Myanmar were clustered into 278 Tun and Yamaguchi the azuki bean group (Fig. 1). The azuki bean group in the clustered as the nested topology sistered to V. umbellata, present study consisted of the majority of the Azuki bean V. hirtella and V. exilis in subclade III. V. riukiuensis and group s. str. (Tateishi 1996) or section Angulares (Tomooka V. nakashimae differed in their morphological features (flat et al. 2002a), with the exclusion of V. reflexo-pilosa and or protruding hilum, larger golden yellow flower or small V. trinervia (Table 1 and Fig. 1). Viable hybrid formation with pale yellow flower), habitats (short-grass plant community on different levels of progeny fertility by interspecific hybrid- seaside cliffs or in open sunny areas vs. sleeve vegetation in ization in the subgenus Ceratotropis (Dana and Karmakar human disturbed areas), and distributional pattern (limited ar- 1990, Egawa et al. 1988, Lawn 1995, Tomooka et al. 2002b, chipelago distribution in V. riukiuensis vs. continental distri- Siriwardhane et al. 1991) may support the clustering of the bution from South East Asia to East Asia in V. nakashimae). azuki bean group species in our trnT-F phylogenetic tree However, the high genetic similarity in the trnT-F regions (Fig. 1). V. reflexo-pilosa and V. trinervia were classified revealed by the nested topology (Fig. 1) and the absence into members of the Azuki bean group s. str. (Tateishi 1996) of crossing barriers between these two species (Tomooka or section Angulares (Tomooka et al. 2002a), based on the et al. 2002b) suggested that V. riukiuensis might have hypogeal germination with petiolate first and second leaves evolved from a cytoplasmically polymorphic ancestral line- (Tateishi 1996, Tomooka et al. 2002a, 2002b). However, the age of V. nakashimae. Low sequence variation between wild chloroplast phylogeny constructed by Yano et al. (2004) re- and cultivated races of V. umbellata indicated its limited vealed that V. reflexo-pilosa was a member of the mung bean cytoplasmic diversification (Table 4). group. The present study showed that both V. reflexo-pilosa Three wild and two cultivated Vigna species from and V. trinervia displayed the mung bean group sequences Myanmar (V. trinervia, V. stipulacea, V. radiata var. sublobata, in the trnT-F regions (Fig. 1). In the substructure of the V. radiata var. radiata and V. mungo var. mungo) were clus- azuki bean group, three subclades were clearly recognized. tered into the mung bean group (Fig. 1). The mung bean Subclade I consisted of V. angularis and V. nepalensis, and group included two germination types; hypogeal in was supported by a higher bootstrap value, except for two V. reflexo-pilosa and V. trinervia and epigeal in the other accessions (Vne-1 and Van-8) (Fig. 1). These two species species (Table 2 and Fig. 1). The mung bean group is predom- showed a close similarity and shared synapomorphic sub- inantly distributed throughout the Indian subcontinent, except stitutions and indels (Table 4). V. nepalensis differed from for two species, V. trinervia (2n = 22) and V. reflexo-pilosa V. angularis var. nipponensis by the presence of a glabrous (2n = 44), which occur in Africa, South and East Asia and bracteole as long as the calyx (Tateishi 1985, Tateishi and Pacific islands. V. trinervia has been considered as an inter- Maxted 2002, Tomooka et al. 2002b). The distribution re- mediate or linking species between the section Angulares and gion of V. nepalensis is limited to the forest margin area of section Ceratotropis (Doi et al. 2002, Tomooka et al. 2002c). the Himalayan highlands which is the boundary zone of the In our trnT-F tree, V. trinervia was clustered with V. reflexo- V. angularis var. nipponensis distribution. The wild azuki pilosa into subclade IV with a high sequence similarity and bean (V. angularis var. nipponensis) populations are widely a high bootstrap value, and the two species shared three syn- distributed from the disturbed habitats of the shiny-leaved apomorphic characters (Data not shown). Since tetraploid forests of the Himalayan highlands to mainland Japan. The V. reflexo-pilosa showed three insertions and one substitu- absence of a clear lineage differentiation (Table 4 and Fig. 1) tion in the trnT-F regions compared with diploid V. trinervia, and of crossing barriers, and the overlapping distribution we can assume that V. reflexo-pilosa might have dispersed suggested that V. angularis and V. nepalensis might be the throughout a wider area after divergence from a common an- same biological species. V. nakashimae and V. riukiuensis cestor, with V. trinervia as a parental chloroplast genome (V. minima var. minor) were treated as subspecies or varie- donor. The phylogenetic relationship of V. reflexo-pilosa ties of V. minima, a widely distributed species from South with other species was inconsistent among the previous Asia to East Asia (Tateishi 1985, Yoon et al. 2000). How- studies (Doi et al. 2002, Goel et al. 2002, Yano et al. 2004). ever, our phylogenetic tree indicated a close similarity be- Despite its similar phylogenetic position in the mung bean tween V. nakashimae and V. riukiuensis, and the formation group in our cpDNA tree (Fig. 1) and the atpB-rbcL tree of of a distinct clade (subclade II, Fig. 1) of the V. minima ac- 14 species (Doi et al. 2002), V. reflexo-pilosa showed a high cessions from Myanmar. Although AFLP data indicated that similarity to the azuki bean group in nuclear ribosomal ITS V. nakashimae and V. riukiuensis were genetically distinct sequence trees (Doi et al. 2002, Goel et al. 2002). This could (Yoon et al. 2000), V. nakashimae and V. riukiuensis were be due to the concerted evolution of ITS genes after

Fig. 2. Twelve apomorphic characters supporting the presence of two major groups, azuki bean group and mung bean group based on trnT-F sequence data. Wild and cultivated Vigna from Myanmar 279

V. reflexo-pilosa had been established through amphidiploid- collection and supply of leaf and seed samples. We extend ization between donor species. Since V. trinervia shows our thanks to two anonymous reviewers for useful com- similar ITS sequences to those in the mung bean group (Doi ments to improve the manuscript. We are grateful to Yuichi- et al. 2002), if V. trinervia was one of the donor species of ro Nakayama, Kyoko Yamane and Firouzeh Javadi for their V. reflexo-pilosa, as suggested in the present study, the other technical advice and suggestions during the research. This re- parental donor might be a representative in the azuki bean search was financially supported by the Japan Society for group. Further studies using adequate materials with careful the Promotion of Science (Grand in Aid for Scientific Re- taxonomic identification should be carried out to confirm the search No. 15310161 and 18310154). hypothesis on the hybrid origin of V. reflexo-pilosa. The high level of sequence variation between V. radiata Literature Cited and V. mungo (Table 5) suggests that these species are ge- netically well differentiated. Limited cross-compatibility be- Baudoin, J.P. and R. Maréchal (1988) Taxonomy and evolution of the tween these two species (viable hybrid could be obtained genus Vigna. Mungbean: Proceedings o the Second Inter- only when V. radiata was used as seed parent (Smartt 1990)) national Symposium. AVRDC, Shanhua, Tainan, Taiwan. may support the genetic differentiation of the two species. Shanmugasundaram, S. and B.T. McLean (eds.). p. 2–12.

Due to the trailing habit, epigeal germination and petiolate Dana,S. and P.G.Karmakar (1990) Species relationships in subgenus first and second leaves, V. aconitifolia, V. trilobata and Ceratotropis and its implications in breeding. Plant Breed. Reviews 8: 19–42. V. stipulacea have been classified into members of the sec- Doi, K., A. Kaga, N. Tomooka and D.A. Vaughan (2002) Molecular tion Aconitifoliae (Doi et al. 2002, Tomooka et al. 2002a). phylogeny of genus Vigna subgenus Ceratotropis based on However, no apomorphic characters were detected in the rDNA ITS and atpB-rbcL intergenic spacer region of cpDNA trnT-F sequence data of the V. aconitifolia, V. stipulacea and sequences. Genetica 114: 129–145. V. trilobata accessions examined. The radiating subclades Doyle, J.J and J.L. Doyle (1987) A rapid DNA isolation procedure for in the mung bean group and better resolved relationships in the small quantities of fresh leaf tissue. Phytochem Bull. 19: 11– azuki bean group revealed in the present study are consistent 15. with the findings based on the morphological characters Egawa, Y., M. Nakagahra and G.C.J. Fernandez (1988) Cytogenetical reported by Tateishi (1996), except for the position of analysis of tetraploid Vigna glabrescens by interspecific hy- V. reflexo-pilosa and V. trinervia (Fig. 1). bridization involving diploid Asian Vigna species. Mungbean. Myanmar is rich in natural and agro-ecosystems due to Proceedings of the Second International Symposium. AVRDC, Shanhua, Taiwan. p. 200–204. its location in subtropical and temperate climatic zones with Farris, J.S., J.S. Kallersjo, A.G. Kluge and C. Bult (1995) Testing signif- varying levels of annual rainfall and humidity (Ye Tint Tun icance of incongruence. Cladistics 10: 315–320. et al. 2004). Wild Vigna species collected under such di- Fatokun, C.A., D. Danesh, N.D. Young and E.L. Stewart (1993) Molec- verse conditions in Myanmar show a high level of genetic ular taxonomic relationships in the genus Vigna based on differentiation (Fig. 1). In spite of their collection from a RFLP analysis. Theor. Appl. Genet. 86: 97–104. narrow geographic area, V. stipulacea (Vst-1 and Vst-2, Felsenstein, J. (1985) Confidence limits on phylogenies: an approach Mandalay division) and V. exilis (Vxi-1 and Vxi-2, Mon using the bootstrap. Evolution 39: 783–791. state) showed intraspecific variation (Table 4). There are at Goel, S., S.N. Raina and Y. Ogihara (2002) Molecular evolution and least 13 wild Ceratotropis species distributed in Myanmar phylogenetic implications of internal transcribed spacer se- (Our collection in 2001, Tomooka et al. 2003). Because quences of nuclear ribosomal DNA in the Phaseolus-Vigna Myanmar is considered to be an overlapping area of two complex. Mol. Phyl. Evol. 22: 1–19. Konarev, A.V., N. Tomooka and D.A. Vaughan (2002) Proteinase inhib- well diverged groups of the subgenus Ceratotropis, the itor polymorphism in the genus Vigna subgenus Ceratotropis Vigna species from Myanmar should be explored and in- and its biosystematic implications. Euphytica 123: 165–177. vestigated in more detail for a better understanding of the Lawn, R.J. (1995) The Asiatic Vigna species. The Evolution of Crop evolutionary process and sustainable utilization of the wild Plants. 2nd edition. Longman, Harlow, J. Smartt and N.W. Vigna genetic resources. Simmonds (eds.), U.K. p. 321–326. Lumpkin, T.A. and D.C. McClary (1994) Azuki Bean: Botany, Produc- Acknowledgments tion and Uses. CAB International, Wallingford, U.K. 268 p. Maekawa, F. (1955) Topo-morphological and taxonomical studies in We would like to thank Makoto Kawase, team leader, Phaseoliae, Leguminosae. Jpn. J. Bot. 15: 103–116.

Myanmar Seed Bank Project (present address: National Maréchal,R., J.M.Mascherpa and F.Stainer (1978) Etude taxonomique Institute of Agrobiological Sciences, Tsukuba, Japan) for his d’un groupe complexe d’espèces des genres Phaseolus et Vigna (Papilionaceae) sur la base de données morphologiques assistance in the wild Vigna exploration in Myanmar in 2001 et polliniques, traitées par l’analyse informatique. Boissiera 28: and to the Myanmar Seed Bank for research cooperation. 1–273. We thank Thierry Vanderborght (National Botanical Garden Nicholas, K.B. and H.B.Jr. Nicholas (1997) GeneDoc: a tool for editing of Belgium) for kindly providing the Vigna accessions. We and annotating multiple sequence alignments. Multiple Se- also thank D.G. Tien, D. Ha, R. Miura, Y. Murata, N. Man- quence Alignment Editor and Shading Utility Version 2.6.002. tani, W.L. Jin, K.U. Kim, S.C. Kim, and S. Pissawan for the Copyright© 2000. 280 Tun and Yamaguchi

Saravanakumar, P., A. Kaga, N. Tomooka and D.A. Vaughan (2004) (2002a) Two new species, new species combinations and sec- AFLP and RAPD analyses of intra- and interspecific variation tional designations in Vigna subgenus Ceratotropis (Piper) in some Vigna subgenus Ceratotropis (Leguminosae) species. Verdcourt (Leguminosae, Phaseoleae). Kew Bull. 57: 613–624. Aust. J. Bot. 52: 417–424. Tomooka, N., D.A. Vaughan, H. Moss and N. Maxted (2002b) The Seehalak, W., N. Tomooka, A. Waranyuwat, P. Thipyapong, P. Laosuwan, Asian Vigna: Genus Vigna Subgenus Ceratotropis Genetic A. Kaga and D.A. Vaughan (2006) Genetic diversity of the Resources. Kluwer, Dordrecht. p. 270. Vigna germplasm from Thailand and neighboring regions re- Tomooka, N., M.S. Yoon, K. Doi, A. Kaga and D.A. Vaughan (2002c) vealed by AFLP analysis. Genet. Resour. Crop Evol. 53: 1043– AFLP analysis of diploid species in the genus Vigna subgenus 1059. Ceratotropis. Genet. Res. Crop Evol. 49: 521–530. Smartt, J. (1990) Grain Legumes: Evolution and Genetic Resources. Tomooka, N., K. Abe, M.S. Thein, W. Twat, J.B. Maw, D.A. Vaughan Cambridge University Press. Cambridge, U.K. 379 p. and A. Kaga (2003) Collaborative exploration and collection of Siriwardhane, D., Y. Egawa and N. Tomooka (1991) Cross-compatibili- cultivated and wild legume species in Myanmar, 15th Oct.–15th ty of cultivated adzuki bean (Vigna angularis) and rice bean Nov. 2002. Annual Report for Exploration and Introduction of (V. umbellata) with their wild relatives. Plt. Breed. 107: 320– Plant Genetic Resources, National Institute of Agrobiological 325. Sciences. 19: 67–83 (in Japanese with English summary). Swofford, D.L. (2000) PAUP*: Phylogenetic Analysis Using Parsimo- Verdcourt, B. (1970) Studies in the Leguminosae-Papilionoideae for ny (* and other methods). Ver. 4.0b10. Sinauer Associates, the ‘Flora of Tropical East Africa’, IV. Kew Bull. 24: 507–569. Sunderland, Mass. Yamaguchi, H. (1992) Wild and weed azuki beans in Japan. Econ. Bot. Taberlet, P., L. Gielly, G. Pautou and J. Bouvet (1991) Universal prim- 46: 384–394. ers for amplification of three non-coding regions of chloroplast Yano, A., K. Yasuda and H. Yamaguchi (2004) A test for molecular DNA. Plant Mol. Biol. 17: 1105–1109. identification of Japanese archaeological beans and phylo- Tateishi, Y. (1985) A revision of the azuki bean group, the subgenus genetic relationship of wild and cultivated species of subgenus Ceratotropis of the genus Vigna (Leguminosae). Ph.D. Disser- Ceratotropis (Genus Vigna, Papilionaceae) using sequence tation, Tohoku University, Japan. 292 p. variation in two non-coding regions of the trnL and trnF genes. Tateishi, Y. (1996) Systematics of the species of Vigna subgenus Econ. Bot. 58: S135–146. Ceratotropis. Mungbean Germplasm: Collection, Evaluation Yasuda, K. and H. Yamaguchi (1996) Phylogenetic analysis of the sub- and Utilization for Breeding Program. Srinives, P., genus Ceratotropis (genus Vigna) and an assumption of the C.Kitabamroong and S. Miyazaki (eds.), JIRCAS, Japan. p. 9– progenitor of azuki bean using isozyme variation. Breed. Sci. 24. 46: 337–342. Tateishi, Y. and N. Maxted (2002) New species and combinations in Ye, T.T., K. Irie, T. Nagamine, J.B. Maw, F. Kikuchi and H. Fujimaki Vigna subgenus Ceratotropis (Piper) Verdcourt (Leguminosae, (2004) Genetic diversity of Myanmar rice landraces in Rice is Phaseoleae). Kew Bull. 57: 625–633. life: Scientific perspectives for the 21th century, Proceedings Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin and D.G. of the World Rice Research Conference held in Tokyo and Higgins (1997) The ClustalX windows interface: flexible strat- Tsukuba, Japan. p. 56–60. egies for multiple sequence alignment aided by quality analysis Yoon, M.S., A. Kaga, N. Tomooka and D.A. Vaughan (2000) Analysis tools. Nucleic Acids Res. 25: 4876–4882. of genetic diversity in the Vigna minima complex and related Tomooka, N., N. Maxted, C. Thavarasook and A.H.M. Jayasuriya species in East Asia. J. Plant Res. 113: 375–386.