Morphological and Molecular Approaches to the Diversity of Digenean Parasites in Two Sparid Fishes, Diplodus Vulgaris (G, 1817) and Sparus Aurata L

REPUBLIQUE ALGERIENNE DEMOCRATIQUE ET POPULAIRE

MINISTERE DE L’ENSEIGNEMENT SUPERIEUR ET DE LA RECHERCHE SCIENTIFIQUE

UNIVERSITE ORAN 1

FACULTE DES SCIENCES DE LA NATURE

ET DE LA VIE

DEPARTEMENT DE BIOLOGIE Laboratoire Réseaux de Surveillance Environnementale

THÈSE

Présenté par

Mohammed RIMA

Pour l’obtention du diplôme de

DOCTORAT 3ème cycle LMD

Biologie

Option : Sciences de la Mer et du Littoral

Morphological and molecular approaches to the diversity of Digenean parasites in two sparid fishes, Diplodus vulgaris (G, 1817) and Sparus aurata L. 1758 along the Algerian coasts of the western Mediterranean.

Soutenance le : / / 2018. Devant le jury composé de :

PRESIDENT : Mme Farida MESLI Professeur, Université Oran 1 Ahmed Ben Bella

EXAMINATEUR : Mme Amaria MAATALLAH-BOUTIBA Maitre de conférences A, Université Oran 1 Ahmed Ben Bella

EXAMINATEUR : Mr Abdellah BOUDJEMAA Professeur, Université Mohamed Boudiaf (USTO)

EXAMINATEUR : Mr Tomáš SCHOLZ Professeur, Institut of Parasitology, République Tchèque

EXAMINATEUR : Mme Kheira SENOUCI Professeur, Université Oran 1 Ahmed Ben Bella RAPPORTEUR : Mme Douniazed MARZOUG Maitre de conférences A, Université Oran 1 Ahmed Ben Bella INVITE : Mr Francisco Esteban MONTERO ROYO Institue Cavanilles, Université de Valencia, Spain

Année universitaire 2017-2018

TABLE OF CONTENTS

RÉSUMÉ i

ABSTRACT ii

iii الملخص

LIST OF FIGURES iv

LIST OF TABLES viii

REMERCIEMENTS ix

DÉDICACES xii

List of abbreviations xiii

CHAPTER 1. General Introduction 1

CHAPTER 2. literature Review 11

CHAPTER 3. General Materials and Methods 21

CHAPTER 4. New molecular and morphological data for opecoelid digeneans in two 38

Mediterranean sparid fishes with descriptions of Macvicaria gibsoni n. sp.

And M. crassigula (Linton, 1910) (sensu stricto)

CONCLUSION AND FUTURE PERSPECTIVES

REFERENCES.

APPENDICES

RÉSUMÉ

La présente étude porte sur l'application d'une approche intégrative à l'identification des parasites trématodes retrouvés chez deux espèces de poissons sparidés, le Diplodus vulgaris (Geoffroy Saint-Hilaire, 1817) et Sparus aurata L. le long des côtes algériennes de la Méditerranée occidentale. Une zone non explorée sur la diversité des helminthes de poisson. Un total de 810 poissons (390 D. vulgaris et 420 S. aurata) a été examiné dans trois localités (au large de Bouzedjar, d'Alger et d'Annaba). Bénéficiant d'échantillons de grande taille et d'une collaboration fructueuse, nous avons généré une base de données de séquences pour le gène cluster mitochondrial cox1 et nucléaire ITS1-5.8S-ITS2 et / ou les séquences d'ADNr 28S partielles pour un total de 15 espèces de trématodes. Une caractérisation morphologique détaillée est fournie pour ces espèces représentant 11 familles : Opecoelidae (5 espèces de 2 genres); Acanthocolpidae, Aephnidiogenidae, Aporocotylidae, Derogenidae, Hemiuridae, Heterophyidae, Lepocreadiidae, Monorchiidae, Strigeidae (une espèce chacune), et une seule espèce de l'Aspidogastridae (Sous-classe Aspidogastrea). Trois nouvelles espèces pour la science ont été décrites à partir du matériel étudié : Macvicaria gibsoni, Rima, Marzoug, Pérez-del-Olmo, Kostadinova, Bouderbala et Georgieva, 2017; une nouvelle espèce de Cardicola; et une nouvelle espèce putative de Monorchis. Les données de séquence de liaison avec les évaluations morphologiques détaillées ont aidé à clarifier la délinéation des espèces au sein des complexes de deux groupes, à savoir « crassigula », le complexe d'espèces de Macvicaria et « Monorchis parvus », le complexe d'espèces de Monorchis. Des aperçus morphologiques et moléculaires sur la diversité des espèces de poissons marins sont fournis à la lumière des phylogénies pour les Opecoelidae, Aporocotylidae, Hemiuroidea, et une phylogénie largement construite pour les Digènes. Le grand nombre d'espèces de trématodes récupérées dans les deux poissons hôtes et la découverte de trois nouvelles espèces pour la science donnent à penser que la diversité de ces parasites dans la région, peut-être plus élevé qu’elle ne le connaît actuellement. Les nouvelles données sur les séquences recueillies au cours de la présente étude feront progresser d'autres études sur la diversité, les aires de répartition des hôtes et la répartition de ces parasites importants. Ces résultats mettent en évidence l'importance de l'application des méthodes morphologiques et moléculaires dans l'évaluation de la diversité des parasites en Méditerranée. Mots Clés : Sparidae, Digène, trématode diversité, Méditerranée, phylogénie moléculaire, cox1, ITS1-5.8S-ITS2, 28S rDNA, Bouzedjar, Alger, Annaba

i ABSTRACT

The present study focuses on the application of an integrative approach to the identification of trematode parasites recovered in two sparid fish species, Diplodus vulgaris (Geoffroy Saint- Hilaire, 1817) and Sparus aurata L. along the Algerian coasts of the Western Mediterranean, an unexplored area regarding fish helminth diversity. A total of 810 fishes (390 D. vulgaris and 420 S. aurata), were examined at three localities (off Bouzedjar, Algiers and Annaba). Profiting from large sample sizes and fruitful collaboration, we have generated a sequence database for the mitochondrial cox1 and nuclear ITS1-5.8S-ITS2 gene cluster and/or partial 28S rDNA sequences for a total of 15 trematode species. Detailed morphological characterisation is provided for these species representing 11 families: Opecoelidae (5 species of 2 genera); Acanthocolpidae, Aephnidiogenidae, Aporocotylidae, Derogenidae, Hemiuridae, Heterophyidae, Lepocreadiidae, Monorchiidae, Strigeidae (one species each), and a single species of the Aspidogastridae (Subclass Aspidogastrea). Three species new to science were described from the studied material: Macvicaria gibsoni, Rima, Marzoug, Pérez-del-Olmo, Kostadinova, Bouderbala & Georgieva, 2017; a new species of Cardicola; and a putative new species of Monorchis. Linking sequence data with detailed morphological assessments helped clarify species delineation within the species complexes of two groups, i.e. the "crassigula" species complex of Macvicaria and "Monorchis parvus" species complex of Monorchis. Morphological and molecular insights into the diversity of marine fish digeneans are provided in the light of phylogenies for the Opecoelidae, Aporocotylidae, Hemiuroidea, and a broadly built phylogeny for the Digenea. The large number of trematode species recovered in the two fish hosts and the finding of three species new to science suggest that the diversity of these parasites in the region may be higher than currently known. The novel sequence data gathered during the present study will advance further studies on the diversity, host ranges and distribution of these important parasites. The present results highlight the importance of the application of morphological and molecular methods in the assessment of parasite diversity in the Mediterranean.

Keywords: Sparidae, Digenea, Sparus aurata, Diplodus vulgaris, Mediterranean, molecular phylogeny, cox1, ITS1-5.8S-ITS2, 28S rDNA, Bouzedjar, Algiers, Annaba

ii الملخص

الهدف الرئيسي من هدا العمل هو استخدام التقنيات الجزئية لتحديد ومعرفة الطفيليات الداخلية في تنائي الجينات ودلك على اثنين من اسماك فصيلة االسبور (.S. aurata L و (D. vulgaris (G, 1847)على طول الساحل الجزائري من منطقة غرب البحر األبيض المتوسط، التي تعتبر منطقة من المناطق الغير المستكشفة في تنوع الديدان الطفيلية ثنائية الجينات. ويحتل هدين النوعين من األسماك موردا بيولوجيا هاما في السلسلة الغذائية البحرية ولسكان المنطقة. تم جمع العينات على مدى عامين(2014-2015) وبمشاركة فعالة تقدر ب 800 من األسماك على التوالي: S. aurata 410 وD. 390 vulgaris في ثالثة مناطق مختلفة على طول الساحل الجزائري: في الغرب مناء بوزجار, في الوسط مناء الجزائر و في الشرق مناء عنابة. من خالل االستفادة من أحجام العينات الكبيرة والتعاون المثمر، قمنا بتوليد قاعدة بيانات تسلسلية لكتلة الميتوكوندريا Cox1 والنواة النووية ITS1-5.8S-ITS2 و / أو متواليات rDNA 28S الجزئية ل 15 نو ًعا من تنائي الجينات. البيانات المورفولوجية الجديدة المفصلة لهده لألنواع التي تمثل 11 عائلة: Opecoelidae (5 أنواع لجنسين) ; Hemiuridae ،Derogenidae، Aporocotylidae ،Aephnidiogenidae ،Acanthocolpidae, Strigeidae ،Monorchiidae ،Heterophyida )نوع واحد لكل منها( ، ونوع واحد من Aspidogastridae )صنف Aspidogastrea(. ان التحاليل النشؤية المستندة على تسلسل الحمض النووي للمناطق التالية: 28S , ITS1-5.8S-ITS والتسلسل الجزئي لجين الميتوكوندريا كوكس1, قدمت بيانات جديدة لألنواع التي تنتمي الى اسر جديدة لثنائية الجينات: Macvicaria gibsoni, Rima, Marzoug, Pérez-del-Olmo, Kostadinova, Bouderbala & Georgieva, 2017; نوع جديد من Cardicola، وأنواع جديدة مفترضة من Monorchis. ساعد ربط البيانات المتسلسلة مع التقييمات المورفولوجية التفصيلية في توضيح وتحديد األنواع الى مجموعتين: نوع ال "crassigula" في النوع المعقد Macvicaria ونوع " Monorchis parvus" في النوع المعقد Monorchis. يشير العدد الكبير من أنواع الديدان التي تم احصائها في النوعين المضيفين لألسماك التي تم فحصهم وإيجاد ثالثة أنواع جديدة للعلم إلى أن تنوع هذه الطفيليات في المنطقة قد يكون أعلى مما هو معروف حاليًا. فإن تسلسل البيانات الجديدة التي تم جمعها خالل هذه الدراسة تقدم المزيد من الدراسات على التنوع وتوزيع هذه الطفيليات الهامة. تسلط النتائج الحالية الضوء على أهمية تطبيق الطرق المورفولوجيا والبيانات الجزيئية في تقييم تنوع الطفيليات في البحر المتوسط.

الكامات المفتاحية: فصيلة األسبور, تنائي الجينات, Sparus aurata, Diplodus vulgaris ,الجزائر,البحر األبيض المتوسط, ITS1-5.8S-ITS2 ,كوكس 1 ,التك ُّون الجزيئي ,28S rDNA, بوزجار ,الجزائر ,عنابة

iii LIST OF FIGURES

CHAPTER I Page Fig. 1.1 Distribution map of Sparus aurata L. (the gilthead seabream) Froese, R. 04 and D. Pauly. Editors. 2016. FishBase.www.fishbase.org, version (10/2016). Fig. 1.2 Distribution map of Diplodus vulgaris (Common two-banded seabream) 06 Froese, R. and D. Pauly. Editors. 2016. FishBase.www.fishbase.org, version (10/2016).

CHAPTER III Fig. 3.1 Map indicating the sampling localities along the Algerian coast of the 21 western Mediterranean Sea. Abbreviations: Bo, Bouzedjar; Al, Algiers; An, Annaba. Fig. 3.2 Schematic illustration of the vouchers connected to genetic data. A, 24 microscope with digital camera and a photo voucher; B, hologenophore; C, permanent mounts of the voucher material prepared to be deposited in publicly accessible collection; D, paragenophores; E, the obtained sequences deposited in accessible repositories, such as GenBank. Fig. 3.3 Schematic illustration of the DNA extraction protocol. Reagents: A, BT 26 Chelex® 100 Resin [Cat. No. 143-2832 BIO-RAD – 100 g; Biotechnology grade, 100–200 mesh, sodium form]; B, Qiagen Proteinase K, [Cat. No. 19131; Solution in 10 mMTris Cl, pH 7.5; > 600 mAU/ml (approx. 20 mg./ml)]. Fig. 3.4 A, Schematic diagram of the rDNA gene cluster. Genes encoding 18S, 28 5.8S and 28S ribosomal RNA subunit separated by the internal transcribed spacers 1 (ITS1) and 2 (ITS2) that are spliced after transcription. The positions of the amplified informative D1-D3 polymorphic domains are indicated at the 5’ end of the large ribosomal subunit (28S); B, Schematic representation of the digenean mitochondrial genome. Non-coding regions (NC1 and NC2) are presented in black and the two rRNA genes (rrnL, nd, and rrnS) are represented in grey, the targeted cox1 gene is highlighted in green Fig. 3.5 Schematic illustrations of the PCR thermocycle profiles and primer 30 combinations used for amplification of the four genetic markers Fig. 3.6 Gel electrophoresis equipment 31

Fig. 3.7 Illustration of the DNA quantification on the NanoDrop™ spectrometer. 34

CHAPTER IV Fig. 4.1 Schematic representation of the ITS1 rDNA region of the species of 45 Macvicaria which contained tandemly repeated elements located at the 5' end of ITS1. Eight tandem subrepeats were recognised: a (12 nt); b (12 nt); c (45 nt); d (26 nt); e (18 nt); f (27 nt); g (14 nt) and h (20 nt). Numbers indicate last (5', before repeat pattern) and first (3', after repeat pattern) nucleotide positions Fig. 4.2 Phylogram from Bayesian inference analysis of the ITS1-5.8S-ITS2 51 dataset for species of Macvicaria (only posterior probability values > 0.95 are shown). The scale-bar indicates the expected number of substitutions per site. The newly generated sequences are highlighted in bold. The type-species of Macvicaria is indicated by a dot. Sequence identification is as in GenBank (except for C. dentecis, see Table1), followed by a letter: An, Andres et al. (2014b); At, Antar et al. (2015); B-T, Born-Torrijos et al. (2012); J, Jousson et al. (1999, 2000) Fig. 4.3 Phylogram from Bayesian inference analysis of the 28S rDNA dataset 53 for species of Macvicaria (only posterior probability values > 0.95 are shown). The scale-bar indicates the expected number of substitutions per site. The newly generated sequences are highlighted in bold. Sequence identification is as in GenBank, followed by a letter: An, Andres et al. (2014b); At, Antar et al. (2015); B, Bray et al. (2016); B- T, Born-Torrijos et al. (2012); H, Hildebrand et al. (2016); O, Olson et al. (2003); T, Tkach et al. 2001) Fig. 4.4 Phylogram from Bayesian inference analysis of the 28S rDNA dataset for the 54 Opecoelidae (only posterior probability values > 0.95 are shown). The scale- bar indicates the expected number of substitutions per site. The newly generated sequences are highlighted in bold. Sequence identification is as in GenBank, followed by a letter: An, Andres et al. (2014a, b); At, Antar et al. (2015); B, Bray et al. (2005, 2009, 2014, 2016); B-T, Born-Torrijos et al. (2012); Co, Constenla et al. (2011); Cu, Curran et al. (2007); F & A, Fayton & Andres (2016); J, Jousson et al. (1999, 2000); H, Hildebrand et al. (2016); M, Martin et al. (2017); O, Olson et al. (2003); S, Shedko et al. (2015); T, Tkach et al. (2000, 2001) Fig. 4.5 Hologenophores of Macvicaria spp. ex Diplodus vulgaris from off Bouzedjar, 56 Algeria. A, Macvicaria gibsoni n. sp. (holotype); B, M. crassigula (Linton, 1910) (sensu stricto). Ventral views with uterus and dorsal vitelline follicles in outline. Scale-bars: 500 μm Fig. 4.6 Hologenophore of Macvicaria mormyri (Stossich, 1885) ex Sparus aurata 67 from off Bouzedjar, Algeria. Ventral view with uterus and dorsal vitelline follicles in outline. Scale-bar: 500 μm Fig. 4.7 Hologenophore of Pseudopycnadena fischthali Saad-Fares & Maillard, 1986 71 ex Diplodus vulgaris from off Bouzedjar, Algeria. Ventral view with uterus and dorsal vitelline follicles in outline. Scale-bar: 500 μm

LIST OF TABLES

CHAPTER III Page 3.1 Summary data for the fishes examined in this study. 22 3.2 Primers used for the sequence generations. 29

CHAPTER IV 4.1 Summary data for the opecoelid species included in the analyses. 47 Asterisks indicate identifications resulting from the present study 4.2 Comparative morphometric data for Macvicaria gibsoni n. sp., M. 59 crassigula, M. maamouriae and M. mormyri 4.3 Comparative morphometric data for Macvicaria crassigula and M. 64 bartolii 4.4 Comparative morphometric data for Macvicaria mormyri 68 4.5 Comparative morphometric data for Pseudopycnadena fischthali 72

CHAPTER V 5.1 Primers used for the sequence generations 82 5.2 Comparative morphometric data for Cardicola from the Mediterranean. 87

viii

REMERCIEMENTS

Acknowledgements

viii

ACKNOWLEDGEMENTS

Il sera très difficile de remercier tout le monde car c’est grâce à l’aide et le soutien de nombreuses personnes que j’ai pu réaliser ce travail. Ce travail a été effectué au sein du laboratoire « Réseau de surveillance Environnementale » (Université d’Oran 1 Ahmed BenBella) et le laboratoire d’Helminthologie de l’institut de Parasitologie à Ceske Budĕjovice (République de Tchèque)

Je voudrais en premier lieu remercier très chaleureusement ma directrice de thèse Mme Douniazed MARZOUG, Maitre de conférences -A- pour m’avoir appris à être un ‘’bon élève’’, Je la remercie de m’avoir donné la chance d’aimer la Parasitologie. Je suis ravi d’avoir travaillé en sa compagnie car outre son appui scientifique, elle était toujours disponible malgré ses nombreuses charges ; sa compétence, sa rigueur scientifique et sa clairvoyance m’ont beaucoup appris. Qu’elle trouve ici l’expression de mon profond respect et ma haute considération.

Je voudrais ensuite remercier et exprimer ma très grand reconnaissance à Mme Aneta KOSTADINOVA, PhD et Maître de conférences au sein de l’Institut de Parasitologie à l’Académie tchèque des sciences à České Budějovice (République tchèque) et de l’Institut de Biodiversité et Recherches d’Écosystèmes dans l’Académie bulgares des sciences à Sofia (Bulgarie), pour son aide précieux, pour ces encouragements tout au long de ma thèse, pour sa gentillesse, pour sa accueil chaleureux, pour avoir mis à ma disposition les moyens nécessaires pour le bon déroulement de mon stage au sein de son laboratoire, et pour avoir contribué avec toute de son équipe à faire de mes courts séjours à České Budĕjovice un souvenir inoubliable. Искрено Ви благодаря!

Mes remerciements s’adressent aussi à Mlle Simona GEORGIEVA, PhD et post- doctorante au sein de l’Unidad de Zoología Marina, Instituto Cavanilles de Biodiversidad y Biología Evolutiva dans l’Université de Valencia (Espagne) et de l’Institut de Parasitologie à l’Académie tchèque des sciences à České Budějovice (République tchèque), pour le traitement de nombreuse données moléculaire concernant ma recherche, je tiens vraiment à lui exprimer toute ma reconnaissance. Je souhaite également exprimer mes remerciements et ma reconnaissance aux membres de jury pour l’honneur qu’ils nous ont fait en acceptant de siéger à notre soutenance, tout particulièrement :

ACKNOWLEDGEMENTS

Je tiens à remercier du fond du cœur Mme Farida MESLI, Professeur à l’Université d’Oran 1 Ahmed Ben Bella et Vice Doyenne de la pédagogie au sein de la Faculté des Sciences de la Nature et de la Vie ; d’avoir accepté avec une grande amabilité de présider mon jury et d’analyser mon travail. Mes sincères remerciements et ma gratitude vont aussi à Mme Amaria MAATALLAH BOUTIBA, Professeur à l’Université d’Oran 1 Ahmed Ben Bella ; pour avoir accepté d’examiner ce travail. Votre présence parmi les membres de jury est un grand honneur. Mes remerciements vont également à Mr Abdellah BOUDJEMAA, Professeur en biologie moléculaire et Doyen de la Faculté des Sciences de la Nature et de la Vie à l’Université des Sciences et de la Technologie d’Oran-Mohamed Boudiaf (USTO-MB), d’avoir accepté d’examiner mon travail. Je lui adresse toute ma gratitude. Je tiens à exprimer toute ma reconnaissance à Mr Tomáš SCHOLZ, Professeur et directeur de l’Institut de Parasitologie et de la phylogénie moléculaire à Ceske Budĕjovice (République de Tchèque), pour l’honneur qui me fait en acceptant d’examiner ce travail de recherche, je le remercie également pour son accueil chaleureux lors de mes séjours au sein de son équipe en République de Tchèque. Je tiens à exprimer mes remerciements les plus sincères à Mme Kheira SENOUCI, Professeur à l’Université d’Oran 1 Ahmed Ben Bella ; pour avoir accepté de juger ce travail en tant qu’examinatrice, je lui adresse mes sentiments les plus respectueux. Un grand merci pour Mr Francisco Esteban MONTERO ROYO, Maitre de Conférence à l’Institut Cavanilles de Biodiversidad y Biología Evolutiva (ICBiBE) de l’Université de Valencia pour avoir accepté d’être invité à cette thèse, de même que pour sa participation au Jury. Qu’il me soit permis de lui exprimer ma sincère gratitude. Dans cette vie, il y’a aussi mes parents, que je tiens à remercier pour leurs soutien moral, financier et leurs prières, ils ont toujours été derrière moi à me transmettre de l’énergie, lorsque le besoin s’en est senti, je leurs demande pardon, à mes frères, mes sœurs à vous tous mille merci. Ces remerciements seraient incomplets si je n’en adressais pas à toute l’équipe du Laboratoire Réseau de Surveillance Environnementale de l’université d’Oran 1 Ahmed Ben Bella pour leur soutien moral ainsi que pour la très bonne ambiance que j’ai toujours trouvée. Il est impossible d’oublier les membres de l’équipe de parasitologie marine au sein de laboratoire « LRSE » Mme Kachour Sihem ABID, Mme Naouel Amel BRAHIM TAZI, Phd, Mme Lamia LABLACK, Mme Fatima BENHAMOU, Mr Mustapha CHARANE, Mlle Amel

ACKNOWLEDGEMENTS

BELLALpour leur disponibilité pendant toute la réalisation de ce travail et leur soutien morale, je vous en remercie et soyez assuré de mon éternelle gratitude. En dehors de la thèse il y’a une vie, et dans cette vie il y’a des personnes qui comptent : Ahmed BELARICHA, Abd el Jalil ZITOUNI, Youcef SOUALMIA, Badredine ABDERRAHIM, Ben Yabka RIMA, Oussama RIMA et tous les autres que j’oublie dans l’urgence de cette fin de rédaction.

Dédicaces

Je dédie ce travail à

A mes très chers parents, que ce travail modeste soit pour vous les mots sont

Insuffisants pour vous exprimer mes sentiments et mon éternelle gratitude. Meilleurs parents.

A mes chères sœurs et frères pour leur encouragement.

A monsieur Pr BOUTIBA Zitouni qui nous a quitté bien trop tôt. Nous aurions tellement aimé encore partager des moments de joie et d’amour comme vous nous en avez tant donné, vous resterez toujours dans nos cœurs, Merci de votre confiance, conseil et de votre soutien.

A mes chères amies et tous ceux qui me connaissent.

xii

LIST OF ABREVIATIONS

List of abbreviations used in the text and figures

Abbreviation Definition An Annaba Al Algiers Bo Bouzedjar FAO Food and Agriculture Organization of the United Nations IPCAS Helminthological Collection of the Institute of Parasitology Abbreviations for the molecular markers and phylogenetic analyses DNA Deoxyribonucleic acid PCR Polymerase chain reaction 28S rRNA 28S ribosomal RNA cox1 Cytochrome c oxidase subunit I ITS Internal transcribed space ITS1-5.8S-ITS2 rRNA Internal transcribed spacer cluster of the rRNA gene rRNA Ribosomal ribonucleic acid dNTP Deoxyribonucleotide triphosphate MEGA Molecular Evolutionary Genetics Analysis software MAFFT Multiple Alignment using Fast Fourier Transform for multiple sequence alignment NJ Neighbour joining ML Maximum likelihood MCMC Markov chain Monte Carlo CIPRES Cyber Infrastructure for Phylogenetic RESearch BLAST Basic Local Alignment Search Tool ABI Applied biosystem GTR General time-reversible model GTR+I+Г General time reversible model including estimates of invariant sites and gamma distributed among-site variation BI Bayesian inference NCBI National Center for Biotechnology Information

xiii

LIST OF ABREVIATIONS

Abbreviation Definition mM milimolar mAU MiliAnson Unit rpm Revolutions per minute NC1, NC2 Non-coding region 1 and 2, respectively BSA Bovine serum albumin TAE Tris-acetate-EDTA PB Phosphate-buffer Milli-Q Millipore Corporation ultrapure water SEQ Sequencing F Forward R Reverse Abbreviations for the metrical features used in the text and tables The Opecoelidae BL Body length BW Maximum body width OSL Oral sucker length OSW Oral sucker width PHL Pharynx length PHW Pharynx width VSL Ventral sucker length VSW Ventral sucker width CSL Cirrus-sac length CSW Maximum cirrus-sac width OVL Ovary length OVW Ovary width ATL Anterior testis length ATW Anterior testis width PTL Posterior testis length PTW Posterior testis width RTLa Right testis length RTWa Right testis width LTLa Left testis length xiv

LIST OF ABREVIATIONS

Abbreviation Definition LTWa Left testis width EL Egg length EW Egg width FOREb Forebody length HINDb Hindbody length Distances VS-AT Distance between ventral sucker and anterior testis VS-OV Distance between ventral sucker and ovary POST Length of post-testicular field Ratios BW/BL (%) Maximum body width as a proportion of body length FORE/BL (%)b Forebody length as a proportion of body length POST/BL (%) Length of post-testicular field as a proportion of body length VSW/BW (%) Ventral sucker width as a proportion of body width HIND/FOREb Hindbody to forebody length ratio VSW/OSW Sucker width ratio PHW/OSW Pharynx width to oral sucker width ratio TL/BL Testis length to body length ratio TW/BW (%) Testis width as a proportion of body width TW/BW Testis width to body width ratio Ovary L/BL (%) Ovary length to body length ratio Ovary W/OW (%) Ovary width to body width ratio

CHAPTER I General Introduction

GENERAL INTRODUCTION

1.1. General Introduction: the diversity of trematodes in fishes Parasites excess half of the organisms on the Earth and represent an integral part of all ecosystems (Dobson et al., 2008). Digenean trematodes are considered the largest group of internal metazoan parasites (Cribb et al., 2001), obligate parasites in all major invertebrate and vertebrate groups used as intermediate and definitive hosts, respectively (Bush et al., 2001). Characterised with complex life-cycles involving a range of host species. Digenean trematodes are largely dependent on the survival of their hosts. The knowledge on the trematode diversity is a cornerstone to a better understanding the role of parasites in a certain ecosystem and the connectivity with other organisms. Thus, in order to unravel the biodiversity of the trematode parasites in the context of fish parasites we should answer questions aiming at an inventory of the number of species, clarifying the range of their hosts and geographical distribution and elucidating their life-cycles is and the hosts involved (Cribb, 2016). Elucidating the complexity and diversity of the trematode life-cycles and recording all host species involved is a formidable task. To date, data on the life-cycle links with the first intermediate hosts exist only for a small number of the known marine fish trematodes and the vast majority of the marine trematode life- cycles remain unknown. This is also true regarding the range of the definitive fish hosts, which a single trematode species can use. Currently, there are thousands of trematode species known from marine fish hosts. However, these comprise just a small portion of the expected number of extant trematode species parasitic in fishes. It has been suggested that ‘an unpredictable number of undescribed species still remains unknown’ and a considerable part of the already known species requires improved characterization (Cribb, 2016). The application of molecular approaches and matching sequence data along with detailed morphological species characterization have been considered as ‘the best practice’ in the recognition of species, linking different life-cycle stages and inferences of phylogenetic relationships (Blasco-Costa et al., 2016; Cribb et al., 2016). Understanding the phylogenetic relationships is almost entirely dependent on molecular data due to the existence of high levels of phenotypic plasticity. However, molecular data exist only for a small portion of the known trematode species in marine fishes as the vast majority of the species have not yet been subjected to molecular phylogenetic studies (Cribb, 2016). Enriching the knowledge of the trematode diversity would provide a better understanding of the fauna, species biology, host- parasite relationships and ecosystem functioning in general. Thus, further studies on cataloguing

1 GENERAL INTRODUCTION fish trematode faunas by means of detailed morphological descriptions associated with phylogenies inferred from molecular data would be of considerable value. The Mediterranean Sea has been one of the first marine areas to be explored for the fish helminth diversity (see Pérez-del-Olmo, 2016 for a detailed review). The basin has been considered a marine biodiversity hot-spot possessing diverse ecosystems (Donovaro et al., 2010) and comprising a high percent of endemic species (Tortonese, 1985; Boudouresque, 2004). Although, the Mediterranean fish parasite fauna is one of the relatively well studied, further surveys are needed to obtain a more comprehensive knowledge on the local trematode diversity. This should include thorough inventories of parasite diversity and complete checklists with host- parasite records. Currently, such an information is virtually lacking since complete checklists with host-parasite records for two host species, Boops boops (see Pérez-del-Olmo et al., 2007) and Sardina pilchardus (Walbum) (see Marzoug et al., 2012), are only available.

1.2. Host group studied: Sparidae The Sparidae (Teleostei: Perciformes) represents one of the most diverse perciform families (Nelson, 2006) including c.154 species of 37 genera (Froese & Pauly, 2016), widely distributed in the temperate and tropical waters. The family comprises a large number of highly appreciated commercially important species implicated in both, fisheries and aquaculture worldwide (Pavlidis & Mylonas, 2011). Sparids are the first fishes involved in the mariculture with the domestication of the sea bream Sparus aurata in the Mediterranean in the 1970s. Nowadays, the aquaculture is considered the fastest growing livestock industry as the fishery products are one of the most important animal protein sources worldwide. Due to their relatively inexpensive value they are considered of strategic importance. The Mediterranean maricultures are dominated by demersal fisheries and especially by sparids and seabreams (FAO, 2017, http://firms.fao.org/firms/resource/10533/en) (Bas Peired, 2005). As demersal inhabitants, sparids inhabit the continental shelf and slope. They are characterised with intricate biology as some are hermaphroditic while others switch their sex with the age (protandy or protogyny) (Whitehead et al., 1986; Pavlidis & Mylonas, 2011). Based on the current molecular studies the family is divided into six subfamilies: Boopsinae, Denticinae, Diplodinae, Pegallinae, Pagrinae and Sparinae (Orrell et al., 2002; Nelson, 2006). Most of the sparids are carnivores feeding on benthic invertebrates which reflects on the acquired parasites through the trophic chain. The Sparidae represents the most studied fish family in respect to metazoan parasites (see Pérez-del-Olmo,

2 GENERAL INTRODUCTION

2016 for detailed review on the digenean fauna in Mediterranean fishes) with records for a total of 31 parasite species.

Two sparid fishes have been chosen for the present PhD project, the gilthead seabream, Sparus aurata L., and the two-banded seabream, Diplodus vulgaris (Geoffroy Saint-Hilaire, 1817) due to their availability and ease to collect large sample sizes along the Algerian coast. Both fish hosts exhibit an intermediate trophic level feeding on molluscs, decapods, annelids and others and being preys of piscivorous fishes and fish-eating birds, making them keystone species for parasite transmission pathways and important components of the local ecosystems involved in ecosystem functioning.

1.2.1. Sparus aurata L. Sparus aurata (the gilthead seabream) (Perciformes: Sparidae) has a long history as a cultured species in the Mediterranean with the first record originating from Italy in 1970. It is commonly found in the Mediterranean waters and more frequently in the western part. The gilthead seabream is a benthopelagic, sedentary fish with solitary behaviour and tends to form small aggregations. It has predominantly carnivorous and occasionally herbivorous behavior. Sparus aurata inhabits depths of about 30 m and the adults could be found at depths of up to 150 m. The growth of the gilthead seabream differs depending on the environment, as it has faster growth rates in the first years of development, when fish inhabit mostly brackish waters before entering into the open sea (Ferra, 2008). The larvae are planktonophagous (Ferra, 2008), while the juveniles and adults are benthic predators. Their diet consists predominantly of molluscs (bivalves, particularly mussels) (Quéro & Vayne, 2005), also crustaceans (crabs, shrimps), small fishes and algae (Rosecchi, 1985; Chaoui et al., 2005; Hadj Taieb et al., 2011). Adults of S. aurata can reach up to 70 cm in standard length, but the usual sizes are about 33–40 cm (Froese & Pauly, 2017). At size of 33–40 cm and weight of 1–3 kg, the gilthead seabream attains maturity. It has been reported a maximum weight of 17.2 kg and a maximum age of 11 years (Bauchot & Hureau, 1986). In the western Mediterranean off Algeria, S. aurata reaches the first maturity at length of 32.6 cm and average age of 18 months (Chaoui et al., 2006). Sparus arata is a typical protandrus species as the majority of the individuals are functional males during the first two years of their individual development (Barnabé et Billard., 1984). Females can lay between 20,000–80,000 eggs per day for up to four months. The estimated total fertility is within the range of 1,000,000 to 3,000,000 eggs/kg for body weight. Spawning season 3 GENERAL INTRODUCTION lasts for two to three months, between October and February (depending on the location). Along the Algerian coast, Chaoui et al. (2006) reported that the reproduction and maturation of S. aurata takes place in the Mellah lagoon, situated at the north-east coast, between October and January, including gonad maturation between October and December and spawning during December (Chaoui et al., 2006). Sparus aurata is one of the most common and abundant fishes along the Algerian coasts with high production rates reaching up to 12 t/year in the Mellah lagoon (Chaoui et al, 2006).

Fig. 1.1. Distribution map of Sparus aurata L. (the gilthead seabream) Froese, R. and D. Pauly. Editors. 2016. FishBase.www.fishbase.org, version (10/2016).

Sparus aurata is one of the relatively well-studied hosts for metazoan parasite infections. The estimated digenean diversity includes records for 16 species (Pérez-del-Olmo et al., 2016). However, the records from off Algeria are predominantly from the 70–90s of the last century. Existing data on the helminth parasites identified to species level from S. aurata are listed in Supplementary Table S1. These include a total of 70 species (20 monogeneans, 25 digeneans, 9 nematodes, 2 acanthocephalans and 14 isopods). Most of the records originate from Mediterranean waters, i.e. a total of 109 records of which 45 come from the western Mediterranean. Overall, two monogeneans, Sparicotyle chrysophrii (Van Beneden & Hesse, 1863) (17 records) and Lamellodiscus echeneis (Wagner,

4 GENERAL INTRODUCTION

1857) (12 records), and three digenean species, Lepocreadium album (Stossich, 1890), Allopodocotyle pedicellata (Stossich, 1887) and Macvicaria obovata (Molin, 1859) (5 records each) have been the most frequently reported parasites. In Algerian waters, the most frequently detected infections concerned mostly monogeneans, copepods and isopods, i.e. Lamellodiscus echeneis (Wagener, 1857), Polylabris tubicirrus (Paperna & Kohn, 1964), Encotyllabe vallei Monticelli, 1907, Atrispinum chrysophrii Euzet & Noisy, 1977; the copepod Clavellotis fallax (Heller, 1865) and the isopod Caligus productus Dana, 1852.

1.2.2. Diplodus vulgaris (Geoffroy Saint-Hilaire, 1817) The common two-banded seabream, Diplodus vulgaris (Geoffroy Saint-Hilaire, 1817) (Perciformes: Sparidae) is a demersal omnivorous predatory fish with a wide geographical distribution including the Mediterranean and Black Seas, the eastern Atlantic coasts from France to Senegal (including the water territories of Madeira, Azores and the Canaries Islands archipelago), and from off Angola to South African waters (Bauchot & Hureau, 1986) (see Fig.1.2.). It is abundant in sublittoral rocky and sandy bottoms and distributed to a maximum depth of 160 m (Sala & Ballesteros 1997). Diplodus vulgaris is among the economically most valuable sparid species. The common two-banded seabream is of ecological importance in the Mediterranean Sea as a major predator of sea urchins and being a major controlling factor on their abundance and effects on benthic communities (Sala et al., 1998; Guidetti, 2006; Guidetti & Sala, 2007). It is also of a socio-economic value supporting the local artisanal fisheries. Diplodus vulgaris is a benthopelagic species that exhibits an intermediate trophic level of 3 for adults (Stergiou & Karpouzi, 2002). It is generally an omnivorous to carnivorous species; feeds on bivalves (predominantly Mytilus galloprovincialis Lamark), ophiurids, polychaetes, alguae (Asparagopsis armata Harvey, 1855), echinoderms, annelids, molluscs, decapods, bivalves, gastropods. (Onofri, 1986; Jardas, 1996; Stergiou & Karpouzi, 2002; Osman & Mahmoud, 2009). Diplodus vulgaris has a pelagic larval stage and adults have sedentary behaviour with estimated home range sizes of less than 1 km2 (Abecasis et al., 2009; Alós et al., 2012). The species can reach a maximum length of 45 cm (Bauchot & Hureau., 1986; Fischer and al., 1987) and a maximum observed age has been recorded to be 14 years for an individual with a total length of 30.9 cm (Gonçalves et al., 2003). The first maturity is reached at 17 cm total length for males and 19 cm for females (Gonçalves et al., 2003; Lozano et al., 1990; Cetinić et al., 2002). 5 GENERAL INTRODUCTION

In the Mediterranean Sea, the spawning period takes place during the autumn-winter seasons, starting in September and finishing in April. In Algerian waters, D. vulgaris attains

Fig. 1.2. Distribution map of Diplodus vulgaris (Common two-banded seabream) Froese, R. and D. Pauly. Editors. 2016. FishBase.www.fishbase.org, version (10/2016).

sexual maturity at a total length of 19.8 cm for males and 20.7 cm for females (Lachkhab., 2007; Djouahra & Harchouche., 2013). The spawning period can occur between October and March (Lechkhab & Djebar., 2001; Lachkhab., 2007; Djouahra & Harchouche, 2013). However, the studies on the biology and ecology of D. vulgaris in off Algeria remain scarce. From the available literature to date, only a few studies have been focused on the biology of this species. Derbel & Kara (2008) reported on the exploitation of the common two-banded seabream in the region off Annaba, while Djouahra & Harchouche (2013) studied its reproduction along the Algiers coast. Significant genetic divergence between D. vulgaris populations across the Almeria-Oran front in the western Mediterranean has been reported by Galarza et al. (2009). Most of the data on the helminth fauna of D. vulagaris come from the Mediterranean with a total of 182 records. Existing data for the helminth parasites identified to the species level from D. vulgaris are listed in Supplementary Table S2. These include 25 digenean species reported in 6 GENERAL INTRODUCTION the Mediterranean (Pérez-del-Olmo et al., 2016), 16 monogeneans, 1 cestode, 3 nematodes, 9 copepods and 4 isopods. The most frequently reported species from this host are: the copepod Clavellopsis sargi (Kurz, 1877) (13 records); the monogeneans Lamellodiscus ignoratus Palombi, 1943 (9 records) and Atriaster heterodus Lebedev & Parukhin, 1969 (5 records); and the digenean trematodes Lepocreadium album (Stossich, 1890) (6 records) and Diphterostomum brusinae (Stossich, 1889) (5 records).

1.3. An integrative approach to parasite species identification Accurate species identification is essential for systematic biology and serves as a link to several areas of research. The correct species recognition is central to taxonomy for species diversity assessment, understanding the geographical ranges and host-parasite interactions. Due to this, taxonomy and systematics are considered cornerstones of parasitology (Littlewood et al., 2011). The existence of complexes of closely related species with vague differentiating morphological characters may impede the correct species identification. Molecular data along with morphological studies on metazoan parasites have proven particularly effective in such cases. The application of an integrative approach to species delineation appeared to be the most promising way for accurate species identification and characterisation. Recently, parasite taxonomy has turned toward the integrative taxonomy approaches incorporating multiple sources of evidence (Dayrat, 2005; Poulin & Presswell, 2016). This has led to uncovering of a large number of species complexes comprising morphologically similar species (reviewed by Pérez Ponce de León & Nadler, 2010; Poulin, 2011). Thus, correct species recondition of parasites has a crucial role in the real biodiversity assessments. Digenean trematodes are considered the largest group of internal metazoan parasites (Cribb et al., 2001) parasitising all major vertebrate groups as definitive hosts. The knowledge of the digenean diversity in marine fishes is highly uneven with respect to fish hosts and geographical regions studied. Understanding the digenean diversity and evolution has received considerable attention during the last century. In the Mediterranean, currently c.302 digenean trematode species are known from 192 fishes, representing less than a third (27%) of the known fish fauna in the basin (see Pérez-del-Olmo et al., 2016 for details). Parasite diversity has been understudied with respect to both digenean geographical distribution and host-parasite associations. The reliable recognition of the species is a considerable problem. The application of molecular approaches in association with morphological studies offers prospects for untangling species identification. Of the known trematode diversity in Mediterranean fishes, just a small 7 GENERAL INTRODUCTION portion has been subjected to molecular studies. Studies aiming reliable identification via a thorough morphological and molecular species characterisation are of considerable importance for further diversity assessments of the local helminth faunas, parasite distribution and host- parasite associations. Most of the molecular phylogenetic studies on digenean parasites of fishes have been restricted in their taxonomic scope. Olson et al. (2003) first used sequence data to estimate the phylogeny of the Digenea via maximum parsimony and Bayesian inference analyses and developed a phylogenetically based higher classification of the group. Here we build upon their study and provide novel molecular data for 16 digenean species of 15 families: Aspidogastridae Poche, 1907 (Subclass Aspidogastrea); Acanthocolpidae Looss, 1902; Aporocotylidae Odhner, 1912; Derogenidae Nicoll, 1910, Hemiuridae Looss, 1899; Heterophyidae Leiper 1909; Lepocreadiidae Odhner, 1905; Monorchiidae Odhner, 1905; Opecoelidae Ozaki, 1925, Strigeidae Railliet, 1919 and Zoogonidae Odhner, 1902.

1.4. Aim of this study The present study aimed a trematode diversity assessment in two sparid fish hosts, Diplodus vulgaris and Sparus aurata, sampled at three localities along the Algerian coast of the western Mediterranean with the application of an integrative approach to species identification and delimitation linking detailed morphological evaluation with genetic data.

The objectives of the individual chapters of the present thesis are as follows. Chapter II provides a literature review of the trematode diversity in the Mediterranean fishes with emphasis on the taxonomic groups found in the two hosts studied. The review includes data for 10 families of the two subclasses of the Trematoda, the Digenea and Aspidogastrea. The chapter also contains complete checklists of the metazoan parasites reported worldwide in D. vulgaris and S. aurata, which were developed during this study.

Chapter III contains a detailed description of the materials and methods of the study, focusing on the study areas and fish samples, processing of the trematode specimens for morphological and molecular studies, the methodology of DNA extraction and PCR amplification and the phylogenetic analyses applied.

Chapter IV provides molecular and morphological characterisation of five species of the family Opecoelidae Ozaki, 1925 with a description of a species new to science, 8 GENERAL INTRODUCTION

Macvicaria gibsoni n. sp., M. crassigula (sensu stricto), M. mormyri, M. maamouriae and Pseudopycnadena fichthali. These results are published in the international journal Systematic Parasitology.

Chapter V provides morphological and molecular characterisation of a new species of the family Aporocotylidae Odhner, 1912, Cardicola sp. The chapter has been written in a style suitable for publication in Systematic Parasitology (manuscript at an advanced stage). The new species is not named to conform to ICZN rules.

Chapter VI is focused on the species of the superfamily Hemiuroidea Looss, 1902. Detailed morphological descriptions of two species, Aphanurus virgula Looss, 1907 and Magnibursatus bartolii Kostadinova, Power, Fernandez, Balbuena, Raga & Gibson, 2003, are provided and a phylogeny of the Hemiuroidea based on partial 28S r DNA sequences is inferred including the novel genetic data.

Chapter VII provides morphological and molecular characterisation of the adult stages of four digeneans [Lepocreadium pegorchis (Stossich, 1901) (Lepocreadiidae Odhner, 1905); Lepidauchen stenostoma Nicoll, 1913 (Acanthocolpidae Lühe, 1906); a putative new species Monorchis sp. (Monorchiidae Odhner, 1911); and Diphterostomum brusinae (Stossich, 1889)] and of the metacercarial stage of two species [Cardiocephaloides longicollis (Rudolphi, 1819) Dubois, 1982 (Strigeidae Raillet, 1919) and Galactosomum lacteum (Jägerskiöld, 1896) (Heterophyidae Leiper, 1909)] recovered in both fish hosts studied. Phylogenetic relationships within the Digenea were assessed with the inclusion of the newly generated sequences for all trematode species characterised in this thesis.

Chapter VIII draws the conclusions based on the results of this study.

9 CHAPTER II

Literature Review

LITERATURE REVIEW

2.1. DIGENEAN DIVERSITY IN THE MEDITERRANEAN FISHES Digenean trematodes are the largest group of internal metazoan parasites (Cribb et al., 2001). Due to the restricted areas explored the global fauna has different levels of understanding; the current knowledge on the trematode diversity of marine fishes is reflected by several contributions covering restricted range of host species and geographical areas (Cribb, 2016). The Mediterranean is considered a marine biodiversity hot spot inhabited by a rich and diverse biota and representing one of the most complex marine ecosystems (Coll, 2010; Danovaro et al., 2010; Mannino et al., 2017). It is further considered a significant area in respect to the species occurrence and endemism regarding both the fish hosts and their digenean parasites. Up to date c.302 digenean species have been reported from 192 fish hosts in the Mediterranean (see Pérez- del-Olmo et al., 2016 for details). Despite being one of first marine areas where digenean diversity has been studied, the current knowledge covers only c.27% of the known fish fauna (Pérez-del-Olmo et al., 2016). Species of a total of 29 trematode families have been recorded in Mediterranean fishes. The recent assessment of the digenean diversity in fishes from the Mediterranean by Pérez-del-Olmo et al. (2016) revealed that the families Opecoelidae Ozaki, 1925, Didymozoidae Monticelli, 1888 and Hemiuridae Looss, 1899 are the most diverse with a summed species richness comprising 36% of the total digenean richness. Recent estimates on the digenean richness in the Mediterranean fishes comprise 1.57 species per host and a total of 890 host-parasite associations have been reported (Pérez-del-Olmo et al., 2016). However, a predominant part of the hosts species was reported with a single or two digenean species. Sparid fishes are the most diverse and the most exhaustively studied in respect to their dinenean parasites in the basin. To date, records for digenean parasites in a total of 20 sparid species exist. All these data suggest that the digenean fauna in fishes of the Mediterranean is still too poorly known and further efforts are needed for a more comprehensive knowledge on the digenean diversity in the region.

2.2. SUPERFAMILY PLAGIORCHIOIDEA LÜHE, 1901

2.2.1. FAMILY OPECOELIDAE OZAKI, 1925 The Opecoelidae Ozaki, 1925 is the largest digenean family of parasites in fishes (Cribb, 2005; Bray et al., 2016) and the most diverse family in the Mediterranean with 41 species of 18 genera (Pérez-del-Olmo et al., 2016). The family is characterised by its complexity due to the weak morphological characters and high levels of homoplasy (Bray et al., 2016). Molecular phylogenetic approaches have begun to unravel the complexity of the family; however, a small 11 LITERATURE REVIEW proportion of this diversity has been tested molecularly to date. This is especially true regarding the genera known from the Mediterranean fishes. The pioneer works of Jousson et al. (1999, 2000a, b, 2001) applied phylogenetic approach using ITS1-5.8S-ITS2 sequence data which helped reveal the presence of opecoelid species complexes in the Mediterranean sparids. Thus, Cainocreadium dentecis Jousson & Bartoli, 2001 was described and differentiated from C. labracis (Dujardin, 1845) based on morphological, morphometric and molecular evidence (Jousson & Bartoli, 2001). A species complex within the Macvicaria crassigula (Linton, 1910) has been revealed based on phylogenetic analysis using ITS1-5.8S-ITS2 rDNA, i.e. one species restricted to D. annularis, and the other sequenced from two fish hosts, D. sargus and D. vulgaris (Jousson et al., 2000). Further molecular studies on larval opecoelids in mollusc intermediate hosts led to species identification and life-cycle elucidation for Macvicaria obovata and C. labracis via matching sequences for the entire ITS1-5.8S-ITS2 rRNA gene cluster (Born-Torrijos et al., 2016). The first study applying integrative approaches to species identification of opecoelid trematodes in sparid fishes from the Tunisian coasts of the Mediterranean (Antar et al., 2015) provided further molecular evidence for the existence of two complexes of related species among the Mediterranean Macvicaria spp. designated as "obovata" and "crassigula" groups. Three species of Macvicaria, including two new to science: M. bartolii Antar, Georgieva, Gargouri & Kostadinova, 2015 (a species of the "crassigula" group), M. maamouriae Antar, Georgieva, Gargouri & Kostadinova, 2015 (a species of the "obovata" group) and M. dubia (Stossich, 1905) have been described from the Bizerte Lagoon and the Bay of Bizerte (Tunisia).

2.3. SUPERFAMILY SCHISTOSOMATOIDEA STILES & HASSALL, 1898

2.3.1. THE APOROCOTYLIDAE ODHNER, 1912 The Aporocotylidae Odhner, 1912 is a large group of digeneans parasitic in elasmobranch, holocephalan and teleost hosts (Nolan et al., 2004). Currently, the genus comprises c.150 species of 34 genera (Yong et al., 2013; Palacios-Abella et al., 2015; Nolan et al., 2016; Palacios-Abella et al., 2017) characteristic with their extra-intestinal sites of infection. Adults usually occur in the circulatory system and body cavity of fish, the heart and gills, or in the mesentery vessels, kidney, liver, pectoral girdles and meningeal vessels (Smith, 2002; Paperna & Dziwoski, 2006; Montero et al., 2009; Alama-Bermejo et al., 2011; Yong et al., 2013; Palacios-Abella et al., 2015, 2017; Yong et al., 2016a, b). Due to the hidden microhabitats where the adults occur, parasite infection in the fish hosts is usually detected by the presence of eggs which are trapped in the gill vessels or in the heart and leading to severe pathologies. Due to their high pathogenicity 12 LITERATURE REVIEW to the fish hosts, significant contributions on the knowledge of their diversity in commercially important fishes have been done worldwide. Species of five out of the 34 currently recognised aporocotylid genera are known from Mediterranean waters, i.e. Aporocotyle Odhner, 1900 (1 species), Cardicola Short, 1953 (5 species), Hyperandrotrema Maillard & Ktari, 1978 (1 species), Paradeontacylix MacInthosh (3 species), 1934 and Skoulekia (2 species), reported from scombrid and sparid hosts. Comparable morphological and molecular data are available for a total of ten species. Repullés-Albelda et al. (2008) provided first molecular evidence (28S rDNA sequences) for the existence of three species of Paradeonthacylix (Paradeontacylix balearicus Repullés-Albelda, Montero, Holzer, Ogawa, Hutson & Raga, 2008, Paradeontacylix ibericus Repullés-Albelda, Montero, Holzer, Ogawa, Hutson & Raga, 2008 and Paradeontacylix kampachi Ogawa & Egusa, 1986) in the Mediterranean Seriola dumerili (Risso). Holzer et al. (2008) described C. auratus Holzer, Montero, Repullés, Sitjà-Bobadilla, Álvarez-Pellitero, Zarza & Raga, 2008 ex Sparus aurata from off-shore sea cages off Spain and provided partial 28S and ITS2 rDNA sequences. Recently, additional four species of Cardicola have been reported from the Atlantic Bluefin tuna Thunnus thynnus in two parallel studies, i.e. the circum-global C. forsteri, C. orientalis, C. opisthorchis and a putative new species Cardicola sp. The latter species was detected only by molecular methods via sequencing of extrauterine eggs excised from the gills and was found to be phylogenetically closely related to C. orientalis (see Forte-Gil et al., 2016; Palacios-Abella et al., 2017). Detailed descriptions together with ITS2 rDNA and partial mitochondrial cox1 sequences have been provided by Palacios-Abella et al. (2017) for 4 number of species (C. forsteri, C. opisthorchis, C. orientalis and Cardicola sp.). Alama-Bermejo et al. (2011) erected a new aporocotylid genus, Skoulekia Alama-Bermejo, Montero, Raga & Holzer, 2011 for Skoulekia meningialis Alama-Bermejo, Montero, Raga & Holzer, 2011 from the meningeal veins surrounding the optical lobes of the brain of the economically important for the Mediterranean aquaculture S. aurata. The authors provided molecular evidence for the distinct status of the new species and genus gathered from phylogenies inferred from partial 28S and ITS2 rDNA sequences. Recently, Palacios-Abella et al. (2017) provided evidence that the diversity of aporocotylids in the Mediterranean is higher and described a second species of Skoulekia, S. erythrini Palacios-Abella, Georgieva, Mele, Raga, Isbert, Kostadinova, & Montero, 2017 from the hearth, cephalic kidney and gill blood vessels of the common pandora Pagellus erythrinus (L.). The authors further reported D. puntazzo (Walbaum) as a new host record for the type-species S. meningialis.

13 LITERATURE REVIEW

2.4. SUPERFAMILY HEMIUROIDEA LOOSS, 1899

2.4.1. FAMILY HEMIURIDAE LOOSS, 1899 The Hemiuroidea represents one of the largest digenean superfamilies characteristic with high diversity of morphological characters and life-cycle strategies. Currently, a total of 12 subfamilies have been recognised (Gibson, 2000) occurring predominantly in fishes; these include fish hosts of 47 orders and just a small part is presently known from amphibians, chelonians and sea-snakes. It has been concluded that hemiurids exhibit broad patterns of co- evolution regarding their definitive vertebrate hosts (Cribb et al., 2001) as a single species, Derogenes varicus, has been recorded from a broad range of fish species including 60 families of 16 orders. The Hemiuridae Looss, 1899 is one of the largest families of parasites in marine teleosts, occurring predominantly in their stomach. Species of the family are characterised by the existence of a protrusible posterior region of the body known as ecsoma, which enables the worm to survive in the acid stomach environment (Gibson & Bray, 1979). The family currently contains 129 genera and represents one of the most diverse digenean families in the Mediterranean with 31 species of 14 genera (see Pérez-del-Olmo et al., 2016). A single species, Aphanurus stossichii (Monticelli, 1891), has been recorded from three Mediterranean sparids [Boops boops (L.); Diplodus puntazo (Walbaum, 1972); and Spicara smaris (L.)]. Pankov et al. (2006) first provided molecular data for three hemiurid species (Bunocotyle progenetica Chabaud & Buttner, 1959, Saturnius minutus Blasco-Costa, Pankov, Gibson, Balbuena, Raga, Sarabeev & Kostadinova, 2006 and Robinia aurata Pankov, Webster, Blasco-Costa, Gibson, Littlewood, Balbuena & Kostadinova, 2006) from off Spain together with detailed morphological descriptions. Based on the phylogenetic hypothesis inferred from a concatenated dataset of partial 28S and 18S rDNA sequences, these authors erected a new genus, Robinia Pankov, Webster, Blasco-Costa, Gibson, Littlewood, Balbuena & Kostadinova, 2006 for R. aurata. Carreras-Aubets et al. (2011) re- assessed the status of Aponurus laguncula Looss, 1907 in the Western Mediterranean via comparative morphological and molecular evaluation of material ex Trachinus draco L. from off Spain. These authors described a new species, Aponurus mulli Carreras-Aubets, Repulles- Albelda, Kostadinova & Carrasson, 2011 within the ‘A. laguncula’ species complex and provided partial sequences of the 28S rRNA gene and the ITS2 spacer (Carreras-Aubets et al., 2011). Marzoug et al. (2014) provided the first molecular data together with a detailed description of another new bunocotyline hemiurid, Saturnius gibsoni Marzoug, Rima, Boutiba, Georgieva, Kostadinova & Pérez-del-Olmo, 2014, from Mugil cephalus L. off Oran, Algeria.

14 LITERATURE REVIEW

2.4.2. FAMILY DEROGENIDAE NICOLL, 1910 The family Derogenidae Nicoll, 1910 has previously been considered to belong within the family Hemiuridae (Gibson, 2002). Members of the family are characterised with complex morphology and are considered often difficult to identify due to their minute sizes and complex parts of the terminal genitalia (Gibson, 2002). A total of 13 derogenid species have been reported from the Mediterranean (see Pérez-del-Olmo et al., 2016) of which seven are known from sparid fishes, i.e. Arnola microcirrus (Vlasenko, 1931) ex Boops boops (L.), Diplodus annularis (L.), Diplodus sargus (L.) and Spondyliosoma cantharus (L.); Derogenes adriaticus Nikolaeva, 1966 ex Diplodus annularis (L.); Derogenes latus Janiszewska, 1953 ex Lithognathus mormyrus (L.) and Pagellus erythrinus (L.); Derogenes varicus (Müller, 1784) ex Boops boops (L.); Magnibursatus barretti Kostadinova & Gibson, 2009 ex Diplodus sargus (L.); Magnibursatus bartolii Kostadinova, Power, Fernández, Balbuena, Raga & Gibson, 2003 ex Boops boops (L.), Diplodus puntazzo (Walbaum), Diplodus sargus (L.) and Sparus aurata L.; and Magnibursatus diplodii Bayoumy & Abu-Taweel, 2012 ex Diplodus sargus (L.). To the best of our knowledge, to date no molecular data are available for Mediterranean derogenids.

2.5. SUPERFAMILY ALLOCREADIOIDEA LOOSS, 1902

2.5.1. FAMILY ACANTHOCOLPIDAE LÜHE, 1906 The Acanthocolpidae Lühe, 1906 is a family of marine fish digeneans, occasionally found in sea snakes (Bray, 2005) characterised by a spinous tegument, and the presence of uterine seminal receptacle. Seventeen genera are currently included within the family (Bray, 2005). Sixteen species of five genera are reported from Mediterranean fishes: Acanthocolpus liodorus Lühe, 1906; Lepidauchen stenostoma Nicoll, 1913; Pleorchis polyorchis (Stossich, 1889); Stephanostomum baccatum (Nicoll, l907) Manter, 1934; Stephanostomum bicoronatum (Stossich, 1883) Fuhrmann, 1928; Stephanostomum caducum (Looss, 1901); Stephanostomum cesticillum (Molin, 1858); Stephanostomum ditrematis (Yamaguti, 1939) Manter; 1947; Stephanostomum euzeti Bartoli & Bray, 2004; Stephanostomum filiforme Linton, 1940; Stephanostomum gaidropsari Bartoli & Bray, 2001; Stephanostomum hispidum (Yamaguti, 1934) Manter, 1940; Stephanostomum minutum (Looss, 1901) Manter, 1940; Stephanostomum petimba Yamaguti, 1970; Stephanostomum pristis (Deslongchamps, 1824) Looss, 1899; and Tormopsolus orientalis Yamaguti, 1934. Molecular data are available for six species of Spephanostomum (S. bicoronatum (Stossich, 1883), S. cestillium (Molin, 1858), Stephanostomum cf. uku, S. gaidropsari Bartoli & Bray, 2001, S. gaidropsari Bartoli & Bray, 2001, S. minutum 15 LITERATURE REVIEW

(Looss, 1901) and S. pristis (Deslongchamps, 1824)) from off Corsica, France (see Bray et al., 2005).

2.6. SUPERFAMILY LEPOCRADIOIDEA ODHNER, 1905

2.6.1. FAMILY AEPHNIDIOGENIDAE YAMAGUTI, 1934 The Aephnidiogenidae Yamaguti, 1934 has been previously recognised as a subfamily within the Lepocreadiidae Odhner, 1905. Bray & Cribb (2012) elevated it to family level based on a re- evaluation of the morphological characters and molecular phylogenies of the Lepocreadidoidea Odhner, 1905 based on concatenated 28S and 18S rDNA sequence data. Three aephnidiogenid species have been reported from the Mediterranean, i.e. (i) Holorchis legendrei Dollfus, 1946 ex Diplodus annularis (Linnaeus, 1758), Diplodus vulgaris (Geoffroy Saint-Hilaire, 1817), Lithognathus mormyrus (L.), Mullus barbatus L., Mullus surmuletus L., Pagellus erythrinus (L.), Pagrus pagrus (L.)., Scorpaena scrofa L., Spicara melanurus (Valenciennes) and Uranoscopus scaber L; (ii) Holorchis pycnoporus Stossich, 1901 ex Diplodus annularis (L.), Diplodus sargus (L.), Diplodus vulgaris (Geoffroy Saint-Hilaire), Lithognathus mormyrus (L.), Pagellus erythrinus (L.), Pagrus pagrus (L.), Sardina pilchardus (Walbaum), Symphodus ocellatus (L.), Symphodus roissali (Risso); and (iii) Holorchis micracanthum (Stossich) ex Pagellus erythrinus (L.) and Pagrus pagrus (L.). No molecular data are available for aephnidiogenid species in the Mediterranean.

2.6.2. FAMILY LEPOCREADIIDAE ODHNER, 1905 The members of the Lepocreadiidae Odhner, 1905 are parasitic in marine teleosts and exhibit a wide geographical distribution. The family includes a large number of genera of which eight are known from Mediterranean fishes. A total of 13 species have been reported from the basin, i.e. Prodistomum polonii (Molin, 1859) Bray & Gibson, 1990; Aephnidiogenes barbatus Nicoll, 1915; Cephalolepidapedon saba Yamaguti, 1970; Echeneidocoelium indicum Simha & Pershad, 1964; Hypocreadium caputvadum Kacem, Derbel & Neifar, 2011; Lepocreadium album (Stossich, 1890); Lepocreadium pegorchis (Stossich, 1901); Lepocreadium pyriforme (Linton, 1900); Neolepidapedoides israelensis (Fischthal, 1980) Bray & Gibson, 1989; Opechona bacillaris (Molin, 1859) Dollfus, 1927; Prodistomum libyacum (Al-Bassel, 2001); Prodistomum orientale (Layman, 1930) Bray & Gibson, 1990; and Prodistomum polonii (Molin, 1859) Bray & Gibson, 1990. Currently, no molecular data are available for the Mediterranean representatives of the family.

16 LITERATURE REVIEW

2.7. SUPERFAMILY MICROPHALLOIDEA WARD, 1901

2.7.1. FAMILY MONORCHIIDAE ODHNER, 1911 Monorchiid digeneans are parasites of marine fishes with a worldwide distribution. They are characterised with spiny tegument, complex terminal genitalia armed with recurved spines, restricted fields of vitelline follicles and well-developed uterine coils (Madhavi, 2005). More than 290 nominal species of 58 genera are currently included into the family (Madhavi, 2008; Cribb & Gibson, 2010; Atopkin, 2017). Despite the high species richness of the family, only nine monorchiids of five genera are known from Mediterranean fishes (Ancylocoelium typicum Nicoll, 1912; Lasiotocus longicystis Bartoli, 1965; Lasiotocus mulli (Stossich, 1883); Lasiotocus typicum (Nicoll, 1912) Bartoli & Bray, 2004; Monorchis blennii Jousson & Bartoli, 2002; Monorchis monorchis (Stossich, 1890); Monorchis parvus Looss, 1902; Proctotrema bacilliovatum Odhner, 1911 and Timonia mediterranea Bartoli & Prévot, 1966). Bartoli et al. (2000), Jousson et al. (2000) and Jousson & Bartoli (2002) made a significant contribution to our knowledge of the diversity of species of Monorchis Monticelli, 1893 in the Mediterranean. Bartoli et al. (2000) elucidated the life-cycle of M. parvus Looss, 1902 via experimental infections and morphological comparisons of experimentally-raised adults with conspecific material from natural infections. Additionally, Bartoli et al. (2000) provided ITS1 rDNA sequences of the studied specimens. In a following study Jousson et al. (2000) revealed a species complex within M. parvus based on phylogenetic analysis of ITS2 sequences. These authors recognized two putative species, one restricted to D. annularis and a second to D. vulgaris and D. parvus. However, the authors refrained from naming the species within the ‘M. parvus complex’. Jousson & Bartoli (2002) described M. blennii Jousson & Bartoli, 2002 from Parablennius gattorugine (L.) based on molecular, morphological and morphometric data from off Corsica. These authors also reported high levels of genetic divergence for the ITS1 rDNA sequences between M. blennii, M. parvus and the type-species M. monorchis (Stossich, 1890).

2.8. SUPERFAMILY OPISTORCHIOIDEA BRAUN, 1901 2.8.1. Family Heterophyidae Leiper, 1909 Heterophyid digeneans are parasitic, as adults, in fish-eating birds and mammals, including humans and are important agents of fish-borne zoonoses via consumption of raw or undercooked fish containing metacercariae, the infective larval stages (Chai et al., 2015). Due to their veterinary and medical importance, the heterophyids have been a subject of several studies. However, the information of their diversity and distributional ranges in the Mediterranean is still 17 LITERATURE REVIEW scarce. A recent study on heterophyid digeneans in mugilid fishes provided molecular evidence for the presence of four otherwise unidentified species, two belonging to Heterophyes Cobbold, 1866, one to Ascocotyle (Phagicola) Looss, 1899 and a single species of Stictodora Looss, 1899 (Masala et al., 2016). Species of Galactosomum are frequently reported in marine fish hosts as the metacercarial stage occurs in the fish brain. However, there are no molecular data for the Mediterranean representatives of the genus.

2.9. SUPERFAMILY DIPLOSTOMOIDEA POIRIER, 1886 2.9.1. Family Strigeidae Railliet, 1919 The family Strigeidae is a species-rich group of digenean trematodes specific to birds with the exception of the genus Duboisiella Baer, 1938 occurring in mammals (Niewiadomska, 2002). Members of the family are characteristic with their intraspecific plasticity and interspecific and even intergeneric homogeneity of morphological characters (Niewiadomska, 2002). Host- specificity has been the main criterion used for the systematics within the group (Dubois, 1938; Sudarikov, 1959; Niewiadomska, 2002). Strigeid trematodes are further considered with uniform morphology of the life-cycle stages; a metacercaria of ‘tetracotyle’ type is recognised for all species with known life-cycles. Strigeids are exclusively found in the freshwater environment with the single exception of Cardiocephaloides longicollis (Rudolphi, 1891), the only strigeid with a marine life-cycle. The metacercariae of C. longicolis occur in the optical lobes of the brain in various fishes and are characterised with low host specificity found in a wide range of fish hosts. A recent study on the life-cycle and distribution of C. longicolis in the Mediterranean summarised the existing data for the second intermediate hosts comprising a total of 36 fish species of 10 families (Born-Torrijos et al., 2016). Of these, sparids appeared to be a preferable host group with the greatest number accounting for a total of 16 species. Born-Torrijos et al. (2016) also provided partial 28S and 5.8S-ITS2 sequences for representative isolates originating from the final bird hosts.

2.10. ORDER ASPIDOGASTRIDA DOLLFUS, 1958

SUBCLASS ASPIDOGASTREA FAUST & TANG, 1936

SUPERFAMILY ASPIDOGASTRIOIDEA POCHE, 1907 Aspidogastreans are parasitic in freshwater and marine molluscs, teleosts and freshwater turtles (Rohde, 2002). Their sister position to the Digenea have been confirmed by inferred molecular phylogeny (Littlewood et al., 1999). In the Mediterranean, a single species, Cotylogaster 18 LITERATURE REVIEW michaelis Monticelli, 1892 (type-species) has been reported from the intestine of S. aurata in the Adriatic Sea (Monticelli, 1982, Stossich, 1898; Skaryabin, 1952; Dollfus, 1958b . To date, no sequence data exist for aspridogatreans from the Mediterranean.

19 Materials and Methods

CHAPTER III Materials and Methods

20 Materials and Methods

This chapter provides a general overview of the sampling approach, the sites and the methods applied to parasite species identification. More detailed data of the materials and methods related to each study are further diven in the relevant chapters (Chapters 4–7).

3.1. STUDY AREAS, FISH SAMPLING AND PARASITE COLLECTION The waters of the Algerian coast belong to the Balearic region of the western Mediterranean Sea (http://www.fao.org/fishery/area/Area37/en#FAO-fishing-area-37.1.1). The two sparid fishes, Saprus aurata L. and Diplodus vulgaris (Geoffroy Saint-Hilaire) studied here, were sampled at three localities along the Algerian coast (Fig. 3.1.). Fish were captured from the commercial fishing areas off Bouzedjar (35°35'16.49''N, 1°9'48.40''W), off Algiers (Bay of Algiers) (36°46'6.05''N, 3°5'32.15''E) and off Annaba (36°57'23.03''N, 7°54'3.88''E) between 2013 and 2016. The three sampling localities represent fishing areas in the western, central and eastern coasts of Algeria. The second sampling locality, the Bay of Algiers is situated 468 kilometres apart from the Bay of Bouzedjar. The third, most eastern sampling locality, the Bay of Annaba is situated off the eastern coast of Algeria, at 554 kilometres apart from the Bay of Algiers. The gulf of Annaba has a maximum depth of 50 m and three main rivers, Oued Seybouse, Oued Boudjemâa, and Oued Kouba, which are flowing out to the Bay thus affecting the water salinity of the gulf.

Fig. 3.1. Map indicating the sampling localities along the Algerian coasts of the western Mediterranean Sea. Abbreviations: Bo, Bouzedjar; Al, Algiers; An, Annaba.

A total of 810 specimens, i.e. 420 Sparus aurata and 390 Diplodus vulgaris, comprising nine distinct samples were collected by local fishermen and examined for the

21 Materials and Methods presence of parasites. Sampling was performed twice a year during the cold (December) and worm (July) weather months, when 30 specimens per fish species were sampled at each locality (see Table 3.1. for details on samples and fish size).

Table 3.1. Summary data for the fishes examined in this study. Host Sampling No. of fish examined Totals FL (cm) SL (cm) date Locality Bouzedjar Algiers Annaba Diplodus vulgaris 12.xi.2013 30 – – 390 16.9–20.8 14.8–18.6 (Geoffroy Saint- 06.vi.2014 30 – – 17.2–21.3 15.2–19.0 Hilaire) 09.vi.2014 – 30 – 15.2–21.2 15.0–18.7 28.vi.2014; – – 30 18.2–21.6 16.3–19.0 04.vi.2014 1.xii.2014 30 – – 17.0–21.7 15.1–19.0 04.xii.2014 – 30 – 16.8–20.4 15–18.0 16.xii.2014 – – 30 17.2–21.6 15.7–19.0 10.vi.2015 30 – – 15.0–20.4 15.1–18.7 15.vi.2015 – 30 – 16.6–20.2 15.0–18.3 17.vi.2015 – – 30 17.3–21.6 15.1–19.0 29.xi.2015 30 – – 17.0–20.3 15.1–18.7 07.xii.2015 – 30 – 17.3–20.6 16.2–18.3 20.xii.2015 – – 30 17.7–20.2 15.5–18.1 Sparus aurata L. 15.xii.2013; 30 – – 420 21.5–27.2 19.1–24.3 28.xii.2013 09.i.2014 – 30 – 17.5–21.1 15.0–18.7 06.vi.2014 30 – – 22.5–25.7 20.1–24.0 06.vi.2014 – 30 – 22.2–26.2 19.2–23.0 04.vi.2014 - - 30 20.1–25.7 19.0–23.6 01.xii.2014 30 - – 22.0–29.0 19.4–24.0 04.xii.2014 – 30 – 23.0–25.0 19.0–22.1 16.xii.2014 – – 30 20.3–23.0 18.0–19.7 09.vi.2015 30 – – 18.2–25.4 17.0–23.9 16.vi.2015 – 30 – 20.1–25.2 18.9–23.9 17.vi.2015 – – 30 20.9–26.7 19.1–24.3 03.xii.2015 30 – – 20.7–27.9 19.0–23.6 07.xii.2015 – 30 – 19.7–25.3 17.0–22.4 20.xii.2015 – – 30 21.3–25.2 18.3–22.3 Abbreviations: FL, fork length; SL, standard length Fishes were caught by different techniques including artisanal fishing such as fishing nets, angling rods and were transported on ice to the laboratory, measured [total length (TL, 22 Materials and Methods cm), standard length (SL, cm), weight (W, g)] and labelled individually. A subsample was examined fresh (10 specimens per host species per locality) while the remaining fishes were frozen at -20 °C and examined at a later stage. Fishes were examined for ecto- and endoparasites according to a standardised protocol. All organs were dissected out and examined under a stereomicroscope. This included examination of the content (including scrapings and washings in 0.9% saline solution) of the parts of the intestinal tract separately (oesophagus, stomach, pyloric caeca and intestine). The internal organs (kidneys, brain, hearth, liver, spleen and gonads) were compressed between glass plates and examined under high magnification. Gills were dissected out and examined separately in 0.9% saline solution. Specific data for the parasites obtained, their hosts and sites of infection are detailed for each study (see Chapters 4–7). All metazoan parasites recovered were provisionally identified and counted. Specimens were washed in saline solution and fixed either in cold molecular-grade ethanol prior to DNA extraction and/or in 70% ethanol for morphological examination.

3.2. MORPHOLOGICAL CHARACTERISATION Specimens intended for morphological analysis were stained with iron acetocarmine according to the protocol of Georgiev et al. (1986), dehydrated in a graded ethanol series, cleared in dimethyl phthalate and examined as permanent mounts in Canada balsam. An effort was made to preserve a voucher of the specimens prior to DNA extraction. Series of digital photomicrographs of the specimens were taken on wet mounts in distilled water, using Quick Photo Camera 2.3 image analysis software. A small piece of the posterior extremity (posterior to posterior testis or posterior to anterior testis depending on the worm’s size) was excised with a scalpel and processed for DNA extraction. The remaining part of the worm was kept as a molecular voucher (hologenophore) following the concept of Pleijel et al. (2008) which were stained as detailed above. Thus, efforts were made to provide genophores (Fig. 3.2.) (i.e. specimen vouchers used to produce molecular samples). In the cases where it was not possible a hologenophore to be retained, paragenophores (i.e. conspecific specimens collected at the same time and place as the specimen used for DNA extraction) were kept as vouchers. Electronic vouchers (series of digital images) were generated for all specimens used

23 Materials and Methods

D B

E GenBank

Fig. 3.2. Schematic illustration of the vouchers connected to genetic data. A, microscope with digital camera and a photo voucher; B, hologenophore; C, permanent mounts of the voucher material prepared to be deposited in a publicly accessible collection; D, paragenophores; E, the newly generated sequences deposited in accessible repositories, such as the GenBank database. 24 Materials and Methods for DNA isolation. Specimens used entirely for DNA extraction (in cases of very small and/or tiny specimens for which it was impossible to excise a piece) had only electronic vouchers which were used for the morphological characterisation. The voucher material serves to verify species identification of the specimens sequenced. Type- and voucher material consisting of holo- and paragenophores are deposited in publicly accessible collections such as the Helminthological Collection of the Institute of Parasitology (IPCAS), Biology Centre of the Czech Academy of Sciences, Česke Budĕjovice, Czech Republic or Museum collections (further data on the specific groups studied and deposited material are provided for each study; Chapters 4–7). Measurements were taken from both, line drawings made at high magnification with the aid of a drawing tube and from photomicrographs. Metrical data presented in the thesis are given in micrometres as the range followed by the mean in parentheses.

3.3. MOLECULAR DATA: DNA EXTRACTION, PCR AND SEQUENCING

3.3.1. DNA EXTRACTION Total genomic DNA was extracted following a standard Chelex® extraction protocol (Walsh et al., 2013) using Chelex100 chelating resin and Proteinase K. The Chelex® extraction was chosen due to its simple and very rapid protocol which does not involve organic solvents and due to this, is a very sensitive method in cases of degraded tissues with low chances to obtain good DNA extract. The process included a pre-extraction step of drying the specimens and evaporation of the remaining ethanol in individual tubes in a thermoblock at 56 °C for 5–30 min depending on the size of the specimen. The dried specimens were digested in 200 µl of a 5% suspension of deionised water and Chelex® and 2 μl containing 0.1 mg/ml of Proteinase K. This was followed by an incubation step at 56 °C overnight during which all tissue cells have been lysed. The process was followed by boiling at 90 °C for 8 min in order all proteins and DNAases to be denaturated. The Chelex protects the sample from the DNAases that might remain after the boiling step and could subsequently contaminate the samples and inhibit the DNA polymerase chain reaction (PCR) amplifications. The extraction was finalised by a centrifugation step at 16,000 g for 10 min. The supernatant was used for polymerase chain reaction amplifications. All steps of the DNA extraction protocol are illustrated in (Fig. 3.3.).

25 Materials and Methods

Fig. 3.3. Schematic illustration of the DNA extraction protocol. Reagents: A, BT Chelex® 100 Resin [Cat. No. 143-2832 BIO-RAD – 100 g; Biotechnology grade, 100–200 mesh, sodium form]; B, Qiagen Proteinase K, [Cat. No. 19131; Solution in 10 mMTris Cl, pH 7.5; > 600 mAU/ml (approx. 20 mg./ml)].

CHELEX EXTRACTION PROTOCOL

Pre-extraction step:

A B

• Prepare 5% solution of Chelex® with ml MQ-H2O

Protocol:

1. Transfer the specimen to a clean tube with as little ethanol as possible and leave the lid open to evaporate the ethanol.

2. Add 200–400 l Chelex solution per tube depending on the worm’s size. Shake the bottle every time you take the solution with the pipette to make sure the 26 Materials and Methods

Chelex balls are in suspension and you get the right amount.

3. Add 2–4 l of Proteinase K per tube (1 l in 100 l extraction ~ 100 µg/ml of Proteinase K).

4. Incubate at 56 – 60 °C overnight 5. Vortex. 6. Boil at 90 °C for 8 min on a hot plate.

7. Vortex. 8. Spin at maximum speed [~14,000× rpm or ~15,000 g (RCF)] for 10 min. 9. Store at -20 °C until use.

3.3.2. PCR AMPLIFICATION Partial fragments the mitochondrial cytochrome c oxidase subunit 1 (cox1) and the 28S rDNA (domains D1-D3), and the entire ITS1-5.8S-ITS2 gene cluster of the rRNA gene were the targeted genes for PCR amplification and further species identification and inference of phylogenetic relationships for the different groups studied. The regions of the amplified rDNA are shown in Fig. 3.4.

27 Materials and Methods

Fig. 3.4. A, Schematic diagram of the rDNA gene cluster. Genes encoding 18S, 5.8S and 28S ribosomal RNA subunit separated by the internal transcribed spacers 1 (ITS1) and 2 (ITS2) that are spliced after transcription. The positions of the amplified informative D1-D3 polymorphic domains are indicated at the 5’ end of the large ribosomal subunit (28S); B, Schematic representation of the digenean mitochondrial genome. Non-coding regions (NC1 and NC2) are presented in black and the two rRNA genes (rrnL, nd, and rrnS) are represented in grey, the targeted cox1 gene is highlighted in green

The selection of the different fragments depended on the parasite family-group and on the base of previous studies with published sequence data. PCR amplifications were performed in a total volume of 20 μl containing 10 μl 2 MyFi™ Mix (Bioline, USA), 10 pmol of each primer and ~50 ng of genomic DNA. Alternatively, PCR amplifications were carried out using illustra puReTaq Ready-To-Go PCR beads (GE Healthcare, UK) in a total volume of 25 μl containing c.2.5 units of puReTaq DNA polymerase, 10 mM Tris-HCl (pH 9.0), 50 mM

KCl, 1.5 mM MgCl2, 200 mM of each dNTP and stabilisers including BSA, 10 pmol of each primer and c.50 ng of genomic DNA. The primer sets used and the corresponding annealing temperatures are listed in Table 3.2. Schematic illustrations of the PCR reaction profiles for the individual gene fragment amplifications are shown in Fig. 3.5.

28 Materials and Methods

Table 3.2. Primers used for the sequence generations.

Target gene or Sequence (5' to 3') Direction Application Annealing Family Source region/Primer temperature (°C)

cox1 JB3 TTTTTTGGGCATCCTGAGGTTTAT F PCR+ SEQ Aporocotylidae Bowles et al. (1995) JB4.5 TAAAGAAAGAACATAATGAAAATG R PCR+ SEQ 28S rRNA LSU5' TAGGTCGACCCGCTGAAYTTAAGC F PCR+ SEQ 55 Acanthocolpidae, Littlewood et al. (2000) Aephnidiogenidae, Aporocotylidae, Heterophyidae, Lepocreadiidae Monorchiidae Opecoelidae Strigeidae, Zoogonidae ZX-1 ACCCGCTGAATTTAAGCATAT F PCR+SEQ Bray et al. (2009) 1500R GCTATCCTGAGGGAAACTTCG R PCR+ SEQ * Tkach et al. (2003) 900F* CCGTCTTGAAACACGGACCAAG F SEQ * Olson et al. (2003) 300* GTTCATGGCACTCCCTTTCAAC R SEQ * Lockyer et al. (2003) ECD2* CTTGGTCCGTGTTTCAAGACGGG R SEQ * Littlewood et al. (2000) ITS1-5.8S-ITS2 D1 AGGAATTCCTGGTAAGTGCAA F PCR 56 Aporocotylidae Galazzo et al. (2002) D2 CGTTACTGAGGGAATCCTGGT R PCR * Galazzo et al. (2002) BD1 GTCGTAACAAGGTTTCCGTA F SEQ Lunton et al. (1992) BD2 TATGCTTAAATTCAGCGGGT R SEQ Littlewood et al. (2000) S18 TAACAGGTCTGTGATGCC F PCR+SEQ 50 Opecoelidae Jousson et al. (1999) L3T CAACTTTCCCTCACGGTACTTG R PCR+SEQ Jousson et al. (1999) S20T2 GGTAAGTGCAAGTCATAAGC F SEQ * Jousson et al. (1999) L5 TTCACTCGCCATTACT R SEQ * Jousson et al. (1999) * Internal sequencing primers.

Abbreviations: F, forward; R, reverse

Fig 3.5. Schematic illustrations of the PCR thermocycle profiles and primer combinations used for amplification of the four genetic markers

30 Materials and Methods

3.3.3. VISUALISATION OF THE PCR PRODUCTS ON AGAROSE GEL Gel electrophoresis was performed for the PCR amplicon visualisation. All amplified products were visualised on 1% TAE agarose gels stained with GelRed™ fluorescent nucleic acid dye. PCR products were loaded along with GeneRuler 1 kb Plus DNA Ladder, ready-to use (Thermo Scientific, Carlsbad, USA). Gels were run at 75–100 V for 45–60 min depending on the amplified fragment size. Presence of amplified products was checked under UV light and documented with a gel documentation system. The individual steps and the equipment used for the gel electrophoreses are shown in Fig. 3.6.

Fig. 3.6. Gel electrophoresis equipment

A, Agarose gel preparation (A1, Placing the agarose and buffer into the microwave to boil; A2, Cool to 65 °C and pour into a glass beaker; A3, Staining the gel with GelRed; A4, Pour heated and stained agarose gel into a gel caster).

31 Materials and Methods

B, Loading the samples (B1, Mixing the PCR product with a loading dye; B2, Loading the mixed samples into the agarose gel).

C, Running the electrophoresis

D, Gel visualisation and gel documentary system

3.3.4. PCR PRODUCT PURIFICATION PCR products were purified with a QIAquick PCR purification kit (Qiagen Ltd, UK) following the manufacturer’s instructions. Purification protocol included 2 steps of washing with buffers: (i) 5 volumes Buffer PB to 1 volume of the PCR reaction; and (ii) with 750 μl Buffer PE, followed 32 Materials and Methods by centrifugation and discarding of the flow-through steps, respectively. Purified products were eluted in 20 μl Milli-Q H2O.

The protocol is designed to purify DNA fragments from primers, nucleotides, polymerases and salts using QIAquick spin columns in a microcentrifuge.

IMPORTANT

• All centrifugation steps are carried out at 13 000× rpm (17,900 g) • The volume of the samples is: 23 l (PCR in 25 l – 2 l for electrophoresis)

1. Add 5 volumes of Buffer PB (i.e. 115 l) to PCR reaction tube and mix. 2. Check that the colour of the mixture is yellow (similar to buffer PBI). 3. Place a spin column in a provided 2 ml collection tube. 4. To bind DNA, apply the sample (volume now 138 l) to the column and centrifuge for 1 min. 5. Discard flow-through and place QIAquick column back into the same tube. 6. To wash, add 750 l Buffer PE to the column and centrifuge for 1 min. 7. Discard flow-through and place QIAquick column back into the same tube. 8. Centrifuge the column for an additional 1 min. 9. Place the column in a clean 1.5 ml microcentrifuge tube.

10. To elute DNA, add 30 l MiliQ-H2O to the centre of the QIAquick membrane, let the column stand for 1 min and centrifuge for 1 min. 11. Leave for 1h at room temperature before NanoDrop or in the fridge overnight if no time to measure the concentration. 12. NanoDrop: Measure the concentration of the PCR product and prepare the samples

for sequencing.

33 Materials and Methods

3.3.5. QUANTIFICATION OF THE DNA SAMPLES AND SEQUENCING DNA quantification (ng/μl) was performed on a NanoDrop™ spectrometer using the software ND1000 (Fig. 3.7.).

Fig. 3.7. Illustration of the DNA quantification on the NanoDrop™ spectrometer.

Only products having sufficiently high concentration (i.e. higher than 20 ng/μl) were processed for sequencing. Sanger sequencing was performed directly on both strands using the PCR primers and/or internal primers (for details see Table 3.2.) on an Applied Biosystems 3730xl DNA Analyser and using BigDye v.1.1 chemistry (ABI Perkin-Elmer) according to the manufacturer’s protocol. Partial sequences were assembled and edited in MEGA v.7 (Kumar et al., 2016). Contiguous sequences were compared with the available sequences in the GenBank database using the Basic Local Alignment Search Tool (BLASTn) (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK _LOC=blasthome) to check for correct origin. All molecular work was carried out at the Institute of Parasitology, Biology Centre of the Czech Academy of Sciences in České Budĕjovice, Czech Republic.

34 Materials and Methods

3.4. ALIGNMENTS AND PHYLOGENETIC ANALYSES

3.4.1. ALIGNMENTS Alignments were built using MAFFT V. 7 (Katoh & Standley, 2013) with default gap parameters (gap penalty of 1.53 and gap extension penalty of 0.123) and 1,000 cycles of iterative refinement executed online on EMBL-EBL bioinformatics web platform (http://www.ebi.ac.uk/Tools/msa/ mafft/). Genetic distance matrices (p-distance model, i.e. the percentage of pairwise character distances with pairwise deletion of gaps) were calculated with MEGA v.7. Ambiguously aligned positions, in the cases where present, were excluded from the alignments prior to analyses using GBlocks (Castresana, 2000) implemented in SEAVIEW v3.2 (Galtier et al., 1996). The alignment for the protein coding cox1 gene included no insertions or deletions and was aligned with reference to the amino acid translation, using the echinoderm and flatworm mitochondrial code (translation table 9; https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi#SG9). Details on the specific alignments, i.e. taxa included and length of the alignments are provided in the respective chapters (Chapters 4–7).

3.4.2. PHYLOGENETIC ANALYSES Distance-based neighbour-joining (NJ) analysis was used for preliminary assessment of the relationships of the isolates and to attempt (where possible) molecular identification. The NJ analyses of Kimura 2-parameter distances were performed in MEGA v.7. Nodal support was estimated over 1,000 bootstrap replicates. Species boundaries were assessed via two probabilistic methods, i.e. maximum likelihood (ML) and Bayesian inference (BI) analyses, both allowing for testing of a variety of evolutionary hypotheses within a statistical framework. Maximum likelihood is a method in that possible trees are compared and given a score how likely the given sequences are to have evolved in a particular tree given a model of nucleotide substitution probabilities (Barton, 2007). The optimal (consensus) tree is the one with the highest probability according the observed data. Bayesian inference analysis attempts to infer the probabilities of the trees themselves of the observed data. The consensus tree is this with the highest probability over the searches of the tree distributions (Barton, 2007). Prior to analyses the best fitting models of nucleotide substitution were estimated using Akaike Information Criterion or Akaike Information Criterion or Akaike Information Criterion or Akaike Information Criterion with correction for small sample sizes (AICc) (Sugiura, 1978; Hurvich & Tsai, 1989) in jModelTest 2.1.9 (Guindon & Gascuel, 2003; Darriba et al., 2012) depending on the dataset analysed. ML analyses were carried out with PhyML 3.0 35 Materials and Methods

(Guindon et al., 2010) online execution on the ATGC bioinformatics platform (http://www.atgc- montpellier.fr/phyml/) with a non-parametric bootstrap validation over 1,000 bootstrap pseudoreplicates. BI analyses were performed with MrBayes v.3.2.6 (Ronquist et al., 2012) on the CIPRES Science Gateway v. 3.3 (http://www.phylo.org/sub_sections/portal/) (Miller et al., 2010) on two simultaneous runs of four chains for 107 generations and sampling trees every 103 generations. Prior to analyses, the first 103 trees sampled were discarded as 'burn-in', determined by stationarity of lnL assessed using Tracer v. 1.5 (Rambaut & Drummond, 2009). Consensus tree topology and nodal support estimated as posterior probability values (Huelsenbeck et al., 2001) were calculated from the remaining trees. Tree visualizations were performed with FigTree v1.4.2 Rambaut (2014) http://tree.bio.ed.ac.uk/software/figtree/).

3.5.2. OUTGROUP SELECTION All trees were rooted against outgroup taxa in order to infer the ancestral traits for the nodes and to assess monophyly of the groups studied. Outgroup selection was based on previous phylogenies on the relevant groups. Depending on the availability of the sequence data, single or multiple outgroups were selected. Specific data on the outgroup selection are provided for each digenean group studied in the respective chapter (Chapters 4–7).

More detailed information on the specific data analyses are presented in the respective chapters (Chapters 4–7).

36 CHAPTER IV CHAPTER IV

New molecular and morphological data for opecoelid digeneans in two Mediterranean sparid fishes with descriptions of Macvicaria gibsoni n. sp. and M. crassigula (Linton, 1910) (sensu stricto)

CHAPTER IV

New molecular and morphological data for opecoelid digeneans in two Mediterranean sparid fishes with descriptions of Macvicaria gibsoni n. sp. and M. crassigula (Linton, 1910) (sensu stricto)

Mohammed Rima • Douniazed Marzoug • Ana Pérez-del-Olmo • Aneta Kostadinova • Mohamed Bouderbala • Simona Georgieva

M. Rima • D. Marzoug • M. Bouderbala

Laboratoire Réseau de Surveillance Environnementale, Département de Biologie, Faculté des Sciences de la Nature et de la Vie, Université d’Oran 1 Ahmed Ben Bella, 31000 Oran, Algeria

A. Pérez-del-Olmo

Science Park, Marine Zoology Unit, Cavanilles Institute of Biodiversity and Evolutionary Biology, University of Valencia, C/ Catedrático José Beltrán 2, 46980 Paterna, Valencia, Spain

S. Georgieva () • A. Kostadinova

Institute of Parasitology, Biology Centre of the Czech Academy of Sciences, Branišovská 31, 370 05 České Budějovice, Czech Republic e-mail: [email protected]

Electronic supplementary material The online version of this article(doi: 10.1007/s11230- 017-9736-2) contains supplementary material, which is available to authorised users.

Abstract Molecular and morphological data were gathered for specimens of species of Macvicaria Gibson & Bray, 1982 and Pseudopycnadena Saad-Fares & Maillard, 1986 (Digenea: Opecoelidae) collected from two sparid fishes, Diplodus vulgaris (Geoffroy Saint- Hilaire) and Sparus aurata L., off the Algerian coast of the Western Mediterranean. Phylogenetic analyses based on ITS1-5.8S-ITS2 and partial 28S rDNA sequences provided evidence for the distinct species status of eight Mediterranean species of Macvicaria. Novel molecular data are provided for four species, M. gibsoni n. sp. and M. crassigula (Linton,

CHAPTER IV

1910) (sensu stricto) based on specimens from D. vulgaris, and M. mormyri (Stossich, 1885) and M. maamouriae Antar, Georgieva, Gargouri & Kostadinova, 2015 based on specimens from S. aurata; descriptions of the molecular voucher material of the former three species are provided. Two species were delineated within the "crassigula" species complex of Macvicaria, M. gibsoni n. sp. and M. crassigula (s. str.), the distinctive differentiating features being the distribution of the dorsal vitelline fields in the forebody, confluent in M. gibsoni n. sp. and non-confluent in M. crassigula (s. str.), and the molecular data for both markers. Sequences associated with morphological description are also provided for the type- species of Pseudopycnadena, P. fischthali Saad-Fares & Maillard, 1986, based on material from D. vulgaris.

Introduction

The Opecoelidae Ozaki, 1925 is the most diverse digenean family in the Mediterranean, with 41 species of 18 genera (Pérez-del-Olmo et al., 2016). However, a small proportion of this diversity has been tested molecularly to date. As highlighted by Pérez-del-Olmo et al. (2016), the application of both morphological and molecular methods has led to the discovery of new digenean taxa in the Mediterranean, including a few opecoelids. Jousson & Bartoli (2001) described Cainocreadium dentecis Jousson & Bartoli, 2001 and differentiated this species from C. labracis (Dujardin, 1845) based on morphological, morphometric and molecular evidence. Recently, Antar et al. (2015) carried out the first study on the diversity of species of Macvicaria Gibson & Bray, 1982 in Mediterranean sparids sampled in the Bizerte Lagoon and the Bay of Bizerte (Tunisia) with the application of morphological and molecular approaches to species delineation. These authors provided molecular evidence for the existence of two complexes of related species among the Mediterranean Macvicaria spp. which they designated as "obovata" and "crassigula" groups. Antar et al. (2015) provided morphological descriptions associated with ITS1-5.8S-ITS2 and 28S rDNA sequences for three Mediterranean species of Macvicaria, including two new to science: M. bartolii Antar, Georgieva, Gargouri & Kostadinova, 2015 (a species of the "crassigula" group), M. maamouriae Antar, Georgieva, Gargouri & Kostadinova, 2015 (a species of the "obovata" group) and M. dubia (Stossich, 1905). This increased the number of the Mediterranean species of Macvicaria to eight.

In a study of the parasites of two sparid fishes, Sparus aurata L. and Diplodus vulgaris (Geoffroy Saint-Hilaire) from localities off the Algerian coast of the Western Mediterranean, 39

CHAPTER IV

we have collected specimens of species in the opecoelid genera Macvicaria and Pseudopycnadena Saad-Fares & Maillard, 1986; the latter were identified based on morphology as Pseudopycnadena fischthali Saad-Fares & Maillard, 1986. However, among the specimens of Macvicaria, we were able to identify with confidence only M. maamouriae and M. mormyri (Stossich, 1885) using morphological characters. Therefore, fragments of all specimens were used for generating sequences for two nuclear markers, the ITS1-5.8S-ITS2 cluster of the rRNA gene and a partial fragment of the 28S rRNA gene. Phylogenetic analyses revealed the presence of four species of Macvicaria in the two sparid hosts studied off Algeria, including one new to science, and confirmed the existence of M. crassigula (Linton, 1910) (sensu stricto) in the Mediterranean (see also Andres et al., 2014b; Antar et al., 2015).

This paper provides molecular characterisation and descriptions of M. gibsoni n. sp., M. crassigula (s. str.), M. mormyri and P. fischthali and adds sequence data for M. maamouriae.

Materials and methods

Morphological data

Two sparids, Sparus aurata L. and Diplodus vulgaris (Geoffroy Saint-Hilaire) were collected at two sampling sites along the Algerian coast of the Western Mediterranean: off Bouzedjar (35°35'16.49''N, 1°9'48.40''W) and off Algiers (Bay of Algiers) (36°46'6.05''N, 3°5'32.15''E). Fishes were captured in the commercial fishing zone, identified and examined for the presence of parasites. All digeneans were recovered from fresh fish, relaxed and fixed in cold molecular-grade ethanol. All type- and voucher specimens of Macvicaria spp. described here represent hologenophores (sensu Pleijel et al., 2008), i.e. the specimens from which the sequences were derived; in addition to the hologenophore, one paragenophore of P. fischthali was characterised morphologically. Prior to excising worm fragments for DNA extraction, photomicrographs of the specimens were taken from wet mounts in distilled water using Quick Photo Camera 2.3 image analysis software (see Supplementary file S1). A piece from the posterior part of each specimen (posterior to posterior testis but in some specimens also including posterior testis) was excised and used for DNA isolation and the remainder kept as a molecular voucher. Molecular vouchers were stained with iron acetocarmine, dehydrated through a graded ethanol series, cleared in dimethyl phthalate and examined as permanent mounts in Canada balsam.

CHAPTER IV

Measurements were taken from illustrations made at a high magnification using a drawing tube. All measurements are given in micrometres. The following abbreviations were used in the text and tables for the measurements taken and ratios calculated from specimens mounted in Canada balsam: BL, body length; BW, maximum body width; OSL, oral sucker length; OSW, oral sucker width; PHL, pharynx length; PHW, pharynx width; VSL, ventral sucker length; VSW, ventral sucker width; CSL, cirrus-sac length; CSW, maximum cirrus-sac width; OVL, ovary length; OVW, ovary width; ATL, anterior testis length; ATW, anterior testis width; PTL, posterior testis length; PTW, posterior testis width; RTL, right testis length; RTW, right testis width; LTL, left testis length; LTW, left testis width; EL, egg length; EW, egg width; VS-AT, distance between ventral sucker and anterior testis; VSW/BW (%), ventral sucker width as a proportion of body width; VSW/OSW, sucker width ratio; PHW/OSW; pharynx/oral sucker width ratio.

Additionally, the following measurements were taken from the digital images of the worms made prior to excising the molecular samples: BL, BW, FORE, forebody length; HIND, hindbody length; POST, length of post-testicular field; EL, egg length; EW, egg width. These were used for the calculation of three ratios: BW/BL (%), maximum body width as a proportion of body length; FORE/BL (%), forebody length as a proportion of body length; HIND/FORE, hindbody to forebody length ratio (the terms forebody and hindbody are as defined by Bartoli et al. (1989a), i.e. the regions between the anterior and posterior margins of the ventral sucker and the anterior and posterior extremity of the worms, respectively.

The type- and voucher specimens were deposited in the Helminthological Collection of the Institute of Parasitology, Biology Centre of the Czech Academy of Sciences, České Budějovice, Czech Republic (accession numbers with a code IPCAS are listed below).

Molecular data

Total genomic DNA was isolated from the excised posterior body fragments of the specimens (one entire specimen of M. maamouriae) in 200 μl of a 5% suspension of deionised water and Chelex® containing 0.1 mg/ml of proteinase K as described in Dallarés et al. (2013). Sequences were generated for two nuclear markers, the ITS1-5.8S-ITS2 cluster of the rRNA gene and partial fragments of the 28S rRNA gene (domains D1-D3; c.1,200 nt). PCR amplifications, primer combinations used, thermocycling conditions and amplicon purification and sequencing protocols are as described previously (Antar et al., 2015).

CHAPTER IV

Contiguous sequences were assembled and edited with MEGA v7 (Kumar et al., 2016) and deposited in the GenBank database under accession numbers MF166830–MF166851.

The newly generated and published sequences for each marker were aligned using MAFFT V. 7 (Katoh & Standley, 2013) with default gap parameters (gap penalty of 1.53 and gap extension penalty of 0.123) and 1,000 cycles of iterative refinement executed online on EMBL-EBL bioinformatics web platform (http://www.ebi.ac.uk/Tools/msa/mafft/). Ambiguously aligned positions were excluded from the resultant alignments prior to analyses using GBlocks (Castresana et al., 2000) implemented in SEAVIEW v3.2 (Galtier et al., 1996).

Three alignments were analysed, two aiming at a molecular identification of the novel isolates of Macvicaria spp. and one aiming at an assessment of the relationships and position of Macvicaria and Pseudopycnadena within the Opecoelidae. The aligned ITS1-5.8S-ITS2 dataset for Macvicaria spp. (1,794 nt) comprised 11 newly generated sequences and 17 representative sequences retrieved from GenBank for nine species of Macvicaria; Cainocreadium dentecis was used as the outgroup. The aligned D1-D3 28S rDNA dataset for Macvicaria spp. (1,180 nt positions) comprised nine newly generated sequences and 12 published sequences for eight species for Macvicaria; Helicometra boseli Nagaty, 1956, Allopodocotyle margolisi Gibson, 1995 and Pseudopecoeloides tenuis Yamaguti, 1940 were used as the outgroup. The aligned 28S rDNA dataset for the Opecoelidae (1,222 nt positions of which 49 were excluded) comprised 5 newly generated sequences for the species recovered in the present study and 51 published sequences for species of the Opecoelidae (see Supplementary Table 4. S1 for the sequences retrieved from GenBank) with the outgroup consistent with previous phylogenies of the Opecoelidae (see Bray et al., 2016; Fayton & Andres, 2016; Faltýnková et al., 2017; Martin et al., 2017): Enenterum aureum Linton, 1910 (Enenteridae Yamaguti, 1958), Preptetos caballeroi Pritchard, 1960 (Lepocreadiidae Odhner, 1905) and Stephanostomum interruptum Sparks & Thatcher, 1958 (Acanthocolpidae Lühe, 1906).

Bayesian inference (BI) analyses were carried out with MrBayes v.3.2.6 (Ronquist et al., 2012) on the CIPRES Science Gateway v. 3.3 (Miller et al., 2010) using Markov chain Monte Carlo (MCMC) searches on two simultaneous runs of four chains for 107 generations, sampling trees every 103 generations. The first 25% of the trees sampled were discarded as 'burn-in', determined by stationarity of lnL assessed using Tracer v. 1.5 42

CHAPTER IV

(http://beast.bio.ed.ac.uk/Tracer) and consensus tree topologies were constructed and nodal support estimated as posterior probability values (Huelsenbeck et al., 2001) calculated from the remaining trees. Prior to analyses the best-fitting models of nucleotide substitution were estimated with jModelTest 2.1.9 (Guindon & Gascuel, 2003; Darriba et al., 2012). The general time reversible model, with estimates of invariant sites and gamma distributed among- site rate variation (GTR + I + Г) was selected for the three alignments based on the Akaike Information Criterion with a correction for small sample sizes (AICc) (Sugiura, 1978; Hurvich & Tsai, 1989).

Pairwise genetic distance matrices (p-distance model, i.e. the percentage of pairwise character differences with pairwise deletion of gaps) were also calculated with MEGA v7.

Results

Comparative sequence analysis

A total of 11 sequences of the ITS1-5.8S-ITS2 was generated from specimens of Macvicaria spp., eight from D. vulgaris and three from S. aurata, and one sequence was generated for P. fischthali. The PCR amplicons differed in size (1,001–1,498 nt); these also contained partial fragments of the 18S (161 nt in Macvicaria spp. and 334 in P. fischthali) and 28S (60 nt in Macvicaria spp. and 322 in P. fischthali) rRNA genes and the complete 5.8S rRNA gene (160 nt).

Interspecific differences in the length and nucleotide composition were detected in the ITS1 region. Sequence lengths of the ITS1-5.8S-ITS2 region were 1,001 nt for P. fischthali; 1,067 nt for M. maamouriae; 1,087 and 1,092 nt for the two isolates of M. mormyri; 1,118 nt for the four isolates designated here as M. crassigula (s. str.) and 1,496–1,498 nt for the four isolates from D. vulgaris representative of a new species, M. gibsoni n. sp., delimitated and described below. Comparative sequence analysis revealed that these size differences were due to the presence of tandemly repeated elements located at the 5' end of the ITS1 spacer; these were composed of three (M. gibsoni n. sp. and M. alacris) or four (M. mormyri and M. maillardi) subrepeats; two small non-tandem repeats were present in M. crassigula (s. str.). One of these was also present at the same position in M. bartolii which also contained a second non-tandem repeat (Fig. 4.1). The ITS1 sequences for M. dubia, M. maamouriae and M. obovata contained no repeat elements.

CHAPTER IV

The repeat pattern in M. gibsoni n. sp. is composed of three tandem subrepeats (labelled a, b and c in Fig. 4.1): a (12 nt; 5'-GGC AGA GCG CAT-3'); b (12 nt; 5'-CAG TTT TGC CAA-3'); and c (45 nt; 5'-CGT TCG TAC CAA AAA CCC TGG GGC CGA CAG CGA TCG GCT GCC AAT-3'). These are located at positions 133–639 of the ITS1 as a tandem cluster in which subrepeats a, b and c (69 nt in total) are repeated 6 times, followed by a single a + b subrepeat combination. The latter subrepeats are further present tandemly at positions 685–708; the repeat structure can be summarised as (abc)6ab-ab (Fig. 4.1). All isolates of M. gibsoni n. sp. exhibited this repeat pattern.

The repeat pattern in M. mormyri is composed of four tandem subrepeats: a and b (see above); d (26 nt; 5'-GTG GCC GAG AGC GAT CGG CTG CCT AC-3'); and e (18 nt; 5'- TGT TCG TAC CAA ACC CTT-3') (Fig. 4.1). These are located at positions 114–287 (SAMMo1) and 119–292 (SAMMo2) of the ITS1 in the two sequences for M. mormyri as a tandem cluster in which subrepeats a, b, d and e are repeated twice (ordered as dabe), followed by a single d + a subrepeat combination; the repeat pattern configuration is

(dabe)2da (Fig. 4.1).

The published sequence for M. maillardi (AJ277373) possesses the 68 nt long repeat cluster observed in M. mormyri composed of the same subrepeats a, b, d and e. However, these are repeated five times, followed by a single d + a combination, resulting in a repeat pattern configuration (dabe)5da. This configuration represents the most conspicuous difference between the sequences for M. maillardi and M. mormyri (Fig. 4.1).

The published sequence for the type-species M. alacris (AJ241801) contained a 67 nt long repeat present twice and composed of three subrepeats: f (27 nt; 5'-GTT TTA CCA ATG TTG TAC CAA AAA CCC-3'), d (as above, however containing ambiguous base 'K' at position 9 in the first repeat) and g (14 nt; 5'-GGT AGA GCG CAT CA-3'). The repeats are located at positions 185–318 as a tandem cluster (fdg)2 (Fig. 4.1).

The two published sequences for M. bartolii (KR149471 and KR149472) possessed repeat a at the same positions as in M. crassigula (172–183) and additional 20 nt long repeat (labelled h in Fig. 4.1) repeated non-tandemly twice at positions 192/211 and 259/278. The repeat pattern configuration for this species is a-h-h. No tandem repeat pattern was observed in M. crassigula (s. str.); however, we detected a non-tandem presence of two subrepeats a

CHAPTER IV

close to the 5' end of ITS1 (Fig. 4.1); these were also present in all published sequences for isolates clustering with the two novel isolates (see below).

Fig. 4.1. Schematic representation of the ITS1 rDNA region of the species of Macvicaria which contained tandemly repeated elements located at the 5' end of ITS1. Eight tandem subrepeats were recognised: a (12 nt); b (12 nt); c (45 nt); d (26 nt); e (18 nt); f (27 nt); g (14 nt) and h (20 nt). Numbers indicate last (5', before repeat pattern) and first (3', after repeat pattern) nucleotide position

Phylogenetic analyses

Of the aligned 1,794 nt positions in the ITS1-5.8S-ITS2 alignment, 484 were excluded; these predominantly represented repeated elements in the sequences for Macvicaria spp. described above. The newly generated sequences clustered into four distinct, strongly supported, reciprocally monophyletic lineages. BI analysis of the ITS1-5.8S-ITS2 dataset yielded a tree with seven monophyletic clades and high support for most nodes (Fig. 4.2). The novel isolates from D. vulgaris fell into two strongly supported monophyletic lineages. The first comprised an adult isolate of "D. sargus-D. vulgaris-type" of M. crassigula (s.l.), and two metacercarial isolates from Paracentrotus lividus (Lamark) (Echinodermata: Parechinidae) and Tricolia speciosa (Mergele von Mühlfeld) (Mollusca: Phasianellidae) sequenced by Jousson et al. (1999, 2000) from off Corsica in the Mediterranean, plus an isolate from Calamus bajonado (Bloch & Schneider) (Perciformes: Sparidae) from the Gulf of Mexico, referred to as M. crassigula (s. str.) by Andres et al. (2014b). Sequence divergence within this lineage, 45

CHAPTER IV

regarded as M. crassigula (s. str.), ranged between 0–1% (0–13 nt difference). The novel isolates of M. crassigula (s. str.) ex D. vulgaris shared identical sequences and differed by 0.3–0.5% (4–6 nt difference) from the other three Mediterranean isolates. The isolate from the Gulf of Mexico differed by 0.6–1% (8–13 nt difference) from the Mediterranean isolates of M. crassigula (s. str.) (Table 4.1).

The second clade represents a novel lineage of Macvicaria, M. gibsoni n. sp. described below, comprising four isolates (sequence divergence of 0–0.5%; 0–6 nt difference). Contrary to our expectations, this lineage did not cluster with the two species of the "crassigula" species complex, M. bartolii and M. crassigula (s. str.) which were resolved in a well- supported clade apart from the remaining species. Instead, the new species exhibited a sister- group relationship with M. mormyri + M. maillardi clade, although with poor support (0.89).

Of the three novel sequences generated from isolates ex S. aurata, two clustered together with sequences for M. maillardi Bartoli, Bray & Gibson, 1989 from the same host and M. mormyri from Lithognathus mormyrus (L.) generated by Jousson et al. (1999, 2000) both from off Corsica. The sequence divergence within the M. mormyri + M. maillardi clade ranged between 0.2–0.4% (2–5 nt difference). However, these values were based on the alignment resulting after the exclusion of the repeated elements; the divergence calculated for the complete sequences is 13.7–13.9% (208–211 nt difference).

CHAPTER IV

Table 4.1. Summary data for the opecoelid species included in the analyses. Asterisks indicate identifications resulting from the present study

Species Isolate Life- Host species Locality GenBank accession number Reference cycle stage ITS1-5.8S- 28S ITS2 *M. gibsoni n. sp. DVMG1 A Diplodus vulgaris (Geoffroy Off Bouzedjar, MF166830 MF166842 Present study Saint-Hilaire) Algeria DVMG2 A Diplodus vulgaris (Geoffroy Off Bouzedjar, MF166831 MF166843 Present study Saint-Hilaire) Algeria DVMG3 A Diplodus vulgaris (Geoffroy Off Bouzedjar, MF166832 MF166844 Present study Saint-Hilaire) Algeria DVMG4 A Diplodus vulgaris (Geoffroy Off Algiers, MF166833 MF166845 Present study Saint-Hilaire) Algeria *M. crassigula (Linton, 1910) (s. DVMC1 A Diplodus vulgaris (Geoffroy Off Bouzedjar, MF166834 MF166846 Present study str.) Saint-Hilaire) Algeria DVMC2 A Diplodus vulgaris (Geoffroy Off Bouzedjar, MF166835 MF166847 Present study Saint-Hilaire) Algeria DVMC3 A Diplodus vulgaris (Geoffroy Off Bouzedjar, MF166836 – Present study Saint-Hilaire) Algeria DVMC4 A Diplodus vulgaris (Geoffroy Off Algiers, MF166837 – Present study Saint-Hilaire) Algeria M. maamouriae Antar, Georgieva, SAMMa A Sparus aurata L. Off Bouzedjar, MF166838 MF166848 Present study Gargouri & Kostadinova, 2015 Algeria M. mormyri (Stossich, 1885) SAMMo1 A Sparus aurata L. Off Bouzedjar, MF166839 MF166849 Present study Algeria SAMMo2 A Sparus aurata L. Off Bouzedjar, MF166840 MF166850 Present study Algeria Pseudopycnadena fischthali Saad- DVPF A Diplodus vulgaris (Geoffroy Off Bouzedjar, MF166841 MF166851 Present study Fares & Maillard, 1986 Saint-Hilaire) Algeria M. alacris (Looss, 1901) A3 A Labrus merula L. Off Corsica, AJ241801 Jousson et al. France (1999) M. bartolii Antar, Georgieva, SC A Spondyliosoma cantharus (L.) Bay of Bizerte, KR149466 Antar et al. (2015) Gargouri & Kostadinova, 2015 Tunisia

CHAPTER IV

Table 4.1 Continued.

Species Isolate Life- Host species Locality GenBank accession number Reference cycle stage ITS1-5.8S- 28S ITS2 DA1 A Diplodus annularis (L.) Bay of Bizerte, KR149471 KR149464 Antar et al. (2015) Tunisia DA2 A Diplodus annularis (L.) Bay of Bizerte, KR149472 KR149465 Antar et al. (2015) Tunisia M. bartolii Antar, Georgieva, A Diplodus annularis (L.) Off Corsica, AJ277372 Jousson et al. (2000) Gargouri & Kostadinova, 2015 ("D. France annularis-type" of Jousson et al., 2000) M. crassigula (Linton, 1910) (s. – A Calamus bajonado (Bloch & Gulf of Mexico KJ701237 KJ701237 Andres et al. (2014) str.) Schneider) *M. crassigula (Linton, 1910) (s. A1 A Diplodus vulgaris (Geoffroy Off Corsica, AJ241803 Jousson et al. (1999, str.) (as Opecoelidae gen. sp.; "D. Saint-Hilaire) France 2000) sargus-D. vulgaris-type" of Jousson et al., 2000) M1 M Paracentrotus lividus Off Corsica, AJ241814 Jousson et al. (1999, (Lamarck) France 2000) M2 M Tricolia speciosa (von Off Corsica, AJ241815 Jousson et al. (1999, Mühlfeld) France 2000) M. dubia (Stossich, 1905) OM1 A Oblada melanura (L.) Bay of Bizerte, KR149488 KR149469 Antar et al. (2015) Tunisia OM2 A Oblada melanura (L.) Bay of Bizerte, KR149489 KR149470 Antar et al. (2015) Tunisia M. maamouriae Antar, Georgieva, LM1 A Lithognathus mormyrus (L.) Bizerte KR149482 KR149468 Antar et al. (2015) Gargouri & Kostadinova, 2015 Lagoon, Tunisia SA1 A Sparus aurata (L.) Bizerte KR149473 KR149467 Antar et al. (2015) Lagoon, Tunisia M. macassarensis (Yamaguti, 1952) A Lethrinus miniatus (Forster) Off Australia AY222208 Olson et al. (2003)

CHAPTER IV

Table 4.1 Continued.

Species Isolate Life- Host species Locality GenBank accession number Reference cycle stage ITS1-5.8S- 28S ITS2 M. magellanica Laskowski, Mush1 A Patagonotothen longipes KU212191 Hildebrand et al. Jezewski & Zdzitowiecki, 2013 (Steindachner) (2016) M. maillardi Bartoli, Bray & A Sparus aurata L. Off Corsica, AJ277373 Jousson et al. Gibson, 1989 France (2000) M. mormyri (Stossich, 1885) A "?fish" "near Corsica" AF184256 Tkach et al. (2001) A2 A Lithognathus mormyrus (L.) Off Corsica, AJ241802 Jousson et al. France (1999) M. obovata (Molin, 1859) AB2012-6 M Cyclope neritea (L.) Ebro Delta JQ694149 JQ694147 Born-Torrijos et al. (2012) AB2012-4 C Gibbula adansonii Ebro Delta JQ694145 JQ694146 Born-Torrijos et (Payraudeau) al. (2012) M. obovata (Molin, 1859)/ A4/M3 M Sparus aurata L./ Tricolia Off Corsica, AJ241816 Jousson et al. Opecoelidae gen. sp. speciosa (von Mühlfeld) France (1999) Allopodocotyle margolisi Gibson, BMNH:1992.3.24.33_42 A Coryphaenoides Rockall KU320596 Bray et al. (2016) 1995 mediterraneus (Giglioli) Trough Cainocreadium dentecis Jousson & A11 A Dentex dentex (L.) Off Corsica, AJ241795 Jousson et al. Bartoli, 2001a France (1999); Jousson & Bartoli (2001) Helicometra boseli Nagaty, 1956 MNHN:JNC2530 A Sargocentron spiniferum New Caledonia KU320600 Bray et al. (2016) (Forsskål) Pseudopecoeloides tenuis MNHN:JNC2214 A Priacanthus hamrur (Forsskål) New Caledonia KU320605 Bray et al. (2016) Yamaguti, 1940 aAs Cainocreadium labracis in the GenBank database

CHAPTER IV

The third sequence from an isolate ex S. aurata fell within the clade representing M. maamouriae, a recently described species of the "obovata" species complex (Antar et al., 2015). The new sequence was identical with the sequences from isolates ex S. aurata and L. mormyrus in Bizerte Lagoon (Antar et al., 2015).

The species of the "obovata" species complex, M. maamouriae and M. obovata were resolved as sister species in a clade with high nodal support which also included M. dubia. The type-species M. alacris from Mediterranean Labrus merula L. occupied a basal position. This sequence differed by 8.4–9.6% (108–124 nt difference; based on the final trimmed alignment) from the remaining sequences for Macvicaria spp.

A total of 9 sequences of the partial 28S rRNA gene (domains D1-D3) were generated from 6 isolates ex D. vulgaris, representing M. gibsoni n. sp. and M. crassigula (s. str.), and 3 isolates ex S. aurata, representing M. maamouriae and M. mormyri. BI analyses of the 28S rDNA alignment for Macvicaria spp. (1,180 nt of which 6 were excluded) confirmed the distinct status of the seven Mediterranean species depicted in the ITS1-5.8S-ITS2 phylogeny, which clustered in a strongly supported clade to the exclusion of M. magellanica Laskowski, Jeżewski & Zdzitowiecki, 2013 and M. macassarensis (Yamaguti, 1952) from Antarctic and Australian waters, respectively (Fig. 4.3). The species of the "crassigula" complex formed a clade together with M. mormyri but with poor support (0.59) whereas the species of the "obovata" complex clustered in a strongly supported clade together with M. dubia (as in the ITS1-5.8S-ITS2 solution and Antar et al., 2015).

No intraspecific divergence was detected in the species lineages which included the novel isolates. The interspecific divergence within the "crassigula" complex ranged between 0.6 and 0.9% (7–11 nt difference), whereas the overall interspecific divergence for the Mediterranean Macvicaria spp. ranged between 0.3 and 2.5% (3–29 nt difference). The two non-Mediterranean species, M. macassarenis and M. magellanica, differed by 6.2–6.9% (73– 81 nt difference) and 7.5–9.7% (86–111 nt difference) from the Mediterranean species of the genus.

CHAPTER IV

Fig. 4.2. Phylogram from Bayesian inference analysis of the ITS1-5.8S-ITS2 dataset for species of Macvicaria (only posterior probability values > 0.95 are shown). The scale-bar indicates the expected number of substitutions per site. The newly generated sequences are highlighted in bold. The type-species of Macvicaria is indicated by a dot. Sequence identification is as in GenBank (except for C. dentecis, see Table 4. 1), followed by a letter: An, Andres et al. (2014b); At, Antar et al. (2015); B-T, Born-Torrijos et al. (2012); J, Jousson et al. (1999, 2000)

CHAPTER IV

Sequences for both markers were generated from one isolate of P. fischthali ex D. vulgaris. The ITS1-5.8S-ITS2 sequence differed by 0.3% (4 nt difference) from the only available sequence for P. fischthali from the same host sampled off Corsica (Jousson et al., 1999).

BI analysis of the 28S rDNA alignment for the Opecoelidae (1,222 nt positions of which 49 were excluded) resolved a tree (Fig. 4.4) exhibiting the general structure of the clades as in the phylogenetic hypotheses in previous studies with some positional variations. The newly generated sequences for the four species of Macvicaria and P. fischthali fell within the "Plagioporinae Clade A" of Bray et al. (2016) comprising mostly Macvicaria spp. Adding sequences for two species of this genus, i.e. M. gibsoni n. sp. and M. magellanica, has added little to the earlier studies (Bray et al., 2016; Fayton & Andres, 2016; Faltýnková et al., 2017; Martin et al., 2017). The Mediterranean species of Macvicaria still formed a non- monophyletic group with two well-supported clades comprising two opistholebethines and four plagioporines nested within it. Furthermore, adding one recently published sequence for M. magellanica reinforced the conclusion that Macvicaria is polyphyletic (Bray et al., 2016; Faltýnková et al., 2017). The Antarctic M. magellanica clustered together with the recently described Trilobovarium parvvatis Martin, Cutmore & Cribb, 2017 (type-species) with a maximum nodal support, whereas the Pacific M. macassarensis was resolved as a sister taxon to Hamacreadium spp. within the "Plagioporinae Clade B" of Bray et al. (2016) also with maximum support.

Notably, the newly generated sequence for the type-species of Pseudopycnadena, P. fischthali, clustered within "Clade A" in a strongly supported subclade together with Gaevskajatrema perezi (Mathias, 1926), Propycnadenoides philippinensis Fischthal & Kuntz, 1964 and Peracreadium idoneum (Nicoll, 1909) nested within the Mediterranean species of Macvicaria, whereas the only other species of Pseudopycnadena with sequence data available, P. tendu Bray & Justine, 2007, joined the clade T. parvvatis + M. magellanica although with poor support (0.48). A separate analysis including only the taxa of "Clade A" resulted in a tree (see Supplementary Fig. 4.S1) with the same structure and nodal support as in the global phylogenetic hypothesis for the Opecoelidae (Fig. 4.4).

In summary, the comparative sequence and phylogenetic analyses provided evidence for the distinct species status of eight Mediterranean species of Macvicaria sequenced to date; this led to the delineation of M. crassigula (s. str.) and a species new to science within the 52

CHAPTER IV

Fig. 4.3. Phylogram from Bayesian inference analysis of the 28S rDNA dataset for species of Macvicaria (only posterior probability values > 0.95 are shown). The scale-bar indicates the expected number of substitutions per site. The newly generated sequences are highlighted in bold. Sequence identification is as in GenBank, followed by a letter: An, Andres et al. (2014b); At, Antar et al. (2015); B, Bray et al. (2016); B-T, Born-Torrijos et al. (2012); H, Hildebrand et al. (2016); O, Olson et al. (2003); T, Tkach et al. 2001)

CHAPTER IV

Fig. 4.4. Phylogram from Bayesian inference analysis of the 28S rDNA dataset for the Opecoelidae (only posterior probability values > 0.95 are shown). The scale-bar indicates the expected number of substitutions per site. The newly generated sequences are highlighted in bold. Sequence identification is as in GenBank, followed by a letter: An, Andres et al. (2014a, b); At, Antar et al. (2015); B, Bray et al. (2005, 2009, 2014, 2016); B-T, Born-Torrijos et al. (2012); Co, Constenla et al. (2011); Cu, Curran et al. (2007); F & A, Fayton & Andres (2016); J, Jousson et al. (1999, 2000); H, Hildebrand et al. (2016); M, Martin et al. (2017); O, Olson et al. (2003); S, Shedko et al. (2015); T, Tkach et al. (2000, 2001)

"crassigula" species complex. The molecular vouchers of these two species, and M. mormyri and P. fischthali are described below.

CHAPTER IV

Family Opecoelidae Ozaki, 1925 Subfamily Plagioporinae Manter, 1947 Genus Macvicaria Gibson & Bray, 1982 Macvicaria gibsoni n. sp.

Syns Macvicaria crassigula (Linton, 1910) Bartoli, Bray & Gibson, 1989 of Bartoli et al. (1989a) in part (ex D. vulgaris; figure 12) Type-host: Diplodus vulgaris (Geoffroy Saint-Hilaire) (Perciformes: Sparidae). Type-locality: Off Bouzedjar (35°35'16.49''N, 1°9'48.40''W), Algeria, Western Mediterranean. Other locality: Off Algiers (36°46'6.05''N, 3°5'32.15''E), Algeria, Western Mediterranean. Type-material: The holotype and three paratypes (all hologenophores) were deposited in the Helminthological Collection of the Institute of Parasitology, Biology Centre of the Czech Academy of Sciences, České Budějovice, Czech Republic under accession number IPCAS D- 756. Site in host: Intestine. Representative DNA sequences: 28S rDNA: MF166842 (holotype), MF166843–MF166845; ITS1-5.8S-ITS2: MF166830 (holotype), MF166831–MF166833. Etymology: The species is named for Dr David Gibson, Natural History Museum, London, UK, in recognition to his important contribution to the knowledge of Mediterranean Macvicaria spp. Description (Fig. 4.5A)

[Based on 4 mature unflattened specimens, see Table 4. 2 for measurements.] Body elongate- oval, rounded at extremities, with maximum width at level of or just posterior to ventral sucker and almost parallel margins in hindbody. Tegument thick, unarmed. Forebody short (30–38% of body length). Oral sucker ventro-subterminal, subspherical to slightly transversely oval. Ventral sucker, muscular, large relative to body (width 50–65% of body width), larger than oral sucker (sucker width ratio 1:1.31–1.74), in second third of body on indistinct eminence. Two pairs of groups of gland-cells present on both sides of oral sucker: 17–18 small, medio-ventral and 15–16 large, ventro-lateral. Prepharynx very short. Pharynx elongate-oval, muscular. Oesophagus very short. Intestinal bifurcation just posterior to mid- forebody. Caeca blind, with wide lumen, overlapped by vitelline follicles in hindbody, terminate close to posterior extremity.

CHAPTER IV

Fig. 4.5. Hologenophores of Macvicaria spp. ex Diplodus vulgaris from off Bouzedjar, Algeria. A, Macvicaria gibsoni n. sp. (holotype); B, M. crassigula (Linton, 1910) (sensu stricto). Ventral views with uterus and dorsal vitelline follicles in outline. Scale-bars: 500 μm

Testes 2, tandem, subspherical to transversely oval, entire, contiguous, in mid- hindbody (post-testicular field 14–20% of body length). Cirrus-sac relatively small to large (holotype), claviform, narrower anteriorly, with thin muscular wall, reaching dorsally to posterior margin of ventral sucker (holotype), its mid-level or more anterior. Internal seminal vesicle wide tubular, convoluted posteriorly. Pars prostatica short, prostatic cells few, small. Ejaculatory duct short. Cirrus short, unarmed. Genital atrium shallow. Genital pore sinistral, at level of intestinal bifurcation.

CHAPTER IV

Ovary dextral, entire, subspherical to slightly transversely oval, separated by a single uterine coil from ventral sucker, pre-testicular, contiguous with anterior testis. Canalicular seminal receptacle dextral, between ovary and testis or at mid-level of anterior testis, 95  120. Laurer's canal and Mehlis' gland not observed. Uterus short, with main bulk between ventral sucker and ovary and anterior testis, distal part of uterus narrow, sinistral to cirrus-sac, terminates as indistinct metraterm opening into genital atrium. Eggs numerous, operculate, non-filamented, with small knob on anopercular pole. Vitellarium follicular, vitelline follicles numerous, relatively small, arranged in 2 wide lateral fields extending between mid-level or posterior margin of pharynx (holotype) to posterior extremity of body; fields in forebody comprising 2 narrow lateral non-confluent strings of ventral follicles and 2 wider confluent fields of dorsal follicles; fields in hindbody comprising predominantly ventral follicles with few dorsal follicles confluent at level of and posterior to testes, both ventral and dorsal fields confluent in post-testicular region.

Excretory system not observed; pore terminal.

Remarks

The present material agrees well with the diagnosis of the genus Macvicaria by Gibson & Bray (1982), Bartoli et al. (1989a) and Cribb (2005). Macvicaria gibsoni n. sp. appears most similar to two of the Mediterranean species of the genus: M. maamouriae recently described from S. aurata and L. mormyrus in Bizerte Lagoon, Tunisia (Antar et al., 2015) and M. mormyri originally described from L. mormyrus from the Adriatic Sea off Trieste, Italy (Stossich, 1885) and redescribed in detail from off Corsica, France (Bartoli et al., 1993). Similarities include the distribution of vitelline follicles in the forebody (ventral follicles in narrow lateral strings and dorsal follicles in two confluent fields) and the extension of the cirrus-sac (predominantly dorsal to the ventral sucker). The new species is characterised by its large ventral sucker in relation to the width of the body, a feature characteristic for M. maamouriae. However, the values for this relation are distinctly smaller in M. gibsoni (VSW/BW 50–65 vs 63–74%), the body in M. gibsoni is not as robust, and despite some overlap, the ventral sucker is not much larger than the oral sucker (sucker width ratio 1:1.31– 1.74 vs 1.59–3.19). All other metrical features exhibit overlapping ranges, the latter being

CHAPTER IV

wider in M. maamouriae (Table 4. 2). Finally, the genital pore is more posteriorly located in M. gibsoni n. sp. and the ventral sucker is borne on an indistinct eminence of the ventral surface of the body in M. gibsoni n. sp.

The ventral sucker being borne on an eminence is also observed in M. mormyri, and is in fact considered to be the main feature distinguishing this species from all other congeners found in the Mediterranean at the time of the redescription (see Bartoli et al., 1993). However, in M. mormyri this eminence is distinct (vs rather faint in the new species), the uterus interjects between the ovary and the anterior testis (vs lack of loops between these organs in M. gibsoni n. sp.) and the ovary is similar in size to or larger than the testes (Bartoli et al., 1993). As shown in Table 4. 2, most metrical features exhibit overlapping ranges, with the upper ranges reported by Bartoli et al. (1993) being higher in M. mormyri; the metrical data for the newly sequenced specimen of M. mormyri fall within the ranges reported by these authors (see below). However, in M. mormyri as described by Bartoli et al. (1993) the body is more elongate (BW/BL 33 vs 42–49% in M. gibsoni) and the testes are more anteriorly located (POST/BL 26 vs 14–20% in M. gibsoni).

Phylogenetic analyses of the 28S and ITS1-5.8S-ITS2 rDNA datasets confirmed the distinct status of the new species and indicated its close relationships (although with poor statistical support) with M. mormyri (0.89; ITS1-5.8S-ITS2 dataset; Fig. 4.2) and M. crassigula (sensu stricto) (0.40; 28S rDNA dataset; Fig. 4.3). Therefore, a comparison with the species of the "crassigula" species complex is required. The present material resembles most closely the specimens of M. crassigula (s.l.) described by Bartoli et al. (1989a) based on material from D. vulgaris, especially in the distribution of the vitelline follicles in the forebody. Comparisons of the morphometric data revealed generally overlapping ranges for most metrical features (Table 4. 2) with specimens described by Bartoli et al. (1989a) exhibiting higher upper ranges for the size of the body and most organs, probably due to the different fixation methods and some degree of specimen flattening in the study of Bartoli et al. (1989a). The only exceptions were the somewhat more elongate body in the new species (BW/BL 42–49 vs 50%) and the larger ventral sucker in relation to the width of body (VSW/BW 50–65 vs 49%). We consider these differences to represent intraspecific variation.

CHAPTER IV

Table 4.2. Comparative morphometric data for Macvicaria gibsoni n. sp., M. crassigula, M. maamouriae and M. mormyri

Species M. gibsoni n. sp. M. crassigula M. crassigula M. mormyri M. maamouriae (Linton, 1910) (sensu lato) (Stossich, Antar, Bartoli, Bray & 1885) Georgieva, Gibson, 1989 Gargouri & (sensu stricto) Kostadinova, 2015 Host Diplodus vulgaris D. vulgaris D. vulgaris Lithognathus Sparus aurata (Geoffroy Saint- (Geoffroy Saint- mormyrus L. Hilaire) Hilaire) Source Present study Present study Bartoli et al. Bartoli et al. Antar et al. (1989) (1993) (2015) Character Range (n = 4) Range (n = 3) Range (n = 10) Range (n = 7) Range (n = 9) BL 1,689–2,865a 1,638–2,823a 2,104–2,975 1,530–4,208 1,159–2,105 BW 529–972 562–929 935–1,275 574–1,403 599–943 (776–1,310)a (803–1,251)a OSL 189–284 205–314 277–378 187–346 167–311 OSW 198–301 219–344 282–400 226–480 144–353 PHL 146–215 143–232 176–293 123–330 135–225 PHW 142–198 176–237 213–320 149–346 135–248 VSL 297–438 324–396 341–560 250–533 281–412 VSW 344–490 332–452 416–666 309–709 419–592 CSL 194–430 319–391 266–426 293–906 277–549 CSW 77–146 108–172 80–165 91–160 72–113 OVL 99–219 138–146 181–336 130–400 90–167 OVW 116–254 143–185 160–240 139–416 149–257 ATL 151–215 165–245 171–293 133–266 126–180 ATW 181–297 224–353 277–533 233–400 266–419 PTL 176–237 206 186–330 160–309 109–212 PTW 198–288 208–344 293–533 191–373 153–387 FORE 396–714 389–783 637–1,360 595–1,275 365–730 (563–943)a (478–981)a HIND 744–1,374a 789–1,404a 999–1,466 680–2,401 473–938 VS-AT 30–215 140–228 133–320 – 36–135 POST 266–447a 171–483a 320–549 270–1,062 297–483 POST/BL (%) 14–20a 10–17 20b 26b na BW/BL (%) 42–49a 44–49a 50b 33b 37–52 FORE/BL (%) 30–38a 29–35a 32b 31b 28–35 VSW/BW (%) 50–65 49–67 49b 52b 63–74 HIND/FORE 1.26–1.65a 1.34–1.65a 1.08–1.69 1.06–1.88 1.23–1.79 VSW/OSW 1.31–1.74 1.28–1.52 1.23–1.72 1.16–1.54 1.59–3.19 PHW/OSW 0.66–0.72 0.64–0.80 0.63–0.79 0.60–0.95 0.55–0.94 EL 67–78a 66–82a 65–75 (68) 59–74 64–81 (66–76)a EW 45–66a 49–69a 28–39 (33) 30–42 36–56 (42–54)a a Measured from wet mounts in water prior to sequencing; b Estimated from the published drawing 59

CHAPTER IV

The finding that the specimens of M. crassigula (s.l.) from D. vulgaris sequenced by Jousson et al. (1999, 2000) clustered with M. crassigula (s. str.) rather than with M. gibsoni n. sp. was surprising (Fig. 4.2); see also remarks to M. crassigula (s. str.) below. A comparison with the description of M. crassigula (s. str.) from the same host (see below) revealed an almost complete overlap in the metrical features and ratios (Table 4. 2) except for the higher upper limits for some features (the size of the oral sucker and testes, pharynx width and cirrus-sac width) and the lower upper limits for the size of the ventral sucker and ovary and the length of the cirrus-sac). Thus, these two species parasitising the same host, D. vulgaris, do appear very similar morphologically, the distinctive differentiating features being the distribution of the dorsal vitelline fields in the forebody, confluent in M. gibsoni n. sp. and non-confluent in M. crassigula (s. str.) and the molecular data for both markers applied here. Results of our molecular analyses and the comparisons provided above justify the distinct species status of M. gibsoni n. sp.

Macvicaria crassigula (Linton, 1910) Bartoli, Bray & Gibson, 1989 (sensu stricto) Syns M. crassigula of Jousson et al. (1999) in part (ex D. vulgaris); "D. sargus-D. vulgaris- type" of M. crassigula of Jousson et al. (2000) Host: Diplodus vulgaris (Geoffroy Saint-Hilaire) (Perciformes: Sparidae). Localities: Off Bouzedjar (35°35'16.49''N, 1°9'48.40''W), off Algiers (36°46'6.05''N, 3°5'32.15''E), Algeria, Western Mediterranean. Voucher material: Three adult specimens (hologenophores) deposited in the Helminthological Collection of the Institute of Parasitology, Biology Centre of the Czech Academy of Sciences, České Budějovice, Czech Republic under accession number IPCAS D-757. Site in host: Intestine. Representative DNA sequences: 28S rDNA: MF166846, MF166847; ITS1-5.8S-ITS2: MF166834–MF166837.

Description (Fig. 4.5B)

[Based on three mature unflattened worms, see Table 4. 3 for measurements.] Body elongate- oval, rounded at extremities, with almost parallel margins in hindbody and maximum width at level of posterior uterine loop. Tegument thick, unarmed. Forebody short (29–35% of body

CHAPTER IV

length). Oral sucker ventro-subterminal, subspherical to slightly transversely oval. Ventral sucker massive, large in relation to body (width 49–67% of body width), transversely oval, larger than oral sucker (sucker width ratio 1:1.28–1.52), in second third of body. Two pairs of groups of gland-cells present on both sides of oral sucker: 15–16 small, medio-ventral and 17–19 large, ventro-lateral. Prepharynx very short. Pharynx large, muscular, elongate-oval, with 2 muscular anterior expansions. Oesophagus very short. Intestinal bifurcation at mid- forebody. Caeca with wide lumen and thin walls, reaching close to posterior extremity, terminate blindly.

Testes 2, tandem, transversely elongate, entire, contiguous or slightly overlapping, in mid-hindbody (post-testicular field 10–17% of body length). Cirrus-sac large, elongate-oval, straight, antero-dorsal to ventral sucker, reaching dorsally to its mid-level or slightly more posterior. Internal seminal vesicle wide tubular, convoluted posteriorly. Pars prostatica distinct, prostatic cells large. Ejaculatory duct short, unarmed. Genital atrium shallow. Genital pore sinistral, at level of intestinal bifurcation.

Ovary dextral, entire, subspherical, at some distance from posterior margin of ventral sucker, pre-testicular, contiguous with or slightly separated from anterior testis. Canalicular seminal receptacle dextral, contiguous with or slightly overlapping ovary and anterior testis, 99–159  146–151. Laurer's canal and Mehlis' gland not observed. Uterus short, with main bulk between ventral sucker and ovary and anterior testis. Metraterm indistinct. Eggs operculate, non-filamented, with small knob on anopercular pole. Vitellarium follicular, vitelline follicles numerous, large, dense, in 2 lateral fields extending from level of pharynx to posterior extremity of body; fields in forebody non-confluent, comprising 2 narrow lateral strings of ventral follicles and 2 wider lateral non-confluent fields of dorsal follicles; fields in hindbody confluent in post-testicular region, comprising predominantly ventral follicles.

Excretory vesicle not observed; pore terminal, wide.

Remarks

The original description of M. crassigula was based on specimens collected from the sparid Calamus calamus (Valenciennes) from off the Dry Tortugas, Florida (Linton, 1910). Recently, Andres et al. (2014b) provided ITS1-5.8S-ITS2 and partial 28S rDNA sequences for specimens identified as M. crassigula (s. str.) from Calamus bajonado and C. leucosteus

CHAPTER IV

(sharing identical sequences) near the type-locality (in the Gulf of Mexico) and indicated their close similarity with the sequences for M. crassigula of Jousson et al. (2000).

Macvicaria crassigula was redescribed by Bartoli et al. (1989a) based on abundant material from five species of Mediterranean sparids: Diplodus annularis (L.), D. sargus (L.), D. vulgaris, Pagellus erythrinus (L.) and Pagrus pagrus (L.). These authors suggested that based on morphological, metrical and ecological characters, the material described as M. crassigula may represent a complex of species, one restricted to D. annularis, another common to D. sargus and D. vulgaris and a third common to P. erythrinus and P. pagrus. Molecular data tend to support this suggestion. In a study of phylogenetic relationships of isolates of M. crassigula from Mediterranean Diplodus spp. based on ITS1 rDNA sequences, Jousson et al. (2000) provided evidence for the genetic distinction of two cryptic species within the "crassigula" group, one sequenced from D. annularis ("D. annularis-type") and another sequenced from D. sargus and D. vulgaris ("D. sargus-D. vulgaris-type"). The first species, i.e. "D. annularis-type" was recently formally described based on morphological and molecular evidence as M. bartolii (see Antar et al., 2015). In their analyses, the second species, i.e. "D. sargus-D. vulgaris-type" of Jousson et al. (2000) clustered with the sequence for M. crassigula (s. str.) by Andres et al. (2014b) and two sequences for larval stages of Macvicaria spp. Our molecular analyses confirm the clustering pattern observed by Antar et al. (2015) and strongly support the distinct species status of the newly sequenced material ex D. vulgaris off Algeria.

Comparisons of our data for M. crassigula (s. str.) with the known ranges for metrical features of the specimens described from the North West Atlantic (Linton, 1910; Rees, 1970) (Table 4. 3) revealed that the type-material comprises somewhat smaller, more elongate (BW/BL 40 vs 44–49% in the present material) specimens, with a longer forebody (FORE/BL 40 vs 29–35%) and a ventral sucker that is smaller in relation to the width of the body (VSW/BW 42 vs 49–67%) (Table 4. 3). Metrical data of the present material also fall within the ranges given by Bartoli et al. (1989a) for the "flattened" material of Rees (1970) except for the larger width of the ventral sucker and testes and the longer cirrus-sac at a comparable body length in the latter; however, the data for the specimens from Bermuda collected by Rees (1970) exhibit higher upper ranges for most metrical features (Table 4. 3).

Of the Mediterranean species of Macvicaria, three possess non-confluent vitelline fields in the forebody, M. bartolii, M. dubia and M. obovata. However, the present material 62

CHAPTER IV

differs from M. obovata in the anterior extent of the ventral strings of follicles (extending to the level of the pharynx vs just to midlevel of the ventral sucker) and from M. dubia in having a larger body (1,638–2,823  803–1,251 vs 1,311–1,600  570–746 μm), larger and more abundant vitelline follicles in the forebody and a longer hindbody (HIND/FORE 1.34–1.65 vs 0.80–1.04).

The present material resembles M. bartolii, a species of the "crassigula" complex, in the distribution of the vitelline follicles in the forebody and the overlapping ranges for most of the metrical features (Table 4. 3). However, the cirrus-sac in M. bartolii is somewhat smaller (257–329  77–126 vs 319–391  108–172 μm) and located mostly in the forebody (vs reaching dorsally at least to the centre of the ventral sucker) and the genital pore is at the level of pharynx (vs more posterior, at the level of the intestinal bifurcation). Molecular analyses also strongly support these differences (see Figs. 4. 2, 3, 4).

The present specimens ex D. vulgaris differ from the material of M. crassigula (s.l.) described by Bartoli et al. (1989a) from P. erythrinus and P. pagrus in having non-confluent dorsal fields of vitelline follicles in the forebody (vs confluent) and this is in line with the suggestion of Bartoli et al. (1989a) that this may represent a third form within the "crassigula" species complex. Molecular data for specimens from these hosts and/or exhibiting the features described by these authors are required to test this hypothesis.

It is surprising that the material described by Bartoli et al. (1989a) from D. vulgaris and D. sargus, indicated as "D. sargus-D. vulgaris-type" by Jousson et al. (2000) does not represent a single species. Our analyses supporting two genetically distinct species with slightly different morphologies from D. vulgaris indicate that further studies combining morphological and molecular approaches are needed to fully uncover species diversity of Macvicaria in the sparid fishes of the Mediterranean. Unfortunately, of the eight isolates of "D. sargus-D. vulgaris-type" used in the phylogenetic analysis by Jousson et al. (2000) just a single sequence from a specimen ex D. vulgaris was submitted to the GenBank database and no molecular voucher material exists. It is possible that the form described from D. sargus by Bartoli et al. (1989a) represents yet another species. The present specimens differ from this material in the more anterior extent of the ventral vitelline follicles (in forebody vs to midlevel of the ventral sucker) and in having non-confluent dorsal vitelline fields in the forebody (vs confluent).

CHAPTER IV

Table 4.3. Comparative morphometric data for Macvicaria crassigula and M. bartolii

Species M. crassigula M. crassigula M. crassigula M. bartolii (sensu stricto) (Linton, 1910) (sensu stricto) Antar, (sensu lato) Georgieva, Gargouri & Kostadinova, 2015 Host D. vulgaris D. vulgaris Calamus Calamus D. annularis (Geoffroy Saint- (Geoffroy Saint- calamus bajonado (Bloch (L.) Hilaire) Hilaire) (Valenciennes) & Schneider) Source Present study Bartoli et al. Linton (1910) Bartoli et al. Antar et al. (1989) (1989)a (2015) Character Range (n = 3) Range (n = 10) Range Range Range (n = 3) (flattened) (flattened) BL 1,638–2,823b 2,104–2,975 1,330–1,540 1,900–2,470 1,510–2,205 BW 562–929 935–1,275 520–660 892–1,190 666–1,033 (803–1,251)b OSL 205–314 277–378 240–250 271–328 203–347 OSW 219–344 282–400 240–250 334–410 234–387 PHL 143–232 176–293 – 209–232 144–279 PHW 176–237 213–320 150 201–328 180–234 VSL 324–396 341–560 290–350 379–468 288–450 VSW 332–452 416–666 290–350 468–522 324–518 CSL 319–391 266–426 – 398–530 257–329 CSW 108–172 80–165 – 120–132 77–126 OVL 138–146 181–336 – 170–182 122–216 OVW 143–185 160–240 – 178–260 144–234 ATL 165–245 171–293 – 226–265 113–230 ATW 224–353 277–533 – 435–537 164–338 PTL 206 186–330 – 240–360 104–212 PTW 208–344 293–533 – 422–440 189–398 FORE 389–783 637–1,360 – 611–830 486–691 (478–981)b HIND 789–1,404b 999–1,466 – 700–1,185 625–1,052 VS-AT 140–228 133–320 – – 101–191 POST 171–483b 320–549 – 100–282 177–402 POST/BL (%) 10–17b 21c 11c – na BW/BL (%) 44–49b 50c 40c – 43–51 FORE/BL 29–35b 32c 40c – 31–34 (%) VSW/BW 49–67 49c 42c – 48–55 (%) HIND/FORE 1.34–1.65b 1.08–1.69 1.04c – 1.23–1.56 VSW/OSW 1.28–1.52 1.23–1.72 1.25–1.33 1.27–1.40 1.34–1.39 PHW/OSW 0.64–0.80 0.63–0.79 – – 0.57–0.77 EL 66–82b 65–75 68–70 67–70 64–92 EW 49–69b 28–39 40 38–41 39–67 a Material of Rees (1970) Bermuda (BMNH 1976.4.9.3); b Measured from wet mounts in water prior to sequencing; c Estimated from the published drawing. Abbreviation: na, not available

CHAPTER IV

Macvicaria mormyri (Stossich, 1885) Bartoli, Gibson & Bray, 1993

Host: Sparus aurata L. (Perciformes: Sparidae). Locality: Off Bouzedjar (35°35'16.49''N, 1°9'48.40''W), Algeria, Western Mediterranean. Voucher material: Two adult specimens (hologenophores) were deposited in the Helminthological Collection of the Institute of Parasitology, Biology Centre of the Czech Academy of Sciences, České Budějovice, Czech Republic, under accession number IPCAS D-758. Site in host: Intestine. Representative DNA sequences: 28S rDNA: MF166849, MF166850; ITS1-5.8S-ITS2: MF166839, MF166840.

Description (Fig. 4.6) [Based on a single mature unflattened worm, see Table 4. 4 for measurements.] Body elongate, rounded at both extremities, with maximum width at level of ventral sucker. Tegument thick, unarmed. Forebody short (41% of body length). Oral sucker, ventro- subterminal, slightly transversely oval. Ventral sucker muscular (width 57% of body width), transversely oval, larger than oral sucker, on distinct eminence in second third of body. Two pairs of groups of gland-cells present on both sides of oral sucker: 17–18 small, medio- ventral, at level of prepharynx and 16–18 large, ventro-lateral. Prepharynx wide, short. Pharynx muscular, elongate-oval. Oesophagus very short. Intestinal bifurcation at mid- forebody. Caeca blind, with broad lumen, terminate close to posterior extremity.

Testes 2, entire, transversely elongate, tandem, contiguous, post-testicular field 12% of body length. Cirrus-sac well developed, claviform, antero-dorsal to ventral sucker, reaching to mid-level of ventral sucker dorsally, overlapping laterally. Internal seminal vesicle tubular, relatively narrow, convoluted posteriorly, 349  65. Pars prostatica short, prostatic cells few, small. Ejaculatory duct short, unarmed. Cirrus short, unarmed, 142  95. Genital atrium shallow. Genital pore sinistral, at mid-forebody.

Ovary large, entire, dextral, pretesticular, transversely oval, separated from ventral sucker and anterior testis by uterine coils. Canalicular seminal receptacle, Mehlis' gland and Laurer's canal not observed. Loops of uterus extend between ventral sucker and anterior margins of ovary and anterior testis; distal part narrow, sinistral to cirrus-sac, terminates as metraterm opening into genital atrium. Eggs operculate, numerous, with distinct knob on 65

CHAPTER IV

anopercular pole. Vitellarium follicular, vitelline follicles numerous, small; arranged in 2 wide lateral fields extending between mid-level of pharynx and posterior extremity of body; fields in forebody comprise 2 lateral non-confluent strings of ventral follicles and 2 confluent fields of numerous dorsal follicles; fields in hindbody predominantly ventral, confluent in post-testicular region.

Excretory system not observed; pore terminal.

Remarks

Macvicaria mormyri is a rare parasite of L. mormyrus in the Mediterranean (see Bartoli et al., 1993 and references and comments therein). These authors provided a redescription based on material from L. mormyrus collected in the Scandola Nature Reserve off Corsica, France. This species was distinguished from all other species of the genus described in the Western Mediterranean by that time by the ventral sucker being borne on a distinct eminence. This character was clearly present in the specimen used for sequence generation (Fig. 4.6); the morphology of this specimen fully agrees with the detailed redescription of M. mormyri by Bartoli et al. (1993) and all measurements fall within the known range for this species (Table 4. 4).

Bartoli et al. (1993) considered M. maillardi to closely resemble M. mormyri but distinguished the two species by the length of the excretory vesicle, the presence of uterine loops between the ovary and the anterior testis and the length of the cirrus-sac. However, in the ITS1-5.8S-ITS2 phylogeny, our isolate of M. mormyri fell within a strongly-supported clade together with the isolates of M. mormyri ex L. mormyrus and M. maillardi ex S. aurata, presumably identified by Professor Bartoli and sequenced by Jousson et al. (2000). However, a comparison of the novel ITS1-5.8S-ITS2 sequences for M. mormyri and the published sequence for M. maillardi revealed substantial differences in the repeat pattern configuration, i.e. (dabe)2da vs (dabe)5da. The newly generated 28S rDNA sequence for M. mormyri clustered with the sequence for this species by Tkach et al. (2001); unfortunately, no host data were provided for the isolate sequenced.

CHAPTER IV

Fig. 4.6. Hologenophore of Macvicaria mormyri (Stossich, 1885) ex Sparus aurata from off Bouzedjar, Algeria. Ventral view with uterus and dorsal vitelline follicles in outline. Scale- bar: 500 μm.

CHAPTER IV

Table 4.4. Comparative morphometric data for Macvicaria mormyri

Host D. vulgaris Lithognathus (Geoffroy mormyrus (L.) Saint-Hilaire) Source Present study Bartoli et al. (1993) Character (n = 1) Range (n = 7) BL 3,144a 1,530–4,208 BW 722 (1,011)a 574–1,403 OSL 297 187–346 OSW 305 226–480 PHL 224 123–330 PHW 206 149–346 VSL 353 250–533 VSW 409 309–709 CSL 538 293–906 CSW 112 91–160 OVL 202 130–400 OVW 241 139–416 ATL 189 133–266 ATW 288 233–400 PTL – 160–309 PTW – 191–373 FORE 976 (1,275)a 595–1,275 HIND 1,345a 680–2,401 VS-OV 43 – VS-AT 275 – POST 387a 270–1,062 POST/BL 12a 26b (%) BW/BL (%) 32a 33b FORE/BL 41a 31b (%) VSW/BW 57 52b (%) HIND/FORE 1.05a 1.06–1.88 VSW/OSW 1.34 1.16–1.54 PHW/OSW 0.68 0.60–0.95 EL 72–75a 59–74 EW 54a 30–42 a Measured from wet mounts in water prior to sequencing; b Estimated from the published drawing

CHAPTER IV

Macvicaria maamouriae Antar, Georgieva, Gargouri & Kostadinova, 2015

Host: Sparus aurata L. (Perciformes: Sparidae). Locality: Off Bouzedjar (35°35'16.49''N, 1°9'48.40''W), Algeria, Western Mediterranean. Site in host: Intestine. Representative DNA sequences: 28S rDNA: MF166848; ITS1-5.8S-ITS2: MF166838.

Remarks

This species was recently described in detail (Antar et al., 2015) within the "obovata" species complex, based on material from S. aurata (type-host) and L. mormyrus in Bizerte Lagoon (Tunisia). Macvicaria maamouriae is distinguished from the other Mediterranean congeners by having a much larger ventral sucker relative to body width (VSW/BW 63–74%); this was the major feature used for the preliminary identification of the specimen used for DNA sequencing; the eggs were operculate, numerous, large, 70–75  58–61 (73  60) μm, with a distinct knob on the anopercular pole. This is the second record of M. maamouriae from the type-host and the first record in the Western Mediterranean.

Superfamily Allocreadioidea Looss, 1902 Family Opecoelidae Ozaki, 1925 Genus Pseudopycnadena Saad-Fares & Maillard, 1986

Pseudopycnadena fischthali Saad-Fares & Maillard, 1986

Host: Diplodus vulgaris (Geoffroy Saint-Hilaire) (Perciformes: Sparidae). Locality: Off Bouzedjar (35°35'16.49''N, 1°9'48.40''W), Algeria, Western Mediterranean. Voucher material: Two adult specimens (one hologenophore) and one juvenile worm were deposited in the Helminthological Collection of the Institute of Parasitology, Biology Centre of the Czech Academy of Sciences, České Budějovice, Czech Republic under accession number IPCAS D-759. Site in host: Intestine. Representative DNA sequence: 28S rDNA: MF166851; ITS1-5.8S-ITS2: MF16684

CHAPTER IV

Description (Fig. 4.7) [Based on 2 adult worms, see Table 4. 5 for measurements.] Body stout, subspherical with indistinct depression on ventral surface and maximum width at level of ventral sucker. Tegument thick, unarmed. Oral sucker subterminal, transversely elongate. Ventral sucker near centre of body, massive, transversely elongate, larger than oral sucker (sucker width ratio 1:1.47–1.60). Forebody longer than hindbody (forebody to hindbody length ratio 1:0.61). Prepharynx very short. Pharynx elongate-oval, smaller than oral sucker (oral sucker to pharynx width ratio 1:0.53–0.71). Oesophagus very short. Intestinal bifurcation just post- pharyngeal. Caeca with wide lumen, extend to and terminate blindly fairly close to posterior extremity. Testes 2, symmetrical, contiguous, transversely oval to subtriangular. Cirrus-sac straight, narrow, located entirely in forebody from level of posterior margin of oral sucker to anterior margin of ventral sucker or slightly overlapping ventral sucker dorsally. Internal seminal vesicle tubular, convoluted. Pars prostatica distinct, prostatic cells small. Ejaculatory duct short, cirrus long, unarmed (everted in one specimen, Fig. 4.7). Genital pore median to somewhat sinistral, at level of anterior margin of pharynx or slightly more posterior.

Ovary entire, subspherical to subtriangular, median to dextral, pre-testicular, overlapping ventral sucker dorsally. Canalicular seminal receptacle, Mehlis’gland and Laurer’s canal not observed. Main bulk of uterus at level of ovary and dorsal to ventral sucker, not extending into post-testicular region; metraterm not differentiated. Eggs numerous, operculate, non-filamented. Vitellarium follicular; follicles distributed in two lateral fields between pharynx and posterior extremity; ventral follicles two non-confluent groups, extending from posterior margin of pharynx to about posterior margin of ventral sucker; dorsal follicles more numerous confluent posterior to testes.

Excretory system not observed.

Remarks

The present material agrees well with the diagnosis of Pseudopycnadena by Cribb (2005) and with the morphology of P. fischthali, the only known species in the Mediterranean. The original description of this species was based on material from D. sargus and D. vulgaris off Lebanon (Saad-Fares & Maillard, 1986).

CHAPTER IV

Fig. 4.7. Hologenophore of Pseudopycnadena fischthali Saad-Fares & Maillard, 1986 ex Diplodus vulgaris from off Bouzedjar, Algeria. Ventral view with uterus and dorsal vitelline follicles in outline. Scale-bar: 500 μm

CHAPTER IV

Table 4. 5 Comparative morphometric data for Pseudopycnadena fischthali

Host Diplodus vulgaris Diplodus sargus (L.) Diplodus (Geoffroy Saint-Hilaire) Diplodus vulgaris vulgaris (Geoffroy Saint- (Geoffroy Hilaire) Saint-Hilaire) Source Present study Saad-Fares & Maillard Bartoli et al. (1986) (1989b) Character Range (n = 2) Range (n = 3) Range (n = 6) BL 1,074–1,388a 1,666–2,346 1,211–2,210 BW 879–935 960–1,870 914–1,742 OSL 196–200 180–284 (205) 133–187 OSW 226–239 282b 171–314 PHL 183–209 220b 133–213 PHW 126–161 132–217 112–213 VSL 274–326 – 267–458 VSW 352–361 304–465 309–469 CSL 278–331 828b – CSW 78–91 144b – OVL 136–148 153–200 133–240 OVW 126–144 215b 128–197 RTL 96–130 226b 160–197 RTW 126–165 243b 112–187 LTL 117–135 210b 160–224 LTW 148–165 241b 133–187 FORE 505 920–1,390 404–765 HIND 309 992b 531–1,020 POST 200 300b 213–560 BW/BL (%) 82 77b 75–78 FORE/BL (%) 47 41b 33–34 VSW/BW (%) 39–40 26b 26–34 HIND/FORE 0.61 1.13 1.13–1.61 VSW/OSW 1.47–1.60 0.79 2.00–2.65 PHW/OSW 0.53–0.71 0.63b 0.90–1.20 EL 57–76 73–80 (77) 74–82 EW 38–43 29–46 (38) 33–43 a Measured from wet mounts in water prior to sequencing (note: BL = 1,388 only); b Estimated from the published drawing

CHAPTER IV

A number of records in sparids have been published after the original description (Bartoli et al., 1989b; Sasal et al., 1999; Jousson et al., 1999, 2000; D'Amico et al., 2006; Gargouri Ben Abdallah & Maamouri, 2008; Derbel et al., 2012; Bellal et al., 2016). However, only the study of Bartoli et al. (1989b) provides morphological data and a description based on material from D. vulgaris thus adding to the knowledge of the intraspecific variation in P. fischthali. The metrical data for most of the morphological characters of the two adult specimens examined here vary below the ranges provided by Saad-Fares & Maillard (1986) but generally fall within the ranges given by Bartoli et al. (1989b) (Table 4. 5).

Characteristic features of the present material include a more rounded body (BW/BL 82 vs 77 and 75–78% in the material described by Saad-Fares & Maillard (1986) and Bartoli et al. (1989b), respectively; a longer forebody (FORE/BL 47 vs 41 and 33–34%, respectively) that is also longer than the hindbody (HIND/FORE 0.61 vs 1.13 and 1.13–1.61%, respectively); and a larger ventral sucker in relation to the width of the body (VSW/BW 39– 40 vs 26 and 26–34%, respectively). The sucker width ratio also differs in the three lots of specimens (1:1.47–1.60 vs 1:0.79 and 1:2.00–2.65, respectively). Our study thus extends the known range of the metrical features for P. fischthali and provides the first 28S sequence for the type-species of Pseudopycnadena.

Discussion

The integration of molecular and morphological data in this study has revealed that species diversity within Macvicaria is higher than previously thought. We provided additional evidence for assessing the taxonomic structure of the "crassigula" species complex (Bartoli et al., 1989a; Jousson et al., 2000; Antar et al., 2015) which now contains three genetically and morphologically distinct species, M. crassigula (s. str.), M. bartolii and M. gibsoni n. sp. However, the morphological homogeneity of the Mediterranean species of Macvicaria proved to be high, and the recent molecular data revealed that variations are not related to the different nature of the hosts. We believe there are more species yet to be delineated within Macvicaria in the Mediterranean. However, due to the above problems we suggest that future studies follow the approach of Antar et al. (2015) and the present study, i.e. morphological and molecular characterisation of the same isolates (hologenophores). This will counteract the scarcity of data on the intra- and interspecific morphological variation.

CHAPTER IV

One important finding supporting the distinct status of M. gibsoni n. sp. was the presence of tandemly repeated elements in the ITS1 region. Our comparative sequence analysis revealed repeated elements at the 5' end of the ITS1 spacer in six of the nine Mediterranean species of Macvicaria and marked differences in the repeat structure further strongly supporting their distinct status, especially because no intraspecific variability in the length or repeat structure were detected. Variation within the ITS1 region due to repeat patterns has been reported in species from the Haematoloechidae Freitas & Lent, 1939, Mesometridae Poche, 1926, Opecoelidae, Schistosomatidae Stile & Hassal, 1898, Strigeidae Railliet, 1919 and the Telorchiidae Looss, 1899 (see Nolan & Cribb, 2000 for a detailed review). Among the Opecoelidae, Jousson & Bartoli (2000) distinguished Opecoeloides furcatus (Bremser in Rudolphi, 1819) from O. columbellae (Pagenstecher, 1863) Jousson & Bartoli, 2000 by the presence of an additional repeat element (60 nt long) in the former, in association with morphological and life-cycle data. These authors mentioned that they observed a similar "presence/absence of a repeated pattern" in M. mormyri and M. maillardi but did not provide details. Analysis of the published sequence for M. maillardi (AJ277373) revealed a clearly distinct composition and repeat structure in comparison with the five species of Macvicaria reported here (Fig. 4.1). Both M. maillardi and M. mormyri exhibited a similar composition of the tandem subrepeats (a, b, d and e, see Fig. 4.1) which differed markedly from M. gibsoni n. sp. (a, b and c). The two former species also differ substantially in the repeat pattern configuration: (dabe)5da in M. maillardi vs (dabe)2da in M. mormyri. As indicated above, this is indeed the most significant difference between the two species which exhibit a substantial similarity of the remaining sequence of the ITS1-5.8S-ITS2 cluster: divergence of 0.2–0.4%, i.e. well within the range of the intraspecific divergence observed in both M. gibsoni n. sp. (0–0.5%) and M. crassigula (s. str.) (0–1.0%). In fact, excluding the regions with tandemly repeated elements in the ITS1-5.8S-ITS2 analysis has resulted in a spurious solution, i.e. isolates of M. maillardi and M. mormyri intermingled within a strongly supported clade (Fig. 4.2) suggesting a possible synonymy. Therefore, we consider that the phylogenetic tree based on the 28S rDNA dataset represents a more plausible hypothesis for the relationships of the Mediterranean Macvicaria spp.; unfortunately, no data are yet available for M. maillardi and M. alacris.

The phylogenetic analysis of the Opecoelidae resulted in a tree overall consistent with the previous solutions (Bray et al., 2016, Fayton & Andres, 2016; Faltýnková et al., 2017, Martin et

CHAPTER IV al., 2017) in spite of the increased taxon sampling within Macvicaria. However, the inclusion of P. fischthali (type-species), increased the number of polyphyletic genera to four, i.e. Allopodocotyle Pritchard, 1966, Gaevskajatrema Gibson & Bray, 1982, Macvicaria and Pseudopycnadena (see also Bray et al., 2016). In previous phylogenies, Pseudopycnadena tendu Bray & Justine, 2007 described from a coral reef fish from off New Caledonia (Bray & Justine, 2007), grouped separately as part of a polytomy including "Clade A" and "Clade B" (Bray et al., 2016) or as a sister group to these clades together with the recently described T. parvvatis albeit with low support (Martin et al., 2017). Adding M. magellanica in our analysis resulted in a strongly supported relationship between this species and T. parvvatis, with P. tendu resolved as a basal taxon to the clade but with poor support (Fig. 4.4). These topological changes resulting from adding single sequences highlight the importance of increased taxon sampling to assess the evolutionary relationships of the Opecoelidae.

Acknowledgements We gratefully acknowledge two anonymous reviewers for their helpful criticisms, constructive comments and important suggestions on an earlier version of the manuscript. We are grateful to the late Professor Zitouni Boutiba (University of Oran 1), who always kindly supported our research. Thanks to him for all his sacrifice for Marine Science and for all the facilities he provided in his laboratory (LRSE).

Funding This study was partially supported by the Laboratoire Réseau de Surveillance Environnementale (DM, MB, MR; grant LRSE 1-2000 Univ. Oran 1 Ahmed Ben Bella), the Czech Science Foundation (AK, APO, SG; grant ECIP P505/12/G112), MINECO/FEDER, UE (APO, grant AGL2015-68405-R) and the Valencian Regional Government (APO, grant Prometeo/2015/018). SG benefited from a postdoctoral fellowship of the Czech Academy of Sciences.

Compliance with ethical standards

Conflict of interest The authors declare that they have no conflict of interest.

Ethical approval All applicable institutional, national and international guidelines for the care and use of animals were followed.

CHAPTER VIII Conclusions and Perspectives

CONCLUSIONS AND PERSPECTIVES

The present study is the first to apply an integrative approach to the identification of trematodes in two sparid fish hosts, Sparus aurata L. and Diplodus vulgaris (Geoffroy Saint- Hilaire), along the Algerian coast of the western Mediterranean. A total of 810 fish (390 D. vulgaris and 420 S aurata) were examined for trematode infections at three localities from off Algeria, Bouzedjar, Algier and Annaba. Profiting from a large-scale sampling and fruitful collaboration, a large sequence database for the mitochondrial cox1 and nuclear ITS1-5.8S- ITS2 gene cluster and/or partial 28S rDNA sequences for the isolates studied and identified on the basis on parasite morphology was generated.

The following conclusions can be drawn as a result of the present study:

8.1. Detailed morphological characterisation was achieved in association with sequence data generated for 15 trematode species of 11 families: Opecoelidae (5 species of 2 genera); Acanthocolpidae, Aephnidiogenidae, Aporocotylidae, Derogenidae, Hemiuridae, Heterophyidae, Lepocreadiidae, Monorchiidae, Strigeidae, and a single species of the Aspidogastridae (Subclass Aspidogastrea).

8.2. Linking sequence data for the nuclear ITS1-5.8S-ITS2 internal transcribed spacer helped species delineation within the species complexes of two groups, i.e. the "crassigula" species complex of Macvicaria and "Monorchis parvus" species complex. The taxonomic structure of the "crassigula" species complex of Macvicaria was assessed and a new species, Macvicaria gibsoni Rima, Marzoug, Pérez-del-Olmo, Kostadinova, Bouderbala & Georgieva, 2017, was described. The existence of M. crassigula (Linton, 1910) (sensu stricto) in the Mediterranean was further confirmed and a detailed morphological description was provided. Within Monorchis, a putative new species was described out of the "M. parvus" species complex.

8.3. Comparative sequence analysis revealed the presence of species-specific tandemly repeated elements in the ITS1 region for Macvicaria spp. Detailed characterisation of the repeated patterns was provided for six species of the genus, i.e. M. alacris (type- species), M. bartolii, M. crassigula (sensu stricto), M. gibsoni, M. mallardi and M. mormyri.

152 CONCLUSIONS AND PERSPECTIVES

8.7. Sparus aurata L. harboured a slightly higher trematode diversity than D. vulgaris: a total of 12 species (Aphanurus virgula, Cardiocephaloides longicollis, Galactosomum lacteum, Holorchis pycnoporus, Lepidauchen stenostoma, Lepocreadium pegorchis, Macvicaria mormyri, M. maamouriae, Magnibursatus bartolii, Monorchis parvus, Diphterostomum brusinae and Cotylogaster michaelis). A total of 10 species were found in D. vulgaris (Cardiocephaloides longicollis, Cardicola sp., Diphterostomum brusinae, Holorchis pycnoporus, Lepidauchen stenostoma, Macvicaria crassigula (s. str.), M. gibsoni, Magnibursatus bartolii, Monorchis parvus and Pseudopycnadena fischthali.

8.8. Complete checklists of the helminth parasites of the two fish hosts studied, S. aurata L. and D. vulgaris (Geoffroy Saint-Hilaire, 1817), were developed during the course of the study. These contain data for a total of 70 metazoan parasites of S. aurata (19 monogeneans, 29 digeneans, 7 nematodes, 2 acanthocephalans, 2 copepods and 11 isopods) and 182 species parasitising D. vulgaris (25 digeneans, 16 monogeneans, 1 cestode, 3 nematodes, 9 copepods and 4 isopods).

The present study is the first exploration of the species diversity of digenean trematodes based on combined molecular and morphological evidence from a broad sampling in the western Mediterranean off Algeria. The large number of trematode species recovered in the two fish hosts and the finding of three species new to science suggest that the diversity of these parasites in the region may be higher than currently known. The novel sequence data gathered here will advance further studies on the diversity, host ranges and distribution of these important parasites. The present results highlight the importance of the application of morphological and molecular methods in the assessment of parasite diversity in the Mediterranean.

Perspectives In view of these results, it would be interesting to complete the inventory and identification of the other helminth of this present study for one cycle annual, with a more regular sampling by season, by accentuating the next research on the understanding of their ecology, including intermediate hosts. It would be important to continue this study with other fish host of great commercial value. It should be necessary to integrate the other classes of helminth parasites, in order to bread our

153 CONCLUSIONS AND PERSPECTIVES range of knowledge of parasitic helmintho-fauna, assessment of the infestation level and pathogenic effect of parasites and their spatio-temporal distribution along the Algerian coast of the western Mediterranean.

154

APPENDICES

CHAPTER IX References

References

Abecasis, D., Bentes, L., & Erzini, K. (2009) Home range, residency and movements of Diplodus sargus and Diplodus vulgaris in a coastal lagoon: Connectivity between nursery and adult habitats. Estuarine, Coastal and Shelf Science, 85 (4), 525–9. Abellan, E., & Basurco, B. (1999). Marine finfish species diversification: current situation and prospects in Mediterranean aquaculture. CIHEAM (Centre International de Hautes Etudes Agronimiques Mediterraneannes)/FAO (Food and Agriculture Organization of the United Nations) Serie B: Etudes et Recherches vol. 24, Zaragoza. 139 pp. Aiken, H. M., Bott, N. J., Mladineo, I., Montero, F. E., Nowak, B. F., & Hayward, C. J. (2007). Molecular evidence for cosmopolitan distribution of platyhelminth parasites of tunas (Thunnus spp.). Fish and Fisheries, 8, 167–80. Alama-Bermejo, G., Montero, F. E., Raga, J. A., & Holzer, A. S. (2011). Skoulekia meningialis n. gen., n. sp. (Digenea: Aporocotylidae Odhner, 1912) a parasite surrounding the brain of the Mediterranean common two-banded seabream Diplodus vulgaris (Geoffroy Saint-Hilaire, 1817) (Teleostei: Sparidae): Description, molecular phylogeny, habitat and pathology. Parasitology International, 60, 34–44. Alós, J., Cabanellas-Reboredo, M., & March, D. (2012). Spatial and temporal patterns in the movement of adult twobanded sea bream Diplodus vulgaris (Saint-Hilaire, 1817). Fisheries Research, 115–116, 82–8. Amine, F., & Euzet, L. (2005). Deux nouvelles espèces du genre Lamellodiscus Johnston & Tiegs, 1922 (Monogenea: Diplectanidae) parasites de Sparidae (Teleostei) des cotes de l’Algerie. Systematic Parasitology, 60,187–96. Amine, F., Euzet, L., & Kechmir-Issad, N. (2006). Description de deux nouvelles espèces du genre Lamellodiscus Johnston & Tiegs, 1922 (Monogenea: Diplectanidae) du groupe morphologique ‘Ignoratus’, parasites de Diplodus sargus et D. vulgaris (TeleosteiSparidae). Systematic Parasitology, 64, 37-45. Amine, F., Euzet, L., & Kechemir-Issad, N. (2007a). Description de Lamellodiscus confusus n. sp. (Monogenea: Diplectanidae), parasite de Sarpa salpa (Teleostei: Sparidae). Parasite, 14, 281. Amine, F., Euzet. L., & Kechemir-Issad, N. (2007b). Lamellodiscus theroni sp. nov. (Monogenea, Diplectanidae), a gill parasite from Diplodus puntazzo (Teleostei, Sparidae) from the Mediterranean Sea. Acta Parasitologica, 52, 305–9.

156 References

Andres, M. J., Pulis, E. E., & Overstreet, R. M. (2014a). New genus of opecoelid trematode from Pristipomoides aquilonaris (Perciformes: Lutjanidae) and its phylogenetic affinity within the family Opecoelidae. Folia Parasitologica, 61, 223–30. Andres, M. J., Ray, C. L., Pulis, E. E., Curran, S. S., & Overstreet, R. M. (2014b). Molecular characterization of two opecoelid trematodes from fishes in the Gulf of Mexico, with a description of a new species of of Helicometra. Acta Parasitologica, 59, 405–12. Anglade, T., & Randhawa, H. S. (2017). Gaining insights into the ecological role of the New Zealand sole (Peltorhamphus novaezeelandiae) through parasites. Journal of Helminthology. 1–10. Antar, R., Georgieva, S., Gargouri, L., & Kostadinova, A. (2015). Molecular evidence for the existence of species complexes within Macvicaria Gibson & Bray, 1982 (Digenea: Opecoelidae) in the western Mediterranean, with descriptions of two new species. Systematic Parasitology, 91, 211–29. Atopkin, D. M., Besprozvannykh, V. V., Ngo, H. D., Van Ha, N., Van Tang, N., Ermolenko, A. V., & Beloded, A. Y. (2017). Morphometric and molecular data of the two digenean species Lasiotocus lizae Liu, 2002 (Monorchiidae) and Paucivitellosus vietnamensis sp. n. (Bivesiculidae) from mullet fish in Tonkin Bay, Vietnam. Journal of Helminthology, 91, 346–55. Balart, E. F., Perez-Urbiola, J. C., Campos-Davila, L., Monteforte, M., & Ortega-Rubio, A. (2009). On the first record of a potentially harmful fish, Sparus aurata in the Gulf of California. Biological Invasions, 11, 547–50. Bao, M., Roura, A., Mota, M., Nachón, D. J., Antunes, C., Cobo, F., MacKenzie, K., & Pascual, S. (2015). Macroparasites of allis shad (Alosa alosa) and twaite shad (Alosa fallax) of the Western Iberian Peninsula Rivers: ecological, phylogenetic and zoonotic insights. Parasitology Research, 114, 3721–39. Barnabé, G., & Billard, R. (1984). L’aquaculture du bar et des Sparidés. Edition INRA. 542 p. Barnett, L. J., Miller, T. L., & Cribb, T. H. (2010). Two new Stephanostomum- like cercariae (Digenea: Acanthocolpidae) from Nassarius dorsatus and N. olivaceus (Gastropoda: Nassariidae) in Central Queensland, Australia. Zootaxa, 2445, 35–52.

157 References

Bartoli, P., Jousson, O., & Russell-Pinto, F. (2000). The life cycle of Monorchis parvus (Digenea: Monorchiidae) demonstrated by developmental and molecular data. The Journal of Parasitology, 86, 479–89. Bartoli, P., & Prévot, G. (1978). Le cycle biologique de Holorchis pycnoporus M. Stossich, 1901 (Trematoda, Lepocreadiidae). Zeitschrift für Parasitenkunde, 58, 73–90. Bartoli, P., & Bray, R. A. (1996). Description of three species of Holorchis Stossich, 1901 (Digenea: Lepocreadiidae) from marine fishes off Corsica. Systematic Parasitology, 35 (2), 133–43. Bartoli, P., Bray, R. A., & Gibson, D. I. (1989a). The Opecoelidae (Digenea) of sparid fishes of the Western Mediterranean. III. Macvicaria Gibson & Bray, 1982. Systematic Parasitology, 13, 167–92. Bartoli, P., Gibson, D. I., & Bray, R. A. (1993). The Opecoelidae (Digenea) of sparid fishes of the western Mediterranean. VI. A redescription of Macvicaria mormyri (Stossich, 1885) n. comb. and a key to the opecoelids from western Mediterranean sparids. Systematic Parasitology, 26, 59–67. Bartoli, P., Gibson, D. I., & Bray, R. A. (2005). Digenean species diversity in teleost fish from a nature reserve off Corsica, France (Western Mediterranean), and a comparison with other Mediterranean regions. Journal of Natural History, 39, 47–70. Bartoli, P., Gibson, D. I., Bray, R. A., Maillard, C., & Lambert, M. (1989b). The opecoelidae (Digenea) of sparid fishes of the western Mediterranean. II. Pycnadenoides Yamaguti, 1938 and Pseudopycnadena Saad-Fares & Maillard, 1986. Systematic Parasitology, 13, 35–51. Barton, N. H. (2007). Evolution. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Bas Peired, C. (2006). Mediterranean Sea: living resources and exploitation. CIEHAM- IAMS: FAO COPEMED Project, Zaragoza. Bauchot, M. L., & Hureau. J. C. (1986). Sparidae. In: Fishes of the North-Eastern Atlantic and the Mediterranean (Whitehead, P. J. P., Bauchot, M. L, Hureau J. C., Nilson, J., & E. Tortenese, eds), Paris, UNESCO. pp: 883–907. Bauchot, M.-L., & J.-C. Hureau. (1990). Sparidae. In: Quero, J.C., Hureau, C., Karrer, A., Post and L. Saldanha (Eds) Check-list of the fishes of the eastern tropical Atlantic

158 References

(CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 2. (Ref. 3688) p. 790–812 Belden, L. K., Peterman, W. E., Smith, S. A., Brooks, L. R., Benfield, E. F., Black, W. P., Yang,Z. & Wojdak, J. M. (2012). Metagonimoides oregonensis (Heterophyidae: Digenea) Infection In: Pleurocerid Snails and Desmognathus quadramaculatus Salamander Larvae In Southern Appalachian Streams. Journal of Parasitology, 98 (4), 760–76. Bellal, A., Tazi, N. A. B., Hadjou, Z., & Boutiba, Z. (2016). First records of digenean trematodes of two fishes (Teleostei Sparidae) from the West Algerian coast and comparative study with Tunisian coast (Mediterranean Sea). Biodiversity Journal, 7, 233–40. Benhamou, F., Marzoug, D., Boutiba, Z., Kostadinova, A., & Pérez-del-Olmo, A. (2017). Parasite communities in two sparid fishes from the western Mediterranean: a comparative analysis based on samples from three localities off the Algerian coast. Helminthologia, 54 (1), 26–35. Besprozvannykh, V. V., Atopkin, D. M., Ngo, H. D., Ermolenko, A. V., Van Ha, N., Van Tang, N., & Beloded, A. Y. (2017). Morphometric and molecular analyses of two digenean species in mugilid fish: Lecithaster mugilis Yamaguti, 1970 from Vietnam and L. sudzuhensis n. sp. from southern Russian Far East. Journal of Helminthology, 91, 326–31. Bianchi, C. N., & Morri, C. (2000). Marine biodiversity of the Mediterranean Sea: Situation, problems and prospects for future research. Marine Pollution Bulletin, 40, 367–76. Blair ,D., Bray, R. A., & Barker, S. C. (1998). Molecules and morphology in phylogenetic studies of the Hemiuroidea (Digenea: Trematoda: Platyhelminthes). Molecular Phylogenetics and Evolution, 9, 15–25. Blasco-Costa, I., Poulin, R., & Presswell, B. (2016). Species of Apatemon Szidat, 1928 and Australapatemon Sudarikov, 1959 (Trematoda: Strigeidae) from New Zealand: linking and characterising life cycle stages with morphology and molecules. Parasitology Reasearch, 115 (1), 271–89. Blasco-Costa, I., Cutmore, S. C., Miller, T. L., & Nolan, M. J. (2016). Molecular approaches to trematode systematics: ‘best practice’ and implications for future study. Systematic Parasitology, 93 (3), 295–306.

159 References

Borges, J. N., Mafra, C. L., Mantovani, C., Barros, E., Santos, E. G. N., & Santos, C. P. (2014). Molecular characterization of Ascocotyle (Phagicola) pindoramensis. Journal of Fish Diseases, 40, 191–203. Born-Torrijos A., Poulin R., Pérez-del-Olmo A., Culurgioni J., Raga J. A., & Holzer, A. S. (2016). An optimised multi-host trematode life cycle: fishery discards enhance trophic parasite transmission to scavenging birds. International Journal for Parasitology, 46, 745–53. Born-Torrijos, A., Kostadinova, A., Raga, J. A., & Holzer, A. S. (2012). Molecular and morphological identification of larval opecoelids (Digenea: Opecoelidae) parasitising prosobranch snails in a Western Mediterranean lagoon. Parasitology International, 61, 450–60. Boualleg, C., Kaouachi, N., Seridi. M., Ternengo, S., & Bensouilah, M. A. (2011). Copepod parasites of gills of 14 teleost fish species caught in the gulf of Annaba (Algeria). African Journal of Microbiological Research, 5, 4253–9. Boudouresque, C. F. (2004). Marine biodiversity in the Mediterranean: status of species, populations and communities. Scientific Reports of Port-Cros National Park, France 20, 97–146. Bowles, J., Blair, D., McManus, D. P. (1995). A molecular phylogeny of the human schistosomes. Molecular Phylogenetics and Evolution, 4, 103–9. Bradai, M. N. (2000). Diversité du peuplement ichtyque et contribution à la connaissance des sparidés du golfe de Gabès. Thèse Doct. D’Etat. 595 P. Fac. Sci. Sfax. Bray R. A., Webster B. L., Bartoli P., & Littlewood D. T. J. (2005). Relationships within the Acanthocolpidae Lühe, 1906 and their place among the Digenea. Acta Parasitologica, 50, 281–91. Bray R. A. (2005). Family Acanthocolpidae Lühe, 1906. In: Keys to the Trematoda. Vol. 2 (Eds. A. Jones, R.A. Bray and D.I. Gibson). CABI Publishing and The Natural History Museum, Wallingford, 603–19. Bray, R. A., & Justine, J.-L. (2007). Pseudopycnadena tendu sp. nov. (Digenea, Opecoelidae) in the yellow-spotted triggerfish Pseudobalistes fuscus (Perciformes, Balistidae) and additional opecoelids parasitizing fishes from the waters off New Caledonia. Acta Parasitologica, 52, 13–7.

160 References

Bray, R. A., Waeschenbach, A., Cribb, T. H., Weedall, G. D., Dyal, P., & Littlewood, D. T. J. (2009). The phylogeny of the Lepocreadioidea (Platyhelminthes, Digenea) inferred from nuclear and mitochondrial genes: Implications for their systematics and evolution. Acta Parasitologica, 54, 310–29. Bray, R. A., & Bartoli, P. (1996). A redescription of Lepidauchen stenostoma Nicoll, 1913 (Digenea), and a reassessment of the status of the genus Lepidauchen Nicoll, 1913. Systematic Parasitology, 33, 167–76. Bray, R. A., & Cribb, T. H. (2012). Reorganisation of the superfamily Lepocreadioidea Odhner, 1905 based on an inferred molecular phylogeny. Systematic Parasitology, 83, 169–77. Bray, R. A., Cribb, T. H., Littlewood, D. T. J., & Waeschenbach, A. (2016). The molecular phylogeny of the digenean family Opecoelidae Ozaki, 1925 and the value of morphological characters, with the erection of a new subfamily. Folia Parasitologica, 63, 013. Bray, R. A., Littlewood, D. T. J., Herniou, E. A., Williams, B., & Henderson, R. E. (1999). Digenean parasites of deep-sea teleosts: a review and case studies of intrageneric phylogenies. Parasitology, 119(Supplement), S125–S144. Bray, R. A., Waeschenbach, A., & Littlewood, D. T. J. (2007). A new species of Stephanostomum Looss, 1899 (Digenea, Acanthocolpidae) with a bizarre oral sucker: S. adlardi sp. nov. from the common coral trout Plectropomus leopardus (Lacepede, 1802) ` (Perciformes, Serranidae) from Lizard Island, Great Barrier Reef. Acta Parasitologica 52, 206–12. Bray, R. A., Waeschenbach, A., Dyal, P., Littlewood, D. T. J., & Morand, S. (2014). New digeneans (Opecoelidae) from hydrothermal vent fishes in the south eastern Pacific Ocean, including one new genus and five new species. Zootaxa, 3768, 73–87. Bray, R. A., Webster, B. L., Bartoli, P., & Littlewood, D. T. J. (2005). Relationships within the Acanthocolpidae Lühe, 1906 and their place among the Digenea, Acta Parasitologica, 50 (4), 281–91. Bray, R. A. (1984). Some helminth parasites of marine fishes and cephalopods of South Africa: Aspidogastrea and the digenean families Bucephalidae, Haplosplanchnidae, Mesometridae and Fellodistomidae. Journal of Natural History, 18, 271‒92 Brooks, X., Cribb, T. H., Yong, R. Q.-Y., & Cutmore, S. C. (2017). A re-evaluation of

161 References

diversity of the Aporocotylidae Odhner, 1912 in Siganus fuscescens (Houttuyn) (Perciformes: Siganidae) and associated species. Systematic Parasitology, 94, 717– 37. Bullard, S. A. (2010). A new species of Cardicola Short, 1953 (Digenea: Aporocotylidae) from the heart and branchial vessels of two surfperches (Perciformes: Embiotocidae) in the Eastern Pacific Ocean off California. The Journal of Parasitology, 96, 382–8. Bullard, S. A. (2013). Cardicola langeli sp. n. (Digenea: Aporocotylidae) from heart of sheepshead, Archosargus probatocephalus (Actinopterygii: Sparidae) in the Gulf of Mexico, with an updated list of hosts, infection sites and localities for Cardicola spp. Folia Parasitologica, 60, 17–27. Bullard, S. A., & Overstreet, R. M. (2002). Potential pathological effects of blood flukes (Digenea: Sanguinicolidae) on pen-reared marine fishes. In: Creswell, R. L. (Ed). Proceedings of the 53rd Gulf & Caribbean Fisheries Institute, November 2000. Biloxi, Mississippi, pp. 10–25. Bullard, S. A., & Overstreet, R. M. (2004). Two new species of Cardicola (Digenea: Sanguinicolidae) in drums (Sciaenidae) from Mississippi and Louisiana. Journal of Parasitology, 90, 128–36. Calhoun, D. M., Curran, S. S., Pulis, E. E., Provaznik, J. M., & Franks, J. S. (2013). Hirudinella ventricosa (Pallas, 1774) Baird, 1853 represents a species complex based on ribosomal DNA. Systematic Parasitology, 86, 197–208. Carreras-Aubets, M., Repullés-Albelda, A., Kostadinova, A., & Carrassón, M. (2011). A new cryptic species of Aponurus Looss, 1907 (Digenea: Lecithasteridae) from Mediterranean goatfish (Teleostei: Mullidae). Systematic Parasitology, 79, 145–159. Castresana, J. (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology & Evolution, 17 (4), 540–52. Cetinić, P., Soldo, A., Dulčić, J., & Pallaoro, A. (2002). Specific method of fishing for Sparidae species in the eastern Adriatic. Fisheries Research, 55, 131–9. Chai, J.-Y., Murrell, K. D., & Lymberly, A. J. (2005). Fish-borne parasitic zoonoses: status and issues. International Journal for Parasitology, 35, 1233–54. Chaoui, L., Derbal, F., Kara, M. H. & Quignard, J. P. (2005). Alimentation et condition de la dorade Sparus aurata (Teleostei: Sparidae) dans la lagune du Mellah (Algérie Nord-Est). Cah. Biol. Mar., 46, 223–5.

162 References

Chaoui, L., Kara, M. H., Faure, E., & Quignard, J. P. (2006). Growth and reproduction of the gilthead seabream Sparus aurata in Mellah lagoon (north-eastern Algeria). Scientia Marina, 70 (3), 545–52. Claxton, A. T., Fuehring, A. D., Andres, M. J., Moncrief, T. D., & Curran, S. S. (2017). Parasites of the Vermilion Snapper, Rhomboplites aurorubens (Cuvier), from the Western Atlantic Ocean. Comparative Parasitology, 84, 1–14. Coll, M., Piroddi, C., Steenbeek, J., Kaschner, K., Ben Rais Lasram, F., Aguzzi, J., et al. (2010). The biodiversity of the Mediterranean Sea: estimates, patterns, and threats. PLoS One, 5, e11842. Constenla, M., Carrasson, M., Moya, C. M., Fernandez-Chacon, A., Padros, F., Repulles- Albelda, A., & Montero, F. E. (2011). Parasitisation by Bathycreadium elongatum (Digenea, Opecoelidae) in pyloric caeca of Trachyrincus scabrus (Teleostei, Macrouridae). Diseases of Aquaculture, 96 (3), 239–47. Crespo, S., Grau, A., & Padrós, F. (1992). Sanguinicoliasis in the cultured amberjack Seriola dumerili Risso, from the Spanish Mediterranean area. Bulletin of the European Association of Fish Pathologists, 12, 157–9. Cribb, T. H. (2016). Editorial: The biodiversity of trematodes of fishes. Systematic Parasitology, 93(3): 219–21. Cribb, T. H. (2005). Family Opecoelidae Ozaki, 1925. In: Gibson, D. I., Jones, A. & Bray, R. A. (Eds) Keys to the Trematoda, Vol. 2. Wallingford, UK: CAB International & The Natural History Museum, pp. 443–532. Cribb, T. H., Adlard, R. D., Hayward, C. J., Bott, N. J., Ellis, D., Evans, D., & Nowak, B. F. (2011). The life cycle of Cardicola forsteri (Trematoda: Aporocotylidae), a pathogen of ranched southern bluefin tuna Thunnus maccoyi. International journal for parasitology, 41, 861–70. Cribb, T. H., Bray, R. A., & Littlewood, D. T. J. (2001). The nature and evolution of the association between digeneans, molluscs and fishes. International Journal for Parasitology, 31, 997–1011. Cribb, T. H., Bray, R. A., Littlewood, D. T. J., Pichelin, S. P., & Herniou, E. A. (2001). The Digenea. In: Interrelationships of the Plathyhelminthes. Littlewood, D. T. J., Bray, R. A. (editors). Taylor & Francis, Lomdon, pp. 168–85.

163 References

Cribb, T. H., Chick, R. C., O’Connor, W., O’Connor, S., Johnson, D., Sewell, K. B., et al. (2017). Evidence that blood flukes (Trematoda: Aporocotylidae) of chondrichthyans infect bivalves as intermediate hosts: indications of an ancient diversification of the Schistosomatoidea. International Journal for Parasitology, 47, 885–91. Cribb, T. H., Wee, N. Q. X., Bray, R. A., & Cutmore, S. C. (2018). Monorchis lewisi n. sp. (Trematoda: Monorchiidae) from the surf bream, Acanthopagrus australis (Sparidae), in Moreton Bay, Australia. Journal of Helminthology, 92, 100–8. Cribb, T. H. (2016). The biodiversity of trematodes of fishes. Systematic Parasitology, 93, 219–21. Cribb, T. H., & Gibson, D. I. (2010). Monorchiidae Odhner, 1911. Available at World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails &id=108453 (Accessed 29 March 2017). Culurgioni, J., D’ Amico, V., & Figus, V. (2007). Metacercariae of Galactosomum lacteum (Jägerskiöld, 1896) Looss, 1899 (Heterophyidae) from marine teleosts in Gulf of Cagliari (southern Sardinia, Italy). Journal of Helminthology, 81, 409–13. Curran, S. S., & Pulis, E. E. (2014). Confirmation of Pseudolepidapedon balistis in the Acanthocolpidae (Digenea) based on phylogenetic analysis of ribosomal DNA. Journal of Parasitology, 100, 856–9. Curran, S. S., Overstreet, R. M., & Tkach, V. V. (2007). Phylogenetic affinities of Plagiocirrus Van Cleave and Mueller, 1932 with the description of a new species from the Pascagoula River, Mississippi. Journal of Parasitology, 93, 1452–8. Curran, S. S., Tkach, V. V., & Overstreet, R. M. (2013). A new species of Homalometron (Digenea: Apocreadiidae) from fishes in the northern Gulf of Mexico. Journal of Parasitology, 99, 93–101. D'Amico, V., Trotti, G. C., Culurgioni, J., & Figus, V. (2006). Helminth parasite community of Diplodus annularis L. (Osteichthyes, Sparidae) from Gulf of Cagliari (Sardinia, South Western Mediterranean). Bulletin of the European Association of Fish Pathologists, 26, 222–8. D’Aguillo, M. C., Harold, A. S., & Darden, T. L. (2014). Diet composition and feeding ecology of the naked goby Gobiosoma bosc (Gobiidae) from four western Atlantic estuaries. Journal of Fish Biology, 85, 355–73.

164 References

Dallarés, S., Georgieva, S., Kostadinova, A., Carrassón, M., Gibson, D. I., & Pérez-del-Olmo, A. (2013). Morphometric and molecular characterisation of specimens of Lepidapedon Stafford, 1904 (Digenea: Lepidapedidae) from the deep-sea fish Mora moro (Risso) (Teleostei: Moridae) in the western Mediterranean. Systematic Parasitology, 85, 243–53. Danovaro, R., Company, J. B., Corinaldesi, C., D’Onghia, G., Galil, B., Gambi, C., Gooday, A. J., Lampadariou, N., Luna, G. M., Morigi, C., Olu, K., Polymenakou, P., Ramirez- Llodra, E., Sabbatini, A., Sardà, F., Sibuet, M., & Tselepides, A. (2010). Deep-sea biodiversity in the Mediterranean Sea: The known, the unknown, and the unknowable. PLoS ONE, 5, e11832. Danovaro, R., Company, J. B., Corinaldesi, C., D’Onghia, G., Galil, B., Gambi, C., Gooday, A.J., Lampadariou, N., Luna, G. M., Morigi, C., Olu, K., Polymenakou, P., Ramirez- Llodra, E., Sabbatini, A., Sardà, F., Sibuet, M., & Tselepides, A. (2010). Deep-sea biodiversity in the Mediterranean Sea: the known, the unknown, and the unknowable. PLoS ONE, 5, e11832. doi:10.1371/journal.pone.0011832 Darriba, D., Taboada, G. L., Doallo, R., & Posada, D. (2012). jModelTest 2: more models, new heuristics and parallel computing. Nature Methods, 9, 772. Dawes, B. (1946). The Trematoda of British fishes. London: The Ray Society. 364 pp. Dayrat, B. (2005). Towards integrative taxonomy. Biol. J. Linn. Soc., 85, 407–15. Dennis, M. M., Landos, M., & D’Antignana, T. (2011). Case–control study of epidemic mortality and Cardicola forsteri–associated disease in farmed southern bluefin tuna (Thunnus maccoyii) of south Australia. Veterinary Pathology, 48, 846–55. Derbel, F., & Kara, M. H. (2006). Régime alimentaire du Sar Tombour, Diplodus cervinus des côtes de l`Est algérien. Laboratoire Bio-ressources Marines, Université Badji- Mokhtar –Annaba. Cybium 200, 30 (2), 161–70. Derbel, F., & Kara, M. H. (2008) Composition du regime alimentaire du bogue Boops boops (Sparidae) dans le golf d’Annaba (Algérie). Cybium, 32 (4), 325–33. Derbel, H., Chaari, M., & Neifar, L. (2012). Digenean species diversity in teleost fishes from the Gulf of Gabes, Tunisia (Western Mediterranean). Parasite, 19, 129–35. Diggles, B., & Hutson, K. S. (2005). Diseases of kingfish (Seriola lalandi) in Australasia. Aquaculture Health International, 3, 12–4.

165 References

Dimitrov, G. (1991). Trematodes of the superfamily Hemiuroidea Looss, 1899 in fishes from the Bulgarian Black Sea coast. Khelmintologiya, 31, 31–44 (In Bulgarian). Djabali, F., Brahmi, B., & Maamass, M. (1993). Poissons des côtes algériennes. Pelagos (NS), 1–215. Djabali, Y., Mouhoub, R., & Hemida, F. (1987). Résultats des travaux réalisées sur les stocks de sardines et de anchois des cotes algéroises. In: Evaluation des stocks dans les divisions statistiques Baléares et Golfe du Lion: Rapport de la cinquième consultation technique: Fuengirola, Espagne, 19-23 October, 1987; C.G.P.M. FAO Raport No. 395, pp. 112–20. Djouahra, C., & Harchouche, K. (2013). Reproduction de Diplodus vulgaris (Poisson Sparidés) des côtes Algériennes. “Dynamics & Biodiversity of the terrestrial & aquatic Ecosystems""CIPCA4"TAGHIT (Bechar) ALGERIA, 19–21. Djouahra, C., & Harchouche, K. (2013). Répartition et faune associée du genre Diplodus (Poisson Sparidés) des côtes algériennes. In: Journées du 39éme anniversaire de la création de l’USTHB. Université des Sciences et de la Technologie Houari Boumediene. Faculté des Sciences Biologiques. 28–30 Avril 2013. Dobson, A., Lafferty, K. D., Kuris, A. M., Hechinger, R. F., & Jetz, W. (2008). Homage to Linnaeus: How many parasites? How many hosts? Proceedings of the National Academy of Sciences, USA. 105, 11482–9. Dollfus, R. Ph. (1958b). Cours d’ helminthologie I. Trématodes, sous-classe Aspidogastrea. Annales de Parasitologie Humaine et Comparée, 33, 305‒95. Draredja, B. (1992). Conditions hydrosédimentaires et structure de la macrofaune benthique en période printanière d’un écosystème lagunaire Méditerranéen: lac Mellah (Algérie)", Thèse magister en océanographie biologique, ISMAL (Alger). 147 p. Drarédja, B., & Kara, M. H. (2004). Caractères physic-chimiques de la lagune Mellah (Algérie Nord-Est). Rapp. Comm. Int. Mer Médit., 37, 93. Dubois, G. (1970). Revision des Proterodiplostomatidae Dubois, 1936 (Trematoda: Strigeta). Anales del Instituto de Biología, Universidad Nacional Autónoma de México, Serie Zoología, 41, 51–60. El-Maremie, H., & El-Mor, M. (2015). Feeding habits of the bogue, Boops boops (Linnaeus, 1758) (Teleostei: Sparidae) in Benghazi Coast, Eastern Libya. J Life Sci, 9, 189–96.

166 References

Fabio, S. P. de (1981). Sobre a ocorrência de três espécies de trematódeos em peixes brasileiros.Revista Brasileira de Biologia, 41, 549–52. Faltýnková, A., Georgieva, S., Kostadinova, A., & Bray, R. A. (2017). Biodiversity and evolution of digeneans of fishes in the Southern Ocean. In: Klimpel, S., Kuhn, T. & Mehlhorn, H. (Eds), Biodiversity and evolution of parasitic life in the Southern Ocean. Parasitology Research Monographs. Switzerland: Springer International Publishing, pp. 49–74. FAO. (2005). Programme d'Information sur les espèces aquatiques cultivées, Sparus aurata Edition FAO. (Linnaeus, 1758). 1–10 p. FAO., (2009). Étude sur l’aquaculture en cage: la mer Méditerranée, Francesco Cardia Consultant en aquaculture, Via A Fabretti 8, 00161 Rome, Italie Alessandro Lovatelli Département des pêches et de l’aquaculture, FAO, 00153 Rome, Italie. Fayton, T. J., & Andres, M. J. (2016). New species of Plagioporus Stafford, 1904 (Digenea: Opecoelidae) from California, with an amendment of the genus and a phylogeny of freshwater plagioporines of the Holarctic. Systematic Parasitology, 93, 731–48. Fayton, T. J., Curran, S. S., Andres, M. J., Overstreet, R. M., & McAllister, C. T. (2016). Two new species of Homalometron (Digenea: Apocreadiidae) from Nearctic freshwater fundulids, elucidation of the life cycle of H. cupuloris, and molecular phylogenetic analysis of some congeners. Journal of Parasitology (in press, online Nov 5, 2015). Ferra, C. (2008). Aquaculture. Edition VUIBERT. 1264 pp. Ferrari. I., & Chieregato, A. R. (1981). Feeding habitats of juvenile stage of Sparus aurata L., Dicentrarchus labarax L. And mugilidae in a brakish embayment of the Po River delta. Aquaculture, 25, 243–57. Fischer, W., Bauchot, M.-L., & Schneider, M. (1987). Fiches FAO d'identification des especes pour les besoins de la peche. (Revision 1). Mediterranee et mer Noire. Zone de Peche 37. FAO, Rome, p. 761–1530. Fisher, W., Schneider, M., Bauchot, M. L. (eds.) (1987). Fishes FAO d’identification des espèces pour les besoins de la pêche. Mediterranée et mer Noire. Vol. I – II., Rome, FAO. 1–2, 760 pp. Forte-Gil, D., Holzer, A. S., Pecková, H., Bartošová-Sojková, P., Peñalver, J., Dolores, E. M., & Muñoz, P. (2016). Molecular and morphological identification of Cardicola

167 References

(Trematoda: Aporocotylidae) eggs in hatchery-reared and migratory Atlantic bluefin tuna (Thunnus thynnus L.). Aquaculture, 450, 58–66. Froese, R., & Pauly, D. (2017). FishBase. World Wide Web electronic publication. www.fishbase.org, version (02/2017). Galarza, J. A., Carreras-Carbonell, J., Macpherson, E., Pascual, M., Roques, S., Turner, G. F., et al. (2009). The influence of oceanographic fronts and early-life-history traits on connectivity among littoral fish species. Proceedings of the National Academy of Sciences of the USA, 106, 1473–8. Galazzo, D. E., Dayanandan, S., Marcogliese, D. J., & McLaughlin, J. D. (2002). Molecular systematics of some North American species of Diplostomum (Digenea) based on rDNA-sequence data and comparisons with European congeners. Canadian Journal of Zoology, 80, 2207–17. Galtier, N., Gouy, M., & Gautier, C. (1996). SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny. Computer Applications & Biosciences, 12 (6), 543–8. Gargouri Ben Abdallah, L., & Maamouri, F. (2008). Digenean fauna diversity in sparid fish from Tunisian coasts. Bulletin of the European Association of Fish Pathologists, 28, 129–37. Georgiev, B. B., Biserkov, V. Y., & Genov, T. (1986). In toto staining method for cestodes in iron acetocarmine. Helminthologia, 23, 279–81. Gilardoni, C., Carballo, M. C., & F. Cremonte. (2013). The life cycle and geographical distribution of the monorchiid Proctotrema bartolii (Digenea) in the Clam Darina Solenoides from the Patagonian Coast, Argentina. Journal of Helminthology, 87 (04), 392–9. Gibson, D. I. (2002). Family Hemiuridae. In: Keys to the Trematoda. vol. 1 (ed. Gibson, D. I., Jones, A. & Bray, R. A.), pp. 305–340. CAB International, Wallingford. Gibson, D. I., & Bray, R. A. (1979). The Hemiuroidea: terminology, systematics andevolution. Bulletin of the British Museum (Natural History) (Zoology), 36, 35– 146. Gibson, D. I., & K¢ie, M. (1991). Magnibursatus caudofilamentosa (Reimer, 1971) n. comb. (Digenea: Derogenidae) from the stickleback Gasterosteus aculeatus L. in Danish waters: a zoogeographical anomaly, Systematic Parasitology, 20, 221–8.

168 References

Gibson, D. I., & Bray, R. A. (1982). A study and reorganisation of Plagioporus Stafford, 1904 (Digenea: Opecoelidae) and related genera, with special reference to forms from European Atlantic waters. Journal of Natural History, 16, 529–59. Gibson, D. I. (2002). Family Derogenidae Nicoll, 1910. In: Gibson, D.I., Jones, A. & Bray, R.A. [Eds] Keys to the Trematoda. Vol. 1. Wallingford: CAB International, pp. 351– 68. Gibson, D. I., & Bray, R. A. (1979). The Hemiuroidea: terminology, systematics and evolution. Bulletin of the British Museum (Natural History), Zoology, 36, 35–146. Gonçalves, J. M. S., Bentes, L., Coelho, R., Correia, C., Lino, P. G., Monteiro, C. C., Ribeiro, J., & Erzini, K. (2003). Age and growth, maturity, mortality and yield-per-recruit for two banded bream (Diplodus vulgaris Geoffr.) from the south coast of Portugal. Fisheries Research, 62, 349–59. Gordy, M. A., Kish, L., Tarrabain, M., & Hanington, P. C. (2016). A comprehensive survey of larval digenean trematodes and their snail hosts in central Alberta, Canada. Parasitology Research, 115, 3867–80. Gouy, M., Guindon, S., & Gascuel, O. (2010). SeaView Version 4: a multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Molecular Biology and Evolution, 27, 221–4 Guidetti, P., & Sala, E. (2007). Community-wide effects of marine reserves in the Mediterranean Sea. Marine Ecology Progress Series, 335, 43–56. Guidetti, P. (2006). Marine reserves reestablish lost predatory interactions and cause community changes in rocky reefs. Ecological Applications, 16 (3), 963–76. Guindon, S., Dufayard, J. F., Lefort, V., Anisimova, M., Hordijk, W., & Gascuel, O. (2010). New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic Biology, 59 (3), 307–21. Hadj Taieb, A. (2013). Etude écobiologique, exploitation et dynamique des populations de deux espèces de poisson de la famille des Sparidae Diplodus vulgaris Geoffroy Saint- Hilaire, 1817 et Sparus aurata Linnaeus, 1758 du golfe de Gabès. Thèse de Doc. INSTM (Tunisie). pp. 241. Hadj Taieb, A., Ghorbel, M., Ben Haddj Hamida, N., & Jarboui, O. (2010). Période de ponte et taille de première maturité sexuelle de la daurade royale Sparus aurata dans les côtes Sud de la Tunisie. BEL 2nd Colloquium LRSE-INOC, 283–8.

169 References

Hamdi, M. S., & Sibachir. M. A (2011). Contribution à l’élevage de la Daurade « Sparus aurata» en eau réchauffée :Cas de la ferme ONDPA Cap Djinet (wilaya de Boumerdes) Thèse d’ingénieur d’état en sciences de la mer , ISMAL (Alger) :1-9p. Hernández-Mena, C.D., Meza-Ruiz, I.V., & Herrera-Camacho, J.A. (2017). Automatic speech recognizers for Mexican Spanish and its open resources. Journal of Applied Research and Technology. 15 (3), 259–70. Hérnandez-Mena, D.I., García-Varela, M., & Pérez Ponce de León, G. (2017). Filling the gaps in the classification of the Digenea Carus, 1863: systematic position of the Proterodiplostomidae Dubois, 1936 within the superfamily Diplostomoidea Poirier, 1886, inferred from nuclear and mitochondrial DNA sequences. Systematic Parasitology, 94, 833–48. Herrmann, K. K., Poulin, R., Keeney, D. B., & Blasco-Costa, I. (2014). Genetic structure in a progenetic trematode: signs of cryptic species with contrasting reproductive strategies. International Journal for Parasitology, 44, 811–18. Hildebrand, J., Sitko, J., Zaleśny, G., Jeżewski, W., & Laskowski, Z. (2016). Molecular characteristics of representatives of the genus Brachylecithum Shtrom, 1940 (Digenea, Dicrocoeliidae) with comments on life cycle and host specificity. Parasitology Research, 115, 1417–25. Holzer, A. S., Montero, F. E., Repullés, A., Nolan, M. J., Sitjá-Bobadilla, A., Álvarez- Pellitero, P., Zarza, C., & Raga, J. A. (2008). Cardicola aurata sp. n. (Digenea: Sanguinicolidae) from Mediterranean Sparus aurata L. (Teleostei: Sparidae) and its unexpected phylogenetic relationship with Paradeontacylix McIntosh, 1934. Parasitology International, 57, 472–82. Huelsenbeck, J. P., & Ronquist, F. (2001). MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17, 754–5. Huelsenbeck, J. P., Ronquist, F., Nielsen, R., & Bollback, J. P. (2001). Bayesian inference of phylogeny and its impact on evolutionary biology. Science, 294, 2310–4. Hurvich, C. M., & Tsai, C. L. (1989). Regression and time series model selection in small samples. Biometrika, 76, 297–307. Huston, D. C., Cutmore, S. C., & Cribb, T. H. (2014). Isorchis cannoni n. sp. (Digenea: Atractotrematidae) from Great Barrier Reef rabbitfishes and the molecular elucidation of its life cycle. Journal of Helminthology, 2, 1–8.

170 References

Hutson, K. S., & Whittington, I. D. (2006). Paradeontacylix godfreyi n. sp. (Digenea: Sanguinicolidae) from the hearth of wild Seriola lalandi (Perciformes: Carangidae) in southern Australis. Zootaxa, 1151, 55–68. Jardas, I. (1996) Jadranska ihtiofauna. Školska knjiga: Zagreb. 553 pp. (In Croatian). Jousson, O. & Bartoli, P. (2001). Molecules, morphology and morphometrics of Cainocreadium labracis and Cainocreadium dentecis n. sp. (Digenea: Opecoelidae) parasitic in marine fishes. International Journal for Parasitology, 31, 706–14. Jousson, O., & Bartoli, P. (2000). The life cycle of Opecoeloides columbellae (Pagenstecher, 1863) n. comb. (Digenea, opecoelidae): evidence from molecules and morphology. International Journal for Parasitology, 30, 747–60. Jousson, O., & Bartoli, P. (2002). Species diversity among the genus Monorchis (Digenea: Monorchiidae) parasitic in marine teleosts: Molecular, morphological and morphometrical studies with a description of Monorchis blennii n. sp. Parasitology Research, 88, 230–41. Jousson, O., Bartoli, P., & Pawlowski, J. (2000). Cryptic speciation among intestinal parasites (Trematoda: Digenea) infecting sympatric host fishes (Sparidae). Journal of Evolutionary Biology, 13, 778–85. Jousson, O., Bartoli, P., & Pawlowski, J., (1999). Molecular identification of developmental stages in Opecoelidae (Digenea). International Journal for Parasitology. 29 (11), 1853–8. Jousson, O., Pawlowski, J., Zaninetti, L., Meinesz, A., & Boudouresque, C. F. (2001). Intra- individual genetic polymorphism in Caulerpa taxifolia populations and related Caulerpa species. In: Gravez, V., Ruitton, S., Boudouresque, C.F., Le Direach, L., Meinesz, A., Scabbia, G.,Verlaque, M. (Eds.), Fourth International Workshop on Caulerpa taxifolia. GIS Posidonie Publisher, Marseille, France, pp. 12–8. Kaouachi, N., Boualleg, C., Bensouilah, M., & Marchand, B. (2010). Monogenean parasites in Sparid fish (Pagellus genus) in eastern Algeria coastline. Afr. J. Microbiol. Res., 4, 10, 989–93. Katoh, K., & Standley, D. M. (2013). MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology & Evolution, 30 (4), 772–80.

171 References

Kostadinova, A., & Gibson, D. I. (2009). New records of rare derogenids (Digenea: Hemiuroidea from Mediterranean sparids, including the description of a new species of Magnibursatus Naidenova, 1969 and redescription of Derogenes adriaticus Nikolaeva, 196. Systematic Parasitology, 74, 187–98. Kostadinova, A., Gibson, D. I., Balbuena, J. A., Power, A. M., Montero, F. E., Aydogdu, A., & Raga, J. A. (2004). Redescriptions of Aphanurus stossichii (Monticelli, 1891) and A. virgula Looss, 1907 (Digenea: Hemiuridae). Systematic Parasitology, 58, 175–84. Kostadinova, A., Power, A. M., Fernández, M., Balbuena, J. A., Raga, J. A., & Gibson, D. I. (2003). Three species of Magnibursatus Naidenova, 1969 (Digenea: Derogenidae) from Atlantic and Black Sea marine teleosts. Folia Parasitologica, 50, 202–10. Kouider, El Amine, F. (1998). Contribution à l’étude des Monogènes parasites des poissons Sparidae (Téléostéens) du littoral Algérois. Approche taxonomique et écologique. Thèses de magister, USTHB. Alger, 215 pp. Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology & Evolution, 33 (7), 1870–4. Kuzmina, T. A., Tkach, V. V., Spraker, T. R., Lyons, E. T., & Kudlai, O. (2018). Digeneans of northern fur seals Callorhinus ursinus (Pinnipedia: Otariidae) from five subpopulations on St. Paul Island, Alaska. Parasitology Research, 117, 1079–86. Le, T. H., Nguyen, K. T., Nguyen, T. B. N., Doan, T. T. H., Dung, D. T., & Blair, D. (2017). The ribosomal transcription units of Haplorchis pumilio and H. taichui and the use of 28S rDNA sequences for phylogenetic identification of common heterophyids in Vietnam. Parasites & Vectors, 10, 17. Lechekhab, S. (2007). Reproduction, développement et processus de différentiation des gonades hermaphrodites chez 5 Sparidés, poissons Téléostéens du golfe d'Annaba. Thèse de Doctorat Fac. Sci. Univ. Annaba, 314 pp. Lechekhab, S., & Djebar, A. (2001). Biométrie et processus de différentiation des gonades chez sar Diplodus vulgaris: Poisson côtier marin. In Annales de l'Institut national agronomique El Harrach. p. 795. Lechkhab, S. (2007). Reproduction, développement et processus de différentiation des Linton, E. (1910). Helminth fauna of the Dry Tortugas, II: Trematodes. Carnegie Institution of Washington Publication, 133, 15–98.

172 References

Littlewood, D. T. J. (2011). Systematics as a cornerstone of parasitology: overview and preface. Parasitology, 138, 1633–7. Littlewood, D. T. J., Curini-Galletti, M., & Herniou, E. A. (2000). The interrelationships of Proseriata (Platyhelminthes: Seriata) tested with molecules and morphology. Molecualar Phylogenetics & Evolution, 16, 449–66. Littlewood, D. T. J., Rohde, K., Bray, R. A., & Herniou, E. A. (1999). Phylogeny of the Platyhelminthes and the evolution of parasitism. Biological Journal of the Linnean Society, 68, 257–87. Locke, S. A., McLaughlin, D. J., & Marcogliese, D. J. (2010). DNA barcodes show cryptic diversity and a potential physiological basis for host specificity among Diplostomoidea (Platyhelminthes: Digenea) parasitizing freshwater fishes in the St. Lawrence River. Canada. Molecular Ecology, 19, 2813–27. Lockyer, A. E., Olson, P. D., & Littlewood, D. T. J. (2003). Utility of complete large and small subunit rRNA genes in resolving the phylogeny of the Neodermata (Platyhelminthes): implications and a review of the cercomer theory. Biological Journal of the Linnean Society, 78, 155–71. Looss, A. (1907). Zur Kenntnis der Distomenfamilie Hemiuridae. Zoologischer Anzeiger, 31, 585–620. López-Neyra, C. R. (1941). Compendio de helmintologia Iberica (continuación). Parte II. Capítulo II – Trematoda Digenea. Descriptive de familias con representación ibérica. Revista Ibérica de Parasitología, 1, 325–87. Lozano, I., Caldentey, M. A., Gonzalez, J. A., Carrollo, J., & Santana, J. I. (1990). Talla de primera madurez sexual de seis esparidos de interes pesquero en Canarias. Inf. Tec. Inst. Esp. Oceanogr., 84, 1–30. Luton, K., Walker, D., & Blair, D. (1992). Comparisons of ribosomal internal transcribed spacers from two congeneric species of flukes (Platyhelminthes: Trematoda: Digenea). Molecular and Biochemical Parasitology, 56, 323–28. Madhavi, R. (2008). Family Monorchiidae Odhner, 1911. In R. A. Bray, D. I. Gibson, & A. Jones (Eds.), Keys to the Trematoda. Vol. 3. Wallingford: CAB International, pp. 145–76. Mannino, A. M., Balistreri, P., & Deidun, A. (2017). the Marine Biodiversity of the Mediterranean Sea in a Changing Climate: The Impact of Biological Invasions. In

173 References

Mediterranean Identities - Environment, Society, Culture. Borna Fuerst-Bjelis, ed. InTech. book edited by Borna Fuerst-Bjelis, Published: November 8, 2017 under CC BY 3.0 license. Manter, H. W. (1947). The digenetic trematodes of marine fishes of Tortugas, Florida. The American Midland Naturalist, 38, 257−416. Martin, S. B., Cutmore, S. C., & Cribb, T. H. (2017). Revision of Neolebouria Gibson, 1976 (Digenea: Opecoelidae), with Trilobovarium n. g., for species infecting tropical and subtropical shallow-water fishes. Systematic Parasitology, 94, 307–38. Marzoug, D., Boutiba, Z., Gibson, D. I., Pérez-del-Olmo, A., & Kostadinova, A. (2012). Descriptions of digeneans from Sardina pilchardus (Walbaum) (Clupeidae) off the Algerian coast of the western Mediterranean, with a complete list of its helminth parasites. Systematic Parasitology, 81, 169–86. Marzoug, D., Rima, M., Boutiba, Z., Georgieva, S., Kostadinova, A., & Pérez-del-Olmo, A. (2014). A new species of Saturnius Manter, 1969 (Digenea: Hemiuridae) from Mediterranean mullet (Teleostei: Mugilidae). Systematic Parasitology, 87, 127–34. Masala, S., Piras, M. C., Sanna, D., Chai, J. Y., Jung, B. K., Sohn, W. M., Garippa, G., & Merella, P. (2016). Epidemiological and molecular data on heterophyid trematode metacercariae found in the muscle of grey mullets (Osteichthyes: Mugilidae) from Sardinia (Western Mediterranean Sea). Parasitolology Research, 115 (9), 3409–17. McVay, M. J., Bakenhaster, M. D., & Bullard, S. A. (2011). Cardicola laruei Short, 1953 (Digenea: Aporocotylidae) from heart of seatrouts, Cynoscion spp. (Perciformes: Sciaenidae) in the Gulf of Mexico and Atlantic Ocean: taxonomic redescription, first observations of egg and miracidium, and comments on geographic distribution and host specificity. Comparative Parasitology, 78, 291–305. Miller, M. A., Pfeiffer, W., & Schwartz, T. (2010). Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: Proceedings of the Gateway Computing Environments Workshop (GCE), 14 November 2010, New Orleans, LA, pp. 1–8. Mladineo I., & Tudor M. (2004). Digenea of Adriatic cage-reared Northern bluefin tuna (Thunnus thynnus thynnus). Bulletin if the European Association of Fish Pathologists, 24, 145−52.

174 References

Mladineo, I., Žilić, J., & Čanković, M. (2008). Health survey of Atlantic Bluefin Tuna, Thunnus thynnus (Linnaeus, 1758), reared in Adriatic cages from 2003 to 2006. Journal of the World Aquaculture Society, 39, 281–9. Montero, F. E., Kostadinova, A., & Raga, J. A. (2009). Development and habitat selection of a new sanguinicolid parasite of cultured greater amberjack, Seriola dumerili, in the Mediterranean. Aquaculture, 288, 132–9. Monticelli, F. S. (1892). Cotylogaster michaelis n. g., n. sp. e revisione degli Aspidobothridae. In: Taschenberg, E.O.W. (Ed.), Festschrift zum Siebenzigsten Geburtstage Rudolf Leuckarts dem Verchrten Jubilar Dargebracht von Seinen Dankbaren Schülern, & c. Leipzig, pp. 168‒214. Nasir, P., & Gomez, Y. (1977). Digenetic trematodes from Venezuelan marine fishes. Rivista di Parassitologia, 38, 53–73. Nawel, D. (2005). Le parasitisme chez les principales espèces de poissons peuplant la lagune EL Mellah-inventaire et quantification (Doctoral dissertation, Université Badji Mokhtar de Annaba). Nelson, J. S. (2006) Fishes of the world, 4th ed., John Wiley & Sons, Inc., Hoboken, New Jersey. Nelson, J. S. (2006). Fishes of the World, 4th Ed., 601 p. John Wiley & Sons, Inc., New York. Niewiadomska, K. (2002). Family Strigeidae Railliet, 1919. In: Gibson, D. I., Jones, A. & Bray, R. A. (Eds). Keys to the Trematoda, Volume 1. Wallingford, UK: CABI Publishing and The Natural History Museum, pp. 231–44. Nolan, M. J., & Cribb, T. H. (2006). Cardicola Short,1953 and Braya n. gen. (Digenea: Sanginicolidae) from five families of tropical Indo-Pacific fishes. Zootaxa, 1265, 1– 80. Nolan, M. J., & Cribb, T. H. (2004). Ankistromeces mariae n. g., n. sp. (Digenea: Sanguinicolidae) from Meuschenia freycineti (Monacanthidae) off Tasmania. Systematic Parasitology, 57, 151–7. Nolan, M. J., & Cribb, T. H. (2005). The use and implications of ribosomal DNA sequencing for the discrimination of digenean dpecies. Advances in Parasitology, 60, 101–63. Nolan, M. J., Cantacessi, C., Cutmore, S. C., Cribb, T. H., & Miller, T. L. (2016). High- intensity cardiac infections of Phthinomita heinigerae n. sp. (Digenea:

175 References

Aporocotylidae) in the orangelined cardinalfish, Taeniamia fucata (Cantor), off Heron Island on the Great Barrier Reef. Parasitology International, 65, 371–7. Nolan, M. J., Miller, T. L., Cutmore, S. C., Cantacessi, C., & Cribb, T. H. (2014). Cardicola beveridgei n. sp. (Digenea: Aporocotylidae) from the mangrove jack, Lutjanus argentimaculatus (Perciformes: Lutjanidae), and C. bullardi n. sp. from the Australian spotted mackerel, Scomberomorus munroi (Perciformes: Scombridae), from the northern Great Barrier Reef. Parasitology International, 63, 735–45. Ogawa, K., & Fukudome, M. (1994). Mass mortality caused by blood fluke (Paradeontacylix) among amberjack (Seriola dumerili) imported to Japan. Fish Pathology, 29, 265–9. Ogawa, K., Akiyama, K., & Grabner, D. (2015). Paradeontacylix buri n. sp. (Trematoda: Aporocotylidae) from Seriola quinqueradiata cultured in Japan with a description of unidentified Paradeontacylix sp. from S. lalani. Fish Pathology, 50, 183–91. Ogawa, K., Nagano, T., Akai, N., Sugita, A., & Hall, K. A. (2007). Blood fluke infection of cultured tiger puffer Takifugu rubripes imported from China to Japan. Fish Pathology, 42, 91–9. Ogawa, K., Tanaka, S., Sugihara, Y., & Takami, I. (2010). A new blood fluke of the genus Cardicola (Trematoda: Sanguinicolidae) from Pacific bluefin tuna Thunnus orientalis (Temminck & Schlegel, 1844) cultured in Japan. Parasitology International, 59, 44– 8. Olson, P. D., Cribb, T. H., Tkach, V. V., Bray, R. A., & Littlewood, D. T. J. (2003). Phylogeny and classification of the Digenea (Platyhelminthes: Trematoda). International Journal for Parasitology, 33, 733–55. Onofri, I. (1986). Morphological adaptation of teeth to the way of nutrition with the species of genus Diplodus, Puntazzo and Sarpa (Pisces, Sparidae) from the Adriatic Sea. Morsko Ribarstvo, 4, 129–34. [in Croatian] Onofri, I. (1986). The rare saw-cheeked fish (Schedophihis medusophagus Cocco, 1839) (Pisces: Centrolophidae) in the central Adriatic. Malice Srpske, 70, 13541. Orrell, T. M., Carpenter, K. E., Musick, J. A., & Graves, J. E. (2002). Phylogenetic and biogeographic analysis of the Sparidae (Perciformes: Percoidei) from cytochrome b sequences. Copeia, 2002, 61831.

176 References

Osman, A. M., & Mahmoud, H. H. (2009). Feeding biology of Diplodus sargus and Diplodus vulgaris (Teleostei, Sparidae) in Egyptian Mediterranean waters. World Journal of Fish and Marine Sciences, 1 (4), 290–6. Paggi, L., & Orecchia, P. (1973). Lecithaster blennii n. sp. (Lecithasteridae Skrjabin e Guschanskaja, 1954) parassita dell'intestino di Blennius sanguinolentus. Parassitologia, 15, 261–6. Paggi, L., & Orecchia, P. (1974). Ridescrizione di Holorchis pycnoporus Stossich, 1901 parassita dell'intestino di Diplodus vulgaris (Geoffroy Saint-Hilaire) 1809 e considerazioni sul genere Holorchis Stossich, 1901. Parassitologia, 16, 209–14. Palacios-Abella, J. F., Georgieva, S., Mele, S., Raga, J. A., Isbert, W., Kostadinova, A., & Montero, F. E. (2017). Skoulekia erythrini n. sp. (Digenea: Aporocotylidae): a parasite of Pagellus erythrinus (L.) (Perciformes: Sparidae) from the western Mediterranean with an amendment of the generic diagnosis. Systematic Parasitology, 94, 669–88. Palacios-Abella, J. F., Rodríguez-Llanos, J., Mele, S., & Montero, F. E. (2015). Morphological characterisation and identification of four species of Cardicola Short, 1953 (Trematoda: Aporocotylidae) infecting the Atlantic bluefin tuna Thunnus thynnus (L.) in the Mediterranean Sea. Systematic Parasitology, 91, 101–17. Pankov, P., Webster, B. L., Blasco-Costa, I., Gibson, D. I., Littlewood, D. T. J., Balbuena, J. A., & Kostadinova, A. (2006). Robinia aurata n. g., n. sp. (Digenea: Hemiuridae) from the mugilid Liza aurata with a molecular confirmation of its position within the Hemiuroidea. Parasitology, 133, 217–27. Paperna, I., & Dzikowski, R. (2006). Digenea (Phylum Platyhelminthes). In: Woo P. T. K. (Ed.) Fish diseases and disorders, Volume 1, 2nd edn. Wallingford, UK: CAB International. Parukhin, A. M. (1968). Helminthofauna of fishes in South Atlantic. Biologiya Morya, 14, 96‒113. [in Russian] Pavlidis, M., & Mylonas, C. (2011). Sparidae: Biology and aquaculture of gilthead sea bream and other species. Wiley-Blackwell, Oxford, UK. 408 pp. Pearson, J. C., & Prévot, G. (1971). Galactosomum timondavidi sp. n. (Trematoda: Heterophyidae) from Larus argentatus, with a note on the metacercaria. Journal of Parasitology. 57, 1227–30.

177 References

Pérez-del-Olmo, A., Fernàndez, M., Gibson, D. I., Raga, J. A., & Kostadinova, A. (2007). Descriptions of some unusual digeneans from Boops boops L. (Sparidae) and a complete checklist of its metazoan parasites. Systematic Parasitology, 66, 137–57. Pérez-del-Olmo, A., Kostadinova, A., & Gibson, D. I. (2016). The Mediterranean: high discovery rates for a well-studied trematode fauna. Systematic Parasitology, 93, 249– 56. Pérez-Ponce de León, G., & Nadler, S. A. (2010). What we don’t recognize can hurt us: a plea for awareness about cryptic species. Journal of Parasitology, 96, 453–64. Pérez-Ponce de León., G, Razo-Mendivil., U., & Garcia-Magana., L (2012). Morphological and molecular evidences for the existence of two new species of Homalometron (Digenea: Apocreadiidae), parasites of cichlids (Osteichthyes: Cichlidae). Zootaxa 3407, 37–48. Pleijel, F., Jondelius, U., Norlinder, E., Nygren, A., Oxelman, B., Schander, C., Sundberg, P., & Thollesson, M. (2008). Phylogenies without roots? A plea for the use of vouchers in molecular phylogenetic studies. Molecular Phylogenetics & Evolution, 48, 369–71. Pornruseetairatn, S., Kino, H., Shimazu, T., Nawa, Y., Scholz, T., Ruangsittichai, J., Saralamba, N. T., & Thaenkham, U. (2015). A molecular phylogeny of Asian species of the genus Metagonimus (Digenea)-small intestinal flukes-based on representative Japanese populations. Parasitology Reasearch, 115, 1123–30. Posada, D., & Buckley, T. (2004). Model selection and model averaging in phylogenetics: Advantages of Akaike Information Criterion and Bayesian approaches over likelihood ratio tests. Systematic Biology, 53, 793–808. Poulin, R. (2011). Uneven distribution of cryptic diversity among higher taxa of parasitic worms. Biological Letters, 7, 241–44. Poulin, R., & Presswell, B. (2016). Taxonomic quality of species descriptions varies over time and with the number of authors, but unevenly among parasitic taxa. Systematic Biology, 65, 1107–16. Prévot, G. (1973). Cycle évolutive de Galactosomum timondavidi Pearson et Pre´vot, 1971 Trematoda: Heterophyidae. Parasite du Goéland à pieds jaunes Larus argentatus. Annales de Parasitologie, 48, 457–67.

178 References

Pulis, E. E., Curran, S. S., Andres, M. J., & Overstreet, R. M. (2014). Change in rank of Megaperidae (Trematoda) to Megaperinae within the Apocreadiidae and description of Haintestinum amplum n. g., n. sp. Parasitology International, 63, 269–74. Quéro, J. C., & Vayne, J. J. (2005). Les poissons de mer des pêche françaises; Ed.Delachaux et Niestlé.Espagne. p. 192. Raduković, B. M., Orecchia, P., & Paggi, L. (1989). Parasites des poisons marines di Monténegro: Digènes. Acta Adriatica, 30, 137–87. Rambaut, A. (2014) FigTree 1.4.2 software. Institute of Evolutionary Biology, Univ. Edinburgh. UK: University of Edinburgh, Institute of Evolutionary Biology, http://tree. bio.ed.ac.uk/software/figtree/. Rambaut, A., & Drummond, A. J. (2009). Tracer 1.5. Available 1136 from http://beast.bio.ed.ac.uk/Tracer. Ramdane, Z. (2003). Identification et indices parasitaires des Monogènes et des Crustacés de trois poissons Sparidae (Téléostéens) Diplodus cervinus cervinus, Diplodus vulgaris et Lithognathus mormyrus pêchés dans le golfe d’Annaba. Mémoire de Magister Université d’Annaba. 110 pp. Rees, G. (1970). Some helminth parasites of fishes of Bermuda and an account of the attachment organ of Alcicornis carangis MacCallum, 1917 (Digenea: Bucephalidae). Parasitology, 60, 195–221. Repullés-Albelda, A., Montero, F. E., Holzer, A. S., Ogawa, K., Hutson, K. S., & Raga, J. A. (2008). Speciation of the Paradeontacylix spp. (Sanguinicolidae) of Seriola dumerili Two new species of the genus Paradeontacylix from the Mediterranean. Parasitology International, 57, 405–14. Rima, M., Marzoug, D., Pérez-del-Olmo, A., Kostadinova, A., Bouderbala, M., & Georgieva, S. (2017). New molecular and morphological data for opecoelid digeneans in two Mediterranean sparid fishes with descriptions of Macvicaria gibsoni n. sp. and M. crassigula (Linton, 1910) (sensu stricto). Systematic Parasitology, 94, 739–63. Rohde, K. (2002). Ecology and biogeography of marine parasites. Advances in Marine Biology, 43, 1–86. Rohner, C. A., & Cribb, T. H. (2013). Opecoelidae (Digenea) in northern Great Barrier Reef goatfishes (Perciformes: Mullidae). Systematic Parasitology, 84, 237–53.

179 References

Ronquist, F., Teslenko, M., Van Der Mark, P., Ayres, D. L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M. A., & Huelsenbeck, J. P. (2012). MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, 61 (3), 539–42. Rosecchi, E. (1985). Ethologie alimentaire des sparidae Diplodus annularis, Diplodus sargus, Diplodus vulgaris, Pagellus erythrinus, Sparus aurata du golfe du Lion et des étangs palavasiens. Thèse de 3ème Cycle, USTL, Montpellier II. 282 pp. Ruiz de Ybañez, R., Peñalver, J., Martinez-Carrasco, C., Del Rio, L., Dolores, E. M., Berriatua, E., & Muñoz, P. (2011). Blood fluke infection of cage reared Atlantic Bluefin tuna, Thunnus thynnus in West Mediterranean. Fish Pathology, 46, 87–90. Saad-Fares, A., & Maillard, C. (1986). Trematodes of fish from Lebanese coasts. I. Pseudopycnadena fischthali n. g. n. sp. (Trematoda, Opistholebetidae), a parasite of Diplodus (Teleostei) from Lebanese coasts. Annales de Parasitologie Humaine et Comparée, 61, 303–9. Saad-Fares, A., & Maillard, C. (1990). Digenetic trematodes of Lebanese coast fishes: the species complexes Lepocreadium album (Stossich, 1890) and Lepocreadium pegorchis (Stossich, 1900) (Lepocreadiidae). Systematic Parasitology, 17, 87–95. Sala, E, Boudouresque C. F., & Harmelin-Vivien, M. (1998) Fishing, trophic cascades, and the structure of algal assemblages: evaluation of an old but untested paradigm. Oikos, 82, 425–39. Sala, E., & Ballesteros, E. (1997). Partitioning of space and food resources by three fish genus Diplodus (Sparidae) in a Mediterranean rocky infralittoral ecosystem. Marine Ecology Progress Series, 152, 273–83. Sándor, D., Molnár, K., Gibson, D. I., Székely, C., Majoros, G., & Cech, G. (2017). An investigation of the host-specificity of metacercariae of species of Apophallus (Digenea: Heterophyidae) in freshwater fishes using morphological, experimental and molecular methods. Parasitology Research, 116, 3065–76. Sarà, M. (1985). Ecological factors and their biogeographic consequences in the Mediterranean ecosystem. In: Moraitous-Apostolopoulou M, Kiortsis V, editors. Mediterranean Marine Ecosystems. New York: Plenum Press. pp. 1–17.

180 References

Sasal, P., Niquil, N., & Bartoli, P. (1999). Community structure of digenean parasites of sparid and labrid fishes of the Mediterranean Sea: a new approach. Parasitology, 119, 635–48 Schrandt, M. N., Andres, M. J., Powers, S. P., & Overstreet, R. M. (2016). Novel infection site and ecology of cryptic Didymocystis sp. (Trematoda) in the Fish Scomberomorus maculatus. The Journal of Parasitology, 102, 297–305. Searle, E. L., Cutmore, S. C., & Cribb, T. H. (2014). Monorchiid trematodes of the painted sweetlips, Diagramma labiosum (Perciformes: Haemulidae), from the southern Great Barrier Reef, including a new genus and three new species. Systematic Parasitology, 88, 195–211. Semroud, R. (1983). Contribution à l’étude écologique des milieux saumatre Méditérranéens: le lac Mellah (El-Kala, Algérie). Thèse de Doctorat. Univ. Des sciences et de la technologie Houari Boumediène, Alger. 137 pp. Shedko, M. B., Sokolov, S. G., & Atopkin, D. M. (2015). The first record of Dimerosaccus oncorhynchi (Trematoda: Opecoelidae) in fishes from rivers of Primorsky Territory, Russia, with a discussion on its taxonomic position using morphological and molecular data. Parazitologiya, 49, 171–189. (In Russian). Shirakashi, S., & Ogawa, K. (2016). Blood fluke infections in marine cultured fish. Fish Pathology, 51, 92–8. Short, R. B. (1953). A new blood fluke, Cardicola laruei n. g., n. sp. (Aporocotylidae) from marine fishes. The Journal of Parasitology, 39, 304–9. Siddiqi, A. H., & Cable, R.M. (1960). Digenetic trematodes of marine fishes of Puerto Rico. Scientific Survey of Porto Rico and the Virgin Islands, 17, 257‒369. Skrjabin, K. I. (1959). Trematody životnych i čeloveka/Osnovy trematodologii, 16, 24, 25, Moskva. Skrjabin, K. I., & Guschanskaja, L. K. (1954). Suborder Hemiurata (Markevitsch) Skrjabin & Guschanskaja, 1954. First part. In: Skrjabin, K.I. (Ed.) [Trematodes of animals and man.] Osnovy Trematodologii, 9, 225–653 (In Russian). Skryabin, K. I. (1952). Trematodes of the subclass Aspidogastrea Faust et Tang, 1936. In: Skryabin, K. I. (Ed), Trematodes of Animals and Man. Osnovy Tremadodologii, pp. 5‒149. (In Russian).

181 References

Smith, J. W. (1997a). The blood flukes (Digenea: Sanguinicolidae and Spirorchidae) of cold- blooded vertebrates: Part 1. A review of the published literature since 1971, and bibliography. Helminthological Abstracts, 66, 255–94. Smith, J. W. (1997b). The blood flukes (Digenea: Sanguinicolidae and Spirorchidae) of cold- blooded vertebrates: Part 2. Appendix I: Comprehensive parasite-host list; Appendix II: Comprehensive host-parasite list. Helminthological Abstracts, 66, 329–44. Smith, J. W. (2002). Familiy Sanguinicolidae von Graff, 1907. In: Gibson, D. I., Jones, A., & Bray, R. A. (Eds). Keys to the Trematoda. Vol. 1. Wallingford: CAB International, pp. 433–52. Snyder S. D., & Tkach V. V. (2009). Haplorchis popelkae n. sp. (Digenea: Heterophyidae) from short-necked turtles (Chelidae) in northern Australia // Journal of Parasitology, 95, 204–7. Sokolov, S. G., Atopkin, D. M., Gordeev, I. I., & Shedko, M. B. (2018). Phylogenetic position of the genus Gonocerca Manter, 1925 (Trematoda, Hemiuroidea), based on partial sequences of 28S rRNA gene and a reconsideration of taxonomic status of Gonocercinae Skrjabin et Guschanskaja, 1955. Parasitology International, 67, 74–8. Sokolov, S. G., Gordeev I. I., & Atopkin D. M. (2016). Redescription of trematode Gonocerca muraenolepisi Paruchin et Ljadov, 1979 (Hemiuroidea: Derogenidae), a body cavity parasite of Antarctic fishes, with a discussion of its phylogenetic position, Invertebrate Zoology, 13, 191–202. Sokolov, S. G., Gordeev, I. I., & Lebedeva, D. I. (2016). Redescription of Proctophantastes gillissi (Overstreet et Pritchard, 1977) (Trematoda: Zoogonidae) with discussion systematic position of the genus Proctophantastes Odhner, 1911. Acta Parasitological, 61, 529–36. Soldanova, M., Georgieva, S., Rohacova, J., Knudsen, R., Kuhn, J. A., Henriksen, E. H., Siwertsson, A., Shaw, J. C., Kuris, A. M., Amundsen, P. A., Scholz, T., Lafferty, K. D., & Kostadinova, A. (2017). Molecular analyses reveal high species diversity of trematodes in a sub-Arctic lake. International Journal of Parasitology. 47, 327–45. Stergiou, K. I., & Karpouzi, V. S. (2002). Feeding habits and trophic levels of Mediterranean fish. Fish Biology & Fisheries, 11 (3), 217–54. Stossich, M. (1885). Brani di elmintologia tergestina. Serie seconda. Bolletino della Societá Adriatica di Scienze Naturali in Trieste, 9, 156–64.

182 References

Stossich, M. (1898). Saggio di una fauna elmintologica di Trieste e provincie contermini. Trieste: Programma della Civiqua Scuola Reale Superiore, 162 pp. Stossich, M. (1901). Osservazioni elmintologiche. Bollettino della Societa Adriatica di Scienze Naturali in Trieste, 20, 89–103. Sugiura, N. (1978). Further analysis of the data by Akaike’s information criterion and the finite corrections. Communication in Statistics Theory and Methods, A, 7, 13–26. Telford, M. J., Herniou, E. A., Russell, R. B., & Littlewood, D. T. J. (2000). Changes in mitochondrial genetic codes as phylogenetic characters: two examples from the flatworms. Proceedings of the National Academy of Sciences USA, 97, 11359–64. Thaenkham, U., Nawa, Y., Blair, D., & Pakdee, W. (2011). Confirmation of the paraphyletic relationship between families Opisthorchiidae and Heterophyidae using small and large subunit ribosomal DNA sequences. Parasitology International, 60(4), 521–3. Thaenkham, U., Dekumyoy, P., Komalamisra, C., Sato, M., Dung, do T., & Waikagul, J. (2010). Systematics of the subfamily Haplorchiinae (Trematoda: Heterophyidae), based on nuclear ribosomal DNA genes and ITS2 region. Parasitology international, 59, 460–5. Timon-David. J., & Timon-David, P. (1970). A study on a larval trematode occurring in the brain of the marine fish Diplodus annularis (L.). II.D. Srivastava Common. 283–8. Timon-David, J. (1937). Etude sur les trématodes parasites des poissons du golfe de Marseille. Bulletin de l’Institut Océanographique de Monaco, 717, 1–24. Tkach, V. V., Littlewood, D. T. J., Olson, P. D., Kinsella, J. M., & Swiderski, Z. (2003). Molecular phylogenetic analysis of the Microphalloidea Ward, 1901 (Trematoda: Digenea). Systematic Parasitology, 56, 1–15. Tkach, V. V., Pawlowski, J., Mariaux, J., & Swiderski, Z. (2001). Molecular phylogeny of the suborder Plagiorchiata and its position in the system of Digenea. In: Littlewood, D. T. J., & Bray, R. A. (Eds) Interrelationships of the Platyhelminthes. London: Taylor & Francis, pp. 186–93. Tkach,V., Pawlowski, J., & Mariaux, J. (2000). Phylogenetic analysis of the suborder plagiorchiata (Platyhelminthes, Digenea) based on partial lsrDNA sequences. International Journal of Parasitology, 30 (1), 83–93.

183 References

Tortonese, E. (1985). Distribution and ecology of endemic elements in the Mediterranean fauna (fishes and echinoderms). In: Moraitous-Apostolopoulou M, Kiortsis V, editors. Mediterranean marine ecosystems. New York: Plenum Press. pp. 57–83. Walsh, P. S., Metzger, D. A., & Higushi, R. (2013). Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques, 10 (4), 506–13 (April 1991). BioTechniques, 54, 134–9. Whitehead, P. J. P., Bauchot, M. L., Hureau J. C., Nielsen J., & Tortonese E. (1986). Percomonphi. In: Fishes of the North-Eastern Atlantic and the Mediterranean, Whitehead P. J. P., Bauchot, M. L., Hureau, J. C., Nielsen J., Tortonese, E. (Eds), United Nations Educational, Scientic and Cultural Organization (UNESCO), Paris, pp. 896–7, 911. Yamaguti, S. (1963). Systema Helminthum. Monogenea and Aspidocotylea. Vol. IV Intersciences Publishers, New York, 699 pp. Yamaguti, S. (1971). Synopsis of digenetic trematodes of vertebrates. Tokyo: Keigaku. 1074 pp. Yong, R. Q-Y., Cutmore, S. C., Bray, R. A., Miller, T. L., Semarariana, I. W. Y., Palm, H. W., & Cribb, T. H. (2016a). Three new species of blood flukes (Digenea: Aporocotylidae) infecting pufferfishes (Teleostei: Tetraodontidae) from off Bali, Indonesia. Parasitology International, 65, 432–43. Yong, R. Q.-Y., Cutmore, S. C., Miller, T. L., Adlard, R. D., & Cribb, T. H. (2013). The ghosts of parasites past: eggs of the blood fluke Cardicola chaetodontis (Aporocotylidae) trapped in the heart and gills of butterflyfishes (Perciformes: Chaetodontidae) of the Great Barrier Reef. Parasitology, 140, 1186–94. Yong, R. Q.-Y., Cutmore, S. C., Miller, T. L., Wee, N. Q.-X., & Cribb, T. H. (2016b). A complex of Cardicola Short, 1953 (Digenea: Aporocotylidae) species infecting the milkfish Chanos chanos Forsskal (Gonorynchiformes), with descriptions of two new species. Systematic Parasitology, 93, 831–46. Yong, R. Q., Cutmore, S. C., Miller, T. L., Adlard, R. D., & Cribb, T. H. (2013). The ghost of parasites past: eggs of the blood fluke Cardicola chaetodontis (Aporocotylidae) trapped in the heart and gills of butterflyfishes (Perciformes: Chaetodontidae) of the Great Barrier Reef. Parasitology, 140, 1186–94.

184 References

Zhukov, E. V. (1977). Contribution to the knowledge of trematodes of marine fishes of India. Parazitologicheskiy Sbornik, 27, 51–79. (In Russian). Zohar, Y., Billard, R., & Weil, C. (1984). La reproduction de la daurade (Sparus aurata) et du bar (Dicentrarchus labrax): connaissance du cycle sexuel et controle de la gamètogènese et de la ponte. L'Aquaculture du Bar et des Sparidès, 3–24.

185 Supplementary Table S1

Supplementary Table S1. Checklist of the metazoan parasites of Sparus aurata at its distributional range. Numbers represent records of the respective parasite in each area.

Species WM EM M NEM AD A WP EA Reference MONOGENEA Family Anoplodiscidae Tagliani, 1912 Anoplodiscus cirrusspiralis Roubal, 2 Armitage & Rohde, 1983 Family Capsalidae Baird, 1853 Benedenia sp. Encotyllabe spari Yamaguti, 1934 1 Encotyllabe vallei Monticelli, 1907 2 1 Neobenedenia melleni (MacCallum, 1927) 1 Yamaguti, 1963 Family Dactylogyridae Bychowsky, 1933 Dactylogyrus sp. 1 Family Diclidophoridae Fuhrmann, 1928 Choriocotyle chrysophrii Van Beneden & 1 Hesse, 1863 Family Diplectanidae Monticelli, 1903 Lamellodiscus echeneis (Wagener, 1857) 8 2 12 3 Furnestinia sp. 1 Lamellodiscus ignoratus Palombi, 1943 2 1 Family Gyrodactylidae Gyrodactylus longipes Paladini, Hansen, 1 Fioravanti & Shinn, 2011 Gyrodactylus orecchiae Paladini, Cable, 1 Fioravanti, Faria, Di Cave & Shinn, 2011 Gyrodactylus sp. 1 Family Microcotylidae Taschenberg, 1879 Atrispinum Chrysophrii Euzet & Noisy, 3 1977 Atrispinum salpae (Parona & Perugia, 1890) 1 Bivagina pagrosomi (Murray, 1931) 2 Microcotyle sp. 1 1 Pagellicotyle mormyri (Lorenz, 1878) 1 Mamaev, 1984 Polylabris tubicirrus (Paperna & Kohn, 5 1 1964) Mamaev & Parukhin, 1976 Spariycotyle chrisophrii (Van Beneden & et 2 1 17 5 Hesse, 1863) DIGENEA Family Aporocotylidae Odhner, 1912

Cardicola auratus Holzer, Montero, 1 Repullés, Sitjà-Bobadilla, Alvarez-Pellitero, Zarza & Raga, 2008 Aporocotylidae gen. sp. 1

Family Aspidogastrae Poche, 1907 Cotylogaster michaelis Monticelli, 1892 1 1 Family Bucephalidae Poche, 1907 Bucephalus labracis Paggi & Orecchia, 1 1965 Bucephalus minimus (Stossich, 1887) 1 186

Supplementary Table S1

Species WM EM M NEM AD A WP EA Reference Labratrema minimus (Stossich, 1887) 1 Family Cryptogonimidae Ward, 1917 Timoniella imbutiforme (Molin, 1859) 1 Brooks, 1980 Family Fellodistomidae Nicoll, 1909 Proctoeces muculatus (Looss, 1901) 1 1 Family Hemiuridae Aphanurus stossichii (Monticelli, 1891) 1

Family Heterophyidae Leiper, 1909 Galactosomum lacteum (Jägerskiöld, 1896) 1 Family Lepocreadiidae Odhner, 1905 Lepocreadium album, (Stossich, 1890) 5 Lepocreadium pegorchis (Stossich, 1904) 2 1 Family Monorchiidae Odhner, 1911 Onorchis hermanis Issa, 1963 1 Monorchis monorchis (Stossich, 1890) 3 3 3 Monorchis sp. 1

Family Opecoelidae Ozaki, 1925 Allopodocotyle pedicellata (Stossich, 1887) 3 5 4 Pritchard, 1966 Cainocreadium labracis (Dujardin, 1845) 1 1 Nicoll, 1909 Macvicaria crassigula (Linton, 1910) Bartoli, Bray & Gibson, 1989 Macvicaria maamouriae Antar, Georgieva, 1 Gargouri & Kostadinova, 2015 Macvicaria maillardi Bartoli, Bray & 4 4 1 Gibson, 1989 Macvicaria obovata (Molin, 1859) Bartoli, 5 5 Bray & Gibson, 1989 Pycnadenoides senegalensis Fischthal & 2 2 1 Thomas, 1972 Family Paramphistomidae Fischoeder, 1901 Basidiodiscus ectorchis Fischthal & Kuntz, 1 1959 Family Strigeidae Railliet, 1919 Cardiocephaloides longicollis (Rudolphi, 1 1819) Dubois, 1982 Family Zoogonidae Odhner, 1911 Diphterostomum brusinae (Stossich 1889) 5 Zoogonus rubellus (Olsson, 1868) Odhner, 2 1902

NEMATODA Family Cucullanidae Cobbold, 1864 Cucullanus chrysophrydis Gendre, 1928 1 1

Dichelyne (Cucullanellus) adriaticus 1 (Törnquist, 1931) Stictodora sawakinensis Looss, 1899 1

187

Supplementary Table S1

Species WM EM M NEM AD A WP EA Reference

Dichelyne (Cucullanus) tripapillatus 1 5 1 (Gendre,1928)

Family Raphidascarididae Hartwich, 1954 Contracaecum sp. 1 Goezia kollari (Molin, 1859) 1 Hysterothylacium aduncum (Rudolphi, 1 1 1802) Hysterothylacium rhacodes (Deardorff & 1 Overstreet, 1978)

ACANTHOCEPHALA Family Polymorphydae Meyer, 1931 Southwellina hispida (Van Cleave, 1925) 1 Family Rhadinorhynchidae (Travassos 1923) Serrasentissa gittifer (Linton, 1889) 1

COPEPODA Family Lernaeopodidae Milne-Edwards, 1840 Clavellotis fallax (Heller, 1865) 2 Clavellotis sp. Brian, 1924 2 Family Pennellidae Burmeister, 1835 Lernaeolophus sultanus (Milne Edwards, 2 1840)

ISOPODA Family Caligidae Burmeister, 1835 Caligus productus Dana,1852 3 Family Cymothoidae Leach, 1818 Anilocra physodes (Linnaeus, 1758) 3 2 Ceratothoa capri (Trilles, 1964) 1 Ceratothoa oestroides (Risso, 1826) 4 1 1 Ceratothoa parallela (Otto, 1828) 2 3 Nerocila orbignyi (Guérin-Mèneville, 1832) 1 Nerocila maculate Milne Edwards, 1840 1 Family Ergasilidae Burmeister, 1835 Ergasilus lizae Krøyer, 1863 1 Naobranchia cygniformis Hesse, 1863 1 Family Philichthyidae Vogt, 1877 Colobomatus baraldii (Richiardi, 1877) 2 Colobomatus oblatae Delamare 1 Deboutteville & Nunes-Ruivo, 1952 Total records 45 18 109 10 24 2 4 5 Abbreviations: A, Atlantic; AD, Adriatic Sea, EA, Eastern Atlantic; EM, Eastern Mediterranean; M Mediterranean; NEM, North East Mediterranean; WM, Western Mediterranean; WP, Western Pacific

188

Supplementary Table S2

Supplementary Table S2. Checklist of the metazoan parasites of Diplodus vulgaris at its distributional range. Numbers represent records of the respective parasite in each area.

Species M WM EM NEM AD A NEA SEA Reference MONOGENEA Family Capsalidae Baird, 1853

Encotyllabe vallei Monticelli, 1907 2 [45, 76] Family Diplectanidae Monticelli, 1903

Lamellodiscus elegans Bychowsky, 1957 8 1 2 [20, 22, 23, 31, 47, 49, 51, 52,70, 72] Lamellodiscus ergensi Euzet & Oliver, 1966 2 1 2 [20, 51, 70, 72, 82] Lamellodiscus falcus Amine, Euzet & Kechemir- 3 [3, 45, 49] Issad, 2006 Lamellodiscus fraternus Bychowsky, 1957 3 3 [20, 22, 23, 25, 51, 60] Lamellodiscus furcosus Euzet & Oliver, 1966 2 [49, 57]

Lamellodiscus ignoratus Palombi, 1943 9 4 2 [2,4, 20, 22, 23, 25, 31, 49, 51, 52, 60, 61, 70, 72, 76] Lamellodiscus kechemirae Amine & Euzet, 2005 1 [2]

Lamellodiscus neifari Amine, Euzet & 1 [3] Kechemir-Issad, 2006 Lamellodiscus oliveri Kouider, 1998 2 [45, 49]

Lamellodiscus tementosus Amine & Euzet, 2005 1 [2] Family Microcotylidae Taschenberg, 1879

Atriaster heterodus Lebedev & Parukhin, 1969 5 1 [15, 23, 30, 46, 51, 76] Atriaster seminalis Euzet & Maillard, 1973 4 2 1 [30, 45, 49, 57, 58, 62, 70] Atrispinum salpae (Parona & Perugia, 1890) 2 [51, 58]

Atrispinum sargi (Parona & Perugia, 1890) 2 [51, 66]

Polylabris tubicirrus (Paperna & Kohn, 1964) 5 1 2 [29, 37, 45, 49, Mamaev & Parukhin, 1976 51, 67, 70, 72]

DIGENEA Family Aporocotylidae Odhner, 1912

Skoulekia meningialis Alama-Bermejo, Montero, 1 [36] Raga & Holzer, 2011 Family Fellodistomidae Nicoll, 1909 Proctoeces lintoni Siddiqi & Cable, 1960 1 [32]

Proctoeces maculatus (Looss, 1901) 1 1 [32, 33]

Steringotrema pagelli van Beneden (1871) 1 [35] Odhner, 1911 Family Hemiuridae Looss, 1899 Lecithocladium excisum (Rudolphi, 1819) Lühe, 1 [35] 1901 189

Supplementary Table S2

Species M WM EM NEM AD A NEA SEA Reference Lecithochirium rufoviride (Rudolphi, 1819) 1 [73] Lühe, 1901 Family Heterophyidae Leiper, 1909 Galactosomum sp. 1 [55]

Pygidiopsis genata Looss, 1907 2 [26, 69] Family Lepocreadidae Odhner, 1905

Holorchis legendrei Dollfus, 1946 2 1 [16, 50, 68]

Holorchis pycnoporus Stossich, 1901 3 1 1 1 [6,16, 24, 35, 80, 81] Lepocreadium album (Stossich, 1890) 6 1 [32, 35, 62, 65, 68, 79, 80] Lepocreadium pegorchis (Stossich, 1901) 1 [32] Family Mesometridae Poche, 1926 Wardula sarguicola, Bartoli & Gibson, 1989 1 [8] Family Monorchiidae Odhner, 1911 Monorchis monorchis (Stossich, 1890) 1 2 1 [38, 53, 68, 80] Monorchis parvus Looss, 1902 2 3 [7, 35, 39, 41, 43] Family Opecoelidae Ozaki, 1925 Macvicaria crassigula (Linton 1910) Bartoli, 2 3 [5, 35, 42, 43, Bray & Gibson, 1989 80] Macvicaria maillardi Bartoli, Bray & Gibson, 1 [5] 1989 Pycnadenoides senegalensis Fischthal & 1 2 [5, 41, 80] Thomas, 1972 Plagioporus alacer (Looss, 1901) Price, 1934 1 [68]

Plagioporus idoneus (Nicoll, 1909) Price, 1934 1 [68] Pseudopycnadena fischthali Saad-Fares & 2 3 [5, 35, 40, 42, Maillard, 1986 80] Family Strigeidae Railliet, 1919 Strigeoid metacercaria 1 [55] Family Zoogonidae Odhner, 1911 Diphterostomum brusinae (Stossich, 1889) 5 1 1 2 1 [9, 18, 33, 34, 35, 63, 68, 72, 74, 80] Diphterostomum sp. 1 [56]

Zoogonus rubellus (Olsson, 1868) Odhner, 1902 1 1 [35, 80]

CESTODA Family Tatraphyllidae incertae sedis Scolex pleuronectis Müller, 1788 2 [73, 78]

NEMATODA Family Acuaariidae Railliet, Henry & Sisoff, 1912 Cosmocephalus obvelatus (Creplin, 1825) 2 [26, 69] Family Anisakidae Skrjabin & Karokhin, 1945 Hysterothylacium aduncum (Rudolphi, 1802) 1 1 1 [38, 44, 48]

Hysterothylacium rhacodes (Deardorff & 1 [19] Overstreet, 1978) 190

Supplementary Table S2

Species M WM EM NEM AD A NEA SEA Reference

COPEPODA Family Hatschekiidae Kabata, 1979 Hatschekia pagellibogneravei (Hesse, 1879) 4 1 [17, 59, 60, 71, 75] Hatschekia Sargi (Valle, 1888) 1 [17] Family Lernaeopodidae Milne-Edwards, 1840 Alella macrotrachelus (Brian, 1906) 3 [11, 13, 75]

Clavella canthari (Heller, 1865) 1

Clavellopsis sargi (Kurz, 1877) 13 1 [10, 12, 14, 17, 21, 23, 64, 71, 72, 75, 77, 83, 85] Colobomatus grubei (Richiardi, 1877) 1 [75] Family Lernanthropidae Kabata, 1979 Lernanthropus brevis Richiardi,1879 2 [17, 75] Family Pennellidae Burmeister, 1835 Lernaeenicus sargi Richiardi,1880 1 [75]

Peniculus fistula Nordmann, 1832 2 [17, 75]

ISOPODA Family Cymothoidae Leach, 1818 Anilocra physodes (Linnaeus, 1758) 1 1 [1, 68]

Ceratothoa oestroides (Risso, 1826) 3 1 1 [1, 27, 54, 84, 86] Ceratothoa oxyrrhynchaena Koelbel, 1878 1 [28] Family Gnathiidae Leach, 1814 Gnathia maxillaris (Montagu, 1804) 1 [68] Total records 124 30 6 4 18 5 1 1 Abbreviations: A, Atlantic; AD, Adriatic Sea; EM, Eastern Mediterranean; M, Mediterranean; NEA, North East Atlantic; NEM, North East Mediterranean; WM, Western Mediterranean.

191

Supplementary Table S3

Supplementary Table S3. GenBank data for the species used in the Bayesian inference analysis

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) ASPIDOGASTREA Faust & Tang, 1936 Aspidogastridae Poche, 1907 Aspidogaster conchicola Baer, 1827 A Quadula pustula USA AY222162 Olson et al. (2003) Cotylaspis sp. VietNam-PO-2003 A Pelodiscus sinensis (Wiegman) Viet Nam AY222165 Olson et al. (2003) Cotylogaster basiri Siddiqi & Cable, 1960 Pogonias cromis (L.) USA AY222164 Olson et al. (2003) C. michaelis Monticelli, 1892 A Sparus aurata L. Algeria: off Ge129 Present study Bouzedjar Multicotyle purvisi Dawes, 1941 A Siebenrockiella crassicollis (Gray) Malaysia: Malaya AY22216 Olson et al. (2003) DIGENEA Carus, 1863 Acanthocolpidae Lühe, 1906 Acanthocolpida sp. VII LJB-2009 "VII" C Nassarius dorsatus (Röding) Queensland: Sandy FJ809039 Barnett et al. (2010) Point, Corio Bay, Ross Creek, Yeppoon Lepidauchen stenostoma Nicoll, 1913 A Diplodus vulgaris (Geoffroy Saint- Algeria: off Ge821 Present study Hilaire) Bouzedjar Monostephanostomum nolani Bray & Cribb, A Carangoides plagiotaenia Bleeker Australia EF506763 Bray et al. (2007) 2007 M. nolani A C. plagiotaenia Australia EF506763 Bray et al. (2007) Pseudolepidapedon balistis Manter, 1940 Balistes capriscus Gmelin USA KJ820760 Curran & Pulis. (2014) Stephanostomum baccatum (Nicoll, 1907) A Eutrigla gurnardus (L.) United Kingdom AY222256 Olson et al. (2003) S. baccatum A Hippoglossoides hippoglossus United Kingdom: DQ248218 Bray et al. (2005) North Sea S. bicoronatum (Stossich, 1883) A S. umbra France: Scandola, DQ248225 Bray et al. (2009) Corsica S. cestillium (Molin, 1858) A Lophius piscatorius L. France: Scandola, DQ248226 Bray et al. (2009) 192

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Corsica Stephanostomum cf. cestillium DTJL-2005 A L. piscatorius France: Scandola, DQ248227 Bray et al. (2009) Corsica Stephanostomum cf. uku DTJL-2005 A A. virescens Australia: Lizard DQ248219 Bray et al. (2005) Island, GBR S. gaidropsari Bartoli & Bray, 2001 A Gaidropsarus mediterraneus (L.) France: Marseille DQ248221 Bray et al. (2009) S. interruptum Sparks & Thatcher, 1958 A Menticirrhus americanus (L.) Off USA: Gulf of DQ248223 Bray et al. (2005) Mexico, Mississippi S. interruptum A M. americanus USA: Gulf of DQ248223 Bray et al. (2009) Mexico, Mississippi S. minutum (Looss, 1901) A Uranoscopus scaber L. France: Scandola, DQ248224 Bray et al. (2009) Corsica S. pristis (Deslongchamps, 1824) A Phycis phycis (L.) France: Scandola, DQ248222 Bray et al. (2009) Corsica Stephanostomum sp. DTJL-2007 A Plectropomus leopardus (Lacépède) Australia EF506761 Bray et al. (2009) S. tantabiddii Bray & Cribb, 2004 A Carangoides fulviguttatus (Forsskål) Australia: Ningaloo DQ248220 Bray et al. (2009) Aephnidiogenidae Yamaguti, 1934 Aephnidiogenes major Yamaguti, 1934 "BMNH:2006.11.8.149155" Diagramma labiosum MacLeay Australia: Lizard FJ788468 Bray et al. (2009) Island, Great Barrier Reef Holorchis castex Bray & Justine, 2007 "BMNH:2006.12.6.4041" Diagramma pictum (Thunberg) New Caledonia FJ788476 Bray et al. (2009) H. castex Bray & Justine, 2007 "BMNH:2006.12.6.4041" D. pictum New Caledonia FJ788476 Bray et al. (2009) H. gigas Bray & Cribb, 2007 "BMNH:2006.11.8.148" Plectorhynchus chrysotaenia Australia: Lizard FJ788477 Bray et al. (2009) (Bleeker) Island, Great Barrier Reef H. pycnoporus Stossich, 1901 A D. vulgaris Algeria: off Ge829 Present study Bouzedjar Neolepocreadium caballeroi Thomas, 1960 Trachinotus blochii (Lacépède) Australia: Lizard FJ788488 Bray et al. (2009) Island, Great Barrier Reef

193

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Preptetos caballeroi Pritchard, 1960 Naso vlamingii (Valenciennes) Australia:Heron AJ405273 Bray et al. (1999) Island, Queensland Stegodexamene anguillae MacFarlane, 1951 "San_2" Gobiomorphus cotidianus New Zealand KF484006 Herrmann et al. (2014) McDowall Tetracerasta blepta Watson, 1984 Posticobia brazieri (Smith) Australia: Brisbane FJ788494 Bray et al. (2009) River, Queensland Apocreadiidae Skrjabin, 1942 Homalometron armatum (MacCallum, A Lepomis microlophus (Günther) USA AY222241 Olson et al. (2003) 1895) Callohelmis pichelinae Cribb & Bray, 1999 Hemigymnus melapterus (Bloch) Australia: Heron FJ788495 Bray et al. (2009) Island, Great Barrier Reef Crassicutis choudhuryi Perez-Ponce de León, Razo-Mendivil, Rosas-Valdez, Cichlasoma beani (Cuvier) Mexico: Nayarit, EU13163 Perez-Ponce de Leon et Mendoza-Garfias & Mejía-Madrid, 2008 Rio Santiago al. (2012) C. cichlasomae Manter, 1936 "4" Cichlasoma urophthalmus Günther Mexico: Cenote Ya- JQ389861 Perez-Ponce de Leon et ax-ek, Yucatan al. (2012) Haintestinum amplum Pulis, Curran, Andres & "USNPC" Acanthostracion quadricornis (L.) USA: Gulf of KF733447 Pulis et al. (2014) Overstreet, 2013 Mexico H. armatum (MacCallum, 1895) "spA" Campeloma sp. USA: Pascagoula KC710978 Curran et al. (2013) River, Jackson County, Mississippi H. cupuloris (Ramsey, 1965) "240" L. microlophus USA KT823420 Fayton et al. (2015) H. elongatum Manter, 1947 "4" Gerres cinereus (Walbaum) USA HM038040 Parker et al. (2010) H. frocioneae Fayton, Curran, Andres, "ON16-2" Fundulus diaphanus (Lesueur) USA KT823419 Fayton et al. (2015) Overstreet & McCallister, 2016 H. manteri (Overstreet, 1970) "4" Leiostomus xanthurus Lacepède USA JX400857 Curran et al. (2013) H. mesoamericanum Pérez-Ponce De León, "1" C. urophthalmu Guatemala: Lago JQ389866 Perez-Ponce de Leon et Razo-Mendivil & Leticia García-Magaña, 2012 Macanche al. (2012) H. mexicanum (Manter, 1937) "1" Balistes sp. Mexico: JQ389867 Perez-Ponce de Leon et Zihuatanejo, al. (2012) Guerrero H. octopapillatum Pérez-Ponce De León, Razo- "4" C. beani Mexico: Estero La JQ389865 Perez-Ponce de Leon et 194

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Mendivil & Leticia García-Magaña, 2012 Tobara, San Blas, al. (2012) Nayarit H. pallidum Stafford, 1904 "2" Fundulus heteroclitus (L.) USA HM038044 Parker et al. (2010) H. palmeri Curran, Tkach & Overstreet, 2013 "5" Fundulus grandis Baird & Girard USA JX400858 Curran et al. (2013) H. pseudopallidum Martorelli, 1986 "1" Australoheros facetus (Jenyns) Argentina JX400856 Curran et al. (2013) H. robisoni Fayton, Curran, Andres, Overstreet "2" Fundulus notatus (Rafinesque) USA KT823418 Fayton et al. (2015) & McCallister, 2016 Homalometron sp. "MD_S2_ITS2" Gobiosoma bosc (Lacepède) USA KP289203 D'Aguillo et al. (2015) H. synagris (Yamaguti, 1953) Australia AY222243 Olson et al. (2003) Megapera gyrina (Linton, 1907) A. quadricornis USA: Gulf of KF733448 Pulis et al. (2014) Mexico M. orbicularis (Manter, 1933) A. quadricornis USA: Gulf of KF733450 Pulis et al. (2014) Mexico Neoapocreadium splendens Cribb & Bray, 1999 Australia AY222242 Olson et al. (2003) Schistorchis zancli Hanson, 1953 French Polynesia: AY222240 Olson et al. (2003) Moorea Thysanopharynx elongatus Manter, 1933 A. quadricornis USA: Gulf of KF733449 Pulis et al. (2014) Mexico Atractotrematidae Yamaguti, 1939 Isorchis currani Andres, Pulis & Overstreet, "THC17137A" A Selenotoca multifasciata Australia: Moreton MF803157 Huston et al. (2017) 2016 (Richardson) Bay Atractotrema sigani Durio & Manter, 1969 A Siganus lineatus (Valenciennes) Australia AY222267 Olson et al. (2003) Bivesuculidae Yamaguti, 1934 Bivesicula fusiformis Cribb, Bray & Barker, A Atherinomorus capricornensis Australia AY222183 Olson et al. (2003) 1994 (Woodland) Bivesicula claviformis Yamaguti, 1934 Epinephelus quoyanus Australia AY222182 Olson et al. (2003) (Valenciennes) Bivesicula unexpecta Cribb, Bray & Barker, A Acanthochromis polyacanthus Australia AY222181 Olson et al. (2003) 1994 (Bleeker) Brachycladiidae Odhner, 1905 195

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Zalophotrema hepaticum Stunkard & Alvey, A Zalophus californianus (Lesson) USA AY222255 Olson et al. (2003) 1929 Bucephalidae Poche, 1907 Prosorhynchoides gracilescens (Rudolphi, L. piscatorius United Kingdom AY222224 Olson et al. (2003) 1819) Rhipidocotyle galeata (Rudolphi, 1819) A E. gurnardus United Kingdom AY222225 Olson et al. (2003) Callodistomidae Odhner, 1910 Prosthenhystera obesa (Diesing, 1850) A Hoplias sp. Peru AY222206 Olson et al. (2003) Clinostomoidea Lühe, 1901 Clinostomum sp. USA-PO-2003 A Rana catesbeiana Shaw USA AY222176 Olson et al. (2003) Clinostomum sp. Australia-PO-2003 M Hypeseleotris galii (Ogilby) Australia AY222175 Olson et al. (2003) Cryptogonimidae Ward, 1917 Adlardia novaecaledoniae Miller, Bray, Goiran, "BMNH:2008.12.30.1-3" Nemipterus furcosus New Caledonia FJ788496 Bray et al. (2009) Justine & Cribb, 2009 (Valenciennes) Adlardia novaecaledoniae Miller, Bray, Goiran, "BMNH:2008.12.30.1-3" N. furcosus New Caledonia FJ788496 Bray et al. (2009) Justine & Cribb, 2009 Caecincola parvulus Marshall & Gilbert, 1905 A Micropterus salmoides USA AY222231 Olson et al. (2003) Mitotrema anthostomatum Manter, 1963 A Cromileptes altivelis Australia AY222229 Olson et al. (2003) (Valenciennes) Siphodera vinaledwardsii (Linton, 1901) Sciaenops ocellatus L. USA AY222230 Olson et al. (2003) Cyclocoelidae Stossich, 1902 Cyclocoelum mutabile (Zeder, 1800) A Calidris canutus (L.) United Kingdom: AY22224 Olson et al. (2003) Scotland Dicrocoeliidae Looss, 1899 Dicrocoelium sp. Spain-PO-2003 A Ovis aries Spain AY222261 Olson et al. (2003) Brachylecithum lobatum (Railliet, 1900) A Corvus corone L. Czech Republic AY222260 Olson et al. (2003) Lyperosomum collurionis (Skrjabin & A Sylvia atricapilla L. Czech Republic AY222259 Olson et al. (2003) Isaichikov, 1927) 196

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Diplodiscidae Cohn, 1904 Diplodiscus subclavatus A Rana ribunda (Pallas) Bulgaria AY222212 Olson et al. (2003) Echinostomatidae Echinostoma revolutum (Fröhlich, 1802) A Mesocricetus auratus Waterhouse United Kingdom AY222246 Olson et al. (2003) Enenteridae Yamaguti, 1958 Cadenatella isuzumi Machida, 1993 "BMNH:2000.3.15.10" Kyphosus vaigiensis (Quoy & Australia: Heron FJ788497 Bray et al. (2009) Gaimard) Island, Great Barrier Reef C. isuzumi Machida, 1993 "BMNH:2000.3.15.10" K. vaigiensis Australia: Heron FJ788497 Bray et al. (2009) Island, Great Barrier Reef C. pacifica (Yamaguti, 1970) K. vaigiensis Australia: Heron FJ788498 Bray et al. (2009) Island, Great Barrier Reef C. pacifica "BMNH:2000.3.15.11" K. vaigiensis Australia: Heron FJ788498 Bray et al. (2009) Island, Great Barrier Reef Enenterum aureum Linton, 1910 K. vaigiensis French Polynesia: AY222232 Olson et al. (2003) Moorea E. aureum A K. vaigiensis Off French AY222232 Olson et al. (2003) Polynesia: Mo’orea Koseiria xishaensis Gu & Shen, 1983 K. vaigiensis Australia AY222233 Olson et al. (2003) Pleorchis polyorchis (Stossich, 1889) A Sciaena umbra L. France: Scandola, DQ248215 Bray et al. (2005) Corsica P. uku Yamaguti, 1970 A Aprion virescens Valenciennes Australia: Lizard DQ248216 Bray et al. (2005) Island, GBR Proenenterum ericotylum Manter, 1954 "BMNH:2002.7.17.25-27" Aplodactylus arctidens Australia: Tasmania FJ788499 Bray et al. (2009) Richardson P. isocotylum Manter, 1954 "BMNH:2007.7.17.28-31" A. arctidens Australia: Tasmania FJ788500 Bray et al. (2009) P. isocotylum "BMNH:2007.7.17.28-31" A. arctidens Australia: Tasmania FJ788500 Bray et al. (2009)

197

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Proenenterum sp. RAHAG-2016 Myripristis murdjan (Forsskål) Egypt KT943447 Abdel-Gaber (2015) Tormopsolus orientalis Yamaguti, 1934 Seriola dumerli L. France: Scandola, DQ248217 Bray et al. (2005) Corsica Fasciolidae Raillet, 1895 Fasciola hepatica L. A Capra hircus (L.) Saudi Arabia AY222244 Olson et al. (2003) Fasciola gigantica Cobbold, 1855 A Bos taurus L. Senegal AY222245 Olson et al. (2003) Faustulidae Poche, 1926 Bacciger lesteri Bray, 1982 A S. multifasciata Australia AY222269 Olson et al. (2003) Antorchis pomacanthi (Hafeezullah & Siddiqi, A Pomacanthus sexstriatus Australia AY222268 Olson et al. (2003) 1970) (Cuvier) Trigonocryptus conus Martin, 1958 A Arothron nigropunctatus (Bloch Australia AY222270 Olson et al. (2003) & Schneider) Fellodistomidae Nicoll, 1909 Steringophorus margolisi Bray, 1995 A Spectrunculus grandis (Günther) United Kingdom AY222281 Olson et al. (2003) Fellodistomum fellis(Olsson, 1868) A Anarhichas lupus L. United Kingdom AY222282 Olson et al. (2003) Olssonium turneri Bray & Gibson, 1980 A Alepocephalus agassizi Goode & United Kingdom AY222283 Olson et al. (2003) Bean Proctoeces maculatus (Looss, 1901) A USA AY222284 Olson et al. (2003) Gorgocephalidae Manter, 1966 Gorgocephalus kyphosi Manter, 1966 K. vaigiensis (Pallas) Australia AY222234 Bray et al. (2009) Gorgoderidae Looss, 1899 Gorgodera cygnoides Rana ridibunda Bulgaria AY222264 Olson et al. (2003) Xystretrum sp. Australia-PO-2003 A Sufflamen chrysopteru (Bloch & Australia AY222263 Olson et al. (2003) Schneider) Nagmia floridensis Markell, 1953 A Rhinoptera bonasus (Mitchill) USA AY222262 Olson et al. (2003) Degeneria halosauri(Bell, 1887) A Halosauropsis macrochir NE Atlantic Ocean AY222257 Olson et al. (2003) (Günther)

198

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Gyliauchenidae Fukui, 1929 Affecauda annulata Hall & Chambers, 1999 Naso tuberosus Lacépède Australia: Lizard FJ788501 Bray et al. (2009) Island, Great Barrier Reef Paragyliauchen arusettae Machida, 1984 Pomacanthus sexstriatus Australia: Ningaloo FJ788503 Bray et al. (2009) (Cuvier) Paragyliauchen sp. DTJL-2009 Centropyge bicolor (Bloch) Australia: Lizard FJ788502 Bray et al. (2009) Island, Great Barrier Reef Petalocotyle adenometra Hall & Cribb, 2000 Prionurus microlepidotus Australia: FJ788504 Bray et al. (2009) Lacépède Stradbroke Island Robphildollfusium fractum (Rudolphi, 1819) Sarpa salpa (L.) France: FJ788505 Bray et al. (2009) Mediterranean Sea at Perpignan Haematoloechidae Freitas & Lent, 1939 Haematoloechus longiplexus (Stafford, 1902) A Rana catesbeiana Shaw USA AY222280 Olson et al. (2003) Haploporidae Nicoll, 1914 Hapladena nasonis Yamaguti, 1970 A N. unicornis Australia AY222265 Olson et al. (2003) Pseudomegasolena ishigakiense Machida & A Scarus rivulatus Forsskål & Australia AY222266 Olson et al. (2003) Kamiya, 1976 Niebuhr Haplosplanchnidae Poche, 1926 Schikhobalotrema sp. Australia-PO-2003 A S. rivulatus Australia AY222238 Olson et al. (2003) Hymenocotta mulli Manter, 1961 A Crenimugal crenilabis (Forsskål) Australia AY222239 Olson et al. (2003) Hemiuroidea Looss, 1899 Otodistomum cestoides(Van Beneden, 1871) A Raja montagui Fowler United Kingdom AY222187 Olson et al. (2003) Lecithophyllum botryophorum(Olsson, 1868) A Alepocephalus bairdii Goode & AY222205 Olson et al. (2003) Bean Merlucciotrema praeclarum (Manter, 1934) A Cataetyx laticeps Koefoed United Kingdom AY222204 Olson et al. (2003) Lecithocladium excisum (Rudolphi, 1819) A Scomber scombrus L. United Kingdom AY222203 Olson et al. (2003) 199

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Dinurus longisinusLooss, 1907 A Coryphaena hippurus L. Jamaica AY222202 Olson et al. (2003) Plerurus digitatus (Looss, 1899) A Scombermorus commerson Australia AY222201 Olson et al. (2003) (Lacepède) Lecithochirium caesionis Yamaguti, 1942 A Caesio cuning (Bloch) Australia AY222200 Olson et al. (2003) Lecithaster gibbosus (Rudolphi, 1802) Merlangius merlangus (L.) United Kingdom AY222199 Olson et al. (2003) Opisthadena dimidia Linton, 1910 A Kyphosus cinerascens (Forsskål) Australia AY222198 Olson et al. (2003) Machidatrema chilostoma (Machida, 1980) A Kyphosus vaigiensis (Quoy & French Polynesia: AY222197 Olson et al. (2003) Gaimard) Moorea Didymozoon scombri Taschenberg, 1879 A Scomberus scombrus L. United Kingdom AY222195 Olson et al. (2003) Didymozoid sp. 3-PO-2003 A Apogon cookii MacLeay Australia AY222194 Olson et al. (2003) Didymozoid sp. 1-PO-2003 A Epinephelus cyanopodus Australia AY222193 Olson et al. (2003) (Richardson) Didymozoid sp. 2-PO-2003 A Taeniura lymma (Forsskål) Australia AY222192 Olson et al. (2003) Prosogonotrema bilabiatum Vigueras, 1940 A Caesio cuning (Bloch) Australia AY222191 Olson et al. (2003) Derogenes varicus(Müller, 1784) A Hippoglossoides platessoides United Kingdom AY222189 Olson et al. (2003) (Fabricius) Copiatestes filiferus(Leuckart in Sars, 1885) A Trachurus murphyi Nichols New Zealand AY222188 Olson et al. (2003) Accacoelium contortum (Rudolphi, 1819) A Mola mola (L.) United Kingdom AY222190 Olson et al. (2003) Heterophyidae Leiper, 1909 Apophallus donicus (Skrjabin & Lindtrop, "MK15" M Perca fluviatili L. Hungary MF447672 Sandor et al. (2017) 1919) Apophallus muehlingi (Jägerskiöld, 1899) "MK11" A Abramis brama (L.) Hungary MF438069 Sandor et al. (2017) A. muehlingi (Jägerskiöld, 1899) "RK2" A Vulpes vulpes (L.) Hungary MF438074 Sandor et al. (2017) Apophallus sp. VK1 "VK1" M Scardinius erythrophthalmus (L.) Hungary MF438075 Sandor et al. (2017) Apophallus zalophi Price, 1932 "OK41" A C. ursinus (L.) USA: Alaska, St. MG806918 Kuzmina et al. (2018) Paul Island Ascocotyle pindoramensis (Travassos, 1928) A Mesocricetus auratus (L.) Brazil KJ094561 Borges et al. (2014)

200

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Ascocotyle sp. "As1" KU559561 Masala et al. (2016) Centrocestus formosanus Nishigori, 1924 M. auratus Thailand HQ874609 Thaenkham et al. (2011) C. formosanus Nishigori, 1924 A Homo sapiens (L.) Viet Nam: Ha KY369153 Le et al. (2017) Giang C. formosanus A H. sapiens Viet Nam: Ha KY351633 Le et al. (2017) Giang C. formosanus M. auratus Thailand HQ874609 Thaenkham et al. (2011) Cryptocotyle lingua (Creplin, 1825) Littorina littorea (L.) Germany AY222228 Olson et al. (2003) Euryhelmis costaricensis Brenes, Arroyo & "metacercaria (2008)" Hynobius lichenatus Boulenger Japan: Fukushima, AB521797 Sato et al. (2010) Jimenez-Quiros, 1960 Minamisoma, northern part of Abukuma Mountains Galactosomum lacteum (Jägerskiöld, 1896) A Phalacrocorax carbo (L.) Ukraine AY222227 Olson et al. (2003) G. timondavidii Pearson & Prévot, 1971 A S. aurata Algeria: off Annaba Ge839 Present study G. ubelakeri "OK4441" A Callorhinus ursinus (L.) USA: Alaska, St. MG806920 Kuzmina et al. (2018) Paul Island Haplorchis popelkae Snyder & Tkach, 2009 "SDS0534" A Elseya dentata (Gray) Australia: Daly EU883586 Snyder & Tkach (2009) River, north of Oolloo Crossing, Northern Territory H. popelkae Snyder & Tkach, 2009 "SDS0534" A E. dentata Australia: Daly EU883586 Snyder and Tkach (2009) River, north of Oolloo Crossing, Northern Territory Haplorchis pumilio Looss, 1896 "HPU8" A H. sapiens Viet Nam: Quang KX815125 Le et al. (2017) Tri H. pumilio Looss, 1896 A Trichogaster trichopterus Thailand HM004191 Thaenkham et al. (2010) (Pallas) H. taichui (Nishigori, 1924) A Puntus brevis (Bleeker) Thailand HM004187 Thaenkham et al. (2010)

201

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) H. taichui (Nishigori, 1924) "NA2" A Mesocricetus Thailand HM004185 Thaenkham et al. (2010) auratus(Waterhouse) H. yokogawai (Katsuta, 1932) A Mystus singaringan (Bleeker) Thailand HM004192 Thaenkham et al. (2010) Haplorchoides sp. Australia-PO-2003 A Arius graeffei Kner & Australia AY222226 Olson et al. (2003) Steindachner Heterophyes heterophyes (Siebold, 1853) "Hes1" KU559560 Masala et al. (2016) Metagonimoides oregonensis Price, 1931 C Pleurocera proxima (Say) USA: North JQ995473 Belden et al. (2012) Carolina Metagonimus hakubaensis Shimazu, 1999 "MH1" A Lethenteron reissneri Japan KM061388 Pornruseetairatn et al. (Dybowski) (2016) M. katsuradai Isumi, 1935 "MK2" A Tanakia limbata (Temminck & Japan KM061392 Pornruseetairatn et al. Schlegel) (2016) M. miyatai Saito, Chai, Kim, Lee & Rim, 1997 "Mm1" A Plecoglossus altivelis Japan: Miyakoda HQ832633 Pornruseetairatn et al. (Temminck & Schlegel) River (2016) M. oregonensis Price, by Ingles (1935) C P. proxima USA: North JQ995473 Belden et al. (2012) Carolina Metagonimus otsurui Saito & Hori, 1962 "MO1" Rhinogobius flumineus (Mizuno) Japan KM061394 Pornruseetairatn et al. (2016) M. otsurui Saito & Hori, 1962 "MO3" A R. flumineus Japan KM061396 Pornruseetairatn et al. (2016) M. suifunensis Shumenko, Tatonova & A Russia: Komarovka KX387460 Pornruseetairatn et al. Besprozvannykh, 2017 (2016) M. takahashii Suzuki in Takahashi, 1929 "Mt1" Carassius auratus langsdorfii Japan: Kiso River HQ832636 Pornruseetairatn et al. Temminck & Schlegel (2016) M. yokogawai (Katsurada, 1912) "My3" A P. altivelis Japan: Tenryu HQ832641 Pornruseetairatn et al. River, Sakuma (2016) Town Procerovum cheni Hsu, 1950 A Anabas testudineus (Bloch) Thailand HM004193 Thaenkham et al. (2010) P. cheni Hsu, 1950 A A. testudineus Thailand HM004193 Thaenkham et al. (2010) Procerovum varium Onji & Nishio, 1916 A Anabas testudineus (Bloch) Thailand HM004182 Thaenkham et al. (2010) P. varium Onji & Nishio, 1916 A A. testudineus Thailand HM004184 Thaenkham et al. (2010)

202

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Phocitrema fusiforme Goto & Ozaki, 1930 A Callorhinus ursinus (L.) USA: Alaska, St. MG806921 Kuzmina et al. (2018) Paul Island Stellantchasmus falcatus Onji & Nishio, 1916 A H. sapiens Viet Nam HM004174 Thaenkham et al. (2010) Labicolidae Blair, 1979 Labicola cf. elongata Blair, 1979 A D. dugong Australia AY222221 Olson et al. (2003) Lepidapedidae Yamaguti, 1958 Bulbocirrus aulostomi Yamaguti, 1965 "QM G 213545" Aulostomus chinensis (L.) Australia: Heron FJ788470 Bray et al. (1999) Island, Great Barrier Reef Intusatrium robustum Durio & Manter, 1968 "BMNH:2006.8.23.2126" Bodianus perditio (Quoy & New Caledonia FJ788481 Bray et al. (2009) Gaimard) Lepidapedon arlenae Bray & Gibson, 1995 "RRS Challenger Trachyrincus sacbrus AJ405262 Bray et al. (1999) 10.viii.1992" (Rafinesque) L. arlenae "RRS Challenger T. sacbrus AJ405262 Bray et al. (1999) 10.viii.1992" L. arlenae "RRS Challenger D. labiosum AJ405262 Bray et al. (1999) 10.viii.1992" L. beveridgei Campbell & Bray, 1993 "RRS Challenger 9- Coryphaenoides (Nematonurus) AJ405263 Bray et al. (1999) 10.viii.1997" armatus (Hector) L. desclersae Bray & Gibson, 1995 "RRS Challenger Mora moro (Risso) AJ405264 Bray et al. (1999) 14.viii.1997" L. discoveryi Bray & Gibson, 1995 "RRS Challenger 9.viii.1997" C. (Nematonurus) armatus AJ405265 Bray et al. (1999) L. elongatum (Lebour, 1908) "RV Scotia 22.v.1990" Gadus morhua L. AJ405266 Bray et al. (1999) L. rachion (Cobbold, 1858) "RV Scotia 6.vi.1993" G. morhua AJ405260 Bray et al. (1999) L. rachion Melanogrammus aeglefinus (L.) New Caledonia AJ405261 Bray et al. (1999) L. sommervillae Bray & Gibson, 1995 "RRS Challenger 7.viii.1992" Coryphaenoides guentheri AJ405268 Bray et al. (1999) (Vaillant) L. zubchenkoi Campbell & Bray, 1993 "RRS Challenger 5- Coryphaenoides (Chalinura) AJ405269 Bray et al. (1999) 6.viii.1992 leptolepis Günther Myzoxenus insolens (Crowcroft, 1945) Notolabrus tetricu (Richardson) Australia: Tasmania FJ788486 Bray et al. (2009)

203

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Neolepidapedon smithi Bray & Gibson, 1989 "RRS Challenger M. moro AJ405270 Bray et al. (1999) 14.viii.1997" Postlepidapedon uberis Bray, Cribb & Barker, Choerodon venustus (De Vis) Australia: Heron FJ788492 Bray et al. (2009) 1997 Island, Great Barrier Reef Profundivermis intercalarius Bray & Gibson, "RRS Challenger 9- C. (Nematonurus) arnatus AJ405271 Bray et al. (1999) 1991 10.viii.1997" (Hector) Lepocreadiidae Odhner, 1905 Clavogalea trachinoti (Fischthal & Thomas, Trachinotus coppingeri Günther Australia: Heron FJ788471 Bray et al. (2009) 1968) Island, Great Barrier Reef Diplocreadium tsontso Bray, Cribb & Barker, Balistoides conspicillum (Bloch Australia: Heron FJ788472 Bray et al. (2009) 1996 & Schneider) Island, Great Barrier Reef D. tsontso Bray, Cribb & Barker, 1996 B. conspicillum Australia: Heron FJ788472 Bray et al. (2009) Island, Great Barrier Reef Diploproctodaeum momoaafata Bray, Cribb & Ostracion cubicus L. Australia: Heron FJ788474 Bray et al. (2009) Barker, 1996 Island, Great Barrier Reef" D. momoaafata Bray, Cribb & Barker, 1996 O. cubicus Australia: Heron FJ788474 Bray et al. (2009) Island, Great Barrier Reef Diploproctodaeum sp. DTJL-2009 Arothron stellatus (Anonymous) Australia: Lizard FJ788473 Bray et al. (2009) Island, Great Barrier Reef Echeneidocoelium indicum Simha & Pershad, Echeneis naucrates L. Australia: Heron FJ788475 Bray et al. (2009) 1964 Island, Great Barrier Reef E. indicum Simha & Pershad, 1964 E. naucrates Australia: Swain FJ788475 Bray et al. (2009) Reefs, Great Barrier Reef" Hypocreadium cf. patellare DTJL-2009 "BMNH:2009.2.12.3135" Balistoides viridescens (Bloch & Australia: Lizard FJ788478 Bray et al. (2009) 204

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Schneider) Island, Great Barrier Reef Hypocreadium sp. 'lacking anterior notch' "BMNH:2009.2.12.1719" Rhinecanthus aculeatus (L.) Australia: Lizard FJ788479 Bray et al. (2009) Island, Great Barrier Reef H. toombo Bray & Justine, 2006 Pseudobalistes fuscus (Bloch & "New Caledonia FJ788480 Bray et al. (2009) Schneider) Lepidapedoides angustus Bray, Cribb & Barker, E. cyanopodus Australia: Heron FJ788482 Bray et al. (2009) 1996 Island, Great Barrier Reef Lepocreadiidae gen. sp. 3 CG-2013 "L3SJ" A Scomber japonicus Houttuyn Argentina: Playa KF451937 Cremonte et al. (2013) Fracasso Lepocreadium album (Stossich, 1890) C Tritia reticulata (L.) Portugal: Aveiro KF656704 Cremonte et al. (2013) stuary L. pegorchis (Stossich, 1889) A S. aurata Algeria: off Ge846 Present study Bouzedjar Lepotrema clavatum Ozaki, 1932 Acanthochromis polyacanthus Australia: Lizard FJ788483 Bray et al. (2009) (Bleeker) Island, Great Barrier Reef Lobatocreadium exiguum (Manter, 1963) "BMNH:2006.8.23.710" P. fuscus New Caledonia" FJ788484 Bray et al. (2009) Multitestis magnacetabulum Mamaev, 1970 Platax teira (Forsskål) Australia: Heron FJ788485 Bray et al. (2009) Island, Great Barrier Reef Neohypocreadium dorsoporum Machida & Chaetodon flavirostris Australia: Heron FJ788487 Bray et al. (2009) Uchida, 1987 Island, Great Barrier Reef N. dorsoporum Chaetodon flavirostris Günther Australia: Heron FJ788487 Bray et al. (2009) Island, Great Barrier Reef Neomultitestis aspidogastriformis Bray & P. teira Australia: Heron FJ788489 Bray et al. (2009) Cribb, 2003 Island, Great Barrier Reef Neopreptetos arusettae Machida, 1982 P. sexstriatus Australia: Ningaloo FJ788490 Bray et al. (2009) 205

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Opechona kahawai Bray & Cribb, 2003 "BMNH:2003.7.23.34-35" Arripis trutta (Forster) Australia: Tasmania FJ788491 Bray et al. (2009) Opecoeloides fimbriatus (Linton, 1934) A Micropogonias undulatus (L.) USA: Texas- KJ001211 Andres et al. (2014a) Louisiana Shelf O. furcatus (Bremser in Rudolphi, 1819) A Mullus surmuletus L. ‘‘Near Corsica’’ AF151937 Tkach et al. (2000) Pelopscreadium spongiosum (Bray & Cribb, O. cubicus Australia: Lizard FJ788469 Bray et al. (2009) 1998) Island, Great Barrier Reef Preptetos caballeroi Pritchard, 1960 A N. vlamingii Australia AY222236 Olson et al. (2003) P. caballeroi Pritchard, 1960 A N. vlamingii Off Heron Island, AY222236 Olson et al. (2003) GBR P. trulla (Linton, 1907) A Ocyurus chrysurus (Bloch) Jamaica AY222237 Olson et al. (2003) P. trulla "2 DNA-1270" Lutjanus campechanus (Poey) USA KU527433 Curran (2016) Prodistomum keyam Bray & Cribb, 1996 Monodactylus argenteus (L.) Australia: FJ788493 Bray et al. (2009) Stradbroke Island P. priedei Bray & Merrett, 1998 "RRS Challenger Epigonus telescopus (Risso) AJ405272 Bray et al. (1999) 14.vii.1997" P. priedei "RRS Challenger E. telescopus AJ405272 Bray et al. (1999) 14.vii.1997" Mesometridae Poche, 1926 Mesometra sp. France-PO-2003 A S. salpa France AY222216 Olson et al. (2003) Microscaphidiidae Looss, 1900 Neohexangitrema zebrasomatis Machida, A Zebrastoma scopas (Cuvier) Australia AY222214 Olson et al. (2003) 1984 Monorchiidae Odhner, 1911 Monorchis lewisi Cribb, Wee, Bray & Cutmore, "THC17250" Acanthopagrus australis Australia: Moreton MF503309 Cribb et al. (2017) 2017 (Günther) Bay, Queensland Lissorchis kritskyi Christopher Barnhar & A Carpiodes cyprinus (Rafinesque) USA AY222250 Olson et al. (2003) Powel, 1979 Ancylocoelium typicum Nicoll, 1912 A Trachurus trachurus (L.) United Kingdom AY222254 Olson et al. (2003)

206

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Cableia pudica Bray, Cribb & Barker, 1996 A Cantherines pardalis (Rüppell) Australia AY222251 Olson et al. (2003) Diplomonorchis leiostomi Hopkins, 1941 A L. xanthurus USA AY222252 Olson et al. (2003) Helicometroides longicollis Yamaguti, 1934 D. labiosum Australia KJ658287 Searle et al. (2014) H. longicollis D. labiosum Australia KJ658287 Searle et al. (2014) Lasiotocus arrhichostoma Searle, Cutmore & D. labiosum Australia KJ658289 Searle et al. (2014) Cribb, 2014 L. lizae Liu, 2002 "Mon14-5" LN831724 Atopki et al. (2017) Monorchis lewisi Cribb, Wee, Bray & Cutmore, "THC16258" Australia: Moreton MF503313 Cribb et al. (2017) 2017 Bay, Queensland M. monorchis (Stossich, 1890) D. vulgaris Near Corsica AF184257 Tkach et al. (1999) M. monorchis "Mon14-1" M. cephalus LN831720 Atopki et al. (2017) M. monorchis "Mon14-1" D. Vulgaris Near Corsica AF184257 Tkach et al. (1999) M. parvus Looss, 1902 A D.vulgaris Algeria: off Algiers Ge830 Present study Ovipusillus mayu Dove & Cribb, 1998 "THC17075" Australia: Moreton MF503314 Cribb et al. (2017) Bay, Queensland Proctotrema addisoni Searle, Cutmore & Cribb, D. labiosum Australia KJ658291 Searle et al. (2014) 2014 Provitellus turrum Dove & Cribb, 1998 Pseudocaranx dentex (Bloch & Australia AY222253 Olson et al. (2003) Schneider) P. turrum P. dentex Australia AY222253 Olson et al. (2003) Multicalycidae Odhner, 1911 Multicalyx elegans (Olsson, 1869) A C. millii Australia AY222163 Olson et al. (2003) Microscaphidiidae Looss, 1900 Hexangium sp. Australia-PO-2003 A Siganus fuscescens (Houttuyn) Australia AY222215 Olson et al. (2003) Notocotylidae Luehe, 1909 Notocotylus sp. UK-PO-2003 S Stagnicola palustris (O. F. United Kingdom AY222219 Olson et al. (2003) Müller)

207

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Catatropis indicus Srivastava, 1935 A Cairina moschata (L.) Australia AY222220 Olson et al. (2003) Opecoelidae Ozaki, 1925 Allopodocotyle epinepheli (Yamaguti, 1942) A E. cyanopodus Off New Caledonia KU320598 Bray et al. (2016) A. margolisi Gibson, 1995 A Coryphaenoides mediterraneus Rockall Trough KU320596 Bray et al. (2016) (Giglioli) Allopodocotyle sp. A A Scolopsis bilineata (Bloch) Off New Caledonia KU320599 Bray et al. (2016) Allopodocotyle sp. B A Epinephelus coioides (Hamilton) Indonesia:off Bali KU320607 Bray et al. (2016) Allopodocotyle sp. Bali B97 "CcXII2" E. coioides Indonesia: Bali KU320607 Bray et al. (2017) Anomalotrema koiae Gibson & Bray, 1984 A Sebastes viviparus Krøyer Islands: off the KU320595 Bray et al. (2016) Shetland Bathycreadium brayi Pérez-del-Olmo, Dallarés, Carrassón & A Trachyrincus scabrus off Spain: JN085948 Constenla et al. (2011) Kostadinova, 2014 (Rafinesque) Mediterranean Bentholebouria blatta (Bray & Justine, 2009) A Pristipomoides argyrogrammicus Off New Caledonia KU320606 Bray et al. (2016) (Valenciennes) B. colubrosa Andres, Pulis & Overstreet, 2014 A Pristipomoides aquilonaris Off USA: West KJ001207 Andres et al. (2014a) (Goode & Bean) Florida Shelf Biospeedotrema biospeedoi Bray, Waeschenbach, Dyal, Littlewood A Thermichthys hollisi (Cohen, Pacific Ocean: KF733986 Bray et al. (2014) & Morand, 2014 Rosenblatt & Moser) South East Pacific Rise, hydrothermal vent site Hobbs B. jolliveti Bray, Waeschenbach, Dyal, A Ventichthys biospeedoi Nielsen, Pacific Ocean: KF733985 Bray et al. (2014) Littlewood & Morand, 2014 Møller & Segonzac South East Pacific Rise, hydrothermal vent site Oasis B. jolliveti Bray, Waeschenbach, Dyal, "HVA" V. biospeedoi Pacific Ocean: KF733988 Bray et al. (2014) Littlewood & Morand, 2015 South East Pacific Rise, hydrothermal vent site Oasis Buticulotrema thermichthysi Bray, Waeschenbach, Dyal, Littlewood A T. hollisi Pacific Ocean: KF733984 Bray et al. (2014) & Morand, 2014 South East Pacific Rise, hydrothermal 208

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) vent site Hobbs B. thermichthysi Bray, Waeschenbach, Dyal, "HVB" T. hollisi Pacific Ocean: KF733987 Bray et al. (2014) Littlewood & Morand, 2014 South East Pacific Rise, hydrothermal vent site Hobbs Cainocreadium labracis (Dujardin, 1845) A Steromphala adansonii Spain: Lagoon Els JQ694144 Born-Torrijos et al. (Payraudeau) Alfacs (Ebro Delta) (2012) C. lintoni (Siddiqi & Cable, 1960) A Epinephelus morio USA: off the Virgin KJ001208 Andres et al. (2014a) (Valenciennes) Islands, St. Thomas Dimerosaccus oncorhynchi (Eguchi, 1931) A Salvelinus curilus (Pallas) Russia: Kedrovaya FR870262 Shedko et al. (2015) River, Primorsky Territory Gaevskajatrema halosauropsi Bray & A Halosauropsis macrochir Off United AY222207 Olson et al. (2003) Campbell, 1996 (Günther) Kingdom: Goban Spur, NE Atlantic Ocean G. perezi (Mathias, 1926) A ‘‘?fish’’ ‘‘near Corsica’’ AF184255 Tkach et al. (2001) Hamacreadium cribbi Bray & Justine, 2016 A Lethrinus miniatus (Forster) Off New Caledonia KU320603 Bray et al. (2016) H. mutabile Linton, 1910 A Lutjanus griseus (L.) Off USA: West KJ001209 Andres et al. (2014a) Florida Shelf H. mutabile Linton, 1910 "MNHN:JNC2531" Lutjanus fulviflamma (Forsskål) New Caledonia KU320588 Bray et al. (2016) Hamacreadium sp. A L. fulviflamma Off New Caledonia KU320601 Bray et al. (2016) Hamacreadium sp. MNHN JNC2161 L. miniatus New Caledonia KU320603 Bray et al. (2016) Hamacreadium sp. MNHN JNC2161 "MNHN:JNC2161" L. miniatus New Caledonia KU320590 Bray et al. (2016) Helicometra boseli Nagaty, 1956 A Sargocentron spiniferum Off New Caledonia KU320600 Bray et al. (2016) (Forsskål) Helicometra boseli Nagaty, 1957 "MNHN:JNC2530" S. spiniferum New Caledonia KU320587 Bray et al. (2016) H. epinepheli Yamaguti, 1934 A Epinephelus fasciatus (Forsskål) Off New Caledonia KU320597 Bray et al. (2016) H. fasciata (Rudolphi, 1819) "MNHN:JNC1658A" E. fasciatus New Caledonia KU320597 Bray et al. (2016)

209

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) H. fasciata (Rudolphi, 1819) "MNHN:JNC1658A" E. fasciatus New Caledonia KU320584 Bray et al. (2016) H. manteri Andres, Ray, Pulis, Curran & Prionotus alatus Goode & Bean Off USA: West KJ701238 Andres et al. (2014b) Overstreet, 2014 Florida Shelf H. manteri Andres, Ray, Pulis, Curran & Bellator egretta (Goode & Bean, USA: West Florida KJ701239 Andres et al. (2014b) Overstreet, 2015 1896) Shelf M. bartolii Antar, Georgieva, Gargouri & A Diplodus annularis (L.) Tunisia: Bay of KR149464 Antar et al. (2015) Kostadinova, 2015 Bizerte M. crassigula (Linton, 1910) (s. str.) Calamus bajonado (Bloch & Off USA: West KJ701237 Andres et al. (2014b) Schneider) Florida Shelf M. crassigula (Linton, 1910) (s. str.) "DVMC1" A D. vulgaris Algeria: off MF166846 Rima et al. (2017) Bouzedjar M. dubia (Stossich, 1905) Oblada melanura (L.) Tunisia: Bay of KR149469 Antar et al. (2015) Bizerte M. dubia (Stossich, 1905) "OM2" A O. melanura Tunisia: Bay of KR149470 Antar et al. (2015) Bizerte Macvicaria gibsoni Rima, Marzoug, Pérez-del- "DVMG1" A D. vulgaris Algeria: off MF166842 Rima et al. (2017) Olmo, Kostadinova, Bouderbala & Georgieva, Bouzedjar 2017 M. maamouriae Antar, Georgieva, Gargouri & A S. aurata Tunisia: Bizerte KR149467 Antar et al. (2015) Kostadinova, 2015 Lagoon M. macassarensis (Yamaguti, 1952) A L. miniatus Island:off Heron AY222208 Olson et al. (2003) GBR M. magellanica Laskowski, Jezewski & A Patagonotothen longipes Off Antarctica KU212191 Hildebrand et al. (2016) Zdzitowiecki, 2013 (Steindachner) M. mormyri (Stossich, 1885) A ‘‘?fish’’ Near Corsica AF184256 Tkach et al. (2001) M. mormyri (Stossich, 1885) "SAMMo1" A S. aurata Algeria: off MF166849 Rima et al. (2017) Bouzedjar M. obovata (Molin, 1859) C S. adansonii Spain: Ebro Delta JQ694146 Born-Torrijos et al. (2012) Maculifer sp. A Diodon holocanthus L. Island: off Heron, AY222211 Olson et al. (2003) GBR Multicalyx elegans (Olsson, 1869) A Callorhinchus milli Bory de Australia AY222163 Olson et al. (2003) Saint-Vincent 210

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Neolebouria lanceolata (Price, 1934) A Polymixia lowei Günther Off USA: Gulf of KJ001210 Andres et al. (2014a) Mexico Neoplagioporus ayu (Takahashi, 1928) A P. altivelis Japan: Okayama KX553947 Fayton & Andres (2016) N. elongatus (Goto & Ozaki, 1930) A Sarcocheilichthys variegatus Japan: Shiga KX553948 Fayton & Andres (2016) microoculus Mori, Prefecture N. zacconis (Yamaguti, 1934) A Opsariichthys evolans (Jordan & Japan: Kyoto KX553949 Fayton & Andres (2016) Evermann) Prefecture Opistholebes amplicoelus Nicoll, 1915 A Tetractenos hamiltoni Off Australia: AY222210 Olson et al. (2003) (Richardson) Moreton Bay Pacificreadium serrani (Nagaty & Abdel-Aal, P. leopardus Off New Caledonia KU320602 Bray et al. (2016) 1962) P. serrani (Nagaty & Abdel-Aal, 1962) "MNHN:JNC3060A" P. leopardus Off New Caledonia KU320589 Bray et al. (2016) Paropecoelus corneliae Rohner & Cribb, 2013 "2" Parupeneus indicus (Shaw) Australia: Great KC357692 Rohner & Cribb. (2013) Barrier Reef P. elongatus (Ozaki, 1928) "2" P. indicus Australia: Great KC357696 Rohner & Cribb. (2013) Barrier Reef P. leonae Rohner & Cribb, 2013 "2" Parupeneus multifasciatus (Quoy Australia: Great KC357694 Rohner & Cribb. (2013) & Gaimard) Barrier Reef P. sogandaresi Pritchard, 1966 "2" P. indicus Australia: Great KC357698 Rohner & Cribb. (2013) Barrier Reef Pedunculacetabulum inopinipugnus Martin, Plectorhinchus chrysotaenia Australia: off MF805700 Martin et al. (2017) Cutmore & Cribb, 2017 (Bleeker) Lizard Island, Queensland Peracreadium idoneum (Nicoll, 1909) A A. lupus Off United AY222209 Olson et al. (2003) Kingdom: North Sea Plagiocirrus loboides Curran, Overstreet & A Fundulus nottii (Agassiz) USA: Upper EF523477 Curran et al. (2007) Tkach, 2007 Pascagoula River Wildlife Management Area, George County, Mississippi

211

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) P. boleosomi (Pearse, 1924) A Percina maculate (Girard) USA: Wisconsin KX553953 Fayton & Andres. (2016) P. chiliticorum (Barger & Esch, 1999) A Notropis chiliticus (Cope) USA: North KX553943 Fayton & Andres. (2016) Carolina P. hageli Fayton & Andres, 2016 A Oncorhynchus mykiss USA: California KX553950 Fayton & Andres. (2016) (Walbaum) P. kolipinskii Tracey, Choudhury, Cheng & A Gasterosteus aculeatus L. USA: California KX553952 Fayton & Andres. (2016) Ghosh, 2009 P. shawi (McIntosh, 1939) A Oncorhynchus tshawytscha USA: Oregon KX553951 Fayton & Andres. (2016) (Walbaum) P. sinitsini Mueller, 1934 A Notemigonus crysoleucas Canada: Montreal KX553944 Fayton & Andres. (2016) (Mitchill) Podocotyloides australis Martin, Cutmore & Diagramma picta (Thunberg) Australia: off MF805696 Martin et al. (2017) Cribb, 2017 Dunwich, North Stradbroke Island, Queensland P. brevis Andres & Overstreet, 2013 A Conger esculentus Poey Off USA: Puerto KJ001212 Andres et al. (2014a) Rico, Mona Passage P. gracilis (Yamaguti, 1932) D. picta Australia: off MF805693 Martin et al. (2017) Lizard Island, Queensland P. parupenei (Manter, 1963) "3" P. indicus Australia: Great KC357701 Rohner & Cribb. (2013) Barrier Reef P. parupenei Mulloidichthys vanicolensis Australia: off MF926409 Martin et al. (2017) (Valenciennes) Lizard Island, Queensland P. stenometra (Manter, 1963) Heniochus chrysostomus Cuvier French Polynesia: MF926406 Martin et al. (2017) off Mo'orea Propycnadenoides philippinensis Fischthal & A Gymnocranius grandoculis Off New Caledonia KU320604 Bray et al. (2016) Kuntz, 1964 (Valenciennes) P. engeleri Rohner & Cribb, 2013 "2" P. indicus Australia: Great KC357703 Rohner & Cribb. (2013) Barrier Reef Pseudopecoeloides sp. 1 CAR-2013 "1" P. multifasciatus "Australia: Great KC357704 Rohner et Cribb. (2013) Barrier Ree 212

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) P. tenuis Yamaguti, 1940 A Priacanthus hamrur (Forsskål) Off New Caledonia KU320605 Bray et al. (2016) Pseudopycnadena fischthali Saad-Fares & "DVPF" A D. vulgaris Algeria: off MF166851 Rima et al. (2017) Maillard, 1986 Bouzedjar Pseudopycnadena tendu Bray & Justine, 2007 A P. fuscus Off New Caledonia FJ788506 Bray et al. (2016) P. tendu "BMNH:2006.11.16.1-6" P. fuscus New Caledonia FJ788506 Bray et al. (2009) Trilobovarium parvvatis Martin, Cutmore & A Lethrinus nebulosus (Forsskål) Off Lizard Island, KY551562 Martin et al. (2017) Cribb, 2017 GBR Urorchis acheilognathi Yamaguti, 1934 A T. limbata Japan: Shiga KX553945 Fayton & Andres (2016) Prefecture U. goro Ozaki, 1927 A Rhinogobius sp. Japan: Nagano KX553946 Fayton & Andres (2016) Prefecture Opisthorchiidae Looss, 1899 Clonorchis sinensis Looss, 1907 A H. sapiens Viet Nam" JF823989 Thaenkham et al. (2011) Opisthorchis viverrini (Poirier, 1886) "THA-SK" H. sapiens Thailand JF823990 Thaenkham et al. (2011) O. viverrini (Poirier, 1886) A M. auratus Thailand HM004188 Thaenkham et al. (2011) Orchipedidae Skrjabin, 1924 Orchipedum tracheicola Braun, 1901 A Cygnus olor (Gmelin) United Kingdom: AY222258 Olson et al. (2003) Scotland Opisthotrematidae Poche, 1926 Lankatrema mannarense Crusz & Fernand, A D. dugong Australia AY222222 Olson et al. (2003) 1954 Opisthotrema dujonis (Leuckart, 1874) A D. dugong Australia AY222223 Olson et al. (2003) Pachypsolidae Yamaguti, 1958 Pachypsolus irroratus (Rudolphi, 1819) A Lepidochelys olivacea Mexico AY222274 Olson et al. (2003) (Eschscholtz) Paramphistomidae Fischoeder, 1901 Indosolenorchis hirudinaceus Crusz, 1951 A Dugong dugong (Müller) Australia AY222213 Olson et al. (2003) Philophthalmidae Looss, 1899

213

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Philopthalmid sp. Australia-PO-2003 R Batillaria australis (Quoy & Australia AY222247 Olson et al. (2003) Gaimard) Cloacitrema narrabeenensis (Howell & Bearup, R B. australis Australia AY222248 Olson et al. (2003) 1967) Plagiorchiidae Looss, 1899 Skrjabinoeces similis (Looss, 1899) A Rana ridibunda Pallas Bulgaria AY222279 Olson et al. (2003) Glypthelmins quieta (Stafford, 1900) A Rana catesbeiana Shaw USA AY222278 Olson et al. (2003) Mesocoelium sp. Australia-PO-2003 A Bufo marinus L. Australia AY222277 Olson et al. (2003) Cephalogonimus retusus (Dujardin, 1845) A Rana ridibunda Pallas, 1771 Bulgaria AY222276 Olson et al. (2003) Rubenstrema exasperatum (Rudolphi, 1819) A Crocidura leucodon (Hermann) Bulgaria AY222275 Olson et al. (2003) Rhabdiopoeidae Poche, 1926 Taprobanella bicaudata Crusz & Fernand, 1954 A D. dugong Australia AY222217 Olson et al. (2003) Rhabdiopoeus taylori Johnston, 1913 A D. dugong Australia AY222218 Olson et al. (2003) Rugogastridae Schell, 1973 Rugogaster hydrolagi Schell, 1973 A Callorhinchus milii Bory de Australia AY157176 Lockyer et al. (2003) Saint-Vincent Schistosomatoidea Stiles & Hassall, 1898 Brachyclaimidae Joyeux & Foley, 1930 Brachylaima sp. Australia-PO-2003 A Mus musculus L. Australia AY222167 Olson et al. (2003) Zeylanurotrema spearei Cribb and Barton, 2005 A Bufo marinus (L.) Australia AY222170 Olson et al. (2003) Spirorchiidae Stunkard, 1921 Spirorchis scripta Stunkard, 1923 A Trachemys scripta scripta USA AY222174 Olson et al. (2003) (Schoepff) Sanguinicolidae von Graff, 1907 Sanguinicola cf. inermis A Lymnaea stagnalis (L.) Poland AY222180 Olson et al. (2003) Aporocotylidae Odhner, 1912

214

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Aporocotyle spinosicanalis Williams, 1958 A Merluccius merluccius (L.) United Kingdom AY222177 Olson et al. (2003) Neoparacardicola nasonis Yamaguti, 1970 A Naso unicornis (Forsskål) Australia AY222179 Olson et al. (2003) Plethorchis acanthusMartin, 1975 Mugil cephalus L. AY222178 Olson et al. (2003) Strigeidae Raillet, 1919 Apatemon gracilis (Rudolphi, 1819) "AGTAK10" Radix balthica (L.) Norway: Lake KY513176 Soldánová et al. (2017) Takvatn Apatemon sp. AK-2017 "ASPTAK1" G. aculeatus Norway: Lake KY513178 Soldánová et al. (2017) Takvatn Apatemon sp. 'jamiesoni' "ApaPpu" Phalacrocorax punctatus New Zealand KT334169 Blasco-Costa et al. (2015) Sparrman Apharyngostrigea cornu (Zeder, 1800) Ardea cinerea L. AF184264 Tkach et al. (1999) A. cornu (Zeder, 1800) A. cinerea AF184264 Tkach et al. (1999) A. cornu AF184264 Tkach et al. (1999) A. cornu "DNA1006" Nyctanassa violacea (L.) JX977840 Hernández-Mena et al. (2017) A. cornu "568" Nycticorax nycticorax (L.) Mexico: El MF398345 Hernández-Mena et al. Huizache, Sinaloa (2017) A. pipientis (Faust, 1918) N. nycticorax USA JF820597 Pulis et al. (2011) Australapatemon burti (Miller, 1923) "138" Anas diazi Ridgway Mexico: MF398342 Hernández-Mena et al. Chicnahuapan, (2017) Estado de Mexico A. niewiadomski Blasco-Costa, Poulin & "AusApl4" A Anas platyrhynchos L. New Zealand KT334165 Blasco-Costa et al. (2015) Presswell, 2015 Australapatemon sp. S.IN.Oxj.DWR9.1.2 Canada: Manitoba, MF124269 Gordy et al. (2017) Lake Manitoba, South Shore, Delta Marsh Cardiocephaloides longicollis (Rudolphi, 1819) A Larus ridibundus L. Ukraine AY222171 Olson et al. (2003) C. longicollis S. aurata Algeria: off Annaba Ge838 Present study

215

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) C. medioconiger (Dubois & Perez-Vigueras, "DNA594" Larus sp. JX977843 Hernández-Mena et al. 1949) (2017) Cardiocephaloides sp. DIHM-2017 "181" Larus occidentalis Audubon Mexico: Guerrero MF398341 Hernández-Mena et al. Negro, Baja (2017) California Sur Cotylurus cornutus (Rudolphi, 1808) "CCTAK6" Gyraulus acronicus (Férussac) Norway: Lake KY513181 Soldánová et al. (2017) Takvatn C. gallinulae Lutz, 1928 "DNA596" Aythya affinis (Eyton) JX977841 Hernández-Mena et al. (2017) Ichthyocotylurus erraticus (Rudolphi 1809) A Coregonus autumnalis (Pallas) United Kingdom: AY222172 Olson et al. (2003) Northern Ireland Ichthyocotylurus sp. NR-2016 KX034049 Moema et al. (2016) Ichthyocotylurus sp. NR-2016 KX034049 Moema et al. (2016) Nematostrigea serpens (Nitzsch, 1819) "D92" Pandion haliaetus (L.) KF434762 Lebedeva et al. (2013) Leucochloridium perturbatum Pojmanska, 1969 A Turdus merula L. Czech Republic AY222169 Olson et al. (2003) Parastrigea cincta Brandes, 1888 "706" Eudocimus albus (L.) Mexico: MF398347 Hernández-Mena et al. Caimanero, Sinaloa (2017) P. diovadena Dubois & Macko, 1972 "852" E. albus Mexico: Pijijiapan, MF398348 Hernandez-Mena et al. Chiapas (2017) P. plataleae Hernández-Mena, García-Prieto & "635" Platalea ajaja (L.) Mexico: El MF398346 Hernandez-Mena et al. García-Varela, 2014 Huizache, Sinaloa (2017) P. plataleae "DNA1041" P. ajaja JX977836 Hernández-Mena et al. (2017) Strigea sp. DIHM-2017 "79" Caracara cheriway (Jacquin) Mexico: Presa La MF398343 Hernandez-Mena et al. Angostura, Chiapas (2017) Strigeidae gen. SL sp. 9 SAL-201 "A.SB.S.S.15.2" Lepomis gibbosus (L.) Canada: Quebec, St. HM064972 Locke et al. (2010) Lawrence River, Lake Saint Pierre, Iles aux Sables Strigeidae sp. HR-2017 "OMNZ:IV85648 A Peltorhamphus novaezeelandiae Thibaut Anglade KY909264 Anglade et al. (2017) " Günther Strigeidae sp. TI-2013 "NARAmonk4M" M Turdus naumanni Temminck Japan:Yamagata, LC011455 Sato et al. (2014) 216

Supplementary Table S3

Species Isolate Life- Host Locality GenBank Reference cycle accession stage number (28S) Tsuruoka City Urogonimus macrostomus (Rudolphi, 1803) A Anas platyrhynchus L. Ukraine AY222168 Olson et al. (2003) Tandanicolidae Johnston, 1927 Prosogonarium angelae Cribb & Bray, 1994 A Euristhus lepturus (Günther) Australia AY222285 Olson et al. (2003) Transversotrematoidea Witenberg, 1944 Transversotrema haasi Witenberg, 1944 A Caesio cuning (Bloch) Australia AY222186 Olson et al. (2003) Crusziella formosa Cribb, Bray & Barker, 1992 A Crenimugil crenilabis (Forsskål) Australia AY222185 Olson et al. (2003) Prototransversotrema steeri Angel, 1969 A Acanthopagrus Australia AY222184 Olson et al. (2003) australis(Günther) Troglotrematidae Odhner, 1914 Nanophyetus salmincola (Chapin, 1926) "OK42" A Callorhinus ursinus L. USA: Alaska, St. MG806919 Kuzmina et al. (2018) Paul Island Paragonimidae Dollfus, 1939 Paragonimus pseudoheterotremus Waikagul, M Larnaudia larnaudii (Milne- Thailand HM004189 Thaenkham et al. (2010) 2007 Edwards) Zoogonidae Odner, 1902 Deretrema nahaense Yamaguti, 1942 A Thalassoma lunare (L.) Australia AY222273 Olson et al. (2003) Diphterostomum brusinae (Stossich, 1889) A D. vulgaris Algeria: off Algiers Ge831 Present study Diphtherostomum sp. A Scolopsis monogramma (Cuvier) Australia AY222272 Olson et al. (2003) Lepidophyllum steenstrupi Odhner, 1902 A A. lupus United Kingdom: AY157175 Lockyer et al. (2003) North Sea Proctophantastes gillissi (Overstreet & "D319" A Muraenolepis marmorata Ross Sea, KU163453 Sokolov et al. (2016) Pritchard, 1977) Günther Antarctica Zoogonoides viviparus (Olsson, 1868) A Callionymus lyra L. United Kingdom AY222271 Olson et al. (2003) Abbreviations: A, adult; C, cercaria; M, metacercaria

217