Genetic Evaluation of the Self-Sustaining Status of a Population of the Endangered Danube Salmon, Hucho Hucho
Total Page：16
File Type：pdf, Size：1020Kb
Hydrobiologia DOI 10.1007/s10750-016-2726-6 PRIMARY RESEARCH PAPER Genetic evaluation of the self-sustaining status of a population of the endangered Danube salmon, Hucho hucho S. Weiss . T. Schenekar Received: 6 October 2015 / Revised: 1 March 2016 / Accepted: 2 March 2016 Ó The Author(s) 2016. This article is published with open access at Springerlink.com Abstract A new multiplex microsatellite protocol Keywords Huchen Á Microsatellites Á Stocking Á was developed for population screening of the endan- Parentage analysis Á IUCN Á European habitat directive gered Danube salmon (or huchen) Hucho hucho. Allelic variation was screened at five newly cloned and four previously published loci in 246 samples to help evaluate the self-sustaining status of an urban Introduction population of huchen in the framework of a contro- versial environmental assessment in the Mur River, The endangered Danube salmon Hucho hucho (Lin- Austria. The loci revealed 78 alleles (mean = 8.6), naeus, 1758), or huchen as commonly known in and in the Mur River an average expected heterozy- Central Europe, is among the largest salmonid fishes in gosity of 0.668. We inferred that the huchen popula- the world. Endemic to the Danube basin, huchen have tion in and around the city of Graz is self-sustaining lost, according to Holcˇ´ık(1990), two-thirds of its based on the following evidence, which includes both global distribution and up to 90% of its original habitat genetic and non-genetic sources of information: (1) in particular regions, such as Austria (Schmutz et al., there is little to no current stocking; (2) presence of 2002). The species is endangered following IUCN juvenile huchen in multiple year classes; (3) sighting criteria (Freyhof & Kottelat, 2008) and listed under of spawning events; (4) documentation of 14 spawning Annexes II and V of the European Habitat Directive, redds; (5) no deviation from Hardy–Weinberg equi- as well as Appendix III of the Bern Convention. These librium; and (6) limited number of recaptures or listings oblige EU member states to certain responsi- parental matches with presumed parent fish of stock- bilities concerning the protection and rehabilitation of ing operations. We discuss the potential application of huchen within their natural range. While a number of such an analysis in evaluating threatened huchen factors such as overfishing and various forms of river populations throughout their native distribution. channel engineering have been responsible for histor- ical losses of the species, ongoing hydropower expansion is the most extensive current threat to remaining populations (Ihut et al., 2014; Freyhof et al., Handling editor: M. Power 2015). Several genetic studies have addressed the phylogenetic position and phylogeographic structure & S. Weiss ( ) Á T. Schenekar of the species throughout its native range (Weiss et al., Institute of Zoology, University of Graz, Universita¨tsplatz 2, 8010 Graz, Austria 2011; Maric´ et al., 2014a), but population studies have e-mail: [email protected] been limited to those of Geist et al. (2009) and Maric´ 123 Hydrobiologia et al. (2014b). While a few microsatellite markers were framework of a controversial hydropower develop- applied in these studies, there has yet to be an efficient ment project in the Mur River, in Graz Austria. The multiplex protocol published to support population Mur River harbors the largest self-sustaining popula- genetic typing in a conservation context, and no study tion of huchen in Austria, primarily in its upper has thus far attempted to evaluate the self-sustaining reaches, but fragmented populations or sub-popula- status of a population that received stocked hatchery tions also exist at least as far downstream as Graz, the material. Like many other salmonid fishes, some second largest city in the country. Local energy populations of huchen are managed, and especially in authorities claim that no huchen reproduction takes Central Europe, hatchery-reared individuals are rou- place in Graz, and thus, no self-sustaining population tinely stocked into flowing waters with the goal of exists in and around the city. enhancing or rehabilitating natural stocks. Annex II of the European Habitat Directive (1992) clearly states that only ‘‘natural populations’’ of huchen warrant Methods protection at the state level under this directive. This clause is similar or identical in meaning to the Genetic markers definition (or limitation) that only ‘‘wild populations’’ are considered for red list nomination by the IUCN red We cloned new tetranucleotide microsatellite loci list criteria (IUCN 2012). Both documents explicitly using a selective hybridization approach (Karagyozov state that individuals released from captivity are not et al., 1993) and streptavidin-coated magnetic beads considered, but neither document implies or states that (Kandpal et al., 1994; Kijas et al., 1994; Paetkau, the existence of released individuals in any way 1999). This approach was improved by Diniz et al. degrades the conservation status of a population. (2007) and McPherson et al. (2001), and finally our Clearly, the concept of a wild or natural population is protocol followed the double-hybridization method as limited to the understanding that the population can outlined in Winkler & Weiss (2008), including all sustain itself, and is within the natural range of its details of adaptor and probe design. distribution. Thus, where species are managed by Approximately 1600 positive clones were screened, supplemental stocking, the issue of whether or not this 20% of which had the appropriate size and were thus population is ‘‘natural’’ or ‘‘wild’’ under the definition sequenced on an ABI 3130xl Genetic Analyzer (Life of existing legislation will become increasingly rele- Technologies). From these, 58 sequences revealed vant as the exploitation of rivers for various economic enough flanking space for primer design. Of 58 loci interests continues to increase. Evaluating self-sus- tested, only five loci revealed clear and polymorphic tainability can involve a number of approaches (across multiple individuals) electropherograms and including the identification of viable spawning areas, no evidence of duplication. To expand the number of documentation of an age-structured population includ- loci, we tested an additional 19 published primer pairs ing young-of-the-year individuals, and enumeration of from huchen or other salmonids and subsequently the relative contribution of stocked versus wild added four of these loci to our protocol: HLJZ023 recruitment. This latter issue is complex, as documen- (Tong et al., 2006), OMM1064 (Froufe et al., 2005), tation of surviving hatchery individuals, or even an TAR101 (Diggs & Ardren, 2008), and ONE2 (Scrib- accurate estimate of the relative contribution of ner et al., 1996). Table 1 summarizes the loci motifs, hatchery individuals does not necessarily clarify what annealing temperatures, and allelic ranges of all loci the population would look like if no stocking were used in this study. Six loci (GATA501, GACA448, taking place. In this study, we aim to evaluate the self- GACA142, GACA559, HLZ023 & OMM1064) were sustaining status of a huchen population in and around combined into one multiplex reaction, TAR101 & an urban area using population genetic analyses ONE2 into a duplex reaction, and the remaining locus, together with field observations and sampling data. because a differing annealing temperature was ampli- To support this goal, we cloned new highly fied singularly; all reactions were carried out with the polymorphic microsatellite loci and developed an Type-It Microsatellite PCR Kit (Qiagen) following the efficient multiplex protocol for typing huchen, and manufacturer’s instructions. The dye-labeled PCR evaluated the effectiveness of this protocol in the products (1 ll) were dried at 60°C for 30 min and 123 Hydrobiologia Table 1 Microsatellite loci used for genotyping Hucho hucho 0 0 Locus Target species Primer Sequence (5 -3 ) Motif Ta (°C) NA Allele size range (bp) GATA501 Hucho hucho F: HEX-TGACCCCTCACAGGCAAAG (GACA)6 57 2 155–159 R: GTACTNTATTGTGATTCTGCGAATGCC GACA448 Hucho hucho F: HEX-GAACTGGTCTACTGAGGAGGTG (GACA)17(CA)8 57 15 187–259 R: GACGTATTCAACTTTTCCAAACCCT GACA142 Hucho hucho F: HEX-GACGTATTCAACTTTTCCAAACCCT (GATT)10 60 3 275–287 R: CTCCGTTCACCGCTATCAG GACA559 Hucho hucho F: FAM-TGTTTTGTTTGGACCAGTCAAGTAACG (TS)54 60 8 206–226 R: AAGTCTGAATACTCAATAATCAATTGCAGG HLJZ023 Hucho taimen F: FAM-CAAGAGGCTCCGCAGGTT (ACA)50 57 5 262–283 R: CTGGCAGTTTGCTCAGAT OMM1064 Oncorhynchus mykiss F: NED-AGAATGCTACTGGTGGCTGTATTGTGA (ACAG)x(ACAG)2 57 17 147–231 (ACAAAC)(ACAG)x R: TCTGAAAGACAGGTGGATGGTTCC GATA31 Hucho hucho F: FAM-ACAGTGCATCCCTAGCCATC (GATA)18 54 13 216–336 R: GACCAGGACCCATAGGGAAT TAR101 Thymallus arcticus F: HEX-CAGAGCACACCAAGCAGAG (CTTT)22 57 5 218–238 R: AGGGCAAGTCATTCCAGTC ONE2 Oncorhynchus nerka F: FAM-GGTGCCAAGGTTCAGTTTATGTT (GA)12 57 10 209–239 R: CAGGAATTTACAGGACCCAGGTT For each locus, we list the target species, primer sequence, repeat motif, annealing temperature, number of alleles found all Austrian individuals (NA), and allele size range. A ‘‘pig-tail’’ of GTTCTT or GTTT was attached to the 50-end of the reverse primer, and CAGTCGGGCGTCATCA was attached to the 50-end of the forward primers based on the method of Schuelke (2000) 123 Hydrobiologia resuspended in 10 ll Hi-DiTM Formamide with reach of the Mur River. Graz vicinity North, stretched 0.25 ll GeneScanTM 500 ROXTM Size Standard (Life from the northern city limits approximately