DOCSLIB.ORG

11130715.Pdf (2.095Mb)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
11130715.Pdf (2.095Mb) PROGRAMA FONDECYT INFORME FINAL ETAPA 2016 COMISIÓN NACIONAL DE INVESTIGACION CIENTÍFICA Y TECNOLÓGICA VERSION OFICIAL Nº 2 FECHA: 31/10/2017 Nº PROYECTO : 11130715 DURACIÓN : 4 años AÑO ETAPA : 2016 TÍTULO PROYECTO : EPIGEAN AND HYPOGEOUS PEST CONTROL IN GRASSLAND OF SOUTHERN CHILE, USING CULTIVARS OF LOLIUM PERENNE CARRIERS OF ENDOPHYTE FUNGUS DISCIPLINA PRINCIPAL : ENTOMOLOGIA AGRICOLA GRUPO DE ESTUDIO : AGRONOMIA INVESTIGADOR(A) RESPONSABLE : LEONARDO JAVIER BARDEHLE PARRA DIRECCIÓN : COMUNA : CIUDAD : TEMUCO REGIÓN : IX REGION FONDO NACIONAL DE DESARROLLO CIENTIFICO Y TECNOLOGICO (FONDECYT) Moneda 1375, Santiago de Chile - casilla 297-V, Santiago 21 Telefono: 2435 4350 FAX 2365 4435 Email: [email protected] INFORME FINAL PROYECTO FONDECYT INICIACION OBJETIVOS Cumplimiento de los Objetivos planteados en la etapa final, o pendientes de cumplir. Recuerde que en esta sección debe referirse a objetivos desarrollados, NO listar actividades desarrolladas. Nº OBJETIVOS CUMPLIMIENTO FUNDAMENTO 1 Objetivo específico 1: To determine the incidence TOTAL Objetivo cumplido en su totalidad y el cual dio of L. bonariensis in L. perenne grasslands of origen a una publicación científica (Parra et al. different aged and phenological stages in different 2017) agroecological zones of regions de La Araucanía, Los Ríos and Los Lagos. 2 Objetivo específico 2: To select endophyte strains TOTAL En este objetivo se logró determinar al menos dos present in cultivars introduced and collected líneas experimentales portadoras de endófitos con populations of L. perenne that present a high actividad antialimentarias contra plagas epigeas e bioinsecticide activity on L. bonariensis, H. hipogeas (Anexo 1-Informe de Resultados) elegans, P. herrmanni and D. pallens, under laboratory conditions. 3 Objetivo específico 3: To determine the TOTAL Este objetivo se encuentra totalmente cumplido controlling effect of the selected cultivars of L. debido a que se han podido determinar al menos perenne with endophyte fungus on the root dos líneas experimentales que presentan hongo feeding larval instars of hypogeous pest such as endófito que produce alcaloides y que tendría un H. elegans, P. herrmanni and D. pallens, under efecto antialimentario contra las plagas field conditions. mencionadas. 4 Objetivo específico 4: To determine the PARCIAL Este objetivo se encuentra parcialmente controlling effect of the selected cultivars of L. cumplido. Se logró determinar preliminarmente perenne with endophyte fungus on both larvae un efecto sobre adultos de L. bonariensis en and adults of the epigean insect L. bonariensis, donde algunas líneas experimentales evidencian under field conditions. bajas poblaciones de este insecto comparadas con un control libre de endófito. Los problemas por lo cual no se pudo cumplir totalmente este objetivo son: 1) falta una nueva temporada (dic-2017-enero-2018) para tener datos más robustos en cuanto a adultos. Con respecto a la evaluación de larvas de L. bonariensis, esta debió ser realizada entre septiembre y octubre, sin embargo, las condiciones climáticas en la Región de La Araucanía (lluvias y bajas temperaturas) han retrasado el ciclo biológico de la primera generación de este insecto. Los muestreos no han permitido recolectar larvas ni tampoco huevos. Otro(s) aspecto(s) que Ud. considere importante(s) en la evaluación del cumplimiento de objetivos planteados en la propuesta original o en las modificaciones autorizadas por los Consejos. Ver Anexo N°7 RESULTADOS OBTENIDOS: Para cada uno de los objetivos específicos, describa o resuma los resultados. Relacione las publicaciones y /o manuscritos enviados a publicación con los objetivos específicos. En la sección Anexos incluya información adicional que considere pertinente para efectos de la evaluación. La extensión máxima de esta sección es de 5 páginas (letra tamaño 10, Arial o Verdana). RESULTADOS OBJETIVO ESPECÍFICO 1: To determine the incidence of L. bonariensis in L. perenne grasslands of different aged and phenological stages in different agroecological zones of regions de La Araucanía, Los Ríos and Los Lagos. Luego de 4 años de evaluación se puede concluir que el insecto Listronotus bonariensis se encuentra en forma activa en las praderas de ballica del sur de Chile. Según los resultados obtenidos, las regiones de La Araucanía y Los Lagos presentan un alto índice de ataque (29,2 individuos/m2) producirían un 30% de daño a estas praderas. Una disminución en la efectividad de las cepas de hongo endófitos existentes en los cultivares comerciales sería una de las causas de esta intensidad de ataque. Por lo tanto, se infiere que el potencial para la producción de forraje podría ser afectado negativamente debido a que L. bonariensis permanece presente y dañando las pasturas de ballica del sur de Chile (Fig. 1) (ver más antecedentes en: Parra et al. (2017); Informes de Avances Etapa I, II y III). Figura 1. Listronotus bonariensis (Coleoptera: Curculionidae). A) Huevo del insecto. B) Daño de la larva. C) Daño en hojas por adultos. D) Pradera de ballica atacada por el gorgojo argentino del tallo de las ballicas. En Tabla se muestran los niveles de endófitos determinados en ballica según localidad evaluada. RESULTADOS OBJETIVO ESPECÍFICO 2: To select endophyte strains present in cultivars introduced and collected populations of L. perenne that present a high bioinsecticide activity on L. bonariensis, H. elegans, P. herrmanni and D. pallens, under laboratory conditions. Secuenciación de cepas de hongos endófitos en ballica. Durante las etapas II y III se informó sobre la aislación y caracterización de 4 cepas de hongos endófitos aisladas desde semillas de ballica (Fig. 2). En dichos informes se detectó la presencia del ADN genómico en las muestras N°1,2, 5 y 7 de cepas candidatos a pertenecer al género Neotyphodium (Fig. 2D). Además se pudo demostrar que estas cepas presentan un gen para la expresión del alcaloide peramina, responsable de la actividad antialimentaria contra insectos plaga (Fig. 2E,F). Figura 2. Secuencia de obtención de cepas de hongos endófitos, aislamiento y aislación y caracterización de las cepas. A) Ensayo con semillas de ballicas en medio nutritivo. B) Detección de hongos endófitos en plántulas de ballicas crecidas en medio nutritivo. C) Aislación de cepas de hongos endófitos. D) Presencia de ADN genómico de las muestras 1, 2, 5 y 7 de hongos candidatos a Neotyphodium spp. E y F) Amplificación de los genes de alcaloides usando ADN genómico visualizadas por una electroforesis en gel de agarosa de PCR. Secuenciación de las cepas 1, 2, 5 y 7. Se realizó un análisis de similitud y alineamiento de las secuencias utilizando BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) para verificar la procedencia de las muestras (Ekanayake et al. 2014), entregando los siguientes resultados: Muestra 1: KRC6533A_2_R1 Secuencia: GAATGCGGTATTCGAGAACTGTAGCTGACCTGTTTCTTTCCCTCTTTTCCCCTCTAGGTTCATCTTCAAACCGGTCAGTGCGTAAGTGACAAATTCGCCGACCTCGA ACGACAGGCACAAACAGCATGAAAAACTCACATTCATTTGGGCAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGC AATGGTGTGTACAATGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGTGTCTACTTCAA Definicion: Neotyphodium sp. Organismo: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Hypocreomycetidae; Hypocreales; Clavicipitaceae; Neotyphodium Muestra 2: KRC6533A_1_R3 Secuencia: ATTCGAGAACTGTAGCTGACCTGTTTCTTTCCCTCTTTTCCCCTCTAGGTTCATCTTCAAACCGGTCAGTGCGTAAGTGACAAATTCGCCGACCTCGAACGACAGG CACAAACAGCATGAAAAACTCACATTCATTTGGGCAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGT GTACAATGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGTGTCTACTTCAA Definición: Neotyphodium sp. Organismo: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Hypocreomycetidae; Hypocreales; Clavicipitaceae; Neotyphodium. Muestra 3: KRC6533T1 Secuencia: GAAAACTGGTAAGCTGACCTGTTTCTTTCCCTCTTTTCCCCTCTAGGTTCATCTTCAAACCGGTCAGTGCGTAAGTGACAAATTCGCCGACCTCGAACGACAGGCA CAAACAGCATGAAAAACTCACATTCATTTGGGCAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTGT ACAATGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGTGTCTACTTCAAA Definicion: Neotyphodium sp. Organismo: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Hypocreomycetidae; Hypocreales; Clavicipitaceae; Neotyphodium. Muestra 4: KRC666040A Secuencia: ATAGGAATGCGGTATTCGAGAACTGTAGCTGACCTGTTTCTTTCCCTCTTTTCCCCTCTAGGTTCATCTTCAAACCGGTCAGTGCGTAAGTGACAAATTCGCCGACC TCGAACGACAGGCACAAACAGCATGAAAAACTCACATTCATTTGGGCAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGA CAGCAATGGTGTGTACAATGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGTTCCTACTTCAAA Definicion: Neotyphodium sp. Organismo: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Hypocreomycetidae; Hypocreales; Clavicipitaceae; Neotyphodium. Estos resultados confirman que las semillas enviadas desde Nueva Zelanda tienen simbiosis con hongos del género Neotyphodium, lo cual se corrobora con las caracteristicas morfologicas de las cepas (Informe de Avance II). Esto permite inferir que los efectos antialimentarios determinados en los bioensayos con L. bonariensis, C. rudis, D. pallens, H. elegans y P. herrmanni se deben a alcaloides producidos por este hongo. Análisis bromatológicos. Los resultados de los análisis bromatológicos son mostrados en Tabla 1. Tabla 1. Análisis bromatológico a diferentes cultivares y líneas experimentales de ballica (n=3). Energía Proteína Cruda Digestibilidad Código Materia Seca (%) metabolizable Cenizas (%) (%) (%) (Mcal/kg) KRC6533A 96,6 15,3 85,9 2,76 10,9 KRC6533T 96,5 16,3 85,5 2,74 11,5 KRC6533L 96,6 16,4 85,8
Load more

Recommended publications
  • Evaluating Grassland Wildlife Exposure to Soybean Aphid Insecticides on Public Lands in Minnesota
    EVALUATING GRASSLAND WILDLIFE EXPOSURE TO SOYBEAN APHID INSECTICIDES ON PUBLIC LANDS IN MINNESOTA Katelin Goebel1 and Nicole M. Davros SUMMARY OF FINDINGS Increasing evidence suggests that pesticides may be an important factor explaining declines in grassland-dependent wildlife in agricultural landscapes. Minnesota Department of Natural Resource (MNDNR) wildlife managers and members of the public have reported concerns about foliar-application insecticides in particular. Such insecticides are used on a variety of crops but their use has been especially important for controlling soybean aphid outbreaks in Minnesota. Concerns have been raised about the impacts of chlorpyrifos, a broad-spectrum organophosphate, and other foliar-application insecticides on water quality and human health, prompting the Minnesota Department of Agriculture (MDA) to release guidelines for voluntary best management practices for their use. Although lab studies have shown chlorpyrifos and other insecticides used to target aphids are highly toxic to non-target organisms, including economically important game species and pollinators, few studies have investigated the environmentally-relevant exposure of free-ranging wildlife to these chemicals. Our objective was to assess the direct and indirect exposure of grassland wildlife to the 3 most common soybean aphid insecticides (i.e., chlorpyrifos, lambda-cyhalothrin, and bifenthrin) along a gradient from soybean field edge to grassland interior. During summer 2017 and 2018, we sampled 5 treatment and 4 control sites across western and southern Minnesota. We detected chlorpyrifos at all distances examined (0-400 m) at both treatment and control sites, suggesting that some background level of chlorpyrifos exposure is occurring in the environment regardless of landowner activities in the adjacent row crop field.
    [Show full text]
  • SELECTION of Entomopathogenic Nematodes Against Dalaca Pallens (Lepidoptera: Hepialidae)
    RESEARCH SELECTION OF EntoMOPathoGENIC NEMatoDES AGAINST DALACA PALLENS (LEPIDOPTERA: HEPIALIDAE) Alexis Maldonado1, Loreto Merino1, and Andrés France1* Dalaca pallens (Blanchard) is a pest with great impact on grassland production in Chile. The objective of this research was to evaluate the use of entomopathogenic nematodes (EPN) against D. pallens larvae. Twenty EPN isolates, collected along Chile, were used for nematode selection. The experimental unit consisted of five 50-mL plastic vials filled withNothofagus dombeyi sawdust and inoculated with 40 dauers per vial. The experimental design was a completely randomized with four replicates per treatment. The results showed that isolate QU N3 (Steinernema australe) and QU N13 (Steinernema unicornum) produced the highest mortality, with 100 and 95% respectively and no differences (P < 0.001) between both. Later, these two isolates were used to calculate the lethal concentration (LC50 and LC90). Concentrations of 0, 10, 20, 30, 40, and 50 dauers per 50-mL plastic vials filled withNothofagus sawdust were evaluated. Then, a single larva of D. pallens was added to each vial and incubated for 13 d. The results showed that LC50 and LC90 were equivalent to 14 and 39 dauers mL-1 for isolate QU N3, while for isolate QUN13 these figures were 14 and 48 dauers mL-1. Consequently, there are native isolates of EPN with the ability to control D. pallens larvae, which require future test under field conditions. Key words: Biological control, Steinernema australe, Steinernema unicornium, lethal concentration. alaca pallens (Blanchard) (Lepidoptera: bacteria, belonging to the genus Xenorhabdus and Hepialidae) is an economically important pest, Photorhabdus, respectively (Emelianoff et al., 2007).
    [Show full text]
  • Entomopathogenic Nematology in Latin America: a Brief History, Current Re- Search and Future Prospects
    Accepted Manuscript Entomopathogenic nematology in Latin America: A brief history, current re- search and future prospects Ernesto San-Blas, Raquel Campos-Herrera, Claudia Dolinski, Caio Monteiro, Vanessa Andaló, Luis Garrigós Leite, Mayra G. Rodríguez, Patricia Morales- Montero, Adriana Sáenz-Aponte, Carolina Cedano, Juan Carlos López-Nuñez, Eleodoro Del Valle, Marcelo Doucet, Paola Lax, Patricia D. Navarro, Francisco Báez, Pablo Llumiquinga, Jaime Ruiz-Vega, Abby Guerra-Moreno, S. Patricia Stock PII: S0022-2011(18)30180-0 DOI: https://doi.org/10.1016/j.jip.2019.03.010 Reference: YJIPA 7192 To appear in: Journal of Invertebrate Pathology Received Date: 31 May 2018 Revised Date: 31 December 2018 Accepted Date: 29 March 2019 Please cite this article as: San-Blas, E., Campos-Herrera, R., Dolinski, C., Monteiro, C., Andaló, V., Garrigós Leite, L., Rodríguez, M.G., Morales-Montero, P., Sáenz-Aponte, A., Cedano, C., Carlos López-Nuñez, J., Del Valle, E., Doucet, M., Lax, P., Navarro, P.D., Báez, F., Llumiquinga, P., Ruiz-Vega, J., Guerra-Moreno, A., Patricia Stock, S., Entomopathogenic nematology in Latin America: A brief history, current research and future prospects, Journal of Invertebrate Pathology (2019), doi: https://doi.org/10.1016/j.jip.2019.03.010 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
    [Show full text]
  • INSECT DIVERSITY and PEST STATUS on SWITCHGRASS GROWN for BIOFUEL in SOUTH CAROLINA Claudia Holguin Clemson University, [email protected]
    Clemson University TigerPrints All Theses Theses 8-2010 INSECT DIVERSITY AND PEST STATUS ON SWITCHGRASS GROWN FOR BIOFUEL IN SOUTH CAROLINA Claudia Holguin Clemson University, [email protected] Follow this and additional works at: https://tigerprints.clemson.edu/all_theses Part of the Entomology Commons Recommended Citation Holguin, Claudia, "INSECT DIVERSITY AND PEST STATUS ON SWITCHGRASS GROWN FOR BIOFUEL IN SOUTH CAROLINA" (2010). All Theses. 960. https://tigerprints.clemson.edu/all_theses/960 This Thesis is brought to you for free and open access by the Theses at TigerPrints. It has been accepted for inclusion in All Theses by an authorized administrator of TigerPrints. For more information, please contact [email protected]. INSECT DIVERSITY AND PEST STATUS ON SWITCHGRASS GROWN FOR BIOFUEL IN SOUTH CAROLINA A Thesis Presented to the Graduate School of Clemson University In Partial Fulfillment of the Requirements for the Degree Master of Science Entomology by Claudia Maria Holguin August 2010 Accepted by: Dr. Francis Reay-Jones, Committee Chair Dr. Peter Adler Dr. Juang-Horng 'JC' Chong Dr. Jim Frederick ABSTRACT Switchgrass (Panicum virgatum L.) has tremendous potential as a biomass and stock crop for cellulosic ethanol production or combustion as a solid fuel. The first goal of this study was to assess diversity of insects in a perennial switchgrass crop in South Carolina. A three-year study was conducted to sample insects using pitfall traps and sweep nets at the Pee Dee Research and Education Center in Florence, SC, from 2007- 2009. Collected specimens were identified to family and classified by trophic groups, and predominant species were identified.
    [Show full text]
  • Insecticide Drift and Impacts on Arthropod Prey Resources of Birds in Public Grasslands in Minnesota
    Insecticide drift and impacts on arthropod prey resources of birds in public grasslands in Minnesota A THESIS SUBMITTED TO THE FACULTY OF THE UNIVERSITY OF MINNESOTA BY Katelin Mary Goebel IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE David E. Andersen February 2021 © Katelin Mary Goebel 2021 Acknowledgments Funding for this project was provided by the Minnesota Environment and Natural Resources Trust Fund as recommended by the Legislative-Citizen Commission on Minnesota Resources and the Minnesota Department of Natural Resources (MNDNR) Section of Wildlife through the Federal Aid in Wildlife Restoration (Pittman-Robertson) Act. This research was conducted through the Minnesota Cooperative Fish and Wildlife Research Unit (U.S. Geological Survey) housed at the University of Minnesota in partnership with MNDNR. I am deeply grateful to David Andersen and Nicole Davros for their guidance, advice, and support through the duration of this project. Your insight and teaching has helped me grow as a scientist and critical thinker. I thank Pamela Rice for her support in developing data collection methods and feedback that has been instrumental to my research. This project would not have been possible without cooperation from landowners, renters, agronomists, cooperative representatives, and pilots – I am grateful for their willingness to be in contact with me in the midst of busy growing seasons. Tonya Klinkner, Hattie Saloka, and Katie Steffl provided logistical support and I am thankful for their help. I am grateful to Sophie Crosby, Chuck Fortier, Greg Gehring, John Letlebo, Lindsey Welch, and Haley Witt for their dedication in collecting data in the field in all conditions.
    [Show full text]
  • Biología Y Control De Insectos Plagas En Praderas
    BIOLOGÍA Y CONTROL DE INSECTOS PLAGAS EN PRADERAS ERNESTO CISTERNAS A. 1. INTRODUCCIÓN Las praderas de la zona Sur de Chile, corresponden en su mayor proporción a praderas naturalizadas, que pretenden ser mejoradas a través de diferentes estrategias de manejo. Las plagas insectiles conforman un factor importante de considerar en el plan de manejo y mantención de la producción y calidad nutritiva de una pradera. Los insectos que actualmente se comportan como plagas, en su mayoría corresponden a especies autóctonas, siendo reducido el número de especies introducidas, las cuales de una forma u otra representan una limitante para el mejoramiento y persistencia de una pradera productiva. Las especies de insectos plaga autóctonas, conforman un complejo insectil variado, dinámico y poco predecible en general, ello a la luz de los antecedentes disponibles. Claro está que al modificar el ecosistema natural para transformarlo en un ecosistema de mayor productividad, se produce un desplazamiento y/o incorporación de diversos organismos vivos, los cuales al recibir beneficios alimenticios, nuevos hospederos, reducción de enemigos naturales, causan incrementos poblacionales de algunas de las especies que al producir daños y causar pérdidas de producción y/o calidad de los productos pasan a denominarse plagas. El problema de las plagas en praderas naturalizadas comienza a ser importante cuando el recurso forraje se incrementa en producción, calidad y distribución estacional, ya que es en ese momento, cuando comenzamos a valorar económicamente la producción y justificamos el uso de alguna estrategia de control. Los mayores problemas entomológicos de las praderas, lo constituyen las Cuncunillas Negras y los Gusanos Blancos sin dejar de lado las larvas de Tana, Curculiónidos, Gusanos Cortadores, Gusanos Alambre, Pirálidos, Típulas y ninfas y adultos de Sminthurus viridis , Therioaphis trifolli y Langostas.
    [Show full text]
  • Summaries of Wildlife Research Findings 2017
    This document is made available electronically by the Minnesota Legislative Reference Library as part of an ongoing digital archiving project. http://www.leg.state.mn.us/lrl/lrl.asp Summaries of Wildlife Research Findings 2017 Minnesota Department of Natural Resources Division of Fish and Wildlife Wildlife Populations and Research Unit SUMMARIES OF WILDLIFE RESEARCH FINDINGS 2017 Edited by: Lou Cornicelli Michelle Carstensen Michael A. Larson Nicole Davros Bruce Davis Minnesota Department of Natural Resources Division of Fish and Wildlife Wildlife Populations and Research Unit 500 Lafayette Road, Box 20 St. Paul, MN 55155-4020 (651) 259-5202 ©August 2019 State of Minnesota, Department of Natural Resources For more information contact: DNR Information Center 500 Lafayette Road St. Paul, MN 55155-4040 (651) 296-6157 (Metro Area) 1 888 MINNDNR (1-888-646-6367) TTY (651) 296-5484 (Metro Area) 1 800 657-3929 http://www.mndnr.gov This volume contains interim results of wildlife research projects. Some of the data and interpretations may change as a result of additional findings or future, more comprehensive analysis of the data. Authors should be contacted regarding use of any of their data. Printed in accordance with Minn. Stat. Sec. 84.03 Equal opportunity to participate in and benefit from programs of the Minnesota Department of Natural Resources is available to all individuals regardless of race, color, creed, religion, national origin, sex, marital status, status with regard to public assistance, age, sexual orientation, membership or activity in a local commission, or disability. Discrimination inquiries should be sent to MN DNR, 500 Lafayette Road, St.
    [Show full text]
  • EU Project Number 613678
    EU project number 613678 Strategies to develop effective, innovative and practical approaches to protect major European fruit crops from pests and pathogens Work package 1. Pathways of introduction of fruit pests and pathogens Deliverable 1.3. PART 4 - REPORT on VACCINIUM – Fruit pathway and Alert List Partners involved: EPPO (Grousset F, Petter F, Suffert M) and JKI (Steffen K, Wilstermann A, Schrader G). This document should be cited as ‘Grousset F, Wilstermann A, Steffen K, Petter F, Schrader G, Suffert M (2016) DROPSA Deliverable 1.3 Report for Vaccinium – Fruit pathway and Alert List’. An Excel file containing supporting information is available at https://upload.eppo.int/download/105o4c33e1452 DROPSA is funded by the European Union’s Seventh Framework Programme for research, technological development and demonstration (grant agreement no. 613678). www.dropsaproject.eu [email protected] DROPSA DELIVERABLE REPORT on VACCINIUM – Fruit pathway and Alert List 1. Introduction ............................................................................................................................................... 2 1.1 Background on Vaccinium ........................................................................................................................... 2 1.2 Data on production and trade of Vaccinium fruit ......................................................................................... 6 1.3 Characteristics of the pathway ‘Vaccinium fruit’ .........................................................................................
    [Show full text]
  • Investigating the Mechanisms Behind Moth Declines: Plants, Land-Use and Climate
    Investigating the Mechanisms Behind Moth Declines: Plants, Land-use and Climate Dan Blumgart August 2020 A thesis submitted to Lancaster University in fulfilment of the requirements for the degree of Doctor of Philosophy Project supervisors James Bell Rothamsted Insect Survey, Rothamsted Research Rosa Menendez Lancaster Environment Centre, Lancaster University Marc Botham Centre for Ecology and Hydrology 1 Declaration and funding statement I declare that the work presented in this thesis is my own and has not been submitted elsewhere for the award of a degree of Doctor of Philosophy. The illustrations at the beginning of each chapter are also my own work. This work was funded by the Natural Environment Research Council (NERC) through the Envision Doctoral Training Program awarded to Lancaster University and Rothamsted Research. Dan Blumgart 22nd August 2020 ii Acknowledgements Thanks go firstly to James Bell, Rosa Menendez and Marc Botham, my three supervisors. Thanks to James, for his encouragement and enthusiasm, and all the hours spent with me going through my work. Thank to Rosa for being so quick and thorough with corrections and feedback, and thanks to Marc for pushing me to think more deeply about the ways of moths. Thanks to everyone in the Rothamsted Insect Survey team, especially to Chris Shortall for answering my endless questions about the database and to Mike Hall for all the woodwork he did for me, as well as all the advice on everything DIY-related. Thanks to Butterfly Conservation for support and to the Centre for Ecology and Hydrology for hosting me several times and arranging my stay at Hillesden Farm.
    [Show full text]
  • Catalogue of the Latin American Hepialidae with Taxonomic Remarks (Lepidoptera)
    Nachr. entomol. Ver. Apollo, N. F. 32 (3/4): 131–158 (2012) 131 Catalogue of the Latin American Hepialidae with taxonomic remarks (Lepidoptera) Carlos G. C. Mielke and John R. Grehan Carlos G. C. Mielke, Caixa Postal 1206, 84 145-000, Carambeí, PR, Brazil; [email protected] Dr. John R. Grehan, Director of Science and Research, Buffalo Museum of Science, 1020, Humboldt Parkway, Buffalo, NY 14211-1193, USA; [email protected] Abstract: A catalogue of the Latin American (i.e., from Systematisches Verzeichnis der lateinamerikanischen Me xi co to the southern end of South America) Hepialidae is Hepialidae mit taxonomischen Anmerkungen (Lepido- pre sented. Taxonomic com ments, type localities, and de po- ptera) si ta ry museums are re cor ded. 125 species in 30 genera are Zusammenfassung: Es wird ein systematisches Verzeichnis re cog nized as valid. A checklist is provided at the end. der lateinamerikanischen (von Mexiko bis zur Südspitze The following are recognized as new synonyms: Aepytus Süd amerikas) Hepialidae (Lepidoptera) prä sen tiert. Ta xo- (Xy trops) Viette, 1951 syn. n. of Cibyra Walker, 1856; no mi sche Anmerkungen, Typenfundorte und Ty pen hin ter- La mel li formia Viette, 1951 syn. n. of Tricladia C. & R. Felder , le gungsstätten werden aufgeführt. 125 Arten in 30 Gat tun- 1874. Schaefferiana jeanneli Viette, 1950 syn. n. of Ae pytus gen werden als valide anerkannt (siehe Checkliste am Ende). guarani (Pfitzner, 1914); Aepytus helga Schaus, 1929 and Die Auf lis tun gen der neuen Synonyme, neuen und re vi- Cibyra poltrona Schaus, 1901 syn. n. of Cibyra do rita Schaus, dier ten Kom bi na tio nen sowie revidierten Status zu wei sun- 1901; Dalaca chiri quen sis Pfitzner, 1914 and Da la ca muysca gen siehe im Ab stract.
    [Show full text]
  • Evaluating Insecticide Exposure Risk for Grassland Wildlife on Public Lands
    EVALUATING INSECTICIDE EXPOSURE RISK FOR GRASSLAND WILDLIFE ON PUBLIC LANDS Nicole M. Davros and Katelin Goebel1 SUMMARY OF FINDINGS Increasing evidence suggests that acute toxicity to pesticides may be more important than agricultural intensity in explaining declines in grassland-dependent wildlife. Although neonicotinoids (systemic insecticides routinely used on corn and soybeans) are currently under scrutiny for their effects on birds and pollinators, other insecticides are commonly used in Minnesota’s farmland regions that may also have negative effects on non-target organisms. Minnesota Department of Natural Resource (MNDNR) wildlife managers and members of the public have reported concerns about foliar-application insecticides in particular. Such insecticides are used on a variety of crops but their use has been especially important for controlling soybean aphid outbreaks in Minnesota’s farmland regions. Concerns have previously been raised about the impacts of chlorpyrifos, a broad-spectrum organophosphate, and other foliar-application insecticides on water quality and human health, prompting the Minnesota Department of Agriculture (MDA) to release guidelines for voluntary best management practices for their use. Although lab studies have shown chlorpyrifos and other insecticides used to target aphids are highly toxic to non-target organisms, including economically important game species and pollinators, fewer studies have investigated the environmentally-relevant exposure risk of free-ranging wildlife to these chemicals. Our research project will assess the direct and indirect exposure risk of grassland wildlife to common soybean aphid insecticides along a gradient from soybean field edge to grassland interior. The data we obtain on the environmentally-relevant exposure risk of wildlife to these insecticides will be used to help natural resource managers and private landowners better design habitats set aside for grassland wildlife in Minnesota’s farmland region.
    [Show full text]
  • Patrones De Urbanización En La Biodiversidad De Humedales Urbanos En Concepción Metropolitano1
    Revista de Geografía Norte Grande, 61: 181-204 (2015)181 Artículos Patrones de urbanización en la biodiversidad de humedales urbanos en Concepción metropolitano1 Carolina Rojas2, Einer Sepúlveda-Zúñiga3, Olga Barbosa4, Octavio Rojas5 y Carolina Martínez6 RESUMEN La urbanización en Concepción metropolitano (36°S) en las últimas décadas ha impactado áreas de valor ecológico, tales como humedales y lagunas. Aquí anali- zamos la perturbación de parámetros de biodiversidad en seis humedales urbanos, mediante la exploración y uso de indicadores. Se proponen tres indicadores: na- turalidad y riqueza de macrolepidópteros y plantas, los que se evalúan mediante modelos de regresión múltiple. Los resultados indican que los humedales con menor grado de perturbación antrópica se encuentran ubicados dentro de una reserva protegida y rodeados de una matriz de paisaje seminatural; mientras que los más perturbados están más próximos a la urbanización. Además, la riqueza de macrolepidópteros se ve más afectada por la distancia a carreteras, en cambio la riqueza de plantas por la densidad de viviendas. Se genera una herramienta para la evaluación de efectos de la urbanización en humedales urbanos. Palabras clave: Humedales, Urbanización, Biodiversidad, Naturalidad ABSTRACT Urbanization of the Metropolitan region of Concepción (36°S) in the last decades has impacted on the ecological value of areas such as wetlands and lagoons. Here, we analyse the disturbance to biodiversity indicators in six urban wetlands. Three measures are proposed: a naturalness indicator and two Macrolepidoptera plant indicators of species richness. Multiple regression models were developed for the assessment of indicators. Results show that the wetlands with the lowest degree of human interference are located in a protected area and surrounded by a matrix of semi-natural landscapes, whereas the more disturbed wetlands are those closer to areas of urbanization.
    [Show full text]