Phylogenetic Patterns and Ecological Determinants of Adaptive Radiation

PHYLOGENETIC PATTERNS AND ECOLOGICAL DETERMINANTS OF ADAPTIVE RADIATION

A DISSERTATION

SUBMITTED TO THE DEPARTMENT OF BIOLOGICAL SCIENCES

AND THE COMMITTEE ON GRADUATE STUDIES

OF STANFORD UNIVERSITY

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS

FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

Matthew Leo Knope

March 2012

This work is licensed under a Creative Commons Attribution- Noncommercial 3.0 United States License. http://creativecommons.org/licenses/by-nc/3.0/us/

This dissertation is online at: http://purl.stanford.edu/pc001rm2983

ii I certify that I have read this dissertation and that, in my opinion, it is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy.

Tadashi Fukami, Primary Adviser

I certify that I have read this dissertation and that, in my opinion, it is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy.

Rodolfo Dirzo

I certify that I have read this dissertation and that, in my opinion, it is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy.

Elizabeth Hadly

I certify that I have read this dissertation and that, in my opinion, it is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy.

Ward Watt

Approved for the Stanford University Committee on Graduate Studies. Patricia J. Gumport, Vice Provost Graduate Education

This signature page was generated electronically upon submission of this dissertation in electronic format. An original signed hard copy of the signature page is on file in University Archives.

iii Abstract

It is well recognized that much of the biodiversity on Earth is the result of adaptive radiation, which is the process by which one biological lineage gives rise to many descendant lineages, all adapted to the various ecological roles they fill. However, it remains unclear why some lineages diversify greatly by adaptive radiation while others diversify little or not at all. The classic view is that “ecological opportunity” (where organisms find themselves in an area with abundant or under-utilized resources) allows the lineage to interact with the environment in novel ways and this promotes adaptive radiation. Here I utilize three taxonomically disparate systems (microbes, plants, and fishes) to examine patterns of diversification and identify possible ecological factors that promote or suppress adaptive radiation. In a laboratory experiment with bacteria and phage, I show that the prior evolutionary history of immigrants may determine their subsequent diversification dynamics after arrival to a new habitat. In another study, using molecular phylogenetics to investigate the rate of diversification of an adaptive radiation of flowering plants in Hawaii, I show that this radiation is among the most rapid yet studied in plants, on a per-unit-area basis, and suggest that the relative scale of habitable area available for the organisms under study is necessary to understand both the rate and the extent of diversification. Lastly, I utilize a radiation of marine fishes along the west coast of North America and show that morphological adaptations can facilitate habitat shifts leading to further evolutionary diversification not only in terrestrial and freshwater systems, but in marine systems as well, confirming the idea that general evolutionary principles apply across systems. One common theme that emerges from these studies is that the “ecological opportunity” hypothesis is supported, but that it may not fully explain diversification patterns. Overall, these studies suggest that explicit consideration of the prior evolution of immigrants, the relative scale of habitable area, and adaptive morphological shifts to novel habitats are necessary to fully understand patterns and drivers of adaptive radiation.

iv Acknowledgments

It has been said that it takes a village to raise a thesis, and while this is certainly true, in my case it has taken two villages and then some. I began my Ph.D. work at the University of Hawaii at Manoa in the fall of 2006 and transferred to Stanford University in the fall of 2008. Therefore, I may have at least double the typical number of people to thank for helping me through this journey.

First and foremost, I would like to express my deepest gratitude to my principal advisor, Tadashi Fukami, who has is in every way exceeded my expectations for what it means to be an academic mentor. Tad is exactly the kind of scientist and mentor that I hope to be one day; he is exceptionally hard-working, enthusiastic, and encouraging. In addition, there is something intangible in Tad’s character that makes him a joy to work with.

I have also been blessed by having a phenomenal Ph.D. committee. Liz Hadly, Rodolfo Dirzo, and Ward Watt define what it means to be excited about ecology and evolution. Their infectious enthusiasm, positive energy, and sharp analytical minds improved this thesis in innumerable ways. In addition, two of the best experiences of my time at Stanford were being a teaching assistant for Liz’s Evolutionary Paleobiology class and for Rodolfo’s Tropical Ecology and Conservation Biology class. They are both inspired and gifted educators dedicated to their craft and never satisfied with their lessons, no matter how refined. I am also very grateful to Jonathan Payne for serving as my outside committee member and for chairing my defense.

I would also like to extend a very warm mahalo to all of the members of the Fukami lab both at Stanford and at the University of Hawaii. Melinda Belisle, Ben Callahan, Marie-Pierre Gauthier, Whitney Hoehn, Yolanda Madrid, Holly Moeller, Mifuyu Nakajima, Colin Olito, Kabir Peay, and Rachel Vannette made everyday at work a better place to be and I learned an incredible amount from each and every one of them. I would also like to thank all of the extended members of the Fukami lab and all other friends and colleagues (many to numerous to list here) in the Departments of Zoology and Botany at the University of Hawaii and in the Department of Biology at Stanford, for

v their support and friendship. In addition, many people helped in a wide variety of ways to make each of the projects of this dissertation come to life and to avoid repeating myself, I acknowledge them individually at the end of the chapter that they contributed to.

In the Biology Student Services Office at Stanford, Monica Bernal, Dan King, Jennifer Mason, Matt Pinheiro, and Valerie Kiszka exemplify what it means to be helpful, friendly, and professional. It seems no question is too small to not demand their full attention. In the Zoology Department Office at the University of Hawaii, Lynne Ogata, Audrey Shintani, and Jan Tatsuguchi truly made me feel like a part of their ‘ohana. I would also like to acknowledge both the chair of the Department of Zoology at the University of Hawaii, Sheila Conant, and the chair of the Department of Biology at Stanford University, Bob Simoni, for their generous support.

During my first two years at the University of Hawaii, I had the best fellowship I could have possibly imagined. As an NSF GK-12 teaching fellow, I had the opportunity to work one day every week bringing ecology and evolution to the middle-school students at Assets School in Honolulu. These students work with a wide variety of learning challenges and I am positive that these students taught me far more than I ever taught them. I also had the priveldge to work with a number of truly gifted teachers at Assets that have dedicated their lives to service and make the world a better place everyday. Likewise, my GK-12 mentors, Erin Baumgartner and Kanesa Duncan, taught me a tremendous amount about how to teach science effectively.

I am also blessed to have a family that is always incredibly supportive of all of my interests. I am forever grateful to my parents, Jeff Knope and Teri Katahara, for their continual encouragement and interest in the things that I find fascinating. Absolutely none of this work would have been possible without their hard work and many sacrifices on my behalf. I am also very fortunate to have the support and encouragement of my sister, Carrie Riley, my brother-in-law Shawn Riley, my nephew Sheamus Riley, and my niece Sophia Riley.

Last, but certainly not least, I am a man blessed in love. Shama Hinard has not only been supportive of my dissertation work, she has been an integral part of it. From

vi suspending me upside-down off a cliff on northern Molokai (and not dropping me) to collect a leaf tissue sample from an endangered species of Hawaiian Bidens, to reading my manuscripts and giving me insightful feedback, to putting up with too many evenings spent suffering through bad practice talks, I have run my tab high and am forever in her debt.

vii Table of Contents

Chapter 1. General introduction...... 1 General introduction...... 2 Analytical approaches ...... 3 Overview of results...... 4 Author contributions...... 6 References cited...... 7

Chapter 2. Evolutionary history, immigration history, and the extent of diversification in community assembly...... 8 Abstract...... 9 Introduction ...... 10 Materials and methods...... 11 Results and discussion...... 15 Conclusions ...... 18 Acknowledgments ...... 18 References cited...... 19

Chapter 3. Area and the rapid radiation of Hawaiian Bidens (Asteraceae) ...... 29 Abstract...... 30 Introduction ...... 32 Materials and methods...... 34 Results ...... 38 Discussion...... 39 Conclusions ...... 46 Acknowledgments ...... 47 References cited...... 47 Supporting material ...... 60

Chapter 4. Adaptive morphological shifts to novel habitats in marine sculpin fishes (Teleostei: Cottidae) ...... 72 Abstract...... 73 Introduction ...... 74 Materials and Methods ...... 76 Results ...... 79 Discussion...... 80 Conclusions ...... 84 Acknowledgments ...... 84 References cited...... 84

Chapter 5. Phylogeny and biogeography of marine sculpins (Teleostei: Cottidae) of the North American Pacific Coast...... 95 Abstract...... 96 Introduction ...... 97 Materials and Methods ...... 98 Results ...... 103 Discussion...... 105 Summary...... 115 Acknowledgments ...... 116 References cited...... 117

Vita...... 129

viii List of Tables

Chapter 2. Evolutionary history, immigration history, and the extent of diversification in community assembly 1. ANOVA results for focal genotypes introduced before standard competitor ...... 23 2. ANOVA results for focal genotypes introduced after standard competitor ...... 23 3. ANOVA results for focal genotypes introduced alone...... 23 4. ANOVA results for difference between early and late arrival of focal genotypes ...... 23 5. ANOVA results for total descended from both focal and competitor genotypes...... 24

Chapter 3. Area and the rapid radiation of Hawaiian Bidens (Asteraceae) 1. Rates of diversification for most rapid plant radiations yet studied...... 56 2. Taxa sampled and molecular markers ...... 61

Chapter 4. Adaptive morphological shifts to novel habitats in marine sculpin fishes (Teleostei: Cottidae) 1. Species mean standard lengths and number of scales ...... 93 2. Model selection criteria for standard lengths ...... 94 3. Model selection criteria for scales...... 94 4. Parameter estimates for best-fit model to actual data for standard lengths...... 94 5. Parameter estimates for best-fit model to actual data for scales ...... 94

Chapter 5. Phylogeny and biogeography of marine sculpins (Teleostei: Cottidae) of the North American Pacific Coast 1. Taxa sampled and collection numbers ...... 123 2. Loci used and primer sequences...... 126 3. Initial model parameters for maximum likelihood and Bayesian analyses...... 126 4. Summary of maximum parsimony analyses...... 126

ix List of Figures

Chapter 2. Evolutionary history, immigration history, and the extent of diversification in community assembly 1. Effects of prior evolutionary history and immigration history on diversification...... 25 2. Comparison of diversification of focal genotypes immigrating early and late ...... 26 3. Effects of prior evolutionary history and immigration history on abundance...... 27 4. Total number of morphotypes descended from both focal and competitor genotypes ...... 28

Chapter 3. Area and the rapid radiation of Hawaiian Bidens (Asteraceae) 1. Representative species showing a sample of variation found among species...... 58 2. Maximum likelihood phylogram of nrITS DNA sequences ...... 59 3. Maximum likelihood phylograms of nrETS and cpDNA sequences ...... 65

Chapter 4. Adaptive morphological shifts to novel habitats in marine sculpin fishes (Teleostei: Cottidae) 1. Conceptual diagram of sculpin phylogeny in relation to habitat affinities ...... 91 2. Evolutionary models (hypotheses) ...... 92

Chapter 5. Phylogeny and biogeography of marine sculpins (Teleostei: Cottidae) of the North American Pacific Coast 1. Phenetic assessment of the phylogenetic relationships of cottids ...... 127 2. Bayesian phylogenetic reconstruction based on cyt b and S7 DNA sequences ...... 128

Chapter 1

General introduction, analytical approaches, overview of results, and author contributions

1 General Introduction

In his seminal work Darwin (1859) essentially posed the question, “What generates new species and why do some lineages diversify more than others?” While many processes are important in the generation of new species, it is now well accepted that many new species are the result of adaptive radiations (Schluter 2000; Gavrilets and Losos 2009; Glor 2011), which can be defined as the often rapid diversification of species in a single evolutionary lineage to fill many ecological roles (Schluter 2000; Gillespie and Emerson 2007). The traditional view of adaptive radiation proposes that an ancestral species finds itself in an environment where resources are under-utilized and this allows the lineage to interact with the environment in novel ways promoting diversification. This “ecological opportunity” may occur after colonization of an underpopulated area (e.g. an isolated island), after extinction of a previously dominant group, or after the evolution of a character that allows the lineage to interact with the environment in ways not previously possible (Lack 1947; Simpson 1953; Schluter 2000; Gavrilets and Losos 2009). While it is clear that adaptive radiations are an important component to the first half of Darwin’s question, it remains a central task of evolutionary biologists to answer the second half of his question, “…why do some lineages diversify more than others?”

This dissertation aims to contribute to our understanding of the factors that determine the extent of diversification by adaptive radiation using systems that were specifically chosen to address knowledge gaps in this field. In particular, I propose that (1) the prior adaptation history of immigrants may determine their subsequent diversification dynamics after arrival to a new habitat; (2) the relative scale of habitable area and the amount of environmental heterogeneity in relation to the dispersal potential of the organisms under study is necessary to understand the rate and the extent of adaptive radiation; and (3) morphological adaptations can facilitate habitat shifts and by doing so, lead to further evolutionary diversification not just in terrestrial and freshwater systems, but in marine systems as well.

2 Analytical approaches

1. Recently, experimental populations of the plant- and soil-colonizing bacterium Pseudomonas fluorescens have been used extensively in adaptive radiation research because a single ancestral genotype rapidly diversifies when introduced into the novel environment of spatially structured aquatic microcosms that can be thought of as analogous to discrete islands (or lakes or mountaintops) (Rainey and Travisano 1998; Fukami et al. 2007). Additionally, a naturally occurring parasitoid phage of the bacteria known as Φ2, attacks the cells and results in bacterial death by cell lysis, thereby imposing strong selection for resistance (Buckling and Rainey 2002). Like P. fluorescens, the phage Φ2 is easy to isolate, store and manipulate. Taken together, this system is ideally suited for investigating the roles of immigration and evolutionary history on diversification, which would not be possible with almost all other types of organisms. While microcosms lack the complexity of natural ecosystems, and results should not be extrapolated uncritically (Carpenter 1996; Cadotte et al. 2005), they uniquely allow for the experimental manipulation of the factors suspected as determinants of radiation.

2. In recent decades, the advent of molecular phylogenetics has allowed for the relatively rapid generation of DNA sequence data that can be used to reconstruct phylogenetic hypotheses. These hypotheses (or phylogenetic trees) can then be used to understand character evolution, habitat and range shifts, and estimate diversification rates during adaptive radiations. Because of the power of molecular phylogenetics to infer speciation patterns, I utilize this approach in Chapters 3, 4 and 5.

3. The recently developed Ornstein-Uhlenbeck Comparative Hypotheses (OUCH) method (Butler & King 2004) allows researchers to test alternative hypotheses of neutral drift, phylogenetic inertia, and adaptation by natural selection on phenotypes of interest in relation to the environments where they are found. The OUCH approach also allows for the estimation of optimal phenotypic trait values in different selective regimes. Therefore, I utilize this approach in Chapter 4.

3 Overview of results

Chapter 2. I propose the hypothesis that whether or not immigration history (i.e. order or timing of colonization) influences the extent of diversification depends on the founding populations’ prior evolutionary history. Using evidence from a bacterial experiment where I manipulated the prior evolutionary history of immigrants, I show that most genotypes diversified to a greater extent when introduced before, rather than after, a standard competitor genotype. However, introduction order did not affect the extent of diversification when the evolved genotype had previously adapted to the environment for a long period of time without exploiters. Diversification of these populations was low regardless of introduction order. These results suggest that the importance of immigration history in diversification can be predicted by the immigrants’ evolutionary past. Further, I suggest that the hypothesis proposed here, may be generally applicable to both micro- and macro-organisms.

Chapter 3. One of the best examples of adaptive radiation in the Hawaiian flora is the endemic species of the genus Bidens (Asteraceae), yet prior to this work no estimates of their age or rate of diversification were available. Further, Hawaiian Bidens are an excellent study system to examine the question of why some lineages diversify more rapidly than others, because they are species-rich, have radiated within a confined, relatively small area that has a well understood geologic and paleo-climatic history, and lastly previous work has suggested that they may be a very young clade and therefore allow for accurate estimation of their diversification rate. I find that on a per-unit-area basis, the Hawaiian Bidens have among the highest rates of speciation for plant radiations documented to date. The rapid diversification within the small area was likely facilitated by the habitat diversity of the Hawaiian Islands and the adaptive loss of dispersal potential.

Chapter 4. Marine sculpin fishes (Cottidae) of the eastern Pacific Ocean provide an ideal opportunity to examine whether adaptive morphological character shifts have facilitated invasion of novel habitat types. In this group, the basal species primarily occupy the subtidal habitat, whereas the derived species are found in the intertidal. I used

4 evolutionary models to test the hypotheses that change in body size and change in number of scales were adaptive responses to novel habitats. I employed OUCH, a recently developed phylogenetic comparative method, to test adaptive and alternative hypotheses. Results show that adaptive evolutionary changes in body size and number of scales to habitat type are supported over models of neutral evolution, stabilizing selection across all habitats, and three models of phylogenetic inertia. Adaptations that allow for colonization of a new habitat often open up new ecological opportunities and thus promote lineage diversification, and while well documented in terrestrial and freshwater systems, this study suggests that this may apply to marine diversifications as well.

Chapter 5. With 90 species found along the Pacific Coast of North America, marine sculpins represent the most species-rich radiation of fishes in this region. In this study, I produced the most complete phylogenetic hypothesis yet generated for this clade. Maximum parsimony, maximum likelihood, and Bayesian analyses produced highly similar tree topologies, suggesting an origin of the clade in the eastern Pacific followed by colonization of the north Pacific, then giving rise to a number of descendant lineages found throughout the northern Pacific Ocean, Arctic, and Atlantic Oceans and one monophyletic lineage that re-colonized the eastern Pacific. Numerous sibling species have fully disjunct ranges, suggesting vicariant or founder speciation. However, many other sibling species have largely overlapping ranges, and repeated habitat shifts appear to have facilitated diversification. Many previously proposed groupings based on morphology are recovered, but the molecular data suggest that a number of genera are either para- or polyphyletic. Further, this study both refutes and supports prior proposals for relationships of genera and species.

5 Author contributions

Chapter 2 was coauthored with Samantha E. Forde (University of California,

Santa Cruz) and Tadashi Fukami (Stanford University) and is a lightly revised version of the manuscript published in Frontiers in Microbiology (Knope et al. 2012). Samantha provided training on aspects of the laboratory protocols, feedback on data analysis, and with improving the main text of the manuscript. Tad was instrumental with inception of ideas, experimental design, data analysis, improving the main text of the manuscript, and provided facilities and materials. I did all other work from the inception to submittal of this research.

Chapter 3 was coauthored with Clifford W. Morden (University of Hawaii,

Manoa), Vicki A. Funk (Smithosonian Institution), and Tadashi Fukami and is a lightly revised version of the manuscript published in the Journal of Biogeography (Knope et al. 2012). Cliff supplied DNA extracts for eight of the 19 species of Hawaiian Bidens and provided feedback on early drafts of the manuscript. Vicki provided the ETS DNA sequences for many of the taxa and also provided feedback on early drafts of the manuscript. Tad assisted with revisions of the manuscript, feedback on data analysis, and provided facilities and materials. I did all other work from the inception to publication of this research.

Chapter 4 was coauthored with Jeffrey A. Scales (University of Hawaii, Manoa). Jeff provided assistance with writing R code for implementation of the OUCH analysis and with feedback on drafts of this manuscript. I did all other work from the inception of this research to preparation of manuscript.

Chapter 5 was not coauthored. I did all work from the inception of this research to preparation of manuscript.

6 References cited

Buckling, A. and P.B. Rainey. (2002) The role of parasites in sympatric and allopatric host diversification. Nature 420, 496-499.

Butler, M.A. and A.A. King. (2004) Phylogenetic comparative analysis: A modeling approach for adaptive evolution. The American Naturalist 164, 683-695.

Carpenter, S.R. (1996) Microcosm experiments have limited relevance for community and ecosystem ecology. Ecology 77, 677-680.

Cadotte, M.W., J.A. Drake, and T. Fukami. (2005) Constructing nature: laboratory models as necessary tools for investigating complex ecological communities. Advances in Ecological Research 37, 333-353.

Darwin, C. (1859) On the Origin of Species by Means of Natural Selection. Oxford University Press, New York.

Fukami, T., H.J.E. Beaumont, X.-X. Zhang, and P.B. Rainey. (2007) Immigration history controls diversification in experimental adaptive radiation. Nature 446, 436-439.

Gavrilets, S. and J.B. Losos. (2009) Adaptive radiation: contrasting theory with data. Science 323, 732-736.

Gillespie, R.G. and B.C. Emerson. (2007) Adaptation under a microscope. Nature 446, 386-387.

Glor, R.E. (2010) Phylogenetic insights on adaptive radiation. Annual Review of Ecology, Evolution, and Systematics 41, 251-270.

Knope M.L., S.E. Forde, and T. Fukami (2012). Evolutionary history, immigration history, and the extent of diversification in community assembly. Frontiers in Microbiology 2, 273.

Knope M.L., C.W. Morden, V.A. Funk, and T. Fukami (2012). Area and the rapid radiation of Hawaiian Bidens (Asteraceae). Journal of Biogeography, 39, 4.

Lack, D. (1947) Darwin’s finches. Cambridge Univ. Press, Cambridge, MA.

Rainey, P.B. and M. Travisano. (1998) Adaptive radiation in a heterogeneous environment. Nature 394, 69-72.

Schluter, D. (2000) The Ecology of Adaptive Radiation. Oxford Univ. Press, Oxford, UK.

Chapter 2

Evolutionary history, immigration history, and the extent of diversification in community assembly

8 Abstract During community assembly, species may accumulate not only by immigration, but also by in situ diversification. Diversification has intrigued biologists because its extent varies even among closely related lineages under similar ecological conditions. Recent research has suggested that some of this puzzling variation may be caused by stochastic differences in the history of immigration (relative timing and order of immigration by founding populations), indicating that immigration and diversification may affect community assembly interactively. However, the conditions under which immigration history affects diversification remain unclear. Here we propose the hypothesis that whether or not immigration history influences the extent of diversification depends on the founding populations’ prior evolutionary history, using evidence from a bacterial experiment. To create genotypes with different evolutionary histories, replicate populations of Pseudomonas fluorescens were allowed to adapt to a novel environment for a short or long period of time (approximately 10 or 100 bacterial generations) with or without exploiters (viral parasites). Each evolved genotype was then introduced to a new habitat either before or after a standard competitor genotype. Most genotypes diversified to a greater extent when introduced before, rather than after, the competitor. However, introduction order did not affect the extent of diversification when the evolved genotype had previously adapted to the environment for a long period of time without exploiters. Diversification of these populations was low regardless of introduction order. These results suggest that the importance of immigration history in diversification can be predicted by the immigrants’ evolutionary past. The hypothesis proposed here may be generally applicable to both micro- and macro-organisms.

Keywords Adaptive peaks, colonization, dispersal, eco-evolutionary dynamics, fitness trade-off, historical contingency, niche pre-emption, priority effect

9 Introduction During community assembly, species can accumulate both ecologically, by immigration, and evolutionarily, by in situ diversification. Traditionally, these processes have been studied separately by ecologists on one hand and evolutionary biologists on the other. However, an increasing number of recent studies on both micro- and macro- organisms consider immigration and diversification simultaneously (e.g., Hubbell 2001; Gillespie 2004; Fukami et al. 2007). Much of this change has been prompted by the growing appreciation of “eco-evolutionary dynamics,” where ecological and evolutionary processes operate interactively at the same time scales (Hairston et al. 2005; Schoener 2011). One idea that is emerging from eco-evolutionary research is that the extent of diversification can be affected by stochastic differences in immigration history, such as the relative timing and order of immigration of competing genotypes (Silvertown 2004; Fukami et al. 2007; Gillespie and Emerson 2007; Seehausen 2007). This interactive effect of immigration and diversification arises because early-arriving immigrants pre-empt available niches, thereby suppressing diversification of late-arriving immigrants—an evolutionary “priority effect” (Samuels and Drake 1997; Chase 2003; Gillespie 2004; Silvertown 2004; Fukami et al. 2007; Gillespie and Emerson 2007; Seehausen 2007; Urban and De Meester 2009). It remains unclear, however, under what conditions immigration history influences the extent of diversification. As a first step toward answering this question, this paper proposes one hypothesis, namely that the importance of immigration history is determined by the degree of prior adaptation of founding populations to the new environment. To provide empirical support for this hypothesis, we present the results of an experiment that involved the plant-colonizing bacterium Pseudomonas fluorescens and its viral parasite, phage Φ2.

P. fluorescens is a useful model system to study diversification. It has been shown to rapidly diversify into spatial niche specialists by de novo mutation when propagated in a novel habitat (static vial containing nutrient-rich liquid medium) (Rainey and Travisano 1998). Primary classes of niche specialists that emerge through this adaptive radiation include ‘smooth morphs’ (SM), which resemble the ancestral type and primarily colonize the liquid phase, ‘wrinkly spreader morphs’ (WS), which form a

10 biofilm at the air-liquid interface, and ‘fuzzy spreader morphs’ (FS), which appear to inhabit the bottom of the vial (Rainey and Travisano 1998). Heritable variation exists within each class, and evolved morphotypes coexist via negative frequency-dependent selection (Rainey and Travisano 1998; Fukami et al. 2007; Meyer and Kassen 2007). Because reproduction in P. fluorescens is entirely asexual, genotypes are analogous to species in other organisms (Kassen et al. 2004). Further, previous work has shown strong effects of the presence of phage Φ2 on P. fluorescens diversification via reduction in bacterial density and selection for phage resistance (Buckling and Rainey 2002).

Using P. fluorescens and phage Φ2, we examined the effects of two aspects of prior evolutionary history on the role of immigration history in diversification: how long immigrants have previously evolved in an environment similar to the new habitat, and whether or not immigrants have previously evolved in the presence of the exploiters that they encounter in the new habitat. We examined these two aspects because both theory (Wright 1932; Dobzhansky 1937; Simpson 1953; Kauffman 1989, Whitlock et al. 1995; Schluter 2000) and observations from the field (Simpson 1953; Schluter 2000) suggest that the degree of similarity between the prior environment that immigrants come from and the new environment (both biotic and abiotic) is a key factor affecting diversification in the new environment. In our experiment, we allowed replicate bacterial populations to evolve in a novel environment, with and without phage Φ2, for approximately 10 or 100 generations. We then introduced each of the evolved genotypes into a new habitat either before or after a standard competitor genotype to evaluate the effect of immigration history. We found that whether or not the extent of diversification was influenced by immigration history did depend significantly on the adaptation history of the immigrants prior to immigration. We will discuss possible mechanisms for this effect, and suggest that they may be generally applicable to other systems of both micro- and macro- organisms, with the caveat that results of microbial experiments should not be extrapolated uncritically (Carpenter 1996; Cadotte et al. 2005).

Materials and Methods Creation of genotypes with different prior evolutionary histories

We propagated six independent replicate lineages of wild type P. fluorescens SBW25 (Rainey and Travisano 1998) at 28°C in static 25-ml universal vials with loose caps containing 6 ml of standard King’s B (KB) liquid medium (Rainey and Travisano 1998; Fukami et al. 2007; Meyer and Kassen 2007), in the absence of phage (three lineages) and in the presence of phage (three lineages). All of these lineages were initiated with a common isogenic SM population of P. fluorescens. Approximately 3 x 105 particles of phage SBW25Φ2 were also introduced to all appropriate vials at the start of the propagation. Subsequently, 60 µl of culture was transferred to fresh media every 48 h for 30 days. We harvested 1 ml of each replicate at every transfer, starting on day 1. Immediately after each harvest, the samples were stored in 70% glycerol at -80 °C. From this collection of evolved SM genotypes, we chose genotypes isolated after 3 days (corresponding to approximately 10 bacterial generations) and 27 days (approximately 100 bacterial generations) of propagation to represent brief and long periods of prior adaptation to the novel environment, respectively. Thus we had four treatments of prior evolutionary history: short or long periods of adaptation, each in either the presence or absence of exploiters. It has been shown under laboratory conditions that P. fluorescens evolves to have increased general resistance to phage over time when continuously exposed to phage (Brockhurst et al. 2003).

Manipulation of prior evolutionary history and immigration history

Using the same conditions as above, we inoculated fresh vials with an isogenic population of SM genotype isolated from an evolved lineage (one of each of the three replicates for all four of the varied evolutionary histories as described above; hereafter referred to as focal genotype) and that of a common ancestral SM genotype with a neutral lacZ genetic marker (Zhang and Rainey 2007) (used as a standard competitor; hereafter referred to as competitor genotype). Use of a lacZ lineage as the competitor genotype allowed the origin of each bacterial cell to be determined by observation of colonies developed on KB agar plates supplemented with X-gal (see below).

12 The following 12 treatments of immigration history were used: (1) focal genotype with 3-day prior history with phage (hereafter called 3W) introduced by itself; (2) focal genotype with 3-day prior history without phage (3WO) introduced by itself; (3) focal genotype with 27-day prior history with phage (27W) introduced by itself; (4) focal genotype with 27-day prior history without phage (27WO) introduced by itself; (5) competitor genotype introduced first, then 3W introduced 24 h later; (6) 3W introduced first, then competitor genotype introduced 24 h later; (7) competitor genotype introduced first, then 3WO introduced 24 h later; (8) 3WO introduced first, then competitor genotype introduced 24 h later; (9) competitor genotype introduced first, then 27W introduced 24 h later; (10) 27W introduced first, then competitor genotype introduced 24 h later; (11) competitor genotype introduced first, then 27WO introduced 24 h later; and (12) 27WO introduced first, then competitor genotype introduced 24 h later.

To initiate these replicates, we separately grew the competitor genotype and the focal genotypes overnight (for 16 h) in liquid KB medium at 28 °C in an orbital shaker (at 150 r.p.m.). We then introduced 6 µl of these overnight samples to each appropriate vial. Additionally, all vials were inoculated with phage, as described above. Replicates were destructively harvested every 24 h for 10 days to measure bacterial diversity and abundances (see below). We used a total of 360 vials, i.e., 12 treatments x 3 replicates x 10 destructive harvests.

This experimental design allowed us to test if the effect of immigration history on diversification depended on the prior evolutionary history of the focal genotype. Additionally, inclusion of phage in all replicates enabled us to determine if diversification was affected by prior evolution with the exploiters that the focal genotype would encounter in the new habitat.

Measuring bacterial morphotype diversity and abundances

For each harvest (every 24 hrs), we determined cell densities of different morphotypes by counting colonies after 2 days of growth on KB agar supplemented with

13 50 µg ml-1 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal). Colony morphotype diversity was measured following the standard methods used in previous work (Buckling et al. 2003; Meyer and Kassen 2007). Niche preference of each morphotype was confirmed by observing growth of each genotype in static medium and establishing whether they mainly colonized the liquid phase (SM), the air–liquid interface (WS), or the bottom (FS) of the medium. This measure of diversity is ecologically relevant because colony morphology corresponds to spatial niche use. It should be noted, however, that genetic diversity may have also existed within colony morphotypes, which we did not measure.

Ecological differences among these mutants can be regarded as large as those among species in many systems of animals and plants, for three reasons. First, previous research has identified the genetic bases of the colony morphotypes (Spiers et al. 2002, 2003; Kassen and Rainey 2004; Spiers and Rainey 2005), indicating that they reflect genetic variation rather than phenotypic variation within the same genotype. Second, when colonies of a given morphotype were isolated, inoculated into a fresh medium, grown for 2 days, and plated, they produced the same colony morphotype (Fukami et al. 2007), further confirming that the colony morphotypes have genetic bases. Third, colony morphology corresponds to spatial niche differentiation that is of similar or greater ecological magnitude compared to that found among species in many other systems. However, in future research, full genome sequencing of different morphotypes should be helpful in further uncovering the genetic mechanisms underlying diversification in this system.

Statistical analyses

Data were assessed for normality and log-transformed when necessary prior to analyses. Two-way analysis of variance (ANOVA) was used to test for effects of length of time of prior evolution, prior evolution in the presence of phage, and their interaction on the following response variables: the number of morphotypes observed (time-averaged for days 8 to 10) (Figure 1, Tables 1-3), differences in the number of morphotypes

14 observed (time-averaged for days 8 to 10) between early-immigration and late- immigration treatments (Figure 2, Table 4), and total number of morphotypes descended from both the focal genotype and the competitor genotype (time-averaged for days 0 to 10) (Figure 4, Table 5). All statistical results were for two-tailed tests with α = 0.05. Statistical analyses were performed using JMP v.8 (SAS Institute Inc.).

Results and Discussion Genotypes differing in prior evolutionary history showed significant differences in the degree to which immigration history affected diversification (Figures 1 and 2). In three of the four prior-history treatments, after approximately 35 bacterial generations (at days 8-10), the focal genotype diversified to a greater extent when it was introduced before, rather than after, its competitor (compare Figure 1a vs. 1e, 1b vs. 1f, and 1c vs. 1g; see also Figure 2). This result is an expected outcome from previous work (Brockhurst et al. 2007; Fukami et al. 2007). However, when the focal genotype had a long history of adaptation to the laboratory environment in the absence of phage, immigration history did not have a significant effect on the extent of diversification (compare Figure 1d vs. 1h; see also Figure 2).

Why did the importance of immigration history depend on prior evolutionary history? To address this question, we examined the effect of prior evolutionary history within each of the two immigration treatments separately, i.e., when the focal genotype was introduced first and when it was introduced after the competitor. When introduced first, the focal genotype almost completely suppressed the competitor genotype, both in diversity (Figure 1a-d) and abundance (Figure 3a-d), regardless of prior evolutionary history. Therefore, diversification of early immigrants can be considered equivalent to diversification following a single immigration event, simplifying interpretation of results. In fact, when the focal genotype was introduced alone, diversification patterns resembled those observed in the early-immigrant treatments (compare Figure 1a-d vs. 1i-l).

We expected that, if introduced alone, genotypes with shorter prior history, and therefore with decreased opportunity for previous adaptation to the novel environment,

15 would diversify more extensively. Two possible mechanisms underlie this expectation. First, both theory (Wright 1932; Dobzhansky 1937; Kauffman 1989, Whitlock et al. 1995) and empirical evidence from P. fluorescens (Buckling et al. 2003) indicate that poorly adapted genotypes have a high potential to diversify via ascending of multiple adaptive peaks. If an immigrant is already adapted to a particular peak, it may be difficult to shift to a new peak, consequently hampering diversification via niche specialization (Buckling et al. 2003; Brockhurst et al. 2007). Second, poorly adapted genotypes may be unable to out-compete descendant genotypes, facilitating the descendants’ increase in abundance once they arise by mutation. Although our data do not allow us to ascertain which of these two mechanisms (or both) operated, our results are consistent with the expectation that shorter prior adaptation to the environment results in more extensive diversification (compare Figure 1i vs. 1k and 1j vs. 1l).

We also expected that genotypes that previously evolved in the presence of phage would diversify more than those that did not evolve with phage. There are three possible mechanisms for this expectation. First, previous work has shown that reduction in P. fluorescens density by phage results in reduced resource competition, weakening selection pressure for competitive ability (Buckling and Rainey 2002). Genotypes that previously evolved with phage may therefore be relatively poorly adapted to the laboratory environment, thereby facilitating subsequent diversification as discussed above. Second, genotypes that previously evolved with phage multiplied more quickly (compare Figure 3i vs. 3j and 3k vs. 3l), which may have caused more intense competition, resulting in more extensive diversification. Third, previous work has also found the existence of fitness trade-offs in P. fluorescens between phage resistance and competitive ability (Brockhurst et al. 2004). With such trade-offs, genotypes that previously evolved with phage may be relatively weak in competition and may not strongly suppress descendant mutants, thereby allowing adaptive radiation. Although we cannot determine which mechanism(s) operated, we found that, as expected, prior evolution with phage led to more extensive diversification (compare Figure 1i vs. 1j and 1k vs. 1l).

16 In contrast to these results for early immigrants, prior evolutionary history did not significantly affect the extent of diversification of late immigrants (Figure 1e-h). Diversification of late immigrants was consistently low regardless of prior evolutionary history (Figure 1e-h). We hypothesize that any potential effect of prior evolutionary history on diversification was overwhelmed by strong niche pre-emption by the early- arriving competitor genotype (Brockhurst et al. 2007; Fukami et al. 2007), which fared better in both diversity (Figures 1e-h) and abundance (Figures 3e-h) by virtue of early arrival. If niche pre-emption was important, diversification should be deterministic when overall diversity of all genotypes descended from both immigrants is considered. Our data are consistent with this expectation, with no significant difference in total diversity between prior-history treatments (Figure 4).

Taken together, our data, combined with previous evidence (Buckling and Rainey 2002; Buckling et al. 2003; Brockhurst et al. 2004; Brockhurst et al. 2007; Fukami et al. 2007), provide likely explanations for why the importance of immigration history depended on prior evolutionary history, which can be summarized as follows. The focal genotype usually diversified more extensively when it arrived early due to niche pre-emption (Brockhurst et al. 2007; Fukami et al. 2007). However, this priority effect did not occur if the focal genotype previously had a long period of adaptation in the absence of phage. Genotypes with this history had such a heavily compromised ability to diversify that the extent of diversification after early arrival was indistinguishable from the consistently low level of diversification after late arrival of any immigrant (Figure 1d vs. 1e-h).

The mechanisms indicated in our experiment may also explain some of the variation in the extent of diversification in other systems of micro- and macro-organisms, particularly those involving discrete, replicated habitats such as islands, lakes, and mountaintops. Some of the evolutionary mechanisms that influence bacteria, including lateral gene transfer, uptake of foreign DNA from the environment, mobile DNA elements, recombination machinery, and high mutation rates, may make their diversification different from that of macro-organisms. Nevertheless, evolutionary

1717 priority effects similar to those we found in P. fluorescens may explain variation in diversification in macro-organisms as well. Possible examples include Macaronesian plants (Silvertown 2004), African lake cichlids (Seehausen 2007), and Hawaiian Tetragnatha spiders (Gillespie 2004). Further, in some systems where the extent of diversification varies considerably, e.g. Caribbean Anolis lizards (Calsbeek and Cox 2010), mainland source populations appear to have evolved in the presence of exploiters (predators), whereas islands where founders immigrated and diversified differ in the occurrence of exploiters, indicating the potential for exploiters to affect diversification.

Conclusion Historical contingency undermines our ability to explain community assembly because it is difficult to ascertain past events in detail (Gould 1989; Schluter 2000; Gavrilets and Losos 2009; Fukami 2010). Not all aspects of history are equally complicated, however. In many communities of both micro- and macro-organisms, immigration history is not possible to infer, but adaptation history often is through the combined use of geological, biogeographical and phylogenetic information (Emerson and Gillespie 2008; Losos and Ricklefs 2009; Glor 2010). Thus, if the hypothesis we propose here is correct, it means that the evolutionary importance of historical events that cannot be reconstructed (i.e., subtle differences in early immigration history) may nevertheless be possible to predict by analyzing more tractable aspects of history (i.e., immigrants’ prior adaptation history). For this reason, we believe it will be worthwhile to evaluate the generality and mechanistic bases of our hypothesis in greater detail to gain an improved understanding of immigration, diversification, and community assembly.

Acknowledgments We thank Julia Borden, Benjamin Callahan, Whitney Hoehn, Nathan Kim, Christine Kyauk, Katrina Luna, Sharia Mayfield, and Aaron Wacholder for laboratory assistance. We thank Paul Rainey and Xue-Xian Zhang for providing us with P. fluorescens SBW25 (wild type) and P. fluorescens SBW25 lacZ, and Angus Buckling for providing us with phage Φ2. We thank Bertus Beaumont, Benjamin Callahan, Sinead Collins, Rodolfo Dirzo, James Estes, Diana Nemergut, Paul Rainey, Uli Stingl, John

18 Thompson, Susannah Tringe and David Wardle for comments. Financial support was provided by Stanford University.

References Brockhurst, M.A., A.D. Morgan, P.B. Rainey, and A. Buckling. (2003). Population mixing accelerates coevolution. Ecol. Lett. 6, 975-979.

Brockhurst, M.A., P.B. Rainey, and A. Buckling. (2004). The effect of spatial heterogeneity and parasites on the evolution of host diversity. Proc. Roy. Soc. B. 271, 107-111.

Brockhurst, M.A., N. Colegrave, D.J. Hodgson, and A. Buckling. (2007). Niche occupation limits adaptive radiation in experimental microcosms. PLoS ONE 2, e193-e195.

Buckling, A. and P.B. Rainey. (2002). The role of parasites in sympatric and allopatric host diversification. Nature 420, 496-499.

Buckling, A., M.A. Wills, and N. Colegrave. (2003). Adaptation limits diversification of experimental bacterial populations. Science 302, 2107-2109.

Cadotte, M.W., J.A. Drake, and T. Fukami. (2005). Constructing nature: laboratory models as necessary tools for investigating complex ecological communities. Adv. Ecol. Res. 37, 333-353.

Calsbeek, R. and R.M. Cox. (2010). Experimentally assessing the relative importance of predation and competition as agents of selection. Nature 465, 613-616.

Carpenter, S.R. (1996). Microcosm experiments have limited relevance for community and ecosystem ecology. Ecology 77, 677-680.

Chase, J.M. (2003). Community assembly: when should history matter? Oecologia 136, 489-498.

Dobzhansky, T. (1937). Genetics and the Origin of Species. New York: Columbia Univ. Press.

Emerson, B.C. and R.G. Gillespie. (2008). Phylogenetic analysis of community assembly and structure over space and time. Trends Ecol. Evol. 23, 619–630.

Fukami, T., H.J.E. Beaumont, X.-X. Zhang, and P.B. Rainey. (2007). Immigration history controls diversification in experimental adaptive radiation. Nature 446, 436-439.

19 Fukami, T. (2010). “Community assembly dynamics in space.” in Community Ecology: Processes, Models, and Applications. Verhoef, H.A. and P.J. Morin, eds. Oxford: Oxford Univ. Press, pp. 45-54.

Gillespie, R.G. (2004). Community assembly through adaptive radiation in Hawaiian spiders. Science 303, 356-359.

Gillespie, R.G. and B.C. Emerson. (2007). Adaptation under a microscope. Nature 446, 386-387.

Gavrilets, S. and J.B. Losos. (2009). Adaptive radiation: contrasting theory with data. Science 323, 732-736.

Glor, R.E. (2010). Phylogenetic insights on adaptive radiation. Ann. Rev. Ecol. Evol. Syst. 41, 251-270.

Gould, S.J. (1989). Wonderful Life: The Burgess Shale and the Nature of History. New York: W.W. Norton Press.

Hairston, N.G. Jr., S.P. Ellner, M.A. Geber, T. Yoshida, and J.A. Fox. (2005). Rapid evolution and the convergence of ecological and evolutionary time. Ecol. Lett. 8, 1114-1127.

Hubbell, S.P. (2001). The Unified Neutral Theory of Biodiversity and Biogeography. Princeton: Princeton Univ. Press.

Kassen, R. and P.B. Rainey. (2004). The ecology and genetics of microbial diversity. Ann. Rev. Microbiology 58, 207-231.

Kassen, R., M. Llewellyn, and P.B. Rainey. (2004). Ecological constraints on diversification in a model adaptive radiation. Nature 451, 984-988.

Kauffman, S.A. (1989). Cambrian explosion and Permian quiescence: implications of rugged fitness landscapes. Evol. Ecol. 3, 274-281.

Losos, J.B. and R.E. Ricklefs. (2009). Adaptation and diversification on islands. Nature 457, 830-836.

Meyer, J.R. and R. Kassen. (2007). The effects of competition and predation on diversification in a model adaptive radiation. Nature 446, 432-435.

Rainey, P.B. and M. Travisano. (1998). Adaptive radiation in a heterogeneous environment. Nature 394, 69-72.

Samuels, C.L. and J.A. Drake. (1997). Divergent perspectives on community convergence. Trends Ecol. Evol. 12, 427-432.

Schoener, T. W. (2011). The newest synthesis: understanding the interplay of evolutionary and ecological dynamics. Science 331, 426-429.

Schluter, D. (2000). The Ecology of Adaptive Radiation. Oxford: Oxford Univ. Press.

Seehausen, O. (2007). Chance, historical contingency, and ecological determinism jointly determine the rate of adaptive radiation. Heredity 99, 361-363.

Silvertown. J. (2004). The ghost of competition past in the phylogeny of island endemic plants. J. Ecol. 92, 168-173.

Simpson, G.G. (1953). The Major Features of Evolution. New York: Columbia University Press.

Spiers, A. J., S. G. Kahn, J. Bohannon, M. Travisano, and P.B. Rainey (2002). Adaptive divergence in experimental populations of Pseudomonas fluorescens. I. Genetic and phenotypic bases of wrinkly spreader fitness. Genetics 161, 33-46.

Spiers, A.J., J. Bohannon, S.M. Gehrig, and P.B. Rainey (2003). Biofilm formation at the air-liquid interface by the Pseudomonas fluorescens SBW25 wrinkly spreader requires an acetylated form of cellulose. Mol. Microbiol. 50, 15–27.

Spiers, A. J. and P. B. Rainey (2005). The Pseudomonas fluorescens SBW25 wrinkly spreader A-L biofilm requires attachment factor, cellulose fibre and LPS interactions to maintain strength and integrity. Microbiology 151, 2829-2839.

Urban, M.C. and L. De Meester. (2009). Community monopolization: local adaptation enhances priority effects in an evolving metacommunity. Proc. R. Soc. B 276, 4129-4138.

Whitlock, M.C., P.C. Phillips, F.B.G. Moore, and S. Tonsor. (1995). Epistasis and multiple fitness peaks. Ann. Rev. Ecol. Syst. 26, 601-29.

Wright, S. (1932). The roles of mutation, inbreeding, crossbreeding and selection in evolution. Proc. 6th Int. Cong. Genet. Ithaca, NY, 1, 356-366.

Zhang, X.-X. and P.B. Rainey. (2007). Construction and validation of a neutrally-marked strain of Pseudomonas fluorescens SBW25. J. Microbiol. Methods 71, 78-81.

21 Figure legends

Figure 1. Effects of prior evolutionary history and immigration history on bacterial diversification. Black and grey lines indicate focal and competitor genotypes, -1 respectively. Each panel (A to L) shows mean abundance (log10(c.f.u. ml )) ± s.e.m. (n = 3) for the corresponding treatment of immigration history and prior evolutionary history. For each treatment of immigration history, two-way ANOVA results are indicated as follows: n.s. denotes P > 0.05, * denotes P < 0.05, and ** denotes P < 0.01 (see Tables 1- 3). “Time,” “Phage,” and “T X P” refer to the effect of length of time of prior adaptation, of prior evolution with phage, and of their interaction, respectively.

Figure 2. Comparison of diversification of focal genotypes immigrating early and late. Data show the difference in the mean number of morphotypes derived from the focal genotype ± s.e.m. (n = 3) measured at the end of the experiment (on days 8 to 10). Two- way ANOVA results are indicated as in Figure 1 (see Table 4).

Figure 3. Effects of prior evolutionary history and immigration history on bacterial abundance. Black lines indicate focal genotype and grey lines indicate competitor -1 genotype. Each panel (A to L) shows mean abundance (log10(c.f.u. ml )) ± s.e.m. (n = 3) for the corresponding treatment of immigration history and prior evolutionary history.

Figure 4. Temporal change in total number of morphotypes after the competitor genotype was introduced on day 0 and the focal genotype on day 1. Data show mean number of morphotypes (those derived from focal and competitor genotypes combined) ± s.e.m. (n = 3). Two-way ANOVA results are indicated as in Figure 1 (see Table 5).

Table 1. ANOVA results on the number of morphotypes (time averaged for days 8-10) for focal genotypes introduced 24 h before standard competitor.

Table 2. ANOVA results on the number of morphotypes (time averaged for days 8-10) for focal genotypes introduced 24 h after standard competitor.

Table 3. ANOVA results on the number of morphotypes (time averaged for days 8-10) for focal genotypes introduced alone.

Table 4. ANOVA results on the number of morphotypes (time averaged for days 8-10) for the difference between early and late arrival of focal genotypes.

Table 5. ANOVA results on the total number of morphotypes from both the competitor genotype and the focal genotype (time-averaged for days 0 to 10).

Figure 1.

Figure 2.

Figure 3.

Figure 4.

Chapter 3

Area and the rapid radiation of Hawaiian Bidens (Asteraceae)

ABSTRACT Aim To estimate the rate of adaptive radiation of endemic Hawaiian Bidens and to compare their diversification rates with those of other plants in Hawaii and elsewhere with rapid rates of radiation. Location Hawaii Methods Fifty-nine samples representing all 19 Hawaiian species, six Hawaiian subspecies, two Hawaiian hybrids and an additional two Central American and two African Bidens species were DNA-extracted, polymerase chain reaction-amplified, and sequenced for four chloroplast and two nuclear loci, resulting in a total of approximately 5400 base pairs per individual. Internal transcribed spacer sequences for additional outgroup taxa, including 13 non-Hawaiian Bidens, were obtained from GenBank. Phylogenetic relationships were assessed by maximum likelihood and Bayesian inference. The age of the most recent common ancestor and diversification rates of Hawaiian Bidens were estimated using the methods of previously published studies to allow for direct comparison with other studies. Calculations are made on a per-unit-area basis. Results We estimate the age of the Hawaiian clade to be 1.3–3.1 million years old, with an estimated diversification rate of 0.3–2.3 species/million years and 4.8 × 10-5 – 1.3 × 10-4 species Myr-1 km-2. Bidens species are found in Europe, Africa, Asia, and North and South America, but the Hawaiian species have greater diversity of growth form, floral morphology, dispersal mode, and habitat type than observed in the rest of the genus worldwide. Despite this diversity, we found little genetic differentiation among the Hawaiian species. This is similar to the results from other molecular studies on Hawaiian plant taxa, including others with great morphological variability (e.g. silverswords, lobeliads and mints). Main conclusions On a per-unit-area basis, Hawaiian Bidens have among the highest rates of speciation for plant radiations documented to date. The rapid diversification within the small area was probably facilitated by the habitat diversity of the Hawaiian Islands and the adaptive loss of dispersal potential. Our findings point to the need to consider the spatial context of diversification – specifically, the relative scale of habitable 30 area, environmental heterogeneity and dispersal ability – to understand the rate and extent of adaptive radiation.

Keywords

Adaptive radiation, Asteraceae, carrying capacity, Compositae, diversification rate, endemism, island evolution, islands, speciation.

INTRODUCTION Remote islands have played a central role in the development of evolutionary theory, particularly with regard to the factors responsible for speciation and adaptive radiation (Darwin, 1859; Lack, 1947; Carlquist, 1974; Schluter, 2000). The Hawaiian Islands (about 4000 km from the nearest land mass) are noteworthy in this regard, as adaptive radiation is prominent in numerous and phylogenetically diverse plant families (Wagner & Funk, 1995; Wagner et al., 1999; Ziegler, 2002; Keeley & Funk, 2011). One of the best known and most well documented of these is the silversword alliance (Asteraceae or Compositae), with at least 30 species found in a vast array of habitats and all descended from a single recent common ancestor (Baldwin & Sanderson, 1998; Carlquist et al., 2003). Similarly, Hawaiian Bidens (Asteraceae), lobeliads (Campanulaceae), mints (Lamiaceae), Cyrtandra (Gesneriaceae), and Schidea (Caryophyllaceae), among others, have many morphologically diverse species, now found in a wide range of habitats, and each lineage is thought to be derived from a single ancestor that colonized Hawaii (Wagner & Funk, 1995; Price & Wagner, 2004).

One of the most striking features of these spectacular Hawaiian plant radiations is the small geographical area in which they have occurred and the short time period over which speciation has taken place (Price & Wagner, 2004; Baldwin & Wagner, 2010; Keeley & Funk, 2011). The total area of the main Hawaiian Islands is 16,644 km2 (about half the size of Belgium), and the oldest among the current high islands is Kauai, which formed c. 4.7 million years ago (Ma) (Price & Clague, 2002). Consequently, Hawaiian radiations are generally relatively young, occupying a limited but highly diverse geographical area. Dispersal mechanisms have also changed from those that facilitated long distance dispersal in their ancestors, to ones favouring more limited, local dispersal (Carlquist, 1974). In contrast, continental radiations often involve orders-of-magnitude larger geographical areas, longer time spans, and multiple mechanisms to promote dispersal away from the parental populations (e.g. Hughes & Eastwood, 2006; Valente et al., 2010).

In understanding the determinants of the rate and extent of adaptive radiation, the effect of area has recently received increasing attention (e.g. Rosenzweig, 1995; Losos & Schluter, 2000; Gavrilets & Vose, 2005; Seehausen, 2006; Whittaker et al., 2008; Gillespie & Baldwin, 2010; Losos & Parent, 2010). There are several reasons proposed for the effect of area, with the following appearing most often in the literature. First, the diversity of habitats within an area tends to increase with area, providing more opportunities for speciation by divergent natural selection (Ricklefs & Lovette, 1999; Losos & Schluter, 2000; Gavrilets & Vose, 2005; Losos & Parent, 2010). Second, the opportunity for geographical isolation within an area (allopatric speciation) increases with area (MacArthur & Wilson, 1967; Gavrilets & Vose, 2005). Third, population size also generally increases with area (MacArthur & Wilson, 1967; Gavrilets & Vose, 2005), providing more mutations upon which selection can act (Lenski et al., 1991; Hall et al., 2010). Additionally, in large populations there is a greater probability of propagules dispersing to suitable habitats, producing, in some cases, species-rich genera that range over large areas (e.g. Lupinus (Fabaceae), Astragalus (Fabaceae), Senecio (Asteraceae), Poa (Poaceae), and others).

Despite much theoretical development, relatively few empirical studies of adaptive radiation have considered the effect of area explicitly. The adaptive radiation of the 19 species and eight subspecies of endemic Hawaiian Bidens offer a particularly good system in which to examine the effect of area on diversification rate because they are a young lineage that has radiated within a confined area with a well-known geological history. In this paper, we present molecular phylogenetic evidence that on a per-unit-area basis, the speciation rates of Hawaiian Bidens are among the highest of plant adaptive radiations documented to date. We propose that primarily two drivers of allopatric speciation caused this rapid radiation: the great diversity of ecological opportunities in Hawaii and the adaptive loss of long-distance dispersal potential by achenes (dry fruits). Based on our findings, we propose that young clades can be used to provide detailed explanations for rates of speciation using the spatial scale of habitat availability in combination with the dispersal potential of the organisms under study. 33

MATERIALS AND METHODS

Study system The 19 species of Bidens endemic to the Hawaiian Islands display greater morphological and ecological diversity than the other c. 320 currently described species in the genus, even though the genus is found on five continents (Ganders & Nagata, 1984). Bidens occur on all six of the main Hawaiian Islands (Kauai, Oahu, Maui, Lanai, Molokai, Hawaii), and can be found from sea level to 2200 m elevation in bogs, woodlands, scrublands, rain forests, cinder deserts, sand dunes and lava flows (Fig. 1). It appears that adaptive shifts have occurred in seed (achene) dispersal mode (Carlquist, 1980, see plate on p. 164), pollination syndrome, and growth form (Carlquist, 1974; Ganders & Nagata, 1984; Carr, 1987).

There has been no previous attempt to estimate the age or rate of the Hawaiian Bidens diversification, although it is probably relatively recent. Of the five Hawaiian Bidens species and two Hawaiian hybrids previously surveyed, all had identical sequences of nuclear ribosomal internal transcribed spacer (ITS) DNA (Ganders et al., 2000), suggesting that the radiation has occurred within the timespan provided by the present high islands (< 5 Myr). However, due to low taxonomic sampling of Hawaiian Bidens, this study was limited in its ability to address how recently the radiation may have occurred. Additionally, Helenurm & Ganders (1985) found little divergence at isozyme loci amongst fifteen Hawaiian Bidens species surveyed, also suggesting recent colonization and radiation. In contrast, Gillett (1975) proposed that the great morphological diversity of this clade pointed to a long history in the Hawaiian Islands, extending back to colonization of the Northwestern Hawaiian Islands prior to the formation of Kauai (c. 4.7 Ma; Price & Clague, 2002). Further, without the inclusion of all Hawaiian Bidens species and their putative sister clades, the hypothesized monophyly of the Hawaiian radiation has not been adequately established, which could affect estimates of the rate of diversification.

Taxon sampling and molecular methods Material was obtained from field collection, botanical gardens, and the University of British Columbia herbarium (see Appendix S1 in Supporting Information). Voucher specimens of newly collected samples were deposited at the Bernice Pauahi Bishop Museum in Honolulu, HI, USA (BISH; Accession 2009.104). All DNA extracts were deposited at the Hawaiian Plant DNA Library at the University of Hawaii, Manoa, USA. DNA was obtained from leaf material from 59 specimens representing all 19 Hawaiian species, six Hawaiian subspecies, two Hawaiian hybrids and four non-Hawaiian outgroup species (Appendix S1). DNA amplification and sequencing were performed using standard methodology (Appendix S2). Inclusion of nuclear ITS data from GenBank resulted in 13 additional non-Hawaiian Bidens species (accession numbers given in Fig. 2). Molecular markers were chosen that are likely to have high rates of molecular evolution. The ITS and external transcribed spacer (ETS) are both nuclear non-coding markers with generally rapid rates of evolution. They have been used extensively for plant molecular systematics, particularly at lower taxonomic levels, and have been shown to be useful in Hawaiian Asteracaeae (Baldwin & Markos, 1998; Baldwin & Carr, 2005; Mort et al., 2007). The chloroplast loci used in this study (trnV–ndhC, rpl32f–trnL, trnQ– rps16 and rpl32r–ndhF) are non-coding introns and spacers and are (on average across a wide variety of plant families) the four most rapidly evolving markers known from this genome (Shaw et al., 2007), although substitution rate heterogeneity across taxa is commonly observed.

DNA sequences Approximately 5400 base pairs (bp) were sequenced (1700 bp of nuclear and 3700 bp of plastid DNA) for the 19 species and six subspecies of Hawaiian Bidens (see Wagner et al., 1999, for species authorities), the two Central American (B. pilosa and B. alba var. radiata) and two African species (B. shimperi and B. pachyloma). See Appendix S1 for the length of the aligned sequences for each marker used in the phylogenetic analysis (regions that were not successfully sequenced in some taxa are also indicated in this 35 table). All sequences were deposited in GenBank (accession numbers GU736412– GU736579). Multiple alignments were performed (see Appendix S1) and all alignments are available in TREEBASE (http://www.treebase.org).

Phylogenetic analysis The African species, B. schimperi and B. pachyloma, were chosen as the most appropriate outgroup for this phylogenetic analysis (Kim et al., 1999). To assess recent common ancestry, putative sister taxa (the Central American species B. pilosa and B. alba, and two undescribed species from the Marquesas) were included in the ITS phylogeny to test for multiple origins of the Hawaiian clade. North American temperate Bidens are more closely related to North American temperate Coreopsis (Asteraceae) and Thelesperma (Asteraceae) (Crawford et al., 2009). Therefore, we excluded all North American temperate Bidens species from this study. However, including them in a separate analysis made no difference in terms of the monophyly of the Hawaiian clade and the general conclusions of this work. For the 13 additional species for which we included ITS data from GenBank, the corresponding data for these species were not available in GenBank for the other five loci we examined. Therefore, for these five loci, we limited our analyses to the 19 Hawaiian Bidens species, their subspecies, and the Central American and African species. Phylogenetic relationships were assessed by maximum likelihood (ML) in PAUP* 4.0 (Swofford, 2002), and by Bayesian inference

(BI) implemented in MRBAYES 3.1.2 (Ronquist & Huelsenbeck, 2003). The total number of characters, number of variable characters, number of parsimony informative characters, and ML corrected pairwise sequence divergences were calculated in PAUP*. Pairwise ML corrected genetic distances were calculated for Hawaiian and non-Hawaiian species, respectively.

Statistical confidence in nodes was assessed by bootstrapping with 1000 pseudoreplicates and ‘FAST’ stepwise-addition (Felsenstein, 1985) for ML analyses and by Bayesian posterior probability values for BI analyses (Ronquist & Huelsenbeck,

2003). For the ML and BI analyses, MODELTEST 3.8 (Posada & Crandall, 1998), with the 36 default parameters, was used to determine the appropriate model of sequence evolution for each locus independently. The Akaike information criterion (AIC) and Bayesian information criterion (BIC) were used to discriminate among the 56 progressively more complex models of nucleotide evolution. The best-fit model for each locus is as follows: ITS = SYM+Γ+I; ETS = TVM+Γ; trnV–ndhC = K81uf; rpl32f–trnL = K81uf+Γ; trnQ– rps16 = K81uf; and rpl32r–ndhF = K81uf+Γ. ML analysis was conducted with a heuristic search option with random, stepwise additions and tree bisection–reconnection (TBR) branch swapping. When searches converged on more than one tree, a single strict consensus tree was generated. Using the model of substitution determined by BIC, the BI analysis was implemented with starting trees chosen by random selection and the analysis was run for 10,000,000 generations, sampling every 100 generations.

Estimation of age of most recent common ancestor Age of the most recent common ancestor (MRCA) was calculated by Bayesian inference in BEAST 1.4.8 (Drummond & Rambaut, 2007) using the ITS sequence database with biogeographical calibration (Ho & Phillips, 2009). Biogeographical calibration was based on data from Clague et al. (2010), which indicates that after the submergence of Koko Seamount at c. 33 Ma there was a period of c. 4 Myr when there were no emergent islands and thus no opportunity for colonization. Thus a new cycle of colonization began between c. 29 Ma and c. 23 Ma (Clague et al., 2010), making 29 Ma, the most conservative value for our calculations. Note, however, that alternative views exist (Heads, 2011). The approximate age of the MRCA of the Hawaiian clade was inferred by using the mean rate of nucleotide substitution (0.00413 substitutions site-1 Myr-1-1) for ITS in herbaceous angiosperms (Kay et al., 2006) with the 29 Ma maximum and a uniform distribution prior. Kay et al. (2006) report that while ITS substitution rates varied by approximately an order of magnitude across 28 angiosperm lineages, there was much less variation within life-history categories. Consequently, we restricted our estimates of the rate of molecular substitution in ITS to values given for herbaceous plants, as the vast majority of Bidens species are herbaceous (with some secondary woodiness among the Hawaiian taxa; Carlquist, 1974). The GTR+Γ+I nucleotide substitution model with 37 empirical base frequencies and eight rate categories was used in BEAST to best match the ML model of the ITS data. The age of MRCA of the Hawaiian Bidens was estimated in

BEAST. Three independent chains of 10,000,000 iterations were run and combined in

LOGCOMBINER 1.4.8 (Drummond & Rambaut, 2007). The effective sample size (ESS; the number of independent samples in the trace) for the age of MRCA of Hawaiian Bidens was 11,440, considerably higher than the recommended ESS cut-off value of 100 (Drummond & Rambaut, 2007). A molecular clock likelihood ratio test (Felsenstein, 1981) showed uniformity in substitution rate across the entire phylogeny.

Estimation of diversification rates To estimate diversification rates, we used Magallón & Sanderson’s (2001) method, which allows for direct comparison among clades that underwent diversification recently (as compiled in Table 1 of Valente et al., 2010; see also Appendix S2 for discussion of

alternative diversification rate equations). Thus, diversification rate ( ε) was calculated as follows:

where ε is defined as ε = µ/λ, and µ is the extinction rate and λ is the speciation rate; the t variable corresponds to the time after the origin of the clade, here the present; and n is the standing species diversity of the clade at time t. We implemented this estimation in the R package GEIGER (Harmon et al., 2008). Following Magallón & Sanderson (2001), we calculated diversification rates for crown groups at two extremes of the relative extinction rate (ε = 0, no extinction; and ε = 0.9, high rate of extinction), and used the age estimates for MRCA based on the Bayesian 95% highest posterior density intervals of the BEAST analysis for the mean angiosperm ITS substitution rate.

RESULTS Phylogeny and genetic distances 38

The monophyly of Hawaiian Bidens is well supported with high ML bootstrap and BI posterior probability values (Fig. 2; Appendix S3). Tree topologies were nearly identical in both analyses, therefore only the ML trees are shown. However, both bootstrap values and posterior probabilities are given at each node (Fig. 2; Appendix S3). Of the 5400 bp examined per individual across all the Pacific, African, and American species we analysed, 475 bp were variable and 277 of those were parsimony informative. In contrast, within the Hawaiian species alone, there were only 143 bp differences, of which only 55 bp were parsimony informative. Similarly, the maximum ITS pairwise genetic distance (maximum likelihood corrected) within the 19 Hawaiian species was 0.8%, whereas across all 35 Bidens species in this study, the maximum genetic distance was 15.6%. Other loci examined show a similar pattern, with extremely small genetic distances between Hawaiian species and much greater genetic distances across all species (Appendix S3). In the ITS phylogeny (Fig. 2), the ML bootstrap values for nodes uniting taxa outside of Hawaii are generally high, including the node connecting all taxa in the Hawaiian radiation and the two Marquesan species included in this study (see Appendix S2 for supplemental discussion of Marquesan species and direction of colonization).

Age and rate of diversification Enforcing the molecular clock does not significantly add length to the ITS tree (chi- square test; P > 0.05). Using the mean ITS substitution rate for herbaceous Angiosperms (Kay et al., 2006) and a 29 Ma maximum (Clague et al., 2010), the Bayesian 95% highest posterior density intervals estimate the MRCA of the Hawaiian clade to be 1.3 Ma to 3.1 Ma, with a mean age of 2.1 Ma (Table 1). Based on these ages and assuming no extinction, diversification rate is 0.9–2.3 species Myr-1. Accounting for extinction by setting the speciation/extinction rate = 0.9, which is considered a relatively high value (Magallón & Sanderson, 2001), we estimate net diversification rate to be 0.3–0.8 species Myr-1. On a per-unit-area basis, we estimate diversification rate to be 4.8 × 10-5–1.3 × 10-4 species Myr-1 km-2, or 0.7 × 10-2 –5.4 × 10-1 species Myr-1 log(km-2), incorporating the range of both estimates above; with and without extinction.

DISCUSSION Hawaiian Bidens show a great deal of divergence in morphological and ecological characters (Gillett, 1975; Ganders & Nagata, 1984; Carr, 1987; Ganders et al., 2000). In contrast, we demonstrate here that rapidly evolving nuclear and plastid loci show little divergence among these species (Fig. 2; Appendix S1). Our results indicate that Hawaiian Bidens have undergone, on a per-unit-area basis, one of the most rapid adaptive radiations yet documented for flowering plants (Table 1).

Comparison of diversification rates Estimated diversification rates for angiosperms as a whole range from 0.078 to 0.091 net speciation events per Myr (Magallón & Castillo, 2009). In this context, the diversification rate we estimate for Hawaiian Bidens (0.3–2.3 species Myr-1) is exceptionally high, approaching that of Andean Lupinus (1.3–3.8 species Myr-1; Hughes & Eastwood, 2006, as recalculated by Valente et al., 2010) and Eurasian Dianthus (Caryophyllaceae) (2.2– 7.6 species Myr-1; Valente et al., 2010). However, both of these radiations were continental and occurred over much larger geographical areas. To compare diversification rates on a per-unit-area basis, we calculated the area of the Andean Lupinus and Eurasian Dianthus radiations based on the area of the minimum convex polygon of the distributions given in Hughes & Eastwood (2006) and Valente et al.

(2010), respectively, using ARCGIS 9.2 (Table 1). For Bidens, we used the area of the Hawaiian Archipelago (16,644 km2) given in Price (2004). For Lupinus, only the main southern portion of their Andean distribution was used, giving a conservative estimate of 970,950 km2 (see Figure 1 in Hughes & Eastwood, 2006). For Dianthus, area was calculated using their Eurasian distribution, estimated at 45,310,246 km2 (see Fig. S2 in Data Supplement in Valente et al., 2010). When considered on a per-unit-area basis, the radiation of Hawaiian Bidens (4.8 x 10-5–1.3 x 10-4 species Myr-1 km-2) is one to four orders of magnitude faster than that of Andean Lupinus (1.3–3.9 x 10-6 species Myr-1 km- 2) and of Eurasian Dianthus (4.9 × 10-8–1.7 × 10-7), although the three radiations have similar per-unit-log(area) rates [Hawaiian Bidens: 0.7 × 10-2–5.4 × 10-1 species Myr-1

40 log(km-2); Andean Lupinus: 2.2–6.3 × 10-1 species Myr-1 log(km-2); and Eurasian Dianthus: 2.9–9.9 × 10-1 species Myr-1 log(km-2)].

When area is not considered, the diversification rates of the Macaronesian Echium (Boraginaceae) (García-Maroto et al., 2009) and South African Cape Floral Region Ruschiodeae (stone plants) (Klak et al., 2004) radiations are not as rapid as the Hawaiian Bidens, Andean Lupinus, or Eurusian Dianthus radiations (Table 1). However, the Macaronesian and South African radiations occurred over small areas, comparable in scale to Hawaii. Using the areas of the Macaronesian archipelago and the Cape Floral Region of South Africa taken from the literature (Sundseth, 2000; McGinley, 2008), we find that, on a per-unit-area basis, the Hawaiian Bidens and Macaronesian Echium radiations have similar per-unit-area diversification rates (Macaronesian Echium: 3.9 × 10-5–1.4 × 10-4 species Myr-1 km-2 and 0.1–3.8 × 10-1 species Myr-1 log(km-2)). The other plant adaptive radiations listed in Valente et al. (2010; Table 1 therein) are less rapid and are found over larger areas than Hawaiian Bidens.

Thus far, relatively few plant groups have been subjected to rigorous analyses of diversification rates. Many other groups warrant detailed examinations. For example, Hawaiian Cyrtandra (Gesneriaceae) has 58 species, which evolved from a single colonist and have high morphological diversity (Cronk et al., 2005). Hawaiian Tetramolopium has 11 species and little divergence at ITS (Lowrey et al., 2001). Hawaiian lobeliads display greater antiquity (c. 13 Myr) than Hawaiian Bidens, but they are composed of 126 extant species in six genera (Givnish et al., 2008). Tolpis (Asteraceae) in the Canary Islands comprises nine species and show no ITS divergence (Mort et al., 2007). Finally, Scalesia (Asteraceae) in the Galápagos Islands are composed of 15 morphologically diverse species. Although Schilling et al. (1994) reported age estimates for the most recent common ancestor of the Scalesia radiation, their estimates are based on chloroplast restriction site data, which are no longer considered reliable for age estimation (Rutschmann, 2006). Future research on diversification rates of these and other clades should help in understanding how rapidly plant radiations may occur. 41

Ecological limits of species numbers It is important to note that calculation of diversification rates depends on several assumptions. For example, Rabosky (2009) argued that inferences about diversification rates are compromised by the often erroneous assumption that species richness has increased unbounded through time. Ecological limits on diversity may be common (Rabosky, 2009; Ricklefs, 2009), and current species richness may therefore not be correlated with diversification rates. Biogeographical evidence suggests that Hawaiian Bidens may have already reached ecological limits on some of the islands. Specifically, the drop in species richness from Maui Nui to Hawaii may indicate inadequate time for species richness to reach ‘carrying capacity’ on Hawaii, as argued for Tetragnatha (Tetragnathidae) spiders by Gillespie (2004) and for Cyanea lobeliads by Givnish et al. (2008). If so, this drop indicates ecological saturation on the older islands (Whittaker et al., 2008). In addition, unrecorded extinction events may further complicate estimation of diversification rates. Even so, relative diversification rates should be comparable among clades of the same or similar age, such as those we discussed above. Furthermore, even if one cannot be certain about true diversification rates, estimated rates for young clades such as Hawaiian Bidens can be informative in showing how rapid diversification may have been.

Temporal changes in area The size of habitable areas has changed over time due to the rise and fall of sea level, shifts in climate, tectonic uplift and erosion, and, in the case of Hawaii and Macaronesia, the geological dynamics of volcanic islands (Whittaker et al., 2008). It is therefore important to consider temporal changes in habitable area in assessing the effect of area on speciation rates. For example, the island of Hawaii, which accounts for 62% (10,433 km2) of the present day area of the entire Hawaiian archipelago, is the youngest of the islands at c. 0.5 Ma (Price & Clague, 2002). Additionally, Maui Nui (c. 2 Myr old) as a single island obtained its maximum area c. 1.2 Ma (Price & Elliot-Fisk, 2004). Yet at no point in the history of the Hawaiian Islands relevant to the Bidens radiation (1.3–3.1 Ma to 42 present) has the total habitable area been significantly greater than today (Carson & Clague, 1995; Price & Clague, 2002; Price & Elliot-Fisk, 2004). Therefore, the diversification rate per-unit-area that we calculate for the Hawaiian Bidens radiation may err on the conservative side. The only other plant radiation whose estimated diversification rate is similar to that of the Hawaiian Bidens on a per-unit-area basis is the Macaronesian Echium (Table 1). We therefore focus here on the changes in historically available area in Macaronesia. Similar to the Hawaiian Islands, the Canary Islands (which comprise the majority of the land area in the Macaronesian island chain) are a group of intraplate oceanic-island volcanoes and are considered to be the result of an upwelling mantle plume or hotspot (Carracedo & Day, 2002; Fernández-Palacios et al., 2011). Also, similar to Hawaii they display a general age progression from east to west (Carracedo & Day, 2002). However, in contrast to the Hawaiian Islands, in the time frame relevant to the Echium radiation (García-Maroto et al., 2009), the present-day Macaronesian islands are smaller than their maximum historical extent (Fernández-Palacios et al., 2011), supporting the conclusion that Hawaiian Bidens had similar or higher per-unit-area rates of diversification relative to Macaronesian Echium. Lastly, while geological and climatic changes in Eurasia and the Andes Mountains undoubtedly resulted in dramatic changes in the total habitable area of the Dianthus and Lupinus adaptive radiations, respectively, these changes are unlikely to have been large enough to affect our general conclusions regarding relative per-unit-area rates of adaptive radiation, as total habitable area would have had to change (on average) by orders of magnitude from present day conditions and relative to the other radiations under consideration (Table 1).

Mode and mechanism of speciation What has made the Hawaiian Bidens rapid radiation possible within such a small area? Three inter-related factors may be of particular importance. First, the majority (about 85%) of all possible interspecific hybrid combinations, which can be easily formed in cultivation, are prevented by geographical isolation among natural populations (Ganders & Nagata, 1984). This high level of geographical isolation may have also been caused or maintained by the relative paucity of animal seed-dispersers in Hawaii. This second 43 factor, the lack of these dispersal agents (particularly mammals), may have eliminated the adaptive potential of achene awns (slender, bristle-like appendages) found in mainland relatives, thus catalysing the loss of long-distance dispersal potential in achenes (Carlquist, 1974). The loss of dispersal potential is known in many island lineages of plants, insects and birds (Carlquist, 1974), and would correspondingly result in a further reduction in gene flow. Loss of dispersability may be favoured by selection, as dispersal off the island is likely to result in the loss of the organism and/or propagules in the large area of surrounding ocean. The ancestor of the Hawaiian Bidens most probably arrived attached to a sea bird, but this kind of transit is unpredictable and prone to failure as far as seed dispersal is concerned. Therefore, there would be little adaptive advantage to possessing mechanisms for seed dispersal away from the place where the parents have survived and reproduced successfully (Carlquist, 1980). Third, the Hawaiian Islands are characterized by high habitat heterogeneity (Carlquist, 1980; Ziegler, 2002), which may result in strong diversifying selection.

These factors may provide reasons to expect radiation in Hawaii, but they may not fully explain why, among the Hawaiian clades, the rate of Bidens evolution has been especially rapid. One potential explanation concerns high variation in dispersal ability among Bidens species worldwide. Dispersal by the species ancestral to the Hawaiian radiation must have been quite efficient, because the genus has reached (by natural means) many of the smaller islands of Polynesia, as well as the Hawaiian archipelago. However, all extant Pacific island species now have reduced dispersal ability (Carlquist, 1974). Additionally, while most species of Hawaiian Bidens are single island endemics and do not disperse beyond a small area, a few are widespread within the archipelago and appear to have retained a moderate level of dispersal ability, based on achene morphology (Carlquist, 1974). Thus, it may be that the rapid radiation was facilitated by those ancestral species that retained inter-island dispersal potential, which, after coastal colonization, gave rise to poorly dispersed species adapted to the interior of islands. We suggest that new studies of diversification in Hawaiian Bidens should include evolutionary genetic studies of morphology and physiology such as those undertaken for 44

Hawaiian Tetramolopium (Whitkus et al., 2000). Such a study could elucidate the genetic basis for achene diversification including the loss of dispersal ability.

Alternative explanations We interpret the high morphological diversity combined with lack of genetic divergence in the Hawaiian Bidens as evidence for recent, rapid diversification. There are three alternative interpretations for the rapid rate of diversification in Bidens beyond those we have suggested, although none of them fully explains our results. First, hybridization and ongoing gene flow across all species could potentially occur, as all taxa are fully allogamous (cross-fertile) in the laboratory (Ganders & Nagata, 1984). As mentioned above this is unlikely as most species are allopatric and 19 of the 27 taxa (70%) are single island endemics. Further, Ganders & Nagata (1984) estimated that allopatry due to habitat and ecological isolation (differences in flowering phenology or pollination mode) prevents natural hybridization in 93% of all possible interspecific combinations of Hawaiian Bidens. Another factor that may have an effect is stabilizing selection, which theoretically could be operating on all of the regions sequenced in this study to prevent differentiation. Again, this does not seem likely as all regions used are non-protein coding, presumed neutral, and rapidly evolving across all plant families studied (Baldwin & Markos, 1998; Kay et al., 2006; Mort et al., 2007; Shaw et al., 2007). Finally, the rates of molecular evolution for ITS may have been unusually slow in the Hawaiian clade. We reject this hypothesis based on the results of our molecular clock test, which demonstrated a uniform rate of nucleotide substitution across all taxa, including 16 American and African Bidens species. Our study results are also consistent with those of Bromham & Woolfit (2004), who reviewed changes in substitution rate for island species radiations compared to their continental relatives and found no evidence for change in substitution rates in island lineages.

Species delineation While taxonomic assignments are not the focus of this study, the close molecular relationships among Hawaiian taxa raise questions about the proper treatment of these 45 species. For example, is it possible that all Hawaiian Bidens should be considered just one species? Sherff (1937) recognized 43 species and more than 20 varieties and forms of endemic Hawaiian Bidens based largely on leaf characters. These traits are now considered unreliable taxonomic characters in this group (Gillett & Lim, 1970; Ganders & Nagata, 1984). At the opposite end of the spectrum, Gillett (1975) suggested that all Hawaiian Bidens should be included in just two species, based on their genetic compatibility in crossing experiments and their ability to hybridize. However the lack of interspecific crossing barriers is well known in insular taxa, particularly in the Asteraceae (Lowrey, 1995; Crawford et al., 2009), and current species delineation, which is based on morphology, ecology, and geographical data (Ganders & Nagata, 1984), proposes that there are 19 species and 8 subspecies of Hawaiian Bidens. Although all species are capable of hybridization in the laboratory (Ganders & Nagata, 1984), cross-compatibility is common in congeneric plants, as some species can remain compatible for at least 10 Myr (Parks & Wendel, 1990). In addition, all Hawaiian species display fixed heritable genetic differences and grow true to form in common garden experiments, demonstrating that phenotypic plasticity is not responsible for the diversity of the Hawaiian clade (Gillett & Lim, 1970). Therefore, we concur with Ganders & Nagata (1984) that there are 19 species and eight sub-species of Hawaiian Bidens despite the lack of genetic divergence at the loci we examined.

CONCLUSION The Hawaiian Bidens radiation is, on a per-unit-area basis, among the most rapid radiations documented to date among flowering plants on islands and continental areas. Further investigation into the role of the habitat heterogeneity of the Hawaiian Islands, the loss of long-distance dispersal ability, and other potential drivers of this diversification should provide new insights into this radiation. Further, as more data become available, diversification rates of taxa in young clades, such as Hawaiian Bidens, that have radiated within areas of well-described palaeoclimatic and geological histories should be instructive to evaluate assumptions about the factors that promote speciation and adaptive radiation. 46

ACKNOWLEDGEMENTS We thank Dan Crawford (University of Kansas), Fred Ganders (UBC), Gabriel Johnson (Smithsonian), Karen Shigematsu and Alvin Yoshinaga (Lyon Arboretum), Ken Wood and Mike DeMotta (Allerton NTBG) and Kawika Winters (Limahuli NTBG) for DNA or tissue donation; Dave Carlon, Ken Hayes, Shaobin Hou and Gabriel Johnson for assistance with DNA sequencing; Yi ‘Apollo’ Qi for assistance with ARCGIS; Gerry Carr and Pasha Feinberg for image preparation; Pat Aldrich, Stephanie Dunbar-Co, Shama Hinard, Jeffrey Knope, Tatiana Kutynina, Kathy McMillen, Kurtis McMillen, Colin Olito, Hank Oppenheimer and Maggie Sporck for assistance in the field; and Melinda Belisle, Rodolfo Dirzo, Liz Hadly, Shama Hinard, Olivia Isaac, Sterling Keeley, Jeffrey Knope, Jonathan Payne, Cindy Sayre, Peter Vitousek, Ward Watt, Belinda Wheeler, and Robert J. Whittaker for comments. Funding was provided in part by a University of Hawaii Ecology, Evolution, and Conservation Biology Research Grant Award to M.L.K. (National Science Foundation GK12 Fellowship Grant # DGEO2-32016 to K.Y. Kaneshiro) and support from the Department of Zoology, University of Hawaii, Manoa and the Department of Biology, Stanford University.

REFERENCES Baldwin, B.G. & Carr, G.D. (2005) Dubautia kalalauensis, a new species of the Hawaiian silversword alliance (Compositae, Madiinae) from northwestern Kauai, U.S.A. Novon, 15, 259-263.

Baldwin, B.G. & Markos, S. (1998) Phylogenetic utility of the external transcribed spacer (ETS) of 18S–26S rDNA: congruence of ETS and ITS trees of Calycadenia (Compositae). Molecular Phylogenetics and Evolution, 10, 449-463.

Baldwin, B.G. & Sanderson, M.J. (1998) Age and rate of diversification of the Hawaiian silversword alliance (Compositae). Proceedings of the National Academy of Sciences USA, 95, 9402-9406.

Baldwin, B.G. & Wagner, W.L. (2010) Hawaiian angiosperm radiations of North American origin. Annals of Botany, 105, 849-879.

Bromham, L. & Woolfit, M. (2004) Explosive radiations and the reliability of molecular clocks: island endemic radiations as a test case. Systematic Biology, 53, 758-766.

Carlquist, S. (1974) Island biology. Columbia University Press, New York.

Carlquist, S. (1980) Hawaii: a natural history. The Natural History Press, New York.

Carlquist, S., Baldwin, B.G. & Carr, G.D. (eds) (2003) Tarweeds and silverswords: evolution of the Madiinae (Asteraceae). Missouri Botanical Garden Press, Saint Louis, MO.

Carr, G.D. (1987) Beggar's ticks and tarweeds: masters of adaptive radiation. Trends in Ecology and Evolution, 2, 192-195.

Carracedo, J.C. & Day, S. (2002) Classic geology in Europe 4: Canary Islands. Terra Publishing, Harpenden, U.K.

Carson, H.L. & Clague, D.A. (1995) Geology and biogeography. Hawaiian biogeography: evolution on a hotspot archipelago (ed. by W.L Wagner and V.A. Funk), pp. 14–29. Smithsonian Institution Press, Washington, DC.

Clague, D.A., Braga, J.C., Bassi, D., Fullagar, P.D., Renema, W. & Webster, J.M. (2010) The maximum age of Hawaiian terrestrial lineages: geological constraints from Koko Seamount. Journal of Biogeography, 27, 1022-1033.

Crawford, D.J., Mesfin, T., Mort, M.E., Kimball, R.T. & Randle, C.P. (2009) Coreopsideae. Systematics, evolution, and biogeography of Compositae (ed. by V.A. Funk, A. Susanna, T. Stuessy and R. Bayer), pp. 713-730. IAPT, Vienna.

Cronk, Q.C.B., Kiehn, M., Wagner, W.L. & Smith, J.F. (2005) Evolution of Cyrtandra (Gesneriaceae) in the Pacific Ocean: the origin of a supertramp clade. American Journal of Botany, 92, 1017-1024.

Darwin, C. (1859) The origin of species. Oxford University Press, New York.

Drummond, A.J. & Rambaut, A. (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology, 7, 214.

Fernández-Palacios, J.M., de Nascimento, L., Otto, R., Delgado, J.D., Garcia-del-Rey, E., Arévalo, J.R., & Whittaker, R.J. (2011) A reconstruction of Palaeo-Macaronesia, with particular reference to the long-term biogeography of the Atlantic island laurel forests. Journal of Biogeography, 38, 226-246.

Felsenstein, J. (1981) Evolutionary trees from DNA sequences: A maximum likelihood approach. Journal of Molecular Evolution, 17, 368-376.

Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39, 83-91.

Ganders, F.R. & Nagata, K.M. (1984) The role of hybridization in the evolution of Bidens in the Hawaiian Islands. Plant Biosystematics (ed. by W.F. Grant), pp. 179- 194. Chapman and Hall, New York.

Ganders, F.R., Berbee, M., & Pirseyedi, M. (2000) ITS base sequence phylogeny in Bidens (Asteraceae): evidence for the continental relatives of Hawaiian and Marquesan Bidens. Systematic Botany, 25, 122-133.

García-Maroto, F., Mañas-Fernández, A., Garrido-Cárdenas, J.A., López-Alonso, D., Guil-Guerrero, J.L., Guzmán, B. & Vargas, P. (2009). Δ6-Desaturase sequence evidence for explosive Pliocene radiations within the adaptive radiation of Macaronesian Echium (Boraginaceae). Molecular Phylogenetics and Evolution 52, 563-574.

Gavrilets, S. & Vose, A. (2005) Dynamic patterns of adaptive radiation. Proceedings of the National Academy of Sciences USA, 102, 18040-18045.

Gillespie, R.G. (2004) Community assembly through adaptive radiation in Hawaiian spiders. Science, 303, 356–359

Gillespie, R.G. & Baldwin, B.G. (2010) Island biogeography of remote archipelagoes. The theory of island biogeography revisited (ed. by J.B. Losos and R.E. Ricklefs), pp. 358-387. Princeton University Press, Princeton, NJ.

Gillett, G.W. (1975) The diversity and history of Polynesian Bidens. Harold L. Lyon Arboretum Lecture Number 6, University of Hawaii, Honolulu.

Gillett, G.W. & Lim, E.K.S. (1970) An experimental study of the genus Bidens (Asteraceae) in the Hawaiian Islands. University of California Publications in Botany, 56, 1-63.

Givnish, T.J., Millam, K.C., Mast, A.R., Patterson, T.B., Theim, T.J., Hipp, A.L., Henss, J.M., Smith, J.F., Wood, K.R., & Sytsma, K.J. (2008) Origin, adaptive radiation and diversification of the Hawaiian lobeliads (Asterales: Campanulaceae). Proceedings of the Royal Society B: Biological Sciences, 1656, 407-416.

Hall, A.R., Griffiths, V.F., MacLean, R.C., & Colegrave, N. (2010) Mutational neighbourhood and mutation supply rate constrain adaptation in Pseudomonas aeruginosa. Proceedings of the Royal Society B: Biological Sciences, 277, 643-650.

Harmon, L.J., Weir, J.T., Brock, C.D., Glor, R.E., & Challenger, W. (2008) GEIGER: investigating evolutionary radiations. Bioinformatics, 24, 129-131.

Heads, M. (2011) Old taxa on young islands: a critique of the use of island age to date island-endemic clades and calibrate phylogenies. Systematic Biology, 60, 204-218.

Helenurm, K. & Ganders, F.R. (1985) Adaptive radiation and genetic differentiation in Hawaiian Bidens. Evolution, 39, 753-765.

Ho, S.Y.W. & Phillips, M.J. (2009) Accounting for calibration uncertainty in phylogenetic estimation of evolutionary divergence times. Systematic Biology, 58, 367-380.

Hughes, C. & Eastwood, R. (2006) Island radiation on a continental scale: exceptional rates of plant diversification after uplift of the Andes. Proceedings of the National Academy of Sciences USA, 103, 10334-10339. 50

Kay, K.M., Whittall, J.B. & Hodges, S.A. (2006) A survey of nuclear ribosomal internal transcribed spacer substitution rates across angiosperms: an approximate molecular clock with life history effects. BMC Evolutionary Biology, 6, 1-9.

Keeley, S.C. & Funk, V.A. (2011) Origin and evolution of Hawaiian endemics: New patterns revealed by molecular phylogenetic studies. The biology of island floras (ed. D. Bramwell), pp. 57-88. Cambridge University Press, Cambridge.

Kim, S., Crawford, D.J., Tadesse, M., Berbee, M., Ganders, F.R., Pirseyedi, M. & Esselman, E.J. (1999) ITS sequences and phylogenetic relationships in Bidens and Coreopsis (Asteraceae). Systematic Botany, 24, 480-493.

Klak, C., Reeves, G. & Hedderson, T. (2004). Unmatched tempo of evolution in southern African semi-desert ice plants. Nature, 427, 63-65.

Lack, D. (1947) Darwin’s finches. Cambridge University Press, Cambridge.

Lenski, R.E., Rose, M.R., Simpson, S.C. & Tadler, S.C. (1991) Long-term experimental evolution in Escherichia coli. I. Adaptation and divergence during 2,000 generations. The American Naturalist, 138, 1315-1341.

Losos, J.B. & Parent, C.E. (2010) The speciation area relationship. The theory of island biogeography revisited (ed. by J.B. Losos and R.E. Ricklefs), pp. 415-438. Princeton University Press, Princeton, NJ.

Losos, J.B. & Schluter, D. (2000) Analysis of an evolutionary species-area relationship. Nature, 408, 847-850.

Lowrey, T.K. (1995) Phylogeny, adaptive radiation, and biogeography of Hawaiian Tetramolopium (Asteraceae: Astereae). Hawaiian biogeography: evolution on a hotspot archipelago (ed by W.L. Wagner and V.A. Funk), pp. 195-220. Smithsonian Institution Press, Washington, DC.

Lowrey, T.K., Quinn, C.J., Taylor, R.K., Chan, R., Kimball, R., & De Nardi, J.C. (2001) Molecular and morphological reassessment of relationships within the Vittadinia group of Astereae (Asteraceae). American Journal of Botany, 88, 1279-1289. 51

MacArthur, R.H. & Wilson, E.O. (1967) The theory of island biogeography. Princeton University Press, Princeton, NJ.

Magallón, S. & Castillo, A. (2009) Angiosperm diversification through time. American Journal of Botany, 96, 349-365.

Magallón, S. & Sanderson, M.J. (2001) Absolute diversification rates in angiosperm clades. Evolution, 55, 1762-1780.

McGinley, M. (2008) Cape floral protected areas, South Africa. Encyclopedia of Earth (ed. by C.J. Cleveland). http://www.eoearth.org/articles/view/150894 (accessed 26 December, 2011).

Mort, M.E., Archibald, J.K., Randle, C.P., Levsen, N.D. O’Leary, T.R., Tapalov, K., Wiegand, C.M., & Crawford, D.J. (2007) Inferring phylogeny at low taxonomic levels: utility of rapidly evolving cpDNA and nuclear ITS loci. American Journal of Botany, 94, 173-183.

Parks, C.R. & Wendel, J.F. (1990) Molecular divergence between Asian and North American species of Liriodendron (Magnoliaceae) with implications for interpretation of fossil floras. American Journal of Botany, 77, 1243-1256.

Posada, D. & Crandall, K.A. (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics, 14, 817-818.

Price, J.P. (2004) Floristic biogeography of the Hawaiian Islands: influences of area, environment, and palaeogeography. Journal of Biogeography, 31, 487-500.

Price, J.P. & Clague, D.A. (2002) How old is the Hawaiian biota? Geology and phylogeny suggests recent divergence. Proceedings of the Royal Society B: Biological Sciences, 269, 2429-2435.

Price, J.P. & Elliot-Fisk, D.L. (2004) Topographic history of the Maui Nui complex, Hawaii, and its implications for biogeography. Pacific Science, 58, 27-45.

Price, J.P. & Wagner, W.L. (2004) Speciation in Hawaiian angiosperm lineages: cause, consequence, and mode. Evolution, 58, 2185-2200. 52

Rabosky, D.L. (2009) Ecological limits and diversification rate: alternative paradigms to explain the variation in species richness among clades and regions. Ecology Letters, 12, 735-743.

Ricklefs, R.E. (2009) Speciation, extinction, and diversity. Ecology and speciation (ed. by R. Butlin, J. Bridle, and D. Schluter), pp. 257-277. Cambridge University Press, Cambridge.

Ricklefs, R.E. & Lovette, I.J. (1999) The roles of island area per se and habitat diversity in the species-area relationships of four Lesser Antillean faunal groups. Journal of Animal Ecology, 68, 1142-1160.

Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572-1574.

Rosenzweig, M.L. (1995) Species diversity in space and time. Cambridge University Press, Cambridge.

Rutschmann, F. (2006) Molecular dating of phylogenetic trees: a brief review of current methods that estimate divergence times. Diversity and Distribution, 12, 35-48.

Schilling, E.E., Panero, J.L., & Eliasson, U.H. (1994) Evidence from chloroplast DNA restriction site analysis on the relationships of Scalesia (Asteraceae: Heliantheae). American Journal of Botany, 81, 248-254.

Schluter, D. (2000) The Ecology of Adaptive Radiation. Oxford University Press, Oxford, UK.

Seehausen, O. (2006) African cichlid fish: a model system in adaptive radiation research. Proceedings of the Royal Society B: Biological Sciences, 273, 1987-1998.

Shaw, J., Lickey, E.B., Schilling, E.E., & Small, R.L. (2007) Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in Angiosperms: the tortoise and the hare III. American Journal of Botany, 94, 275-288.

Sherff, E.E. (1937) The genus Bidens. Field Museum of Natural History, Botanical Series, 16, 1-721.

Sundseth, K. (2000) Natura 2000 in the Macaronesian Region. Office for official publications of the European communities, Luxembourg, Belgium.

Swofford, D.L. (2002) PAUP*: phylogenetic analysis using parsimony (*and other methods). Sinauer Associates, Sunderland, MA.

Valente, L.M., Savolainen, V. & Vargas, P. (2010) Unparalleled rates of species diversification in Europe. Proceedings of the Royal Society B: Biological Sciences, 359, 265–274.

Wagner, W.L. & Funk V.A. (eds) (1995) Hawaiian biogeography: evolution on a hot spot archipelago. Smithsonian Institution Press, Washington, DC.

Wagner, W.L., Herbst, D.R. & Sohmer, S.H. (eds) (1999) Manual of the flowering plants of Hawaii, revised edition. University of Hawaii Press, Honolulu, HI.

Whitkus, R., Doan, H. & Lowrey, T.K. (2000) Genetics of adaptive radiation in Hawaiian species of Tetramolopium (Asteraceae). III. Evolutionary genetics of sex expression. Heredity, 85, 37-42.

Whittaker, R.J., Triantis, K.A. & Ladle, R.J. (2008) A general dynamic theory of oceanic island biogeography. Journal of Biogeography, 35, 977-99.

Ziegler, A.C. (2002) Hawaiian natural history, ecology, and evolution. University of Hawai'i Press, Honolulu, HI.

SUPPORTING INFORMATION

Additional Supporting Information may be found in the online version of this article:

Appendix S1 Taxa sampled and molecular markers used in this study.

Appendix S2 Molecular methods and estimation of diversification rates. 54

Appendix S3 Maximum likelihood phylograms of ETS and cpDNA markers.

As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.

BIOSKETCH

Matthew L. Knope is a PhD. candidate in the Department of Biology at Stanford University with specialization in ecology, evolution, and population biology. His primary research interests are in the patterns and drivers of adaptive radiation.

Author contributions: M.L.K. and T.F. designed research. M.L.K., C.W.M., and V.A.F. performed research. M.L.K. analysed data. M.L.K. and T.F. wrote the paper.

Editor: Jorge Crisci

TABLE

Table 1 Rates of diversification of Hawaiian Bidens in comparison to the other taxa documented as the most rapid plant radiations to date. Estimates are based on 95% highest posterior density intervals of the age estimates reported for each taxon.

Diversification No. Taxon and Clade Diversification Diversification rate per unit spp. geographical age Area (km2) rate (species rate per unit area (log) area Citation in region (Myr) Myr-1) (species yr-1 km-2) (species Myr-1 clade (log)km-2)

Hawaiian Bidens 19 1.3–3.1 16644 0.3–2.3 4.8-5–1.3-4 0.7-2–5.4-1 This study

Eurasian Valente et Dianthus 200 1.9–7.0 45310246 2.2–7.6 4.9-8–1.7-7 2.9–9.9-1 al. (2010)

Andean Hughes & Lupinus Eastwood 81 1.2–1.8 970950 1.3–3.8 1.3–3.9-6 2.2–6.3-1 (2006)

Macaronesian García- Echium Maroto et 19 2.7–3.9 10372 0.4–1.5 3.9-5–1.4-4 0.1–3.8-1 al. (2009) Cape Floral Region Klak et al. Ruschioideae 1563 3.8–8.7 90000 0.8–1.8 8.9-6–2.0-5 1.6–3.6-1 (2004)

FIGURE LEGENDS

Figure 1 Representative Hawaiian Bidens species showing a sample of the morphological and ecological variation found among species. Clockwise from left: (a) B. hillebrandia (photo credit: Forest and Kim Starr); (b) B. cosmoides (photo credit: C.H. Lamourex); (c) B. amplectens (photo credit: C.H. Lamourex); (d) B. sandvicensis confusa (photo credit: M.L. Knope); (e) B. mauiensis (photo credit: G.D. Carr); (f) B. hawaiensis (photo credit: C.H. Lamourex); and (g) B. alba radiata (Central American species in basal sister clade to Hawaiian species) (photo credit: J.C. Knope).

Figure 2 Maximum likelihood phylogram based on DNA sequences of the nuclear internal transcribed spacer (ITS) marker for Hawaiian ingroup and non-Hawaiian outgroup Bidens species. Accession numbers follow those taxa where the ITS data was downloaded from GenBank. Branch lengths represent genetic distances. Numbers above lines are maximum likelihood bootstrap support values (1000 replicates) to left and Bayesian posterior probabilities to right. The red arrow depicts the basal node of the Hawaiian radiation.

Figure 1

Figure 2

SUPPORTING INFORMATION

Area and the rapid radiation of Hawaiian Bidens (Asteraceae)

Matthew L. Knope, Clifford W. Morden, Vicki A. Funk and Tadashi Fukami

Journal of Biogeography

Appendix S1 Bidens taxa sampled and molecular markers used in this study. Taxa represented in the phylogenetic analysis in alphabetical order with abbreviation, corresponding sampling locations, number of individuals sampled and number of bases analysed per individual for each of the six loci used. Bidens alba radiata and Bidens pilosa are Central American species recently introduced to Hawaii, where they were collected. Abbreviations are as follows: 1Taxon abbreviation: first letter denotes genus name, followed by first three letters of specific epithet, followed by first two letters of subspecies (if applicable), except hybrids where first letter denotes genus name, second letter beginning of specific epithet, and third letter beginning of subspecies name; 2ITS, internal transcribed spacer; 3ETS, external transcribed spacer; 4trnQ, trnQ–rps16; 5trnV, trnV–ndhC; 6rpl32, rpl32–trnL; 7ndhF, ndhF–rpl32.

Collection Taxon 1Abbrev. Location No. 2ITS 3ETS 4trnQ 5trnV 6rpl32 7ndhF Bidens alba BALBRA KAUAI 2 632 1133 940 1072 665 994 Bidens amplectens BAMP OAHU 2 632 1133 940 1088 665 994 Bidens asymmetrica BASY OAHU 4 632 1133 940 1088 665 859 Bidens campylotheca BCAMCA OAHU 1 632 1133 821 1088 665 994 campylotheca Bidens campylotheca BCAMPE MAUI 1 632 1133 940 1088 551 737 pentamera Bidens cervicata BCER OAHU 1 632 1133 940 1088 665 637 Bidens conjuncta BCON MAUI 2 632 1133 646 1088 609 994 Bidens cosmoides BCOS KAUAI 1 632 1133 940 1088 665 853 Bidens forbesii forbesii BFORFO KAUAI 2 632 1133 940 1088 665 846 Bidens forbesii kahiliensis BFORKA KAUAI 1 632 1133 940 1088 665 994 Bidens hawaiensis BHAW HAWAII 1 632 1133 933 951 0 0 Bidens hillebrandia BHILPO HAWAII 2 632 1133 940 1088 665 994 polycephala Bidens menziesii filiformis × BMFxBMC HAWAII 3 632 1133 900 1088 0 783 Bidens micrantha ctenophylla Bidens macrocarpa BMAC OAHU 7 632 1133 940 1088 665 994 Bidens mauiensis BMAU MAUI 2 632 1133 940 1088 665 994 Bidens menziesii filiformis BMENFI HAWAII 1 632 1133 940 1085 665 994 Bidens menziesii menziesii BMENME MOLOKAI 2 632 1133 940 324 665 994 Bidens micrantha kalealaha BMICKA MAUI 1 632 1133 940 1088 665 994 Bidens micrantha ctenophylla BMICCT HAWAII 2 632 1133 940 793 665 994 Bidens molokaiensis BMOL MOLOKAI 2 632 1133 940 1088 646 783 Bidens pachyloma BPAC AFRICA 1 632 0 940 1045 0 994 Bidens pilosa BPIL OAHU 2 632 1133 846 1047 665 994 Bidens populifolia BPOP OAHU 1 401 1133 940 0 0 0 Bidens sandvicensis confusa BSANCO KAUAI 3 632 1133 940 1088 665 994 Bidens sandvicensis BSANSA KAUAI 5 632 1133 940 1088 665 994 sandvicensis Bidens shimperi BSHI AFRICA 1 632 0 940 0 643 844 Bidens torta BTOR OAHU 3 632 1133 940 1088 665 994 Bidens valida BVAL KAUAI 2 632 1133 940 1088 665 994 Bidens wiebkei BWIE MOLOKAI 3 632 1133 940 1088 551 722

Appendix S2 Molecular methods and estimation of diversification rates. Total genomic DNA was extracted from fresh tissue samples using standard DNeasy Plant Mini Kit preparation protocol (Qiagen Corp., Valencia, CA, USA). Double- stranded DNA was amplified in 25 µL volume reactions. Each polymerase chain reaction (PCR) contained 18.1 µL PCR water, 2.5 µL 10× Accuzyme Buffer (Bioline USA Inc.,

Taunton, MA, USA), 1 µL 10mM dNTP, 1 µL 25mM MgCl2, 1 µL 10mM of each primer for internal and external transcribed spacer (ITS and ETS) amplification and 0.5 µL 10mM of each primer for plastid loci amplifications and 0.3 µL Accuzyme DNA Polymerase (Bioline USA Inc., Taunton, MA, USA). Amplifications were obtained for ITS with the primer pair ITS-4 and ITS-5 (White et al., 1990). Reactions were run with an initial denaturation temperature of 96 °C for 2 min, and subsequent cycles at 96 °C for 60 s, 51 °C for 60 s, and 72 °C for 45 s with an additional 4 s each cycle, for 35 cycles. PCR was performed for the ETS locus with the primer pair 18S-ETS and ETS-Hel-1 (Baldwin & Markos, 1998). Thermal cycling was performed with an initial denaturation temperature of 94 °C for 2 min, and subsequent cycles at 94 °C for 60 s, 63 °C for 60 s, and 72 °C for 2 min with an additional 4 s each cycle, for 39 cycles and a final extension of 72 °C for 7 min. Amplifications were obtained for plastid loci with the following primer pairs: trnV(uacX2)– ndhC, rpl32f–trnL(uug), trnQ–rps16, and rpl32r–ndhF (Shaw et al., 2007). Reactions for plastid loci were run with an initial denaturation of 80 °C for 5 min, and subsequent cycles at 95 °C for 60 s, 50–55 °C for 60 s, ramping at 65% to 65 °C for 4 min, for 30 cycles with a final extension of 65 °C for 5 min (Shaw et al., 2007). PCR products were visualized by electrophoresis in 1% agarose gels with subsequent GelStar DNA staining (Lonza, Rockland, ME, USA) and UV trans- illumination. PCR products were cleaned of unincorporated dNTPs and excess primer by ExoSAP-IT enzymatic reactions (USB Corporation, Cleveland, OH, USA) following the manufacturer’s protocol. Double stranded PCR products were sequenced directly in both directions with the same primers used for the PCR amplifications. DNA sequencing was performed using the Applied Biosystems (ABI) 3730XL DNA Analyzer capillary

62 electrophoresis based sequencer, using BigDye Terminator v3.1 for cycle sequencing reactions (Applied Biosystems, Carlsbad, CA, USA). Cycle sequencing products were cleaned using NaAc+EDTA+EtOH, according to ABI manufacturer’s protocol. Hi-Fi formamide was used to dissolve the precipitated DNA in 96-well plates, and then loaded onto the 3730XL sequencer for electrophoresis analysis. The raw data were automatically processed using KB basecaller to generate chromatograph and quality files.

All sequences were edited in SEQUENCHER 4.8 (Gene Codes Corp., Ann Arbor,

MI, USA) and were aligned with CLUSTALW (Larkin et al., 2007) or MUSCLE (Edgar,

2004). Alignments and tree files are available at TREEBASE (www.treebase.org). Double peaks in nuclear gene sequences, reflecting heterozygous positions, were coded with International Union of Pure and Applied Chemistry (IUPAC) degeneracy codes and were treated as polymorphisms. Target sequence authenticity was verified by blast searching sequences in the National Center for Biotechnology Institute GenBank database for appropriate target locus and taxonomic affinity. All sequences have been deposited in GenBank (accession numbers GU736412–GU736579). Whenever possible, two to seven individuals were sequenced for each species to verify morphological identification and to assess intraspecific genetic variability, except for those species in which only one specimen was available (Appendix S1). Very few substitutions were observed within taxa for all loci and subsequent phylogenetic analyses were performed using one consensus sequence of all individuals per taxon.

Estimation of diversification rates While diversification rates are often directly compared across studies, the underlying equations used to derive the rates are often quite different (e.g. Baldwin & Sanderson, 1998; Hughes & Eastwood, 2006; Magallón & Castillo, 2009; Valente et al., 2010). For example, under the Yule model, the speciation rate is calculated with the following equation:

λ = (ln n1-ln n0)/t where n1 is the number of extant species, and n0 is the initial species richness (generally assumed to be 1; Hughes & Eastwood, 2006; Guzmán et al., 2009) and t is the time in 63 millions of years (Myr) since most recent common ancestor (MRCA). Yet others, such as Givnish et al. (2008), use the following equation: r = ln [(n/c)/t] where n represents the number of extant species, c the number of colonization events, and t the age of the island. Furthermore, Magallón & Sanderson (2001) developed the following equation for crown groups:

where ε is the diversification rate; ε is defined as ε = µ/λ, where µ is the extinction rate and λ is the speciation rate; the t variable corresponds to the time after the origin of the clade, here the present; and n is the standing species diversity of the clade at time t. We advocate for diversification rate estimates to be compared directly across studies; authors should clearly identify when the equations used differ. Although this work supports the hypothesis that the basal sister clade of the Hawaiian radiation is located in Central America (Ganders et al., 2000), inclusion of the Australasian and remaining South American and South Pacific Bidens species is necessary to confirm this hypothesis (Fosberg, 1948; Baldwin & Wagner, 2010). It is also important to note that the two undescribed Bidens species from the Marquesas are in the polytomy with the Hawaiian clade (Fig. 2), which makes the direction of colonization order between the archipelagos ambiguous. Therefore, we conservatively excluded the Marquesan species from our diversification rate estimates. However, the question of whether the Marquesas possibly served as a ‘stepping-stone’ to colonization of Hawaii or recipient of colonization from Hawaiian Bidens warrants further investigation.

Appendix S3 Maximum likelihood phylograms of external transcribed spacer (ETS) and chloroplast DNA (cpDNA) markers for Hawaiian ingroup and outgroup Bidens species with maximum likelihood bootstrap values to the left (1000 replicates) and Bayesian posterior probabilities to the right. Individual phylograms are as follows: (a) ETS; (b) trnV–ndhC; (c) rpl32–trnL; (d) trnQ–rps16; and (e) ndhF–rpl32. The chloroplast markers (b–e) employed are among those identified to be the most highly variable across a wide array of angiosperm families. Scale bar indicates number of nucleotide substitutions per site. Species names abbreviated by first letter of genus name, followed by first three letters of specific epithet, followed by first two letters of subspecies (if applicable), except hybrids where first letter denotes genus name, second letter beginning of specific epithet, and third letter beginning of subspecies name (see Appendix S1 for names).

(a)

Figure S1 (continued)

(b)

Figure S1 (continued)

(c)

Figure S1 (continued)

(d)

Figure S1 (continued)

(e)

REFERENCES

Baldwin, B.G. & Sanderson, M.J. (1998) Age and rate of diversification of the Hawaiian silversword alliance (Compositae). Proceedings of the National Academy of Sciences USA, 95, 9402-9406.

Baldwin, B.G. & Wagner, W.L. (2010) Hawaiian angiosperm radiations of North American origin. Annals of Botany, 105, 849-879.

Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32, 1792-1797.

Fosberg, F.R. (1948) Derivation of the flora of the Hawaiian Islands. Insects of Hawaii, Vol. 1 (ed. by E.C. Zimmerman), pp. 107–109. University of Hawaii Press, Honolulu, HI.

Guzmán, B., Lledo, M.D. & Vargas, P. (2009) Adaptive radiation in Mediterranean Cistus (Cistaceae). PLoS ONE, 4, e6362.

Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., & Higgins, D.G. (2007) ClustalW and ClustalX version 2. Bioinformatics 23, 2947- 2948.

Magallón, S. & Castillo, A. (2009) Angiosperm diversification through time. American Journal of Botany, 96, 349-365.

Magallón, S. & Sanderson, M.J. (2001) Absolute diversification rates in angiosperm clades. Evolution, 55, 1762-1780.

Valente, L.M., Savolainen, V. & Vargas, P. (2010) Unparalleled rates of species diversification in Europe. Proceedings of the Royal Society B: Biological Sciences, 359, 265–274.

White, T.J., Bruns, T., Lee, S., & Taylor, J.W. (1990) Amplification and direct sequencing of a fungal ribosomal RNA gene for phylogenetics. PCR Protocols: a guide to methods and applications (ed. by M.A. Innis, D.H. Gelfand, J.J. Sninsky and T.J. White), pp. 315-322. Academic Press, New York.

Chapter 4 Adaptive morphological shifts to novel habitats in marine sculpin fishes (Teleostei: Cottidae)

ABSTRACT Adaptations that allow for colonization of a new habitat often open up new ecological opportunities and thus facilitate lineage diversification. While well documented in terrestrial and freshwater systems, it is less clear if this applies to marine diversifications as well. Because of their well-described phylogeny and ecology, sculpins of the eastern Pacific Ocean provide an ideal opportunity to examine whether adaptive morphological character shifts have facilitated invasion of novel habitat types. In this group, the basal species primarily occupy the subtidal habitat, whereas the derived species are found in the intertidal. We used multiple evolutionary models to test the hypotheses that change in body size and change in number of scales are adaptive responses to novel habitats. We generated a well-supported, highly resolved molecular phylogeny of 26 species of sculpins based on ~800 basepairs of the mitochondrial cytochrome b gene. In combination with morphometric and habitat affinity data, we then employed OUCH, a recently developed phylogenetic comparative method, to test adaptive and alternative hypotheses. Results show that adaptive evolutionary changes in body size and number of scales to habitat type are supported over models of neutral evolution, stabilizing selection across all habitats, and three models of phylogenetic inertia. We suggest that loss of scales and reduction of body size in the intertidal likely facilitates cutaneous breathing in hypoxic tidepools and in air during low tides. This study demonstrates how the combined use of phylogenetic, ecological, and statistical approaches helps to identify traits that are adaptive to novel habitats. Further, we suggest that these traits may have facilitated further diversification.

Keywords: adaptation, body size, comparative methods, intertidal, natural selection, skin breathing, speciation, subtidal

INTRODUCTION A central tenet of modern evolutionary theory is that adaptations that allow for colonization of a new habitat often open up new ecological opportunities and thus promote lineage diversification (for review see Schluter 2000). Numerous studies demonstrate this in terrestrial systems, particularly from oceanic archipelagos, with Darwin’s finches in the Galápagos among the best-illustrated examples (Grant & Grant 2011). In aquatic systems, habitat shifts from marine to freshwater have been frequently documented (Hou 2011), with the diversification of Amazonian stingrays being among the most well known examples (Lovejoy et al. 1998). However, this question of whether adaptations to novel habitats promote evolutionary diversification has been essentially unexplored within modern marine communities (Miglietta et al. 2011; but see Alfaro et al. 2007). Further, while many diversification events are presumed to be adaptive, few have been rigorously demonstrated to be so (Schluter 2000; Glor 2010). As a necessary step towards the goal of testing if morphological innovations have facilitated diversification in novel habitats, the traits must first be demonstrative to be adaptive to those habitats.

Sculpins of the eastern Pacific Ocean provide an ideal opportunity to examine whether adaptive morphological trait shifts are associated with invasion of novel habitat types because basal species live primarily in the subtidal habitat, whereas derived species are found in the intertidal where they have diversified extensively (see Figs. 1 and 2; and Ramon & Knope 2008; Mandic et al. 2009a). With approximately 90 species generally restricted to the narrow continental shelf and near-shore environment between Baja California and the Aleutian Islands, sculpins are the most species-rich clade of fishes in this region (Howe & Richardson 1978; Love 2011). In addition to molecular phylogenetic reconstruction (Knope 2004; Ramon & Knope 2008; Mandic et al. 2009a) and habitat affinity data (Miller & Lea 1972; www.FishBase.org), marine sculpin morphometrics (Bolin 1944; Howe & Richardson 1978; Yabe 1985; Strauss 1993) and ecophysiology are well described (Martin 1991; Martin 1993; Martin 1995; Martin 1996; Mandic et al. 2009a,b). In particular, we chose to examine the subfamily Oligocottinae, a 74 monophyletic clade comprised of 16 species, and ten closely related species, with habitat affinities ranging from the subtidal to the intertidal (Bolin 1944; Bolin 1947; Knope 2004; Ramon & Knope 2008; Mandic et al. 2009a).

The intertidal environment is influenced by the daily ebb and flow of tides resulting in dramatic diurnal fluctuations in temperature and dissolved oxygen levels (Truchot & Duhamel-Jouve 1980; Burggren & Roberts 1991). Conversely, the subtidal environment experiences little fluctuation in these environmental factors (Stillman & Somero 1996; Mandic 2009a). This environmental gradient with depth appears to affect species distributions, with more temperature and hypoxia-tolerant species located in the intertidal and less tolerant species found in subtidal environments (Stillman & Somero 1996). Additionally, tidepools typically experience daily extreme hypoxia during low tides, particularly on warm days, when dissolved oxygen escapes the pools (Charles Law; Gay-Lussac 1802) and at night when photosynthesis by algae and marine plants ceases. This can potentially drive strong natural selection for hypoxia tolerance, and consequently, cutaneous breathing has evolved in a large number of intertidal fishes (including, but not limited to sculpins) to supplement oxygen intake by gills (Yoshiyama & Cech 1994; Martin & Bridges 1999; Nelson 2006). However, scales prohibit cutaneous breathing (Martin & Bridges 1999) and repeated, phylogenetically independent loss of scales (Nelson, 2006) suggests selection operated on this trait in variable and low oxygen environments (Martin and Bridges 1999).

In addition to scale number, body size may also be under selection to optimize cutaneous respiration. The surface area to volume ratio is important for cutaneous respiration, as a high surface area to volume ratio is beneficial for efficient oxygen diffusion (Graham et al., 1987). Thus, a small body size would lead to more efficient cutaneous respiration, whereas a large body size would be detrimental. Of course, body size is likely under selection by a large number of other factors, including pool size, prey size, and predation pressure (Stearns 1992; Roff 2002; Bird 2011).

In this paper, we test the hypothesis that changes in body size and scale number are adaptations to the transitional zone (lowest intertidal) and the intertidal habitats. To this end, we used the phylogenetic comparative approach known as the Ornstein- Uhlenbeck Comparative Hypotheses (OUCH) (Butler & King 2004) utilizing data from previously published molecular phylogenies (Ramon & Knope 2008; Mandic et al. 2009a), morphometric data (this study; Bolin 1944; Miller & Lea 1972), and habitat affinity data (Miller & Lea 1972; www.FishBase.org).

MATERIALS AND METHODS

Phylogeny

Mitochondrial cytochrome b (cyt b) sequences in Ramon & Knope (2008) and Mandic et al. (2009a) were used for this study (GenBank Accession numbers EF521313– EF521387; EU836693-EU836704, respectively). This locus has been used extensively in fish phylogenetics and its molecular evolution is well studied (e.g. Johns & Avise 1998; Crow et al. 2004). The cyt b locus is protein coding and exhibited no insertions or deletions. An unambiguous alignment of ~800 basepairs was constructed in Sequencher 4.8 (Gene Codes Corp.).

To conduct the maximum likelihood (ML) phylogenetic analysis, Modeltest 3.7 (Posada & Crandall, 1998) was used to determine the appropriate model of sequence evolution for cyt b. Aikake Information Criterion (AIC) was used to determine which of 56 models of nucleotide evolution best fit the data (Burnham & Anderson 2002). The Hasegawa, Kishino, and Yano model with rate variation among sites and invariant sites (HKY85+Γ+I) was selected as the best-fit model. The HKY85 model assumes an equal substitution rate at all sites, uses empirical data for base frequencies. The transition rate is not assumed to equal the transversion rate, and the substitution rate is estimated (Hasegawa et al. 1985).

The HKY85+Γ+I model of sequence evolution was then used to find the best ML tree using a heuristic tree search with stepwise addition and TBR branch swapping. Jordania zonope was chosen as the outgroup taxon based on published phylogenies (Bolin 1947, Ramon & Knope 2008), and trees were rooted for the heuristic search. Starting trees were obtained via stepwise addition with addition sequences “as-is.”

We calculated the branch lengths on this topology in a maximum likelihood framework in PAUP* version 4.0b10 (Swofford 2002). To test the sequences for a constant rate of substitution across lineages, a likelihood ratio test (LRT) was employed by calculating the log likelihood score of the best tree with the molecular clock enforced and comparing it with the log likelihood score previously obtained without enforcing the molecular clock (Jukes & Cantor 1969; Goldman 1993). In this case, the molecular clock is the null hypothesis. Enforcing the molecular clock constrains branch lengths by forcing terminal ends to be contemporaneous and sequence substitution rates to be equal across all lineages (χ2 = 2x [(-lnLclock) – (-lnLunconstrained)]. The chi-square distribution was calculated with n-2 degrees of freedom, where n is equal to the number of taxa sampled (Felsenstein 1981).

Morphological Data Total number of scales above the lateral line and standard length for each individual were measured from specimens at the California Academy of Sciences or taken from Bolin (1944). Mean standard length in millimeters (tip of maxilla to end of caudal peduncle) of each species was measured as a proxy for body size (Bolin 1944; Cailliet et al. 1986; Moyle & Cech 2003). A total of 1160 individuals were measured for body size (mean number of individuals per species = 45). The total number of scales above the lateral line posterior of the operculum (on right side, if looking anterior to posterior) were counted for 302 individuals (mean number of individuals per species = 12). Species means and ranges for standard length and number of scales are given in Table 1. All data were natural log transformed to improve fit to normality.

Evolutionary hypotheses (models) Numerous methods exist for addressing phylogenetic non-independence of species (Felsenstein 1985; Harvey & Pagel 1991; Garland et al. 2005; Losos 2011). However, most of these methods assume neutral Brownian motion to model the evolution of a character that is thought to be under selection (Harvey & Purvis 1991; Harvey & Rambaut 2000). Additionally, since traits can reflect adaptations or processes from past niches, current trait values can represent this historical influence. This historical effect on current trait values is the result of phylogenetic inertia, or resistance to evolutionary change. However, adaptation and phylogenetic intertia are not mutually exclusive (Hansen & Orzack, 2005). For this reason, we used the OUCH method (Butler & King 2004), which allowed us to test alternative hypotheses of neutral drift, phylogenetic inertia, and adaptation by natural selection on phenotypes of interest in relation to the environments where they are found. The OUCH approach also allows for the estimation of optimal phenotypic trait values in different selective regimes.

We tested six evolutionary hypotheses for the evolution of body size and number of scales by assigning (sensu Butler & King 2004) adaptive regimes to individual branches of our phylogeny (Fig. 2). Two models are adaptive, while four models are non- adaptive. The simplest model tested was Brownian motion, or a random drift model and assumes that the character in question is evolving in a completely neutral fashion across the phylogeny. The second model tested assumes stabilizing selection with a single global optimum for all species. This model predicts that all sculpins share the same adaptive regime. This situation would occur if the functional demands of the morphologies of all sculpin species were identical, irrespective of habitat affinity. The third model tested is an adaptive model based on habitat affinities. This model contains three separate optima and sculpin species were classified as subtidal, intertidal, or transitional (for those species found only in the lowest intertidal and extending into the subtidal) (Miller & Lea 1972; Ramon & Knope 2008; www.FishBase.org). The final three models are non-adaptive models of phylogenetic inertia, where sculpins morphologies are simply the result of sharing a recent common ancestor with that 78 morphology (clade models). The first of these phylogenetic inertia models (clade model 1) splits the phylogeny into two major derived clades (with Oligocottus-Clinocottus including Leiocottus hirundo as a clade, and the Artedius species and Clinocottus acuticeps, which consistently groups with Artedius [this study; Ramon & Knope 2008], as the other derived clade) and all remaining basal species as a single grade. The second phylogenetic inertia model (clade model 2) is based on genera, except for Clinocottus analis plus Leiocottus hirundo as a clade as these two species appear most closely related to one another and Clinocottus as it is currently described is not a natural group (this study; Howe & Richardson 1978; Ramon & Knope 2008). The third phylogenetic inertia model (clade model 3) is essentially the same as clade model 1, except that the basal species are coded by genera rather than as a single grade.

Statistical Analyses We fit the various evolutionary models to the body size and scale data assuming the cyt b phylogeny and calculated branch lengths. The models of evolution were evaluated using a ML approach as employed in the OUCH package (Butler & King 2004) in the R statistical computing environment (R Development Core Team 2011). The fit of each of the models to the data (ML scores) were compared using the change (Δ) in Akaike Information criterion (AIC.c) and the more conservative Schwartz information criterion (SIC.c) scores from the best fit model, both with correction for small sample size (following Butler & King 2004; Scales et al. 2007; and others). Model selection frequencies and 95% confidence intervals for model parameters were calculated using 2000 bootstrap replicates (Burnham & Anderson 2002). Once the optima for each model were calculated, these parameters were back-transformed into standard length (mm) and number of scales to facilitate interpretation.

RESULTS

The tree topology recovered in the cyt b phylogeny is not statistically significantly different (Shimodaira-Hasegawa test; p>0.05) from the phylogeny reconstructed from two other molecular markers (mitochondrial NADH1 and nuclear S7) and from the 79 consensus tree based on all three of these molecular markers (Ramon & Knope 2008) and is in general agreement with phylogenies based on morphology (Bolin 1947; Begle 1989; Strauss 1993). A chi-square test fails to reject the null hypothesis that enforcing the molecular clock does not significantly add length to the tree (p>.05), indicating that branch lengths are proportional to time.

Both AIC.c and SIC.c scores suggest that the habitat model best explains the evolution of body size (Table 2). The habitat model was selected as the best-fit model in 72% of the bootstrap replicates. In contrast, we found limited support for alternative hypotheses such as the clade 2 model (11%), the global optimum model (9%), and the clade 1 model (6%). Further, the OUCH model θ parameter (variable for the character modeled – in this case, standard length) closely matches the actual data for species mean values (Table 4), with the smallest species found in the intertidal, species of intermediate size found in the transitional zone, and the largest species found in the subtidal.

The habitat model best explains the evolution of scale number, with the lowest AIC.c and SIC.c scores (Table 1). In fact, 100% of the 2000 bootstraps selected the habitat model as the best fit to the data over the alternative hypotheses. Again, the OUCH model θ parameter (in this case, scales) estimates closely match the actual data, except for subtidal sculpins where the model underpredicts the actual number of scales (Table 5). However, both the θ parameter estimates and the actual data match in the prediction of essentially no scales on intertidal fish, the greatest number of scales on fish in the transitional zone, and an intermediate number of scales on subtidal species (Table 5).

DISCUSSION Our results show that adaptive evolutionary responses to habitat best explain the evolution of body size and number of scales (Tables 2 and 3). Evolution of small body size in the intertidal may facilitate cutaneous breathing by reducing the surface area to volume ratio of the fish, facilitating diffusion of oxygen across the cutaneous membrane (Graham et al., 1987). However, selection for body size may also be governed by 80 predation pressure, prey size and pool size (Stearns 1992; Roff 2002; Bird 2011). While the habitat model was selected most often as the best fit model, we find some limited support for the global optimum model and two of the clade models (Table 2). This could reflect that some subtidal sculpins are actually quite small (Table 1) or alternatively, could be due to the combined roles of stabilizing selection, phylogentic inertia, and diversifying selection on body size, as these are not mutually exclusive hypotheses. The results for the evolution of scales show that the habitat model is selected as the best fit to the actual data in 100% of the 2000 bootstraps (Table 3). All intertidal sculpins in this study have no scales, while those in the transition zone and in the subtidal have numerous scales. Interestingly, those sculpins found in the transition zone have the greatest number of scales (Table 5). We hypothesize that there is strong selection for scale covering in the transition zone due to wave stress (to protect the body against rocks, etc.) and predatory attacks (Gosline 1965; Ricketts et al. 1985; Love 2011), and strong selection for loss of scales entirely in the intertidal (where wave stress and predatory pressure are reduced; Gosline 1965; Ricketts et al. 1985; Bird 2006; Bird 2011) to facilitate skin breathing during hypoxia (Martin and Bridges 1999).

Ecophysiological studies of cutaneous breathing in sculpins across a depth gradient show that species of intertidal cottids are capable of skin breathing while subtidal species are not (Wright & Raymond 1978; Martin 1991, 1993, 1995, 1996) and that loss of scales is required for the acquisition of this trait (Martin & Bridges 1999). All of the intertidal cottids studied thus far are known to respire in hypoxic tidepools and in air with little or no metabolic effects (as measured by whole body lactate; Martin 1991,

1993,1995, 1996; Sloman et al. 2008; or by critical O2 tensions; Mandic et al. 2009a,b). For example, Oligocottus maculosus has been shown experimentally to perform aerial respiration with no discernable adverse metabolic effects for up to 72hrs (Sloman et al. 2008). Further, Clinocottus analis performs approximately 30% of its respiration through the skin during emergence (Martin & Bridges 1999).

In addition to shifts in body size and scale covering, intertidal sculpins appear to possibly have a wide array of other morphological, behavioral, and physiological adaptations. For example, Mandic et al. (2009a) found that intertidal sculpins have higher hypoxia tolerance than subtidal sculpins and that routine O2 consumption rate, mass- specific gill surface area, and whole blood haemoglobin-O2-binding affinity account for most of the variation in hypoxia tolerance, although this study did not explore the contribution of skin breathing to hypoxia tolerance. Further, Martin (1996) showed that intertidal sculpins have specific behavioral attributes that subtidal sculpins do not, allowing them to survive hypoxia. Martin (1996) further found a high rate of mortality in three species of subtidal sculpins (Icelinus borealis, Jordania zonope, and Chitonotus pugetensis) during emergence in air, as compared to the intertidal sculpins Oligocottus maculosus and Ascelichthyes rhodorus. Additionally, intertidal sculpins likely have adaptations that are largely independent of coping with daily periodic hypoxia. For example, three exclusively intertidal species (Clinocottus globiceps, C. recalvus, and C. embryum) have unique head and jaw morphology not observed in subtidal sculpins (Bolin 1944; Miller & Lea 1972), which may be adaptive for acquisition of prey unique to the intertidal environment (Boyle & Horn 2006; Love 2011). Of course, these physiological, behavioral, and morphological attributes may be correlated with the evolution of body size and loss of scales.

Did adaptation to novel habitat types lead to diversification? The analyses presented here do not explicitely test if the morphological adaptations facilitated diversification. However, the following lines of evidence suggest that this may have been the case. First, basal species of marine sculpins in the eastern Pacific are found in the subtidal and the shift to the intertidal resulted in diversification (Ramon & Knope 2008; Mandic et al. 2009a), giving rise to at least the five transitional and ten intertidal species examined in this study (Fig. 2c). Second, our results demonstrate that species of sculpins found in the intertidal and transitional zones acquired body size and scale covering adaptations to these novel habitat types. Third, because scales inhibit cutaneous breathing (Martin and Bridges 1999) and subtidal sculpins (all 82 having scales) are not able to survive hypoxia (Martin 1996), it follows that the loss of scales (and perhaps the reduction of body size) are adaptations necessary for occupation of the intertidal and for diversification within this habitat.

However, the question remains, did adaptation to the novel habitat types occur before, during, or after diversification? To address this question, we mapped loss of scales onto the phylogeny (not shown) as a new character state in a parsimony framework (where the fewest number of changes required to account for the evolution of a character is most likely to be correct). It only requires three steps if each of the three intertidal lineages lost scales before diversification, whereas if each species acquired scale loss independently (as would be the case if this adaptation occurred after diversification) it would require ten steps (as there are ten intertidal species; see Fig. 2c). Therefore, based on parsimony, the loss of scales likely occurred before the diversification in the intertidal, particularly because scales inhibit cutaneous breathing (Martin and Bridges 1999). Yet, the possibility remains that the adaptive loss of scales and diversification co-occurred, although always the fewest steps are required if the loss occurred prior to diversification.

We hypothesize that adaptation to the novel habitats gave rise to “ecological opportunity” resulting in diversification. The “ecological opportunity” hypothesis predicts that when interspecific competition or predation is reduced, populations will exhibit increases in phenotypic variance, upon which diversifying selection can act, resulting in speciation (Schluter 2000; Nosil & Reimchen 2005). The intertidal habitat is well known as a refuge from predation pressure by larger predators, and many non-cottid fish species occupy the intertidal as juveniles before an ontogenetic shift to deeper water as adults (Love 1996; Love 2011). Additionally, as demersal ambush predators themselves (Boyle & Horn 2006), intertidal sculpins may have experienced less competition for prey resources, compared to closely related subtidal sculpins, during the initial phases of diversification in the novel intertidal habitats. Thus the shift to these novel marine habitats may have been analogous to the colonization of new islands by

83 mainland terrestrial lineages (e.g. Darwin’s finches, Caribbean anoles) leading to ecological speciation (Schluter 2000; Grant & Grant 2011).

We employed the macro-evolutionary comparative approach, as comparative methods have long been used to test and provide strong evidence for adaptation (Baum & Larson 1991; Harvey & Pagel 1991; Losos & Miles 1994; Baum & Donoghue 2001). A repeated fit between divergent phenotypes and different habitats, behaviors, or life histories is considered evidence for adaptation (Baum & Donoghue 2001; Losos & Miles 1994; Scales et al. 2007). More specifically, because the OUCH model uses a predictive framework, it is not just demonstrating correlation, but rather showing that a given trait repeatedly and predictably evolves in response to a selective regime indicating adaptation (Harvey & Pagel 1991; Butler & King 2004).

CONCLUSIONS Although many diversification events are presumed to be adaptive, few have been rigorously demonstrated to be so, and these generally come only from a few well-studied terrestrial systems (Schluter 2000; Glor 2010). Our results suggest that adaptive morphological character shifts can facilitate movement into novel habitat types in marine systems. Future work should increase the phylogenetic breadth of sculpins investigated and test adaptive and alternative hypotheses for other morphological, physiological, and behavioral characters associated with the habitat shifts. Additionally, cutaneous breathing may be a “key innovation” that promoted the diversification of intertidal sculpins and future work that explicitly tests this hypothesis would be valuable. More broadly, additional marine studies are needed to evaluate the generalities and differences in the factors that promote diversification across terrestrial, freshwater, and marine systems.

ACKNOWLEDGEMENTS We thank Marguerite Butler, David Catania, Pasha Feinberg, Tadashi Fukami, Olivia Isaac, Holly Moeller, Jason Pienaar, and Tomio Iwamoto for assistance with this project. We thank the following for comments: Lis Castillo Nelis, Tadashi Fukami, Holly 84

Moeller, Mifuyu Nakajima, and Rachel Vannette. Financial support was provided by Stanford University, the University of Hawaii at Manoa, and a Dr. Earl H. Myers and Ethel M. Myers Oceanographic and Marine Biology Trust grant to MLK.

REFERENCES Alfaro, M.E., F. Santini, and C.D. Brock. (2007) Do reefs drive diversification in marine teleosts? Evidence from the pufferfish and their allies (Order Tetraodontiformes). Evolution 61:2104-2126.

Baum, D.A. and M.J. Donoghue. (2001) A likelihood framework for the phylogenetic analysis of adaptation. In “Adaptation and Optimality” (S. Orzack and E. Sober, eds.) pp. 24-44. Cambridge Univ. Press, New York, NY.

Baum, D.A. and A. Larson. (1991) Adaptation reviewed: a phylogenetic methodology for studying character macroevolution. Systematic Zoology 40:1-18.

Begle, D.P. (1989) Phylogenetic analysis of the cottid genus Artedius (Teleostei: Scorpaeniformes). Copeia 3:642-652.

Bird, C.E. (2006) Aspects of community ecology of wave-exposed rocky Hawaiian coasts. PhD Dissertation. University of Hawai’i at Manoa. 239 pp.

Bird, C.E. (2011) Morphological and behavioral evidence for adaptive diversification of sympatric Hawaiian limpets (Cellana spp.). Journal of Integrative and Comparative Biology 51(3):466-473.

Bolin, R.L. (1944) A review of the marine cottid fishes of California. Stanford Ichthyological Bulletin 3:1-135.

Bolin, R.L. (1947) The evolution of the marine Cottidae of California with a discussion of the genus as a systematic category. Stanford Ichthyological Bulletin 3:153-168.

Boyle, K.S. and M.S. Horn. (2006) Comparison of feeding guild structure and ecomorphology of intertidal fish assemblages from central California and central Chile. Marine Ecology Progress Series 319:65-84.

Burggren, W. and J. Roberts. (1991) Respiration and metabolism. Pp. 353–435 in C. Ladd Prosser, ed. Environmental and Metabolic Animal Physiology: Comparative Animal Physiology. 4th ed. Wiley-Liss, New York, NY.

Burnham, K.P. and D. R. Anderson. (2002) Model selection and multimodel inference. Springer, New York, NY. 85

Butler, M.A. and A.A. King. (2004) Phylogenetic comparative analysis: A modeling approach for adaptive evolution. The American Naturalist 164:683-695.

Cailliet, G.M., M.S. Love, and A.W. Ebeling. (1986) Fishes: a field and laboratory manual on their structure, identification and natural history. Wadsworth Publishing Company, Belmont, CA.

Crow, K.D., Z. Kanamoto, and G. Bernardi. (2004) Molecular phylogeny of the hexagrammid fishes using a multi-locus approach. Molecular Phylogenetics and Evolution 32:986-997.

Darwin, C. (1859) On the origin of species. J. Murray, London, UK.

Felsenstein, J. (1981) Evolutionary trees from DNA sequences: A maximum likelihood approach. Journal of Molecular Evolution 17:368-376.

Felsenstein, J. (1985) Phylogenies and the comparative method. American Naturalist 125:1-15.

Garland, T.J., A.F. Bennett, and E.L. Rezende. (2005) Phylogenetic approaches in comparative physiology. Journal of Experimental Biology 208:3015–3035.

Gay-Lussac, J.L. (1802) “Sur le dilatation des gaz et des vapeurs,” Annal. Chim. 43(1):137–175.

Glor, R.E. (2010) Phylogenetic insights on adaptive radiation. Annual Review of Ecology, Evolution, and Systematics 41:251-270.

Goldman, N. (1993) Statistical tests of models of DNA substitution. Journal of Molecular Evolution 36:182-198.

Gosline, W.A. (1965) Vertical zonation of inshore fishes in the upper water layers of the Hawaiian Islands. Ecology 46:823-831.

Graham, J.B., T.A. Baird, and W. Stockmann. (1987) The transition to air breathing in fishes. Journal of Experimental Biology 129:83-106.

Grant, P.R. and B.R. Grant. (2011) How and Why Species Multiply: The Radiation of Darwin’s Finches. Princeton Univ. Press, Princeton, NJ.

Hansen, T.F. (1997) Stabilizing selection of adaptation. Evolution 51:1341-1351.

Hansen, T.F. and S.H. Orzack. (2005) Assessing current adaptation and phylogenetic inertia as explanations of trait evolution: the need for controlled comparisons. Evolution 59:2063-2072.

Harvey, P.H. and M.D. Pagel. (1991) The comparative method in evolutionary biology. Oxford University Press, Oxford, UK.

Harvey, P.H. and A. Purvis. (1991) Comparative methods for explaining adaptations. Nature 351:619-624.

Harvey, P.H. and A. Rambaut. (2000) Comparative analyses for adaptive radiations. Philosophical Transactions of the Royal Society, London. B 355:1599-1605.

Hasegawa, M., H. Kishino, and T.A. Yano. (1985) Dating of the Human Ape Splitting by a Molecular Clock of Mitochondrial-DNA. Journal of Molecular Evolution 22:160-174.

Howe, K.M. and S.L. Richardson. (1978) Taxonomic review and meristic variation in marine sculpins (Osteichthyes: Cottidae) of the northeast Pacific Ocean. National Marine Fisheries report, contract no. 03-78-M02-120.

Hou, Z., B. Sket, C. Fiser, and S. Li. (2011) Eocene habitat shift from saline to freshwater promoted Tethyan amphipod diversification. Proceedings of the National Academy of Sciences 108:14533-14538.

Johns, G.C. and J.C. Avise. (1998) Tests for ancient species flocks based on molecular phylogenetic appraisals of Sebastes rockfishes and other marine fishes. Evolution 52:1135-1146.

Jukes, T.H. and C.R. Cantor. (1969) Evolution of protein molecules. In “Mammalian Protein Metabolism” (H.N. Munro, Ed.), vol. III, pp. 21-132. Academic Press, New York, NY.

Knope, M.L. (2004) Molecular phylogenetics of sculpins in the genera Ruscarius, Artedius, Clinocottus, and Oligocottus. Master’s thesis, San Francisco State University.

Losos, J.B. (2011) Seeing the forest for the trees: The limitations of phylogenies in comparative biology. The American Naturalist 177:709-727.

Losos, J.B, and D.B. Miles. (1994) Adaptation, constraint, and the comparative method: phylogenetic issues and methods. In “Ecological Morphology: Integrative Organismal Biology” (P.C. Wainwright and S. Reilly, Eds.). pp. 60-98. University of Chicago Press, Chicago, IL.

Love, M. (1996) Probably more than you want to know about the fishes of the Pacific Coast. Really Big Press, Santa Barbara, CA.

Love, M. (2011) Certainly more than you want to know about the fishes of the Pacific Coast. Really Big Press, Santa Barbara, CA.

Lovejoy N.R., E. Bermingham, and A.P. Martin. (1998) Marine incursion into South America. Nature 396:421–422.

Mandic, M., A.E. Todgham, and J.G. Richards. (2009) Mechanisms and evolution of hypoxia tolerance in fish. Proceedings of the Royal Society, London B 276:735– 744.

Mandic, M., K.A. Sloman, and J.G. Richards. (2009) Escaping to the Surface: A Phylogenetically Independent Analysis of Hypoxia-Induced Respiratory Behaviors in Sculpins. Physiological and Biochemical Zoology 82(6):730–738.

Martin, K.L.M. (1991) Facultative Aerial Respiration in an Intertidal Sculpin, Clinocottus analis (Scorpaeniformes, Cottidae). Physiological and Biochemical Zoology 64:1341-1355.

Martin, K.L.M. (1993) Aerial CO2 release and respiratory exchange ratio in marine intertidal fishes. Environmental Biology of Fishes 37:189-196.

Martin K.L.M. (1995) Time and tide wait for no fish: Air-breathing in intertidal fishes. Environmental Biology of Fishes 44:165-181.

Martin, K.L.M. (1996) An ecological gradient in air-breathing ability among marine cottid fishes. Physiological Zoology 69:1096-1113.

Martin, K.L.M. and C.R. Bridges. (1999) Respiration in Water and Air. In: Intertidal fishes: life in two worlds. Academic Press, San Diego, CA. pp 54-96.

Miller, D.J. and R.N. Lea. (1972) Guide to the coastal marine fishes of California. California Department of Fish and Game Fish Bulletin, Sacramento, CA.

Miglia, K.J., E.D. McArthur, W.S. Moore, H. Wang, J.H. Graham, and D.C. Freeman. (2005) Nine‐year reciprocal transplant experiment in the gardens of the basin and mountain big sagebrush (Artemisia tridentata: Asteraceae) hybrid zone of Salt Creek Canyon: the importance of multiple‐year tracking of fitness. Biological Journal of the Linnean Society 86:213–225.

Miglietta, M.P., A. Faucci, and F. Santini. (2011) Speciation in the Sea: Overview of the Symposium and Discussion of Future Directions. Integrative and Comparative Biology 51:449–455.

Molles, M.C., Jr. (2002) Ecology: Concepts and Applications (International Edition ed.). The McGraw-Hill Companies, Inc., New York, NY.

Moyle, P.B. and J.J. Cech, Jr. (2003) Fishes: an introduction of ichthyology. Prentice Hall, Englewood Cliffs, NJ.

Nelson, J.S. (2006) Fishes of the world. John Wiley & Sons, Inc., New Jersey.

Nosil, P. and T.E. Reimchen. (2005) Ecological opportunity and levels of morphological variance within freshwater stickleback populations. Biological Journal of the Linnean Society. 86:297-308.

Posada, D., and K.A. Crandall, K.A. (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics 14:817-818.

Ramon, M.L. and M.L. Knope. (2008) Molecular support for marine sculpin (Cottidae; Oligocottinae) diversification during the transition from the subtidal to intertidal habitat in the Northeastern Pacific Ocean. Molecular Phylogenetics and Evolution 46:475-483.

Ricketts E.F., J. Calvin, and J.W. Hedgpeth (revised by D.W. Phillips). (1985) Between Pacific Tides. Stanford University Press, Stanford, CA.

Roff, D. (2002) Life History Evolution. New York: Chapman and Hall.

Scales, J.A., A.A. King, and M.A. Butler. (2009) Running for Your Life or Running for Your Dinner: What Drives Fiber-Type Evolution in Lizard Locomotor Muscles? The American Naturalist 173:543-553.

Schluter, D. (2000) The Ecology of Adaptive Radiation. Oxford Univ Press, Oxford, UK.

Sloman K.A., M. Mandic, A.E. Todgham, N.A. Fangue, P. Subrt, and J.G. Richards. (2008) The response of the tidepool sculpin, Oligocottus maculosus, to hypoxia in laboratory, mesocosm and field environments. Comparative Biochemistry and Physiology 149:284–292.

Stearns, S.C. (1992) The Evolution of Life Histories. Oxford: Oxford University Press.

Stillman, J.H. and G.N. Somero. (1996) Adaptation to temperature stress and aerial exposure in congeneric species of intertidal porcelain crabs (genus Petrolisthes):

correlation of physiology, biochemistry and morphology with vertical distribution. Journal of Experimental Biology 199:1845–1855.

Strauss, S.E. (1993) Relationships among the cottid genera Artedius, Clinocottus, and Oligocottus (Teleostei: Scorpaeniformes). Copeia 2:518-522.

Swofford, D.L. (2002) PAUP* Phylogenetic analysis using parsimony (*and other methods). Sinauer, Sunderland, Massachusetts.

Truchot, J.P. and A. Duhamel-Jouve. (1980) Oxygen and carbon dioxide in the marine intertidal environment: diurnal and tidal changes in rockpools. Respiratory Physiology and Neurobiology 39:241-254.

Westoby, M., M.P. Leishman, and J.R. Lord. (1995) On misinterpreting the "phylogenetic correction". Journal of Ecology 83:531-534.

Wright, W.G. and J.A. Raymond. (1978) Air-breathing in a California sculpin. Journal of Experimental Zoology 203:171-176.

Yabe, M. (1985) Comparative osteology and myology of the superfamily Cottoidea (Pisces: Scorpaeniformes), and its phylogenetic classification. Faculty of Fisheries, Hokkaido University, Hakodate, Japan.

Yoshiyama, R.M., C. Sassaman, and R.N. Lea. (1986) Rocky intertidal fish communities of California: temporal and spatial variation. Environmental Biology of Fishes 17:23-40.

Yoshiyama, R.M., K.B. Gaylord, M.T. Philippar, T.R. Moore, J.R. Jordan, C.C. Coon, L.L. Schalk, C.J. Valpey, and I. Tosques. (1992) Homing behavior and site fidelity intertidal sculpins (Pisces: Cottidae). Journal of Experimental Marine Biology and Ecology 160:115-130.

Yoshiyama, R.M. and J.J. Cech, Jr. (1994) Aerial respiration by rocky intertidal fishes of California and Oregon. Copeia 1:153-158.

FIGURES AND TABLES

Figure 1. Conceptual diagram of sculpin phylogeny in relation to habitats where species are found. Image on bottom (Ruscarius creaseri) representing the basal species, which are predominately subtidal. Image in middle (Artedius notospilotus) representing the derived clade with species extending into the transition zone. Image on top (Oligocottus recalvus) representing the derived clade with species predominately found in the intertidal. Scientific illustrations from Bolin (1944). Photo credits (from bottom to top): K. Jameson, M.L. Knope, and M.L. Knope.

Figure 2. Evolutionary models (hypotheses). From left to right, top to bottom: Brownian motion model; O-U global optimum model; habitat model; clade model 1; clade model 2; and clade model 3. Taxon abbreviation: first two letters denotes genus name, followed by first two letters of specific epithet.

Table 1. Species mean standard length in millimeters (followed by range) and number of scales (followed by range).

Species Standard length Scales Artedius corallinus 65 (42-91.5) 287 (275-300) Artedius fenestralis 80 (51.3-103) 126 (126-127) Artedius harringtoni 44 (17.9-81.3) 244 (204-280) Artedius lateralis 70 (16.1-124.1) 185 (161-221) Artedius notospilotus 82 (39.2-134.5) 155 (145-165) Chitonotus pugetensis 85 (54.3-143.2) 186 (185-187) Clinocottus acuticeps 35 (21.2-53.1) 0 (0-0) Clinocottus analis 79.5 (30.6-139.3) 0 (0-0) Clinocottus embryum 38.5 (18.4-60.7) 0 (0-0) Clinocottus globiceps 55 (25.2-153.8) 0 (0-0) Clinocottus recalvus 64 (21-108.5) 0 (0-0) Enophrys bison 90.5 (20.6-231) 32 (30-35) Hemilepidotus jordani 149.5 (83-215) 193 (175-210) Icelinus borealis 67 (52-80) 100 (88-106) Icelinus burchami 68 (36.6-107.5) 76 (72-81) Icelinus filamentosus 123 (51.1-2.1) 98 (90-104) Icelinus quadriseriatus 65 (51.8-73.4) 34 (30-36) Jordania zonope 73 (49.2-90.8) 331 (283-358) Leptocottus armatus 120 (22.3-185.9) 0 (0-0) Leiocottus hirundo 196.5 (150-205) 0 (0-0) Oligocottus maculosus 46 (23.8-73.2) 0 (0-0) Oligocottus rimensis 34 (21.8-45.2) 0 (0-0) Oligocottus rubellio 47 (23.3-60.2) 0 (0-0) Oligocottus snyderi 52 (25.5-75.6) 0 (0-0) Orthonopius triacus 57 (28.7-77) 153 (144-160) Ruscarius meanyi 55.5 (40-85) 182 (170-190)

Table 2. Model selection criteria for standard length. ΔAIC.c and ΔSIC.c scores followed by percent of 2000 bootstraps where model selected as the best fit. Model ΔAIC.c ΔSIC.c Habitat 0.00 (72%) 0.00 (74%) Single Optima 3.48 (9%) 2.86 (13%) Brownian Motion 11.41 (2%) 10.11 (4%) Clade 1 3.65 (6%) 3.64 (8%) Clade 2 21.13 (11%) 15.75 (0%) Clade 3 33.12 (0%) 9.26 (1%)

Table 3. Model selection criteria for scales. ΔAIC.c and ΔSIC.c scores followed by percent of 2000 bootstraps where model selected as the best fit. Model ΔAIC.c ΔSIC.c Habitat 0.00 (100%) 0.00 (100%) Single Optima 45.05 (0%) 44.49 (0%) Brownian Motion 50.61 (0%) 49.30 (0%) Clade 1 29.00 (0%) 29.00 (0%) Clade 2 48.16 (0%) 42.78 (0%) Clade 3 49.34 (0%) 25.48 (0%)

Table 4. The θ parameter estimates (character modeled) of the best fitting size model as compared to the actual data for standard length (50% quantile followed by the 2.5% and 97.5% quantiles, respectively, in parentheses). Actual data represents the average of all species mean values for each habitat type. Habitat type θ estimate Actual data Intertidal 49.8 (39.4, 62.0) 52.9 Transitional 73.1 (56.2, 93.7) 75.9 Subtidal 86.7 (67.9, 108.6) 83.9

Table 5. The θ parameter (character modeled) estimates of the best fitting scale model as compared to the actual data for scales (50% quantile followed by the 2.5% and 97.5% quantiles, respectively in parentheses). Actual data represents the average of all species mean values for each habitat type. Habitat type θ estimate Actual data Intertidal 0.1 (0.03, 0.2) 0 Transitional 180.2 (65.7, 485.9) 191.9 Subtidal 45.2 (19.2, 107.4) 115.4

Chapter 5 Phylogeny and biogeography of marine sculpins (Teleostei: Cottidae) of the North American Pacific Coast

Abstract With 90 species along the North American Pacific Coast, marine sculpins represent the most species-rich radiation of fishes in this region. I used the mitochondrial cytochrome b gene and the nuclear ribosomal S7 intron for 99 species (76 North American, 19 Asian, and four North Atlantic) to produce the most complete phylogenetic hypothesis yet generated for this clade. Maximum parsimony, maximum likelihood, and Bayesian analyses produced highly similar tree topologies, suggesting an origin of the clade in the eastern Pacific followed by colonization of the north Pacific, then giving rise to a number of descendant lineages found throughout the northern Pacific, Arctic, and Atlantic Oceans, including one monophyletic clade that re-colonized the eastern Pacific. Numerous sibling species have disjunct ranges, suggesting founder or vicariant speciation. However, many other sibling species have largely overlapping ranges, and repeated habitat shifts appear to have facilitated diversification. While many previously proposed groupings based on morphology are recovered, the molecular data suggest that a number of genera are para- or polyphyletic.

Keywords: allopatry, dispersal, founder speciation, historical biogeography, mtDNA, nuclear DNA, speciation, sympatry, vicariance

Introduction The process of species formation in the marine environment is poorly understood (Palumbi, 1994; Miglietta et al., 2011). Typically, marine species have large population sizes, the potential for long-distance dispersal, and large geographic ranges, and these characteristics can inhibit genetic differentiation and species formation (Palumbi, 1994; Miglietta et al., 2011). However, many marine radiations are species-rich (e.g., Eastman and McCune, 2000; Hyde and Vetter, 2007) and it remains unclear why some lineages diversify greatly while others diversify little. One such lineage that is exceptionally species-rich is the marine fishes in the northern Pacific Ocean commonly known as sculpins. With 90 species along the North American Pacific Coast (Howe and Richardson, 1978), this clade represents the most diverse radiation of fishes in this region (Love, 2011).

There has been a long history of attempts to reconstruct the phylogenetic relationships of the sculpins of the North American Pacific Coast (Gill, 1889; Hubbs, 1926a; Taranets, 1941; Bolin, 1947) and current ideas about the evolutionary history and definitions of genera are based primarily on morphology (Bolin, 1944, 1947). Using a phenetic (overall similarity) approach, Bolin (1947) was the first to offer a branching diagram for this clade (Fig. 1). However, Bolin limited his sampling to the 50 species found in California waters alone, which are now recognized to be both a polypheletic and a paraphyletic assemblage. More recently, Yabe (1985) and Jackson (2003) used internal and external morphological characters, respectively, to address cottoid/cottid arguments. Further, Ramon and Knope (2008) used molecular markers to address the phylogenetic relationships of 27 species, with a focus on the putative subfamily Oligocottinae (family Cottidae) and found both congruencies and differences between their molecular and previous morphological assessments of relationships. Despite this long history of work, most generic and specific relationships within the family Cottidae remain unresolved. Additionally, there has been little formal investigation of the historical biogeography of sculpins of the northern Pacific Ocean and their relationships to the sculpins of the northern Atlantic are poorly understood. 97

The primary objectives of this study were to: (i) reconstruct a phylogenetic hypothesis for the sculpins of the North American Pacific Coast (NAPC), (ii) determine at which hierarchical level the NAPC radiation is monophyletic; (iii) test the hypothesis that the clade originated in the north Pacific (NP) and radiated to the south along the NAPC; (iv) test the hypothesis that north Atlantic (NAtl) sculpins are derived from NP species via historical dispersal through the Bering Strait and across the Arctic Ocean; and (v) determine if the molecular phylogenetic hypothesis is consistent with previous morphological hypotheses at the generic and species levels. To this end, I generated a molecular phylogeny based on the mitochondrial cytochrome b gene and the intron of nuclear ribosomal protein S7 for 99 species and mapped biogeographic range data on to the resultant phylogenetic tree.

2. Materials and Methods

2.1. Study system

The Cottidae is the largest family of sculpins with about 70 genera and 275 species worldwide, found primarily in boreal and cold-temperate regions (Mecklenberg et al., 2002; Nelson, 2006). Sculpins in the family Cottidae are called cottids (sensu stricto) to avoid confusion with other sculpins in the superfamily Cottoidea. Cottids are generally small, intertidal and subtidal benthic marine fishes, although about 75 species are found in freshwater. The family is considered to be of recent Oligocene or Miocene origin, but marine species are not well represented in the fossil record (MacFarlane, 1923; Berg, 1947). While sculpins are found in all oceans of the world except the Indian Ocean (four species occur in the Southern Hemisphere), the north Pacific has been identified as the center of diversity and hypothesized to also be the center of origin for the family (Eschmeyer, 1983; Watanabe, 1969; Yabe, 1985). In this work, I define the north Pacific as the waters of the Gulf of Alaska, Bering Sea, and closely adjacent areas and separately from the northern Pacific Ocean, which refers to the Pacific Ocean north of the equator. 98

Cottids are generally restricted to the near shore and continental shelf, but display great habitat diversity and can be found on deep reefs and soft sediments, shallow reefs and soft sediments, in kelp forests, the intertidal, estuarine, and freshwater environments (Miller and Lea, 1972). They are not commercially important, but a few species are important in sport fisheries (e.g. Hemilepidotus and Scorpaenichthys).

Like other scorpaeniform fishes, cottids have a suborbital stay (Mecklenburg et al., 2002). Yabe (1985) defined cottids as a monophyletic group having one autapomorphy (presence of the lateral process of the hyomandibular) and a unique combination of nine synapomorphies (e.g., absence of tooth plate on third epibranchial, presence of six branchiostegal rays, presence of two supratemporals, and absence of stay behind last pterygiophore). Cottids are proposed to differ from sailfin sculpins (Hemitripteridae) and grunt sculpins (Rhamphocottidae) in that they are not densely covered with prickles and from most fathead sculpins (Psychrolutidae) by not being extremely tadpole-shaped and lacking loose skin over a gelatinous layer (Mecklenburg et al., 2002). They differ from poachers (Agonidae) by not being completely covered with bony plates (Miller and Lea, 1972; Mecklenburg et al., 2002; Nelson, 2006). Cottids exhibit wide variation in color and in distribution of pigment, from nearly uniform to heavily mottled, spotted, and banded. In some genera there is much intraspecific variability (including differences between the sexes), as well as individual ontogenetic shifts in morphology (Bolin, 1944; Miller and Lea, 1972; Mecklenburg et al., 2002).

2.2. Specimen collection

Of the 99 species examined, 80 are represented by new collections and 19 are from a previous study (Ramon and Knope, 2008). A total of 130 new sculpins were collected in the field, from aquaria at the Alaska Sea Life Center, or donated from the University of Washington Burke Ichthyology Museum or the Maizuru Fisheries Research Station (Table 1). Intertidal specimens were collected by dipnet at low tides and

99 deepwater specimens were collected by bottom-trawl on the NOAA vessels F/V Alaska Knight, F/V Vesteraalen, F/V Dominator, F/V Sea Storm, and F/V Ocean Explorer.

2.3. DNA extraction, amplification, sequencing, and alignment

Whole genomic DNA was extracted from muscle tissue or fin clippings stored in 95% ethanol. Tissues were digested and DNA extracted using standard DNEASY protocol (Qiagen Corp.). Samples were PCR amplified for mitochondrial cytochrome b (GluDG-L and CB3H from Palumbi, 1996; Table 2) and the first intron of the nuclear S7 ribosomal protein (custom designed primers S72F and S74R; Table 2). PCR amplifications were performed in a 25µl volume with 10-12.5µl MyTaqTM Red Mix

(Bioline Corp.), 1µl (10µM) each primer (Table 2), and the remaining volume H2O. PCR thermalcycling was performed using the following protocol for cyt b: 1 min initial denaturation at 95°C, followed by 35 cycles of 95°C for 30s, 50°C for 30s, and 72°C for 45s. PCR thermalcycling was performed using the following protocol for S7: 1 min initial denaturation at 95°C, followed by 30 cycles of 95°C for 15s, 50°C for 15s, and 72°C for 20s. PCR products were visualized in 1% sodium borate agarose gels and enzymatically cleaned with 2µl of Exo-Sap-It (USB Corp.). Double stranded PCR products were sequenced directly with the same primers used for the PCR amplifications by ELIM Biopharmaceuticals, Inc.

Raw forward and reverse sequences were assembled and edited in Sequencher 4.8 (Gene Codes, Corp). The mitochondrial cyt b locus exhibited no insertions or deletions (indels), as it is protein-coding. The nuclear ribosomal S7 exhibited some indels, which were included in the analysis, but were coded as gaps. Double peaks in the nuclear sequences, reflecting heterozygous positions, were coded with IUPAC degeneracy codes and treated as polymorphisms. When multiple sequences for a single species were available, few or no nucleotide differences were found among individuals. Therefore, for the phylogenetic analyses we used sequences from the individual with the most complete coverage. All alignments were created in MUSCLE (Edgar, 2004) and were 100 unambiguous. The matrix analyzed was over 97% complete (Table 1). Genes not sequenced for given individuals were coded as missing. All previous sequences from Ramon and Knope (2008) were downloaded from GenBank (accession numbers EF521313-EF521387).

2.4. Model selection

Models of evolution were determined using jModelTest 0.1.1 (Posada, 2008) for each gene independently and for both loci combined. Akaike Information Criterion (AIC) was used to discriminate among 88 progressively more complex models of nucleotide evolution. The models chosen for each of the datasets are as follows: the cyt b data set best fit the general time reversible model with invariable sites and rate variation among sites included (GTR+I+G), the S7 data best fit the Hasegawa, Kishino, Yano 85 model (Hasegawa et al., 1985) with rate variation among sites included (HKY+G) and the combined data set best fit the transversion model with rate variation among sites included (TVM+G).

2.5. Phylogenetic analyses

All trees were outgroup rooted with Stellerina xyosterna in the family Agonidae, which has been identified as the most appropriate outgroup by previous studies (Crow et al., 2004; Smith and Wheeler, 2004; Ramon and Knope, 2008). Among-taxa base composition differences and overall base composition bias values were calculated according to Irwin et al. (1991). Phylogenetic relationships were assessed by maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference (BI) methods. Both loci were examined individually and in a concatenated analysis in all three phylogenetic reconstruction approaches. In general, individual analyses were less resolved and had lower statistical support (not shown) than the combined loci analyses. The resulting topologies for shared species were compared with the morphological tree (Fig. 1; Bolin, 1947) using the Shimodaira and Hasegawa test (hereafter referred to as S-H test; 101

Shimodaira and Hasegawa, 1999) as implemented in PAUP* version 4.0b10 (Swofford, 2002).

2.5.1. Parsimony analysis

The total number of characters, number of variable characters and number of parsimony informative characters were calculated in PAUP*. Trees were outgroup rooted and full heuristic searches were performed for the individual and combined loci matrices and the maximum number of trees retained was set to 2000. Gaps were treated as missing data, starting trees were obtained via stepwise addition, branch swapping was performed by tree-bisection-reconnection, and the optimality criterion set to ACCTRAN (which puts the character change as close to the root of the cladogram as possible). Consensus trees were evaluated by 50% majority-rule and the confidence index (CI) and retention index (RI) were calculated on this tree. Statistical confidence in nodes was assessed by bootstrapping with 1000 pseudoreplicates and “FAST” stepwise-addition (Felsenstein, 1985).

2.5.2. Maximum likelihood analysis

ML analyses were conducted with PhyML (Guindon and Gascuel, 2003). The appropriate models of sequence evolution, as detected by jModelTest (Table 3), were used to find the best ML tree and statistical support values for nodes were obtained by approximate likelihood ratio tests (aLRT). The transition to transversion ratio was set to estimate, the proportion of invariable sites was set to estimate, the number of substitution rate categories was set to eight, and the gamma distribution parameter was set to estimate.

2.5.3. Bayesian analysis

BI analyses were conducted with MrBayes 3.1 (Huelsenbeck and Ronquist, 2001) as implemented within Geneious (Drummond et al., 2009). The appropriate models of 102 nucleotide evolution as determined by jModelTest were implemented (Table 3). Four chains were run for one million generations each, with one chain heated at a setting of 0.2. The first 100,000 generations were discarded as burn-in and trees were sampled every 200 generations. A consensus tree was constructed and statistical confidence in nodes was evaluated by Bayesian posterior probabilities.

2.6. Biogeographic analysis

To evaluate the biogeographic history, I mapped the biogeographic regions where species are presently found onto the BI tree utilizing a parsimony framework in Mesquite 2.73 (Maddison and Maddison, 2010). Biogeographic regions were taken directly from FishBase (www.fishbase.org). Fishbase categorizes sculpins as found within major biogeographic regions based on their total range. Sculpins were categorized into eight biogeographic regions: the eastern Pacific (EP), north Pacific (NP), northeastern Pacific (NEP), northwestern Pacific (NWP), north Atlantic (NAtl), NP + arctic, NAtl + arctic, and NP + NAtl + Arctic. The four species found in the eastern central Pacific (ECP) were grouped into EP as these species do not range farther south than Punta Eugenia, Baja California and have mostly overlapping ranges with the other EP species (Table 1) and doing so makes no difference in terms of the general conclusions of this work. Since the freshwater species were not the focus of this study and not found within a marine biogeographic region they were not coded (Fig. 2).

RESULTS

3.1. Nucleotide composition and DNA sequences

103

Approximately 1270 bp were sequenced for almost all 130 individuals. However due to PCR or sequencing difficulties, a few taxa are represented by only one of the two loci. The fragment lengths used for phylogenetic analysis for cyt b = 800bp and S7 = 470bp. Both cyt b and S7 show a positive C bias and an anti-G bias (Table 3). However, for both loci, chi-square analyses showed no difference in base frequency across taxa (p > 0.95 in both cases).

3.2. Maximum parsimony

Maximum parsimony analysis of the cyt b gene resulted in 355 parsimony informative sites (Table 4) and 53 equally parsimonious trees of length 4070 steps (not shown). The S7 locus resulted in 188 parsimony informative sites (Table 4) and reached the maximum of 2000 equally parsimonious trees of length 910 (not shown). The combined data analysis from both loci yielded 543 parsimony informative characters and also reached the maximum of 2000 equally parsimonious trees of 4851 steps. The 50% majority-rule consensus tree (not shown) resulted in a tree length of 6435 steps (CI = 0.177, RI = 0.371).

3.3. Maximum likelihood and Bayesian inference

The BI and ML tree topologies were nearly identical to each other, therefore only the BI tree is shown with Bayesian posterior probabilities and aLRT support plotted on each node (Fig. 2). Generally, statistical confidence in nodes was high for both basal and derived nodes, but varied considerably (Fig. 2). For shared species, the molecular ML phylogenetic hypothesis proposed here is statistically significantly different from that based on morphology (S-H Test P<0.05; Bolin, 1947).

3.4. Biogeographic history

104

The area cladogram (Fig. 2) shows that the basal species in this phylogeny are found in the eastern Pacific (EP) and that a lineage of freshwater sculpins (Cottus) branched off early in the evolutionary history of the group. It appears the clade then predominantly moved to the NP giving rise to a number of descendant lineages found throughout the NP, Arctic, and NAtl. The monophyletic clade consisting of Chitonotus, Ruscarius, Artedius, Clinocottus, Oligocottus, Orthonopias, and Leiocottus appears to have radiated back in the EP and these species have largely overlapping ranges. The NWP sculpin assemblage is polyphyletic with seven independent colonization events indicated. Additionally, the NAtl species are also polyphyletic with eight independent colonization events indicated. One species, Triglops pingelii, is found throughout the NP, the Arctic, and the NAtl.

Discussion

4.1. A phylogenetic hypothesis for North American Pacific Coast sculpins

With the inclusion of 76 species from the NAPC and 99 species in total (14 species still missing from NAPC), this study nearly doubles the taxonomic coverage of previous work (Bolin, 1947) with few unresolved nodes and generally high statistical support (Fig. 2).

4.2. Monophyly of North American Pacific Coast radiation?

The NAPC sculpin assemblage is not monophyletic as a number of genera have exclusively NWP species (e.g. Myoxocephalus, Icelus). However, it has not previously been addressed if there is a monophyletic assemblage nested within the NAPC clade. I have found evidence for multiple trans-Pacific dispersal events resulting in strictly NWP species within NAPC lineages. For example, Icelus ochotensis and I. toyamensis are only found in the NWP but are nested within the otherwise NAPC genus Icelus (Fig. 2). Similarly, Myoxocephalus brandtii and M. stelleri are only found in the NWP but again 105 are nested within the otherwise NAPC genus Myoxocephalus (Fig. 2). However, all members of the Chitonotous-Ruscarius-Artedius-Orthonopius-Clinocottus-Leiocottus- Oligocottus clade (Fig. 2) are strictly found along the NAPC (predominately in EP) and therefore constitute a monophyletic assemblage.

4.3. Did the radiation originate in the north Pacific?

The NP is the center of diversity for sculpins and has been hypothesized to also be their center of origin (Watanabe, 1969; Eschmeyer, 1983; Yabe, 1985). However, the evidence presented here indicates this radiation has a more complex biogeographic history. The area cladogram (Fig. 2) indicates that basal species in this phylogeny are found strictly in the eastern Pacific (EP). It appears the clade then predominantly moved to the NP giving rise to a number of descendant lineages found throughout the NP, NWP, Arctic, NAtl, and EP (Fig. 2).

4.4. Origin of northern Atlantic sculpins

Has trans-Arctic dispersal resulted in NAtl species nested within NP clades? Approximately 4.4 million years ago (MYA) the Bering Strait opened and allowed for exchange of marine organisms from the NP to the NAtl (Vermeij, 1991; Briggs, 1995; Hardy et al. 2011). For approximately one million years after the first opening of the Bering Strait, Arctic water mainly flowed to the south through the strait. It was not until the shoaling of the Isthmus of Panama caused major changes in global ocean circulation that resulted in a reversal to northward current-flow through the Bering Strait (Haug and Tiedemann 1998; Gladenkov and Gladenkov 2004). Fossil data suggest that the Bering Strait has opened and closed repeatedly since this time period (Gladenkov and Gladenkov 2004) and many taxa are known to have colonized the NAtl from the NP, and vice-versa (although the interchange has been dominated by NP clades invading the NAtl), since this time period (Vermeij, 1991; Hardy et al. 2011).

106

I find evidence that the NAtl species are polyphyletic with eight independent colonization events indicated, giving rise to the three NAtl endemics and four NAtl + Arctic species included in this analysis (Fig. 2). One species, Triglops pingelii, is found throughout the NP, Arctic, and NAtl (Fig. 2). It appears that either long distance dispersal and founder speciation or range expansion and subsequent vicariant speciation gave rise to the Arctic + NAtl and NAtl endemics, as all are nested within NP clades. Additionally, all appear to be of recent evolutionary origin, as all are descended from relatively distal nodes in the phylogeny (Fig. 2). While we cannot be sure whether this historical connection occurred across the northern coastlines of Asia or North America, the predominant current pattern was (and remains) from west to east in both cases and it is believed that most marine organisms that colonized the NAtl from the NP during this time period did so across the northern coastline of North America (Vermeij, 1991; Hardy et al. 2011).

4.5. Molecular vs. morphological hypotheses

For species represented in both this study and Bolin (1947), the phylogenetic hypotheses are statistically significantly different from each other (S-H Test P<0.05; Bolin, 1947). This work also suggests that the family Cottidae is not monophyletic, as representatives of three other cottoid families (Rhamphocottidae, Hemitripteridae, and Psychrolutidae; Table 1) included in this study nest within the Cottidae (Fig. 2). However, formerly these families were included in the Cottidae (Taranets, 1941; Bolin 1944, 1947). The Rhamphocottidae is comprised of a single species, the grunt sculpin (Rhamphocottus richardsonii). Some taxonomists classify grunt sculpins in the Cottidae, but Washington et al. (1984) and Yabe (1985) classified them as a primitive sister family to the other members of the superfamily Cottoidea. The Hemitripteridae, or sailfin sculpins, are comprised of eight marine species that all have tall first dorsal fins. Again, these species were formerly considered members of the Cottidae, but Washington et al. (1984) and Yabe (1985) classified them as the sister group to the Agonidae (poachers). Lastly, the Psychrolutidae (fathead, soft, or blob sculpins), includes about 30 species of 107 loose-skinned, demersal marine sculpins that differ from other members of the Cottoidea by the presence of well-developed bony arches (which may bear spines) over the lateral line system of the head (Nelson, 1982). Taranets (1941) defined many subfamilies of cottids that are largely considered no longer reliable due to the body of evidence that now points to too many exceptions, and most researchers consider it premature to define subfamilies (Bolin, 1947; Mecklenburg et al., 2002).

4.5.1. Generic relationships

I focus here on the evolutionary relationships within genera recovered in this phylogenetic analysis and how those proposed relationships compare to previous assessments. All genera found on the NAPC with two or more species included in this analysis are discussed below in alphabetical order.

Artedius. Bolin (1947) defined Artedius by its large head, normal pelvic fins, and unadvanced anus. However, as Begle (1989) points out, these are not synapomorphic characters for the group and are symplesiomorphic characters for the family. However, Begle (1989) found six morphological synapomorphies that support Artedius. Bolin (1947) was the first to offer a branching diagram for the Artedius species and Howe and Richardson (1978) agreed with Bolin that A. corallinus and A. lateralis appear to be closely related and that A. fenestralis and A. notospilotus share some characteristics suggesting affinity, but not to the extent as the above species pair. This work supports the conclusion that A. lateralis and A. corallinus are more closely related to each other than either is to the other Artedius species. However, this work places A. fenestralis and A. harringtoni in a polytomy with the split to A. notospilotus and Clinocottus acuticeps (Fig. 2).

Blepsias. This genus is currently classified in the cottoid family Hemitripteridae along with the genera Nautichthys and Hemitripterus based on the presence of numerous prickles on the head and body, a knobby front-parietal ridge, broad plate-like epurals, and 108 the absence of the basihyal bone (Mecklenburg et al. 2002). There are only two currently recognized species in the genus Blepsias and they form a monophyletic pair with high statistical confidence (Fig. 2). However, they do not group with the Nautichthys species or with Hemitripterus bolini in this analysis (Fig. 2).

Clinocottus. Bolin (1947) defined Clinocottus based on the more anterior position of the anus between the anal fin and pelvic fins, the heavy and blunt penis, and the unmodified anal fin in both sexes. Howe and Richardson (1978) concurred with Bolin (1947) that Clinocottus globiceps and Clinocottus recalvus appear quite closely related and that Clinocottus embryum appears more closely related to these two species than to either Clinocottus analis or Clinocottus acuticeps. However, Howe and Richardson noted that the interrelationships of the species within the genus are in need of study. This study does not support the monophyly of Clinocottus in any of the analyses performed (Fig. 2) and is in agreement with Ramon and Knope (2008) that Clinocottus is not a natural group.

In this study, C. acuticeps appears to be the most distantly related to any of the other nominal species of Clinocottus. C. analis consistently groups with L. hirundo and basal to the Oligocottus clade (Fig. 2). All the trees presented here support sister status for C. recalvus and C. embryum, with C. globiceps closely related to this pair. All previous morphological investigators have concluded that C. recalvus and C. globiceps are sister species, with C. embryum the closest relative to this pair. This work supports the conclusion by Howe and Richardson (1978) and Ramon and Knope (2008) that C. acuticeps and C. analis do not appear closely related to each other or to the other three species of Clinocottus.

The genus Clinocottus was originally described as three separate genera (Oxycottus, Blennicottus, and Clinocottus) and Bolin (1947) subsumed them into Clinocottus. Bolin demoted the generic designations to subgeneric designations based on the following three lines of evidence: (1) progressive loss of preopercular spines, scales, 109 and last gill slit, (2) head change from pointed to hemispherical, and (3) enlargement and elaboration of the penis. C. analis and C. acuticeps retain the primitive pointed head structure, unlike the other three Clinocottus species that have very large rounded heads (Bolin, 1944) amd form a monophyletic group in this analysis (Fig. 2). In addition, Bolin (1947) was making an argument for the retention of the genus as a valid systematic category to counter the trend of systematic splitting that was common at the time, which may explain why Clinocottus is not a natural group.

Cottus. The freshwater sculpins in the genus Cottus have radiated throughout Northern Hemisphere freshwater habitats. The phylogenetic relationships among Cottus and related taxa were evaluated with molecular markers by Yokoyama and Goto (2005) and Kinziger et al. (2005). Yokoyama and Goto (2005) suggested that the common ancestor of freshwater sculpins was a euryhaline species, similar to Leptocottus, which is primarily marine but often enters lower reaches of rivers and streams. Kinziger et al. (2005) recognized the lack of monophyly for Cottus with respect to the Lake Baikal sculpins and the genus Leptocottus. Both Yokoyama and Goto (2005) and Kinziger et al. (2005) showed that Cottus is both polyphyletic and paraphyletic and suggest that the genus is in need of revision. While freshwater sculpins were not the focus of this study, the four species included form a monophyletic group with Leptocottus basal to this group (Fig. 2).

Enophrys. The genus and the relationships of the six recognized species are currently based on the morphometric analysis of Sandercock and Wilimovsky (1968). The Enophrys species are exclusively marine with plates along the lateral line, prickly scales below the lateral line in some species, a very long, sharp upper preopercular spine, and sharp nasal spines (Sandercock and Wilimovsky, 1968). This study includes only four of the six Enophrys species, limiting the ability to infer evolutionary relationships within the genus. However, it is important to note that the four species of Enophrys included in this study form a monophyletic group in all analyses performed (Fig. 2). Quast and Hall (1972) questioned the validity of Enophrys lucasi as a species distinct 110 from E. diceraus. This analysis places the two as sister species with high statistical confidence (Fig. 2) and the two species are 2.7% divergent at cyt b and 3.4% divergent at S7, perhaps suggesting incipient speciation.

Gymnocanthus. Wilson (1973) reviewed the six species of the genus Gymnocanthus that inhabit the NP, Arctic, and NAtl. Wilson described the genus as characterized by edentulous palatines and prevomer, granulations on the nape, scales restricted to axillary prickles, and an elongate, multi-cusped pre-opercular spine. The three species included in this study form a monophyletic cluster with high statistical support (Fig. 2), but since only half of the species in the genus are represented, I do not discuss their relationships further.

Hemilepidotus. Peden (1978) revised the systematics of Hemilepidotus and there are six currently recognized species in the genus. They all have three bands of scales: a dorsal band, a lateral band, and a ventral band and are generally similar in appearance (Bolin, 1947). All six species form a monophyletic clade in this analysis with very high statistical support (Fig. 2).

Icelus. The most recent revision of the genus Icelus and the very closely related Rastrinus were based on an osteological assessment by Nelson (1984). The monotypic Rastrinus scutiger is so closely related to Icelus that some researchers classify it in that genus (Mecklenburg et al., 2002). Icelus has one row of large, spiny plate-like scales below the dorsal fins, spiny tubular lateral line scales, scales on the pectoral axil and on the upper portion of the eye, and a nuchal spine or protuberance (Mecklenburg et al., 2002). As only seven of the broadly distributed twenty species of the genus are included here, I do not discuss relationships within the genus. However, I note that four species cluster in a monophyletic clade and the remaining three species cluster with Rastrinus scutiger, Nautichthys pribilovius, and Synchirus gilli in a sister group (Fig. 2).

111

Icelinus. Bolin (1936) described eight species in the genus, but recent discoveries place 11 species in the genus (Peden, 1984; Yabe et al. 1980; Yabe et al., 2001; Rosenblatt and Smith, 2004). The genus is diagnosed as including an antler-like fourth (dorsalmost) preopercular spine, a pelvic fin with one spine and two soft rays, two rows of ctenoid scales extending along the base of the dorsal fins (Bolin, 1936, 1944). All five species included in this analysis form a monophyletic group with high statistical confidence (Fig. 2).

Myoxocephalus. Neyelov (1979) described the genus as having a long, straight upper pre-opercular spine, an opening behind the last gill arch, a lower jaw that does not extend beyond the upper, and absence of cirri from the cheeks, jaws, and lateral line. Of the twenty species in the genus, six were included in this study and from a monophyletic clade with high statistical support (Fig. 2), except for one specimen identified as M. cf. scorpiodes which groups with a sister clade and basal to Megalocottus platycephalus and Triglops quadricornis, and could represent a new undescribed species.

Nautichthys. There are three species of sailfin sculpins in the genus Nautichthys (Hemitripteridae) differentiated from other members of the putative family by branched rays in the caudal fin and lack of cirri on the lower jaw (Mecklenburg et al., 2002). The two species included in this study (N. oculofasciatus and N. pribilovius) appear distantly related to one another (Fig. 2), with N. oculofasciatus and N. pribilovius in a basal polytomy with Jordania zonope and N. pribilovius nested within the clade primarily comprised of Icelus species (Fig. 2).

Oligocottus. The genus Oligocottus contains four species originally identified as sharing common ancestry by Hubbs (1926a). Bolin (1947) concurred with this conclusion, presenting the affinities of the four species and diagnosed the genus Oligocottus by the location of the anus directly in front of anal fin origin, the shape of the penis as a long, slender, simple cone, and the modification of the anterior anal rays in males. Bolin suggested that O. rubellio and O. snyderi are the most specialized and the 112 most closely related. O. maculosus was considered less specialized and less closely related to both of the aforementioned species. Bolin stated that O. rimensis is the most primitive and equally related to the other three species. Howe and Richardson (1978) agreed with the designation of Oligocottus as a monophyletic genus, but did not suggest any further affinities. This analysis confirms the monophyly of Oligocottus and supports the conclusion that O. rimensis is the basal species in the group, but places the other three species into a polytomy (Fig. 2).

Porocottus. Neyelov (1976, 1979) classified Porocottus and Microcottus by the upper preopercular spine being abruptly curved upward and by the lack of slit or pore behind the fourth gill arch. Neyelov distinguished Porocottus from Microcottus by the postoccular and occipital cirri being usually multifid. There are currently ten species classified in Porocottus and the two species of Porocottus in this study group together with high statistical support (Fig. 2), but without the inclusion of the other species in the genus they are not necessarily sister species.

Pseudoblennius. There are currently six described species in the genus Pseudoblennius and an additional three undescribed species (Nakobo 2002; Sado et al., 2004). All species are restricted to the NWP. The two species included in this study (P. percoides and P. sp. 3 sensu Nakobo 2002) form a monophyletic grouping with high statistical support (Fig. 2).

Ruscarius. Begle (1989) proposed that the former Artedius creaseri and Artedius meanyi are the sister clade to the monotypic Chitonotus. In fact, Begle found no synapomorphies that unite A. creaseri and A. meanyi with the other Artedius species. However, these two species share seven synapomorphic morphological characters with each other, prompting Begle to resurrect the genus Ruscarius for these two species. In addition to Begle’s study, Washington (1986), Strauss (1993), and Ramon and Knope (2008) have suggested that these two species do not belong with the other Artedius species and concurred that these species should be placed back in their original genus 113

Ruscarius. This work also supports Begle’s (1989) conclusion that Ruscarius is most closely related to Chitonotus and not to the Artedius species (Fig. 2).

Triglops. Pietsch (1994) revised the classification of Triglops and concluded that there are nine valid species of Triglops. Pietsch defined the genus based on the following characters: a small head, a narrow, elongate body, a slender caudal peduncle, a long anal fin containing 18-32 rays, pelvic fins with a single spine and three soft rays, branchiostegal membranes united on the ventral midline but lying free from the isthmus, and the scales below the lateral line modified to form discrete rows of tiny serrated plates that lie in close-set, oblique dermal folds. Eight of the nine Triglops species included here form a monophyletic clade with high statistical support (Fig. 2), however T. quadricornis does not group with the other species. Neyelov (1979) changed Myoxocephalus quadricornis to Triglops quadricornis and this work suggests that the name change was incorrect (Fig. 2).

4.6. Why is the North American Pacific Coast sculpin radiation so speciose? Many marine organisms have the potential for long distance dispersal with long- lived and planktonic eggs and/or larvae, but recent work shows this is not always the case (e.g., Swearer et al., 1999; Cowen et al., 2006). Sculpins are known to display high site fidelity as adults (Yoshiyama et al., 1986; Yoshiyama et al., 1992) and are not broadcast spawners, so gene flow is likely to be mediated only through the larval stage (Budd, 1940; Hubbs, 1966; Swank, 1979; Ramon, 2007). Judging from the widespread distribution of species, sculpin larvae can disperse great distances. However, along the NAPC, the larvae are generally only found nearshore in plankton tows (Marliave, 1986; Knope and Sakuma, unpubl. data) and population genetic surveys have found low to moderate levels of gene flow among populations (Swank, 1979; Waples, 1987; Ramon, 2007; Knope unpubl. data). So it may be that sculpin larvae can disperse enough to colonize novel ranges and habitats, but have limited ongoing gene flow facilitating speciation by diversifying selection (Schluter, 2000). Further, colonization of new habitats is hypothesized to open up new ecological opportunities and thus promote 114 lineage diversification (Schluter, 2000). Sculpins can be found in almost every aquatic habitat type and it appears that repeated habitat shifts have facilitated their diversification. For example, Ramon and Knope (2008) and Mandic et al. (2009) found a clear trend in the Chitonotous-Ruscarius-Artedius-Orthonopius-Clinocottus-Leiocottus- Oligocottus clade that subtidal sculpins in this clade are basal species, while the most derived species are primarily found in the intertidal.

5. Summary

In many respects, this work supports the phylogenetic relationships proposed by previous authors working with morphological characters. However, this phylogeny differs in a number of respects from those of previous investigators. Other molecular markers could be useful in resolving the discrepancies. In addition, the phylogenetic relationships may become more clearly resolved by reexamining the morphological characters that Bolin investigated using modern phylogenetic methods that can distinguish shared ancestral from shared derived characters.

Marine sculpins of the northern Pacific have a complicated biogeographic history. All analyses produced highly similar tree topologies that suggest an origin of the clade in the EP followed by colonization of the NP, then giving rise to a number of descendant lineages found throughout the northern Pacific Ocean, including one that re-colonized the EP. Many species have largely overlapping ranges and it appears that repeated habitat shifts have facilitated diversification. Additionally, historical dispersal through the Bering Strait and across the Arctic Ocean has given rise to eight separate colonization events of the NAtl and it appears either founder speciation or vicariant speciation has given rise to the NAtl and NAtl + Arctic endemics.

Future research should aim towards complete taxonomic sampling of all approximately 275 cottid species and related cottoid families to fully resolve the evolutionary history of this successful radiation of fishes. In addition, further 115 identification of drivers of speciation in this radiation may provide insights into what causes some lineages to diversify greatly while others do not.

Acknowledgements

I thank: Tadashi Fukami for support and advice; Jilian Chapman, David Christie, Robert Foy, Erica Fruh, Michael Hardman, Stewart Grant, Richard Hocking, Yoshiaki Kai, Dan Kamikawa, Aimee Keller, Andrew Kinziger, Heather Leba, Ty Linderoth, Katherine Maslenikov, Mifuyu Nakajima, Carmen Olito, James Orr, Sheamus Riley, Gento Shinohara, and David Tallmon for assistance with obtaining samples; Nicole Bitler, Pasha Feinberg, Olivia Isaac, Christine Kyauk, and Alexandra Ritchie for assistance with lab work; and Melinda Belisle, Lis Castillo Nelis, Tadashi Fukami, and Marina Oster for comments. Financial support was provided by Stanford University, a Stanford University VPUE SCORE grant, and a Dr. Earl H. Myers and Ethel M. Myers Oceanographic and Marine Biology Trust grant.

116

References

Begle, D.P., 1989. Phylogenetic analysis of the cottid genus Artedius (Teleostei: Scorpaeniformes). Copeia 3:642-652.

Berg, L.S., 1947. Classification of fishes both recent and fossil. Mich., J.W. Edwards, Ann Arbor.

Bolin, R.L., 1936. A revision of the genus Icelinus Jordan. Copeia 3:151-159.

Bolin, R.L., 1944. A review of the marine cottid fishes of California. Stanford Ichthy. Bull. 3:1-135.

Bolin, R.L., 1947. The evolution of the marine Cottidae of California with a discussion of the genus as a systematic category. Stanford Ichthy. Bull. 3:153-168.

Briggs, J.C., 1995. Global Biogeography. Elsevier, Amsterdam.

Budd, P.L. 1940. Development of the eggs and early larvae of six California fishes. California Department of Fish and Game. Fish Bulletin 56.

Chow, S., Hazama, K., 1998. Universal PCR primers for S7 ribosomal protein gene introns in fish. Mol. Ecol. 7, 1255.

Cowen R. K., Paris C. B., Srinivasan A. 2006. Science 311:522–527.

Crow, K.D., Kanamoto, Z., Bernardi, G., 2004. Molecular phylogeny of the hexagrammid fishes using a multi-locus approach. Mol. Phylo. Evol. 32:986-997.

Drummond, A.J., Ashton, B., Cheung, M., Heled, J., Kearse, M., Moir, R., Stones-Havas, S., Thierer, T., Wilson, A., 2009. Geneious v4.7

Eastman, J.T., McCune, A.R., 2000. Fishes on the Antarctic continental shelf: evolution of a marine species flock? J. Fish Biol. 57:84-102.

Eschmeyer, W. N., Herald, E. S., Hamann, H., 1983. A field guide to Pacific Coast fishes of North America. Peterson Field Guide Series. Houghton Mifflin Co., Boston

Felsenstein, J., 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39:83-91.

Gill, T., 1889. On the classification of the mail-cheeked fishes. Proc. U.S. Natl. Mus., pp. 567-592.

117

Gladenkov, A.Y., Gladenkov, Y.B. 2004. Onset of connections between the Pacific and Arctic oceans through the Bering Strait in the Neogene. Stratigr. Geol. Correl. 12:175-187.

Guindon, S., Gascuel, O., 2003. A simple, fast and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52:696-704.

Hardy, S.M., Carr, C.M., Hardman, M., Steinke, D., Corstophine, E., Mah, C. 2011. Biodiversity and phylogeography of Arctic marine fauna: insights from molecular tools. Mar. Biod. 41:195-210.

Hart, J.L., 1973. Pacific fishes of Canada. Fish. Res. Board Can. Bull. 180. 740 pp.

Haug, G.H., Tiedemann R.1998. Effect of the formation of the Isthmus of Panama on Atlantic Ocean thremohaline circulation. Nature 393:673-676.

Hasegawa, M., Kishino, H., Yano, T.A., 1985. Dating of the Human Ape Splitting by a Molecular Clock of Mitochondrial-DNA. J. Mol. Evol. 22:160-174.

Howe, K.M., Richardson, S.L., 1978. Taxonomic review and meristic variation in marine sculpins (Osteichthyes:Cottidae) of the northeast Pacific Ocean. National Marine Fisheries report.

Hubbs, C.L., 1926a. A revision of the fishes of the subfamily Oligocottinae. University of Michigan, Ann Arbor, Mich.

Hubbs, C.L., 1926b. Descriptions of new genera of cottoid fishes related to Artedius. Occ. Pap. Mus. Zool. Univ. Mich. 170:1-16

Hubbs, C.L. 1966. Fertilization, initiation of cleavage, and development temperature tolerance of the cottid fish, Clinocottus analis. Copeia 1966:29-42.

Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754-755.

Hyde, J.R., Vetter, R.D., 2007. The origin, evolution, and diversification of rockfishes of the genus Sebastes (Cuvier). Mol. Phyl. Evol. 44:790-811.

Jackson, K.L., 2003. Contributions to the systematics of cottoid fishes (Teleostei: Scorpaeniformes). Dept. of Biological Sciences. University of Alberta, pp. [13], 181 leaves 128 cm.

Jordan, D.S., Starks, E.C., 1895. The fishes of Puget Sound. Leland Stanford Junior University. Hopkins Laboratory of Biology. Contribution no. III. Palo Alto, CA.

118

Jordan, D.S., Starks, E.C., 1904. A review of the Cottidae or sculpins found in the waters of Japan. Proc. U.S. Natl. Mus. 27:231-335.

Kinziger, A.P., Wood, R.M., Neely, D.A., 2005. Molecular systematics and classification of Cottus and the Baikalian cottoids (Scorpaeniformes). Copeia 2005:303-311.

Knope, M.L., 2004. Molecular phylogenetics of sculpins in the genera Ruscarius, Artedius, Clinocottus, and Oligocottus. Master’s thesis, San Francisco State University.

Love, M., 2011. Certainly more than you want to know about the fishes of the Pacific Coast. Really Big Press, Santa Barbara, CA.

Macfarlane, J.M., 1923. The evolution and distribution of fishes. The Macmillan Company, New York.

Marliave, J.B. 1986. Lack of planktonic dispersal of rocky intertidal fish larvae. Trans. Amer. Fish. Soc. 115:149-154.

Mecklenburg, C.W., Mecklenburg, T.A., Thorsteinson, L.K., 2002. Fishes of Alaska. American Fisheries Society, Bethesda, Maryland. 1,037 pp.

Miglietta, M.P., Faucci, A., Santini, F., 2011. Speciation in the Sea: Overview of the Symposium and Discussion of Future Directions. Integr. Compar. Biol. 51(3):449–455.

Miller, D.J., Lea, R.N., 1972. Guide to the coastal marine fishes of California. Cal. Dept. Fish and Game Fish Bull. Sacramento, CA.

Morrow, J.E., 1980. The freshwater fishes of Alaska. Alaska Northwest Publishing Company, Anchorage. 248 pp.

Nakobo, T. 2002. Cottidae. In: Nakabo T. (ed) Fishes of Japan with pictorial keys to the species, English edition. Tokai University Press, Tokyo, pp 628-650, 1525-1528.

Nelson, J.S., 1982. Two new South Pacific fishes of the genus Ebinania and contrbutions to the systematics of Psychrolutidae (Scorpaeniformes). Can. J. Zool. 60:1470- 1504.

Nelson, D.W., 1984. Systematics and distribution of cottid fishes of the genera Rastrinus and Icelus. Occas. Pap. Calif. Acad. Sci. 138. 58 pp.

Nelson, J.S., 2006. Fishes of the world. John Wiley & Sons, Inc., New Jersey.

119

Neylov, A.V., 1976. Survey of the fringed sculpins of the genus Porocottus Gill and closely related genera (Cottidae, Myoxocephalinae). Pp 78-112 in V.M. Korovina, ed. Zoogeography and systematics of fishes. Zool. Inst. Akad. Nauk SSSR. [In Russian.]

Neylov, A.V., 1979. Seismosensory system and classification of sculpins (Cottidae: Myoxocephalinae, Artediellinae). Leningrad, Nauka. 208 pp. [In Russian.]

Palumbi, S. R., 1994. Genetic divergence, reproductive isolation, and marine speciation. Ann. Rev. Ecol. Evol. Syst. 25:547-572.

Palumbi, S.R., 1996. The simple fool’s guide to PCR. Dept. of Zoology and Kewalo Marine Laboratory, University of Hawaii, Honolulu, HI.

Peden, A.E., 1978. A systematic revision of the hemilepidotine fishes (Cottidae). Syesis 11:11-49.

Pietsch, T.W., 1994. Systematics and distribution of cottid fishes of the genus Triglops Reinhardt (Teleosti: Scorpaeniformes). Zool. J. Linn. Soc. 109(4):335-393.

Posada D., 2008. jModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25, 1253– 1256.

Quast, J.C., Hall, E.L., 1972. List of fishes of Alaska and adjacent waters with a guide to some of their literature. U.S. Dep. Commer. NOAA Tech. Rep. NMFS SSRF-658. 47 pp. [With errata sheet data 20 Dec. 1972].

Ramon, M.L., 2007. Molecular ecology of intertidal sculpins. PhD thesis, UCSC.

Ramon, M.L., Knope, M.L., 2008. Molecular support for marine sculpin (Cottidae; Oligocottinae) diversification during the transition from the subtidal to intertidal habitat in the Northeastern Pacific Ocean. Mol. Phylogen. Evol. 46: 475-483.

Rosenblatt, R.H., Smith, W.L., 2004. Icelinus limbaughi: a new species of sculpin (Teleostei: Cottidae) from southern California. Copeia 3:556-561.

Sado, T., Tachibana Y., Kimura, S. 2005. Developmental morphology of the cottid fish Pseudoblennius marmoratus. Ichth. Res. 52:292-296.

Sandercock, F.K., Wilimovsky, N.J., 1968. Revision of the cottid genus Enophrys. Copeia 4:832-853.

120

Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol. Biol. Evol. 16:1114-1116.

Smith, W.L., Wheeler, W.C., 2004. Polyphyly of the mail-cheeked fishes (Teleostei: Scorpaeniformes): evidence from mitochondrial and nuclear sequence data. Mol. Phylogen. Evol. 32:627-646.

Strauss, S.E., 1993. Relationships among the cottid genera Artedius, Clinocottus, and Oligocottus (Teleostei: Scorpaeniformes). Copeia 2:518-522.

Swank S.E. 1979. Population genetics and evolution of some intertidal fishes of the genus Clinocottus. PhD thesis, University of Southern California.

Swearer, S.E., Caselle, J.E., Lea, D.W., Warner, R.R. (1999) Larval retention and recruitment in an island population of a coral-reef fish. Nature 402:799-802.

Swofford, D.L., 2002. PAUP* Phylogenetic analysis using parsimony (*and other methods). Sinauer, Sunderland, Massachusetts.

Taranets, A.Y., 1941. On the classification and origin of the family Cottidae. Isues. Akad. Nauk. SSSR, Otd. Biol. 1943(3):427-447 (Translated from Russian, Inst. Fish., Univ. British Columbia Mus. Contr. 5:1-28).

Vermeij, G.J., 1991. Anatomy of an invasion: The Trans-Arctic Interchange. Paleobiology 17:281-307.

Waples, R.S. 1987. A multispecies approach to the analysis of gene flow in marine shore fishes. Evolution 41:385-400.

Washington, B.B., Eschmeyer, W.N., Howe, K.M., 1984. Scorpaeniformes: relationships. Pp 438-447 in H.G. Moser et al., eds. Ontogeny and systematics of fishes. Am. Soc. Ichthyol. Herpetol. Spec. Publ. 1.

Washington, B.B., 1986. Systematic relationships and ontogeny of the sculpins Artedius, Clinocottus, and Oligocottus (Cottidae: Scorpaeniformes). Proc. Calif. Acad. Sci. 44:157-224.

Watanabe, M., 1969. Fauna Japonica: Cottidae (pisces). Tokyo News Service, Tokyo.

Wilson, D.E., 1973. Revision of the cottid genus Gymnocanthus, with a description of their osteology. M.S. thesis, University of British Columbia, Vancouver. 223 pp.

121

Yabe, M., 1985. Comparative osteology and myology of the superfamily Cottoidea (Pisces:Scorpaeniformes), and its phylogenetic classification. Faculty of Fisheries, Hokkaido University, Hakodate, Japan.

Yabe, M., Tsumura, K., Katayama, M., 1980. Description of a new cottid fish, Icelinus japonicus, from Japanese waters. Jpn. J. Ichthyol. 27:106–110.

Yabe, M., Soma, A., Amaoka, K., 2001. Icelinus pietschi sp. nov. and a rare species, Sigmistes smithi, from the southern Kuril Achipelago (Scorpaeniformes: Cottidae). Ichthyol. Res. 48(1):65-70.

Yokoyama, R., Goto, A., 2005. Evolutionary history of freshwater sculpins, genus Cottus (Teleostei: Cottidae) and related taxa, as inferred from mitochondrial DNA phylogeny. Mol. Phylogen. Evol. 36:654–668.

Yoshiyama, R.M., C. Sassaman, and R.N. Lea. (1986) Rocky intertidal fish communities of California: temporal and spatial variation. Env. Biol. Fishes 17(1):23-40.

122

Table 1. Summary of taxa sampled, distribution, and collection numbers. Distributions are abbreviated: Arctic (Arc), north Atlantic (NAtl), north Pacific (NP), northwestern Pacific (NWP), the eastern Pacific (EP), eastern central Pacific (ECP), and northeastern Pacific (NEP). Collection numbers begin with two-letter code for location of voucher specimen (FK = Maizuru Fisheries Research Station, Kyoto University; SU = Stanford University, Dept. of Biology; UH = University of Helsinki, Natural History Museum; UW = University of Washington, Burke Ichthyology Museum; N/A = Not applicable, as sequence is from GenBank). Collection Family Genus Species Distribution Number Cottidae Alcichthys elongatus NWP FK13118 Cottidae Archaulus biseriatus NP UW11997 Cottidae Artediellus fuscimentus NWP FK131111 Cottidae Artediellus pacificus NP UW150025 Cottidae Artediellus scaber NAtl UW150030 Cottidae Artedius corallinus EP N/A Cottidae Artedius fenestralis EP N/A Cottidae Artedius harringtoni EP N/A Cottidae Artedius lateralis NP SUKN010 Cottidae Artedius notospilotus EP N/A Cottidae Atopocottus tribranchius NWP FK132895 Cottidae Bero elegans NWP FK130488 Hemitripteridae Blepsias bilobus NP SUKN014 Hemitripteridae Blepsias cirrhosus NP SUKN008 Cottidae Chitonotus pugetensis EP SUKN057 Cottidae Clinocottus acuticeps EP SUKN015 Cottidae Clinocottus analis EP (ECP) N/A Cottidae Clinocottus embryum EP SUKNO25 Cottidae Clinocottus globiceps EP N/A Cottidae Clinocottus recalvus EP N/A Cottidae Cottiusculus gonez NWP FK132213 Cottidae Cottus amblystomopsis Asia UW29174 Cottidae Cottus cognatus N. America UH114 Cottidae Cottus kazika Japan FK132173 Cottidae Cottus pollux (mid-size egg) Japan SUKN130 Cottidae Dasycottus setiger NP SUKN0013 Cottidae Enophrys bison EP N/A Cottidae Enophrys diceraus NP UW150180 Cottidae Enophrys lucasi NP UW112174 Cottidae Enophrys taurina EP (ECP) SUKN058 Cottidae Furcina osimae NWP FK131882 Cottidae Gymnocanthus galeatus NP UW 44189 Cottidae Gymnocanthus pistilliger NP UW150257 Cottidae Gymnocanthus tricuspis Arc & NAtl UW150277 Cottidae Hemilepidotus gilberti NP UW49723 Cottidae Hemilepidotus hemilepidotus NP SUKN001 123

Cottidae Hemilepidotus jordani NP SUKN002 Cottidae Hemilepidotus papilio Arc & NP UW 49428 Cottidae Hemilepidotus spinosus EP SUKN018 Cottidae Hemilepidotus zapus NP UW111999 Cottidae Hemitripterus bolini NP SUKN017 Cottidae Icelinus borealis EP N/A Cottidae Icelinus burchami EP SUNK059 Cottidae Icelinus filamentosus EP UW49116 Cottidae Icelinus fimbriatus EP SUKN038 Cottidae Icelinus tenuis EP UW117021 Cottidae Icelus euryops NP UW117205 Cottidae Icelus ochotensis NWP FK132551 Cottidae Icelus spatula Arc & NAtl UW150028 Cottidae Icelus toyamensis NWP FK132550 Cottidae Icelus uncinalis NEP UW117176 Cottidae Icelus canaliculatus NP UW112091 Cottidae Icelus spiniger NP UW115870 Cottidae Jordania zonope EP N/A Cottidae Leiocottus hirundo EP (ECP) N/A Cottidae Leptocottus armatus EP SUKN016 Cottidae Megalocottus platycephalus NP UW150203 Cottidae Microcottus sellaris NP UW150203 Cottidae Myoxocephalus brandtii NWP FK130458 Cottidae Myoxocephalus cf. scorpioides NP UH112 Cottidae Myoxocephalus jaok NP UW150274 Cottidae Myoxocephalus polyacanthocephalus NP UW 47635 Cottidae Myoxocephalus scorpius Arc & NAtl SUKN039 Cottidae Myoxocephalus stelleri NWP FK130458 Cottidae Myoxocephalus verrucosus NP UW150284 Hemitripteridae Nautichthys oculofasciatus EP SUKN003 Hemitripteridae Nautichthys pribilovius NP UW117335 Cottidae Oligocottus maculosus NP SUKN023 Cottidae Oligocottus rimensis EP N/A Cottidae Oligocottus rubellio EP N/A Cottidae Oligocottus snyderi EP N/A Cottidae Orthonopias triacis EP (ECP) N/A Cottidae Porocottus allisi NWP UW 47873 Cottidae Porocottus camtschaticus NWP UW 44501 Cottidae Pseudoblennius percoides NWP FK131881 Cottidae Pseudoblennius sp.3 sensu Nakabo NWP FK132480 Psychrolutidae Psychrolutes phrictus NP SUKN079 Cottidae Radulinus asprellus EP SUKN037 Cottidae Rastrinus scutiger NEP UW117240 Rhamphocottidae Rhamphocottus richardsonii NP SUKN011 Cottidae Ricuzenius pinetorum NWP FK131167

124

Cottidae Ruscarius creaseri EP (ECP) N/A Cottidae Ruscarius meanyi EP N/A Cottidae Scorpaenichthys marmoratus EP N/A Cottidae Stellerina xyosterna EP N/A Cottidae Stlengis misakia NWP FK132495 Cottidae Synchirus gilli EP UW49430 Cottidae Trichocottus brashnikovi NP UW150262 Cottidae Triglops forficatus NP UW49483 Cottidae Triglops macellus EP UW110461 Cottidae Triglops metopias NP UW49475 Cottidae Triglops murrayi NAtl UW111785 Cottidae Triglops nybelini NAtl UW111786 Cottidae Triglops pingelii Arc, NP, NAtl UW49659 Cottidae Triglops quadricornis Arc & NAtl UW150271 Cottidae Triglops scepticus NP UW111989 Cottidae Triglops xenostethus NP UW117184 Cottidae Zesticelus profundorum NP UW115868

125

Table 2. Summary of loci used and primer sequences. Locus Length Primers Mitochondrial cyt b 800 GLUDG-L: 5’–TGACTTGAARAACCAYCGTTG–3’ CB3-H: 5’–GGCAAATAGGAARTATCATTC–3’ Nuclear ribosomal S7 470 S72F: 5’–TCTCAAGGCTCGGATACGTT–3’ S74R: 5’–TACTGAACATGGCCGTTGTG–3’

Table 3. Summary of initial model parameters used in maximum likelihood and Bayesian analyses. a Gamma shape parameter; b Proportion of invariant sites Locus Model -lnL Ga Ib Base freq. Rate matrix cyt b GTR+G+I 18299.29 0.716 0.489 A = 0.2489 AC=0.8518 AT=0.7871 CT=5.6744 C = 0.4009 G = 0.1258 AG=7.8251 CG=0.5392 GT=1.0000 T = 0.2245 S7 TIM3ef+I+G 4822.85 0.859 0.000 A = 0.2074 AC=1.6804 AT=1.0000 CT=2.2493 C = 0.2457 AG=1.6804 CG=0.9727 GT=1.0000 G = 0.2546 T = 0.2923 Both TVM+G 23460.41 0.313 0.000 A = 0.2177 AC=0.8539 AT=0.7715 CT=4.0213 C = 0.3654 AG=4.0213 CG=0.4488 GT=1.0000 G = 0.1813 T = 0.2356

Table 4. Summary of maximum parsimony analyses Locus # Species # Constant # Variable # Parsimony # Trees sites uninformative informative sites (length) sites cyt b 97 480 53 355 53 (4070) S7 85 245 130 188 2000 (910) Both 99 566 144 548 2000 (4851)

126

Fig. 1. Bolin’s (1947) hand-drawn phenetic assessment of the phylogenetic relationships of cottids found in California waters. The line A-A in the diagram indicates the generally accepted limits of the genera of California Cottidae before Bolin’s (1947) reassessment, the line B-B indicates the demarcation line of subgenera based on Bolin’s reassessment, and the line C-C represents the limits of genera after Bolin’s reassessment.

127

Fig. 2. Bayesian phylogenetic reconstruction using the mitochondrial gene cyt b and the nuclear ribosomal S7 intron. Statistical support values are either above or below each node with Bayesian posterior probabilities to the left and maximum likelihood aLRT values to the right. Dashed lines indicate less than 50% support. Present-day species biogeographic regions are plotted on the tree in a parsimony framework. Green = EP, blue = NP, yellow = NEP, red = NWP, pink = NAtl, purple = Arctic + NP, orange = Arctic + NAtl, dark green = NP + Arctic + NAtl, black = freshwater, and grey = equivocal.

128

VITA

Matthew Knope was born in Miami, FL on May 10, 1975. He was raised in rural Humboldt County, CA and Kauai, HI, where he attended public schools and graduated from South Fork High School in 1993. He received a Bachelor of Science degree in 1999 from the University of California, Santa Cruz and a Master of Arts degree in 2004 from San Francisco State University. He began his PhD at the University of Hawaii in 2006 and transferred to Stanford University in 2008 to pursue a Ph.D. degree in Biology with concentration in Ecology, Evolution, and Population Biology. In the spring of 2012, he plans to begin work as an instructor for Stanford University’s Biology Department.

129