1 Title: Revealing paraphyly and placement of extinct species within Epischura (Copepoda:

2 Calanoida) using molecular data and quantitative morphometrics

3

4 Author List: Larry L. Bowman, Jr.1,2, Daniel J. MacGuigan1, Madeline E. Gorchels3,4, Madeline 5 M. Cahillane3,5, and Marianne V. Moore3 6 7 1 Department of Ecology and Evolutionary Biology, Yale University, Osborn Memorial 8 Laboratories, 165 Prospect St., New Haven, CT, USA 06511 9 2Corresponding author: [email protected] 10 3Department of Biological Sciences, Wellesley College, 106 Central St., Wellesley, MA, USA 11 02481-0832 12 4Current address: Bren School of Environmental Science & Management, Bren Hall, 2400, 13 University of California, Santa Barbara, CA, USA 93117 14 5384 South St., Northampton, MA 01060 15 16 Declarations of interest: none.

Genetics Epischura (Epischurella) baikalensis

Epischura (Epischurella) chankensis

Heterocope septentrionalis

Diaptomidae Epischura fluviatilis .94 Epischura nordenskioldi

Pseudodiaptomidae

Epischura lacustris

Temoridae* .99 Epischura nevadensis

Fosshageniidae .96

Bathypontiidae .83 Temora discaudata .58 .97 .98 Sulcanidae Temora longicornis .97 .83 125 100 75 50 25 0 MYBP Rhincalanidae Centropagidae .82 Morphology Epischura lacustris Eucalanidae .88 .88 Pontellidae .89 Tortanidae Temora discaudata .72 Candaciidae Epischura nevadensis Subeucalanidae .64 .73 .39 Epischura nordenskioldi .66 Temoridae* .79 Epischura fluviatilis

Temora longicornis .83 250 150 50 MYBP .93 Epischura (Epischurella) baikalensis .97 Epischura (Epischurella) chankensis

Spinocalanidae Epischura massachusettsensis .98 .94 .90 Heterocope septentrionalis

.87 .67 .93 .44 .89 Calanidae .77 Genetics + Morphology Epischura (Epischurella) baikalensis Tharybidae .86 .52 Epischura (Epischurella) chankensis Phaennidae .64 Diaixidae .58 Epischura massachusettsensis .57 Heterocope septentrionalis .97 .79 Scolecitrichidae .98 Epischura fluviatilis .89 Epischura nordenskioldi .98 Clausocalanidae Epischura lacustris Paracalanidae Aetideidae* Epischura nevadensis

Euchaetidae* Aetideidae* Temora discaudata .84

Euchaetidae* Temora longicornis

Megacalanidae 125 100 75 50 25 0 MYBP 17 Abstract

18 Epischura (Calanoida: Temoridae) is a Holarctic group of copepods serving important ecological

19 roles, but it is difficult to study because of small range sizes of individual species and widespread

20 distribution of the genus. This genus includes Tertiary relicts, some endemic to single, isolated

21 lakes and can play major roles in unique ecosystems like Lakes Baikal and Tahoe. We present

22 the first molecular and morphological analysis of Epischura that reveals their spatio-temporal

23 evolutionary history. Morphological measurements of mandibles and genetics estimated

24 phylogenetic relationships among all species represented in Epischura, including E.

25 massachusettsensis, whose extinction status is of concern. Analyses used three gene regions for

26 six previously unsequenced species to infer highly-resolved and well-supported phylogenies

27 confirming a split between Siberian and North American species. Previously published age

28 estimates and sequence data from broad taxonomic sampling of calanoid copepods estimated

29 divergence times between the two Epischura groups. Divergence time estimates for Epischura

30 were consistent with earlier molecular clock estimates and late-Miocene cooling events.

31 Additionally, we provide the first taxonomically broad estimates of divergence times within

32 Calanoida. The paraphyletic nature of the genus Epischura (and the family Temoridae) is

33 apparent and requires the resurrection of the genus Epischurella (Smirnov 1936) to describe the

34 Siberian species.

35

36 1. Introduction

37

38 As a group, Epischura (Calanoida:Temoridae) copepods inhabit the entire Holarctic

39 (Figure 1). Given their disjunct distribution across the Holarctic and small range sizes, 40 Epischura may represent one of the few animal examples of Tertiary relict endemism, also noted

41 in many plant species (Wu, et al, 2005). Yet, having survived in endemic refugia for millions of

42 years, the Epischura may be at risk given the rapid pace of climate change in the Holarctic zone.

43 Notably, Epischura baikalensis is currently listed as an IUCN threatened species due to pollution

44 and E. massachusettsensis (possibly extinct) has not been observed since the 1950s (Humes,

45 1955)—making them both of conservation concern. While most species in the group, namely, E.

46 baikalensis, E. chankensis, E. nevadensis, E. massachusettsensis, and to a lesser extent, E.

47 nordenskioldi, are geographically isolated to single or few proximal lakes, there are also two

48 widespread species, E. lacustris and E. fluviatilis that regularly establish in reservoirs (Bowman,

49 T. E., 1991; DeBiase and Taylor, 1993). Two of the species, E. baikalensis and E. chankensis,

50 are endemic to Siberia, and the five remaining species are endemic to North America, so

51 understanding the timing and relationship of this divergence will give insight into the history of

52 the group’s Holarctic distribution.

53 Dispersal in obligate, sexually-reproducing zooplankton is likely to be extremely limited

54 (Allen, 2007), restricting the ability of Epischura to migrate or establish in new habitats.

55 Consequently, it is imperative to understand the evolutionary history and genetic diversity within

56 and among this vulnerable group. Epischura are also ecologically important as aggressive

57 primary and secondary consumers, often serving as critical links between trophic levels in the

58 foodwebs in which they inhabit (Moore, et al, 2019). In general, Epischura reside in the pelagic

59 zone of lakes that lack a diverse zooplanktivorous fish assemblage but have a robust community

60 of small-bodied zooplankton (Brooks and Dodson, 1965). Hence, we see Epischura in Lakes

61 Baikal and Tahoe and large reservoirs in the Southeastern USA. However, we also find them in

62 smaller-volume ecosystems, such as vernal pools and kettle ponds in New England and Lake 63 Khanka on the Eastern Siberian-Chinese border (Ma, et al, 2019), where they likely serve as

64 keystone consumers. Due to their expansive geographic distribution and restricted endemism

65 (Afanasyeva, 1998), few studies have explored the group as a whole.

66 Here we performed the first phylogenetic and morphological analyses of Epischura in an

67 effort to understand their evolutionary history and to evaluate their relationships to each other

68 and within the Temoridae. Using another Holarctic sister genus Heterocope as an outgroup, we

69 constructed a dataset that includes three rRNA gene regions across all extant species represented

70 in the genus. In addition, we used publicly available data to reconstruct the evolutionary history

71 of Calanoida, the order containing Epischura and around 1,800 other species. We show that

72 Epischura is a paraphyletic group, interspersed with the genus Heterocope. We suggest that the

73 Siberian species constitute their own genus, diverging from the North American species

74 ~40MYBP, and we propose resurrecting the originally assigned genus name, Epischurella

75 (Smirnov, 1936).

76

77

78 2. Materials and methods

79

80 2.1 Sample collection, DNA extraction, and sequencing

81

82 We generated DNA sequences for seven species of calanoid copepods, including six from

83 the genus Epischura and one outgroup from the genus Heterocope (Table 1and Supplemental

84 Table 1). All specimens are vouched at the Smithsonian National Museum of Natural History

85 Invertebrate Zoology Collections: E. baikalensis (USNM 1578660), E. chankensis (USNM 86 1578661), E. fluviatilis (USNM 1578664), E. lacustris (1578662), E. nevadensis (USNM

87 1578665), E. nordenskioldi (USNM 1578663), H. septentrionalis (USNM 1578666). All

88 specimens were collected from the field (Figure 1) directly via plankton net sampling between

89 2012 and 2016 and preserved in 70% ethanol until extraction, with the exception of E.

90 massachusettsensis. Formalin-fixed E. massachusettsensis specimens were acquired from the

91 Smithsonian National Museum of Natural History Invertebrate Zoology Collections (USNM

92 93932). We were unable to extract or amplify DNA from E. massachusettsensis specimens

93 despite multiple attempts with various protocols including a standard extraction protocol

94 (Bowman Jr, et al, 2017), a Qiagen DNeasy blood and tissue kit (Qiagen, Inc. Valencia, CA), a

95 modified ancient DNA protocol (Ruane and Austin, 2017), and phenol-chloroform extraction

96 (Pine, et al, 1999).

97 Animals were identified under a 40x Leica dissecting microscope and vouchered before

98 extraction. We used the DNA extraction protocol outlined in Bowman et al. (2017) to extract

99 DNA, which had been previously shown to work well with the Epischura group (Bowman Jr, et

100 al, 2017). This extraction protocol involves homogenizing whole-body specimens in 25uL of

101 50mM TE buffer, pH 8.0 that contains 60mAU/mL proteinase K (Qiagen) before incubation at

102 54C for 20min. For Epischura nordenskioldi and Epischura nevadensis, we used the Qiagen

103 DNeasy blood and tissue kit per the manufacturer’s directions, due to low-yield results with the

104 aforementioned protocol.

105 Three regions of ribosomal DNA were sequenced: 18s, ITS2, and 28s. We used oligo

106 primers found in the literature for amplification with their published PCR protocols (Table 2)

107 except for Epischura nordenskioldi, for which we designed a species-specific primer for ITS2

108 and Epischura nevadensis, for which we reduced the annealing temperature of the 28s PCR 109 reaction to 50C due to previous low-yield amplicons. For each reaction, we used 10.2 uL H2O,

110 2.0 uL MgCl2, 1.5 uL 10mM dNTPs, 5.0 uL 5X PCR buffer, 0.1 uL BSA, 0.5 uL 10 uM forward

111 primer, 0.5 uL 10 uM reverse primer, 0.2 uL 5,000 U/mL Taq DNA polymerase, and 1 uL of

112 template DNA. Amplicons were verified visually via gel electrophoresis. The PCR amplicons

113 were sequenced by the Yale Keck DNA Sequencing Facility using an Applied Biosystems

114 3730xL DNA Analyzer with BigDye Terminator chemistry (Heiner, et al, 1998). We were able

115 to sequence at least one individual per species for 18s, 28s, ITS2 regions (Supplemental Table 1).

116 We blasted these sequences against the GenBank database and with previously published

117 transcriptome data from Bowman, Jr, et al, (2018) to confirm species identity. To supplement our

118 genetic data, we also downloaded all 18s and 28s sequence data from Genbank for calanoid

119 copepods. We filtered this additional data to retain only species that had sequence data for both

120 loci (Supplemental Table 2). We did not collect ITS2 data across calanoids due to the paucity

121 and quality of ITS2 sequences available. However, we downloaded ITS2 sequence data for two

122 outgroup species, Pontellina plumata and Temora discaudata (Supplemental Table 2).

123

124 2.2 Morphological data

125 All copepods were stained with 5% Congo Red solution for 72 hours to enhance

126 visualization of the mandibles with confocal laser microscopy (Michels and Büntzow, 2010).

127 Following staining, copepods (female adults and late stage copepodites) were placed in

128 deionized water for 3-5 days before measuring total body length (extending from anterior end of

129 cephalothorax to end of caudal rami) using stereomicroscopes (Wild-Heerbrugg M5A or Unitron

130 Z850) at 25-30x magnification. 131 Mandibles were removed from each copepod by dissection performed under

132 stereomicroscopes using dissecting probes made from insect Minuten pins (diam = 0.145 mm)

133 and deionized water as the dissecting fluid. Mandibles were each separately mounted on a

134 microscope slide in a 99% glycerol solution and sealed with a coverslip and clear nail enamel.

135 Twelve to twenty-five mandibles per copepod species, each removed from a separate individual

136 copepod, were individually mounted and measured. Either the left or right mandible was

137 mounted and measured for E. nevadensis, E. lacustris, E. chankensis, and E. baikalensis; but, the

138 right mandible was used for measurements for all other copepod species.

139 For each mandible, the length of the cutting edge (W), the height of the most ventral

140 tooth (H), the height of each of the 6 smaller teeth (hi), and the distance between the peaks of

141 each adjacent pair of teeth (wi) were measured at 200x magnification using a confocal Leica TCS

142 SP5 microscope with an argon laser that emitted excitation wavelengths of 450-600 nm (Figure

143 2, F). Confocal images were used to make a drawing of a representative mandible for each

144 copepod species (Figure 2). Incidence of broken teeth was also recorded. Due to the high

145 frequency of a broken ventral tooth among E. baikalensis individuals, mandibles from 41 and 60

146 individuals collected during winter and summer, 2013, respectively, were examined for broken

147 teeth.

148 We used measurements of individual teeth (height and width; Fig. 2) and body length to

149 construct a morphological phylogeny. We included values for the Itoh index (Itoh, 1970) in our

150 morphological reconstruction for phylogenetic inference (equation in Fig. 2). This index has

151 successfully predicted the diet of calanoid copepod species based on their teeth and mandible

152 measurements (e.g., Balseiro, et al, 2001). We also included morphological measurements from

153 the literature for Temora discaudata (Itoh, 1970) and Temora longicornis (Jansen, 2006) as 154 outgroups. Moreover, Itoh index and body length were the two heaviest loading individual

155 morphological traits in a principle components analysis (PCA; Supplemental Table 3).

156

157 2.3 Phylogenetic Analysis

158 We trimmed raw sequence data by eye to remove low quality bases and assembled the

159 reads into contigs using Geneious v.11.1.5 (https://www.geneious.com). Since we observed

160 almost no intraspecific genetic variation, we created species consensus sequences for each locus

161 for each species. We then aligned the species consensus sequences and the Genbank sequence

162 data using MUSCLE v.3.8.425 (Edgar, 2004). For 18s and 28s we created three sets of

163 alignments: one with all calanoid copepod species available from Genbank (Supplemental Table

164 2), one with two outgroup species for which we also had ITS2 sequence data (Pontellina plumata

165 and Temora discuadata), and one with two outgroup species for which we had morphological

166 data (Temora discuadata and Temora longicornis).

167 We inferred maximum likelihood gene trees for each locus using IQTree v.1.6.8

168 (Nguyen, et al, 2014). For each locus, we used ModelFinder to assign substitution models

169 (Kalyaanamoorthy, et al, 2017). To assess support for the gene tree topologies, we performed

170 1000 ultrafast bootstrap replicates (Hoang et al. 2018). In addition to our individual gene trees,

171 we also performed analyses on two concatenated datasets. In the first, we included all three loci,

172 but only two outgroup species (Pontellina plumata and Temora discaudata). For the second

173 concatenated analysis, we included 116 calanoid copepod species but excluded ITS2 due to

174 difficulties in aligning sequence data from distantly related species.

175 To estimate divergence times for Epischura, we used a previously published time-

176 calibrated phylogeny from Eyun (2017) that estimated the crown age of Calanoida at 266.3 177 million years before present (MYBP). However, this phylogeny sampled only three calanoid

178 species that do not span the crown of Calanoida (Eyun, 2017). Therefore, we subsampled our 18s

179 + 28s dataset to contain only the ninety-three calanoid copepod species whose crown node was

180 sampled by Eyun (2017). We performed our divergence-time estimates with RevBayes v.1.0.10

181 (Höhna, et al, 2016), and we specified a normal distribution (mean = 266.3, sd =20.3) on the root

182 age consistent with the previous age estimate from Eyun (2017). We applied substitution models

183 to each locus based on the ModelFinder results from our maximum likelihood tree searches. To

184 account for branch-specific rate heterogeneity, we applied an uncorrelated lognormal (UCLN)

185 rates model. We specified an exponential hyperprior (lambda = 1000) on the mean of the

186 lognormal distribution and an exponential prior (lambda = 10) for sigma. For the tree, we used a

187 birth-death model with an exponential prior (lambda = 10) on the diversification rate and a beta

188 (2,2) prior on the turnover rate. Since we only included a small but representative number of all

189 calanoid copepod species, we specified a sampling probability of 1% with a uniform sampling

190 strategy. To improve MCMC performance, we used the maximum likelihood tree as our starting

191 topology (Supplemental Figures 1-4). We performed two independent runs of the analysis for

192 100,000 MCMC generations, sampling every 100 generations. To summarize the posterior tree

193 distributions, we discarded the first 25% of trees as burnin and estimated the maximum clade

194 credibility tree. Using Tracer v.1.7.1 (http://tree.bio.ed.ac.uk/software/tracer/), we checked for

195 convergence by comparing posterior distributions of parameter estimates and MCMC mixing by

196 calculating expected sample sizes (ESS>200 indicates good mixing). We plotted the resulting

197 phylogeny using FigTree v.1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/).

198 To determine the phylogenetic placement of the possibly extinct Epischura

199 massachusettsensis, we subsampled to include only species with both genetic and morphological 200 data. These included all Epischura, Heterocope septentrionalis, and two species of Temora. For

201 Epischura massachusettsensis, we had only morphological data. We applied the method outlined

202 by Parins-Fukuchi (2017) which uses a Brownian motion model to estimate tree likelihoods

203 using continuous trait data. Originally developed to place fossil taxa in a phylogeny, this

204 approach works equally well for recently extinct taxa of species lacking genetic data. We

205 performed all analyses with RevBayes v.1.0.10 (Hohna, et al, 2016). For the Brownian motion

206 model, we specified a normally distribution prior (mean=0, sd=1) on the log of sigma. All priors

207 and models for the genetic data were the same as described above. We performed four sets of

208 analyses using morphology only, genetics only (with and without E. massachusettsensis), and

209 genetics plus morphology. We performed two independent runs of each analysis for 100,000

210 MCMC generations, sampling every 100 generations. We summarized the posterior tree

211 distributions and checked for convergence and mixing as described above. Phylogenies were

212 plotted using FigTree v.1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/).

213

214

215 3. Results and Discussion

216

217 3.1 Sequencing and inferences

218 We generated sequence data for three new gene regions for seven copepod species in this

219 study. All sequence data were deposited on the NCBI Genbank database (Supplemental Table

220 1). Genetic data from a total of thirty-five individuals were used for the phylogenetic analysis

221 across the three-gene region representing a large portion of the ribosomal genome. One

222 limitation of our analyses is that the genetic data were all from a single genomic region, the 18s- 223 28s ribosomal DNA complex. Unfortunately, we had difficulties sequencing other regions such

224 as mitochondrial DNA from all species (though see previous successful studies on COI

225 amplification in Epischura baikalensis, Zaidikov, et al, 2015). Despite trying several primers,

226 specific (Zaidikov, et al, 2015) and nonspecific (Folmer, et al, 1994), for mitochrondrial genes,

227 including cytb and COI, we were unable to amplify any mitochondrial genes across all species,

228 possibly suggesting mitochondrial rearrangement in the group, which is noted in other Calanoids

229 (Machida, et al, 2004) or high rates of evolution in these regions. Future attempts should include

230 more variable binding temperatures and attempts at species-specific primers for the

231 mitochondrial region. Note, however, that we replicated conditions in Zaidikov, et al, 2016, but

232 this yielded no amplicons.

233 3.1.1 Epischura massachusettsensis extinction

234 The current status of Epischura massachusettsensis remains unclear; after five separate

235 sampling endeavors across three years to the eastern Massachusetts vernal pools where it was

236 last collected, we neither witnessed nor collected any specimens. More concerted effort is

237 needed to clarify the status of this species given that its most recent sighting was in the 1950s

238 (Humes, 1955) and extensive residential development has occurred in the area since then. If

239 rediscovered in the area, the species should be considered of conservation importance.

240

241 3.2 Mandible morphology

242

243 Despite vast differences in mandible size, the shape of the mandibular teeth was similar

244 among the North American species and among the Siberian species (Fig 2.). Values of the Itoh

245 index for each North American species and both groups of E. baikalensis predicted an 246 omnivorous feeding strategy (Table 1), which has been confirmed for four of these species by

247 results from feeding experiments (e.g., Folt and Byron, 1989; Schulze and Folt, 1989; Moore, et

248 al, 2019). In contrast, the mean Itoh index for E. chankensis predicts voracious carnivory (Table

249 1); yet, Naumova, et al, (2015) report that this species feeds on detritus of higher plants and

250 probably phytoplankton, suggesting that the Itoh index may sometimes falsely predict carnivory.

251 We also note that the variance of the mean Itoh index for E. chankensis and E. baikalensis

252 (summer-collected copepods) was generally 2-3 times higher than that for their North American

253 counterparts, possibly indicating a more varied diet or variable food availability. In addition,

254 broken ventral teeth were nearly 10 times more common among summer- than winter-collected

255 E. baikalensis, suggesting the former, which had matured under the ice during a ‘Melosira’ year

256 (Katz, et al, 2015), had difficulties in feeding on the heavily silicified winter-spring diatoms.

257

258 3.3 Phylogenetic relationships among Epischura

259

260 After 100,000 MCMC generations, our Bayesian phylogenetic analyses converged and

261 exhibited good mixing (ESS>200) for all parameters. All phylogenetic topologies show

262 congruent support for the Siberian species (Epischura baikalensis and E. chankensis) being a

263 monophyletic group with strong node support (Figure 3). However, there remain several nodes

264 in the calanoid tree with low support, emphasizing the need for more complete sampling across

265 more genes and taxa. We also inferred monophyly of the North America species (E. fluviatilis,

266 E. lacustris, E. nevadensis, E. nordenskioldi via molecular data (Figure 3B) and the concatenated

267 morphological and molecular data (Figure 3D). However, E. massachusettsensis clusters with H.

268 septentrionalis in the morphological (Figure 3B) and concatenated morphological + molecular 269 analysis (Figure 3D). Our data suggest that in order for E. massachusettsensis to have evolved

270 such extreme mandible morphology similar to that of H. septentrionalis, E. massachusettsensis

271 likely belongs to the genus Heterocope or has undergone significant convergent evolution,

272 evidenced by other species rearrangements in the morphology only tree (Figure 3B).

273 The current phylogeny provides further evidence that the genus Epischura is paraphyletic

274 and includes the sister genus Heterocope, as described by Smirnov in 1936 (Figure 3, Hebert, et

275 al, 1980). Therefore, we propose the resurrection of the genus Epischurella to describe the

276 Siberian copepod clade with representatives E. baikalensis and E. chankensis. Interestingly, E.

277 udylensis, E. vagans, and E. smirnovi, were all previously synonymized with E. chankensis or

278 are of questionable validity (Dussart and Defaye, 2002) and would also belong to this group.

279 We compared our phylogeny to that of Renz et al, 2018 (Supplementary Figure 6) as the

280 most recent and largest dataset of calanoids, though see Blanco-Bercial et al, 2011, Bradford-

281 Grieve et al, 2014, Khodami et al, 2017, and Laakman et al, 2019, for a comprehensive history of

282 calanoid phylogenetics. We note paraphyly in Temoridae, Aetideidae, and Euchaetidae (Figure

283 3A); for other instances of discordance between the topologies see Supplementary Figure 6. The

284 recent paraphyly in both Aetideidae and Euchaetidae could be due to sparse sampling. However,

285 our more robust sampling within Temoridae places divergence between the paraphyletic groups

286 at 150 MYBP. We suggest that the Temoridae:Temora clade retain its current name and the

287 Temoridae:Epischura, Epischurella, and Heterocope clade should become a candidate for further

288 exploration and possible taxonomic revision.

289

290 3.4 Timing of divergence among Epischura 291 Our divergence time estimates (Figure 3A) provide evidence for the Tertiary relict

292 hypothesis (Wu, et al, 2005), suggesting that Epischura, Epischurella, and Heterocope are likely

293 relicts from the last mass range expansion occurring at the K-Pg mass extinction at 76.45

294 (±18.86) MYBP in the late Cretaceous/early Tertiary, followed by the Epischura diversifying

295 into North America 39.64 (±6.86) MYBP. Epischurella diverged from the Heterocope, a genus

296 composed of fresh, brackish, and marine representatives also restricted to the Holarctic (Hebert,

297 et al, 1980), around 58.26 (±11.52) MYBP. The rise of these groups of copepods, known to be

298 aggressive consumers (Brooks and Dodson, 1965), corresponds to the worldwide loss of many

299 vertebrate species, including many freshwater fish, and may suggest the opening of trophic

300 niches in these lakes that were subsequently filled by calanoids—specifically we estimate

301 Epischura predates most other Baikalian animal lineages, including the endemic sculpin

302 radiation by ten million years (Sherbakov, 1999).

303 According to our analyses, Epischura (Epischurella) baikalensis diverged from

304 Epischura (Epischurella) chankensis around 14.81 (±0.88) MYPB. These time estimates agree

305 with previous estimates of divergence time using COI data for E. baikalensis (Bowman, et al,

306 2018). How exactly Lake Baikal became populated with its current (mostly endemic) species

307 remains a mystery (Timoshkin, 2001), but this adds further confusion as to what the ancient

308 Baikalian zooplankton assemblage may have looked like, given its current dominance (>90%) by

309 E. baikalensis. Though we recognize the limitations of our time-calibrated tree for accurate

310 divergence estimates given the paucity of invertebrate fossils (but see Eyun, 2017), it appears

311 that E. baikalensis has been present for nearly two-thirds of Lake Baikal’s estimated 25 million

312 years of existence (Mats et al, 2000).

313 314 4. Conclusion

315 Phylogenetic analyses of then calanoid copepod genus Epischura has previously proven

316 difficult due to its expansive range and isolated endemism. Our study provides the first

317 evolutionary analysis of the genus using both genetic and morphological data, and confirms a

318 divergence between the North American and Siberian species, first proposed by Smirnov in 1936

319 (Smirnov, 1936). The phylogeny strongly supports the paraphyly of Epischura due to the

320 placement of the genus Hetercope sister to Epischurella—a genus that we resurrect to describe

321 the Siberian species of Epischura. This study presents age estimates for divergences between

322 freshwater copepod lineages restricted to Siberia and North America and confirms previous work

323 suggesting the ancient establishment and dominance of E. baikalensis in the Lake Baikal

324 ecosystem. The diversity among these genera both genetically and morphologically underscores

325 the need to explore the evolutionary history of the Temoridae, and Calanoida as a whole, for

326 understanding circumpolar species distributions of aquatic organisms and their transitions into

327 freshwater ecosystems.

328

329 Acknowledgements

330 We would like to thank Dr. Barbara Taylor and her team at the South Carolina

331 Department of Natural Resources (E. fluviatilis), Dr. Rafael Lemaitre at the Smithsonian

332 Institution (USNM 93932) (E. massachusettsensis), Dr. Geoffrey Schladow at the University of

333 California, Davis and Tahoe Environmental Research Center (E. nevadensis), Dr. Stephen

334 Klobucar at the University of Alaska (H. septentrionalis), and Dr. Igor Zaidykov of the

335 Limnological Institute of the Russian Academy of Sciences in Irkutsk (E. chankensis) for

336 generously collecting or sharing samples with us. 337 Funding: This work was supported by the American Museum of Natural History

338 [Theodore Roosevelt Memorial Fund to LLB]; the Phi Kappa Phi Honor Society and the Yale

339 Institute for Biospheric Studies. This work was also supported by the National Science

340 Foundation Dimensions of Biodiversity [DEB-1136657 to MVM] and the Frost Professorship

341 Fund at Wellesley College.

342 343 References

344 Afanasyeva, E., 1998. Life cycle of Epischura baicalensis Sars (Copepoda, Calanoida) in Lake

345 Baikal. J. Mar. Syst. 15, 351-357.

346 Allen, M.R., 2007. Measuring and modeling dispersal of adult zooplankton. Oecologia 153, 135-

347 143.

348 Balseiro, E.G., Modenutti, B.E., and Queimaliños, C.P., 2001. Feeding of Boeckella gracilipes

349 (Copepoda, Calanoida) on ciliates and phytoflagellates in an ultraoligotrophic Andean

350 lake. J. Plankton Res. 23, 849-857.

351 Blanco-Bercial, L., Bradford-Grieve, J., Bucklin, A., 2011. Molecular phylogeny of the

352 Calanoida (Crustacea: Copepoda). Mol Phylogenet Evol. 59: 103-113.

353 Bowman Jr, L.L., Kondrateva, E.S., Silow, E.A., Wilburn, P., and Yampolsky, L.Y., 2017. A

354 capital breeder in a heterogeneous environment: Lipid reserves and RNA: DNA ratio in

355 Lake Baikal's endemic Epischura. J. Great Lakes Res. 43, 280-288.

356 Bowman, L.L., Kondrateva, E.S., Timofeyev, M.A., and Yampolsky, L.Y., 2018. Temperature

357 gradient affects differentiation of gene expression and SNP allele frequencies in the

358 dominant Lake Baikal zooplankton species. Mol. Ecol. 27, 2544-2559.

359 Bowman, T.E., 1991. Epischura fluviatilis Herrick, 1883 (Copepoda: Calanoida: Temoridae),

360 first report from South Carolina, with notes on sexual dimorphism in the caudal rami and

361 its possible role in mating. J. Crust. Biol. 11, 460-463. 362 Bradford-Grieve, J.M., Boxshall, G.A., Blanco-Bercial, L., 2014. Revision of the basal calanoid

363 copepod families, with a description of a new species and genus of Pseudocyclopidae.

364 Zool J Linn Soc 171: 507-533.

365 Brooks, J.L. and Dodson, S.I., 1965. Predation, Body Size, and Composition of Plankton.

366 Science 150, 28-35.

367 DeBiase, A.E. and Taylor, B.E., 1993. New occurrences of Eurytemora affinis and Epischura

368 fluviatilis, freshwater calanoid copepod species of the family Temoridae, in South

369 Carolina. Am. Midl. Nat. 386-392.

370 Dussart, B. and Defaye, D., 2002. World Directory of Crustacea Copepoda of Inland Waters.

371 Backhuys.

372 Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high

373 throughput. Nucleic Acids Res. 32, 1792-1797.

374 Eyun, S., 2017. Phylogenomic analysis of Copepoda (Arthropoda, Crustacea) reveals unexpected

375 similarities with earlier proposed morphological phylogenies. BMC evolutionary biology

376 17, 23.

377 Folmer, O., Black, M., Hoeh, W., Lutz, R., and Vrijenhoek, R., 1994. DNA primers for

378 amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan

379 invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294-299. 380 Folt, C.L. and Byron, E.R., 1989. A comparison of the effects of prey and non prey neighbours

381 on foraging rates of Epischura nevadensis (Copepoda: Calanoida). Freshwat.‐ Biol. 21,

382 283-293.

383 Hebert, P.D., Good, A.G., and Mort, M.A., 1980. Induced swarming in the predatory copepod

384 Heterocope septentrionalis 1. Limnol. Oceanogr. 25, 747-750.

385 Heiner, C.R., Hunkapiller, K.L., Chen, S.M., Glass, J.I., and Chen, E.Y., 1998. Sequencing

386 multimegabase-template DNA with BigDye terminator chemistry. Genome Res. 8, 557-

387 561.

388 Höhna, S., Landis, M.J., Heath, T.A., Boussau, B., Lartillot, N., Moore, B.R., Huelsenbeck, J.P.,

389 and Ronquist, F., 2016. RevBayes: Bayesian phylogenetic inference using graphical

390 models and an interactive model-specification language. Syst. Biol. 65, 726-736.

391 Humes, A.G., 1955. The postembryonic developmental stages of a fresh water calanoid copepod,

392 Epischura massachusettsensis Pearse. J. Morphol. 96, 441-471. ‐

393 Itoh, K., 1970. A consideration of feeding habits of planktonic copepods in relation to the

394 structure of their oral parts. Bull. Plankton Soc. Japan 17, 1-10.

395 Jansen, S., 2006. Feeding of calanoid copepods and analyses of their faecal pellets.

396 Kalyaanamoorthy, S., Minh, B.Q., Wong, T.K., von Haeseler, A., and Jermiin, L.S., 2017.

397 ModelFinder: fast model selection for accurate phylogenetic estimates. Nature methods

398 14, 587. 399 Katz, S.L., Izmest'eva, L.R., Hampton, S.E., Ozersky, T., Shchapov, K., Moore, M.V.,

400 Shimaraeva, S.V., and Silow, E.A., 2015. The “Melosira years” of Lake Baikal: Winter

401 environmental conditions at ice onset predict under ice algal blooms in spring. Limnol.

402 Oceanogr. 60, 1950-1964. ‐

403 Khodami S., McArthur J.V., Blanco-Bercial, L., Martinez Arbizu, P., 2017. Molecular

404 phylogeny and revision of copepod orders (Crustacea:Copepoda). Scientific Reports

405 7:9164.

406 Laakman, S., Markhaseva E.L., Renz, J., 2019. Do molecular phylogenies unravel the

407 relationships among the evolutionary young “Bradfordian” families

408 (Copepoda:Calanoida)? Mol Phylogenet Evol 130:330-345.

409 Ma, C., Mwagona, P.C., Yu, H., Sun, X., Liang, L., and Mahboob, S., 2019. Seasonal dynamics

410 of zooplankton functional group and its relationship with physico-chemical variables in

411 high turbid nutrient-rich Small Xingkai Wetland Lake, Northeast China. J. Freshwat.

412 Ecol. 34, 65-79.

413 Mats, V.D., Khlystov, O.M., De Batist, M., Ceramicola, S., Lomonosova, T.K., Klimansky, A.,

414 2000. Evolution of the Acamedician Ridge Accomodation Zone in the central part of the

415 Baikal Rift, from high resolution reXection seismic proWling and geological Weld

416 investigations. International Journal of Earth Science 89, 229-250.

417 Michels, J. and Büntzow, M., 2010. Assessment of Congo red as a fluorescence marker for the

418 exoskeleton of small crustaceans and the cuticle of polychaetes. J. Microsc. 238, 95-101. 419 Moore, M.V., De Stasio Jr, Bart T, Huizenga, K.N., and Silow, E.A., 2019. Trophic coupling of

420 the microbial and the classical food web in Lake Baikal, Siberia. Freshwat. Biol. 64, 138-

421 151.

422 Naumova, E.Y., Zaidykov, I.Y., Tauson, V.L., and Likhoshway, Y.V., 2015. Features of the fine

423 structure and Si content of the mandibular gnathobase of four freshwater species of

424 Epischura (Copepoda: Calanoida). J. Crust. Biol. 35, 741-746.

425 Nguyen, L., Schmidt, H.A., von Haeseler, A., and Minh, B.Q., 2014. IQ-TREE: a fast and

426 effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol.

427 Biol. Evol. 32, 268-274.

428 Parins-Fukuchi, C., 2017. Use of continuous traits can improve morphological phylogenetics.

429 Syst. Biol. 67, 328-339.

430 Pine, E.M., Hibbett, D.S., and Donoghue, M.J., 1999. Phylogenetic relationships of cantharelloid

431 and clavarioid Homobasidiomycetes based on mitochondrial and nuclear rDNA

432 sequences. Mycologia 944-963.

433 Renz, J. Markhaseva, E.L., Laakman, S., 2018. The phylogeny of Ryocalanoidea (Copepoda,

434 Calanoida) based on morphology and a multi-gene analysis with a description of new

435 ryocalanoidean species. Zool J Linn Soc 185: 925-957.

436 Ruane, S. and Austin, C.C., 2017. Phylogenomics using formalin fixed and 100 year old

437 intractable natural history specimens. Molecular Ecology ‐Resources 17, 1003‐-1008. 438 Schulze, P.C. and Folt, C.L., 1989. Effects of conspecifics and phytoplankton on predation rates

439 of the omnivorous copepods Epischura lacustris and Epischura nordenskioldi. Limnol.

440 Oceanogr. 34, 444-450.

441 Sherbakov, D., Yu. 1999. Molecular phylogenetic studies on the origin of biodiversity in Lake

442 Baikal. Trends in Ecology and Evolution 14.3, 92-95.

443 Smirnov, S., 1936. Epischura baikalensis G. 0. Sars from Kamchatka (Crustacea Copepoda).

444 Trudy Zoologicheskogo Instituta Akademii Nauk SSSR 3, 59-65.

445 Timoshkin, O., 2001. Lake Baikal: diversity of fauna, problems of its immiscibility and origin,

446 ecology and “exotic” communities. Index of animal species inhabiting Lake Baikal and

447 its catchment area 1, 74-113.

448 Wu, Z., Sun, H., Zhou, Z., Peng, H., and Li, D., 2005. Origin and differentiation of endemism in

449 the flora of China. Acta Botanica Yunnanica 27, 577-604.

450 Zaidikov, I.Y., Maior, T.Y., Sukhanova, L., Kirilchik, S., and Naumova, E.Y., 2015. MtDNA

451 polymorphism of Lake Baikal Epischura—an endemic key species of the plankton

452 community. Russian journal of genetics 51, 935-937.

453 454 Tables

455 Table 1. Mean (±SD) values of the Itoh index for six species of Epischura and 456 Heterocope septentrionalis. An Itoh index value less than 500 indicates an herbivorous 457 feeding mode, a value of 500-1000 is typical for an omnivore and values higher than 458 1000 indicate a carnivorous feeding mode (Itoh, 1970). 459 Species N Mean Itoh Index SD CV (%) E. baikalensis (summer) 22 952.24 225.29 23.66 E. baikalensis (winter) 25 918.65 126.06 13.72 E. chankensis 12 1939.92 559.93 28.86 E. fluviatilis 22 836.25 91.31 10.92 E. lacustris 12 721.43 75.76 10.50 E. massachusettsensis 12 774.14 85.26 11.01 E. nevadensis 12 618.47 69.53 11.24 E. nordenskioldi 12 767.73 54.75 7.13 H. septentrionalis 12 842.17 83.84 9.96 460 461 462 463 Table 2. Primers and PCR conditions for the three loci used in the molecular phylogeny 464 of Epischura. AT is annealing temperature; (F) refers to forward, (R) to reverse. Gene Primer name, sequence AT 18s 18SE (F), CTGGTTGATCCTGCCAGT (Blanco-Bercial et al, 2011) 52C 18SL (R), CACCTACGGAAACCTTGTTACGACTT (Blanco-Bercial et al, 2011) 28s 28S-F1a, GCGGAGGAAAAGAAACTAAC (Blanco-Bercial et al, 2011) 50C 28S-R1a, GCATAGTTTCACCATCTTTCGGG (Blanco-Bercial et al, 2011) ITS2 18SE (F) , CTGGTTGATCCTGCCAGT (Blanco-Bercial et al, 2011) 50C 28S-R1a, GCATAGTTTCACCATCTTTCGGG (Blanco-Bercial et al, 2011) ITS2 ITS2_429F, GCTTGGGGGTCGATGAAGAA 50C (for E. nevadensis) ITS2_1082R, CACTCTCAAGCAACCCGACT 465 466 467 Supplemental Table 1. Genbank accession numbers for 18s, 28s, and ITS2 sequences 468 generated for Epischura, Epischurella, and Heterocope used for maximum-likelihood 469 and Bayesian phylogenies. Family Genus Species 18s 28s ITS2 Temoridae Epischura baikalensis NA MK834590 NA Temoridae Epischura baikalensis MK834639 MK834591 NA Temoridae Epischura baikalensis MK834640 MK834592 NA Temoridae Epischura baikalensis MK834641 MK834593 NA Temoridae Epischura baikalensis MK834642 MK834594 NA Temoridae Epischura baikalensis NA NA MK834617 Temoridae Epischura baikalensis NA NA MK834618 Temoridae Epischura baikalensis NA NA MK834619 Temoridae Epischura chankensis MK834643 MK834595 MK834620 Temoridae Epischura chankensis MK834644 MK834596 MK834621 Temoridae Epischura chankensis MK834645 MK834597 MK834622 Temoridae Epischura chankensis MK834646 NA NA Temoridae Epischura fluviatilis MK834648 MK834598 MK834623 Temoridae Epischura fluviatilis MK834649 MK834599 MK834624 Temoridae Epischura fluviatilis MK834650 MK834600 MK834625 Temoridae Epischura fluviatilis MK834651 MK834601 MK834626 Temoridae Epischura fluviatilis MK834647 NA NA Temoridae Epischura lacustris MK834652 MK834602 MK834627 Temoridae Epischura lacustris MK834653 MK834603 MK834628 Temoridae Epischura lacustris MK834654 MK834604 MK834629 Temoridae Epischura lacustris MK834655 MK834605 MK834630 Temoridae Epischura lacustris MK834656 NA MK834631 Temoridae Epischura nevadensis NA MK834606 MK834632 Temoridae Epischura nevadensis NA MK834607 MK834633 Temoridae Epischura nevadensis MK834657 NA NA Temoridae Epischura nordenskioldi MK834658 MK834608 NA Temoridae Epischura nordenskioldi NA MK834609 NA Temoridae Epischura nordenskioldi MK834660 MK834610 NA Temoridae Epischura nordenskioldi MK834661 MK834611 NA Temoridae Epischura nordenskioldi MK834661 NA NA Temoridae Heterocope septentrionalis MK834662 MK834612 MK834634 Temoridae Heterocope septentrionalis MK834663 MK834613 MK834635 Temoridae Heterocope septentrionalis MK834664 MK834614 MK834636 Temoridae Heterocope septentrionalis NA MK834615 MK834637 Temoridae Heterocope septentrionalis MK834665 MK834616 MK834638

470 471 Supplemental Table 2. Genbank accession numbers for 18s, 28s, and ITS2 sequences 472 used in maximum-likelihood and Bayesian phylogenies for Calanoida. 473 Family Genus Species 28s 18s ITS2 Diaptomidae Acanthodiaptomus pacificus KR048904 KR048708 NA Paracalanidae Acrocalanus longicornis AB820752 JQ911939 NA Aetideidae Aetideus armatus HM997051 HM997082 NA Diaptomidae Arctodiaptomus salinus JX945144 JX945130 NA Diaptomidae Arctodiaptomus stephanidesi JX945141 JX945135 NA Diaptomidae Arctodiaptomus wierzejskii JX945143 JX945131 NA Megacalanidae Bathycalanus princeps HM997039 HM997069 NA Pseudodiaptomidae Calanipeda aquaedulcis JX945160 JX945125 NA Calanidae Calanoides carinatus AF385465 GU969155 NA Calanidae Calanus finmarchicus MF993124 AF367719 NA Calanidae Calanus helgolandicus HM997038 JX995315 NA Calanidae Calanus hyperboreus EF460769 JQ819751 NA Calanidae Calanus pacificus JF703104 L81939 NA Calanidae Calanus propinquus JF703105 AY118066 NA Calanidae Calanus sinicus KR048902 GU969174 NA Paracalanidae Calocalanus curtus AB820754 JQ911943 NA Paracalanidae Calocalanus minutus AB820756 JQ911944 NA Paracalanidae Calocalanus pavoninus AB820758 GU969160 NA Paracalanidae Calocalanus plumulosus AB820759 GU969146 NA Paracalanidae Calocalanus styliremis AB820761 JQ911949 NA Candacidae Candacia simplex AB820744 HM997063 NA Centropagidae Centropages abdominalis EU477084 GU969163 NA Centropagidae Centropages furcatus GU049769 GU969158 NA Centropagidae Centropages violaceus HM997030 HM997060 NA Clausocalanidae Clausocalanus arcuicornis AB820764 HM997079 NA Diaptomidae Copidodiaptomus numidicus JX945153 JX945134 NA Calanidae Cosmocalanus darwinii KT389858 GU969206 NA Clausocalanidae Ctenocalanus vanus AB753612 AF462320 NA Paracalanidae Delibus nudus AB820771 JQ911951 NA Diaixidae Diaixis hibernica HM997050 HM997081 NA Diaptomidae Diaptomus castor JX945142 JX945123 NA Diaptomidae Diaptomus cyaneus JX945145 JX945132 NA Diaptomidae Diaptomus kenitraensis JX945150 JX945124 NA Diaptomidae Diaptomus mirus JX945148 JX945133 NA Heterorhabdidae Disseta scopularis LC107408 LC107402 NA Euchaetidae Euchaeta indica AB753613 GU969170 NA Euchaetidae Euchaeta rimana AB753615 GU969149 NA Diaptomidae Eudiaptomus vulgaris JX945156 JX945121 NA Spinocalanidae Foxtonia barbatula HM997043 HM997074 NA Augaptillidae Haloptilus longicornis HM997023 GU969152 NA Diaptomidae Heliodiaptomus kikuchii KR048905 KR048709 NA Heterorhabdidae Hemirhabdus grimaldii LC107409 LC107403 NA Family Genus Species 28s 18s ITS2 Heterorhabdidae Heterorhabdus papilliger LC107412 LC107406 NA Heterorhabdidae Heterostylites longicornis LC107410 LC107404 NA Megapontiidae Hyalopontius typicus HM997052 HM997083 NA Hyperbionycidae Hyperbionyx athesphatos HM997029 HM997059 NA Centropagidae Limnocalanus macrurus GU049774 HQ407006 NA Lucicutiidae Lucicutia flavicornis AB753552 HM997055 NA Paracalanidae Mecynocera clausi AB753696 GU969203 NA Heterorhabdidae Mesorhabdus brevicaudatus LC107413 LC107407 NA Metridiidae Metridia effusa HM997024 HM997054 NA Metridiidae Metridia longa EF460773 AB625961 NA Metridiidae Metridia lucens AF385468 GU594642 NA Metridiidae Metridia pacifica EF460774 AB625956 NA Clausocalanidae Microcalanus pygmaeus EF460775 AY118068 NA Calanidae Nannocalanus minor AB796409 AF367715 NA Calanidae Neocalanus cristatus EF460776 AF514344 NA Calanidae Neocalanus flemingeri EF460777 AF514339 NA Calanidae Neocalanus gracilis AB796410 GU969177 NA Calanidae Neocalanus plumchrus EF460778 AF514340 NA Calanidae Neocalanus robustior AB820737 GU969178 NA Diaptomidae Neodiaptomus schmackeri KR048906 KR048710 NA Heterorhabdidae Neorhabdus latus LC107411 LC107405 NA Nullosetigeridae Nullosetigera auctiseta HM997027 HM997057 NA Paracalanidae Paracalanus aculeatus AF385459 GU969180 NA Paracalanidae Paracalanus denudatus AB753698 JQ911956 NA Paracalanidae Paracalanus parvus AB820781 GU969181 NA Paracalanidae Paracalanus tropicus LC159125 JQ911958 NA Euchaetidae Paraeuchaeta glacialis EF460782 JQ819758 NA Euchaetidae Paraeuchaeta norvegica EU375496 KJ193784 NA Heterorhabdidae Paraheterorhabdus compactus HM997026 HM997056 NA Arietellidae Paraugaptilus buchani HM997028 HM997058 NA Eucalanidae Pareucalanus attenuatus AB796416 GU969148 NA Phaennidae Phaenna spinifera AB753619 HM997075 NA Pseudocyclopidae Pinkertonius ambiguus KF753814 KF753813 NA Metridiidae Pleuromamma abdominalis AB753532 GU969183 NA Metridiidae Pleuromamma xiphias AB753539 GU969186 NA Pontellidae Pontellina plumata AB753560 GU969204 AB753560 Pseudodiaptomidae Pseudocyclops juanibali KF753810 KF753809 NA Pseudodiaptomidae Pseudocyclops schminkei KF753811 KF753812 NA Pseudodiaptomidae Pseudodiaptomus inopinus KR048910 GU969194 NA Pseudodiaptomidae Pseudodiaptomus marinus KR048912 KR048712 NA Pseudodiaptomidae Pseudodiaptomus nihonkaiensis KR048913 KR048713 NA Rhincalanidae Rhincalanus cornutus HM997041 GU969190 NA Rhincalanidae Rhincalanus nasutus AB753650 GU969191 NA Rhincalanidae Rhincalanus rostrifrons AB753645 AY335861 NA Scholecitrichidae Scolecithrix bradyi HM997045 HM997076 NA Family Genus Species 28s 18s ITS2 Scholecitrichidae Scolecithrix danae AB753624 GU969141 NA Centropagidae Sinocalanus tenellus KR048903 GU969144 NA Diaptomidae Sinodiaptomus sarsi KR048907 KR048711 NA Spinocalanidae Spinocalanus abyssalis HM997042 HM997073 NA Spinocalanidae Spinocalanus angusticeps AB753709 KU247647 NA Spinocalanidae Spinocalanus elongatus EF460786 KU247652 NA Spinocalanidae Spinocalanus horridus EF460787 KU247667 NA Spinocalanidae Spinocalanus spinosus AB753710 KU247675 NA Subeucalanidae Subeucalanus crassus AB820792 GU969168 NA Subeucalanidae Subeucalanus pileatus HM997040 HM997071 NA Subeucalanidae Subeucalanus pileatus AB820793 GU969188 NA Subeucalanidae Subeucalanus subcrassus AB820794 GU969150 NA Subeucalanidae Subeucalanus subtenuis AB753654 GU969143 NA Sulcanidae Sulcanus conflictus HM997034 HM997064 NA Temoridae Temora discaudata KT389859 GU969209 KT389859 Temoridae Temora longicornis EU375497 JX995310 NA Temoridae Temora turbinata KR048916 GU969211 NA Bathypontiidae Temorites brevis HM997037 HM997067 NA Bathypontiidae Temoropia mayumbaensis HM997036 HM997066 NA Tharybidae Tharybis groenlandica HM997047 HM997078 NA Harpacticidae Tigriopus japonicus EU054307 EU054307 NA Tortanidae Tortanus gracilis HM997035 HM997065 NA Aetideidae Undeuchaeta major AB753574 AB625972 NA 474

475 476 Supplemental Table 3. Morphological traits principle components analysis loading 477 matrix. Measurements for width (W), height (H), and Itoh index (Itoh, 1970) of individual 478 mandibles are described in Table 1 and Figure 2. Traits in bold were used in 479 morphological phylogenetic analyses with their major loadings in bold. Morphological Trait PC1 PC2 PC3 Body Length 0.65 0.73 -0.15 W 0.97 -0.23 0.08 H 0.99 -0.12 0.01 h1 0.99 -0.03 0.04 w1 0.98 -0.16 0.05 h2 0.98 -0.34 0.18 w2 0.89 -0.25 -0.06 h3 0.98 -0.10 0.12 w3 0.95 -0.27 0.05 h4 0.96 0.23 0.06 w4 0.96 0.23 -0.04 h5 0.90 0.37 0.05 w5 0.98 0.16 0.01 h6 0.98 0.22 0.00 w6 0.93 -0.09 0.00 Itoh Index -0.53 0.23 0.812 480 481

482 483 Figure captions

484 Figure 1. Sampling sites for Epischura (Blue), Epischurella (Red), and Heterocope (Yellow)

485 specimens. Hashed line represents Arctic Circle.

486

487 Figure 2. Mandibles of Epischura (Epischurella) A-C, Epischura (D-H), Temora (I-J) and

488 Heterocope (K) copepods

489 Scale bar is equal to 20 μm. A) E. baikalensis (summer) B) E. baikalensis (winter) C) E.

490 chankensis D) E. fluviatilis E) E. lacustris F) E. massachusettsensis G) E. nevadensis H) E.

491 nordenskioldi I) Temora discaudata J) Temora longicornis and K) Heterocope septentrionalis.

492 Measurements used to calculate the Itoh index (Itoh, 1970) are shown in F. Itoh Index

493 = , where W = total length of cutting edge of mandible; H = height of ventral �� ℎ� 4 �(� × � × 10 )/� 494 tooth; hi = depth of inter-cusp depression; wi = distance between peaks of adjacent cusps, and N

495 = total number of teeth.

496

497 Figure 3, A) Time-calibrated phylogeny of Calanoida using 18s and 28s rRNA genes. All

498 unlabeled nodes have posterior support values of 1.0. * indicates paraphyletic families. Red

499 indicates Siberian species in Epischura (Episcurella); blue indicates North American species in

500 Epischura; and yellow indicates species in Heterocope. B-D) Time-calibrated phylogenies of

501 molecular data (B), morphological data (C), and molecular and morphological data (D). Genes

502 used for B and D include rRNA genes 18s, 28s, and ITS2. Colors correspond to genera as in Fig.

503 3A, and mandible drawings used for morphological analysis appear beside their species

504 identities. Epischura (Epischurella) chankensis Epischura nevadensis Lake Khanka, Siberia, Russia Lake Tahoe, CA, USA

Heterocope septentrionalis Lake Toolik, AK, USA USA Epischura (Epischurella) baikalensis Lake Baikal, Siberia, Russia

North Pole RUS Epischura fluviatilis Lake Marion, SC, USA Epischura lacustris Miller Pond, Thetford, VT, USA

Epischura massachusettsensis Epischura nordenskioldi Vernal Pools, Dover, MA, USA Storrs Pond, Hanover, NH, USA ABC

wi

W DEF

hi H

G H

I J K A B Genetics only Epischura (Epischurella) baikalensis

Epischura (Epischurella) chankensis

Heterocope septentrionalis

Diaptomidae Epischura fluviatilis .94

Pseudodiaptomidae Epischura nordenskioldi

Acanthodiaptomus pacificus Copidodiaptomus numidicus Epischura lacustris Temoridae* Neodiaptomus schmackeri

Fosshageniidae Eudiaptomus vulgaris Epischura nevadensis Heliodiaptomus kikuchii Arctodiaptomus wierzejskii Arctodiaptomus salinusSinodiaptomus sarsi Bathypontiidae Temora discaudata Sulcanidae .98 Temora longicornis DiaptomusDiaptomus kenitraensisDiaptomus cyaneus mirus Rhincalanidae 125 100 75 50 25 0 MYBP Temoropia mayumbaensis Centropagidae Diaptomus castor

Pseudodiaptomus marinus Pseudodiaptomus nihonkaiensis Pseudodiaptomus inopinus Calanipeda aquaedulcis Epischura baikalensis .99 Epischura chankensis Heterocope septentrionalis .96 Temorites brevis Epischura fluviatilis C Morphology only Rhincalanus nasutus .83 1 Epischura nordenskioldi .58 Epischura lacustris Eucalanidae .97 Epischura lacustris Rhincalanus rostrifrons Epischura nevadensis Pontellidae .97 .83 Sulcanus conflictus Rhincalanus cornutus Centropages furcatus Tortanidae Temora discaudata Centropages violaceus Pareucalanus attenuatus .82 Centropages abdominalis Subeucalanus subcrassus Limnocalanus macrurus Candaciidae Epischura nevadensis .88 .88 Subeucalanidae Sinocalanus tenellus Subeucalanus pileatus 1 .89 Pontellina plumata Epischura nordenskioldi .72 Tortanus gracilis Subeucalanus subtenuis .64 Candacia simplex Temoridae* .73 .39 Temora longicornis Subeucalanus pileatus 2 Epischura fluviatilis .66 Temora turbinata .79 Temora discaudata Subeucalanus crassus Temora longicornis .83 250 50150 Calanus pacificus Foxtonia barbatula MYBP .93 .97Calanus sinicus Calanus helgolandicus Epischura (Epischurella) baikalensis Spinocalanus angusticeps Calanus finmarchicus Spinocalanus elongatus .98 Cosmocalanus darwinii Epischura (Epischurella) chankensis .94 Nannocalanus minor Spinocalanus abyssalis .87 .67 Calanus propinquus Spinocalanidae .93 .44 Calanus hyperboreus Epischura massachusettsensis Spinocalanus spinosus .89 .77 Calanoides carinatus .90 .86 Spinocalanus horridus .52 Neocalanus gracilis Heterocope septentrionalis Neocalanus robustior

Tharybis groenlandica .58 Neocalanus flemingeri Phaenna spinifera Neocalanus plumchrus Diaixis hibernica Neocalanus cristatus .97 Paracalanus indicus Calanidae .98 Paracalanus parvus Tharybidae Scolecithrix danae Paracalanus tropicus Delibus nudus D Genetics + Morphology Epischura (Epischurella) baikalensis Paracalanus aculeatus Paracalanus denudatus Acrocalanus longicornis Scolecithrix bradyi Calocalanus curtus Calocalanus styliremis Calocalanus minutus Phaennidae Epischura (Epischurella) chankensis Diaixidae .64 MicrocalanusCtenocalanus pygmaeus vanus Epischura massachusettsensis Aetideus armatus Euchaeta rimana Euchaeta indica .57 Clausocalanus arcuicornis Heterocope septentrionalis Scolecitrichidae Undeuchaeta major .79 Mecynocera clausi Epischura fluviatilis

Paraeuchaeta glacialis Paraeuchaeta norvegica Bathycalanus princeps .89

Calocalanus plumulosus Epischura nordenskioldi Clausocalanidae .98 Paracalanidae Epischura lacustris Aetideidae* Epischura nevadensis

Euchaetidae* Aetideidae* Temora discaudata .84 Euchaetidae* Temora longicornis

Megacalanidae 125 100 75 50 25 0 MYBP 505 Supplemental Figure 1, Maximum-likelihood 18s gene tree for Calanoida. Support values not

506 shown equal 100.

507

508 Supplementary Figure 2, Maximum-likelihood 28s gene tree for Calanoida. Support values

509 not shown equal 100.

510

511 Supplementary Figure 3, Maximum-likelihood 18s+28s concatenated gene tree for

512 Calanoida. Support values not shown equal 100.

513

514 Supplemental Figure 4. Maximum-likelihood gene trees for genera Epischura (Epischurella),

515 Epischura, and Heterocope with Temora and Pontellina as outgroups for A) 18s, B) 28s, C)

516 ITS2, and D) concatenated tree for 18s+28s+ITS2. Colors correspond to genera as previously

517 noted (Figs. 1, 3). Support values not shown equal 100.

518

519 Supplementary Figure 5. Time-calibrated phylogeny of Calanoida using 18s and 28s rRNA

520 genes, vertical representation. Error bars represent 95% confidence intervals for age estimates.

521 All unlabeled nodes have posterior support values of 1.0.

522

523 Supplementary Figure 6. Comparison to Renz et al., (2018) Calanoida Phylogeny. Nodes

524 with posterior probabilities less than 1.0 (Bowman) or less than 100% bootstrap support (Renz)

525 are indicated. Nodes with less than 0.6 posterior probability (Bowman et al.) or less than 60%

526 bootstrap support (Renz) were collapsed. Lines between the trees indicate topological

527 discordance. 528

529 Supplementary Figure 7. Time-calibrated phylogenies of Temoridae using 18s and 28s RNA

530 genes for different combinations of available morphological traits. All unlabeled nodes have

531 posterior support values of 1.0; timescale is MYBP. Disseta_scopularis Hemirhabdus_grimaldii 57Neorhabdus_latus 66Heterostylites_longicornis Heterorhabdus_papilliger 71 71 Paraheterorhabdus_compactus Mesorhabdus_brevicaudatus 69 Lucicutia_flavicornis 82 Nullosetigera_auctiseta Hyperbionyx_athesphatos 93 99 Paraugaptilus_buchani Haloptilus_longicornis Metridia_effusa 99 Metridia_lucens Metridia_pacifica 50 Metridia_longa Pleuromamma_abdominalis Pleuromamma_xiphias 31 Pinkertonius_ambiguus Pseudocyclops_juanibali Pseudocyclops_schminkei Acrocalanus_longicornis Paracalanus_aculeatus Paracalanus_denudatus 98 Delibus_nudus 97 Paracalanus_indicus 96Paracalanus_tropicus Paracalanus_parvus Calocalanus_curtus 81 Calocalanus_minutus 93 Calocalanus_styliremis 69 Calocalanus_plumulosus Mecynocera_clausi Bathycalanus_princeps Calanoides_carinatus 54 Neocalanus_gracilis 26 Neocalanus_robustior Calanus_finmarchicus 90Calanus_helgolandicus 94 99 Calanus_sinicus 99 Calanus_pacificus 64 Calanus_propinquus 83 98 Cosmocalanus_darwinii Nannocalanus_minor 63Calanus_hyperboreus 23 Neocalanus_plumchrus 73Neocalanus_flemingeri Neocalanus_cristatus Aetideus_armatus Euchaeta_indica 6098 59 Euchaeta_rimana 33 Paraeuchaeta_glacialis 95Paraeuchaeta_norvegica 44 Undeuchaeta_major 95 Clausocalanus_arcuicornis 99 98 Ctenocalanus_vanus 82 Diaixis_hibernica 9788 Microcalanus_pygmaeus Tharybis_groenlandica Phaenna_spinifera 68 Scolecithrix_bradyi Scolecithrix_danae Foxtonia_barbatula Spinocalanus_abyssalis Spinocalanus_elongatus 74 80Spinocalanus_horridus 90 Spinocalanus_spinosus Spinocalanus_angusticeps Pareucalanus_attenuatus Subeucalanus_crassus Subeucalanus_pileatus_2 Subeucalanus_pileatus_1 Subeucalanus_subcrassus 99Subeucalanus_subtenuis Rhincalanus_cornutus 94Rhincalanus_rostrifrons Rhincalanus_nasutus Temorites_brevis Temoropia_mayumbaensis Candacia_simplex Centropages_abdominalis 76 98 93 Centropages_furcatus 63 Centropages_violaceus Limnocalanus_macrurus Sinocalanus_tenellus 55 Epischura_baikalensis 72 Epischura_chankensis 94Heterocope_septentrionalis 96 Epischura_fluviatilis 61Epischura_nordenskioldi 56 71Epischura_lacustris 65 76 Epischura_nevadensis Sulcanus_conflictus Temora_discaudata 93 Temora_longicornis Temora_turbinata Tortanus_gracilis Pontellina_plumata Calanipeda_aquaedulcis 99 Pseudodiaptomus_inopinus Pseudodiaptomus_marinus Pseudodiaptomus_nihonkaiensis Arctodiaptomus_salinus 68Arctodiaptomus_wierzejskii Copidodiaptomus_numidicus 8865Diaptomus_castor 42 Diaptomus_kenitraensis 81 89 Diaptomus_cyaneus 35 Diaptomus_mirus 53 Neodiaptomus_schmackeri Eudiaptomus_vulgaris Sinodiaptomus_sarsi 65 Acanthodiaptomus_pacificus 89Heliodiaptomus_kikuchii Hyalopontius_typicus Tigriopus_japonicus 0.04 Acrocalanus_longicornis Paracalanus_aculeatus 79 Paracalanus_denudatus 81 Paracalanus_indicus Paracalanus_parvus Paracalanus_tropicus 96 Calocalanus_curtus 99 Calocalanus_styliremis 99 Calocalanus_minutus 97 Calocalanus_plumulosus Delibus_nudus Mecynocera_clausi Calanoides_carinatus Calanus_finmarchicus 75 Calanus_helgolandicus 97 9591 Calanus_pacificus 94 60 Calanus_propinquus 40 Calanus_sinicus 91 Cosmocalanus_darwinii Nannocalanus_minor 45 Neocalanus_gracilis 48 Neocalanus_robustior 60 Calanus_hyperboreus Neocalanus_cristatus 93 Neocalanus_flemingeri 93 Neocalanus_plumchrus Bathycalanus_princeps 63 94 Temorites_brevis Temoropia_mayumbaensis Pareucalanus_attenuatus Subeucalanus_crassus 98 Subeucalanus_pileatus_2 98 Subeucalanus_subtenuis Subeucalanus_pileatus_1 Subeucalanus_subcrassus Rhincalanus_cornutus Rhincalanus_rostrifrons Rhincalanus_nasutus Aetideus_armatus Euchaeta_indica 99 Euchaeta_rimana 75 Paraeuchaeta_glacialis Paraeuchaeta_norvegica 74 Undeuchaeta_major 69 Clausocalanus_arcuicornis 94 Ctenocalanus_vanus 97 Microcalanus_pygmaeus 68 Foxtonia_barbatula Spinocalanus_abyssalis 88 81 Spinocalanus_horridus 99 Spinocalanus_spinosus 98 Spinocalanus_elongatus Spinocalanus_angusticeps 68 Diaixis_hibernica 61 Tharybis_groenlandica 29 Phaenna_spinifera 62 Scolecithrix_bradyi 88 Scolecithrix_danae Disseta_scopularis 80 Mesorhabdus_brevicaudatus 96 Hemirhabdus_grimaldii 97 Neorhabdus_latus 93 92 Heterorhabdus_papilliger 56 Paraheterorhabdus_compactus 79 Heterostylites_longicornis Hyperbionyx_athesphatos 43 97 Nullosetigera_auctiseta 82 Paraugaptilus_buchani Lucicutia_flavicornis 62 Metridia_effusa 71 Metridia_longa 72 Metridia_lucens 69 Metridia_pacifica Pleuromamma_abdominalis Pleuromamma_xiphias Haloptilus_longicornis Pinkertonius_ambiguus 46 Pseudocyclops_juanibali Pseudocyclops_schminkei Candacia_simplex 86 Temora_discaudata Temora_longicornis Temora_turbinata Centropages_abdominalis 73 Sinocalanus_tenellus 95 Limnocalanus_macrurus 80 86 99 Centropages_furcatus 27 Centropages_violaceus 77 Epischura_baikalensis Epischura_chankensis Epischura_fluviatilis 88 98 Epischura_lacustris 92 Epischura_nevadensis 9198 Epischura_nordenskioldi Heterocope_septentrionalis Sulcanus_conflictus Tortanus_gracilis Pontellina_plumata Calanipeda_aquaedulcis 46 Pseudodiaptomus_inopinus Pseudodiaptomus_marinus 98 Pseudodiaptomus_nihonkaiensis Sinodiaptomus_sarsi Heliodiaptomus_kikuchii Neodiaptomus_schmackeri 72 Arctodiaptomus_salinus 7298 Arctodiaptomus_wierzejskii 9695 Diaptomus_castor 97 Diaptomus_kenitraensis 75 Diaptomus_cyaneus Diaptomus_mirus Acanthodiaptomus_pacificus 70 Copidodiaptomus_numidicus 99 Eudiaptomus_vulgaris Hyalopontius_typicus Tigriopus_japonicus

0.08 Tigriopus_japonicus Hyalopontius_typicus Calocalanus_minutus 67Calocalanus_curtus Calocalanus_styliremis Calocalanus_plumulosus Acrocalanus_longicornis 98 Paracalanus_aculeatus Paracalanus_denudatus 99 Paracalanus_parvus 99Paracalanus_indicus Paracalanus_tropicus Delibus_nudus Mecynocera_clausi 97Calanus_helgolandicus 93Calanus_pacificus 88 Calanus_sinicus 84 Calanus_propinquus Cosmocalanus_darwinii Nannocalanus_minor 92 Calanus_finmarchicus 68 98Calanus_hyperboreus 47 Calanoides_carinatus 97Neocalanus_plumchrus 97Neocalanus_flemingeri 98 Neocalanus_cristatus Neocalanus_gracilis Neocalanus_robustior Bathycalanus_princeps Temorites_brevis Temoropia_mayumbaensis Subeucalanus_crassus Subeucalanus_pileatus_2 97 Subeucalanus_subtenuis Subeucalanus_subcrassus Subeucalanus_pileatus_1 Pareucalanus_attenuatus 67 Rhincalanus_nasutus Rhincalanus_rostrifrons Rhincalanus_cornutus Diaixis_hibernica 91 Scolecithrix_bradyi Scolecithrix_danae Foxtonia_barbatula Spinocalanus_angusticeps 69 Spinocalanus_elongatus 48 Spinocalanus_abyssalis 53 99Spinocalanus_horridus Spinocalanus_spinosus Microcalanus_pygmaeus 97 Ctenocalanus_vanus 53 Clausocalanus_arcuicornis Euchaeta_rimana Euchaeta_indica 97 Paraeuchaeta_norvegica 99Paraeuchaeta_glacialis 98 Undeuchaeta_major Aetideus_armatus Tharybis_groenlandica 89 Phaenna_spinifera Centropages_furcatus Centropages_violaceus 82 Centropages_abdominalis 82 Limnocalanus_macrurus Sinocalanus_tenellus 70 Epischura_baikalensis Epischura_chankensis 96Heterocope_septentrionalis Epischura_fluviatilis 82 Epischura_nevadensis 97Epischura_lacustris 80 Epischura_nordenskioldi Sulcanus_conflictus Temora_discaudata 80 Temora_longicornis Temora_turbinata 81 Candacia_simplex Tortanus_gracilis Pontellina_plumata Pseudodiaptomus_inopinus Pseudodiaptomus_marinus 99 Pseudodiaptomus_nihonkaiensis Calanipeda_aquaedulcis Acanthodiaptomus_pacificus Heliodiaptomus_kikuchii 73 Sinodiaptomus_sarsi 73 Neodiaptomus_schmackeri 95 Diaptomus_castor 87 Diaptomus_kenitraensis 99Diaptomus_cyaneus 78 Diaptomus_mirus 8798Arctodiaptomus_wierzejskii Arctodiaptomus_salinus Eudiaptomus_vulgaris Copidodiaptomus_numidicus Pseudocyclops_schminkei Pseudocyclops_juanibali 76 Pinkertonius_ambiguus Lucicutia_flavicornis Pleuromamma_abdominalis 52 Pleuromamma_xiphias Metridia_lucens Metridia_pacifica 31 Metridia_effusa Metridia_longa 25 Haloptilus_longicornis Nullosetigera_auctiseta 92 Paraugaptilus_buchani 90 Hyperbionyx_athesphatos 37 Mesorhabdus_brevicaudatus Heterorhabdus_papilliger 7899Paraheterorhabdus_compactus 89Heterostylites_longicornis 99Hemirhabdus_grimaldii Neorhabdus_latus Disseta_scopularis

0.05 Pontellina_plumata Temora_discaudata 87 96 A 18s Temora_discaudata B 28s Pontellina_plumata Epischura_baikalensis Epischura_baikalensis 94 Epischura_chankensis 73 58 Epischura_chankensis Heterocope_septentrionalis Heterocope_septentrionalis Epischura_fluviatilis 87 96 Epischura_lacustris 42 98 Epischura_nordenskioldi Epischura_nevadensis 53 57 Epischura_lacustris Epischura_nordenskioldi 99 43 Epischura_nevadensis Epischura_fluviatilis 0.005 0.02 C ITS2 Epischura_baikalensis D 18s + 28s + ITS2 98 Pontellina_plumata Epischura_chankensis 99 Temora_discaudata Heterocope_septentrionalis Epischura_baikalensis

Epischura_fluviatilis 86 Epischura_chankensis 44 99 Heterocope_septentrionalis Epischura_lacustris 99 95 Epischura_fluviatilis 37 Epischura_nevadensis Epischura_nevadensis Temora_discaudata 99 59 Epischura_lacustris Pontellina_plumata Epischura_nordenskioldi 0.06 0.02 Calanus_pacificus 0.93 0.97Calanus_sinicus Calanus_helgolandicus Calanus_finmarchicus Cosmocalanus_darwinii Calanidae 0.94 Nannocalanus_minor Calanus_propinquus 0.67 Calanus_hyperboreus 0.44 Calanoides_carinatus Neocalanus_gracilis 0.89 Neocalanus_robustior Neocalanus_flemingeri Neocalanus_plumchrus Neocalanus_cristatus Paracalanus_indicus 0.7 Paracalanus_parvus Paracalanus_tropicus Delibus_nudus Paracalanidae Paracalanus_aculeatus 0.97 Paracalanus_denudatus Acrocalanus_longicornis 0.52 Calocalanus_curtus Calocalanus_styliremis Calocalanus_minutus Calocalanus_plumulosus Mecynocera_clausi Bathycalanus_princeps Megacalanidae Paraeuchaeta_glacialis Euchaetidae* Paraeuchaeta_norvegica 0.98 Undeuchaeta_major Aetideidae* Euchaeta_indica Euchaetidae* Euchaeta_rimana 0.58 Aetideus_armatus Aetideidae* Clausocalanus_arcuicornis Ctenocalanus_vanus Clausocalanidae 0.86 Microcalanus_pygmaeus Scolecithrix_bradyi Scolecitrichidae 0.77 Scolecithrix_danae 0.93 Diaixis_hibernica Diaixidae Phaenna_spinifera 0.87 Phaennidae Tharybis_groenlandica Tharybidae Spinocalanus_horridus 0.98Spinocalanus_spinosus Spinocalanus_abyssalis Spinocalanidae Spinocalanus_elongatus Spinocalanus_angusticeps 0.83 Foxtonia_barbatula Subeucalanus_crassus 0.79 Subeucalanus_pileatus_2 Subeucalanus_subtenuis Subeucalanidae Subeucalanus_pileatus_1 0.73 Subeucalanus_subcrassus Pareucalanus_attenuatus Eucalanidae Rhincalanus_cornutus Rhincalanus_rostrifrons Rhincalanidae Rhincalanus_nasutus Temorites_brevis Bathypontiidae Temoropia_mayumbaensis Fosshageniidae Diaptomus_castor 0.83 Diaptomus_kenitraensis Diaptomus_cyaneus 0.58 Diaptomus_mirus Arctodiaptomus_wierzejskii Arctodiaptomus_salinus 0.83 Diaptomidae Heliodiaptomus_kikuchii 0.96 Sinodiaptomus_sarsi Neodiaptomus_schmackeri Copidodiaptomus_numidicus 0.99 Eudiaptomus_vulgaris Acanthodiaptomus_pacificus Pseudodiaptomus_marinus Pseudodiaptomus_nihonkaiensis Pseudodiaptomidae Pseudodiaptomus_inopinus Calanipeda_aquaedulcis Epischura_baikalensis Epischura_chankensis Heterocope_septentrionalis Epischura_fluviatilis Temoridae* 0.97 0.72 Epischura_nordenskioldi 0.82 Epischura_lacustris 0.97 Epischura_nevadensis Sulcanus_conflictus Sulcanidae 0.88 Centropages_furcatus 0.88 Centropages_violaceus Centropagidae 0.89 Centropages_abdominalis Limnocalanus_macrurus Sinocalanus_tenellus Pontellina_plumata Pontellidae 0.64 0.39 Tortanus_gracilis Tortanidae Candacia_simplex Candaciidae 0.66 Temora_longicornis Temora_turbinata Temoridae* Temora_discaudata

-350 -300 -250 -200 -150 -100 -50 0 MYBP

Morphology + Genetics Teeth and Itoh Index (n=15) Teeth (n=14)

Epischura_fluviatilis Epischura_lacustris 0.97 1 Epischura_nordenskioldi Epischura_nevadensis 0.97 0.89

Epischura_lacustris 1 Epischura_nordenskioldi 0.99 0.86Epischura_nevadensis Epischura_fluviatilis 0.97

Temora_discaudata Epischura_baikalensis 1 1 1 Temora_longicornis 1 Epischura_chankensis

Epischura_massachusettensis Epischura_massachusettensis 1 0.87 1 1 Heterocope_septentrionalis Heterocope_septentrionalis

1 1 Epischura_baikalensis Temora_longicornis

Epischura_chankensis Temora_discaudata

-175 -150 -125 -100 -75 -50 -25 0 -150 -125 -100 -75 -50 -25 0

Body Size and Itoh Index (n=2) Body Size (n=1)

Epischura_baikalensis Epischura_baikalensis 1 1 Epischura_chankensis Epischura_chankensis 0.54 0.64

Epischura_massachusettensis 0.51 Heterocope_septentrionalis 0.57 Heterocope_septentrionalis Epischura_massachusettensis 0.79 0.72 Epischura_fluviatilis Epischura_fluviatilis 0.89 0.89 Epischura_nordenskioldi Epischura_nordenskioldi 0.98 0.97 1 Epischura_lacustris Epischura_lacustris 1 1 0.99 Epischura_nevadensis Epischura_nevadensis

Temora_discaudata Temora_discaudata 0.84 0.78 Temora_longicornis Temora_longicornis

-150 -125 -100 -75 -50 -25 0 -125 -100 -75 -50 -25 0

Body Size and Largest Tooth (n=2) All Traits (n=16) Epischura_baikalensis Epischura_lacustris 1 1 Epischura_chankensis Epischura_nevadensis 0.99 0.73

Epischura_massachusettensis 1 Epischura_nordenskioldi 0.68 Heterocope_septentrionalis Epischura_fluviatilis 1 0.84 Epischura_fluviatilis Temora_discaudata 0.88 1 Epischura_nordenskioldi 0.9 Temora_longicornis 1 1 Epischura_lacustris Epischura_baikalensis 1 1 1 Epischura_nevadensis Epischura_chankensis

Temora_discaudata Epischura_massachusettensis 0.89 1 Temora_longicornis Heterocope_septentrionalis

-125 -100 -75 -50 -25 0 -150 -125 -100 -75 -50 -25 0