Exploring the Dark Genome Implications for Precision Medicine Oprea, Tudor I

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Exploring the dark genome implications for precision medicine Oprea, Tudor I. Published in: Mammalian Genome DOI: 10.1007/s00335-019-09809-0 Publication date: 2019 Document version Peer reviewed version Citation for published version (APA): Oprea, T. I. (2019). Exploring the dark genome: implications for precision medicine. Mammalian Genome, 30(7- 8), 192-200. https://doi.org/10.1007/s00335-019-09809-0 Download date: 28. sep.. 2021 HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Mamm Manuscript Author Genome. Author Manuscript Author manuscript; available in PMC 2020 August 01. Published in final edited form as: Mamm Genome. 2019 August ; 30(7-8): 192–200. doi:10.1007/s00335-019-09809-0. Exploring the Dark Genome - Implications for Precision Medicine Tudor I. Oprea1,2,3,4 1.Department of Internal Medicine, University of New Mexico School of Medicine, Albuquerque, NM, USA. 2.UNM Comprehensive Cancer Center, Albuquerque, NM, USA. 3.Department of Rheumatology and Inflammation Research, Institute of Medicine, Sahlgrenska Academy at University of Gothenburg, Gothenburg, Sweden. 4.Novo Nordisk Foundation Center for Protein Research, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen, Denmark. Abstract The increase in the number of both patients and healthcare practitioners who grew up using the Internet and computers (so-called “digital natives”) is likely to impact the practice of precision medicine, and requires novel platforms for data integration and mining, as well as contextualized information retrieval. The “Illuminating the Druggable Genome Knowledge Management Center” (IDG KMC) quantifies data availability from a wide range of chemical, biological and clinical resources, and has developed platforms that can be used to navigate understudied proteins (the “dark genome”), and their potential contribution to specific pathologies. Using the “Target Importance and Novelty Explorer” (TIN-X) highlights the role of LRRC10 (a dark gene) in dilated cardiomyopathy. Combining mouse and human phenotype data leads to increased strength of evidence, which is discussed for 4 additional dark genes: SLX4IP and its role in glucose metabolism, the role of HSF2BP in coronary artery disease, the involvement of ELFN1 in attention deficit hyperactivity disorder and the role of VPS13D in mouse neural tube development and its confirmed role in childhood onset movement disorders. The workflow and tools described here are aimed at guiding further experimental research, particularly within the context of precision medicine. Navigating the Target Landscape by Illuminating the Druggable Genome Data wrangling, distilling unrelated data elements into contextualized knowledge and the overall ability to rapidly process digital information are increasing demands placed on current healthcare professionals. At the same time, the number of “digital native” patients Conflict of Interest Dr. Oprea was a former full time employee at AstraZeneca (1996–2002). He has received honoraria, or consulted for, Abbott, AstraZeneca, Chiron, Genentech, Infinity Pharmaceuticals, Merz Pharmaceuticals, Merck Darmstadt, Mitsubishi Tanabe, Novartis, Ono Pharmaceuticals, Pfizer, Roche, Sanofi, and Wyeth. His spouse was a full-time employee of AstraZeneca (2002–2014) and is a full time employee of Genentech Inc. Publisher's Disclaimer: This Author Accepted Manuscript is a PDF file of an unedited peer-reviewed manuscript that has been accepted for publication but has not been copyedited or corrected. The official version of record that is published in the journal is kept up to date and so may therefore differ from this version. Oprea Page 2 (i.e., patients who started to use computers/tablets/smart phones from an early age) is Author ManuscriptAuthor Manuscript Author Manuscript Author Manuscript Author increasing. Indeed, when it comes to healthcare issues, more and more patients, especially “digital natives”, seek information via social media and web-based platforms and healthcare databases. It therefore seems necessary for healthcare professionals to embrace novel analytic technologies to integrate multi-faceted big data and translate them into patient benefits (Bezemer et al. 2019). This integration process faces unique technical, semantic, and ethical challenges (Seneviratne, Kahn, and Hernandez-Boussard 2019), challenges that could be overcome by emerging computational technologies rooted in phenotypic ontologies drawing from a multi-species context (Robinson, Mungall, and Haendel 2015), Therefore, there is an imperative to improve and streamline “big data” analytics technologies in the context of precision medicine. As both healthcare practitioner and patient categories are increasingly more “digital native”, the patient-doctor relationship is likely to fundamentally change given the unfettered Internet access to healthcare information. Biomedical advances have fostered the emergence of data science, a relatively novel discipline focused on novel algorithms for data analytics and visualization (Berger and Schneck 2019), which ultimately warrants an informatics-oriented formalization of study design, interoperability and model development (Prosperi et al. 2018), specifically in the context of precision medicine (National Research Council et al. 2012), Defined as “prevention and treatment strategies that take individual variability into account” (Collins and Varmus 2015), precision medicine is widely regarded as the future of clinical practice, and is poised to take advantage of the large-scale integration of the contextualized knowledge emerging from genomic, phenomic and patient-centric databases. Here, we briefly discuss the Illuminating the Druggable Genome Knowledge Management Center, IDG KMC (Oprea, Bologa, et al. 2018) project, and how its platform can be used to extract relevant data elements for precision medicine. IDG KMC extracts and processes expression and functional data related to proteins and genes, molecular probes such as small molecules, antibodies and approved drugs, small molecule bioactivities, genome-wide association studies, disease associations and drug indications and off-label uses (among other data types) into the Target Central Repository Database, TCRD(Nguyen et al. 2017) - see Figure 1. TCRD organizes and structures information, thus mapping the current target landscape. Key elements from genomic and proteomic sources, in addition to literature, patents, clinical trials, drug labels and other information, are standardized, linked and associated with disease information, and exposed via the Pharos portal (https:// pharos.nih.gov/index), and through a limited REST API TCRD (https://bit.ly/31lMT17). By bridging clinical, biological, chemical and genomic data, the IDG KMC integrates information and knowledge for over 20,000 protein-encoding genes by combining data science, informatics and computational biology to prioritize targets for further experimental evaluation and analysis by the broader scientific community. Quantifying Data Availability The TCRD/Pharos platform is well suited to address questions about the “druggable genome”, which Hopkins and Groom defined (Hopkins and Groom 2002) as the set of protein-encoding genes that can be therapeutically modulated by orally formulated drugs, Mamm Genome. Author manuscript; available in PMC 2020 August 01. Oprea Page 3 using Lipinski’s “rule of five” criteria, which defined four physico-chemical property Author ManuscriptAuthor Manuscript Author Manuscript Author Manuscript Author parameter sets enriched in orally available drugs(Lipinski et al. 1997). The intersection between disease-modifying genes and the “druggable genome” was estimated to be between 600 and 1,500 targets (Hopkins and Groom 2002). Indeed, the known druggable genome, categorized as Tclin, or targets via which approved drugs act, includes 602 human proteins (Santos et al. 2017), a number that increased by thirteen via drugs approved in 2018 (Ursu, Glick, and Oprea 2019). A second set of well-studied proteins, Tchem, encompasses proteins that lack mode-of-action associations with approved drugs, and are known to bind small molecules with high potency. Current thresholds are ≤ 30nM for Kinases, ≤ 100nM for G-protein coupled and nuclear receptors, ≤ 10μM for ion channels, and ≤ 1μM for other target families (Oprea, Bologa, et al. 2018). Bioactivity values were extracted from ChEMBL, DrugCentral and the Guide to Pharmacology (Southan et al. 2016). The third Target Development Level (TDL) category, Tbio, includes proteins that have confirmed Mendelian disease phenotype in OMIM (Amberger et al. 2009) or have Gene Ontology (Ashburner et al. 2000) “leaf” (lowest level) term annotations based on experimental evidence; or meet two of the following three conditions: A fractional publication count (Pafilis et al. 2013) above 5, three or more Gene RIF, “Reference Into Function” annotations(https://bit.ly/2WDE1oL), or 50 or more commercial antibodies, as counted in the Antibodypedia database (Kiermer 2008). The fourth TDL category, Tdark, also referred to as the “ignorome” (Pandey et al. 2014) or the “dark genome”, encompasses one in three human proteins that were manually curated at the primary sequence level in UniProt (UniProt Consortium 2015), yet do not meet any of the criteria for Tclin, Tchem or Tbio. Additional information concerning this category may be available from genome-wide association studies (GWAS), tissue and subcellular compartment location, dysregulation, IMPC mouse
Recommended publications
  • Primepcr™Assay Validation Report

    Primepcr™Assay Validation Report

    PrimePCR™Assay Validation Report Gene Information Gene Name vacuolar protein sorting 13 homolog D (S. cerevisiae) Gene Symbol VPS13D Organism Human Gene Summary This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. Gene Aliases FLJ23066 RefSeq Accession No. NC_000001.10, NT_021937.19 UniGene ID Hs.439381 Ensembl Gene ID ENSG00000048707 Entrez Gene ID 55187 Assay Information Unique Assay ID qHsaCID0012130 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000543710, ENST00000356315, ENST00000358136, ENST00000543766, ENST00000011700 Amplicon Context Sequence CCTTGTCTCCAAAGACCATGGGAAGGTGTATGTGCAGGTGACCAAGAAAGCCGT GAGCACGAGCAGTGGAGTGTCCATCCCCGGCCCCTCCCACCAGAAGCCCATGG TCCATGTGAAATCTGAGGTCCTTGCTGTCAA Amplicon Length (bp) 108 Chromosome Location 1:12567042-12568978 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9991 cDNA Cq 21.41 cDNA Tm (Celsius) 86 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 35.2 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report VPS13D, Human Amplification Plot Amplification of
  • Pathogenesis of ETV6/RUNX1-Positive Childhood Acute Lymphoblastic Leukemia and Mechanisms Underlying Its Relapse

    Pathogenesis of ETV6/RUNX1-Positive Childhood Acute Lymphoblastic Leukemia and Mechanisms Underlying Its Relapse

    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 21), pp: 35445-35459 Review Pathogenesis of ETV6/RUNX1-positive childhood acute lymphoblastic leukemia and mechanisms underlying its relapse Congcong Sun1, Lixian Chang1 and Xiaofan Zhu1 1 Center for Pediatric Blood Disease, State Key Laboratory of Experimental Hematology, Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences, and Peking Union Medical College, Tianjin, P.R. China Correspondence to: Xiaofan Zhu, email: [email protected] Keywords: ETV6/RUNX1, childhood acute lymphoblastic leukemia, mechanisms, initiation, relapse Received: November 21, 2016 Accepted: February 23, 2017 Published: March 18, 2017 Copyright: Sun et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT ETV6/RUNX1 (E/R) is the most common fusion gene in childhood acute lymphoblastic leukemia (ALL). Multiple lines of evidence imply a “two-hit” model for the molecular pathogenesis of E/R-positive ALL, whereby E/R rearrangement is followed by a series of secondary mutations that trigger overt leukemia. The cellular framework in which E/R arises and the maintenance of a pre-leukemic condition by E/R are fundamental to the mechanism that underlies leukemogenesis. Accordingly, a variety of studies have focused on the relationship between the clones giving rise to the primary and recurrent E/R-positive ALL. We review here the most recent insights into the pathogenic mechanisms underlying E/R-positive ALL, as well as the molecular abnormalities prevailing at relapse.
  • Genetic Analysis of Over One Million People Identifies 535 New Loci Associated with Blood 2 Pressure Traits

    Genetic Analysis of Over One Million People Identifies 535 New Loci Associated with Blood 2 Pressure Traits

    1 Genetic analysis of over one million people identifies 535 new loci associated with blood 2 pressure traits. 3 4 Table of Contents 5 SUPPLEMENTARY TABLES LEGENDS……………………………………………………………………………….…….3 6 SUPPLEMENTARY FIGURES LEGENDS ........................................................................................ 6 7 SUPPLEMENTARY METHODS ................................................................................................... 10 8 1. UK Biobank data .................................................................................................................................... 10 9 2. UKB Quality Control ............................................................................................................................... 10 10 3. Phenotypic data ..................................................................................................................................... 11 11 4. UKB analysis ........................................................................................................................................... 11 12 5. Genomic inflation and confounding ....................................................................................................... 12 13 6. International Consortium for Blood Pressure (ICBP) GWAS .................................................................... 12 14 7. Meta-analyses of discovery datasets ..................................................................................................... 13 15 8. Linkage Disequilibrium calculations ......................................................................................................
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway

    Analysis of the Indacaterol-Regulated Transcriptome in Human Airway

    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
  • Characterisation of the Genomic Landscape of CRLF2‐Rearranged Acute Lymphoblastic Leukemia

    Characterisation of the Genomic Landscape of CRLF2‐Rearranged Acute Lymphoblastic Leukemia

    Characterisation of the Genomic Landscape of CRLF2- rearranged Acute Lymphoblastic Leukemia Lisa J Russell1*, Lisa Jones1, Amir Enshaei1, Stefano Tonin1, Sarra L Ryan1, Jeyanthy Eswaran1 , Sirintra Nakjang2, Elli Papaemmanuil3,4, Jose M C Tubio4, Adele K Fielding5, Ajay Vora6, Peter J Campbell4, Anthony V Moorman1, and Christine J Harrison1 1 Leukaemia Research Cytogenetics Group, Northern Institute for Cancer Research, Newcastle University, Newcastle-upon-Tyne, UK 2 Bioinformatics Support Unit, Newcastle University, Newcastle-upon-Tyne, UK 3 Memorial Sloan Kettering Cancer Center, USA 4 Cancer Genome Project, Wellcome Trust Sanger Institute, Hinxton, UK 5 Research Department of Haemaoloty, UCL Cancer Institute, London, UK 6 Department of Haematology, Sheffield Children’s Hospital, Sheffield, UK; AVM and CJH contributed equally to this study Running Title – Genomic landscape of CRLF2 rearranged leukemia Correspondence to: Dr Lisa J Russell, Wolfson Childhood Cancer Research Centre, Northern Institute for Cancer Research, Newcastle University, Level 6, Herschel Building, Brewery Lane, Newcastle upon Tyne, NE1 7RU, [email protected]. Acknowledgements Support by: The Kay Kendall Leukaemia Fund, Leuka, European Haematology Association and Bloodwise (formerly Leukaemia and Lymphoma Research) This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1002/gcc.22439 This article is protected by copyright. All rights reserved. Genes, Chromosomes & Cancer Page 2 of 147 Deregulated expression of the type I cytokine receptor, CRLF2, is observed in 5-15% of precursor B-cell acute lymphoblastic leukaemia (B-ALL).
  • SZDB: a Database for Schizophrenia Genetic Research

    SZDB: a Database for Schizophrenia Genetic Research

    Schizophrenia Bulletin vol. 43 no. 2 pp. 459–471, 2017 doi:10.1093/schbul/sbw102 Advance Access publication July 22, 2016 SZDB: A Database for Schizophrenia Genetic Research Yong Wu1,2, Yong-Gang Yao1–4, and Xiong-Jian Luo*,1,2,4 1Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Kunming, China; 2Kunming College of Life Science, University of Chinese Academy of Sciences, Kunming, China; 3CAS Center for Excellence in Brain Science and Intelligence Technology, Chinese Academy of Sciences, Shanghai, China 4YGY and XJL are co-corresponding authors who jointly directed this work. *To whom correspondence should be addressed; Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China; tel: +86-871-68125413, fax: +86-871-68125413, e-mail: [email protected] Schizophrenia (SZ) is a debilitating brain disorder with a Introduction complex genetic architecture. Genetic studies, especially Schizophrenia (SZ) is a severe mental disorder charac- recent genome-wide association studies (GWAS), have terized by abnormal perceptions, incoherent or illogi- identified multiple variants (loci) conferring risk to SZ. cal thoughts, and disorganized speech and behavior. It However, how to efficiently extract meaningful biological affects approximately 0.5%–1% of the world populations1 information from bulk genetic findings of SZ remains a and is one of the leading causes of disability worldwide.2–4 major challenge. There is a pressing
  • Increased Expression of Fragmented Trna Promoted Neuronal Necrosis ✉ ✉ Yanyan Cao1,2, Kai Liu3, Ying Xiong1, Chunyue Zhao4 and Lei Liu1

    Increased Expression of Fragmented Trna Promoted Neuronal Necrosis ✉ ✉ Yanyan Cao1,2, Kai Liu3, Ying Xiong1, Chunyue Zhao4 and Lei Liu1

    www.nature.com/cddis ARTICLE OPEN Increased expression of fragmented tRNA promoted neuronal necrosis ✉ ✉ Yanyan Cao1,2, Kai Liu3, Ying Xiong1, Chunyue Zhao4 and Lei Liu1 © The Author(s) 2021 Neuronal necrosis induced by excessive glutamate release is well known to contribute morbidity and mortality in ischemic stroke. Over the past decades, strategies on targeting glutamate receptor did not achieve desirable clinical outcomes. Finding the downstream mechanism of the glutamate receptor activation may provide new targets to suppress the cell death. Previously, our study demonstrated that the increase of H3K4 trimethylation (H3K4me3) played a key detrimental role on neuronal necrosis; however, the mechanism of this histone modification is unclear. Through a genome-wide small RNA sequencing, we identified several tRNA-derived fragments (tRFs) and piwi-interacting RNA (piRNAs) species were enriched in glutamate-induced neuronal necrosis in rat primary neuron cultures, and this enrichment was dependent on the H3K4me3 increase. Strikingly, when we transfected several synthesized tRFs and piRNA species into neurons, the tRFs but not the piRNAs induced neuron swelling and death. The cell death morphology recapitulated neuronal necrosis induced by glutamate. For the cytotoxic effect of tRFs, our data suggested that protein synthesis was inhibited likely through induction of ribosomal stalling. By proteomic analysis of tRFs effect, the most affected pathway was enriched in the mitochondrial metabolism. Consistently, mitochondrial fragmentation was increased in neuronal necrosis, and suppression of mitochondrial fission by genetic manipulation or drug rescued neuronal necrosis. Using our previously established Drosophila model of neuronal necrosis, we found that inhibition of small RNA transcription, blocking RNA transport from nucleus to cytosol, or knocking down Ago1/2 to suppress the RNA interference effect, all rescued the fly death, suggesting transcription and processing of small RNAs contribute to neuronal necrosis.
  • The Clinical Utility of Optical Genome Mapping for the Assessment of Genomic Aberrations in Acute Lymphoblastic Leukemia

    The Clinical Utility of Optical Genome Mapping for the Assessment of Genomic Aberrations in Acute Lymphoblastic Leukemia

    cancers Article The Clinical Utility of Optical Genome Mapping for the Assessment of Genomic Aberrations in Acute Lymphoblastic Leukemia Jonathan Lukas Lühmann 1,† , Marie Stelter 1,†, Marie Wolter 1, Josephine Kater 1, Jana Lentes 1, Anke Katharina Bergmann 1, Maximilian Schieck 1 , Gudrun Göhring 1, Anja Möricke 2, Gunnar Cario 2, Markéta Žaliová 3 , Martin Schrappe 2, Brigitte Schlegelberger 1, Martin Stanulla 4 and Doris Steinemann 1,* 1 Department of Human Genetics, Hannover Medical School, 30625 Hannover, Germany; [email protected] (J.L.L.); [email protected] (M.S.); [email protected] (M.W.); [email protected] (J.K.); [email protected] (J.L.); [email protected] (A.K.B.); [email protected] (M.S.); [email protected] (G.G.); [email protected] (B.S.) 2 Department of Pediatrics I, ALL-BFM Study Group, Christian-Albrechts University Kiel and University Medical Center Schleswig-Holstein, 24105 Kiel, Germany; [email protected] (A.M.); [email protected] (G.C.); [email protected] (M.S.) 3 Department of Paediatric Haematology and Oncology, 2nd Faculty of Medicine, Charles University and University Hospital Motol, CZ-15006 Prague, Czech Republic; [email protected] 4 Pediatric Hematology and Oncology, Hannover Medical School, 30625 Hannover, Germany; [email protected] * Correspondence: [email protected] † These authors equally contributed to this work. Citation: Lühmann, J.L.; Stelter, M.; Wolter, M.; Kater, J.; Lentes, J.; Bergmann, A.K.; Schieck, M.; Simple Summary: The stratification of childhood ALL is currently based on various diagnostic Göhring, G.; Möricke, A.; Cario, G.; assays.
  • Maintenance of Mammary Epithelial Phenotype by Transcription Factor Runx1 Through Mitotic Gene Bookmarking Joshua Rose University of Vermont

    Maintenance of Mammary Epithelial Phenotype by Transcription Factor Runx1 Through Mitotic Gene Bookmarking Joshua Rose University of Vermont

    University of Vermont ScholarWorks @ UVM Graduate College Dissertations and Theses Dissertations and Theses 2019 Maintenance Of Mammary Epithelial Phenotype By Transcription Factor Runx1 Through Mitotic Gene Bookmarking Joshua Rose University of Vermont Follow this and additional works at: https://scholarworks.uvm.edu/graddis Part of the Biochemistry Commons, and the Genetics and Genomics Commons Recommended Citation Rose, Joshua, "Maintenance Of Mammary Epithelial Phenotype By Transcription Factor Runx1 Through Mitotic Gene Bookmarking" (2019). Graduate College Dissertations and Theses. 998. https://scholarworks.uvm.edu/graddis/998 This Thesis is brought to you for free and open access by the Dissertations and Theses at ScholarWorks @ UVM. It has been accepted for inclusion in Graduate College Dissertations and Theses by an authorized administrator of ScholarWorks @ UVM. For more information, please contact [email protected]. MAINTENANCE OF MAMMARY EPITHELIAL PHENOTYPE BY TRANSCRIPTION FACTOR RUNX1 THROUGH MITOTIC GENE BOOKMARKING A Thesis Presented by Joshua Rose to The Faculty of the Graduate College of The University of Vermont In Partial Fulfillment of the Requirements for the Degree of Master of Science Specializing in Cellular, Molecular, and Biomedical Sciences January, 2019 Defense Date: November 12, 2018 Thesis Examination Committee: Sayyed Kaleem Zaidi, Ph.D., Advisor Gary Stein, Ph.D., Advisor Seth Frietze, Ph.D., Chairperson Janet Stein, Ph.D. Jonathan Gordon, Ph.D. Cynthia J. Forehand, Ph.D. Dean of the Graduate College ABSTRACT Breast cancer arises from a series of acquired mutations that disrupt normal mammary epithelial homeostasis and create multi-potent cancer stem cells that can differentiate into clinically distinct breast cancer subtypes. Despite improved therapies and advances in early detection, breast cancer remains the leading diagnosed cancer in women.
  • Identification of Proteins Involved in the Maintenance of Genome Stability

    Identification of Proteins Involved in the Maintenance of Genome Stability

    Identification of Proteins Involved in the Maintenance of Genome Stability by Edith Hang Yu Cheng A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Biochemistry University of Toronto ©Copyright by Edith Cheng2015 Identification of Proteins Involved in the Maintenance of Genome Stability Edith Cheng Doctor of Philosophy Department of Biochemistry University of Toronto 2015 Abstract Aberrant changes to the genome structure underlie numerous human diseases such as cancers. The functional characterization ofgenesand proteins that maintain chromosome stability will be important in understanding disease etiology and developing therapeutics. I took a multi-faceted approach to identify and characterize genes involved in the maintenance of genome stability. As biological pathways involved in genome maintenance are highly conserved in evolution, results from model organisms can greatly facilitate functional discovery in humans. In S. cerevisiae, I identified 47 essential gene depletions with elevated levels of spontaneous DNA damage foci and 92 depletions that caused elevated levels of chromosome rearrangements. Of these, a core subset of 15 DNA replication genes demonstrated both phenotypes when depleted. Analysis of rearrangement breakpoints revealed enrichment at yeast fragile sites, Ty retrotransposons, early origins of replication and replication termination sites. Together, thishighlighted the integral role of DNA replicationin genome maintenance. In light of my findings in S. cerevisiae, I identified a list of 153 human proteins that interact with the nascentDNA at replication forks, using a DNA pull down strategy (iPOND) in human cell lines. As a complementary approach for identifying human proteins involved in genome ii maintenance, I usedthe BioID techniqueto discernin vivo proteins proximal to the human BLM- TOP3A-RMI1-RMI2 genome stability complex, which has an emerging role in DNA replication progression.
  • TERRA Transcription Destabilizes Telomere Integrity to Initiate Break

    TERRA Transcription Destabilizes Telomere Integrity to Initiate Break

    ARTICLE https://doi.org/10.1038/s41467-021-24097-6 OPEN TERRA transcription destabilizes telomere integrity to initiate break-induced replication in human ALT cells ✉ Bruno Silva 1,4, Rajika Arora 1,3,4, Silvia Bione 2 & Claus M. Azzalin 1 Alternative Lengthening of Telomeres (ALT) is a Break-Induced Replication (BIR)-based mechanism elongating telomeres in a subset of human cancer cells. While the notion that 1234567890():,; spontaneous DNA damage at telomeres is required to initiate ALT, the molecular triggers of this physiological telomere instability are largely unknown. We previously proposed that the telomeric long noncoding RNA TERRA may represent one such trigger; however, given the lack of tools to suppress TERRA transcription in cells, our hypothesis remained speculative. We have developed Transcription Activator-Like Effectors able to rapidly inhibit TERRA transcription from multiple chromosome ends in an ALT cell line. TERRA transcription inhi- bition decreases marks of DNA replication stress and DNA damage at telomeres and impairs ALT activity and telomere length maintenance. We conclude that TERRA transcription actively destabilizes telomere integrity in ALT cells, thereby triggering BIR and promoting telomere elongation. Our data point to TERRA transcription manipulation as a potentially useful target for therapy. 1 Instituto de Medicina Molecular João Lobo Antunes (iMM), Faculdade de Medicina da Universidade de Lisboa, Lisbon, Portugal. 2 Computational Biology Unit, Institute of Molecular Genetics Luigi Luca Cavalli-Sforza,