Exploring the Dark Genome Implications for Precision Medicine Oprea, Tudor I
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name vacuolar protein sorting 13 homolog D (S. cerevisiae) Gene Symbol VPS13D Organism Human Gene Summary This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. Gene Aliases FLJ23066 RefSeq Accession No. NC_000001.10, NT_021937.19 UniGene ID Hs.439381 Ensembl Gene ID ENSG00000048707 Entrez Gene ID 55187 Assay Information Unique Assay ID qHsaCID0012130 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000543710, ENST00000356315, ENST00000358136, ENST00000543766, ENST00000011700 Amplicon Context Sequence CCTTGTCTCCAAAGACCATGGGAAGGTGTATGTGCAGGTGACCAAGAAAGCCGT GAGCACGAGCAGTGGAGTGTCCATCCCCGGCCCCTCCCACCAGAAGCCCATGG TCCATGTGAAATCTGAGGTCCTTGCTGTCAA Amplicon Length (bp) 108 Chromosome Location 1:12567042-12568978 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9991 cDNA Cq 21.41 cDNA Tm (Celsius) 86 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 35.2 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report VPS13D, Human Amplification Plot Amplification of -
Pathogenesis of ETV6/RUNX1-Positive Childhood Acute Lymphoblastic Leukemia and Mechanisms Underlying Its Relapse
www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 21), pp: 35445-35459 Review Pathogenesis of ETV6/RUNX1-positive childhood acute lymphoblastic leukemia and mechanisms underlying its relapse Congcong Sun1, Lixian Chang1 and Xiaofan Zhu1 1 Center for Pediatric Blood Disease, State Key Laboratory of Experimental Hematology, Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences, and Peking Union Medical College, Tianjin, P.R. China Correspondence to: Xiaofan Zhu, email: [email protected] Keywords: ETV6/RUNX1, childhood acute lymphoblastic leukemia, mechanisms, initiation, relapse Received: November 21, 2016 Accepted: February 23, 2017 Published: March 18, 2017 Copyright: Sun et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT ETV6/RUNX1 (E/R) is the most common fusion gene in childhood acute lymphoblastic leukemia (ALL). Multiple lines of evidence imply a “two-hit” model for the molecular pathogenesis of E/R-positive ALL, whereby E/R rearrangement is followed by a series of secondary mutations that trigger overt leukemia. The cellular framework in which E/R arises and the maintenance of a pre-leukemic condition by E/R are fundamental to the mechanism that underlies leukemogenesis. Accordingly, a variety of studies have focused on the relationship between the clones giving rise to the primary and recurrent E/R-positive ALL. We review here the most recent insights into the pathogenic mechanisms underlying E/R-positive ALL, as well as the molecular abnormalities prevailing at relapse. -
Genetic Analysis of Over One Million People Identifies 535 New Loci Associated with Blood 2 Pressure Traits
1 Genetic analysis of over one million people identifies 535 new loci associated with blood 2 pressure traits. 3 4 Table of Contents 5 SUPPLEMENTARY TABLES LEGENDS……………………………………………………………………………….…….3 6 SUPPLEMENTARY FIGURES LEGENDS ........................................................................................ 6 7 SUPPLEMENTARY METHODS ................................................................................................... 10 8 1. UK Biobank data .................................................................................................................................... 10 9 2. UKB Quality Control ............................................................................................................................... 10 10 3. Phenotypic data ..................................................................................................................................... 11 11 4. UKB analysis ........................................................................................................................................... 11 12 5. Genomic inflation and confounding ....................................................................................................... 12 13 6. International Consortium for Blood Pressure (ICBP) GWAS .................................................................... 12 14 7. Meta-analyses of discovery datasets ..................................................................................................... 13 15 8. Linkage Disequilibrium calculations ...................................................................................................... -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol . -
Characterisation of the Genomic Landscape of CRLF2‐Rearranged Acute Lymphoblastic Leukemia
Characterisation of the Genomic Landscape of CRLF2- rearranged Acute Lymphoblastic Leukemia Lisa J Russell1*, Lisa Jones1, Amir Enshaei1, Stefano Tonin1, Sarra L Ryan1, Jeyanthy Eswaran1 , Sirintra Nakjang2, Elli Papaemmanuil3,4, Jose M C Tubio4, Adele K Fielding5, Ajay Vora6, Peter J Campbell4, Anthony V Moorman1, and Christine J Harrison1 1 Leukaemia Research Cytogenetics Group, Northern Institute for Cancer Research, Newcastle University, Newcastle-upon-Tyne, UK 2 Bioinformatics Support Unit, Newcastle University, Newcastle-upon-Tyne, UK 3 Memorial Sloan Kettering Cancer Center, USA 4 Cancer Genome Project, Wellcome Trust Sanger Institute, Hinxton, UK 5 Research Department of Haemaoloty, UCL Cancer Institute, London, UK 6 Department of Haematology, Sheffield Children’s Hospital, Sheffield, UK; AVM and CJH contributed equally to this study Running Title – Genomic landscape of CRLF2 rearranged leukemia Correspondence to: Dr Lisa J Russell, Wolfson Childhood Cancer Research Centre, Northern Institute for Cancer Research, Newcastle University, Level 6, Herschel Building, Brewery Lane, Newcastle upon Tyne, NE1 7RU, [email protected]. Acknowledgements Support by: The Kay Kendall Leukaemia Fund, Leuka, European Haematology Association and Bloodwise (formerly Leukaemia and Lymphoma Research) This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1002/gcc.22439 This article is protected by copyright. All rights reserved. Genes, Chromosomes & Cancer Page 2 of 147 Deregulated expression of the type I cytokine receptor, CRLF2, is observed in 5-15% of precursor B-cell acute lymphoblastic leukaemia (B-ALL). -
SZDB: a Database for Schizophrenia Genetic Research
Schizophrenia Bulletin vol. 43 no. 2 pp. 459–471, 2017 doi:10.1093/schbul/sbw102 Advance Access publication July 22, 2016 SZDB: A Database for Schizophrenia Genetic Research Yong Wu1,2, Yong-Gang Yao1–4, and Xiong-Jian Luo*,1,2,4 1Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Kunming, China; 2Kunming College of Life Science, University of Chinese Academy of Sciences, Kunming, China; 3CAS Center for Excellence in Brain Science and Intelligence Technology, Chinese Academy of Sciences, Shanghai, China 4YGY and XJL are co-corresponding authors who jointly directed this work. *To whom correspondence should be addressed; Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China; tel: +86-871-68125413, fax: +86-871-68125413, e-mail: [email protected] Schizophrenia (SZ) is a debilitating brain disorder with a Introduction complex genetic architecture. Genetic studies, especially Schizophrenia (SZ) is a severe mental disorder charac- recent genome-wide association studies (GWAS), have terized by abnormal perceptions, incoherent or illogi- identified multiple variants (loci) conferring risk to SZ. cal thoughts, and disorganized speech and behavior. It However, how to efficiently extract meaningful biological affects approximately 0.5%–1% of the world populations1 information from bulk genetic findings of SZ remains a and is one of the leading causes of disability worldwide.2–4 major challenge. There is a pressing -
Increased Expression of Fragmented Trna Promoted Neuronal Necrosis ✉ ✉ Yanyan Cao1,2, Kai Liu3, Ying Xiong1, Chunyue Zhao4 and Lei Liu1
www.nature.com/cddis ARTICLE OPEN Increased expression of fragmented tRNA promoted neuronal necrosis ✉ ✉ Yanyan Cao1,2, Kai Liu3, Ying Xiong1, Chunyue Zhao4 and Lei Liu1 © The Author(s) 2021 Neuronal necrosis induced by excessive glutamate release is well known to contribute morbidity and mortality in ischemic stroke. Over the past decades, strategies on targeting glutamate receptor did not achieve desirable clinical outcomes. Finding the downstream mechanism of the glutamate receptor activation may provide new targets to suppress the cell death. Previously, our study demonstrated that the increase of H3K4 trimethylation (H3K4me3) played a key detrimental role on neuronal necrosis; however, the mechanism of this histone modification is unclear. Through a genome-wide small RNA sequencing, we identified several tRNA-derived fragments (tRFs) and piwi-interacting RNA (piRNAs) species were enriched in glutamate-induced neuronal necrosis in rat primary neuron cultures, and this enrichment was dependent on the H3K4me3 increase. Strikingly, when we transfected several synthesized tRFs and piRNA species into neurons, the tRFs but not the piRNAs induced neuron swelling and death. The cell death morphology recapitulated neuronal necrosis induced by glutamate. For the cytotoxic effect of tRFs, our data suggested that protein synthesis was inhibited likely through induction of ribosomal stalling. By proteomic analysis of tRFs effect, the most affected pathway was enriched in the mitochondrial metabolism. Consistently, mitochondrial fragmentation was increased in neuronal necrosis, and suppression of mitochondrial fission by genetic manipulation or drug rescued neuronal necrosis. Using our previously established Drosophila model of neuronal necrosis, we found that inhibition of small RNA transcription, blocking RNA transport from nucleus to cytosol, or knocking down Ago1/2 to suppress the RNA interference effect, all rescued the fly death, suggesting transcription and processing of small RNAs contribute to neuronal necrosis. -
The Clinical Utility of Optical Genome Mapping for the Assessment of Genomic Aberrations in Acute Lymphoblastic Leukemia
cancers Article The Clinical Utility of Optical Genome Mapping for the Assessment of Genomic Aberrations in Acute Lymphoblastic Leukemia Jonathan Lukas Lühmann 1,† , Marie Stelter 1,†, Marie Wolter 1, Josephine Kater 1, Jana Lentes 1, Anke Katharina Bergmann 1, Maximilian Schieck 1 , Gudrun Göhring 1, Anja Möricke 2, Gunnar Cario 2, Markéta Žaliová 3 , Martin Schrappe 2, Brigitte Schlegelberger 1, Martin Stanulla 4 and Doris Steinemann 1,* 1 Department of Human Genetics, Hannover Medical School, 30625 Hannover, Germany; [email protected] (J.L.L.); [email protected] (M.S.); [email protected] (M.W.); [email protected] (J.K.); [email protected] (J.L.); [email protected] (A.K.B.); [email protected] (M.S.); [email protected] (G.G.); [email protected] (B.S.) 2 Department of Pediatrics I, ALL-BFM Study Group, Christian-Albrechts University Kiel and University Medical Center Schleswig-Holstein, 24105 Kiel, Germany; [email protected] (A.M.); [email protected] (G.C.); [email protected] (M.S.) 3 Department of Paediatric Haematology and Oncology, 2nd Faculty of Medicine, Charles University and University Hospital Motol, CZ-15006 Prague, Czech Republic; [email protected] 4 Pediatric Hematology and Oncology, Hannover Medical School, 30625 Hannover, Germany; [email protected] * Correspondence: [email protected] † These authors equally contributed to this work. Citation: Lühmann, J.L.; Stelter, M.; Wolter, M.; Kater, J.; Lentes, J.; Bergmann, A.K.; Schieck, M.; Simple Summary: The stratification of childhood ALL is currently based on various diagnostic Göhring, G.; Möricke, A.; Cario, G.; assays. -
Maintenance of Mammary Epithelial Phenotype by Transcription Factor Runx1 Through Mitotic Gene Bookmarking Joshua Rose University of Vermont
University of Vermont ScholarWorks @ UVM Graduate College Dissertations and Theses Dissertations and Theses 2019 Maintenance Of Mammary Epithelial Phenotype By Transcription Factor Runx1 Through Mitotic Gene Bookmarking Joshua Rose University of Vermont Follow this and additional works at: https://scholarworks.uvm.edu/graddis Part of the Biochemistry Commons, and the Genetics and Genomics Commons Recommended Citation Rose, Joshua, "Maintenance Of Mammary Epithelial Phenotype By Transcription Factor Runx1 Through Mitotic Gene Bookmarking" (2019). Graduate College Dissertations and Theses. 998. https://scholarworks.uvm.edu/graddis/998 This Thesis is brought to you for free and open access by the Dissertations and Theses at ScholarWorks @ UVM. It has been accepted for inclusion in Graduate College Dissertations and Theses by an authorized administrator of ScholarWorks @ UVM. For more information, please contact [email protected]. MAINTENANCE OF MAMMARY EPITHELIAL PHENOTYPE BY TRANSCRIPTION FACTOR RUNX1 THROUGH MITOTIC GENE BOOKMARKING A Thesis Presented by Joshua Rose to The Faculty of the Graduate College of The University of Vermont In Partial Fulfillment of the Requirements for the Degree of Master of Science Specializing in Cellular, Molecular, and Biomedical Sciences January, 2019 Defense Date: November 12, 2018 Thesis Examination Committee: Sayyed Kaleem Zaidi, Ph.D., Advisor Gary Stein, Ph.D., Advisor Seth Frietze, Ph.D., Chairperson Janet Stein, Ph.D. Jonathan Gordon, Ph.D. Cynthia J. Forehand, Ph.D. Dean of the Graduate College ABSTRACT Breast cancer arises from a series of acquired mutations that disrupt normal mammary epithelial homeostasis and create multi-potent cancer stem cells that can differentiate into clinically distinct breast cancer subtypes. Despite improved therapies and advances in early detection, breast cancer remains the leading diagnosed cancer in women. -
Identification of Proteins Involved in the Maintenance of Genome Stability
Identification of Proteins Involved in the Maintenance of Genome Stability by Edith Hang Yu Cheng A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Biochemistry University of Toronto ©Copyright by Edith Cheng2015 Identification of Proteins Involved in the Maintenance of Genome Stability Edith Cheng Doctor of Philosophy Department of Biochemistry University of Toronto 2015 Abstract Aberrant changes to the genome structure underlie numerous human diseases such as cancers. The functional characterization ofgenesand proteins that maintain chromosome stability will be important in understanding disease etiology and developing therapeutics. I took a multi-faceted approach to identify and characterize genes involved in the maintenance of genome stability. As biological pathways involved in genome maintenance are highly conserved in evolution, results from model organisms can greatly facilitate functional discovery in humans. In S. cerevisiae, I identified 47 essential gene depletions with elevated levels of spontaneous DNA damage foci and 92 depletions that caused elevated levels of chromosome rearrangements. Of these, a core subset of 15 DNA replication genes demonstrated both phenotypes when depleted. Analysis of rearrangement breakpoints revealed enrichment at yeast fragile sites, Ty retrotransposons, early origins of replication and replication termination sites. Together, thishighlighted the integral role of DNA replicationin genome maintenance. In light of my findings in S. cerevisiae, I identified a list of 153 human proteins that interact with the nascentDNA at replication forks, using a DNA pull down strategy (iPOND) in human cell lines. As a complementary approach for identifying human proteins involved in genome ii maintenance, I usedthe BioID techniqueto discernin vivo proteins proximal to the human BLM- TOP3A-RMI1-RMI2 genome stability complex, which has an emerging role in DNA replication progression. -
TERRA Transcription Destabilizes Telomere Integrity to Initiate Break
ARTICLE https://doi.org/10.1038/s41467-021-24097-6 OPEN TERRA transcription destabilizes telomere integrity to initiate break-induced replication in human ALT cells ✉ Bruno Silva 1,4, Rajika Arora 1,3,4, Silvia Bione 2 & Claus M. Azzalin 1 Alternative Lengthening of Telomeres (ALT) is a Break-Induced Replication (BIR)-based mechanism elongating telomeres in a subset of human cancer cells. While the notion that 1234567890():,; spontaneous DNA damage at telomeres is required to initiate ALT, the molecular triggers of this physiological telomere instability are largely unknown. We previously proposed that the telomeric long noncoding RNA TERRA may represent one such trigger; however, given the lack of tools to suppress TERRA transcription in cells, our hypothesis remained speculative. We have developed Transcription Activator-Like Effectors able to rapidly inhibit TERRA transcription from multiple chromosome ends in an ALT cell line. TERRA transcription inhi- bition decreases marks of DNA replication stress and DNA damage at telomeres and impairs ALT activity and telomere length maintenance. We conclude that TERRA transcription actively destabilizes telomere integrity in ALT cells, thereby triggering BIR and promoting telomere elongation. Our data point to TERRA transcription manipulation as a potentially useful target for therapy. 1 Instituto de Medicina Molecular João Lobo Antunes (iMM), Faculdade de Medicina da Universidade de Lisboa, Lisbon, Portugal. 2 Computational Biology Unit, Institute of Molecular Genetics Luigi Luca Cavalli-Sforza,