sign in sign up
<<
Home , David Relman, Gut microbiota, Human microbiome, Human microbiome project, Stanley Falkow

Developed by the Federation of American Societies for Experimental (FASEB) to educate the general public about the benefits of fundamental biomedical research.

INSIDEthis issue The : Your Own Personal

Animalcules 1 Germs 1 Cultural Variety 2 A Microbial Menagerie 3 A Blank Canvas 4 Bug 5 From Battlefield to Ecosystem 5 The Great Plate Count Anomaly and its Resolution 7 Unexpected Variety 8 Weighty Effects 9 The Project 10 A Microbiome Success Story 12 A New Frontier 12 Acknowledgments The Human Microbiome: Your Own Personal Ecosystem

Author, Jacqueline Jaeger Houtman, PhD Scientific Advisor, Sarah K. Highlander, PhD, J. Institute Scientific Reviewer, Karen Guillemin, PhD, University of Oregon

BREAKTHROUGHS IN BIOSCIENCE COMMITTEE Paula H. Stern, PhD, Chair, Northwestern University Feinberg School of Medicine Aditi Bhargava, PhD, University of California San Francisco David L. Brautigan, PhD, University of Virginia School of Medicine Blanche Capel, PhD, Duke University Medical Center Rao L. Divi, PhD, National Institute, National Institutes of Health Marnie Halpern, PhD, Carnegie Institution for Science Tony E. Hugli, PhD, Torrey Pines Institute for Molecular Studies Edward R. B. McCabe, MD, PhD, March of Dimes Foundation Loraine Oman-Ganes, MD, FRCP(C), CCMG, FACMG, Sun Life Financial Sharma S. Prabhakar, MD, MBA, FACP, Texas Tech University Health Sciences Center COVER: In 1964 wrote: “Our recent studies have revealed that there exists in normal animals an R. Brooks Robey, MD, FASN, FAHA, White River Junction VA abundant and characteristic microflora, not only in the Medical Center and Geisel School of Medicine at Dartmouth , but also in all the other parts of the digestive tract, including the mouth, the stomach and Scott I. Simon, PhD, University of California Davis the . These should not be regarded merely as contaminants. Rather, they become so intimately associated with the various digestive organs BREAKTHROUGHS IN BIOSCIENCE that they form with them a well-defined ecosystem of PRODUCTION STAFF which each component is influenced by the others, and by the environmental conditions.” Dubos’s observations Managing Editor, Anne M. Deschamps, PhD, Senior Science as well as discoveries from other scientific disciplines Policy Analyst, FASEB Office of Public Affairs and advances in scientific technologies have allowed scientists to begin exploring the effects of our personal Production Staff, Lawrence Green, Communications Manager, ecosystem on health and . FASEB Office of Public Affairs Cover illustration: © Michael Linkinhoker, Link Studio, LLC The Human Microbiome: ECOSYSTEMYour Own Personal Ecosystem

We are not alone. For each of the ten than-perfect , where he at the time infectious were trillion human cells in our bodies, found “an unbelievably great company thought to be caused by poisonous there are ten microbial cells living in of living animalcules, a-swimming vapors, the influence of heavenly and on us. Our own cells encode about more nimbly than any I had ever seen bodies, and bad smells. 20,000 , but the sum total of up to this time.” He even described genes in our body is close to a billion. what seems to have been the intestinal Germs The vast majority of these are the Giardia lamblia from his Two centuries later, in France, Louis genes carried by microbes. own during a bout of . Pasteur studied the organisms that For more than three hundred Leeuwenhoek reported in great depth ferment wine and beer (beneficial years, scientists have observed, on his findings with a sense of wonder organisms, to be sure). He determined that the “wrong” organisms could spoil identified, and implicated individual and curiosity. He made no connection the beverage. This led him to the idea microorganisms in specific diseases. between microbes and disease, since More recently, with a convergence that specific microbes could cause of scientific disciplines, an explosion diseases in . The germ theory of in technical capabilities and disease was further expanded by Robert revolutionary new ways of thinking, Koch, who was responsible for several we are exploring the organisms technical and conceptual innovations with which we share our bodies. that would make the modern science of The effects of these organisms—our possible. microbiome—on our health are only At the time, microbiologists grew just being recognized. in liquids such as meat broths. If more than one kind of organism Animalcules grew in the liquid, it was impossible The first person to observe to separate them. Koch, however, microorganisms associated with developed a way to obtain pure the human body was Antonie van cultures. At first, he used the surface Leeuwenhoek, a Dutch merchant in of sliced potatoes. Each of the small the seventeenth century. Although raised bumps that grew on the potato he did not invent the microscope, Figure 1 – Animalcules: surface was a colony of bacteria he was the first to construct devices Leeuwenhoek had boundless curiosity derived from a single organism. Koch with enough magnification and clarity and “whenever I found out anything began looking for a more suitable solid to see life forms as tiny as bacteria. remarkable, I have thought it my on which to grow bacteria. Initially, duty to put down my discovery on He described and drew pictures of paper, so that all ingenious people the best solution seemed to be gelatin, what he saw, including organisms might be informed thereof.” He used an animal protein, but it was not from the cleft in between his teeth his microscope to look at bacteria, without problems. For one thing, many and gum, where he observed “many protozoans, nematodes, sperm cells, bacteria consume gelatin, and those very little living animalcules, very blood cells, muscle fibers, , algae, that caused disease in humans grew fleas, bees, aphids, diatoms, prettily a-moving.” Not content with crystals, and fossils. best at human body temperature—the looking at the stuff in his own mouth, Image credit: © Ann Ronan Picture point at which gelatin melts. Even on he searched out family members and Library/Heritage Images/Imagestate very warm days, gelatin would turn neighbors, especially those with less- from solid to liquid.

1 Figure 2 – Robert Koch: Often Figure 3 – Angelina and Walther Hesse: Angelina helped Walther in the referred to as the founder of modern Koch laboratory as a technician. She also illustrated many of his publications. The bacteriology, Robert Koch developed agar she used in her jellies became the basis for the agar plates used in modern new ways of studying bacteria and microbiology laboratories. infectious diseases. He was awarded Image credit: National Library of Medicine the 1905 Nobel Prize in Physiology or Medicine “for his investigations and discoveries in relation to tuberculosis.” Important as these technical Christian Gram introduced a stain Image credit: Science Photo Library innovations were, Koch’s conceptual that made bacteria easier to see under contribution was perhaps the most the microscope. It also turned some Walther Hesse, a scientist in Koch’s influential. Koch’s postulates were bacteria purple and some pink. This first lab, told his wife, Angelina, about the formulated to determine the microbial differential stain, based on structural gelatin problem. Angelina knew that cause of infectious disease. Using differences of the , is still used to her fruit jellies stayed solid throughout these rules, scientists could be sure the summer heat because she used that the organism in question was the agar-agar. First used in Japan in the perpetrator of pathogenesis and not 1600s, agar-agar (or agar) is derived just an innocent bystander. from seaweed and is sometimes used In 1876, Koch was the first to today as a vegetarian substitute for associate a particular disease, anthrax, gelatin. Unlike the protein gelatin, with a specific organism, agar is a that is not anthracis. He also discovered the generally used by bacteria as food, microbial causes of tuberculosis and and it stays solid at temperatures used cholera. In the next thirty years, the to grow the cultures. bacteria that cause more than a dozen Staples in the modern microbiology diseases, from to dysentery lab, agar and the Petri dish (invented to whooping cough, were identified. Figure 4 – Petri dish with agar by Julius Petri in the Koch lab) made For a century, Koch’s postulates were and bacterial colonies: Using materials the gold standard for determining the and techniques first developed in Robert it easy to isolate and grow pure Koch’s lab, isolated colonies can be cause of infectious disease. cultures of bacteria descended from produced by diluting a culture in liquid a single cell. By diluting a liquid medium or on the plate itself until the culture, and then spreading it on Cultural Variety sample is dilute enough to separate individual cells, each of which grows agar in Petri dishes, bacteriologists At first, scientists could only tell one into a colony. could count the colonies and calculate kind of bacterium from another by Image credit: Alina Cardiae how many bacteria were in the their shape and ability to move around. Photography/Shutterstock original culture. In 1884, Danish bacteriologist Hans

Breakthroughs in Bioscience 2 A GRAM-POSITIVE BACTERIA B GRAM-NEGATIVE BACTERIA KOCH’S POSTULATES (i.e., ) (i.e., coli)

1. The must be present in all cases of the disease.

2. The disease-causing organism (pathogen) can be isolated from the diseased and grown in pure culture.

3. The pathogen from the pure culture must cause the Cell wall – layer (retains crystal violet dye) disease when inoculated

into a healthy, susceptible Cell wall Outer plasma laboratory animal. (crystal violet membrane dye is washed Peptidoglycan 4. The pathogen must be away) layer re-isolated from the new Inner plasma membrane host and shown to be (Lipid bilayer) the same as the originally inoculated organism.

classify bacteria—as either Gram-positive or Gram-negative. Today, there are many different stains that can help further identify and differentiate microbes. Soil microbiologists were the first to use functional properties of bacteria to select for specific strains. Using Microscopic view of Gram-positive bacteria Microscopic view of Gram-negative bacteria agar that contained no nitrogen, they were able to selectively grow Figure 5 – Gram-positive and Gram-negative: Because of the thickness and bacteria that could obtain nitrogen composition of their cell wall, Gram-positive bacteria retain the crystal violet stain. solely from the air. Taking a clue Gram-positive bacteria include Staphylococcus, , and . from soil microbiologists, medical Gram-negative bacteria do not retain crystal violet, so the stain is rinsed away, microbiologists were able to identify and, after counterstaining, the organisms appear pink under the microscope. Examples of gram-negative bacteria include E. coli, Salmonella, and the organisms and study bacteria based on their that cause cholera and gonorrhea. metabolic functions, such as which Illustration: © Michael Linkinhoker, Link Studio, LLC. nutrients they can utilize or which metabolic products they excrete. Some culture media contain indicators to be amputated. Microbiologists A Microbial that change color according to pH could identify bacteria in the wounds and can thereby identify organisms with microscopes, but they couldn’t Menagerie that produce acidic products. Others cultivate the organism in the lab, no As new culture media and techniques contain chemicals that specifically matter which special nutrients they were developed, more disease-causing inhibit or enhance growth of used. The organisms that cause gas microorganisms were discovered, particular organisms. gangrene, , identified, and studied. When The onset of World War I brought are anaerobes, which only grow in the microbiologists turned their attention bacteriology to the battlefield. Soldiers absence of oxygen. Paul Fildes and to the healthy human body, they found wounded in the trenches often James McIntosh solved the problem by a zoo of organisms on just about every developed gangrene, which killed inventing a device that could create an surface, inside and out--in the nostrils tissue and sometimes required limbs oxygen-free environment. and lungs, the vagina, and even on the

3 surface of the eye. The skin, depending on the site, has between 100 and 10,000 organisms per square centimeter. The richest populations of microbes occur in the , from the mouth to the anus. Saliva contains ten million organisms per milliliter. The colon contains the largest population of organisms, and about a third of the mass of feces is microbes (100 billion microbes per gram). This diverse menagerie consists mostly of bacteria, but it also includes fungi (especially ), protozoans, , and organisms from the kingdom we now call . Archaea look like bacteria, but genetic analyses have Figure 6 – Gnotobiotic room: Germ-free or gnotobiotic animals are raised in sterile enclosures and fed sterile food and water. They can only be handled by determined that they are as different investigators through the gloves attached to their enclosures. from bacteria as we are from trees. Image credit: National Institute of and Infectious Diseases/National Many of the organisms in the gut, Institutes of Health mouth, and vagina are anaerobes. The residents of the menagerie— be done by introducing specific, often called normal , A Blank Canvas known organisms or populations of or commensals—are not constant. Just as an agar plate must be sterile organisms to produce what is known Populations differ vastly between in order to study the organisms used as a “gnotobiotic” animal (from the individuals and over the course of an to inoculate it, studying the effects of Greek roots meaning known and life). individual’s life. While the grows microbes on the lives of those they They can even be colonized with in an essentially sterile environment, inhabit is best studied in an animal organisms from other animals, like infants are colonized quickly. Studies with no indigenous microbes. Building humans. Research with germ-free in experimental animals show that the on discoveries in soil science, Pasteur and gnotobiotic animal models has organisms in the gut change in number thought that the study of microbes in revealed the many beneficial functions and character after birth. In humans, a animals might benefit from the use of of our microbiome. similar story emerged through the study “pure” animals. A hen’s egg, he had of feces. The organisms associated suggested, could be hatched and raised Animals raised in the absence of any with babies delivered vaginally look in a sterile environment. sort of microbe are certainly viable, like those of the mother’s vagina, but Laboratory such as mice, but they develop quite abnormally. babies born by cesarean section are rats, and guinea pigs would require a The heart, lungs, and are smaller originally colonized by organisms from more complicated procedure, finally than those of conventionally raised the mother’s and the delivery nurses’ perfected in the 1950s. The animal is animals. The most noticeable changes skins. The of gut microbes also delivered surgically to avoid contact occur in the digestive tract. The part differ between breast-fed and formula- with the mother’s microbiome. It is of the intestine called the is fed babies. A child continues to acquire raised in a sterile environment and dramatically enlarged, and the new microbiota and by three years of supplied with sterile food structure of the intestinal lining is age possesses an adult-like assortment and water. Once a colony of germ-free altered, especially in places where of organisms. Even in adults, normal animals is established and maintained, microbes would normally be found microbiota can vary with diet, disease, they can reproduce naturally to in large numbers. medications, puberty, climate, produce germ-free offspring, occupation, and other factors. Scientists Animals grown without since there will be no microbes to suspected that the microbiota in and microorganisms require about 30% contaminate the newborns. on our bodies may have an impact on more calories than conventionally health and disease, and they developed The germ-free animal is a sort of grown animals to maintain their new techniques to figure it out. blank canvas. Further studies can weight. Studies in germ-free animals

Breakthroughs in Bioscience 4 have helped us understand the The medical consensus at the time importance of microbes in human was that and ulcers were nutrition. Nutrients that our own cells caused by too much acid—from stress cannot utilize are readily gobbled or spicy food, for example. Warren up by our gut microbes. Most and Marshall used Koch’s postulates complex and plant to investigate the possibility that , for example, cannot ulcers were caused by a bacterium be broken down by human . called . (See Gut microbes ferment these large Breakthroughs in Bioscience article, molecules into smaller molecules that “Helicobacter pylori and Ulcers: can be absorbed and used for energy A Paradigm Revisited”) H. pylori by human cells. In the process, they , in most cases, does not may produce gas; gut microbes are cause symptoms, while in some, it the main culprit in . Figure 7 – H. pylori: This distinctive, causes gastritis and ulcers. Marshall spiral-shaped bacterium is a major and Warren were awarded the Nobel Gut microbes also produce nutrients cause of chronic gastritis, peptic Prize in 2005 for their discovery that that we couldn’t get otherwise, such ulcers, and some types of stomach as B12 and , an cancer. Interestingly, it may also H. pylori infection was a major cause important blood-clotting factor. be protective for some types of of chronic gastritis, peptic ulcers, and gastrointestinal disease. some types of . This Microbes form a barrier between us Image credit: Steve Gschmeissner/ discovery increased our understanding and the outside world. The microbes Science Photo Library of the connection between chronic in our guts and on our skin and infection, , and cancer. mucous membranes colonize those Treatment of H. pylori infection with surfaces, preventing disease-causing there were transients that had been became the treatment of organisms from gaining a foothold by swallowed but did not stick around. choice for ulcers, and the incidence competing for nutrients and blocking Although German scientists had of stomach cancer fell. We have now attachment sites. They also secrete observed a spiral shaped organism in learned that H. pylori can be protective compounds that inhibit for some types of gastrointestinal the stomach in 1875, they were unable by altering the local environment disease including gastroesophageal to grow the organism in the lab, so (sometimes lowering pH, for example) reflux disease (GERD). or directly antagonizing pathogens. it was forgotten. However, in 1971, Australian pathologist Robin Warren A single organism in a sparsely Animals raised in a germ-free began examining tissue from patients populated part of the body presents environment are much more with stomach ulcers. He consistently a complicated picture if it can both susceptible to infectious disease than cause and prevent disease. What of found the distinctive S-shaped bacteria their conventionally raised cohorts for the situation farther downstream, and shared his findings with internist another reason: the is in the intestines, where the number Barry Marshall. dependent on the normal microbiota and diversity of microbes increases for its development. It is believed dramatically? The task of determining that the microbes normally found in what is protective and what is the gut educate the immune system pathogenic becomes even “…it would appear to be to attack microbial invaders that more complicated. a pointless and doubtful may cause disease, while tolerating beneficial microbes. exercise to examine and From Battlefield disentangle the apparently randomly appearing bacteria to Ecosystem Stomach Bug As a college student in France, in normal feces and the For many years, it was thought that René Dubos disliked chemistry and intestinal tract, a situation no microbes could survive the highly microbiology. A chance meeting that seems controlled by a acidic environment in the stomach. with onboard a thousand coincidences.” As recently as the 1990s, medical ship across the Atlantic in 1924, textbooks stated that there were no - Theodor Escherich, 1885 however, found himself in Waksman’s pathogens in the stomach and that the lab at Rutgers University studying only organisms that could be found the relationship between soil

5 MICROBIOME: AN ECOLOGICAL

The term “microbiome” was coined in 2001 by Nobel Prize-winning microbiologist , “to signify the ecological community of commensal, symbiotic, and pathogenic microorganisms that literally share our body space and have been all but ignored as determinants of health and disease.”

Lederberg used the language of ecologists. Those investigating the microbiome often use the tools developed by microbial ecologists to identify the organisms in and on us and to understand the relationships between them. The relationships can take several forms.

• : Any interaction between two or more .

• : Both species benefit and depend on each other for survival.

• : One species benefits, while the other is not affected.

Figure 8 – René Dubos: René Dubos • : One species benefits, while the other is harmed. studied the within us and around us. In his later years, Dubos • COMPETITION: One species deprives another of a resource was an outspoken environmentalist, (such as a nutrient). concerned with environmental • ANTIBIOSIS: One organism damages the other through a secretion (such influences on human health. He won as an ). a Pulitzer Prize for Nonfiction in 1969 for So Human an Animal: How We Are Within an ecological community such as the microbiome there are niches, Shaped by Surroundings and Events. each with its own inhabitants. The organisms that live behind your ear, for He coined the phrase “Think globally, example, are different from those between your toes. act locally.” Image credit: Rockefeller Archive Center microbes and their environment. microbiological paradigm. He studied be regarded merely as contaminants. After finishing his doctoral degree, the interactions of microorganisms Rather, they become so intimately another chance meeting brought with their environment and with each associated with the various digestive him to ’s lab at the other. In contrast to the warlike model organs that they form with them a Rockefeller Institute. Like so many associated with the germ theory, well-defined ecosystem of which each investigators before him (and many in which specific disease-causing component is influenced by the others, to follow), Dubos looked to the soil. microorganisms were “the enemy,” and by the environmental conditions.” He isolated several drugs from soil Dubos promoted a more complex Dubos believed that the true character bacteria, including the antibiotic model, calling the human digestive of microbes could not be discovered by gramicidin. His success encouraged tract an ecosystem. He changed the studying them in . Microbes others to investigate soil bacteria for conversation from Us Against Them to inhibit and enhance each others’ antibiotics. Selman Waksman was We’re All in This Together. growth. They communicate with each one of those investigators. Waksman In 1964 he wrote: “Our recent studies other and alter their environments. It discovered streptomycin and credited have revealed that there exists in was important, but complicated work. his former student Dubos, noting that normal animals an abundant and The ecosystem model emphasized the “to obtain the desired results required characteristic microflora, not only interactions between organisms, but an analytical mind, an original in the large intestine, but also in nobody knew what most of them were. coordination of all the facts, and all the other parts of the digestive How can you study an ecosystem if you especially a new philosophy.” tract, including the mouth, the don’t know what most of the organisms The most important contribution stomach and the small intestine. are? It would be like trying to study a of Dubos was a shift in the These microorganisms should not forest by just looking at the squirrels.

Breakthroughs in Bioscience 6 The Great Plate A Environmental sample of microbes Count Anomaly and its Resolution Although the concept of studying the microbiome as an ecosystem was groundbreaking, the technology did not exist at the time to make that study possible. One major hurdle was known as “The Great Plate Count Anomaly.” The number of bacteria in a sample (from a person or a lake, for example) counted directly under the B Genomic DNA removed from microscope did not match the number microbes in environmental sample of colonies that grew on agar plates. Scientists could see more microbes— C Microbial DNA sometimes a hundred times more— fragmented than they could cultivate in the lab. It seemed most microbes were “viable but not cultivable.” Since the only D Microbial DNA way to study them was to grow them sequenced machine in the lab, the majority of these microbes remained uncharacterized mystery organisms. It was unknown what else was out there—and in us. Once again, environmental microbiologists led the way. Vexed by the Great Plate Count Anomaly, they hypothesized that something E DNA sequences analyzed about the environment from which they obtained their samples was needed for the organisms to grow in the lab (just as anaerobic bacteria TT-GCTTGCGGGTGAGAGT GATGTGCCGGGCTCCTGCATG GTCCTATCAGCTTCGATGGCT from gangrenous wounds would only grow in an environment devoid of TT-GCTTGCGAGTGAGAGT GATGTGCTAGGCTCCTGCATG GTCCTTTCAGCTTCGAGATCA oxygen). They devised methods to cultivate microbes in conditions that TT-GCTTGCTGGTGAGAGT GATGCTCCATCACACCGCATG GACCTATCAGCTTCGACGGTT mimicked the natural environment using chambers that would allow nutrients and other molecules—but not other organisms—to diffuse into the culture. They also used “helper” organisms from the same F CLASSIFICATION OF MICROBES: community biodiversity, phylogeny, and function environment to provide needed growth factors. For example, bacteria need iron, but environmental iron Figure 9 – : A sample is taken (A) directly from the environment cannot get into the cell unless it is (such as soil, water, feces, or skin). DNA is extracted (B), broken into random fragments (C), sequenced (D), and analyzed (E) with the help of computers. Analysis bound to a bacterial product called a of specific genes, such as 16SrDNA, will reveal which organisms are present in . Some microbes cannot the sample and how they are related (phylogeny). Analysis of other genes and make their own and comparison to sequences of known genes can yield clues to their potential functions. must use siderophores produced by Illustration: © Michael Linkinhoker, Link Studio, LLC. other organisms to obtain their iron.

7 Finally, environmental microbiologists angiomatosis. Although investigators got past the cultivation problem by could see what looked like bacteria in skipping it altogether. They applied the lesions when they examined the sensitive DNA-based technologies tissue under the microscope, nobody to look directly at the genes. It was was able to cultivate any sort a culture-independent way to study of organism. complex bacterial communities. Falkow suggested to Relman that Metagenomics (also called community he try some molecular techniques , environmental genomics, to solve the problem, just as or population genomics) examines environmental microbiologists were the genes of a population of microbes doing at the time. Relman set to work as a whole, instead of individual finding a way to identify organisms organisms. DNA is obtained from that couldn’t be grown in the lab by microbial samples taken directly from looking for their genes. the environment without culturing Relman used the 16S rDNA technique them. The extracted DNA contains Figure 10 – Jo Handelsman: on diseased tissue and found a a mixture of genes from all the Jo Handelsman coined the phrase organisms in the sample. metagenomics, which she described sequence that was closely related to as “an analysis of a collection of the organism that causes cat scratch Specific genes can be analyzed using similar but not identical items.” disease. In the paper describing the polymerase chain reaction (PCR), Her pioneering work using experiment, he said, “We expect metagenomics and culture-based which makes millions of copies of that this approach will be applicable specific sections of DNA between microbial analyses resulted in the discovery of new antibiotics and to other infectious diseases with the short sections recognized by insights into antibiotic resistance. unclear causes and will expand our defined sequences called primers. Image courtesy of University of understanding of interactions between Environmental microbiologists Wisconsin-Madison humans and microbes.” used PCR to analyze 16S rDNA, the that encodes part of the In designing his experiment using protein-assembling ribosomes found metagenomics) is used to examine all this extremely sensitive technique, in all bacterial cells. This gene has the genes in a population. Random Relman was careful to choose tissues sections that are common to all genes in a sample taken directly that did not have a lot of other bacteria, as well as highly variable from the environment are analyzed organisms in them so that he could sections, that can be used to identify using automated high-throughput find the organism that was causing the individual organisms and to see technologies, which can quickly disease more easily. Then, he said, “it how closely related they are to each sequence vast numbers of genes. The became clear to me that what I was other. These investigators used 16S new sequences can be compared to considering the background problem rDNA sequencing to identify the the sequences of known genes to was actually an interesting topic unto diverse microbes that occurred in guess their function or can be inserted itself.” He began to look at parts the environment and found evidence into domesticated bacteria to find of the body that he knew contained for many more different kinds of out for sure. Because the number of numerous organisms. microbes than they were able to different genes that can be found in He started with the mouth. isolate or cultivate in the lab. an environmental sample is so huge, His own mouth. advanced computational techniques, The 16S rDNA sequences gave “I had this idea as I was getting called bioinformatics, are needed to microbiologists a lot of information ready to go to my dentist. I went into make sense of it all. about what types of organisms were work first, picked up some sterile present and how they were related, collection tubes, brought them with but it was only one gene. There were Unexpected Variety me to the dentist’s office, and asked literally millions of genes in the , a postdoctoral fellow him, as he was cleaning my teeth, uncultivable organisms, and we knew in ’s lab at Stanford in would he mind putting this stuff into nothing about them. the late 1980s early 1990s, studied a these tubes, instead of throwing it Another kind of metagenomics disease of the skin and lymph nodes out.” At the time, about 500 different (sometimes called “shotgun” of AIDS patients called bacillary organisms were known to inhabit

Breakthroughs in Bioscience 8 in the intestines was significantly ECOLOGICAL SUCCESSION greater than that of human cells alone. The authors described humans as Ecological succession is a phenomenon whereby ecosystems change over “superorganisms,” which use both time. Think of a forest growing back after a forest fire or a cornfield left host and microbe functions to obtain fallow for many years. The first plants to grow change the environment energy and nutrients from food, to (by producing shade or nutrients, for example) to make it more hospitable synthesize and amino acids, to different plants, which replace the original plants and change the and to break down drugs and toxins. environment so it is no longer hospitable to the earlier species. A similar process can happen within the human body. In the mouth, both Weighty Effects beneficial and pathogenic organisms can be found, but the beneficial Even without knowing exactly what bacteria help to keep the environment at a steady, neutral pH. Colonizing organisms are in the microbiome, bacteria adhere to the tooth surface, where they are exposed to evidence continues to mount that from food. They metabolize the sugar and produce acid, lowering the pH they have profound effects on health. at the tooth surface. Reduced flow of saliva can enhance the process. The acidic environment inhibits beneficial bacteria and promotes the growth Jeffrey Gordon and colleagues at of cavity-forming bacteria, which produce more acid. More sugar acidifies Washington University in St. Louis the environment even more, favoring cavity-forming bacteria and removing studied the effect of gut microbes on minerals from the , eventually breaking down the structure of . In one set of experiments, the tooth and forming a cavity. they transplanted gut microbes from mice with genetic or dietary obesity into germ-free mice. The recipients gained more weight (and fat) than germ-free mice that received gut microbes from lean mice. Another study by Gordon’s group transplanted gut microbes from humans into germ-free mice. Gut microbes from four sets of , each pair with one lean and one obese , were transplanted directly (without any attempt to cultivate them). The mice that received microbes from the obese twins got fat, and those that Figure 11 – Bacteria on tooth surface were colonized with microbes from Image credit: Thierry Berrod, Mona Lisa Production/Science Photo Library the lean twin did not, but only when they were housed separately. When they were housed together, the mice transplanted with obese microbes the gum pocket, some harmless, and in addition to H. pylori, over one acquired microbes from the lean mice some that can cause diseases such hundred new types of bacteria living and all the mice remained lean. as dental cavities, gingivitis, and there. This led to a study of the More studies followed, many with . Relman and his lower gastrointestinal tract, home intriguing results, but one question colleagues compared the results of the to trillions of microorganisms, the remained unanswered. What is a 16S rDNA analysis with traditional vast majority of them uncultivated culture techniques. The molecular healthy microbiome? The variations and unstudied. In a study directed by between individuals, laboratories, technique revealed a more diverse Karen Nelson of the J. Craig Venter techniques, and protocols made it population than the culture technique, Institute, the fecal DNA from two difficult to sort out. To what extent are with many types never before healthy adults was sequenced by the differences biologically relevant— observed in humans. the 16S rDNA and metagenomic associated with health or disease— Relman then turned his attention to methods. This study revealed that the or natural variation? A systemic the stomach, where he discovered, metabolic potential of the microbes way to answer the question would

9 A LEAN HUMAN twin When HOUSED SEPARATELY, study beginning in 2007, coordinated gut microbes are… …transplanted into MICE REMAINED LEAN. the work of over 200 researchers germ-free mice. in 80 institutions. The study was designed to compare the at multiple body sites over a large number of people and to look at changes in individual microbiomes OBESE HUMAN twin over time. Standardized procedures gut microbes are… …transplanted into When HOUSED SEPARATELY, were created to minimize sampling germ-free mice. MICE GAINED FAT. differences between laboratories. The goal was to construct a reference database of sequences for the genes of all the organisms in the samples, both the cultivable and the (much more numerous) uncultivable microbes. The study, funded by the NIH, recruited 300 subjects (149 men and B When HOUSED TOGETHER, BOTH MICE REMAINED LEAN. 151 women), age 18 to 40. Since the purpose of the study was to find out what constitutes a healthy microbiome, people with certain medical conditions were excluded from the study. To minimize the effects of external factors, participants were instructed to refrain from using certain medications and Figure 12 – Lean/obese twin study: On the same diet, germ-free mice were given a kit of personal care transplanted with gut microbes from an obese twin gain fat, while those given products to use for a period before the microbes from a lean twin do not. When the mice are housed together, the mice study. The investigators asked subjects with the microbes from the obese twin acquire the microbes from the with the lean microbes and do not gain fat. numerous questions about their medical Illustration: © Michael Linkinhoker, Link Studio, LLC. history, family situation, diet, lifestyle, occupation, and so on. Samples were taken from four sites on be a huge undertaking and would other —the human microbial the skin (behind each ear and inside require a coordinated effort from genome—would require an even each elbow), six sites on the soft tissue many researchers. larger effort. inside the mouth, the teeth above and As is often the case, technological below the gumline, the nostrils and, The Human advances allow us to ask new from women, three sites in the vagina. Microbiome Project questions in ways that were not Subjects also provided saliva and stool In 2003, the first complete human possible a decade ago. The Human samples. Some subjects gave samples genome was published and hailed as took thirteen years, two or three times over the course a milestone of scientific discovery. cost about three billion dollars, and of the study to see if (and how) the (See the Breakthroughs in Bioscience required the cooperation of many organisms changed over time. universities and other research article, “Individualized Medicine: Once the difficult work of collecting institutions in the U.S., United Genetically Fine-Tuning Prevention, samples and subject information Kingdom, France, Germany, Japan, Diagnosis, and Treatment of Disease”) was accomplished, there was even and China. In 2014, the same number On the heels of the more complex work: processing of genes could be sequenced in Project, funded by the National and sequencing the samples. To days, at a cost of about $1,000, in Institutes of Health (NIH) and the identify and classify the organisms, a single lab. Department of Energy, scientists investigators used the 16S rDNA recognized that the human genes were The first phase of the Human method. Metagenomic analysis only part of the story. To fill in the Microbiome Project (HMP), a five-year was used to determine the potential

Breakthroughs in Bioscience 10 THE MICROBIOME IN HEALTH AND DISEASE

Every day it seems the news is full of stories of a new association between the microbiome and some disease or condition. The microbiome likely does affect many aspects of our health, but the complexities will take years to untangle. Research continues on potential diagnostic or therapeutic aspects of the microbiome.

Asthma and Obesity and Crohn’s disease and Gastrointestinal Psoriasis and Rheumatoid arthritis Muscular dystrophy Fibromyalgia Multiple sclerosis Depression

functions of the genes in the microbial Figure 13 – Organisms in parts of the body: Microbes can be found anywhere community. The end result was a the body has contact with the environment, including the digestive tract from mountain of data that required serious mouth to anus, and the vagina. The composition of microbes in different parts of the body can vary widely. Each person’s microbiome is different and can change computer power and new kinds with diet, illness, medication, geography, and age. of bioinformatics. Image credit: Daryl Leja/National Human Genome Research Institute; Reprinted with permission from the Annual Review of Genomics and Human Genetics, On June 13, 2012, NIH director Volume 13 © 2012 by Annual Reviews, http://www.annualreviews.org announced the completion of a reference database constructed from 5,000 samples. They identified at least 10,000 distinct they do is more important than what Project, research continues on the microorganisms and eight million they are. If a microbiome is disrupted effects of the microbiome on human microbial genes—360 times as many (by antibiotics, for example) it could health, especially in the gut, which microbial genes as human genes. eventually move back to a healthy has strong connections to the immune state, but perhaps not with the The main finding was that there are system, the nervous system, and other identical microbial species. many different microbiomes that are aspects of health and disease. The considered healthy. The individual Knowing what is “normal” and being potential uses of the data generated by genetic signatures of the microbiomes able to diagnose or treat a condition or the have vary widely between individuals. disease based on microbiota are two yet to be fully realized, but it is clear Metabolic function is more important very different things. Using the data that it will be a valuable resource for than microbial composition; what generated by the Human Microbiome future research.

11 A Microbiome soup.” In the seventeenth century, A New Frontier Fabricius Aquapedente performed We now think about the organisms Success Story a similar procedure on cows. In that share our bodies not as invaders, In 2008, a 64-year-old woman came to 1958, Dr. Ben Eiseman and his team but as integral parts of ourselves. Dr. Alexander Khoruts desperate for used a fecal enema to treat a case of Using new technologies and borrowing help. She had taken antibiotics after pseudomembranous colitis—a severe some surgery and to treat a case of strategies from other disciplines, manifestation of C. diff infection with pneumonia. As a result, she developed we are learning what constitutes a a 75% mortality rate. The patient an infection with the bacterium healthy microbiome and starting to walked out the door of the hospital a Clostridium difficile. Despite treatment see how changes in our personal few days later. with multiple courses of antibiotics, ecosystems can affect our health. New her condition worsened. Suffering from It had been assumed that this type of discoveries, built upon knowledge severe diarrhea, she had lost 60 pounds treatment, also called fecal microbiota from seemingly unrelated research, in eight months. transplantation (FMT), restores the gut may lead to new treatments for a ecosystem to a normal state, but Khoruts variety of disorders. Since Dubos and C. difficile (or C. diff) are wanted to find out. He took a sample of Waksman isolated antibiotics from soil a growing problem, especially in bacteria, more than 50,000 products hospitals and long-term care facilities. the patient’s before the of environmental microorganisms The U.S. Centers for Disease Control procedure and found a much less diverse have been identified. The human and Prevention (CDC) reports that the population with many unusual species. microbiome has enormous potential number of cases has tripled in the last After using an endoscope to introduce as a source of novel drugs. New decade, to 250,000 cases (and 14,000 a preparation of the husband’s gut technologies are allowing scientists to deaths) per year. C. diff infections often microbiota, he tested again. This time isolate products of organisms in the occur after antibiotics have disrupted the profile looked more like that of her environment and in ourselves without the gut microbiome, as was the case healthy husband. cultivating them in the laboratory. with Khoruts’s patient. Treating with As distasteful as the thought of In addition, a more thorough more antibiotics to kill the C. diff may administering to a understanding of the organisms work, but its spores survive and the patient might be, the results have and their growth requirements will infection recurs. been astounding. In hundreds of expand our knowledge of basic Dr. Khoruts treated the patient with subsequent cases of C. diff, fecal biological processes. David Relman more antibiotics, with no success. He transplants have achieved over 90% once said, “one of the most important then decided to try a different strategy. cure rates. The technique is being ecosystems on the planet might be the Instead of killing more of the gut refined to be more precise, more human body.” Our exploration of that microbes with antibiotics, he would try convenient, and less pungent. ecosystem is just beginning. to restore a normal complement of gut • microbiota. For that, he turned to the patient’s husband, or more specifically ADDITIONAL SUGGESTED READING to his feces, which were homogenized and reintroduced into the patient. Her NIH HMP site http://commonfund.nih.gov/hmp/programhighlights diarrhea stopped within a day. Scientific American Magazine June 2012 Issue “Your Inner Ecosystem” There was one small drawback. As The New Yorker October 22, 2012 “Germs Are Us” by Michael Specter Khoruts described it, “The olfactory (http://www.newyorker.com/magazine/2012/10/22/germs-are-us) potency of human fecal material The New York Times May 15, 2013 “Some of My Best Friends are Germs” revealed at the touch of a button on the by Michael Pollan (http://www.nytimes.com/2013/05/19/magazine/ blender can be quite shocking—it can say-hello-to-the-100-trillion-bacteria-that-make-up-your-microbiome. empty waiting rooms.” html?pagewanted=all&_r=0) http://www.actionbioscience.org/genomics/the_human_microbiome.html This was not the first fecal transplant in history. In China, Ge Hong in the http://learn.genetics.utah.edu/content/microbiome/ fourth century and Li Shizhen in the Organisms Major and Level Bacteria at Found Different Body sixteenth century successfully treated Sites (Annu Rev Genomics Hum Genet. 2012; 13: 151–170). patients with fecal suspensions, which they sometimes called “yellow

Breakthroughs in Bioscience 12 BIOGRAPHIES

Jacqueline Jaeger Houtman, PhD is a freelance biomedical science writer and editor based in Madison, Wisconsin. Her science writing for adults and children has appeared in World Book Science Year, Cleveland Clinic Magazine, The Dana Foundation’s Progress in Brain Research, The Dana Sourcebook of Immunology and numerous academic and educational publications. This is her fourth Breakthroughs in Bioscience article. Dr. Houtman has published two books for young readers, The Reinvention of Edison Thomas (Boyds Mills Press) and Bayard Rustin: The Invisible Activist (with Walter Naegle and Michael G. Long, Quaker Press). She can be reached via her website: www.jhoutman.com

Sarah K. Highlander, PhD is a Professor in the Genomic Medicine Group at the J. Craig Venter Institute (JCVI) in La Jolla, California. She has broad expertise in medical and veterinary microbiology, microbial genomics, and microbiome research resulting from her experiences in academia and the pharmaceutical industry. From 2007 to 2014, she was a principal investigator for the NIH funded Human Microbiome Project. Her current interests are in applied microbiome research, comparative microbial genomics, and computational metagenomics. Dr. Highlander is a member of the Editorial Boards of Infection and Immunity and and served on the Editorial Board of PLoS ONE. She received her undergraduate degree from the University of Michigan and MS and PhD degrees in from the Sackler Institute of Biomedical Sciences at the New York University School of Medicine.

THE BREAKTHROUGHS IN BIOSCIENCE series is a collection of illustrated articles that explain recent developments in basic biomedical research and how they are important to society. Electronic versions of the articles are available in html and pdf format at the Breakthroughs in Bioscience website at: www.faseb.org/breakthroughs

13 Published 2015 © Copyright, FASEB

For reprints or other information: Federation of American Societies for Experimental Biology Office of Public Affairs 9650 Rockville Pike Bethesda, MD 20814-3998 http://www.faseb.org/breakthroughs