DOCSLIB.ORG

Broad-Spectrum Antiviral Strategies and Nucleoside Analogues

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Broad-Spectrum Antiviral Strategies and Nucleoside Analogues viruses Review Broad-Spectrum Antiviral Strategies and Nucleoside Analogues Robert J. Geraghty 1 , Matthew T. Aliota 2 and Laurent F. Bonnac 1,* 1 Center for Drug Design, College of Pharmacy, University of Minnesota, Minneapolis, MN 55455, USA; [email protected] 2 Department of Veterinary and Biomedical Sciences, University of Minnesota, St. Paul, MN 55108, USA; [email protected] * Correspondence: [email protected] Abstract: The emergence or re-emergence of viruses with epidemic and/or pandemic potential, such as Ebola, Zika, Middle East Respiratory Syndrome (MERS-CoV), Severe Acute Respiratory Syndrome Coronavirus 1 and 2 (SARS and SARS-CoV-2) viruses, or new strains of influenza represents sig- nificant human health threats due to the absence of available treatments. Vaccines represent a key answer to control these viruses. However, in the case of a public health emergency, vaccine develop- ment, safety, and partial efficacy concerns may hinder their prompt deployment. Thus, developing broad-spectrum antiviral molecules for a fast response is essential to face an outbreak crisis as well as for bioweapon countermeasures. So far, broad-spectrum antivirals include two main categories: the family of drugs targeting the host-cell machinery essential for virus infection and replication, and the family of drugs directly targeting viruses. Among the molecules directly targeting viruses, nucleoside analogues form an essential class of broad-spectrum antiviral drugs. In this review, we will discuss the interest for broad-spectrum antiviral strategies and their limitations, with an emphasis on virus-targeted, broad-spectrum, antiviral nucleoside analogues and their mechanisms of action. Keywords: broad-spectrum antivirals; lethal mutagenesis; chain terminator; nucleoside analogues Citation: Geraghty, R.J.; Aliota, M.T.; Bonnac, L.F. Broad-Spectrum Antiviral Strategies and Nucleoside Analogues. Viruses 2021, 13, 667. https://doi.org/10.3390/v13040667 1. The Interest of Broad-Spectrum Antiviral Strategies Antiviral drug development has long focused on virus-specific approaches: the strat- Academic Editor: Cheng-Wen Lin egy to study a virus and identify a specific viral protein as a drug target in order to limit potential toxicity and to increase drug efficacy (Figure1). Virus-specific drug development Received: 18 March 2021 has also been favored as a way to simplify the drug discovery process compared to the Accepted: 12 April 2021 more complex design of broad-spectrum antivirals, which often require targeting critical Published: 13 April 2021 proteins belonging to different viruses or critical cellular processes used by different viruses. Virus-specific antiviral research remains a successful and essential strategy to combat viral Publisher’s Note: MDPI stays neutral infections [1]. However, a major obstacle to virus-specific drug development is the length with regard to jurisdictional claims in of the process, which, on average, takes more than a decade between research and drug published maps and institutional affil- approval [2]. Indeed, virus-specific drug development needs first to address fundamental iations. biology of the virus to find an appropriate target before moving to medicinal chemistry research, compounds screening, lead optimization, animal studies and eventual clinical trials. The time constraint for antiviral drug discovery has gradually become more impor- tant due to the increasing number of viral outbreaks that have recently and consecutively Copyright: © 2021 by the authors. afflicted our societies including Ebola virus [3], Middle East Respiratory Syndrome coron- Licensee MDPI, Basel, Switzerland. avirus MERS-CoV [4], Severe Acute Respiratory Syndrome Coronavirus 1 and 2 (SARS and This article is an open access article SARS-CoV-2) [5,6], new strains of influenza A virus [7] as well as dengue virus [8], Zika distributed under the terms and virus [9,10], West Nile virus [11] and Chikungunya virus [12]. Reasons for the increased conditions of the Creative Commons appearances of these outbreaks include increased population densities, forest fragmenta- Attribution (CC BY) license (https:// tion, intercontinental traveling, and climate change [13,14]. Regardless of their origins, the creativecommons.org/licenses/by/ recent and consecutive nature of these outbreaks highlight the challenges of virus-specific 4.0/). Viruses 2021, 13, 667. https://doi.org/10.3390/v13040667 https://www.mdpi.com/journal/viruses Viruses 2021, 13, x FOR PEER REVIEW 2 of 12 Viruses 2021, 13, 667 forest fragmentation, intercontinental traveling, and climate change [13,14]. Regardless 2of of 12 their origins, the recent and consecutive nature of these outbreaks highlight the challenges of virus-specific drug research for fast discovery of a therapeutic. Similarly, vaccine de- drugvelopment, research although for fast discoveryparticularly of relevant a therapeutic. to face Similarly,outbreaks vaccineand pandemics, development, also requires although particularlya significant relevant development to face time outbreaks to ensure and the pandemics, efficacy and also safety requires of the avaccine significant [15]. Re- devel- opmentpurposing time antiviral to ensure drugs, the efficacythe strategy and safetyto evaluate of the approved vaccine [15drugs]. Re-purposing for known viruses antiviral drugs,against the new strategy viruses to is evaluate highly advantageous approved drugs in terms for known of reducing viruses cost against and saving new viruses time, is highlyand has advantageous therefore been in termsan essential of reducing component cost and of savingemergency time, responses and has thereforeduring public been an health crisis [16]. essential component of emergency responses during public health crisis [16]. Virus replication cycle Antiviral strategies Figure 1. Virus replication cycle and antiviral strategies. Figure 1. Virus replication cycle and antiviral strategies. Drug re-purposing is advantageous in that the initial part of the drug discovery Drug re-purposing is advantageous in that the initial part of the drug discovery pro- process can be bypassed including medicinal chemistry research and lead optimization as cess can be bypassed including medicinal chemistry research and lead optimization as well as the safety evaluation in phase 1 clinical trials, therefore reducing considerably the well as the safety evaluation in phase 1 clinical trials, therefore reducing considerably the research and development time. Yet, re-purposing antiviral drugs successfully is inherently research and development time. Yet, re-purposing antiviral drugs successfully is inher- dependentently dependent on the on ability the ability of an antiviralof an antiviral drug drug to be to active be active against against multiple multiple viruses, viruses, hence, thehence, need the of need a broad-spectrum of a broad-spectrum antiviral antivira effect.l Historically,effect. Historically, broad-spectrum broad-spectrum antivirals antivi- have firstrals beenhave discoveredfirst been discovered by serendipity by serendip throughity through simple screeningsimple screening assays againstassays against different virusesdifferent rather viruses than rather through than through a deliberate a deliberate strategy strategy to design to design drugs drugs to display to display a broad- a spectrumbroad-spectrum antiviral antiviral effect [effect17,18 ][17,18] for ribavirin for ribavirin or more or more recently recently with with antibiotic antibiotic derivatives deriv- withatives antiviral with antiviral properties properties [19,20]. [19,20]. From theseFrom initial these antiviralinitial antiviral drug evaluations drug evaluations emerged patternsemerged of patterns drugs withof drugs similar with biological similar biologic effects.al effects. Broad-spectrum Broad-spectrum antiviral antiviral drugs drugs can be classifiedcan be classified into two into main two categories; main categories; first, drugs first, thatdrugs affect that the affect host-cell the host-cell machinery machinery essential foressential the infection for the andinfection replication and replication of different of different viruses, viruses, and second; and second; drugs drugs targeting targeting viruses directly.viruses directly. Both families Both families of broad-spectrum of broad-spec antiviraltrum antiviral drugs drugs (e.g., (e.g., host-targeted host-targeted or virus-or targetedvirus-targeted broad-spectrum broad-spectrum antivirals) antivirals) present present advantages, advantages, and disadvantagesand disadvantages (Table (Table1). 1). Table 1. Pros and cons of different antiviral strategies, virus-specific antiviral strategies, host-targeted and virus-targeted broad-spectrum antiviral strategies. Broad-Spectrum Antiviral Strategies Virus-Specific Antiviral Strategies Host-Targeted Virus-Targeted Pros: Pros: Pros: - Proven efficacy - Host proteins broadly required by viruses - Less potential for toxicity compared to - Easier design, one viral target - Demonstrated antiviral effect host-targeted strategies. - Relative safety compared to other strategies - Higher barrier to drug resistance development - Potential for repurposing Cons: Cons: Cons: - Narrow application - More complex design - Not selective - Low barrier to drug resistance development - Limited examples of broad-spectrum - Potential for toxicity - Long development time antiviral drugs Viruses 2021, 13, 667 3 of 12 2. Host-Targeted Antiviral Strategies Host-targeted antiviral strategies, reviewed here [21,22], feature a wide range of host
Load more

Recommended publications
  • Highlights of Prescribing Information
    HIGHLIGHTS OF PRESCRIBING INFORMATION --------------------------WARNINGS AND PRECAUTIONS--------------------­ These highlights do not include all the information needed to use • New onset or worsening renal impairment: Can include acute VIREAD safely and effectively. See full prescribing information renal failure and Fanconi syndrome. Assess creatinine clearance for VIREAD. (CrCl) before initiating treatment with VIREAD. Monitor CrCl and ® serum phosphorus in patients at risk. Avoid administering VIREAD (tenofovir disoproxil fumarate) tablets, for oral use VIREAD with concurrent or recent use of nephrotoxic drugs. (5.3) VIREAD® (tenofovir disoproxil fumarate) powder, for oral use • Coadministration with Other Products: Do not use with other Initial U.S. Approval: 2001 tenofovir-containing products (e.g., ATRIPLA, COMPLERA, and TRUVADA). Do not administer in combination with HEPSERA. WARNING: LACTIC ACIDOSIS/SEVERE HEPATOMEGALY WITH (5.4) STEATOSIS and POST TREATMENT EXACERBATION OF HEPATITIS • HIV testing: HIV antibody testing should be offered to all HBV- infected patients before initiating therapy with VIREAD. VIREAD See full prescribing information for complete boxed warning. should only be used as part of an appropriate antiretroviral • Lactic acidosis and severe hepatomegaly with steatosis, combination regimen in HIV-infected patients with or without HBV including fatal cases, have been reported with the use of coinfection. (5.5) nucleoside analogs, including VIREAD. (5.1) • Decreases in bone mineral density (BMD): Consider assessment • Severe acute exacerbations of hepatitis have been reported of BMD in patients with a history of pathologic fracture or other in HBV-infected patients who have discontinued anti- risk factors for osteoporosis or bone loss. (5.6) hepatitis B therapy, including VIREAD. Hepatic function • Redistribution/accumulation of body fat: Observed in HIV-infected should be monitored closely in these patients.
    [Show full text]
  • COVID-19) Pandemic on National Antimicrobial Consumption in Jordan
    antibiotics Article An Assessment of the Impact of Coronavirus Disease (COVID-19) Pandemic on National Antimicrobial Consumption in Jordan Sayer Al-Azzam 1, Nizar Mahmoud Mhaidat 1, Hayaa A. Banat 2, Mohammad Alfaour 2, Dana Samih Ahmad 2, Arno Muller 3, Adi Al-Nuseirat 4 , Elizabeth A. Lattyak 5, Barbara R. Conway 6,7 and Mamoon A. Aldeyab 6,* 1 Clinical Pharmacy Department, Jordan University of Science and Technology, Irbid 22110, Jordan; [email protected] (S.A.-A.); [email protected] (N.M.M.) 2 Jordan Food and Drug Administration (JFDA), Amman 11181, Jordan; [email protected] (H.A.B.); [email protected] (M.A.); [email protected] (D.S.A.) 3 Antimicrobial Resistance Division, World Health Organization, Avenue Appia 20, 1211 Geneva, Switzerland; [email protected] 4 World Health Organization Regional Office for the Eastern Mediterranean, Cairo 11371, Egypt; [email protected] 5 Scientific Computing Associates Corp., River Forest, IL 60305, USA; [email protected] 6 Department of Pharmacy, School of Applied Sciences, University of Huddersfield, Huddersfield HD1 3DH, UK; [email protected] 7 Institute of Skin Integrity and Infection Prevention, University of Huddersfield, Huddersfield HD1 3DH, UK * Correspondence: [email protected] Citation: Al-Azzam, S.; Mhaidat, N.M.; Banat, H.A.; Alfaour, M.; Abstract: Coronavirus disease 2019 (COVID-19) has overlapping clinical characteristics with bacterial Ahmad, D.S.; Muller, A.; Al-Nuseirat, respiratory tract infection, leading to the prescription of potentially unnecessary antibiotics. This A.; Lattyak, E.A.; Conway, B.R.; study aimed at measuring changes and patterns of national antimicrobial use for one year preceding Aldeyab, M.A.
    [Show full text]
  • Chapter 12 Antimicrobial Therapy Antibiotics
    Chapter 12 Antimicrobial Therapy Topics: • Ideal drug - Antimicrobial Therapy - Selective Toxicity • Terminology - Survey of Antimicrobial Drug • Antibiotics - Microbial Drug Resistance - Drug and Host Interaction An ideal antimicrobic: Chemotherapy is the use of any chemical - soluble in body fluids, agent in the treatment of disease. - selectively toxic , - nonallergenic, A chemotherapeutic agent or drug is any - reasonable half life (maintained at a chemical agent used in medical practice. constant therapeutic concentration) An antibiotic agent is usually considered to - unlikely to elicit resistance, be a chemical substance made by a - has a long shelf life, microorganism that can inhibit the growth or - reasonably priced. kill microorganisms. There is no ideal antimicrobic An antimicrobic or antimicrobial agent is Selective Toxicity - Drugs that specifically target a chemical substance similar to an microbial processes, and not the human host’s. antibiotic, but may be synthetic. Antibiotics Spectrum of antibiotics and targets • Naturally occurring antimicrobials – Metabolic products of bacteria and fungi – Reduce competition for nutrients and space • Bacteria – Streptomyces, Bacillus, • Molds – Penicillium, Cephalosporium * * 1 The mechanism of action for different 5 General Mechanisms of Action for antimicrobial drug targets in bacterial cells Antibiotics - Inhibition of Cell Wall Synthesis - Disruption of Cell Membrane Function - Inhibition of Protein Synthesis - Inhibition of Nucleic Acid Synthesis - Anti-metabolic activity Antibiotics
    [Show full text]
  • Nucleotide Degradation
    Nucleotide Degradation Nucleotide Degradation The Digestion Pathway • Ingestion of food always includes nucleic acids. • As you know from BI 421, the low pH of the stomach does not affect the polymer. • In the duodenum, zymogens are converted to nucleases and the nucleotides are converted to nucleosides by non-specific phosphatases or nucleotidases. nucleases • Only the non-ionic nucleosides are taken & phospho- diesterases up in the villi of the small intestine. Duodenum Non-specific phosphatases • In the cell, the first step is the release of nucleosides) the ribose sugar, most effectively done by a non-specific nucleoside phosphorylase to give ribose 1-phosphate (Rib1P) and the free bases. • Most ingested nucleic acids are degraded to Rib1P, purines, and pyrimidines. 1 Nucleotide Degradation: Overview Fate of Nucleic Acids: Once broken down to the nitrogenous bases they are either: Nucleotides 1. Salvaged for recycling into new nucleic acids (most cells; from internal, Pi not ingested, nucleic Nucleosides acids). Purine Nucleoside Pi aD-Rib 1-P (or Rib) 2. Oxidized (primarily in the Phosphorylase & intestine and liver) by first aD-dRib 1-P (or dRib) converting to nucleosides, Bases then to –Uric Acid (purines) –Acetyl-CoA & Purine & Pyrimidine Oxidation succinyl-CoA Salvage Pathway (pyrimidines) The Salvage Pathways are in competition with the de novo biosynthetic pathways, and are both ANABOLISM Nucleotide Degradation Catabolism of Purines Nucleotides: Nucleosides: Bases: 1. Dephosphorylation (via 5’-nucleotidase) 2. Deamination and hydrolysis of ribose lead to production of xanthine. 3. Hypoxanthine and xanthine are then oxidized into uric acid by xanthine oxidase. Spiders and other arachnids lack xanthine oxidase.
    [Show full text]
  • 35 Disorders of Purine and Pyrimidine Metabolism
    35 Disorders of Purine and Pyrimidine Metabolism Georges van den Berghe, M.- Françoise Vincent, Sandrine Marie 35.1 Inborn Errors of Purine Metabolism – 435 35.1.1 Phosphoribosyl Pyrophosphate Synthetase Superactivity – 435 35.1.2 Adenylosuccinase Deficiency – 436 35.1.3 AICA-Ribosiduria – 437 35.1.4 Muscle AMP Deaminase Deficiency – 437 35.1.5 Adenosine Deaminase Deficiency – 438 35.1.6 Adenosine Deaminase Superactivity – 439 35.1.7 Purine Nucleoside Phosphorylase Deficiency – 440 35.1.8 Xanthine Oxidase Deficiency – 440 35.1.9 Hypoxanthine-Guanine Phosphoribosyltransferase Deficiency – 441 35.1.10 Adenine Phosphoribosyltransferase Deficiency – 442 35.1.11 Deoxyguanosine Kinase Deficiency – 442 35.2 Inborn Errors of Pyrimidine Metabolism – 445 35.2.1 UMP Synthase Deficiency (Hereditary Orotic Aciduria) – 445 35.2.2 Dihydropyrimidine Dehydrogenase Deficiency – 445 35.2.3 Dihydropyrimidinase Deficiency – 446 35.2.4 Ureidopropionase Deficiency – 446 35.2.5 Pyrimidine 5’-Nucleotidase Deficiency – 446 35.2.6 Cytosolic 5’-Nucleotidase Superactivity – 447 35.2.7 Thymidine Phosphorylase Deficiency – 447 35.2.8 Thymidine Kinase Deficiency – 447 References – 447 434 Chapter 35 · Disorders of Purine and Pyrimidine Metabolism Purine Metabolism Purine nucleotides are essential cellular constituents 4 The catabolic pathway starts from GMP, IMP and which intervene in energy transfer, metabolic regula- AMP, and produces uric acid, a poorly soluble tion, and synthesis of DNA and RNA. Purine metabo- compound, which tends to crystallize once its lism can be divided into three pathways: plasma concentration surpasses 6.5–7 mg/dl (0.38– 4 The biosynthetic pathway, often termed de novo, 0.47 mmol/l). starts with the formation of phosphoribosyl pyro- 4 The salvage pathway utilizes the purine bases, gua- phosphate (PRPP) and leads to the synthesis of nine, hypoxanthine and adenine, which are pro- inosine monophosphate (IMP).
    [Show full text]
  • (LRV1) Pathogenicity Factor
    Antiviral screening identifies adenosine analogs PNAS PLUS targeting the endogenous dsRNA Leishmania RNA virus 1 (LRV1) pathogenicity factor F. Matthew Kuhlmanna,b, John I. Robinsona, Gregory R. Bluemlingc, Catherine Ronetd, Nicolas Faseld, and Stephen M. Beverleya,1 aDepartment of Molecular Microbiology, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; bDepartment of Medicine, Division of Infectious Diseases, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; cEmory Institute for Drug Development, Emory University, Atlanta, GA 30329; and dDepartment of Biochemistry, University of Lausanne, 1066 Lausanne, Switzerland Contributed by Stephen M. Beverley, December 19, 2016 (sent for review November 21, 2016; reviewed by Buddy Ullman and C. C. Wang) + + The endogenous double-stranded RNA (dsRNA) virus Leishmaniavirus macrophages infected in vitro with LRV1 L. guyanensis or LRV2 (LRV1) has been implicated as a pathogenicity factor for leishmaniasis Leishmania aethiopica release higher levels of cytokines, which are in rodent models and human disease, and associated with drug-treat- dependent on Toll-like receptor 3 (7, 10). Recently, methods for ment failures in Leishmania braziliensis and Leishmania guyanensis systematically eliminating LRV1 by RNA interference have been − infections. Thus, methods targeting LRV1 could have therapeutic ben- developed, enabling the generation of isogenic LRV1 lines and efit. Here we screened a panel of antivirals for parasite and LRV1 allowing the extension of the LRV1-dependent virulence paradigm inhibition, focusing on nucleoside analogs to capitalize on the highly to L. braziliensis (12). active salvage pathways of Leishmania, which are purine auxo- A key question is the relevancy of the studies carried out in trophs.
    [Show full text]
  • Utilisation Des Cellules Souches Pluripotentes Pour Le Criblage À Haut Débit De Molécules Thérapeutiques
    Utilisation des cellules souches pluripotentes pour le criblage à haut débit de molécules thérapeutiques dans la maladie de Lesch-Nyhan : 2019SACLE011 NNT Thèse de doctorat de l'Université Paris-Saclay, préparée à l’Université d’Evry Val-d’Essonne École doctorale n°569 Innovation thérapeutique : du fondamental à l’appliqué (ITFA) Spécialité de doctorat: Immunologie Thèse présentée et soutenue à Corbeil-Essonnes, le 01 juillet 2019, par Valentin Ruillier Composition du Jury : Dr. Olivier Goureau Institut de la Vision, Université Sorbonne, Paris Président Pr. Odile Boespflug-Tanguy Université Paris Diderot, Hôpital Robert Debré, Paris Rapporteur Dr. Amélie Piton IGBMC, Hôpitaux Universitaires de Strasbourg Rapporteur Dr. Terence Beghyn APTEEUS, Lille Examinateur Pr. Christelle Monville UEVE/INSERM U861, I-STEM, Corbeil-Essonnes Directeur de thèse Dr. Alexandra Benchoua CECS, I-STEM, Corbeil-Essonnes Co-Encadrant Résumé - Abstract Mots clés : Maladie de Lesch-Nyhan, cellules souches pluripotentes, iPSC, criblage à haut débit, HGPRT, purines Résumé : Les mutations affectant la fonction identifier, par une approche de criblage à haut d’enzymes impliquées dans le cycle des purines débit, de nouvelles molécules chimiques capables sont responsables d’une multitude de syndromes de corriger ces défauts. Plus de 3000 molécules pédiatriques, caractérisés par des atteintes ont été testées et 6 composés, tous dérivés de neurologiques et comportementales. A ce jour, l’adénosine, ont pu être identifiés comme aucune stratégie thérapeutique n’a été compensant le métabolisme par un mécanisme réellement efficace pour contrôler ces d’action indépendant de l’HGPRT. De manière symptômes. La maladie de Lesch-Nyhan (MLN), intéressante, un des composés, la S- associée à la perte de fonction de l’enzyme de adenosylmethionine (SAM) a par le passé déjà recyclage HGPRT, constitue un bon modèle démontré des effets bénéfiques sur les d’étude.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Design and Evaluation of 5•²-O-Dicarboxylic And
    University of Rhode Island DigitalCommons@URI Open Access Master's Theses 2014 DESIGN AND EVALUATION OF 5′-O-DICARBOXYLIC AND POLYARGININE FATTY ACYL DERIVATIVES OF ANTI-HIV NUCLEOSIDES Bhanu Priya Pemmaraju Venkata University of Rhode Island, [email protected] Follow this and additional works at: https://digitalcommons.uri.edu/theses Recommended Citation Pemmaraju Venkata, Bhanu Priya, "DESIGN AND EVALUATION OF 5′-O-DICARBOXYLIC AND POLYARGININE FATTY ACYL DERIVATIVES OF ANTI-HIV NUCLEOSIDES" (2014). Open Access Master's Theses. Paper 474. https://digitalcommons.uri.edu/theses/474 This Thesis is brought to you for free and open access by DigitalCommons@URI. It has been accepted for inclusion in Open Access Master's Theses by an authorized administrator of DigitalCommons@URI. For more information, please contact [email protected]. DESIGN AND EVALUATION OF 5′-O- DICARBOXYLIC AND POLYARGININE FATTY ACYL DERIVATIVES OF ANTI-HIV NUCLEOSIDES BY BHANU PRIYA, PEMMARAJU VENKATA A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE MASTER’S DEGREE IN BIOMEDICAL AND PHARMACEUTICAL SCIENCES UNIVERSITY OF RHODE ISLAND 2014 MASTER OF SCIENCE THESIS OF BHANU PRIYA, PEMMARAJU VENKATA APPROVED: Thesis Committee: Major Professor Keykavous Parang Roberta King Stephen Kogut Geoffrey D. Bothun Nasser H. Zawia DEAN OF THE GRADUATE SCHOOL UNIVERSITY OF RHODE ISLAND 2014 ABSTRACT 2′,3′-Dideoxynucleoside (ddNs) analogs are the most widely used anti-HIV drugs in the market. Even though these drugs display very potent activities, they have a number of limitations when are used as therapeutic agents. The primary problem associated with ddNs is significant toxicity, such as neuropathy and bone marrow suppression.
    [Show full text]
  • Determining Ribavirin's Mechanism of Action Against Lassa Virus Infection
    www.nature.com/scientificreports OPEN Determining Ribavirin’s mechanism of action against Lassa virus infection Received: 28 March 2017 Paola Carrillo-Bustamante1, Thi Huyen Tram Nguyen2,3, Lisa Oestereich4,5, Stephan Accepted: 4 August 2017 Günther4,5, Jeremie Guedj 2,3 & Frederik Graw1 Published: xx xx xxxx Ribavirin is a broad spectrum antiviral which inhibits Lassa virus (LASV) replication in vitro but exhibits a minor effect on viremiain vivo. However, ribavirin significantly improves the disease outcome when administered in combination with sub-optimal doses of favipiravir, a strong antiviral drug. The mechanisms explaining these conflicting findings have not been determined, so far. Here, we used an interdisciplinary approach combining mathematical models and experimental data in LASV-infected mice that were treated with ribavirin alone or in combination with the drug favipiravir to explore different putative mechanisms of action for ribavirin. We test four different hypotheses that have been previously suggested for ribavirin’s mode of action: (i) acting as a mutagen, thereby limiting the infectivity of new virions; (ii) reducing viremia by impairing viral production; (iii) modulating cell damage, i.e., by reducing inflammation, and (iv) enhancing antiviral immunity. Our analysis indicates that enhancement of antiviral immunity, as well as effects on viral production or transmission are unlikely to be ribavirin’s main mechanism mediating its antiviral effectiveness against LASV infection. Instead, the modeled viral kinetics suggest that the main mode of action of ribavirin is to protect infected cells from dying, possibly reducing the inflammatory response. Lassa fever (LF) is a severe and often fatal hemorrhagic disease caused by Lassa virus (LASV), a member of the Arenaviridae virus family.
    [Show full text]
  • Reconstituted IMPDH Polymers Accommodate Both Catalytically Active and Inactive Conformations
    M BoC | BRIEF REPORT Reconstituted IMPDH polymers accommodate both catalytically active and inactive conformations Sajitha A. Anthonya,†, Anika L. Burrellb,†, Matthew C. Johnsonb, Krisna C. Duong-Lya, Yin-Ming Kuoa, Jacqueline C. Simoneta, Peter Michenerc, Andrew Andrewsa, Justin M. Kollmanb,†,*, and Jeffrey R. Petersona,†,* aCancer Biology Program, Fox Chase Cancer Center, Philadelphia, PA 19111; bDepartment of Biochemistry, University of Washington, Seattle, WA 98195; cDepartment of Biochemistry & Molecular Biology, Drexel University College of Medicine, Philadelphia, PA 19102 ABSTRACT Several metabolic enzymes undergo reversible polymerization into macromo- Monitoring Editor lecular assemblies. The function of these assemblies is often unclear, but in some cases they Diane Barber regulate enzyme activity and metabolic homeostasis. The guanine nucleotide biosynthetic University of California, San Francisco enzyme inosine monophosphate dehydrogenase (IMPDH) forms octamers that polymerize into helical chains. In mammalian cells, IMPDH filaments can associate into micron-length Received: Apr 25, 2017 assemblies. Polymerization and enzyme activity are regulated in part by binding of purine Revised: Aug 2, 2017 nucleotides to an allosteric regulatory domain. ATP promotes octamer polymerization, Accepted: Aug 4, 2017 whereas guanosine triphosphate (GTP) promotes a compact, inactive conformation whose ability to polymerize is unknown. Also unclear is whether polymerization directly alters IMPDH catalytic activity. To address this, we identified point mutants of human IMPDH2 that either prevent or promote polymerization. Unexpectedly, we found that polymerized and nonassembled forms of recombinant IMPDH have comparable catalytic activity, substrate affinity, and GTP sensitivity and validated this finding in cells. Electron microscopy revealed that substrates and allosteric nucleotides shift the equilibrium between active and inactive conformations in both the octamer and the filament.
    [Show full text]
  • Lethal Mutagenesis of Hepatitis C Virus Induced by Favipiravir
    RESEARCH ARTICLE Lethal Mutagenesis of Hepatitis C Virus Induced by Favipiravir Ana I. de AÂ vila1, Isabel Gallego1,2, Maria Eugenia Soria3, Josep Gregori2,3,4, Josep Quer2,3,5, Juan Ignacio Esteban2,3,5, Charles M. Rice6, Esteban Domingo1,2*, Celia Perales1,2,3* 1 Centro de BiologõÂa Molecular ªSevero Ochoaº (CSIC-UAM), Consejo Superior de Investigaciones CientõÂficas (CSIC), Campus de Cantoblanco, 28049, Madrid, Spain, 2 Centro de InvestigacioÂn BiomeÂdica en Red de Enfermedades HepaÂticas y Digestivas (CIBERehd), Barcelona, Spain, 3 Liver Unit, Internal Medicine, Laboratory of Malalties Hepàtiques, Vall d'Hebron Institut de Recerca-Hospital Universitari Vall d a11111 ÂHebron, (VHIR-HUVH), Universitat Autònoma de Barcelona, 08035, Barcelona, Spain, 4 Roche Diagnostics, S.L., Sant Cugat del ValleÂs, Spain, 5 Universitat AutoÂnoma de Barcelona, Barcelona, Spain, 6 Center for the Study of Hepatitis C, Laboratory of Virology and Infectious Disease, The Rockefeller University, New York, United States of America * [email protected] (ED); [email protected] (CP) OPEN ACCESS Abstract Citation: de AÂvila AI, Gallego I, Soria ME, Gregori J, Quer J, Esteban JI, et al. (2016) Lethal Lethal mutagenesis is an antiviral approach that consists in extinguishing a virus by an Mutagenesis of Hepatitis C Virus Induced by excess of mutations acquired during replication in the presence of a mutagen. Here we Favipiravir. PLoS ONE 11(10): e0164691. show that favipiravir (T-705) is a potent mutagenic agent for hepatitis C virus (HCV) during doi:10.1371/journal.pone.0164691 its replication in human hepatoma cells. T-705 leads to an excess of G ! A and C ! U tran- Editor: Ming-Lung Yu, Kaohsiung Medical sitions in the mutant spectrum of preextinction HCV populations.
    [Show full text]