Identification of Rhizobial Symbionts Associated with Lupinus Spp

Home , Kennedia coccinea, Lebeckia ambigua, Lessertia (plant), Listia (plant), Lupinus, Mesorhizobium alhagi

IDENTIFICATION OF RHIZOBIAL SYMBIONTS ASSOCIATED WITH LUPINUS SPP.

Dilshan Beligala

A Thesis

Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of

MASTER OF SCIENCE

August 2015

Committee:

Vipaporn Phuntumart, Advisor

Helen Michaels

Dilshan Beligala

Vipaporn Phuntumart, Advisor

Lupinus, commonly called lupine is a genus of legumes which belongs to the family

Fabaceae and its members have the ability to establish a symbiotic association with rhizobia and

effectively fix atmospheric nitrogen in root nodules. Although, the main symbiont lineage of

most Lupinus spp. is Bradyrhizobium sp., there are evidence of other rhizobial genera nodulating

lupines such as Rhizobium, Mesorhizobium, Burkholderia and Microvirga. Furthermore,

Burkholderia spp. has been reported to colonize cluster roots of lupine. Accordingly, there is a

great diversity among the root nodule bacteria which nodulate lupines in different geographic

locations. Therefore, the aim of this work is to identify rhizobial symbionts associated with

Lupinus spp. using 16S rRNA, atpD, glnII and dnaK phylogenies. In this study, these marker

genes of 17 strains were PCR amplified, sequenced and analyzed using NCBI-BLAST. Sequence alignment was performed using ClustalW2 followed by computing the maximum-likelihood phylogenetic trees using MEGA6 software package. According to the congruence of single gene trees of 16S rRNA, atpD, glnII and dnaK, the strains USDA 3040, 3051, 3709 and SB_J are

identified as members that belong to the genus Bradyrhizobium. In addition, L_3d52 strain is

identified as Rhizobium sp. whereas USDA 3063 and 3717 are proven to be Mesorhizobium

sp. and USDA 3043 and L_OO are identified as Burkholderia sp. whereas USDA 3057a is

identified as Microvirga sp. However, further experiments and analysis are needed to confirm

the identities of the rest of the studied strains that are not in full agreement among generated

phylogenetic trees. iii

I would like to dedicate this to my mother Mrs. Renuka Ranaweera, my father Mr. Samarasinghe

Beligala, my brother Mr. Lakshan Beligala and my wife Mrs. Gayathri Beligala

for being great pillars of support. iv ACKNOWLEDGMENTS

As I approach the completion of my Master’s Degree, I realize that I am extremely thankful to

the support and assistance of many people. I wish to thank every one of those who have helped

me to survive the birthing of this thesis.

First and foremost, I would like to express my sincere gratitude to my supervisor, Associate

Professor Vipa Phuntumart, for her time and effort spent on continuously leading, advising and encouraging me throughout this research. Her passion for challenges has given me inspiration,

her vast knowledge has given me guidance and her enthusiasm in research has given me

motivation. I feel lucky to work under the supervision of such a talented advisor.

I owe gratitude to my committee members, Associate Professor Paul F. Morris and Associate

Professor Helen J. Michaels, whose stimulating vmoti ation and valuable ideas were extremely

helpful in completing my research successfully. They have been a constant source of knowledge and support throughout the years.

Further, I would like to acknowledge .M Ps atrick Elia, a curator in the United States Department

of Agriculture, for providing me with rhizobial strains for the experiment. Also, I am indebted to

Mr. Jacob Sublett from Dr. Helen Michaels's lab for providing me with lupine root nodules.

In addition, I gratefully acknowledge the support of everyone in the Department of Biological

Science, Bowling Green State University, all the academic staff and non-academic staff,

especially Ms. DeeDee Wentland and Ms. Denise Holcombe for their kindness and support in all administration issues. I would like to acknowledge everyone in Dr. Paul Morris’s lab who helped me with the necessary equipments and chemicals time to time. My special thanks go to Assistant

Professor Dr. Hans Wildschutte for allowing me to use the nanodrop spectrophotometer in his lab when it was needed to continue my experiment. v I would also like to be grateful to all the members in my lab, especially Mr. Alex Howard, for

helping me out in the field and Ms. Shannon Miller for helping me with phylogenetic analysis. I

feel lucky to have the opportunity to work with such friendly lab mates. I also must mention the

valuable support I received from Ms. Menaka Ariyaratna, a PhD candidate in the Department who helped me in numerous ways throughout my research work.

With much of happiness I thank my dear friends, especially Ms. Ramadha Dilhani, Mr.

Madushanka Sugath and Mr. Dayal Wijayarathne for all the support they have given me throughout until this point. I feel so blessed to have such supportive friends and I would like to acknowledge all of them who offered many words of encouragement throughout the years.

Finally, my deepest gratitude goes to my loving parents and my wife Ms. Gayathri Beligala for

their support in my studies and for being there with me through thick and thin. I am forever

indebted to all that they have done for me. Without their endless support and unconditional love,

I wouldn’t have achieved this much. Thank you for being around and for never ending

motivations I’ve been getting all this while. vi TABLE OF CONTENTS

Page

CHAPTER I. INTRODUCTION………………...... ……………………………. 1

CHAPTER II. AIMS ………………………….…………………………………………… 10

CHAPTER III. MATERIALS AND METHODS …..……………………………………… 11

3.1 Isolation of rhizobia from root nodules of Lupinus spp. and soybean………….. 11

3.1.1 Surface sterilization…………………...... ……………………………. 11

3.2 Molecular characterization ……………….……………………………………. 12

3.2.1 DNA isolation ………………………...... ……………………………. 12

3.2.2 PCR of gene candidates……………………………….…..………….. 13

3.2.3 DNA sequencing and analysis………………………………………… 16

3.2.4 Phylogenetic analysis ………………………………………………… 16

3.2.4.1 Phylogeny of single gene trees …..…..….……...………….. 16

3.2.4.2 Phylogeny of concatenated gene sequences …....………….. 20

CHAPTER IV. RESULTS ……………………...... ……………………………. 21

4.1 DNA Quantification and Quality Analysis ....………………………………….. 21

4.2 Gel electrophoresis of PCR products……………………………………………. 22

4.3 Phylogenetic analysis of root nodule symbionts based on 16S rRNA, glnII, atpD and

dnaK genes………………………………………………………..…………………. 29

4.3.1 Phylogeny of the 16S rRNA gene.....………………….…..………….. 29

4.3.2 Phylogeny of the dnaK gene.………………………….…..………….. 32

4.3.3 Phylogeny of the glnII gene..………………………….…..………….. 33

4.3.4 Phylogeny of the atpD gene...………………………….…..………….. 36

4.3.5 Phylogeny of the concatenated dataset….…………….…..………….. 37 vii 4.3.5.1 Concatenation of 16S rRNA, atpD, glnII and dnaK

sequences……………………………………..….……...………….. 37

4.3.5.2 Concatenation of 16S rRNA, atpD and glnII sequences...….. 40

4.3.5.3 Concatenation of 16S rRNA, dnaK and glnII sequences...….. 41

4.3.5.4 Concatenation of 16S rRNA and dnaK sequences……....….. 44

CHAPTER V. DISCUSSION…..………………………………………………………….. 46

CHAPTER VI. CONCLUSIONS………………………………………………………….. 51

REFERENCES……………………………………………………………………………… 52 viii LIST OF FIGURES

Figure Page

1 Agarose gel electrophoresis of extracted genomic DNA of representative strains… 22

2 Agarose gel electrophoresis of PCR products of 16S rRNA, atpD and glnII gene

regions………………………………………………………………………………. 24

3 Agarose gel electrophoresis of PCR products of 16S rRNA and atpD gene regions.. 25

4 Agarose gel electrophoresis of PCR products of glnII gene regions……………..… 26

5 Agarose gel electrophoresis of PCR products of dnaK gene regions with Bradyrhizobium

specific primers……………………………………………………………………… 27

6 Agarose gel electrophoresis of temperature gradient PCR products of L_OO dnaK gene

regions with Burkholderia specific primers………………………………………… 28

7 Agarose gel electrophoresis of temperature gradient PCR products of L_3d52 dnaK gene

regions with Rhizobium specific primers…………………………………………… 29

8 Maximum-likelihood phylogenetic tree of rhizobial strains isolated from lupine and

soybean root nodules and representative strains of named genera, based on 16S rRNA

gene sequences (1485 bp)…………………………………………………………… 31

9 Maximum-likelihood phylogenetic tree of rhizobial strains isolated from lupine and

soybean root nodules and representative strains of named genera, based on dnaK gene

sequences………………………………………………………………………….... 32

10 Maximum-likelihood phylogenetic tree of rhizobial strains isolated from lupine and

soybean root nodules and representative strains of named genera, based on glnII gene

sequences…………………………………………………………………………… 34 ix 11 Maximum-likelihood phylogenetic tree of rhizobial strains isolated from lupine and

soybean root nodules and representative strains of named genera, based on atpD gene

sequences…………………………………………………………………………… 36

12 Maximum-likelihood phylogenetic tree of rhizobial strains isolated from lupine and

soybean root nodules and representative strains of named genera, computed from the

concatenation of 16S rRNA, atpD, glnII and dnaK gene sequences………………… 38

13 Maximum-likelihood phylogenetic tree of USDA 3042 and 3717, computed from the

concatenation of 16S rRNA, atpD and glnII gene sequences………………………. 40

14 Maximum-likelihood phylogenetic tree of L_3d52 and SB_5, computed from the

concatenation of 16S rRNA, dnaK and glnII gene sequences………………………. 42

15 Maximum-likelihood phylogenetic tree of L_OO, USDA 3043 and USDA 3057a,

computed from the concatenation of 16S rRNA and dnaK gene sequences………… 44 x LIST OF TABLES

Table Page

1 Rhizobial strains incorporated in this study, the sources and the locations from which

they have been isolated……………………………………………………………… 12

2 Primers and PCR conditions for the amplification of Bradyrhizobium spp. genes.… 14

3 Primers and PCR conditions for the amplification of the dnaK gene of Burkholderia,

Microvirga, Mesorhizobium and Rhizobium genera………………………………... 15

4 Information about the DNA sequences of the reference strains used in phylogenetic

analysis……..……………………………………………………………………….. 18

5 Concatenation of DNA sequences based on the availability of DNA sequences…… 20

6 Spectrophotometric measurements of extracted genomic DNA of all USDA strains and

isolated strains……………………………………………………………………….. 21

CHAPTER I. INTRODUCTION

The plant family Fabaceae or Leguminosae, which is considered as the third largest family of

flowering plants, is well known for its peculiar ecological function in fixing atmospheric

nitrogen. It is comprised of three subfamilies Caesalpinioideae, Mimosoideae and Faboideae.

Lupinus (commonly called lupines) is a genus of legumes which belongs to the Genisteae tribe of the subfamily Faboideae and it encompasses more than 280 species of annual herbs and perennial herbaceous and woody shrubs distributed mainly in South and Western North America, the Andes, the Mediterranean regions and Africa (Duran et al., 2013).

The genus Lupinus is a relatively large and geographically widespread. The species that belong to this genus can be divided into two major groups; the Mediterranean/North and East African

“Old World” species and the North and South American “New World” group. The latter group is comprised of the greater number of species. The species that belong to these two geographically separate groups could grow in habitats from sea level to alpine tundra up to 4000 m altitude.

There are some main features that distinguish the genus Lupinus. They have large and numerous flowers on terminal racemes with erect standard petals. Also, they have ten short and versatile stamens that are alternately long and basifixed. Moreover, their ovaries are sessile and styles are incurved and glabrous. In addition they possess terminal stigma, oblong and more or less compressed pods, and thick and fleshy cotyledons (Wolko et al., 2011).

Lupines prefer to grow in well drained, light to medium textured soil. They are suited to live in poor acid soils preferring acidic to near-neutral conditions and do not grow well when the soil pH is higher than 6.8. Also, lupines are highly resistant to low temperatures with some species being able to resist -9°C or more. They are also salt tolerant to different degrees depending on the species (Duran et al., 2013; Reeve et al., 2013). 2

When the history of lupine cultivation is considered, it dates from about 2000-1000 BC or earlier in the Mediterranean basin and the central Andean region of South America. L. albus was predominant during that time since it was favored as a green manure and a source of seed harvest due to its ability to grow on poor soils. Seeds have been used for both animal and human consumption. Subsequently, various other species of the genus Lupinus have been cultivated in different other regions across the world. L. luteus have been introduced in northern Europe to be used for forage, green manuring and seed production. At a later time, L. angustifolius have been established in south western France for cattle fodder, in Germany for green manuring and in

England for sheep folding and improvement of sandy soils.

However, the development and acceptance of lupines as crops were hindered for some extent because of their high alkaloid content that impeded their direct use as food and feed without processing. This problem has been overcome over recent years by implementing various plant breeding methods. This lupine breeding basically focuses on the identification of natural mutants of lupine with low alkaloids and transformation of genes responsible for the reduction of alkaloids from a wild plant to a domesticated crop with good biological and seed yields (Wolko et al., 2011).

Although historically lupines have been mainly used as food, animal feed and soil improvers, current and future use has been extended to many other different disciplines. Most of the Lupinus spp. are cultivated as pulse crops because of its high protein content in the seeds and its positive impact on soil fertility. In addition, lupines have a diverse spectrum of uses which makes it an economically important crop. The flour taken from some species such as L. albus is used in the production of bakery, cake, pastry, noodles, lupine-coffee, milk analogues and yogurt analogues.

Seeds of lupines are used in some countries in the production of alcoholic beverages such as 3

‘katikala’ and ‘gibto areke’ (Tizazu & Emire, 2010). Furthermore, lupines play a weighty role in pharmaceutical industry and cosmetic production since they are abundant in alkaloids such as sparteine and angraine (Yildiz, 2013). Other than these, lupines are used in certain regions as forage for livestock, ectoparasite control on livestock bodies, ornamentation and fencing purposes (Nigussie, 2012). Accordingly, lupines will become a successful option for world agriculture in the future specially because of its need for reduced fertilizer input and nutrient leaching into subsoil (Wolko et al., 2011).

The positive impact of lupines on soil fertility makes it more important as a crop plant. Lupines have a large tap root and deep side roots which improve the physical soil structure by aerating it.

This can lead to enhanced water storage in soil which may be advantageous for the subsequent crop. Additionally, lupines are able to mobilize phosphorus and other elements from the soil as a result of the exudation of citrate from proteoid roots, which permits reprocessing of nutrients making them available for subsequent crops as well as the present one. Together with these features, the higher above ground biomass of lupine makes it an excellent source of green manure. Since lupines have a higher tendency of growing on marginal lands, it serves in erosion control and soil stabilization. The presence of alkaloids in lupines enables it to be used as a pest control too. Lupines can also be used to remediate polluted soils by methods of phytoremediation and phytoextraction (Nigussie, 2012).

Members of the genus Lupinus have the ability to establish a symbiotic association with rhizobia and effectively fix atmospheric nitrogen in root nodules. This enables them to thrive in nutrient poor soils. Symbiotic bacteria inside root nodules reduce dinitrogen to ammonium which is contributed to the plant in exchange for a carbon and an energy source. The nodulation process in lupines differs from many other legumes in that the bacteria access the host root through 4

intercellular spaces in the root and entering the root cortex cells without forming an infection

thread. The initiation of the host-rhizobial symbiosis is mediated by the secretion of chemical

signal compounds such as lipooligosaccharides and lumichromes from bacterial cells as well as

flavonoid compounds from the plant (Wolko et al., 2011).

Soil bacteria that belong to the genera Allorhizobium, Azorhizobium, Bradyrhizobium,

Mesorhizobium, Rhizobium and Sinorhizobium (Ensifer) are called as rhizobia which nodulate leguminous plants. In addition, there are some new lineages of nodule bacteria related to the genera Devosia, Methylobacterium, Ocrobactrum, Shinella, Burkholderia and Ralstonia that

have been described recently. Out of these, the latter two belong to the beta subclass of

Proteobacteria, being the most phylogenetically distant with respect to all rhizobial species.

However, the rhizobial requirement of the genus Lupinus is relatively specific. Lupines are

mainly nodulated by soil bacteria classified in the genus Bradyrhizobium, although there are

some other fast growing strains associated with lupines have been identified (Stępkowski et al.,

2003).

Various genetic and molecular approaches have been taken towards the characterization and

identification of rhizobial symbionts of lupines and it has been revealed that most strains broadly

cluster with B. japonicum lineage. However, according to recent findings of genetic approaches,

European Lupinus Spp. are mainly nodulated by B. canariense and B. japonicum whereas, most

American species are nodulated by strains related to B. japonicum and B. elkanii (Duran et al.,

2013). The genus Bradyrhizobium includes slow-growing soil bacteria and it belongs to the order

Rhizobiales and family Bradyrhizobiaceae. Members of this genus are rod-shaped, non-spore-

forming and mobile due to polar or subpolar flagella. They usually contain the carbon storage

compound β–hydroxybutyrate. As in the case of many other rhizobia that nodulate legumes, 5

Bradyrhizobium spp. also belong to the class of Alpharoteobacteria. However, Bradyrhizobium

spp. which nodulate lupines are different from the other species of the genus in being acid-

tolerant and able to grow in soils with high levels of free aluminum (Fernandez-Pascual et al.,

2007).

Although the genus Bradyrhizobium is the main symbiont lineage for most Lupinus spp., there

are a few species that make the nodule symbiotic relationship with members of the genus

Mesorhizobium as well. This genus is classified under the family Phyllobacteriaceae in the order

Rhizobiales and is comprised of species with distinctive phenotypic properties. According to 16S

rRNA phylogeny, this genus forms a well-defined clade different from the Rhizobium–Ensifer–

Agrobacterium clusters (Degefu et al., 2013). There are evidence reported that L. albus plants are nodulated by Mesorhizobium loti strain NZP2037 (González‐Sama et al., 2004).

Rhizobium is another genus that nodulates Lupinus spp. which belongs to the family

Rhizobiaceae in the order Rhizobiales. This genus includes basically, fast growing soil bacteria that belong to the class of Alphaproteobacteria. A strain previously named as Rhizobium lupini H

13-3 has been reported as isolated from L. luteus rhizosphere. However, it has been later described as Agrobacterium sp. H 13-3 after revealing genetic similarities between the two strains (Wibberg et al., 2011). In addition, Rhizobium loti has been reported from L. densiflorus

that has been later described as Mesorhizobium sp. (Jarvis et al., 1997).

Burkholderia is another genus which includes species that nodulate certain legume hosts. It is

classified under the family Burkholderiaceae in the order Burkholderiales. Unlike most other rhizobial genera, the genus Burkholderia belongs to the subclass Betaproteobacteria. Members of the genus Burkholderia are Gram-negative, aerobic, non-spore-forming, non-fermentative,

straight rod-shaped, and catalase-positive. Most species are motile by using a single polar 6 flagellum or a tuft of polar flagella. Interestingly, species of the genus Burkholderia have been isolated from a variety of sources including humans with cystic fibrosis, rhizosphere soil, root nodules, animals, plants, water and even hospital equipment. Although the genus Burkholderia is largely studied as pathogenic representatives, there are reports about certain species that have been isolated from root nodules, and that they can form N2-fixing symbioses with some legumes such as Mimosa spp., Lebeckia ambigua, Parapiptadenia rigida, Kennedia coccinea and

Gastrolobium capitatum. There are approximately 141 nodule symbionts that have been isolated from Mimosa spp. in Brazil and characterized as Burkholderia sp. using 16S rRNA and recA gene sequences (Sheu et al., 2013). Burkholderia phymatum, Burkholderia tuberum,

Burkholderia mimosarum and Burkholderia nodosa have been formally described as legume nodulating, N2-fixing Burkholderia species (Reeve et al., 2015; Wong-Villarreal & Caballero-

Mellado, 2010).

When Burkholderia-Lupinus relationship is considered, it has been shown that Burkholderia spp. are the major inhabitants of white lupine cluster roots. Some traits such as tolerance to low pH, ability to utilize citrate and oxalate as carbon sources and the ability to produce large amounts of siderophores have played an important role in successful colonization and maintenance of

Burkholderia spp. in white lupine cluster roots. Cluster roots are densely branched root structures possessing a unique excretion physiology that has been evolved to access scarce nutrients like phosphate. White lupine is the only species with agricultural importance that has cluster roots

(Weisskopf et al., 2011). It has been found that, only plant-beneficial species of the Burkholderia genus has the ability to use oxalate as a carbon source, whereas plant pathogenic (Burkholderia glumae, Burkholderia plantarii) or human opportunistic pathogens (Burkholderia cepacia 7

complex strains) are unable to degrade oxalate (Kost et al., 2013). However, there is a lack of evidence about root nodulating and N2-fixing symbiosis of Burkholderia spp. in Lupinus spp.

Recently, some novel rhizobial species that belong to the genus Microvirga has been described

as N2-fixing nodule symbionts. Members of the genus Microvirga is Alphaproteobacterial,

Gram negative, rod shaped and non-spore forming. The characterization of microsymbionts

isolated from Listia angolensis (from Zambia) and Lupinus texensis (from Texas, USA) has led

to the description of three new rhizobial species; Microvirga lotononidis, Microvirga zambiensis

and Microvirga lupini. They possess several distinctive phenotypic properties such as the ability

to grow at relatively elevated temperatures and the presence of pigmentation in most strains

(Ardley et al., 2012).

Classification of root nodule bacteria is usually conducted by analyzing various phenetic and

genetic data in a process called polyphasic approach. Molecular characterization and

phylogenetic analysis, which constitutes the genetic portion of the polyphasic approach, can be

carried out by sequence analysis of appropriately selected genetic markers (Stępkowski et al.,

2003).

Analysis of rRNA gene sequences has become one of the most decisive steps in the classification

process. The genetic marker that has been most commonly used in bacterial phylogenetic studies

by far is the 16S rRNA sequence. The 16S rRNA codes for an rRNA which makes a part of the

30S small subunit of prokaryotic ribosomes. As far as the phylogentic analysis is considered, 16S

rRNA is preferred over others for some reasons. Its functional importance is conserved and therefore has a slower mutation rate. In addition, it is present in all bacteria and large enough for informatics purposes. The 16S rRNA sequence is genus specific and hence provides genus identification in more than 90% of the cases (Janda & Abbott, 2007; Willems & Collins, 1993). 8

However, the application of 16S rRNA sequence as a genetic marker is limited by low resolution

of closely related species. Therefore, the attention was focused on using housekeeping protein-

coding genes as genetic markers. Out of the proteins that have been used as alternative phylogenetic markers, the most consistent with 16S rRNA phylogeny were the phylogenies obtained with GroEL, RecA, ATP synthase subunit beta, elongation factor Tu, and RNA polymerases (Stępkowski et al., 2003).

A housekeeping gene that can be used in molecular characterization of root nodule bacteria is

atpD which encodes the ATP synthase subunit beta. It functions to produce ATP from ADP in

the presence of a proton gradient across the membrane. The phylogenetic studies based on

atpD have revealed that the resulting phylogenies are highly correlated with those based on the

16S rRNA. However, genetic recombination of this gene can cause high genetic heterogeneity

and hence it should be used with caution in phylogenetic studies (Gaunt et al., 2001; Menna et

al., 2009a; Stepkowski et al., 2007)

GlnII, which encodes glutamine synthetase II, is another housekeeping gene that can be

employed in phylogenetic studies of rhizobia. It catalyzes the condensation of glutamate and

ammonia to form glutamine, which is one of the essential amino acids (Batista et al., 2013;

Behrmann et al., 1990; Chahboune et al., 2012; Menna et al., 2009b)

DnaK is another housekeeping gene which is used in phylogenetic studies of root nodule

symbionts. DnaK protein which is also called Hsp70 is a molecular chaperone responsible for

various cellular processes, such as folding of nascent polypeptides, assembly and disassembly of

protein complexes, protein degradation and membrane translocation of secreted proteins. There

are a large number of dnaK sequences available in the databases which make this gene a good

candidate to be incorporated in phylogenetic studies. The product of dnaK is a 70kDa protein 9

composed of two domains named as the ATPase and the substrate-binding domain. The substrate

binding domain has two subdomains: the β-sandwich and the more variable α-subdomain. The α-

subdomain is less conserved than ATPase or the β-sandwich. Hence, specific primers homologous to the conserved regions of the 3’ end of the dnaK gene have been developed which

enables the use of dnaK gene sequence in phylogenetic studies of root nodule bacteria

(Stępkowski et al., 2003; Stepkowski et al., 2007).

CHAPTER II. AIMS

The aims of this work is to 1) identify rhizobial symbionts isolated from lupines which were received from USDA using 16S rRNA, atpD, glnII and dnaK phylogenies, 2) isolate rhizobial symbionts from root nodules of lupines and soybean in Ohio and 3) identify isolated rhizobial symbionts using 16S rRNA, atpD, glnII and dnaK phylogenies. 11

CHAPTER III. MATERIALS AND METHODS

3.1 Isolation of rhizobia from root nodules of Lupinus spp. and soybean

Lupine root nodules were collected from the Kitty Todd Nature Preserve, Swanton, OH,

(September, 2014) and from plants grown in the growth chamber in the Department of

Biological Sciences at Bowling Green State University (January, 2015). The seeds of those growth chamber plants had been collected from lupine populations in Mary’s Savanna, Oak

Openings Preserve, Toledo, OH. In addition, soybean root nodules were collected from soybean fields in Bowling Green, OH regions. The collected nodules were then removed from the root

using a sterile blade and placed in a micro-centrifuge tube. Then they were subjected to a series

of washing steps of surface sterilization, according to a modified protocol of Deng et al. (2011)

as described below.

3.1.1 Surface sterilization

First, the nodules were washed three times with sterile distilled water by vortexing for 30

seconds each time. Then, they were washed with 10% Clorox by vortexing for 30 seconds. Next,

they were washed again with sterile distilled water to remove any remaining Clorox. After that,

they were subjected to a washing step with 70% ethanol for 10 minutes with shaking in the

shaking platform. Finally, the nodules were washed again for three times with sterile distilled

water by vortexing 30 seconds (Deng et al., 2011).

After the process of surface sterilization, the nodules were crushed separately using sterile

forceps in 100 µl of sterile distilled water in a micro-centrifuge tube. Next, serial dilutions of the

crushed solution were made which were then used to make streak and spread plates on Modified

Arabinose Gluconate (MAG) medium. The plates were then incubated for 3-4 days at 30°C. 12

Subsequently, single colonies from each plate were sub-cultured for four times to ensure pure cultures.

3.2 Molecular characterization

3.2.1 DNA isolation

In addition to four strains that were isolated from Ohio, thirteen rhizobial strains were kindly provided by Patrick Elia, Curator, National Rhizobium Germplasm Resource Collection, USDA.

Single colonies that were grown on MAG at 30°C were used to extract genomic DNA of all the strains (Table 1) using ZR Fungal/Bacterial DNA MiniPrep™ kit (Zymo research, CA) according to manufacturer’s instruction. Then the purified DNA was quantified using the

NanoDrop ND-1000 spectrophotometer (Thermo Scientific, DE) and the quality of purified

DNA was assessed using gel electrophoresis.

Table 1: Rhizobial strains incorporated in this study, the sources and the locations from which they have been isolated

Strain Isolated from Isolated location USDA 3040 L. albus Fla, 1940 USDA 3042 L. albus Yugoslavia, 1955 USDA 3051 L. angustifolious GA, 1946 USDA 3063 L. densiflorus CA, 1962 USDA 3044 L. luteus Fla, 1946 USDA 3048 L. luteus Brazil, 1959 USDA 3504 L. mutabilis unknown USDA 3715 L. nanus CA, 1922 USDA 3043 L perennis MD, 1941 13

USDA 3709 L. polyphyllus Nitragin, 1945 USDA 3057a L. subcarnosus Nitragin, Fla, 1946 USDA 3717 L. succulentus CA, 1973 USDA 3060 L. spp Nitragin, unknown L_OO L. perennis Kitty Todd Nature Preserve, Swanton, OH, 2014, this study L_3D52 L. perennis Growth chamber, 2015, this study SB_J Glycine max OH, 2014, this study SB_5 Glycine max OH, 2014, this study

3.2.2 PCR of gene candidates

Taq 2X master mix (New England BioLabs: M0270) was used to amplify 16S rRNA, atpD, glnII and dnaK gene regions of extracted bacterial DNA. 100- 150 ng of genomic DNA was used as the template. PCR conditions recommended in the protocol for Taq 2X master mix were used: initial denaturation at 95°C for 30 seconds, 30 cycles of; denaturaion at 95°C for 15-30 seconds, primer annealing at 45-68°C (depending on the Tm of the primer pair) for 15-60 seconds and extension at 68°C, then final extension at 68°C for 5 minutes followed by holding at 10°C. The extension time is calculated as 1 minute per kb. Information about primers and annealing temperatures for specific primers are shown in tables 2 & 3. 14

Table 2: Primers and PCR conditions for the amplification of Bradyrhizobium spp. genes (Menna et al., 2009a)

Annealing Expected size Target gene Primer Sequence (5’-3’) temperature of the band (Region) (°C) (bp) fD1 AGAGTTTGATCCTGGCTCAG 16S rRNA (9-29) 55 1485

rD1 CTTAAGGAGGTGATCCAGCC 16S rRNA (1474–1494)

TSatpDf TCTGGTCCGYGGCCAGGAAG atpD (189–208) 58 595

TSatpDr CGACACTTCCGARCCSGCCTG atpD (804–784)

TSglnIIf AAGCTCGAGTACATCTGGCTCGACGG glnII (13–38) 57 647

TSglnIIr SGAGCCGTTCCAGTCGGTGTCG glnII (681–660)

BRdnaKf TTCGACATCGACGCSAACGG dnaK (1411–1430) 58 455

BRdnaKr GCCTGCTGCKTGTACATGGC dnaK (1905–1885)

Table 3: Primers and PCR conditions for the amplification of the dnaK gene of Burkholderia, Microvirga, Mesorhizobium and

Rhizobium genera

Annealing Expected Primer Sequence (5’-3’) Reference size of the temperature (°C) band (bp) BUdnaKf GTSTAYGAYCTSGGCGGCGG 58 (Nagata et al., 2005) 900

BUdnaKr GAASGTSACYTCGATCTGCGG

MIdnaKf GAGATCGGCGACGGCGTGTTC 56 (Radl et al., 2014) 746

MIdnaKr GATGCGGATCTGSTGCTCCTTG

MEdnaKf AAGGAGCAGCAGATCCGCATCCA 58 (Gerding et al., 2012) 330

MEdnaKr GTACATGGCCTCGCCGAGCTTCA

RHdnaKf CACSACGATCCCGACSAA 54 (López-López et al., 2010) 650

RHdnaKr TCGTAGTCGGCRTCGACSAC

3.2.3 DNA sequencing and analysis

PCR amplicons of 16S rRNA, atpD, glnII and dnaK genes of all the strains were purified using

Qiagen MinElute PCR Purification kit and were quantified using the NanoDrop ND-1000

spectrophotometer (Thermo Scientific, DE). Then, the purified PCR products were sequenced at

DNA Analysis LLC at Cincinnati, OH.

Once DNA sequences were obtained, they were first analyzed using NCBI BLAST (McEntyre,

Ostell, & Madden, 2003). The cutoff e-value used was 1 x 10-6 with a minimum coverage of

approximately 70% (Gonzalez et al., 2006). In addition, 70% DNA-DNA re-association threshold was used for the identification of species, which is the one and only important criterion used since 1987 for species delineation (Konstantinidis & Tiedje, 2005).

3.2.4 Phylogenetic analysis

The DNA sequences of gene candidates were aligned using ClustalW2 multiple sequence alignment tool (Larkin et al., 2007) and maximum likelihood (ML) phylogenetic trees were inferred using MEGA6 software package with 1000 bootstraps (Tamura et al., 2013).

3.2.4.1 Phylogeny of single gene trees

For the computation of single gene phylogenetic trees, gene sequences of known reference

strains were incorporated that were obtained from the NCBI GenBank Database (Benson et al.,

2015) and the Integrated Microbial Genomes (IMG) Database (Markowitz et al., 2012) (Table 4).

The IMG database maintains microbial genome and metagenome datasets sequenced at the Joint

Genome Institute (JGI) at the United States Department of Energy. The choice of the reference strains for each genus was dependent on the availability of previous records about that particular strain making N2 fixing symbiosis with leguminous plants and the availability of the complete 17 genome sequence in databases. When choosing Burkholderia spp. it was made sure that those strains are plant beneficial strains because there are many pathogenic Burkholderia sp. strains that are considered as phylogenetically different from plant beneficial strains (Angus et al.,

2014). 18

Table 4: Information about the DNA sequences of the reference strains used in phylogenetic analysis

Species Strain Accession no. / IMG Gene ID

16S rRNA atpD glnII dnaK

Bradyrhizobium diazoefficiens USDA 110 NR_074322.1a NC_004463.1a NC_004463.1a NC_004463.1a Bradyrhizobium daqingense CGMCC 1.10947 2596849087b 2596843584b 2596844579b 2596843831 b Bradyrhizobium elkanii WSM1741 2513694649b 2513695301b 2513692556 b 2513695064 b Bradyrhizobium yuanmingense CGMCC 1.3531 2596918164b 2596919055 b 2596920471 b 2596918860 b Bradyrhizobium huanghuaihaiense CGMCC 1.10948 2596982279 b 2596975684b 2596979525b 2596975428b Bradyrhizobium japonicum USDA 6 2511997030b 2511995921b 2513662812b 2511996162b Mesorhizobium loti MAFF303099 2596918164b 637076488b 637073590b NC_002678.2a Mesorhizobium alhagi CCNWXJ12-2 2514587298b * 2514587350b 2514586487b Mesorhizobium ciceri WSM1271 NC_014923a 649871049b 649873526b 649870594b Mesorhizobium australicum WSM2073 2509394613b 2509394154b 2509397135b 2509393630b Mesorhizobium metallidurans STM 2683 2601505225b 2601504724b 2601506641b 2601504159b Mesorhizobium opportunistum WSM2075 2503199683b 2503199217b 2503202630b 2503198743b Mesorhizobium amorphae CCNWGS0123 2514416430b * 2514417309b Rhodopseudomonas palustris DX-1 649839171b 649837789b 649841704b 649837619b Rhizobium tropici CIAT_899 NR_102511.1a 2524421805b 2524419063b 2524418614b Rhizobium multihospitium HAMBI 2975 2616551835b 2616557675b 2616553289b 2616551680b Rhizobium giardinii H152T 2514002513b * 2513996665b 2514001597b 19

Rhizobium alamii YR540 2585227592b * 2585221953b 2585223201b Rhizobium loessense CGMCC 2596901882b 2596899519b 2596896711b 2596896745b Rhizobium mongolense USDA 1844 2513930752b 2513928522b 2513924297b 2513924262b Rhizobium mesoamericanum STM3625 2537420238b 2537420370b 2537421941b 2537416751b Rhizobium etli CFN 42 640437097b 640440878b 640440115b 640437182b Rhizobium leguminosarum CCGE 510 2530650189b 2530647440b 2530646549b 2530648392b Rhizobium rhizogenes CF262 2587978724b 2530647440b 2587979059b 2587978481b Burkholderia phymatum STM815 NR_074668.1a 642594831b 642593265b 642594287b Burkholderia mimosarum NBRC 106338 2600796967b 2600790698b 2600791842b 2600789814b Burkholderia tuberum STM678 2512348064b 2512346960b 2512345484b 2512347522b Burkholderia xenovorans LB400 2607186426b 637949601b 2607184451b 637945690b Burkholderia pseudomallei K96243 640705518b 637569407b 637568300b 637568821b Microvirga lupini Lut6 2508725373b 2508734351b 2508728833b 2508727620b Microvirga lotononidis WSM3557 2509076004b 2509079259b 2509075706b 2509077502b Microvirga guangxiensis CGMCC 1.7666 2596960782b 2596957129b 2596959864b 2596957490b Streptobacillus moniliformis DSM 12112 NR_074449.1a 646426574b 646426302b 646426905b Campylobacter jejuni jejuni NCTC 11168 2608345134b 2608345210b 2608345793b 2608345849b Helicobacter pylori OK113 2598008753b 2598009033b 2598009653b 2598010026b

*gene sequences were not used in glnII phylogenetic analysis and hence were not used in concatenation. a gene sequences were obtained from NCBI GenBank Database. b gene sequences were obtained from Integrated Microbial Genomes (IMG) Database, United States Department of Energy. 20

3.2.4.2 Phylogeny of concatenated gene sequences

An approach was taken towards computing a tree using concatenated DNA sequences of all gene

candidates. However, since all four genes could not be amplified in all the strains, concatenation

of DNA sequences were conducted as four different combinations as shown in table 5 leading to

four concatenated phylogenetic trees. These concatenation combinations were based on the

successfulness of gene amplification.

Table 5: Concatenation of DNA sequences based on the availability of DNA sequences

Strains Available DNA sequences which were

used in concatenation

USDA 3040, USDA 3051, USDA 3063, USDA 16S rRNA, atpD, glnII and dnaK

3044, USDA 3048, USDA 3715, USDA 3709,

USDA 3060, USDA 3504 and SB_J

USDA 3042 and USDA 3717 16S rRNA, atpD and glnII

SB_5 and L_3d52 16S rRNA, glnII and dnaK

USDA 3057a, USDA 3043 and L_OO 16S rRNA and dnaK

In addition to the sequences of the above mentioned strains, sequences of reference strains

(Table 4) were also incorporated in computing phylogenetic trees using concatenated data.

CHAPTER IV. RESULTS

4.1 DNA Quantification and quality analysis

Table 6: Spectrophotometric measurements of extracted genomic DNA of all USDA strains and isolated strains

Strain DNA Concentration A260 260/280

ng/µl

USDA 3040 8.2 0.163 1.83

USDA 3042 59.2 1.183 1.66

USDA 3051 5.3 0.107 2.19

USDA 3063 15.1 0.303 1.65

USDA 3044 93.7 1.875 1.84

USDA 3048 45.0 0.900 1.78

USDA 3504 30.6 0.611 1.63

USDA 3715 34.1 0.682 1.56

USDA 3043 91.9 1.837 1.84

USDA 3709 26.6 0.533 1.53

USDA 3057a 100.1 2.001 1.85

USDA 3717 41.4 0.828 1.82

USDA 3060 75.0 1.500 1.85

L_3d52 80.7 1.613 1.55

L_OO 102.4 2.047 1.92

SB_J 89.3 1.786 1.81 22

SB_5 74.6 1.493 1.88

Figure 1: Agarose gel electrophoresis of extracted genomic DNA of representative strains.

Five µg of DNA per lane. Lanes L= 1kb ladder; A=USDA 3044, B= USDA 3048, C= USDA

3504, D= USDA 3715, E= USDA 3043, F= USDA 3709, G= USDA 3057a, H= USDA 3717, I=

USDA 3060 and J=L_3d52.

4.2 Gel electrophoresis of PCR products

DNA profiles were obtained for all the strains after amplification with primers specific for their corresponding genes. Bands observed after gel electrophoresis were differing in intensity and varying in size from 300 to 2000 bp. 23

When extracted DNA of all the strains was subjected to the PCR amplification of the 16S rRNA gene, a unique band of approximately 1500bp was observed from USDA 3040, 3042, 3051,

3063, 3044, 3048, 3504, 3715, 3043, 3709, 3057a, 3060 and L_3d52 (Figures 2 & 3). Similarly, with the PCR of the glnII gene, a band of approximately 650 bp was obtained from USDA 3040,

3042, 3051, 3063, 3044, 3048, 3504, 3715 and 3709 (Figures 2 & 4). With the PCR of the atpD

gene, a band of approximately 600 bp was obtained from USDA 3040, 3042, 3051, 3063, 3044,

3048, 3715, 3709, 3057a and 3060 (Figures 2 & 3). For the samples in which the expected band

was not observed, the PCR was repeated with further optimizations such as the annealing

temperature and the amount of template. Those results are not shown here. 24

Figure 2: Agarose gel electrophoresis of PCR products of 16S rRNA, atpD and glnII gene regions. Lanes L = 1kb ladder; A-G = 16S rRNA ; A=negative control, B= USDA 3040, C=

USDA 3042, D= USDA 3051, E= USDA 3063, F=colony B, isolated from lupine and G= colony

D, a commercial rhizobial strain; H-O = glnII; H=negative control, I= USDA 3040, J= USDA

3042, K= USDA 3051, M= USDA 3063, N=colony B, isolated from lupine and O=colony D, a commercial rhizobial strain; P-V = atpD; P=negative control, Q= USDA 3040, R= USDA 3042,

RS= USDA 3051, T= USDA 3063, U=colony B, isolated from lupine and V= colony D, a commercial rhizobial strain. Strains represented by colonies B and D are not included in this study since they did not produce successful results in initial PCR amplification steps. 25

J K L

Figure 3: Agarose gel electrophoresis of PCR products of 16S rRNA and atpD gene regions.

Lanes L = 1kb ladder; A-N (top row) = 16S rRNA; A=negative control, B=USDA 3042, C=

USDA 3044, D= USDA 3048, E= USDA 3504, F= USDA 3715, G= USDA 3043, H= USDA

3709, I= USDA 3057a, J= USDA 3717, K= USDA 3060, M=L_3d52_1 and N=L_3d52_2; O-1

(bottom row) = atpD; O=negative control, P= USDA 3042, Q= USDA 3044, R= USDA 3048,

S= USDA 3504, T= USDA 3715, U= USDA 3043, V= USDA 3709, W= USDA 3057a, X=

USDA 3717, Y= USDA 3060, Z=L_3d52_1 and 1= L_3d52_2 . 26

After the PCR products of 16S rRNA gene region of all the strains were sequenced, the obtained

DNA sequences were analyzed using NCBI-BLAST with a cutoff e-value of 1 x 10-6. According to sequence analysis of 16S rRNA gene, most of the USDA strains were identified as

Bradyrhizobium sp. whereas a few others were identified as Mesorhizobium sp. and Microvirga sp. However, the strains L_OO and L_3d52 (isolated from lupine root nodules) were identified as Burkholderia sp. and Rhizobium sp. respectively. Therefore, in order to confirm the identity of these strains dnaK gene also was incorporated into the study.

Figure 4: Agarose gel electrophoresis of PCR products of glnII gene regions. Lanes L = 1kb ladder; A=negative control, B=USDA 3042, C= USDA 3044, D= USDA 3048, E= USDA 3504,

F= USDA 3715, G= USDA 3043, H= USDA 3709, I= USDA 3057a, J= USDA 3060, K= USDA

3717 and M= L_3d52 respectively. PCR was repeated with samples in lanes G, I, J, K and M since the expected band was not observed in this. Results are not shown. 27

When PCR amplification of all USDA strains and soybean isolated strains were conducted using dnaK primers specific for Bradyrhizobium genus, a band of approximately 500 bp was observed with most of them as expected (Figure 5).

Figure 5: Agarose gel electrophoresis of PCR products of dnaK gene regions with

Bradyrhizobium specific primers. Lanes L = 1kb ladder; A=negative control, B=USDA 3042,

C= USDA 3044, D= USDA 3048, E= USDA 3504, F= USDA 3715, G= USDA 3043, H= USDA

3709, I= USDA 3057a, J= USDA 3717, K= USDA 3060, M=L_3d52, N=SB_J and O=SB_5.

PCR was repeated with samples in lanes G, I, J and M since the expected band was not observed in this. Results are not shown. 28

The DNA of L_OO and L_3d52 strains were subjected for the PCR amplification using dnaK primers specific for Burkholderia and Rhizobium genera respectively based on their identities obtained from 16S rRNA sequence analysis. Temperature gradient PCR was performed to optimize the annealing temperature and bands of approximately 900 and 650 bp were obtained respectively with L_OO and L_3d52 at all the temperatures used. The most intense band was observed at 58°C for L_OO and at 54 °C for L_3d52 (Figures 6 and 7).

Figure 6: Agarose gel electrophoresis of temperature gradient PCR products of L_OO dnaK gene regions with Burkholderia specific primers. Lanes L= 1kb ladder; A = negative control; B=54, C=56, D=58, E=60, F=62 and G=64 °C of annealing temperature. 29

Figure 7: Agarose gel electrophoresis of temperature gradient PCR products of L_3d52 dnaK gene regions with Rhizobium specific primers. Lanes L= 1kb ladder; A = negative control; B=50, C=52, D=54, E=56 and F=58 °C of annealing temperature.

4.3 Phylogenetic analysis of root nodule symbionts based on 16S rRNA, glnII, atpD and dnaK genes

4.3.1 Phylogeny of the 16S rRNA gene

According to the maximum likelihood phylogenetic tree resulted from 16S rRNA sequences, five distinct clades can be identified each for Bradyrhizobium, Mesorhizobium, Rhizobium,

Microvirga and Burkholderia genera. The strains USDA 3051, 3042, 3709, 3040, SB_5 and

SB_J group with Bradyrhizobium spp. whereas, the strains USDA 3044, 3048, 3060 and 3057a 30

group with Microvirga spp. with Microvirga lupini Lut6 being the closest relative with a bootstrap support of 93%. The strains USDA 3063 and 3717 cluster with the Mesorhizobium spp. and the lupine isolated strain L_3d52 groups with Rhizobium spp. with Rhizobium tropici and

Rhizobium multihospitium being the closest relatives with a bootstrap support of 98%. In addition, USDA 3043 and L_OO group with Burkholderia spp. USDA 3715 and USDA 3504 do not group closely with any of the five genera. However, the taxonomic position of USDA 3715 is closer to Mesorhizobium spp. whereas that of USDA 3504 is closer to Burkholderia spp. according to the 16S rRNA phylogeny (Figure 8). 31

Figure 8: Maximum-likelihood phylogenetic tree of rhizobial strains isolated from lupine and soybean root nodules and representative strains of named genera, based on 16S rRNA gene sequences (1485 bp). The significance of each branch is indicated by the bootstrap percentage calculated for 1000 bootstraps. The bootstrap values greater than 70% are indicated at 32 nodes. The 16S rRNA sequences of Campylobacter jejuni NCTC 11168 and Helicobacter pylori

OK113 were used as outgroups.

4.3.2 Phylogeny of the dnaK gene

Figure 9: Maximum-likelihood phylogenetic tree of rhizobial strains isolated from lupine and soybean root nodules and representative strains of named genera, based on dnaK gene 33 sequences. The significance of each branch is indicated by the bootstrap percentage calculated for 1000 bootstraps. The bootstrap values greater than 70% are indicated at nodes. The dnaK sequences of Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK113 were used as outgroups.

According to the dnaK phylogeny USDA 3709, 3060, 3040, 3044, 3504, 3048, 3051, 3715, SB_J and SB_5 cluster with Bradyrhizobium spp. The strain L_3d52 groups with Rhizobium spp. with

Rhizobium tropici and Rhizobium multihospitium being the closest relatives. Furthermore, L_00,

USDA 3043 and USDA 3063 group with Burkholderia spp. USDA 3057a does not cluster with any of the five genera, but taxonomically closer to Mesorhizobium spp (Figure 9).

4.3.3 Phylogeny of the glnII gene

According to the glnII phylogeny, USDA 3709, 3060, 3040, 3042, 3044, 3048, 3051, 3715 and

SB_J cluster with Bradyrhizobium spp. Among those, SB_J groups with Bradyrhizobium japonicum USDA 110 with 98% bootstrap support. In addition, L_3d52 and USDA 3504 group with Rhizobium spp. whereas USDA 3717 and 3063 group with Mesorhizobium spp. with

Mesorhizobium ciceri being the closest relative that has a 92% bootstrap value. However, the soybean isolated strain SB_5 groups with two outgroups, Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK113 with 100% bootstrap value which was really unpredicted (Figure

10). 34

Figure 10: Maximum-likelihood phylogenetic tree of rhizobial strains isolated from lupine and soybean root nodules and representative strains of named genera, based on glnII gene sequences. The significance of each branch is indicated by the bootstrap percentage calculated for 1000 bootstraps. The bootstrap values greater than 70% are indicated at nodes. The glnII 35 sequences of Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK113 were used as outgroups.

4.3.4 Phylogeny of the atpD gene

Figure 11: Maximum-likelihood phylogenetic tree of rhizobial strains isolated from lupine and soybean root nodules and representative strains of named genera, based on atpD gene 37 sequences. The significance of each branch is indicated by the bootstrap percentage calculated for 1000 bootstraps. The bootstrap values greater than 70% are indicated at nodes. The glnII sequences of Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK113 were used as outgroups.

According to the atpD phylogeny, USDA 3709, 3060, 3040, 3042, 3044, 3504, 3048, 3051, 3715 and SB_J cluster with Bradyrhizobium spp. out of which the strain SB_J groups with

Bradyrhizobium japonicum USDA 110 with 84% bootstrap support. In addition, USDA 3063 and 3717 group with Mesorhizobium spp. (Figure 11).

4.3.5 Phylogeny of the concatenated dataset

4.3.5.1 Concatenation of 16S rRNA, atpD, glnII and dnaK sequences

According to figure 12, USDA 3040, 3051, 3709 and SB_J strains group with Bradyrhizobium spp. with >96% bootstrap support. In addition, USDA 3044, 3048 and 3060 cluster with

Microvirga spp. Further, USDA 3063 groups with Mesorhizobium spp. with Mesorhizobium australicum being the closest relative that has 97% bootstrap support. The strains USDA 3715 and USDA 3504 do not closely cluster with any of the five genera used. 38

Figure 12: Maximum-likelihood phylogenetic tree of rhizobial strains isolated from lupine and soybean root nodules and representative strains of named genera, computed from the concatenation of 16S rRNA, atpD, glnII and dnaK gene sequences. The significance of each 39 branch is indicated by the bootstrap percentage calculated for 1000 bootstraps. The bootstrap values greater than 70% are indicated at nodes. The concatenated sequences of Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK113 were used as outgroups. 40

4.3.5.2 Concatenation of 16S rRNA, atpD and glnII sequences

Figure 13: Maximum-likelihood phylogenetic tree of USDA 3042 and 3717, computed from the concatenation of 16S rRNA, atpD and glnII gene sequences. The significance of each branch is indicated by the bootstrap percentage calculated for 1000 bootstraps. The bootstrap 41 values greater than 70% are indicated at nodes. The concatenated sequences of Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK113 were used as outgroups.

According to the maximum-likelihood phylogenetic tree computed from concatenated sequences of 16S rRNA, atpD and glnII of USDA 3042, 3717 and reference strains, USDA 3042 clusters with Rhodopseudomonas palustris DX-1 with 100% bootstrap support whereas, USDA 3717 groups with Mesorhizobium ciceri WSM 1271 with a bootstrap value of 99%. However, the two outgroup strains Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK113 do not show up as outgroups in this concatenated tree. Instead they appear as an ingroup being taxonomically closer to Burkholderia spp. (Figure 13).

4.3.5.3 Concatenation of 16S rRNA, dnaK and glnII sequences

According to the maximum-likelihood phylogenetic tree computed from concatenated sequences of 16S rRNA, dnaK and glnII of L_3d52, SB_5 and reference strains, L_3d52 clusters with

Rhizobium spp. whereas, SB_5 groups with Bradyrhizobium spp. As similar as in the concatenated tree of 16S rRNA, atpD and glnII sequences, the two outgroup strains

Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK113 appear as an ingroup in this concatenated tree as well. However, Rhodopseudomonas palustris DX-1 appears as an outgroup

(Figure 14). 42

Figure 14: Maximum-likelihood phylogenetic tree of L_3d52 and SB_5, computed from the concatenation of 16S rRNA, dnaK and glnII gene sequences. The significance of each branch is indicated by the bootstrap percentage calculated for 1000 bootstraps. The bootstrap 43 values greater than 70% are indicated at nodes. The concatenated sequences of Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK113 were used as outgroups. 44

4.3.5.4 Concatenation of 16S rRNA and dnaK sequences

Figure 15: Maximum-likelihood phylogenetic tree of L_OO, USDA 3043 and USDA 3057a, computed from the concatenation of 16S rRNA and dnaK gene sequences. The significance of each branch is indicated by the bootstrap percentage calculated for 1000 bootstraps. The 45

bootstrap values greater than 70% are indicated at nodes. The concatenated sequences of

Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK113 were used as outgroups.

According to the maximum-likelihood phylogenetic tree computed from concatenated sequences

of 16S rRNA and dnaK of USDA L_OO, USDA 3057a, USDA 3043 and reference strains,

L_OO and USDA 3043 cluster with Burkholderia spp. whereas, USDA 3057a group with

Microvirga spp. with Microvirga lupini Lut6 being the closest relative with a bootstrap value of

94%. In this concatenated tree also, the two outgroup strains Campylobacter jejuni NCTC 11168

and Helicobacter pylori OK113 appear as an ingroup and Rhodopseudomonas palustris DX-1

appears as an outgroup (Figure 15). 46

CHAPTER V. DISCUSSION

Analysis of the 16S rRNA showed that it is highly conserved among different species of bacteria and hence they share highly conserved primer binding sites making the amplification process less primer specific and easier (Pereira et al., 2010).

The glnII gene could be amplified only in 14 strains (Figures 2 and 4). The expected bands were not given by USDA 3043 and 3057a even after further optimization. When 16S rRNA sequence analysis was used, USDA 3043 was identified as Burkholderia sp. and USDA 3057a as

Microvirga sp. This might be a reason for the gene being not amplified with glnII primers specific for Bradyrhizobium spp.

When the amplification of the atpD gene is considered, the expected band has not been produced by USDA 3043, 3057a, SB_5 and L_3d52 (Figures 2 and 3). When single genes were used to build the phylogenetic tree, USDA 3043, 3057a and L_3d52 have been identified as

Burkholderia sp., Microvirga sp. and Rhizobium sp. respectively with 16S rRNA sequence analysis. Hence, the failure to get amplified this gene in these strains can be attributed to the use of inappropriate primers that are specific for Bradyrhizobium spp. However, the situation is different with SB_5, which has been identified as Bradyrhizobium sp. with all three other genes.

One possible reason for the atpD gene of SB_5 being not amplified with Bradyrhizobium spp. specific primers is the lack of a combination of required conditions such as appropriate template volume and annealing temperature. This requires further optimizations.

For the amplification of the dnaK gene, primers specific for different genera were employed. The choice of primers was dependent on the results of sequence analysis of other three genes (16S rRNA, glnII and atpD). Accordingly, the DNA of USDA 3040, 3051, 3044, 3048, 3504, 3715, 47

3709, 3060, SB_J and SB_5 produced the expected band with Bradyrhizobium spp. specific primers whereas USDA 3063 gave the band with Mesorhizobium spp. specific primers. In addition, the expected band was observed for USDA 3057a with Microvirga spp. specific primers, for USDA 3043 and L_OO with Burkholderia spp. specific primers and for L_3d52 with Rhizobium spp. specific primers. Altogether, bands have been observed with 15 strains.

Successful amplifications of the expected fragments have also not been produced with USDA

3042 and 3717, which can be again attributed to the lack of the required combination of conditions.

When single gene trees obtained with each of the 16S rRNA, dnaK, glnII and atpD genes are considered they all are not in 100% agreement. USDA 3040, 3709, 3051 and SB_J strains group with Bradyrhizobium spp. in all 4 trees indicating that these strains should belong to the genus

Bradyrhizobium. The strain USDA 3051 has been already identified recently as Bradyrhizobium lupini, consistent with the relationship obtained in this study (Peix et al., 2015). In addition,

USDA 3044, 3048 and 3060 strains group with Microvirga spp. in the 16s rRNA tree whereas they all group with Badyrhizobium spp. in all 3 housekeeping gene trees. The strains USDA

3042, 3504, 3715 and SB_5 cluster with Bradyrhizobium spp. only in some of the four marker gene phylogenies. Further, USDA 3717 and 3063 group with Mesorhizobium spp. in 16S rRNA, atpD and dnaK phylogenetic trees. Moreover, USDA 3043 and the lupine isolated L_OO strain, cluster with Burkholderia spp. in 16S rRNA and dnaK trees. USDA 3057a groups with

Microvirga spp. only in the 16S rRNA tree whereas the lupine isolated L_3d52 strain clusters with Rhizobium spp. in all phylogenetic trees except the atpD based one.

Accordingly, there were discrepancies among the four single gene phylogenetic trees. This incongruence can be attributed to the processes like coalescent, gene flow, selection, 48

hybridization, and gene duplication (Kubatko & Degnan, 2007). The disagreement in the

observed single gene trees directed the study towards computing phylogenetic trees using

concatenated DNA sequences of all gene candidates. Trees generated by the concatenation of

sequences are considered as reflecting explicit information about the identities of bacterial

strains. In most cases, the concatenation of different genes allows significant increases in discrimination power and the robustness of the phylogenetic tree (Devulder et al., 2005).

However, for some of the strains studied, the identities based on concatenated trees contradicted

the phylogenies made based on single gene trees. For instance, the strain USDA 3042 which was

identified as Bradyrhizobium spp. in 16S rRNA, atpD and glnII single gene trees, group with

Rhodopseudomonas palustris in the concatenated gene tree of 16S rRNA, atpD and glnII genes with 100% bootstrap support. Rhodopseudomonas palustris is a purple photosynthetic bacterium that belongs to the order Rhizobiales of Alphaproteobacteria. It is widely distributed in nature

and has been isolated from sources such as swine waste lagoons, earthworm droppings, marine

coastal sediments and pond water. It can fix atmospheric nitrogen and possesses structural genes

for three different nitrogenases, a molybdenum-dependent nitrogenase, a vanadium-dependent

nitrogenease and an alternative iron nitrogenase. In addition it encodes assembly genes for these

nitrogenases and also related cofactors. Moreover, this species is phylogenetically closer to the

unusual photosynthetic Bradyrhizobium sp. strain ORS278 sharing 75% amino acid identity.

However, Rhodopseudomonas palustris has never been found in symbiotic association with

plants, and its genome lacks nodulation genes which questions the identities based on the

concatenated gene tree (Larimer et al., 2004).

Although, the concatenation of sequences from multiple genes into a single supergene is thought

to maximize the power in making phylogenetic inferences, analytical results have shown that 49 phylogenetic analysis of concatenated sequences can positively mislead inference of species relationships (Edwards et al., 2007). The performance of the concatenation approach under conditions in which there was a disagreement among single gene trees has been studied by

Kubatko and Degnan (2006) who found that it leads to statistically inconsistent estimations.

Furthermore, they have shown that the use of bootstrap to measure the reliability of the inferred phylogeny can even result in moderate to strong support for an incorrect tree (Kubatko &

Degnan, 2007).

In phylogenetic construction, rooting the phylogenetic tree is considered as a vital step since it defines the position of the ancestor on the tree. The outgroup method is the most widely used strategy with respect to rooting a phylogenetic tree (Hess & De Moraes Russo, 2007). In this study the strains Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK113 have been used as outgroups. Both of them belong to the class Epsilonproteobacteria of the phylum

Proteobacteria whereas all the other strains included in this study belong to the classes,

Alphaproteobacteria and Betaproteobacteria (Brenner et al., 2005). However, in three of the four concatenated gene trees, the two outgroups do not show up as outgroups and instead appear as ingroups with very high bootstrap support which is really unlikely. It has been found that the correct positioning of the root strongly depends on the availability of a proper outgroup (Tarrio et al., 2001). In addition, issues such as long branch attraction, differences in nucleotide composition between taxa and long edge attraction have been identified as factors that mislead outgroup rooting. In such a situation, the method of mid-point rooting (MPR) has been proven to be useful in rooting phylogenetic trees, since it does not depend on the existence of an outgroup

(Hess & De Moraes Russo, 2007). 50

In order to lead this experiment into a more precise conclusion through accurate identification of

nodule symbionts, more marker genes could be incorporated in to the study such as nod genes

(Hungria, Menna, & Delamuta, 2015). In addition, Average Nucleotide Identity (ANI) could be

employed. This method is based on measuring the average nucleotide identity between two

genomes, and is considered as providing more promising results (Richter & Rossello-Mora,

2009). The species delineation cutoff of ANI method is 96% which is equal to 70% in DNA-

DNA hybridization methods (Kumar et al., 2015).

Furthermore, when there is a substantial incongruence among single gene trees, sampling more

individuals per species may be beneficial. However this can be helpful only in some settings,

such as breaking up long branches. If short branches occur deep in the tree or the disagreement is

due to some other factor, then increased levels of sampling are not expected to improve

phylogenetic accuracy (Maddison & Knowles, 2006).

CHAPTER VI. CONCLUSION

According to the congruence of single gene trees of 16S rRNA, atpD, glnII and dnaK, the strains

USDA 3040, 3051, 3709 and SB_J are identified as members that belong to the genus

Bradyrhizobium. In addition, L_3d52 strain is identified as Rhizobium sp. whereas USDA 3063 and 3717 are proven to be Mesorhizobium sp. Furthermore, USDA 3043 and L_OO are recognized as Burkholderia sp. whereas USDA 3057a is identified as Microvirga sp.

However, further experiments and analysis are needed to confirm the above mentioned identities and also to resolve the identities of the rest of the studied strains that are not in agreement among generated phylogenetic trees. 52

REFERENCES

Angus, A. A., Agapakis, C. M., Fong, S., Yerrapragada, S., Estrada-de los Santos, P., Yang, P., .

. . de Faria, S. M. (2014). Plant-associated symbiotic Burkholderia species lack hallmark

strategies required in mammalian pathogenesis.

Ardley, J. K., Parker, M. A., De Meyer, S. E., Trengove, R. D., O'Hara, G. W., Reeve, W. G., . . .

Howieson, J. G. (2012). Microvirga lupini sp. nov., Microvirga lotononidis sp. nov. and

Microvirga zambiensis sp. nov. are Alphaproteobacterial root-nodule bacteria that

specifically nodulate and fix nitrogen with geographically and taxonomically separate

legume hosts. International Journal of Systematic and Evolutionary Microbiology, 62(Pt

11), 2579-2588. doi:10.1099/ijs.0.035097-0 [doi]

Batista, L., Tomasco, I., Lorite, M. J., Sanjuán, J., & Monza, J. (2013). Diversity and phylogeny

of rhizobial strains isolated from Lotus uliginosus grown in Uruguayan soils. Applied Soil

Ecology, 66, 19-28.

Behrmann, I., Hillemann, D., Puhler, A., Strauch, E., & Wohlleben, W. (1990). Overexpression

of a Streptomyces viridochromogenes gene (glnII) encoding a glutamine synthetase similar

to those of eukaryotes confers resistance against the antibiotic phosphinothricyl-alanyl-

alanine. Journal of Bacteriology, 172(9), 5326-5334.

Benson, D. A., Clark, K., Karsch-Mizrachi, I., Lipman, D. J., Ostell, J., & Sayers, E. W. (2015).

GenBank. Nucleic Acids Research, 43(Database issue), D30-5. doi:10.1093/nar/gku1216

[doi] 53

Brenner, D. J., Krieg, N. R., Garrity, G. M., & Staley, J. T. (2005). Bergey's manual of

systematic bacteriology.

Chahboune, R., Carro, L., Peix, A., Ramirez-Bahena, M. H., Barrijal, S., Velazquez, E., &

Bedmar, E. J. (2012). Bradyrhizobium rifense sp. nov. isolated from effective nodules of

cytisus villosus grown in the moroccan rif. Systematic and Applied Microbiology, 35(5),

302-305. doi:10.1016/j.syapm.2012.06.001 [doi]

Degefu, T., Wolde-Meskel, E., Liu, B., Cleenwerck, I., Willems, A., & Frostegard, A. (2013).

Mesorhizobium shonense sp. nov., Mesorhizobium hawassense sp. nov. and Mesorhizobium

abyssinicae sp. nov., isolated from root nodules of different agroforestry legume trees.

International Journal of Systematic and Evolutionary Microbiology, 63(Pt 5), 1746-1753.

doi:10.1099/ijs.0.044032-0 [doi]

Deng, Z. S., Zhao, L. F., Kong, Z. Y., Yang, W. Q., Lindstrom, K., Wang, E. T., & Wei, G. H.

(2011). Diversity of endophytic bacteria within nodules of the Sphaerophysa salsula in

different regions of loess plateau in china. FEMS Microbiology Ecology, 76(3), 463-475.

doi:10.1111/j.1574-6941.2011.01063.x [doi]

Devulder, G., Perouse de Montclos, M., & Flandrois, J. P. (2005). A multigene approach to

phylogenetic analysis using the genus Mycobacterium as a model. International Journal of

Systematic and Evolutionary Microbiology, 55(Pt 1), 293-302. doi:55/1/293 [pii]

Duran, D., Rey, L., Sanchez-Canizares, C., Navarro, A., Imperial, J., & Ruiz-Argueso, T. (2013).

Genetic diversity of indigenous rhizobial symbionts of the Lupinus mariae-josephae

endemism from alkaline-limed soils within its area of distribution in Eastern Spain. 54

Systematic and Applied Microbiology, 36(2), 128-136. doi:10.1016/j.syapm.2012.10.008

[doi]

Edwards, S. V., Liu, L., & Pearl, D. K. (2007). High-resolution species trees without

concatenation. Proceedings of the National Academy of Sciences of the United States of

America, 104(14), 5936-5941. doi:0607004104 [pii]

Gaunt, M. W., Turner, S. L., Rigottier-Gois, L., Lloyd-Macgilp, S. A., & Young, J. P. (2001).

Phylogenies of atpD and recA support the small subunit rRNA-based classification of

rhizobia. International Journal of Systematic and Evolutionary Microbiology, 51(Pt 6),

2037-2048.

Gerding, M., O’Hara, G. W., Bräu, L., Nandasena, K., & Howieson, J. G. (2012). Diverse

Mesorhizobium spp. with unique nodA nodulating the South African legume species of the

genus Lessertia. Plant and Soil, 358(1-2), 385-401.

González‐Sama, A., Lucas, M. M., De Felipe, M. R., & Pueyo, J. J. (2004). An unusual infection

mechanism and nodule morphogenesis in white lupin (Lupinus albus). New Phytologist,

163(2), 371-380.

Gonzalez, V., Santamaria, R. I., Bustos, P., Hernandez-Gonzalez, I., Medrano-Soto, A., Moreno-

Hagelsieb, G., . . . Davila, G. (2006). The partitioned rhizobium etli genome: Genetic and

metabolic redundancy in seven interacting replicons. Proceedings of the National Academy

of Sciences of the United States of America, 103(10), 3834-3839. doi:0508502103 [pii] 55

Hess, P. N., & De Moraes Russo, Claudia A. (2007). An empirical test of the midpoint rooting

method. Biological Journal of the Linnean Society, 92(4), 669-674.

Hungria, M., Menna, P., & Delamuta, J. R. M. (2015). Bradyrhizobium, the ancestor of all

rhizobia: Phylogeny of housekeeping and nitrogen-fixation genes. Biological Nitrogen

Fixation, 2 Volume Set, , 191.

Janda, J. M., & Abbott, S. L. (2007). 16S rRNA gene sequencing for bacterial identification in

the diagnostic laboratory: Pluses, perils, and pitfalls. Journal of Clinical Microbiology,

45(9), 2761-2764. doi:JCM.01228-07 [pii]

Jarvis, B., Van Berkum, P., Chen, W., Nour, S., Fernandez, M., Cleyet-Marel, J., & Gillis, M.

(1997). Transfer of rhizobium loti, rhizobium huakuii, rhizobium ciceri, rhizobium

mediterraneum, and rhizobium tianshanense to mesorhizobium gen. nov. International

Journal of Systematic Bacteriology, 47(3), 895-898.

Konstantinidis, K. T., & Tiedje, J. M. (2005). Towards a genome-based taxonomy for

prokaryotes. Journal of Bacteriology, 187(18), 6258-6264. doi:187/18/6258 [pii]

Kost, T., Stopnisek, N., Agnoli, K., Eberl, L., & Weisskopf, L. (2013). Oxalotrophy, a

widespread trait of plant-associated Burkholderia species, is involved in successful root

colonization of lupin and maize by Burkholderia phytofirmans. Frontiers in Microbiology, 4

Kubatko, L. S., & Degnan, J. H. (2007). Inconsistency of phylogenetic estimates from

concatenated data under coalescence. Systematic Biology, 56(1), 17-24. 56

Kumar, N., Lad, G., Giuntini, E., Kaye, M. E., Udomwong, P., Shamsani, N. J., . . . Bailly, X.

(2015). Bacterial genospecies that are not ecologically coherent: Population genomics of

Rhizobium leguminosarum. Open Biology, 5(1), 140133.

Larimer, F. W., Chain, P., Hauser, L., Lamerdin, J., Malfatti, S., Do, L., . . . Lang, A. S. (2004).

Complete genome sequence of the metabolically versatile photosynthetic bacterium

Rhodopseudomonas palustris. Nature Biotechnology, 22(1), 55-61.

Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., . .

. Higgins, D. G. (2007). Clustal W and clustal X version 2.0. Bioinformatics (Oxford,

England), 23(21), 2947-2948. doi:btm404 [pii]

López-López, A., Rogel, M. A., Ormeno-Orrillo, E., Martínez-Romero, J., & Martínez-Romero,

E. (2010). Phaseolus vulgaris seed-borne endophytic community with novel bacterial

species such as Rhizobium endophyticum sp. nov. Systematic and Applied Microbiology,

33(6), 322-327.

Maddison, W. P., & Knowles, L. L. (2006). Inferring phylogeny despite incomplete lineage

sorting. Systematic Biology, 55(1), 21-30. doi:Q1126T60VN7L1015 [pii]

Markowitz, V. M., Chen, I. M., Palaniappan, K., Chu, K., Szeto, E., Grechkin, Y., . . . Kyrpides,

N. C. (2012). IMG: The integrated microbial genomes database and comparative analysis

system. Nucleic Acids Research, 40(Database issue), D115-22. doi:10.1093/nar/gkr1044

[doi]

McEntyre, J., Ostell, J., & Madden, T. (2003). The BLAST sequence analysis tool. 57

Menna, P., Barcellos, F. G., & Hungria, M. (2009a). Phylogeny and taxonomy of a diverse

collection of Bradyrhizobium strains based on multilocus sequence analysis of the 16S rRNA

gene, ITS region and glnII, recA, atpD and dnaK genes. International Journal of Systematic

and Evolutionary Microbiology, 59(Pt 12), 2934-2950. doi:10.1099/ijs.0.009779-0 [doi]

Menna, P., Barcellos, F. G., & Hungria, M. (2009b). Phylogeny and taxonomy of a diverse

collection of Bradyrhizobium strains based on multilocus sequence analysis of the 16S rRNA

gene, ITS region and glnII, recA, atpD and dnaK genes. International Journal of Systematic

and Evolutionary Microbiology, 59(Pt 12), 2934-2950. doi:10.1099/ijs.0.009779-0 [doi]

Nagata, Y., Matsuda, M., Komatsu, H., Imura, Y., Sawada, H., Ohtsubo, Y., & Tsuda, M.

(2005). Organization and localization of the dnaA and dnaK gene regions on the

multichromosomal genome of Burkholderia multivorans ATCC 17616. Journal of

Bioscience and Bioengineering, 99(6), 603-610.

Nigussie, Z. (2012). Contribution of white lupin (lupinus albus L.) for food security in north-

Western Ethiopia: A review. Asian Journal of Plant Sciences, 11(5), 200.

Peix, A., Ramirez-Bahena, M. H., Flores-Felix, J. D., Alonso de la Vega, P., Rivas, R., Mateos,

P. F., . . . Velazquez, E. (2015). Revision of the taxonomic status of the species Rhizobium

lupini and reclassification as Bradyrhizobium lupini comb. nov. International Journal of

Systematic and Evolutionary Microbiology, 65(Pt 4), 1213-1219. doi:10.1099/ijs.0.000082

[doi] 58

Pereira, F., Carneiro, J., Matthiesen, R., van Asch, B., Pinto, N., Gusmao, L., & Amorim, A.

(2010). Identification of species by multiplex analysis of variable-length sequences. Nucleic

Acids Research, 38(22), e203. doi:10.1093/nar/gkq865 [doi]

Radl, V., Simoes-Araujo, J. L., Leite, J., Passos, S. R., Martins, L. M., Xavier, G. R., . . . Zilli, J.

E. (2014). Microvirga vignae sp. nov., a root nodule symbiotic bacterium isolated from

cowpea grown in semi-arid brazil. International Journal of Systematic and Evolutionary

Microbiology, 64(Pt 3), 725-730. doi:10.1099/ijs.0.053082-0 [doi]

Reeve, W., Ardley, J., Tian, R., Eshragi, L., Yoon, J. W., Ngamwisetkun, P., . . . Kyrpides, N. C.

(2015). A genomic encyclopedia of the root nodule bacteria: Assessing genetic diversity

through a systematic biogeographic survey. Standards in Genomic Sciences, 10(1), 1-8.

Reeve, W., Terpolilli, J., Melino, V., Ardley, J., Tian, R., De Meyer, S., . . . Kyrpides, N. (2013).

Genome sequence of the lupin-nodulating Bradyrhizobium sp. strain WSM1417. Standards

in Genomic Sciences, 9(2), 273-282. doi:10.4056/sigs.4518260 [doi]

Richter, M., & Rossello-Mora, R. (2009). Shifting the genomic gold standard for the prokaryotic

species definition. Proceedings of the National Academy of Sciences of the United States of

America, 106(45), 19126-19131. doi:10.1073/pnas.0906412106 [doi]

Sheu, S. Y., Chou, J. H., Bontemps, C., Elliott, G. N., Gross, E., dos Reis Junior, F. B., . . . Chen,

W. M. (2013). Burkholderia diazotrophica sp. nov., isolated from root nodules of Mimosa

spp. International Journal of Systematic and Evolutionary Microbiology, 63(Pt 2), 435-441.

doi:10.1099/ijs.0.039859-0 [doi] 59

Stępkowski, T., Czaplińska, M., Miedzinska, K., & Moulin, L. (2003). The variable part of the

dnaK gene as an alternative marker for phylogenetic studies of rhizobia and related

Alphaproteobacteria. Systematic and Applied Microbiology, 26(4), 483-494.

Stepkowski, T., Hughes, C. E., Law, I. J., Markiewicz, L., Gurda, D., Chlebicka, A., & Moulin,

L. (2007). Diversification of lupine Bradyrhizobium strains: Evidence from nodulation gene

trees. Applied and Environmental Microbiology, 73(10), 3254-3264. doi:AEM.02125-06

[pii]

Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6: Molecular

evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 30(12), 2725-

2729. doi:10.1093/molbev/mst197 [doi]

Tarrio, R., Rodriguez-Trelles, F., & Ayala, F. J. (2001). Shared nucleotide composition biases

among species and their impact on phylogenetic reconstructions of the Drosophilidae.

Molecular Biology and Evolution, 18(8), 1464-1473.

Tizazu, H., & Emire, S. (2010). Chemical composition, physicochemical and functional

properties of lupin (Lupinus albus) seeds grown in Ethiopia. African Journal of Food,

Agriculture, Nutrition and Development, 10(8)

Weisskopf, L., Heller, S., & Eberl, L. (2011). Burkholderia species are major inhabitants of

white lupin cluster roots. Applied and Environmental Microbiology, 77(21), 7715-7720.

doi:10.1128/AEM.05845-11 [doi] 60

Wibberg, D., Blom, J., Jaenicke, S., Kollin, F., Rupp, O., Scharf, B., . . . Setubal, J. C. (2011).

Complete genome sequencing of Agrobacterium sp. H13-3, the former Rhizobium lupini

H13-3, reveals a tripartite genome consisting of a circular and a linear chromosome and an

accessory plasmid but lacking a tumor-inducing ti-plasmid. Journal of Biotechnology,

155(1), 50-62.

Willems, A., & Collins, M. D. (1993). Phylogenetic analysis of rhizobia and agrobacteria based

on 16S rRNA gene sequences. International Journal of Systematic Bacteriology, 43(2), 305-

313.

Wolko, B., Clements, J. C., Naganowska, B., Nelson, M. N., & Yang, H. (2011). Lupinus. Wild

crop relatives: Genomic and breeding resources (pp. 153-206) Springer.

Wong-Villarreal, A., & Caballero-Mellado, J. (2010). Rapid identification of nitrogen-fixing and

legume-nodulating Burkholderia species based on PCR 16S rRNA species-specific

oligonucleotides. Systematic and Applied Microbiology, 33(1), 35-43.

Yildiz, S. (2013). Rotational and nematicidal effect of lupine (Lupinus albus L.: Leguminosae).

African Journal of Biotechnology, 10(61), 13252-13255.