DOCSLIB.ORG

Phylogenetic Study of Peronia Peronii Species (Mollusca Gastropod: Sea Slug) in Inter-Tidal Chabahar Coast, Based on 18S-Rdna Se

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetic Study of Peronia Peronii Species (Mollusca Gastropod: Sea Slug) in Inter-Tidal Chabahar Coast, Based on 18S-Rdna Se مجله تازه هاي بیوتکنولوژی سلولي- مولکولي دوره چهارم، شماره پانزدهم، تابستان 1393 بررسی فیلوژنتیکی گونه Peronia peronii )نرمتنان:شکم پایان، sea slug ( در سواحل بین جزر و مدی چابهار بر اساس توالی ژنی SrDNA 18 گیﻻن عطاران فریمان* 1 ، یاسمن موسوی پور2 ، آرش شکوری1 1 هیئت علمی دانشگاه علوم دریایی و دریانوردی چابهار ،گروه زیست شناسی ،دانشکده علوم دریایی ،دانشگاه علوم دریایی و دریانوردری چابهار ، چابهار ، ایران 2کارشناسی ارشد ،گروه زیست شناسی ، دانشکده علوم دریایی ، دانشگاه علوم دریایی و دریانوردری چابهار ، چابهار ، ایران چکیده سابقه و هدف : بررسی های فیلوژنتیکی و شناساسیی مورفولوژی و مولکولی بر روی گونه های هر منطقه میتواند پایه ی مطالعات بعدی را بنیان گزاری کند . مطالعات فیلوژنتیکی زیادی بر اساس ژنوم میتوکندریایی در دیگر نقاط ساحلی دنیا بر روی این گروه از شکم پایان تابحال انجام گرفته ، اما اطﻻعات کمی از ژنوم هسته ای این گروه ثبت شده است. بیشتر مطالعات انجام شده در ایران بر اساس بررسی های ریخت شناسی موجود انجام شده ولی گزارشی از بررسی های مولکولی گونه های ایرانی از سواحل جنوبی ثبت نشده است . در این پژوهش برای اولین بار گونه ای از sea slug های سواحل چابهار مورد بررسی فیلوژنتیکی قرار گرفت . مواد و روش ها : نمونه برداری از سواحل صخره ای تیس در چابهار انجام شد و به آزمابشگاه انتقال داده شدند و پس از بررسی های ریخت شناسی گونه ، نمونه ها در فریزر 80- درجه نگه داری شدند ، استخراج DNA با استفاده از روش CTAB صورت گرفت ، سپس واکنش زنجیره ای پلیمراز و توالی یابی و ترسیم درخت فیلوژنی انجام شدند. یافته ها : توالی نوکلئوتیدهای بدست آمده در منطقه ژنی S rDNA 18مورد آنالیزهای مولکولی قرار گرفتند . با آنالیزهای انجام شده و ترسیم درخت فیلوژنی مشخص شد که گونه ی ایرانی در کﻻد Panpulmonata قرار گرفته است ، گونه ایرانی و دیگر گونه های این کﻻد بیشترین واگرایی را نسبت به گونه های دوکﻻد دیگر دارند . نتایج : آنالیز فیلوژنتیکی MLنشان داد که گونه ی چابهار 100 درصد شبیه با Peronia cf. peronii و در یک گروه خواهری قرار گرفته اند ، بررسی خصوصیات مورفولوژیکی هم این نتایج را تایید کرد . S rDNA Peronia peronii کلمات کلیدی : ، 18 ، فیلوژنی ، سواحل چابهار ، شکم پایان Downloaded from ncmbjpiau.ir at 1:09 +0330 on Monday September 27th 2021 مقدمه Pulmonata Cu� نرم تنان یکی از بزرگترین و متنوع ترین گروههای جانوری 1931 انجام گرفت شکم پایان در سه گروه Opisthobranchia Milne Edwards vier هستند و بعد از بندپایان بزرگترین گروه را در میان بی مهرگان 1814 , ، 1848 , - و Prosobranchia Miln _ Edwards به خود اختصاص داده اند . نرم تنان در همه جای زمین در 1848, تقسیم بندی شدند ، محیط های دریایی از سواحل جزر و مدی تا عمیق ترین قسمت شکم پایان یکی از گروههای تخصص یافته ی متازوآ میباشد و های اقیانوس ،آب های شیرین و در خشکی دیده میشوند .رده مطالعات زیادی روی آنها صورت گرفته است اما مطالعه فیلوژنی Opistho� Euthyneura ی شکم پایان بزرگترین و متنوع ترین گروه از نرم تنان هستند آنها از سال 1988 انجام شد )9( . ) pulmonates branchs ، بر اساس طبقه بندی که توسط Thiele Johannes در سال چندین خصوصیت مشترک با ششداران دارند که هردوی آنها در یک گروه بنام Euthyneura قرار گرفته آدرس نویسنده مسئول : گروه زیست شناسی ،دانشکده علوم دریایی ،دانشگاه علوم دریایی و دریانوردری چابهار ، چابهار ، ایران اند( که شامل بیشترگونه های sea slug ها ، land snail ها ، Email :[email protected] land slug تاریخ دریافت مقاله: 29/2/92 و برخی خانواده های شکم پایان دریازی که صدف تاریخ پذیرش: 20/4/93 دارند میباشند، تاکسون راسی شکم پایان محسوب میشود)9(. تازه های بیو تکنولوژی سلولی - مولکولی دوره چهارم، شماره پانزدهم، تابستان 1393، بررسی... Pulmonata گروهی از شکم پایان دریازی هستند که با توانایی تعداد 5_4 نمونه این نرم تن زگیل دار از منطقه بین جزر و تنفس در معرض هوا شناخته شده اند ، بجای آبشش یک ریه مدی تیس واقع در غرب چابهار ) شکل شماره 1 ( با موقعیت تنفسی دارند ، این گروه خانواده های زیادی از شکم پایان جغرافیایی º 60 و ´ 37 شرقی و º 25 درجه و ´ 22 شمالی خشکی زی ، آب شیرین و دریازی را به خود اختصاص داده جمع اوری گردید . نمونه ها بصورت دستی گرفته شدند و اند )11(. نظریه ای وجود دارد بر این مبنا که �Opisthobran جهت عملیات آزمایشگاهی به آزمایشگاه بیوتکنولوژی دانشگاه chia پارافایلتیک هستند که شاید بدلیل وجود Pulmonata دریانوردی و علوم دریایی چابهار انتقال داده شدند ، و بﻻفاصله باشد ،البته این نظریه هنوز به اثبات نرسیده است. �Pulmon پاهای شکمی جداسازی شدند و در دمای 80- درجه سانتیگراد ata ممکن است یک گروه منوفایلتیک با Opisthobranchia نگه داری شدند )23(. باشد، از طرفیOpisthobranchia یک گروه منوفایلتیک نیست استخراج DNA ، واکنش زنجیره ای پلیمراز و توالی یابی و نمیتواند بعنوان یک تاکسون معتبر پذیرفته شود.آنها در حال در این پژوهش به منظور استخراج DNA از تکه های کوچک حاضر در زیر رده ی Orthogastropoda قرار گرفته اند )24(. جداشده از پاهای شکمی موجود و توسط بافر CTAB 2% قطعات ژنی مورد استفاده در این پژوهش قطعه ژنی CTAB( ,1.4M NaCl , 0.1% β_mercaptooethanol ,20mM 18S rRNA )18S ribosomal RNA( میباشد . 18S rRNA قسمتی از EDTA and 100mM TRIS-HCl pH8 ( به همراه پروتئیناز ژن RNA ریبوزومی است و جز ساختاری RNA ریبوزوم های mercapthonal β_ , K در یک میکروتیوب با هم ترکیب شدند یوکاریوتی سیتوپﻻسمی است و بهمین ترتیب یکی از اجزای ، پس از انکوباسیون و سانتریفیوژ، کلروفرم _ ایزوآمیل الکل اساسی در تمام سلول های یوکاریوتی بشمار میرود. این قطعه )به نسبت 24:1 ( اضافه شد ، بسته به مقدار رسوب DNA ، ژنی هومولوگ 16S rRNA در پروکاریوت ها و میتوکندری آب دیونیزه اضافه شد و DNA استخراجی برای مطالعات بعدی است. توالی ژنی 18S rRNA بطور گسترده ای در تجزیه و در فریزر20_ نگه داری شد )23( . کیفیت DNA استخراج تحلیل های مولکولی مورد استفاده قرار میگیرد. زیرواحد کوچک شده روی ژل آگارز 1% با دستگاه الکتروفورز و کمیت آن هم SSU( 18S rRNA( از ژنهایی است که اغلب در مطالعات با استفاده از دستگاه اسپکتروفوتومتر مدل RS232C مورد فیلوژنتیکی مورد استفاده قرار میگیرد و همچنین یک مارکر سنجش قرار گرفت . بررسی باند ها ی DNAبا استفاده از E_BOX_VX M PCR مهم در واکنش زنجیره ای پلی مراز( ) میباشد)16( .تا دستگاه ژل داک مدل 2/2 بررسی گردید بحال مطالعات زیادی بر روی توالی های ژنی این گروه از شکم ..در واکنش زنجیره ای پلیمراز بسط و توسعه قسمتی از ژن Downloaded from ncmbjpiau.ir at 1:09 +0330 on Monday September 27th 2021 پایان انجام شده است ، ولی مطالعاتی که بر روی این قطعه ژنی هسته ای 18S rDNA که چیزی با استفاده از آغازگرهای های صورت گرفته است نسبت به قطعه ژنوم میتوکندریایی کمتر Sa)5’_AACCTGGTTGATCCTGCCAGT_3’( 18و 18 است که از ان جمله میتوان Göbbeler و klussmann-kolb در GATCCTTCTGCAGGTTCACCTAC_3_’5( Sb’( بود سال2009 )6(و Shields در سال 2009 )20( اشاره کرد. جنس )15( . هر واکنش زنجیره ای پلیمراز با استفاده از دستگاه Peronii در اغلب سواحل صخره ای جنوب شرقی ایران پراکنش ترموسایکلر ependorf مدل 5331 انجام شد . در هر واکنش دارد . در این تحقیق گونه ای از این جنس برای اولین بار در 15 نانوگرم DNA استخراج شده در حجمی 50 میکرولیتری ایران مورد آنالیز های مولکولی قرار گرفت و توالی آن با گونه بعنوان نمونه الگو استفاده گردید . در واکنش زنجیره ای پلیمراز Mgcl PCR Buffer x S rRNA های مشابه موجود در بانک ژنی در منطقه ژنی 18 5 میکرولیتر 10 , 6 میکرولیتر 2 مورد مقایسه قرار گرفت . ، 2.5 میکرولیتر dNTP ، و Taq DNA polymerase مورد مواد و روش ها استفاده قرار گرفتند . در سیکل حرارتی داده شده به دستگاه نمونه برداری PCR ، در ابتدا به مدت 4 دقیقه در دمای 95 درجه سانتی پس از بررسی منطقه و تعیین ایستگاهها در بهمن ماه 1390 گراد قرار گرفت و بدنبال آن در یک سیکل 38 تایی که شامل 31 30 تازه های بیوتکنولوژی سلولی - مولکولی دوره چهارم، شماره پانردهم، گیﻻن عطاران فریمان و همکاران واسرشتگی در دمای 94 درجه سانتی گراد به مدت 1 دقیقه میباشد که صحت کار را باﻻ برده و مقایسه را راحت تر میکند . ، اتصال اغازگرها در دمای 5 .56 درجه سانتی گراد به مدت در حقیقت بکار بردن یک یا دو گونه به عنوان out group در 1 دقیقه ،بسط نهایی در دمای 72 درجه سانتی گراد به مدت ترسیم درخت، rooting را در درخت انجام می دهد . 2 دقیقه ، و در اخر با دمای 72 درجه سانتی گراد به مدت جدول شماره 1: گونه های استفاده شده در مطالعه حاضر و 10 دقیقه سیکل حرارتی پایان داده میشود . پس از اطمینان شماره ثبت آنها در بانک ژنی که در آنالیز مولکولی این پژوهش از صحت محصول PCR و تکثیر باندهای مورد نظر، به کمک استفاده شده است. الکتروفورز روی ژل آگارز 1% ، نمونه ها برای تعیین توالی ژن ها شــماره بانــک نام گونه ژنــی به کشور کانادا ارسال گردید و نتایج بدست امده از تعیین توالی Peronia peronii مطالعه حاضر محصوﻻت با استفاده از بسته های نرم افزاری مورد آنالیزهای Peronia peronii HQ659975 فیلوژنتیکی قرار گرفت Peronia cf. peronii HQ659976 Onchidium cf. tumidum HQ659973 Onchidium verrucosum AY427522 Phyllocaulis tuberculosus HQ659987 Onchidella celtica X70211 Marinula filholi HQ659944 Aplysia parvula DQ237959 Aplysia californica AY039804 Sarasinula linguaeformis HQ659989 Smeagol phillipensis FJ917210 Phyllocaulis variegates HQ659988 Vaginulus taunaisii HQ659990 تصویر شماره 1: منطقه نمونه برداری، منطقه نموبرداری در این مطالعه در Parahedyle cryptophthalma AY427518 شکل مشخص شده است . Stylocheilus longicauda DQ237963 )Acteon tornatilis)out group GQ845183 آنالیزهای فیلوژنتیک در ابتدا کروماتوگرام هاي حاصل از تعیین توالي نمونه ها ، با نتایج BioEdit با بررسی مورفولوژی گونه مورد نظر مشخص گردید که دارای استفاده از نرم افزار )7( ویرایش شده سپس توالي هاي Downloaded from ncmbjpiau.ir at 1:09 +0330 on Monday September 27th 2021 بدنی نرم میباشد در حدود 100 میلیمتر طول متوسط دارد و مورد اشاره با استفاده از نرم افزار ClustalX7.0 )11( هم ردیف به رنگ سبز تیره مایل به قهوهای دیده میشوند، سطح پشتی گردیدند.
Load more

Recommended publications
  • (Gastropoda: Eupulmonata: Onchidiidae) from Iran, Persian Gulf
    Zootaxa 4758 (3): 501–531 ISSN 1175-5326 (print edition) https://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2020 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4758.3.5 http://zoobank.org/urn:lsid:zoobank.org:pub:2F2B0734-03E2-4D94-A72D-9E43A132D1DE Description of a new Peronia species (Gastropoda: Eupulmonata: Onchidiidae) from Iran, Persian Gulf FATEMEH MANIEI1,3, MARIANNE ESPELAND1, MOHAMMAD MOVAHEDI2 & HEIKE WÄGELE1 1Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, 53113 Bonn, Germany. E-mail: [email protected] 2Iranian Fisheries Science Research Institute (IFRO), 1588733111, Tehran, Iran. E-mail: [email protected] 3Corresponding author Abstract Peronia J. Fleming, 1822 is an eupulmonate slug genus with a wide distribution in the Indo-Pacific Ocean. Currently, nine species are considered as valid. However, molecular data indicate cryptic speciation and more species involved. Here, we present results on a new species found in the Persian Gulf, a subtropical region with harsh conditions such as elevated salinity and high temperature compared to the Indian Ocean. Peronia persiae sp. nov. is described based on molecular, histological, anatomical, micro-computer tomography and scanning electron microscopy data. ABGD, GMYC and bPTP analyses based on 16S rDNA and cytochrome oxidase I (COI) sequences of Peronia confirm the delimitation of the new species. Moreover, our 14 specimens were carefully compared with available information of other described Peronia species. Peronia persiae sp. nov. is distinct in a combination of characters, including differences in the genital (ampulla, prostate, penial hooks, penial needle) and digestive systems (lack of pharyngeal wall teeth, tooth shape in radula, intestine of type II).
    [Show full text]
  • Comprehensive Comparison of Four Species of Onchidiidae Provides Insights on Morphological and Molecular Adaptations of Invertebrates from Shallow Seas to Wetlands
    Comprehensive comparison of four species of Onchidiidae provides insights on morphological and molecular adaptations of invertebrates from shallow seas to wetlands Guolv Xu 1, 2, 3, 4 , Tiezhu Yang 1, 2, 3, 4 , Dongfeng Wang 1, 2, 3, 4 , Jie Li 1, 2, 3, 5 , Xin Liu 1, 2, 3, 4 , Xin Wu 1, 2, 3, 4 , Heding Shen Corresp. 1, 2, 3, 4 1 College of Fisheries and Life Science, Shanghai Ocean University, Shanghai, China 2 National Demonstration Center for Experimental Fisheries Science Education, Shanghai, China 3 International Research Center for Marine Biosciences at Shanghai Ocean University, Ministry of Science and Technology, Shanghai, China 4 Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources (Shanghai Ocean University), Ministry of Education, Shanghai, China 5 Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources (Shanghai Ocean University), Ministry of Education, Shaghai, China Corresponding Author: Heding Shen Email address: [email protected] Background.The Onchidiidae family provides ideal species of marine invertebrates for the study of the evolution from seas to wetlands. However, different species of Onchidiidae have rarely been considered in comparative studies. Methods.A total of 40 samples were collected from four species (10 specimens per onchidiid). In addition, we systematically investigated the histological and molecular differences to elucidate the morphological foundations underlying these adaptations. Results.Histological analysis enabled the structural comparison of respiratory organs (gill, lung-sac, dorsal skin) among onchidiids. Transcriptome sequencing of four representative onchidiids was performed to further expound the molecular mechanisms with their respective habitats. Twenty-six Single nucleotide polymorphism (SNP) markers of Onchidium struma presented the DNA polymorphism determining some visible genetic traits.
    [Show full text]
  • On the Phylogenetic Relationships of the Genus Mexistrophia and of the Family Cerionidae (Gastropoda: Eupulmonata)
    THE NAUTILUS 129(4):156–162, 2015 Page 156 On the phylogenetic relationships of the genus Mexistrophia and of the family Cerionidae (Gastropoda: Eupulmonata) M.G. Harasewych Estuardo Lopez-Vera Fred G. Thompson Amanda M. Windsor Instituto de Ciencias del Mar y Limnologia Florida Museum of Natural History Dept. of Invertebrate Zoology, MRC-163 Universidad Nacional Autonoma de Mexico University of Florida National Museum of Natural History Circuito Exterior S/N Gainesville, FL 32611 USA Smithsonian Institution Ciudad Universitaria PO Box 37012 Delegacion Coyoacan Washington, DC 20013-7012 USA CP: 04510 Mexico D.F. MEXICO [email protected] ABSTRACT morphology, anatomy, and radula of Mexistrophia reticulata, the type species of Mexistrophia,withthoseof Phylogenetic analyses of partial DNA sequences of the mito- several species of Cerion,includingCerion uva (Linnaeus, chondrial COI and 16S rDNA genes derived from Mexistrophia 1758), the type species of the type genus of Cerionidae. reticulata Thompson, 2011, the type species of the genus He concluded that anatomical features of Mexistrophia Mexistrophia, indicate that this genus is sister taxon to all remaining living Cerionidae, and that the family Cerionidae is reticulata are typical of Cerionidae and that radular mor- most closely related to Urocoptidae. Relationships among repre- phology differs only slightly. However, Mexistrophia may sentative cerionid taxa are consistent with the zoogeographic be distinguished from species of Cerion in lacking lamellae hypothesis that Mexistrophia has been isolated from the remain- and denticles along the columella at all stages of growth. ing living Cerionidae since the Cretaceous, and suggest that the Harasewych (2012) reviewed the diversity of living and near-shore, halophilic habitat that has commonly been associated fossil Cerionidae from geographic and temporal perspec- with this family is likely a Cenozoic adaptation that coincided tives and combined these data with paleogeographic recon- with the transition from continental to island habitats.
    [Show full text]
  • From the Marshall Islands, Including 57 New Records 1
    Pacific Science (1983), vol. 37, no. 3 © 1984 by the University of Hawaii Press. All rights reserved Notes on Some Opisthobranchia (Mollusca: Gastropoda) from the Marshall Islands, Including 57 New Records 1 SCOTT JOHNSON2 and LISA M. BOUCHER2 ABSTRACT: The rich opisthobranch fauna of the Marshall Islands has re­ mained largely unstudied because of the geographic remoteness of these Pacific islands. We report on a long-term collection ofOpisthobranchia assembled from the atolls of Bikini, Enewetak, Kwajalein, Rongelap, and Ujelang . Fifty-seven new records for the Marshall Islands are recorded, raising to 103 the number of species reported from these islands. Aspects ofthe morphology, ecology, devel­ opment, and systematics of 76 of these species are discussed. THE OPISTHOBRANCH FAUNA OF THE Marshall viously named species are discussed, 57 of Islands, a group of 29 atolls and five single which are new records for the Marshall islands situated 3500 to 4400 km west south­ Islands (Table 1). west of Honolulu, Hawaii, is rich and varied but has not been reported on in any detail. Pre­ vious records of Marshall Islands' Opistho­ METHODS branchia record only 36 species and are largely restricted to three studies. Opisthobranchs The present collections were made on inter­ collected in the northern Marshalls during the tidal reefs and in shallow water by snorkeling period of nuclear testing (1946 to 1958) and and by scuba diving to depths of 25 m, both now in the U.S. National Museum, along with by day and night. additional material from Micronesia, were Descriptions, measurements, and color studied by Marcus (1965).
    [Show full text]
  • Peronia Verrculata در سواحل استان بوشهر ) خلیجفارس(
    اقیانوسشناسی/ سال دهم/ شماره 38/ تابستان 1398/8/36ـ29 اثر ضد باکتریایی عصاره های استحصالی از شکم پای Peronia verrculata در سواحل استان بوشهر ) خلیجفارس( 5 4 3 *2 1 نجمه جهانی ، سید محمدباقر نبوی ، بیتا ارچنگی ، ابراهیم رجبزاده قطرمی ، رحیم عبدی 1- دانشکده علوم دریایی و اقیانوسی، گروه زیست شناسی دریا، دانشگاه علوم و فنون دریایی خرمشهر، پست الکترونیکی: [email protected] 2- دانشکده علوم دریایی و اقیانوسی، گروه زیست شناسی دریا، دانشگاه علوم و فنون دریایی خرمشهر 3- دانشکده علوم دریایی و اقیانوسی، گروه زیست شناسی دریا، دانشگاه علوم و فنون دریایی خرمشهر 4- دانشکده منابع طبیعی ،گروه شیﻻت، دانشگاه علوم و فنون دریایی خرمشهر 5- دانشکده علوم دریایی و اقیانوسی، گروه زیست شناسی دریا، دانشگاه علوم و فنون دریایی خرمشهر تاریخ دریافت: 02/4/97 * نویسنده مسوول تاریخ پذیرش: 97/9/21 چکیده امروزه در اثر تکامل مداوم میکروبهای بیماریزا و مقاومت آنها نسبت به آنتی بیوتیکها، تقاضا برای ایجاد ترکیبـات جدید و مؤثر ضد میکروبی وجود دارد. به همین دلیل عصارههای بوتانولی، متانولی و استونی گونه Peronia verruculata تهیه و با استفاده از روشهای MIC و MBC اثرات ضد باکتریایی دو باکتری گرم مثبت Staphylococcus aureous و گرم منفی Escherichi بر روی عصارههای گرفته شده تعیین شد. بررسی کدورت و شفافیت میکروتیوبهای حاوی مقادیر مختلف عصاره بوتانولی نشان داد که حداقل غلظت ممانعت کنندگی از رشد )MBC( باکتری E.coli برابر با µg/µl 600 و باکتری استافیلوکوکوس اورئوس µg/µl 800 بود. وضعیت رشد باکتری E.coli در پلیتهای حاوی محیط کشت مولر هینتون آگار در غلظتهای مختلف عصاره بوتانولی حداقل غلظت کشندگی )MBC( این باکتری را 800µg/µl و باکتری استافیلوکوکوس اورئوس را 1000µg/µl نشان داد.
    [Show full text]
  • Onchidiidae from Australia and the South-Western Pacific Islands
    AUSTRALIAN MUSEUM SCIENTIFIC PUBLICATIONS Bretnall, Rex W., 1919. Onchidiidae from Australia and the south western Pacific Islands. Records of the Australian Museum 12(11): 303–328, plate xxxviii. [2 October 1919]. doi:10.3853/j.0067-1975.12.1919.888 ISSN 0067-1975 Published by the Australian Museum, Sydney nature culture discover Australian Museum science is freely accessible online at http://publications.australianmuseum.net.au 6 College Street, Sydney NSW 2010, Australia ONOHlDIIDJE FROM AUS'l'RALIA AND 'l'HE SOUTH-WES'rERN P ACIFIO ISLANDS BY Rf;;x. W. BHETNALL, Invertebrate Zoologist, Australian Museum. (Plate xxxviii.) L-INT1WD UCTIOJ'(. From the following historical review of the family, it will be seen that, since the discovery of Onchidin?n typhm by Buchanan in 1800, the biological affinities of the Onchidiidre have received the attention of many of the eminent authorities of'MalacoIogy. ,Vhile much remains to be done to bring the knowledge of .this group into line with that we have of other gI'OUpS, this paper may serve as a convenient suminary for the use of Australian students, and since it has had for its foundation the excellent works of Semper, Plate, Joyeux-Laffuie and many others, no apology need be offered for the more or less extensive quotations from these authors. The bulk of the material examined is preserved in alcohol in the collections of the Australian Museum. The absence of marine aquaria has made the much needed observations on the life and habits of even the commonest forms almost impossible. OlwhidimIL damelii is fairly common on the shores of Port Jackson, living either below water, or under rocks between tide marks.
    [Show full text]
  • A Comprehensive Comparison of Four Species of Onchidiidae Provides
    RESEARCH ARTICLE A comprehensive comparison of four species of Onchidiidae provides insights on the morphological and molecular adaptations of invertebrates from shallow seas to wetlands Guolv Xu1,2,3☯, Tiezhu Yang1,2,3☯, Dongfeng Wang1,2,3, Jie Li1,2,3, Xin Liu1,2,3, Xin Wu1,2,3, Heding Shen1,2,3* a1111111111 1 National Demonstration Center for Experimental Fisheries Science Education (Shanghai Ocean a1111111111 University), Shanghai, China, 2 International Research Center for Marine Biosciences at Shanghai Ocean a1111111111 University, Ministry of Science and Technology, Shanghai, China, 3 Key Laboratory of Exploration and a1111111111 Utilization of Aquatic Genetic Resources (Shanghai Ocean University), Ministry of Education, Shanghai, a1111111111 China ☯ These authors contributed equally to this work. * [email protected] OPEN ACCESS Abstract Citation: Xu G, Yang T, Wang D, Li J, Liu X, Wu X, et al. (2018) A comprehensive comparison of four The Onchidiidae family is ideal for studying the evolution of marine invertebrate species species of Onchidiidae provides insights on the from sea to wetland environments. However, comparative studies of Onchidiidae species morphological and molecular adaptations of invertebrates from shallow seas to wetlands. PLoS are rare. A total of 40 samples were collected from four species (10 specimens per onchi- ONE 13(4): e0196252. https://doi.org/10.1371/ diid), and their histological and molecular differences were systematically evaluated to journal.pone.0196252 elucidate the morphological foundations underlying the adaptations of these species. A his- Editor: Wan-Xi Yang, Zhejiang University College of tological analysis was performed to compare the structures of respiratory organs (gill, lung Life Sciences, CHINA sac, dorsal skin) among onchidiids, and transcriptome sequencing of four representative Received: December 6, 2017 onchidiids was performed to investigate the molecular mechanisms associated with their Accepted: April 9, 2018 respective habitats.
    [Show full text]
  • Assessment of Mitochondrial Genomes for Heterobranch Gastropod Phylogenetics Rebecca M
    Varney et al. BMC Ecol Evo (2021) 21:6 BMC Ecology and Evolution https://doi.org/10.1186/s12862-020-01728-y RESEARCH ARTICLE Open Access Assessment of mitochondrial genomes for heterobranch gastropod phylogenetics Rebecca M. Varney1, Bastian Brenzinger2, Manuel António E. Malaquias3, Christopher P. Meyer4, Michael Schrödl2,5 and Kevin M. Kocot1,6* Abstract Background: Heterobranchia is a diverse clade of marine, freshwater, and terrestrial gastropod molluscs. It includes such disparate taxa as nudibranchs, sea hares, bubble snails, pulmonate land snails and slugs, and a number of (mostly small-bodied) poorly known snails and slugs collectively referred to as the “lower heterobranchs”. Evolutionary relationships within Heterobranchia have been challenging to resolve and the group has been subject to frequent and signifcant taxonomic revision. Mitochondrial (mt) genomes can be a useful molecular marker for phylogenetics but, to date, sequences have been available for only a relatively small subset of Heterobranchia. Results: To assess the utility of mitochondrial genomes for resolving evolutionary relationships within this clade, eleven new mt genomes were sequenced including representatives of several groups of “lower heterobranchs”. Maximum likelihood analyses of concatenated matrices of the thirteen protein coding genes found weak support for most higher-level relationships even after several taxa with extremely high rates of evolution were excluded. Bayes- ian inference with the CAT GTR model resulted in a reconstruction that is much more consistent with the current understanding of heterobranch+ phylogeny. Notably, this analysis recovered Valvatoidea and Orbitestelloidea in a polytomy with a clade including all other heterobranchs, highlighting these taxa as important to understanding early heterobranch evolution.
    [Show full text]
  • The Atlantic Species of Onchidella (Gastropoda Pulmonata) Part 2*
    Bolm. Zool., Univ. S. Paulo 4:1-38,1979 THE ATLANTIC SPECIES OF ONCHIDELLA (GASTROPODA PULMONATA) PART 2* Eveline du Bois-Reymond Marcus Caixa Postal 6994, 01000 São Paulo, Brasil. Figures 1- 56 This paper is dedicated to the memory of our dear Friend Adolf Remane (t 22.XII.1976) who during his visit to Brasil in 1952 familiarized us with the Opisthobranchia andTound the first Onchidella on the coast of São Paulo. RESUMO Os caracteres apücáveis à classificação são discutidos e uma chave para as oito espécies do Atlântico central e oriental é dada. Das 18 espécies de Onchidella mencionadas do Atlântico, duas, pachyderma (Plate, 1893) e pulchella Watson, 1925, não são reconhecíveis. O mesmo refere-se à Onchidella celtica (Seurat, 1932). O. remanei Marcus, 1956, foi reconhecida como sinônimo de cel- tica (Cuvier, 1817). As cinco espécies do Atlântico oriental das quais material pôde ser estudado, celtica, incisa, capensis, accrensis e a nova espécie phttippei, são descritas. Algumas observações so­ bre O. floridana são acrescentadas. O. maculata, O. monodi e O. souriei são discutidas. Onchidella é o único gênero dos Onchidiacea que ocorre no Atlântico. A distribuição das espécies é indicada no mapa (Fig. 56). * As SARSIA could only publish a short paper (Sarsia, 63: 221-224, figs. 1-15) oh the Western Atlantic species, the presente part 2 includes the species form the Atlantic Islands and those from Cornwall to Capetown on the Eastern Atlantic. The diagrams of the male organs of the Western species are repeated, and some additional remarks to the Western O. floridana are added.
    [Show full text]
  • Understanding Kūpeʻe (Nerita Polita) Gonad Development and Demography for Continued Use at Two Sites on Hawaiʻi Island
    UNDERSTANDING KŪPEʻE (NERITA POLITA) GONAD DEVELOPMENT AND DEMOGRAPHY FOR CONTINUED USE AT TWO SITES ON HAWAIʻI ISLAND A THESIS SUBMITTTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAWAI‘I AT HILO IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE IN TROPICAL CONSERVATION BIOLOGY & ENVIRONMENTAL SCIENCE DECEMBER 2017 Heather Nahaku Kalei Thesis Committee: Marta deMaintenon, Chairperson Kalei Nuʻuhiwa Misaki Takabayashi Keywords: Kūpeʻe, Nerita polita, life histories, length at maturity, population density. Acknowledgements My deepest gratitude goes out to all those, who, knowingly or unknowingly stoked my love for home, and in turn led me to choose a life and career centered around living in ways which honor my kūpuna. I am grateful for the lessons learned through this thesis journey and the alternate futures they create. Mahalo mau a mau to those who have guided this journey, including those who came before me, my ʻohana, committee members and mentors, and the community we are a part of. May this work provoke curiosity, inspiration, and action. May it be refined, added to, and one day rendered obsolete by the wealth of knowledge and understanding. Amama ua noa! i Abstract Kūpeʻe (Nerita polita Linnaeus, 1758) is a cryptic, mostly nocturnal intertidal species of gastropod mollusc used widely in Hawaiʻi for sustenance and cultural practices. Despite a long tradition of human interaction with this species, information is generally lacking regarding its reproductive ecology. Results of this study suggest that male and female individuals do not differ significantly in size and that the minimum shell length at maturity for both males and females is 14 mm.
    [Show full text]
  • The Complete Mitochondrial Genome Sequences of the Philomycus Bilineatus (Stylommatophora: Philomycidae) and Phylogenetic Analysis
    G C A T T A C G G C A T genes Article The Complete Mitochondrial Genome Sequences of the Philomycus bilineatus (Stylommatophora: Philomycidae) and Phylogenetic Analysis Tiezhu Yang 1,2,3,† , Guolyu Xu 1,2,3,†, Bingning Gu 1,2,3, Yanmei Shi 1,2,3, Hellen Lucas Mzuka 1,2,3 and Heding Shen 1,2,3,*,† 1 National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai 201306, China; [email protected] (T.Y.); [email protected] (G.X.); [email protected] (B.G.); [email protected] (Y.S.); [email protected] (H.L.M.) 2 Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Shanghai Ocean University, Ministry of Education, Shanghai 201306, China 3 Shanghai Universities Key Laboratory of Marine Animal Taxonomy and Evolution, Shanghai 201306, China * Correspondence: [email protected]; Tel.: +86-21-61900446; Fax: +86-21-61900405 † These authors contributed equally to this work. Received: 22 January 2019; Accepted: 27 February 2019; Published: 5 March 2019 Abstract: The mitochondrial genome (mitogenome) can provide information for phylogenetic analyses and evolutionary biology. We first sequenced, annotated, and characterized the mitogenome of Philomycus bilineatus in this study. The complete mitogenome was 14,347 bp in length, containing 13 protein-coding genes (PCGs), 23 transfer RNA genes, two ribosomal RNA genes, and two non-coding regions (A + T-rich region). There were 15 overlap locations and 18 intergenic spacer regions found throughout the mitogenome of P. bilineatus. The A + T content in the mitogenome was 72.11%. All PCGs used a standard ATN as a start codon, with the exception of cytochrome c oxidase 1 (cox1) and ATP synthase F0 subunit 8 (atp8) with TTG and GTG.
    [Show full text]
  • Integrative Taxonomy of the Genus Onchidium Buchannan, 1800
    A peer-reviewed open-access journal ZooKeys 636: 1–40 (2016)Integrative taxonomy of the genus Onchidium Buchannan, 1800... 1 doi: 10.3897/zookeys.636.8879 RESEARCH ARTICLE http://zookeys.pensoft.net Launched to accelerate biodiversity research Integrative taxonomy of the genus Onchidium Buchannan, 1800 (Mollusca, Gastropoda, Pulmonata, Onchidiidae) Benoît Dayrat1, Tricia C. Goulding1, Deepak Apte2, Vishal Bhave2, Joseph Comendador3, Ngô Xuân Qua,ng4, Siong Kiat Tan5, Shau Hwai Tan6 1 Department of Biology, Pennsylvania State University, University Park, PA 16802, USA 2 Bombay Natural History Society, Mumbai, Hornbill House, Opp. Lion Gate, Shaheed Bhagat Singh Road, Mumbai 400 001, Maharashtra, India 3 National Museum of the Philippines, Taft Ave, Ermita, Manila, 1000 Metro Manila, Philippines 4 Institute of Tropical Biology, Vietnam Academy of Science and Technology, 85 Tran Quoc Toan Str., District 3, Ho Chi Minh city, Vietnam 5 Lee Kong Chian Natural History Museum, 2 Conservatory Dr, National University of Singapore, 117377, Singapore 6 Marine Science Laboratory, School of Biological Scien- ces, Universiti Sains Malaysia, 11800 Minden Penang, Malaysia Corresponding author: Benoît Dayrat ([email protected]) Academic editor: N. Yonow | Received 17 April 2016 | Accepted 8 November 2016 | Published 24 November 2016 http://zoobank.org/55CD3416-9B90-40DD-A34A-2026640E1E83 Citation: Dayrat B, Goulding TC, Apte D, Bhave V, Comendador J, Ngô XQ, Tan SK, Tan SH (2016) Integrative taxonomy of the genus Onchidium Buchannan, 1800 (Mollusca, Gastropoda, Pulmonata, Onchidiidae). ZooKeys 636: 1–40. doi: 10.3897/zookeys.636.8879 Abstract In an effort to clarify the species diversity of onchidiid slugs, the taxonomy of the genusOnchidium Bu- channan, 1800 is revised using an integrative approach.
    [Show full text]