Complete Mitochondrial Genome and Novel Gene Organization of Ryssota Otaheitana (Pulmonata: Chronidae), and Its Implications on the Stylommatophora Phylogeny
Total Page：16
File Type：pdf, Size：1020Kb
Philippine Journal of Science 148 (S1): 167-180, Special Issue on Genomics ISSN 0031 - 7683 Date Received: 02 Apr 2019 Complete Mitochondrial Genome and Novel Gene Organization of Ryssota otaheitana (Pulmonata: Chronidae), and its Implications on the Stylommatophora Phylogeny Amor M. Damatac II1* and Ian Kendrich C. Fontanilla1,2 1Institute of Biology, University of the Philippines, Diliman, Quezon City 1101 Philippines 2Philippine Genome Center, University of the Philippines, Diliman, Quezon City 1101 Philippines, Whole mitochondrial genomes (mitogenomes) have been increasingly used as markers for phylogenetic inferences. In the Philippines, a marine snail from the Conidae family has been the only species to date whose mitogenome has been fully sequenced, despite the country’s rich malacofaunal diversity particularly in the terrestrial environment. In this study, we sequenced the complete mitogenome of the land snail Ryssota otaheitana (Chronidae), an endemic Philippine pulmonate species. The mitogenome is 13,888 bp in length and encodes the typical 37 genes – including 13 protein-coding, 22 tRNA, and 2 rRNA genes. Short intergenic spacers were found – including a reduced, 42-bp putative control region. Although the gene content is conserved, R. otaheitana showed a novel mitogenome organization involving the translocation of tRNASerine and NADH dehydrogenase subunit 4 gene segment. Combined with available stylommatophoran mitogenomes, different datasets from concatenated sequences of protein-coding and rRNA genes were used for phylogenetic reconstructions. Bayesian Inference (BI) and Maximum Likelihood (ML) trees congruently supported several monophyletic clades within the Stylommatophora such as the Helicoidea, Urocoptoidea, Orthurethra, and Limacoidea sensu lato (syn. ‘limacoid clade’). R. otaheitana is grouped with Deroceras reticulatum in the lower Stylommatophora and forms the monophyletic Limacoidea sensu lato. Both sequence-based phylogeny and gene order comparisons have led us to a hypothesis that Limacoidea sensu lato is at the base of the ‘non-achatinoid’ clade while supporting the division of ‘achatinoid and ‘non-achatinoid’ groups in the Stylommatophora. This study reports the first complete mitogenome from the Chronidae family, which can be used further for the molecular phylogeny of Philippine snails and gastropods at large. Keywords: mitogenome, molecular phylogenetics, pulmonate snail, sequencing INTRODUCTION (Pilsbry 1900); however, groupings at the lower level were unclear due to inconsistent findings from morphological The suborder Stylommatophora comprises the majority datasets (Shileyko 1979, Nordsieck 1986, Tillier, 1989). of pulmonate gastropods and terrestrial mollusks in Given the challenges of traditional techniques, their the world (Barker 2001). Its higher classification was lineage reconstructions have later shifted towards the traditionally based on the excretory system anatomy use of molecular characters due to their higher resolving *Corresponding Author: [email protected] power. Wade et al. (2001) provided the first extensive molecular phylogeny of the Stylommatophora, which 167 Special Issue on Genomics Damatac and Fontanilla: Complete Mitogenome and Novel Gene Organization showed an unexpected separation into ‘achatinoid’ and sequenced to date. Phylogenetic studies involving whole ‘non-achatinoid’ groups. Such analyses have increased mitogenomes have already been done on various animal in the past years primarily due to the extent of molecular groups (Cameron 2014, Weigert et al. 2016). A concern data to produce large sets of discrete, heritable, and in those studies, however, is the impact of incomplete unambiguous characters that can be effectively used for taxon sampling on the reconstruction of evolutionary systematic inferences (Hillis 1987, Grauer and Li 2000). relationships. Tree topologies could vary depending on the taxa included, and therefore hypotheses derived from Mitochondrial DNA has been steadily used as a standard phylogenies can be affected by sampling of taxa (Nabhan molecular marker to infer historical relationships among and Sarkar 2011). Obtaining the mitogenome sequences taxa. Its advantages such as being small, haploid with no of underrepresented taxa such as Philippine snails and recombination, being maternally inherited, and having comparing them with other mitogenomes would not fast mutation rates make it suitable for the phylogenetic only provide baseline information on their phylogenetic reconstruction of divergent groups (Curole and Kocher position with respect to other species worldwide but also 1999). Today, the development of cost-efficient high add valuable knowledge to the current phylogeny of snails. throughput sequencing technologies has made it easier to obtain the whole mitochondrial genome (or mitogenome) Here, we present the complete mitogenome of the endemic and use it as a marker for phylogenetic analysis (Boore snail – Ryssota otaheitana Ferrusac, 1821 – characterize et al. 2005). The mitogenome practically offers a larger the features of its mitochondrial DNA and construct a set of characters; therefore, it has a higher chance to phylogenetic tree of the species. R. otaheitana (syn. R. approximate relationships than just using an individual to ovum Valenciennes, 1854) is the largest of its genus and few genes from the mitochondrial DNA. This approach is distributed in Luzon and the Visayas islands (Faustino of using mitogenomes may support existing phylogenies 1930, Springsteen and Leobrera 1986, Solatre 2004). and provide new answers to some unresolved gaps in Locally known as bayuku, it is considered as bush meat evolutionary history (Boore and Brown 1998, Boore 1999). and a delicacy in some parts of the country (Solatre 2004, Scheffers et al. 2012). This study provides the first In the Philippines, the phylogeny of gastropods mitogenome of a chronid land snail from the Philippines particularly of those found in the terrestrial habitats and contributes to the taxon sampling of the currently is poorly understood. The distinct geological history available gastropod mitogenomes. of the archipelago has resulted to a high number of endemic species, including many pulmonate land snails that have restricted biogeographic distribution in the country (Faustino 1930, Heaney 1986, Springsteen MATERIALS AND METHODS and Leobrera 1986). The stylommatophoran Ryssota (Chronidae family) includes endemic representatives in the Philippines (Faustino 1930, Springsteen and Leobrera Sample Collection and DNA Extraction 1986). In some studies, the genus is considered as part of A voucher specimen of R. otaheitana was collected the Helicarionidae family due to the former inclusion of from Mt. Makiling, Laguna, Philippines. The snail was the Chronidae in the Helicarionidae (Solem 1978, Tillier identified following Springsteen and Leobrera (1986) and 1989, Sosa et al. 2014). Most recent classifications, Abbott (1989), and the whole sample was kept in –80 °C however, have separated the two families and placed at the DNA Barcoding Laboratory, Institute of Biology, them in separate superfamilies and thus consequently University of the Philippines Diliman. Approximately 25 dissociates the genus from Helicarionidae (Hausdorf 1998, mg of foot tissue was excised for DNA extraction using Bouchet et al. 2005). There is limited molecular data on DNeasy Blood and Tissue Kit (Qiagen) following the the Ryssota since most studies made on the taxon have manufacturer’s protocol. relied on traditional taxonomic methods (De Chavez and De Lara 2011, Sosa et al. 2014). It is therefore important Polymerase Chain Reaction (PCR) and Sequencing to provide such data to understand the phylogeny of the Two PCR approaches were employed in this study. genus, its family, and Philippine land snails in general. The first approach involved the amplification of three overlapping long fragments using pulmonate-specific As of March 2019, the National Center for Biotechnology Information (NCBI) database contains 169 gastropod primers designed by White et al. (2011) (Table 1). The mitogenomes, of which 25 are stylommatophorans. This PCR was carried out in a total volume of 50 μl containing is far insufficient given that gastropods have an estimated 10 μl of 5x Ranger Reaction Buffer (Bioline), 1 μL of number of 40,000 to 100,000 species (Boss 1971, Gotting each primer (20 mM), 1 μl of Ranger DNA Polymerase (Bioline), 27 μl of ultrapure water, and 10 μl of template 1974). In the Philippines, only the marine snail Conus tribblei (Conidae family) has its entire mitogenome DNA (10ng/ μl). The amplification conditions were: 3 168 Special Issue on Genomics Damatac and Fontanilla: Complete Mitogenome and Novel Gene Organization Table 1. Primers used in the PCR approach. For long PCR, a forward F437 and reverse primers were used when the genes are coded in CRNCTGTTTANCAAAAACATAGYY the same direction while either both forward or both reverse R972 primers were used when the genes are coded in the opposite CCGGTCTGAACTCAGATCATGT directions. All primers were designed by White et al. (2011) F515 except for LEP primers by Smith et al. (2007). GGCCGCAGTACMYTGACTGTGCDAAGGTAGC Region Primer sequence (5’–3’) R972 CCGGTCTGAACTCAGATCATGT Long PCR cytb F384 cox1- cytb F844 GGNTAYGTNYTDCCDTGRGGNCARAT GGWTTTATTGTNTGRGCDCAYATRTTTAC R809 R809 GCRTANGCRAANARRAARTAYCAYTCNGG GCRTANGCRAANARRAARTAYCAYTCNGG cox2 F301 cytb- rrnS F384 AYHGGNCAYCARTGRTAYTG GGNTAYGTNYTDCCDTGRGGNCARAT R580 F302 ATYTCNGARCAYTGNCCRTA AAACTRGGATTAGAKACCCYAYTAT