Molecular Investigation of the Cnidarian-Dinoflagellate Symbiosis

Home , Aequorea macrodactyla, Anthopleura, Cephalochordate, Phyllodiscus

AN ABSTRACT OF THE DISSERTATION OF

Laura Lynn Hauck for the degree of Doctor of Philosophy in Zoology presented on March 20, 2007.

Title: Molecular Investigation of the Cnidarian-dinoflagellate Symbiosis and the Identification of Genes Differentially Expressed during Bleaching in the Coral Montipora capitata.

Abstract approved:

______Virginia M. Weis

Cnidarians, such as anemones and corals, engage in an intracellular symbiosis with photosynthetic dinoflagellates. Corals form both the trophic and structural foundation of reef ecosystems. Despite their environmental importance, little is known about the molecular basis of this symbiosis. In this dissertation we explored the cnidarian- dinoflagellate symbiosis from two perspectives: 1) by examining the gene, CnidEF, which was thought to be induced during symbiosis, and 2) by profiling the gene expression patterns of a coral during the break down of symbiosis, which is called bleaching.

The first chapter characterizes a novel EF-hand cDNA, CnidEF, from the anemone Anthopleura elegantissima. CnidEF was found to contain two EF-hand motifs. A combination of bioinformatic and molecular phylogenetic analyses were used to compare CnidEF to EF-hand proteins in other organisms. The closest homologues identified from these analyses were a luciferin binding protein involved in the bioluminescence of the anthozoan Renilla reniformis, and a sarcoplasmic calcium- binding protein involved in fluorescence of the annelid worm Nereis diversicolor.

Northern blot analysis refuted link of the regulation of this gene to the symbiotic state.

The second and third chapters of this dissertation are devoted to identifying those genes that are induced or repressed as a function of coral bleaching. In the first of these two studies we created a 2,304 feature custom DNA microarray platform from a cDNA subtracted library made from experimentally bleached Montipora capitata, which was then used for high-throughput screening of the subtracted library. In the second of these studies we used this array to profile the gene expression of bleached samples collected in

Pilaa Bay, Kauai, HI. In both studies we detected a large number of host genes that displayed statistically different ratios of expression between the control and bleached groups of corals. The identified repressed genes included a novel carbohydrate associated protein (CnidCAP) putatively involved in host/symbiont specificity and recognition. Our data, particularly the emergence of CnidCAP, suggest that host/symbiont specificity in corals is homologous to the complement pathway active in innate immunity in animals. In addition, we have isolated many novel, unidentified genes that may prove useful as markers of coral stress.

Molecular Investigation of the Cnidarian-dinoflagellate Symbiosis and the Identification of Genes Differentially Expressed during Bleaching in the Coral Montipora capitata

by Laura Lynn Hauck

A DISSERTATION

submitted to

Oregon State University

in partial fulfillment of the requirements for the degree of

Doctor of Philosophy

Presented March 20, 2007 Commencement June 2007

Doctor of Philosophy dissertation of Laura Lynn Hauck presented on March 20, 2007.

APPROVED:

______Major Professor, Representing Zoology

______Chair of the Department of Zoology

______Dean of the Graduate School

I understand that my dissertation will become part of the permanent collection of Oregon State University libraries. My signature below authorizes release of my dissertation to any reader upon request.

______Laura Lynn Hauck, Author

ACKNOWLEDGEMENTS

The accomplishments of any individual are merely a reflection of that individual’s network of support. I have many people, professional and personal, to thank for helping me succeed in my graduate school experience. First I must give my advisor, Virginia Weis, a huge thank you. She has been a great advisor who has provided me with academic, intellectual and financial support while allowing me to grow as a scientist and ask the research questions that I truly wanted to ask. Virginia has also been a great role model, demonstrating that academia and family can coincide with one another. She overcame tremendous personal strife during the time that I was her student, with the loss of her spouse Mark Patterson, and she has handled it with a dignity and grace that is truly astounding. Thank you, Virginia, for being the inspiration that you are.

I have been fortunate to have had a great graduate committee who guided my research and provided encouragement and enthusiasm along the way; my thanks to

Kevin Ahern, Andy Karplus, Dahong Zhang, and Larry Curtis. I must also thank the many members of the Weis lab, former and present, for sharing their time, advise, expertise and friendship; many thanks to Wendy Phillips, Jodi Schwartz, Carys

Mitchelmore, Melissa DeBoer, Maurico Rodriguez-Lanetty, Simon Dunn, Sophie

Richier, Elisha Wood-Charlson and Christy Schnitzler. I must give particular thanks to

Wendy Phillips, a true ‘lab goddess’, whose willingness to share her laboratory expertise was instrumental in the successful completion of my own laboratory work.

On the same topic, I must also give Mauricio Rodriguez-Lanetty a special thank you for his guidance in the development, execution and analysis of my microarray experiments.

Christy Schnitzler also patiently waded through stacks of baby paraphernalia, and suffered through diaper changes in our shared office and never once complained. I was also fortunate to have worked with two very talented undergraduate students, Morgan

Packard and Marrisa Matzler, to whom I wish the best of luck in their future endeavors.

My thanks must also go out to the folks at the Hawaii Institute of Marine Biology on

Coconut Island, particularly Ruth Gates, Fenny Cox and Dave Krupp, for their assistance with my research activities there.

On a personal note, “Yes Jeff, this does mean I am finally done with school!” I must thank my husband, Jeff Hauck, for being mostly tolerant of the fact that I have been in school the entire thirteen years (thus far) that we have been married. Seriously though, his support on my long scholastic journey is truly appreciated. I couldn’t have done this without you, Jeff, thanks! My parents, Nancy and John Lowas, taught me early on that I can do anything as long as I set my mind to it. Thanks for that lesson, and for all of the support and encouragement that you have provided to me throughout my life and in pursuit of this degree. It is nice to know that, no matter what, there are two people on this earth that absolutely believe in me. My daughter, McKenzie, has generously shared her mommy time, and made the whole journey worthwhile. I thank her for being a very good baby, allowing me to bring her to work with me every week until she was about 10 months old! That would not work well with the average baby; I was blessed with you. I would also like to thank my Grandma, Marjean Hatfield, for believing in my ability to finish what I started, and for giving me encouragement as I needed it.

There are many friends that I need to thank as well. My undergraduate mentor,

Sylvia Yamada, was my inspiration for continuing my education past the Bachelor’s degree. Sylvia, your friendship, mentoring, support and guidance has been truly appreciated, and was influential in shaping my entire scholastic career. Thank you so very much for everything. While I was able to bring McKenzie to work with me often, there are many research and teaching activities that are not conducive to the presence of a baby. My dear friend LaRae Wallace and I ‘care-swapped’ with our daughters making it possible for me to do a large portion of my research, all while Kira and

McKenzie grew up together like sisters. Thanks! Finally, my Friday through Sunday sanity days with friends were key to my mental health throughout this process. I must thank Glen, Jeff & LeAnn, and Ron & Bonnie and for our many evenings of fun, and also thank Linda & Bob and Aimee’s Allstars for hours of softball entertainment. In addition, the motorcyclists of the ‘un-group’ patiently listened to my grumblings, tirades and triumph dialogs over beer at Friday Night Lodge, and joined me on the open road when I needed the escape from stress that can only be found on two wheels.

Thanks to Sandy, Reid, Ted, Blinky, Randy, Rabbitt, Bill and the rest of the gang for waiting for me at the next road-stop. Cheers!

CONTRIBUTION OF AUTHORS

Wendy S. Phillips performed the Anthopleura elegantissima subtracted library from which CnidEF was isolated. She also sequenced the entire CnidEF cDNA prior to my analysis of the sequence. Steve J. Dollar is the contact for the Kauaii field site. He provided all background information on Pilaa Bay, and also arranged for access to this field site for sample collection.

TABLE OF CONTENTS Page Chapter 1: General Introduction…………………………………………… 1 The Host ………………………………………………………..……….. 3 The Symbiont ………………………………………………….………... 6 The Symbiosis…………………………………………………………… 9 Breakdown of the Symbiosis……………………………………………. 14 The Adaptive Bleaching Hypothesis……………………………………. 16 Model Systems ………………………………………………………….. 17 Research Approach ……………………………………………………... 19 Thesis Chapters …………………………………………………………. 21

Chapter 2: Characterization of a novel EF-Hand homologue, CnidEF, in the anemone Anthopleura elegantissima …………………………………… 31

Chapter 3: Identification of bleaching-linked genes from the scleractinian coral, Montipora capitata, using high-throughput screening of a cDNA subtracted library on a DNA microarray platform ……………………….. 58

Chapter 4: Transcriptome analysis of the coral Montipora capitata during coral bleaching in Pilaa Bay, Kauaii, HI …………………………….. 112

Chapter 5: General Conclusion ……………………………………………. 146 Bibliography ………………………………………………………………. 152 Appendices ………………………………………………………………... 159 Appendix A Supplementary methods for Chapter 2 ……………………. 160

LIST OF FIGURES

Figure Page

1. Cross-section of a coral polyp tentacle, showing cellular layers and location of symbionts…………………………………………………………… 4

2. Illustrations depicting the a) motile (mastigote) and b) vegetative (coccoid) Forms from the life cycles of a Symbiodinium dinoflagellate ………… 8

3. Symbiotic and aposymbiotic A. elegantissima ……………………….. 11

4. Illustration showing placement of coccoid dinoflagellate (green) within the multi-layered symbiosome (purple) inside of the host animal cell (brown) 12

5. Photographs of non-bleaching sheltered plates exposed during sampling of a bleaching M. capitata colony ……………………………………….. 20

6. Schematic representation of an EF-hand calcium-binding loop domain depicting the positions of the seven ligands that contribute to coordinated calcium binding ………………………………………………………. 34

7. The nucleotide, predicted amino acid sequence and predicted secondary structure of Anthopleura elegantissima CnidEF ……………………... 37

8. Northern blot analysis comparing CnidEF expression between symbiotic and aposymbiotic Anthopleura elegantissima sampled at various times throughout the year …………………………………………………… 43

9. Schematic diagram depicting location and number of EF-hand domains in Anthopleura elegantissima CnidEF and other EF-hand protein subfamilies ……………………………………………………………. 44

10. Phylogenetic relationships of EF-hand proteins including CnidEF from Anthopleura elegantissima inferred by a Neighbor-Joining analysis…. 49

11. Bleaching resonse monitored by cell counts from cores taken during the DCMU-induced bleaching experiment ……………………………….. 64

12. Distribution of the significant array features (p<0.05 after adjusting for the FDR) as a function of the ratio of gene expression …………………... 66

13. Phylogenetic relationships of CUB domain proteins with the 7 isoforms of CUB containing CnidCAP sequences repressed in M. capitata during bleaching ……………………………………………………………… 73

LIST OF FIGURES (continued)

14. Phylogenetic relationships of crystallin proteins with the 14 isoforms of beta-gamma crystallin induced in M. capitata during bleaching ……. 82

15. Distribution of the significant array features (p<0.05 after adjusting for the FDR) as a function of the ratio of gene expression …………………. 126

16. Phylogenetic relationship of repressed isoform 15 beta-gamma crystallin (BGCrys) identified in the field study with the 14 isoforms of BGCrys induced in M. capitata during experimental bleaching and other crystallins …………………………………………………………… 134

LIST OF TABLES

Table Page

1. The most significant hits from the (m)GenTHREADER analysis for CnidEF from Anthopleura elegantissima and LBP from Renilla reniformis……………………………………………………………… 47

2. GenBank accession IDs for sequences used in the phylogenetic analysis ……………………………………………………………….. 50

3. Known unigenes significantly down-regulated (p<0.05 after FDR adjustment) during coral bleaching …………………………………… 68

4. Known unigenes significantly up-regulated (p<0.05 after FDR adjustment) during coral bleaching ………………………………………………... 69

5. Unknown unigenes significantly up or down-regulated during coral bleaching (p<0.05 after FDR adjustment) …………………………… 70

6. Feature IDs for the sequences contributing to the CnidCAP and Beta-Gamma Crystallin Isoform unigenes formed from multiple sequences ……………………………………………………………... 71

7. M. capitata CnidCAP (m)GenTHREADER results …………………. 75

8. Forward and Reverse primers used to amplify selected genes for Q-PCR assays ………………………………………………………………… 97

9. Genbank accession identification numbers of sequences used in alignments ……………………………………………………………. 99

10. Genbank accession identification numbers of crystallin sequences used in the alignment ………………………………………………………… 124

11. Significant unigenes (p<0.05 after FDR adjustment) shared by both the field collected bleached corals, and the experimentally bleached corals ………………………………………………………………… 127

12. Known significant unigenes (p<0.05 after FDR adjustment) induced and repressed during coral bleaching in the field ……………………….. 128

13. Unknown unigenes significantly induced or repressed (p<0.05 after FDR adjustment) in the field during coral bleaching …………………….. 129

CHAPTER 1:

INTRODUCTION

CHAPTER 1

INTRODUCTION

Cnidarians, such as anemones and corals, engage in a symbiosis with photosynthetic dinoflagellates (zooxanthellae). The algae pass energy in the form of photosynthetically fixed carbon to the host in exchange for nitrogen, phosphorous and inorganic carbon from the host (Lewis & Smith 1971, Muscatine & Porter 1977, Smith

& Douglas 1987, Wang & Douglas 1998, Weis & Reynolds 1999). Furthermore, by hosting the symbionts in vacuoles called symbiosomes within their own gastrodermal cell layer (Smith & Douglas 1987, Muller-Parker & D'Elia 1997), the host coral also provides the dinoflagellate with a high light and stable living environment and a refuge from herbivory. Corals, with healthy symbiont populations, form both the trophic and structural foundation of reef ecosystems and are responsible for nutrient cycling in these nutrient poor waters (Muscatine & Porter 1977).

Coral bleaching is defined as an event in which there is a loss of the symbiotic zooxanthellae, or a reduction in the chlorophyll pigment concentrations of the symbiont

(Glynn 1993, Douglas 2003) causing the host tissue to appear white. Worldwide episodes of coral bleaching are extremely disconcerting considering that many coral species die without their algal symbionts and many tropical ecosystems would disappear without healthy reefs. The decline of vast reef ecosystems could have deleterious effects on a global scale. Reefwide bleaching events are now known to be caused primarily by elevated temperature, including global warming (Walther et al. 2002), and elevated UV radiation (Shick & Lesser 1991, Shick et al. 1991). Many studies have shown that exposure of some corals to even slightly elevated temperatures can initiate a bleaching 3 response (Sawyer & Muscatine 2001). It has also been shown that damage to the photosystems of the symbiont, particularly the D1 reaction center of photosystem II, is the first step in the coral bleaching process (Iglesias-Prieto 1997, Jones et al. 1998, Warner et al. 1999). This would imply that the dinoflagellate is the ‘weak link’ in this symbiosis, and that bleaching is a host response to an impaired symbiont. Loss of the symbiosis as an adaptive strategy for the coral host has been explored and debated extensively

(Buddemeier & Fautin 1993, Baker 2001, Kinzie III et al. 2001, Downs et al. 2002).

What is not known about the breakdown of this crucial symbiosis is the extent to which differential gene expression is a factor, and whether or not bleaching is dictated by the host or the symbiont. This study was designed to explore those questions. To date the vast majority of studies on coral bleaching have been at the ecological level. There is a need to explore, at the cellular and molecular level, the physiological response mechanisms that trigger bleaching episodes in cnidarians.

The Host

Most of the information in this section, except where indicated, was obtained from Ruppert & Barnes (1994). Host anemones and corals are members of the Phylum

Cnidaria. They are radially symmetrical, and diploblastic. They have an epidermis which covers the entire exterior of the organism, and an endodermal (gastrodermis) which lines the gastric cavity of the organisms and functions in food absorption and metabolic waste exchange (Fig. 1). These two layers are separated by a gelatinous mesoglea (Fig. 1), and those cnidarians that are symbiotic host their symbionts in

XS: Cross Section of Polyp Tentacle Gastrovascular Cavity Endodermal Cell Layer with Symbionts Mesoglea

Ectodermal Cell Layer

Fig. 1. Cross-section of a coral polyp tentacle, showing cellular layers and location of symbionts.

5 vacuoles called symbiosomes within the gastrodermal cell layer (Smith & Douglas

1987, Muller-Parker & D'Elia 1997).

There are four classes of cnidarians: 1) Scyphozoa, the true jellyfish, 2)

Cubozoa, the sea wasps, 3) Hydrozoa, hydroids, hydromedusae, and the Portuguese

Man-of-War, and 4) Anthozoa, the corals and anemones. All adult anthozoans are polypoid in form. Their polyps can be either solitary, as in many anemones, or colonial, as seen in most corals.

Most anthozoans reproduce both sexually and asexually. Asexual reproduction occurs via pedal laceration or longitudinal fission in anemones or via asexual budding in coral; to form colonies or aggregates of genetically identical polyps. Most sexual reproduction occurs via spawning of eggs and sperm which is often tied to a lunar cycle.

There are numerous species, however, that brood eggs and developing larvae. Planula larvae develop from fertilized eggs and are small (100 μm – 1 mm) ciliated balls that swim in the water column or creep on the benthos. Planulae persist for varying lengths of time before they settle and undergo metamorphosis into a juvenile polyp.

Anemones are in the Order Actiniaria and are most often solitary polyps with no calcified skeleton. Anemone polyps commonly range in size from 1.5 – 10 cm in length and 1 – 5 cm in diameter, but some species can exceed a diameter of more than a meter at the oral disk. They usually attach to the sea floor or intertidal substrate via a muscular pedal disk. Anemones are primarily sessile organisms, but all anemones can slowly creep along a substrate on their pedal disk. Anemones can host both zoochlorellae

(chlorophytes) and zooxanthellae (dinoflagellates), depending on the host species. 6

Corals are in the Order Scleractinia. They are characterized by an aragonite calcium carbonate skeleton secreted by the basal epidermis, and are therefore also known as the stony corals. A majority of stony corals are reef-building (hermatypic) animals that host symbiotic zooxanthellae. The calcification rate in corals has been tied directly to the productivity of their resident symbiotic zooxanthellae. Some corals lack symbiotic algae and secrete fragile skeletons. They are known as ahermatypic and are not reef builders. Most of these species occur in deep water habitats. The morphology of the skeleton is often specialized for the environment in which the coral lives. For example; low-light species tend to have large flat surface areas to increase light exposure for the symbiotic zooxanthellae, and corals in low flow areas have branched morphologies that increase surface area exposure and boundary layer disruption. Coral polyps are generally small in the colonial species averaging 1 – 3 mm in diameter. All of the polyps within one colony are connected by a lateral tissue layer. Sixty genera of corals possess endosymbionts, and the symbiont population can account for up to 50% of the total biomass.

The Symbiont

Most of the information in this section, except where indicated, was obtained from one of the following references: (Van den Hoek et al. 1995); (Freudenthal 1962,

Taylor 1987, Trench & Blank 1987, Wakefield et al. 2000). While there are many host- symbiont relationships in marine invertebrates, the predominant unicellular algal symbionts are various species of dinoflagellates. Dinoflagellates are an enigmatic group that are in the candidate kingdom Alveolata with apicomplexans and ciliates (Sogin

1996). Many, but not all species, possess choloroplasts and are autotrophic. 7

Most dinoflagellates possess both a motile (mastigote) and a vegetative (coccoid) isoform in their life cycle (Fig. 2). The vegetative coccoid form is the most common isoform in hospite within symbioses with cnidarians. It is a spherical body that is green to ochre in color. The motile isoform of Symbiodinium spp. possesses a pair of flagella, and follows the basic dinokont flagellar arrangement. The overall shape of the mastigote is pyriform, and can be divided into two parts, the epicone at the anterior end

(orientation determined by forward motion of the motile cell) and the slightly smaller hypocone at the posterior. The transverse flagellum lies within the girdle groove, between the hypocone and epicone. The other flagellum is the longitudinal flagella. It lies in the sulcus, a groove that extends longitudinally from the girdle down the hypocone. It should be noted that the free-living motile form of Symbiodinium has rarely been isolated in nature (Carlos et al. 1999). As a result there are key gaps in our understanding of the basic life history of Symbiodinium.

Vegetative dinoflagellates can reproduce sexually as well as asexually, however only asexual reproduction has been observed in the symbiont Symbiodinium spp.

Asexual reproduction takes place via binary fission in the motile and coccoid phases of

Symbiodinium. Recent molecular evidence indicates that Symbiodinium dinoflagellates, at least in the vegetative life stage, are haploid (Santos & Coffroth 2003). The ploidy of the other life stages is still unknown. The chromosomes of dinoflagellates are unusual in that they lack histones and remain condensed throughout the cell cycle.

Because symbiotic dinoflagellates appear virtually identical in the vegetative coccoid form, and vary only slightly, if at all, in the motile form; taxonomic classification at the species level has been very challenging. Until the recent advent of 8

Fig. 2. Illustrations depicting the a) motile (mastigote) and b) vegetative (coccoid) forms from the life cycles of a Symbiodinium dinoflagellate.

9 molecular technology all Symbiodinium phylotypes were mistakenly clumped together in a single species, Symbiodinium microadriaticum, regardless of host species. It is now known that many different phylotypes exist, presumably each with characteristics that make them specifically suited for certain hosts. There can also be a high level of host- symbiont specificity involved in the onset of symbiosis (Trench 1988, Weis et al. 2001,

Belda-Baillie et al. 2002). The phylotype classifications have now been developed under a clade organization using the designation of clades “A”, “B”, “C” (Rowan &

Powers 1991 (a)). Using a variety of techniques, including sequence and restriction fragment length polymorphism (RFLP) analysis of small and large subunit rDNA, and most recently sequence and denaturing gradient gel electrophoresis (DGGE) analysis of the internal transcribed spacer region (ITS) of the SSU rDNA, a phylogeny of

Symbiodinium spp. has emerged that includes 7 clades designated A through F (Rowan

& Powers 1991 (a), 1991 (b), McNally et al. 1994, Wilcox 1998, Baillie et al. 2000,

LaJeunesse 2001, Pawlowski et al. 2001, LaJeunesse 2002). Symbiont phylotype B1 is the single most prevalent Symbiodinium in the Caribbean, with Clade C types dominating in deeper, low-light areas (below 5 m), and Clade A species functioning as shallow water specialists (0-3m) (LaJeunesse 2002). Clades B and C showed the greatest diversity in this study. Distribution and niche diversification, however, does vary geographically. The Indo-Pacific is dominated by highly diverse representatives of

Clade C (Baker & Rowan 1997, Van Oppen et al. 2001).

The Symbiosis

The relationship formed between cnidarian hosts and their dinoflagellate algae is a tightly interwoven one that is often referred to as the ‘holobiont’ when viewed as a 10 single functional unit (Rowan 1998). It is classified as a mutualistic relationship that is based around nutritional exchange. The algae pass energy in the form of photosynthetically fixed carbon to the host and the host provides the symbiont with nitrogen and phosphorous compounds and inorganic carbon (Muscatine & Porter 1977,

Smith & Douglas 1987, Wang & Douglas 1998, Weis & Reynolds 1999). This recycling of nutrients is thought to be responsible for the success of symbiotic corals in nutrient limited tropical waters (Lewis & Smith 1971, Muscatine & Porter 1977). The host coral or anemone houses the symbionts in vacuoles within their own gastrodermal cell layer (Smith & Douglas 1987, Muller-Parker & D'Elia 1997), thus providing the dinoflagellate with refuge from herbivory and a high-light, stable living environment.

For many symbiotic corals, loss of the symbiont eventually results in death. For this reason the symbiosis is considered obligatory for the host. Symbiosis breakdown will be discussed in more detail later. There are many anemone species, including the temperate anemone Anthopleura elegantissima, for which the symbiotic relationship is facultative. They can be found in nature in both the symbiotic and aposymbiotic state

(Fig. 3). The term aposymbiotic is used to describe an individual that is capable of forming a symbiotic relationship, but is not involved in one. This term is not to be confused with asymbiotic, which refers to a species that never forms a symbiosis.

Symbionts can be obtained in an open or closed manner. A closed system, called vertical transmission, is one in which the symbiont is passed from the parent generation within the oocyte. The open system, called horizontal transmission, occurs when the larvae are produced aposymbiotic and need to obtain their symbionts from the environment. 11

Symbiotic

Aposymbiotic

Fig. 3: Symbiotic and aposymbiotic A. elegantissima (Weis & Levine 1996).

Fig. 4. Illustration showing placement of coccoid dinoflagellate (green) within the multi-layered symbiosome (purple) inside of the host animal cell (brown). The presence of both host and symbiont genomes is emphasized.

As mentioned above, the symbiont is housed within a multi-layered membrane bound vacuole known as the symbiosome, and the dinoflagellate partner actually dominates the space within the animal cell (see Fig. 4). Recent monoclonal antibody experiments have revealed that the outer membrane of the symbiosome is host derived,while the underlying apparent membranes are symbiont derived (Wakefield &

Kempf 2001). The presence of two separate genomes in such a close association makes molecular work on the symbiosis challenging. It is nearly impossible to isolate RNA from either partner that is truly free of contamination from the other.

The presence of symbionts inside host cells accentuates their ability to evade the host’s self-non-self protection that would otherwise identify the potential symbiont as a foreign entity and initiate its removal through phagocytosis. Alternatively, the phogocytosis process used in the host feeding response is what allows the symbiont to gain access to the host cell, and phagoctosis is avoided after entry is gained. It is therefore hypothesized that some form of host-symbiont communication exists. In an effort to further explore the symbiotic relationship between cnidarians and dinoflagellates, research using differential protein profiles and cDNA subtractive library techniques has been conducted in the Weis Lab. Such research is conducted with the intent of identifying ‘symbiosis genes’: those genes and gene products that are upregulated as a result of the symbiotic state. The products of such genes could be involved in the cnidarian-algal molecular intercommunication. There is evidence of such genes in other areas of symbiosis research, such as receptors involved in the root symbiosis between legumes and nitrogen fixing bacterium Rhizobium (Endre et al. 2002,

Spaink 2002, Stracke et al. 2002). Indeed, the concept of a symbiosis transcriptome 14 holding many symbiosis-linked genes, has been discussed in plant research (Birch &

Kamoun 2000). Examples of host derived symbiosis enhanced genes in the cnidarian- algal symbiosis that have been identified thus far include carbonic anhydrase (CA) from many hosts, an enzyme that catalyzes the interconversion of CO2 with HCO3-; and sym32, a gene identified in the anemone Anthopleura elegantissima that appears homologous to the fascilin-I (FasI) family of homophilic cell adhesion proteins (Weis &

Levine 1996, Weis & Reynolds 1999, Reynolds et al. 2000). The actual role of Sym32 has not yet been defined, however it has been determined that CA increases the supply of inorganic carbon available to the symbiont for fixation. It has also been shown that lectin/glycan interactions play a role in symbiont recognition and specificity during the onset of symbiosis in the scleractinian coral Fungia scutaria (Wood-Charlson et al.

2006), and the sea anemone Aiptasia pulchella (Lin et al. 2000); and a host lectin has been sequenced from the octocoral Sinularia lochmodes, which was shown through immunohistochemical studies to bind to the surface of the symbiotic dinoflagellates

(Jimbo et al. 2000). What recognition events occur subsequent to the lectin/glycan interaction remains undescribed.

Breakdown of the Symbiosis

As mentioned above, coral bleaching is defined as an event in which there is a loss of the symbiotic zooxanthellae, or a reduction in the chlorophyll pigment concentrations of the symbiont (Glynn 1993). Coral bleaching is visibly evident because the white host skeleton is very visible through the mostly transparent host tissues once the symbiont is removed from the holobiont. The white appearance of 15 bleached corals is the origin for the name ‘coral bleaching’. There are multiple reviews published that describe details of the causes and consequences of coral bleaching (Glynn

1993, Brown 1997, Douglas 2003). The reviews point out that most coral bleaching events are tied to elevated sea surface temperatures, such as those caused by global warming (Walther et al. 2002), and elevated UV radiation (Shick & Lesser 1991, Shick et al. 1991). Exposure of some corals to even slightly elevated temperatures can initiate a bleaching event (Sawyer & Muscatine 2001). It has also been demonstrated that elevated temperature and light work synergistically to increase the likelihood of a bleaching event occurring (Brown 1997). Although not completely understood, many different cellular mechanisms of coral bleaching have been observed. These mechanisms include host cell detachment (Gates et al. 1992), exocytosis leading to the release of the algae from the host cell (Steen & Muscatine 1987, Fang et al. 1998), programmed cell death, and necrosis (Dunn et al. 2002 (a), Dunn et al. 2002 (b)).

Coral bleaching initiated by elevated temperature and light stress actually begins with impairment of the symbionts photosystems. Exposure of the intact symbiosis to elevated light causes photoinhibition of the algae. Photoinhibition occurs by damage to the quinone binding protein, QB, in photosystem II (Shick & Lesser 1991). As a result, light energy funnels into the photosystem and has no way to be converted into chemical energy. Temperature stress of corals has recently been shown to act in a remarkably similar way as elevated light stress. Corals exposed to elevated temperature showed a marked impairment in carbon fixation (Jones et al. 1998) and further investigation has shown that this is a result of damage to photosystem II, more specifically in part due to a reduction in the number of D1 reaction centers (Iglesias-Prieto 1997, Jones et al. 1998, 16

Warner et al. 1999). As a result of both photoinhibition and temperature stress, the damage to photosystem II leads to a reduction in photosynthate production by the algae, the generation of reactive oxygen species, and ultimately loss of the symbiont from the symbiosis (Lesser & Shick 1989, Lesser & Shick 1990, Lesser et al. 1990, Shick &

Lesser 1991, Shick et al. 1991, Banaszak & Trench 1995).

The Adaptive Bleaching Hypothesis

The adaptive bleaching hypothesis introduced by Buddemeier & Fautin (1993) is much debated among coral reef researchers (Brown 1997, Baker 2001, Kinzie III et al.

2001). Simply stated, the adaptive bleaching hypothesis claims that corals are bleaching in order to survive the shifting parameters of the ecosystem in which they live. The underlying concept that drives this hypothesis is the evolutionary perception that organisms must adapt to changing environments. Global warming is a widely accepted theory that has been correlated with increases in sea surface temperatures, which are rising at alarmingly rapid rates that are not consistent with the rates observed for previous climate changes throughout geologic time (Walther et al. 2002, NOAA 2003).

If the photosystems of the algal partner in a symbiosis are unable to adapt to rapidly changing environmental parameters, the adaptive bleaching hypothesis asserts that the host would voluntarily remove the defunct algal population to free tissue space for a more environmentally suitable partner (one that is still producing photosynthate, and not producing oxygen radicals). This is a particularly crucial step for a host that obtains their algal symbiont vertically, from the parent generation. In such a closed transmission, the host never has an opportunity to select the algal partner from the 17 environment. Bleaching of the symbionts may be the only way for some host species to obtain symbionts suited to the environment in which the planula larvae settles.

In support of this hypothesis is the trend of Symbiodinium clades to be distributed along environmental gradients (Rowan et al. 1997, Rowan 1998, Toller et al.

2001, LaJeunesse 2002). For example, it has been observed that Clade A algae appear to be shallow water (1-3 M) specialists whereas Clade C usually dominates deeper water

(10-15M) corals (LaJeunesse 2002). This indicates that different clades perform better under different environmental parameters. It has also been observed that the repopulation of experimental and disease-associated bleached corals follows a successional shift in algal clades. Those hosts that originally housed narrowly adapted specialist clades, such as B and C, are repopulated by stress tolerant generalist clades, such as A and E (Toller et al. 2001). Although supportable and quite interesting, it should be noted that no research performed to date has proven or nullified the adaptive bleaching hypothesis. Even if found to be true, coral bleaching is still a serious ecological threat. The rapid pace at which corals are trying to adapt may be too rapid ultimately for survival.

Model Systems

Model systems currently in use in the Weis Lab at Oregon State University to study the cnidarian symbiosis include the temperate anemone Anthopleura elegantissima, the tropical anemone Aiptasia pulchella, larvae of the scleractinian coral

Fungia scutaria, and the scleractinian coral Montipora capitata. Each of these model systems has advantages and disadvantages that make them, as a suite of organisms, suitable for studying symbiosis onset, maintenance and breakdown. The two models 18 used for the research in this dissertation, 1) Anthopleura elegantissima, and 2)

Montipora captitata, will be described in more detail in the following section.

Anthopleura elegantissima (BRANDT, 1835)

The temperate anemone Anthopleura elegantissima is an ideal model for symbiosis-specific gene expression as it exists in nature in both the symbiotic and aposymbiotic state (Fig. 3). This allows for the comparison of gene expression without confounding factors such as heat shock expression from stress-induced bleaching. This animal lives in large, clonal colonies in the rocky intertidal of the western coast of North

America. It ranges in distribution from Alaska to Baja California. The life history and larval biology of this species was reviewed by Weis et al. (2002). It can form a symbiotic relationship with dinoflagellates of the genus Symbiodinium (LaJeunesse &

Trench 2000) as well as with taxonomically unidentified green algae (zoochlorellae). It was from this species that Cnid-EF, the topic of the first chapter of this dissertation, was first identified.

Montipora capitata (DANA, 1846)

Montipora capitata is an acroporid scleractinian coral with a highly plastic morphology consisting of large delicate plates and cups that skirt the base of finger-like projections called pinnacles. The plate morphology dominates in darker locations, with the finger-like projections predominant in higher light areas (Hoover 1998). This species is endemic to Hawaii (Hoover 1998). It is found most often in areas free of turbulence, and can range from a depth of only a few feet all the way to 150 feet. It spawns the third night after the new moon in June. Each coral releases bundles that contain both eggs and sperm (Hoover 1998). According to Fenny Cox at the Hawaii 19

Institute of Marine Biology (2002) the algal symbionts are passed vertically from the adult through the egg, therefore each successive generation presumably has the same symbiont population as the parent.

This species was chosen for use in bleaching studies for multiple reasons. M. capitata has a high propensity to bleach (personal observation, see Fig. 5, and Cox,

2002), providing many opportunities to collect naturally bleaching specimens in the field. The plate morphology of this species allows for uniformity in experimental manipulations. The plates can be trimmed to a given size, and algal cell count samples can be collected by a fixed diameter ‘punch’ allowing for the indexing of algal cell counts to surface area quickly and accurately. This species also occurs in two color morphs. These color morphs were once thought to be due to host pigment, however recent analysis of the ITS spacer region using denaturing gradient gel electrophoresis

(DGGE) has revealed that each morph hosts a different clade of algae: C31 (endemic only to Hawaii) in the dark brown morph, and D1a (a cosmopolitan opportunist) in the orange morph (LaJeunesse 2002). The presence of two distinct algal strains within a single host allows for the design of a variety of bleaching and specificity related experiments, and sparks additional interest in host-symbiont specificity within this relationship.

Research Approach

The research in this dissertation was designed to examine, at the molecular level, changes in gene expression of the host under two different conditions: 1) during a steady-state symbiosis as a function of the symbiosis and 2) during a coral bleaching 20

Fig. 5: Photographs of non-bleaching sheltered plates exposed during sampling of a bleaching M. capitata colony.

21 event as a function of the breakdown of the relationship. The specific questions being asked are: 1) What host genes are induced during a steady state symbiosis? and 2) What host genes are induced or repressed during coral bleaching? Despite the environmental importance of this symbiosis very little is known, particularly at the molecular level, about how these two partners interact. This research was performed with a discovery base approach and the intention of providing baseline molecular data that will provide a starting point for future physiologically-based research. Changes in host gene expression under each of the two conditions can provide insight into the cnidarian- dinoflagellate molecular intercommunication, and in particular host/symbiont recognition. In addition, the analysis of host gene expression during coral bleaching provides insight into stress management by the host, and can supply valuable molecular markers of stress for future studies.

Thesis Chapters

Chapter 1: What host genes are induced during a steady-state symbiosis?

CnidEF is a novel gene that was isolated from a symbiosis-enhanced subtracted library of the temperate anemone A. elegantissima by Wendy Reynolds (Hauck et al.

2007). Initial data indicated that CnidEF was expressed by symbiotic animals only.

The identity of CnidEF had not yet been looked at when I began to investigate this gene; however the full cDNA had been sequenced. The goal of this study was to determine if

Cnid-EF was truly a symbiosis-specific gene, and to determine its identity through a bioinformatics analysis.

Chapters 2 and 3: What host genes are induced or repressed during coral bleaching?

The goal of both of these chapters was to profile the patterns of gene expression found in the host coral Montipora capitata during coral bleaching. In chapter two I initiated the bleaching response experimentally through exposure of the holobiont to the commercial herbicide Diuron, which acts by blocking electron flow at the quinone acceptors of photosystem II (Taiz & Zeiger 1991). This exposure serves as a proxy to the type of damage that occurs to photosystem II during heat and UV stress as described above, and allows us to specifically examine the host’s response to a photosynthetically impaired symbiont without the interference of additional environmental stressors. A cDNA subtracted library was built from the experimentally bleached samples and printed onto a microarray platform for high-throughput screening.

In chapter three I collected bleaching and healthy M. capitata samples from a field bleaching event in Pilaa Bay; which is located on the North shore of Kauai, Hawaii. The specific trigger for this bleaching event is unkown, but suspected to be elevated temperatures. These samples were used to probe the microarray created in chapter 2, thus allowing us to compare the molecular mechanisms of coral bleaching in an experimental setting with that observed in a field bleaching event.

REFERENCES

Baillie BK, Belda-Baillie CA, Maruyama T (2000) Conspecificity and Indo-Pacific Distribution of Symbiodinium Genotypes (Dinophyceae) from Giant Clams. Journal of Phycology 36:1153-1161

Baker AC (2001) Reef Corals Bleach to Survive Change. Nature 411:765-766

Baker AC, Rowan R (1997) Diversity of Symbiotic Dinoflagellates (Zooxanthellae) in Scleractinian Corals of the Caribbean and Eastern Pacific, Vol 2. Smithsonian Tropical Research Institute, Balboa, Panama

Banaszak AT, Trench RK (1995) Effects of Ultraviolet (UV) Radiation on Marine Microalgal-Invertebrate Symbioses. II. The Synthesis of Mycosporine-like Amino Acids in Response to Exposure to UV in Anthopleura elegantissima and Cassiopeia xamachana. Journal of Experimental Marine Biology and Ecology 194:233-250

Belda-Baillie CA, Baillie BK, Maruyama T (2002) Specificity of a Model Cnidarian- Dinoflagellate Symbiosis. Biological Bulletin 202:74-85

Birch PRJ, Kamoun S (2000) Studying Interaction Transcriptomes: Coordinated Analyses of Gene Expression During Plant-Microorganism Interactions. Trends in Plant Science 5:77-82

Brown BE (1997) Coral Bleaching: Causes and Consequences. Coral Reefs 16:S129- S138

Buddemeier RW, Fautin DG (1993) Coral Bleaching as an Adaptive Mechanism. BioScience 43:320-326

Carlos AA, Baillie BK, Kawachi M, Maruyama T (1999) Phylogenetic Position of Symbiodinium (Dinophyceae) Isolates From Tridacnids (Bivalvia), Cardiids (Bivalvia), a Sponge (Porifora), a Soft Coral (Anthazoa) and a Free-Living Strain. Journal of Phycology 35:1051-1062 24

Cox F (2002) Montipora capitata spawning and bleaching information, direct observation. In: Hauck LL (ed)

Douglas AE (2003) Coral Bleaching - How and Why? Marine Pollution Bulletin 46:385-392

Downs CA, Fauth JE, Halas JC, Dustan P, Bemiss J, Woodley CM (2002) Oxidative stress and seasonal coral bleaching. Free Radical Biology & Medicine 33:533- 543

Dunn SR, Bythell JC, Le Tissier MDA, Burnett WJ, Thomason JC (2002 (a)) Programmed Cell Death and Cell Necrosis Activity During Hyperthermic Stress-Induced Bleaching of the Symbiotic Sea Anemone Aiptasia sp. Journal of Experimental Marine Biology and Ecology 272:29-53

Dunn SR, Thomason JC, Le Tissier MDA, Bythell JC (2002 (b)) Detection of Cell Death Activity During Bleaching of the Symbiotic Sea Anemone Aiptasia sp. In: Moosa K (ed) Proceedings of the 9th International Coral Reef Symposium, Bali

Endre G, Kereszt A, Kevei Z, Mihacea S, Kaló P, Kiss GB (2002) A Receptor Kinase Gene Regulating Symbiotic Nodule Development. Nature 417:962-966

Fang L-S, Wang J-T, Lin K-l (1998) The Subcellular Mechanism of the Release of Zooxanthellae During Coral Bleaching. Proceedings of the National Science Council Republic of Korea B 22:150-158

Freudenthal HD (1962) Symbiodinium gen. nov. and Symbiodinium microadriaticum sp. nov., a Zooxanthella: Taxonomy, Life Cycle, and Morphology. Journal of Protozoology 9:45 - 52

Gates RD, Baghdasarian G, Muscatine L (1992) Temperature Stress Causes Host Cell Detachment in Symbiotic Cnidarians: Implications for Coral Bleaching. Biological Bulletin 182:324-332

Glynn PW (1993) Coral Reef Bleaching: Ecological Perspectives. Coral Reefs 12:1-17 25

Hauck LL, Phillips WS, Weis VM (2007) Characterization of a novel EF-hand homologue, CnidEF, in the sea anemone Anthopleura elegantissima. Comparative biochemistry and Physiology Part B 146:551-559

Hoover JP (1998) Hawai'i's Sea Creatures: A Guide to Hawai'i's Marine Invertebrates, Vol. Mutual Publishing, Honolulu, Hawaii

Iglesias-Prieto R (1997) Temperature-Dependent Inactivation of Photosystem II in Symbiotic Dinoflagellates Proceedings of the 8th International Coral Reef Symposium, Panama City, p 1313-1318

Jimbo M, Yanohara T, Koike K, Koike K, Sakai R, Muramoto K, Kamiya H (2000) The d-galactose-binding lectin of the octocoral Sinularia lochmodes: characterization and possible relationship to the symbiotic dinoflagellates. Comparative Biochemistry and Physiology Part B 125:227-236

Jones RJ, Hoegh-Guldberg O, Larkum AWD, Schreiber U (1998) Temperature-Induced Bleaching of Corals Begins With Impairment of the CO2 Fixation Mechanism in Zooxanthellae. Plant, Cell and Environment 21:1219-1230

Kinzie III RA, Takayama M, Santos SR, Coffroth MA (2001) The Adaptive Bleaching Hypothesis: Experimental Tests of Critical Assumptions. Biological Bulletin 200:51-18

LaJeunesse T, C. (2001) Investigating the Biodiversity, Ecology, and Phylogeny of Endosymbiotic Dinoflagellates in the Genus Symbiodinium Using the ITS Region: In Search of a "Species" Level Marker. Journal of Phycology 37:866- 880

LaJeunesse T, C. (2002) Diversity and Community Structure of Symbiotic Dinoflagellates From Caribbean Coral Reefs. Marine Biology 141:387-400

LaJeunesse T, C., Trench RK (2000) Biogeography of Two Species of Symbiodinium (Freudenthal) Inhabiting the Intertidal Sea Anemone Anthopleura elegantissima (Brandt). Biological Bulletin 199:126-130

Lesser MP, Shick JM (1989) Effects of Irradiance and Ultraviolet Radiation on Photoadaptation in the Zooxanthellae of Aiptasia pallida: Primary Production, Photoinhibition, and Enzymic Defenses Against Oxygen Toxicity. Marine Biology 102:243-255

Lesser MP, Shick JM (1990) Effects of Visible and Ultraviolet Radiation on the Ultrastructure of Zooxanthellae (Symbiodinium sp.) in Culture and in situ. Cell Tissue Research 261:501-508

Lesser MP, Stochaj WR, Tapley DW, Shick JM (1990) Bleaching in Coral Reef Anthozoans: Effects of Irradiance, Ultraviolet Radiation, and Temperature on the Activities of Protective Enzymes Against Active Oxygen. Coral Reefs 8:225-232

Lewis DH, Smith DC (1971) The Autotrophic Nutrition of Symbiotic Marine Coelenterates with Special Reference to Hermatypic Corals. I. Movement of Photosynthetic Products Between the Symbionts. Proceedings of the Royal Society of London. Series B, Biological Sciences. 178:111-129

Lin KL, Wang JT, Fang LS (2000) Participation of glycoproteins on zooxanthellal cell walls in the establishment of a symbiotic relationship with the sea anemone Aiptasia pulchella. Zoological Studies 39:172-178

McNally KL, Govind NS, Thomé PE, Trench RK (1994) Small-Subunit Ribosomal DNA Sequence Analyses and a Reconstruction of the Inferred Phylogeny Among Symbiotic Dionflagellates (Pyrrophyta). Journal of Phycology 30:316- 329

Muller-Parker G, D'Elia CF (1997) Chapter 5 "Interactions Between Corals and Their Symbiotic Algae" in Life and Death of Corals Reefs, Vol. Chapman and Hall, New York, New York

Muscatine L, Porter JW (1977) Reef Corals: Mutualistic Symbioses Adapted to Nutrient-Poor Environments. BioScience 27:454-460

NOAA (2003) NOAA Paleoclimatology Global Warming - The Data. National Oceanic and Atmospheric Association 27

Pawlowski J, Holzmann M, Fahrni JF, Pochon X, Lee JJ (2001) Molecular Identification of Algal Endosymbionts in Large Milioli Foraminifera: 2. Dinoflagellates. Journal of Eukaryotic Microbiology 48:368-373

Reynolds WS, Schwarz JA, Weis VM (2000) Symbiosis-Enhanced Gene Expression in Cnidarian-Algal Associations: Cloning and Characterization of a cDNA, sym32, Encoding a Possible Cell Adhesion Protein. Comparative Biochemistry and Physiology, Part A 126:33-44

Rowan R (1998) Diversity and Ecology of Zooxanthellae on Coral Reefs. Journal of Phycology 34:407-417

Rowan R, Knowlton N, Baker A, Jara J (1997) Landscape Ecology of Algal Symbionts Creates Variation in Episodes of Coral Bleaching. Nature 388:266-269

Rowan R, Powers DA (1991 (a)) Molecular Genetic Identification of Symbiotic Dinoflagellates (Zooxanthellae). Marine Ecology Progress Series 71:65-73

Rowan R, Powers DA (1991 (b)) A Molecular Genetic Classification of Zooxanthellae and the Evolution of Animal-Algal Symbiosis. Science 251:1348-1351

Ruppert EE, Barnes RD (1994) Invertebrate Zoology, Vol. Saunders College Publishing, New York

Santos SR, Coffroth MA (2003) Molecular Genetic Evidence that Dinoflagellates Belonging to the Genus SymbiodiniumFreudenthal Are Haploid. Biological Bulletin 204:10-20

Sawyer SJ, Muscatine L (2001) Cellular Mechanisms Underlying Temperature-Induced Bleaching in the Tropical Sea Anemone Aiptasia pulchella. The Journal of Experimental Biology 204:3443-3456

Shick JM, Lesser MP (1991) An Overview of Photooxidative Stress and Defenses Against It In Coral Reef Symbioses Workshop on Coral Bleaching, Coral Reef Ecosystems and Global Climate Change: June 1991, p 1-15 28

Shick JM, Lesser MP, Stochaj WR (1991) Ultraviolet Radiation and Photooxidative Stress in Zooxanthellate Anthozoa: the Sea Anemone Phyllodiscus semoni and the Octocoral Clavularia sp. Symbiosis 10:145-173

Smith DC, Douglas AE (1987) The Biology of Symbiosis: Chapter 3, Vol. Edward Arnold Publishers, London

Sogin ML (1996) Ancestral Relationships of the Major Eukaryotic Lineages. Microbiologia 12:17-28

Spaink HP (2002) A Receptor in Symbiotic Dialogue. Nature 417:910-911

Steen RG, Muscatine L (1987) Low Temperature Evokes Rapid Exocytosis of Symbiotic Algae by a Sea Anemone. Biological Bulletin 172:246-263

Stracke S, Kistner C, Yoshida S, Mulder L, Sato S, Kaneko T, Tabata S, Sandal N, Stougaard J, Szczyglowski K, Parniske M (2002) A Plant Receptor-Like Kinase Required for Both Bacterial and Fungal Symbiosis. Nature 417:959-962

Taiz L, Zeiger E (1991) Plant Physiology, Vol. The Benjamin/Cummings Publishing Company, Inc., Redwood City, California

Taylor FJR (1987) Chapter 2, "Dinoflagellate Morphology," The Biology of Dinoflagellates, Vol Volume 21. Blackwell Scientific Publications, Boston, MA

Toller WW, Rowan R, Knowlton N (2001) Repopulation of Zooxanthellae in the Caribbean Corals Montastraea annularis and M. faveolata Following Experimental and Disease-Associated Bleaching. Biological Bulletin 201:360- 373

Toller WW, Rowan R, Knowlton N (2001) Zooxanthellae of the Montastraea annularis Species Comples: Patterns of Distribution of Four Taxa of Symbiodinium on Different Reefs and Across Depths. Biological Bulletin 201:348-359

Trench RK (1988) Specificity in Dinomastigote-Marine Invertebrate Symbioses: An Evaluation of Hypotheses of Mechanisms Involved in Producing Specificity, Vol 17. Springer-Verlag, Berlin, Heidelberg 29

Trench RK, Blank RJ (1987) Symbiodinium microadriaticum Freudenthal, S. goreauii sp. NOV., S. kawagutii sp. NOV. and S. pilosum sp. NOV.: Gymnodinioid Dinoflagellate Symbionts of Marine Invertebrates. Journal of Phycology 23:469- 481

Van den Hoek C, Mann DG, Jahns HM (1995) Algae, An Introduction to Phycology, Vol. Press Syndicate of the University of Cambridge, New York, NY

Van Oppen MJH, McDonald BJ, Willis B, Miller DJ (2001) The Evolutionary History of the Coral Genus Acropora (Scleractinia, Cnidaria) Based on a Mitochondrial and a Nuclear Marker: Reticulation, Incomplete Lineage Sorting, or Morphological Convergence? Molecular Biology and Evolution 18:1315-1329

Wakefield TS, Farmer MA, Kempf SC (2000) Revised Description of the Fine Structure of in situ "Zooxanthellae" Genus Symbiodinium. Biological Bulletin 199:76-84

Wakefield TS, Kempf SC (2001) Development of Host- and Symbiont-Specific Monoclonal Antibodies and Confirmation of the Origin of the Symbiosome Membrane in a Cnidarian-Dinoflagellate Symbiosis. Biological Bulletin 200:127-143

Walther G-R, Post E, Convey P, Menzel A, Parmesan C, Beebee TJC, Fromentin J-M, Hoegh-Guldberg O, Bairlein F (2002) Ecological responses to recent climate change. Nature 416:389-395

Wang J-T, Douglas AE (1998) Nitrogen Recycling or Nitrogen Conservation in an Alga-Invertebrate Symbiosis. The Journal of Experimental Biology 201:2445- 2453

Warner ME, Fitt WK, Schmidt GW (1999) Damage to Photosystem II in Symbiotic Dinoflagellates: A Determinant of Coral Bleaching. Proceedings of the National Academy of Science of the United States of America 96:8007-8012

Weis VM, Levine PR (1996) Differential Protein Profiles Reflect the Different Lifestyles of Symbiotic and Aposymbiotic Anthopleura elegantissima, a Sea Anemone From Temperate Waters. The Journal of Experimental Biology 199:883-892 30

Weis VM, Reynolds WS (1999) Carbonic Anhydrase Expression and Synthesis inthe Sea Anemone Anthopleura elegantissima are Enhanced by the Presence of Dinoflagellate Symbionts. Physiological and Biochemical Zoology 72:307-316

Weis VM, Reynolds WS, deBoer MD, Krupp DA (2001) Host-Symbiont Specificity During Onset of Symbiosis Between the Dinoflagellates Symbiodinium spp. and Planula Larvae of the Scleractinian Coral Fungia scutaria. Coral Reefs 20:301- 308

Weis VM, Verde EA, Pribyl A, Schwarz JA (2002) Aspects of the Larval Biology of the Sea Anemones Anthopleura elegantissima and A. artemisia. Invertebrate Biology 12:190-201

Wilcox TP (1998) Large-Subunit Ribosomal RNA Systematics of Symbiotic Dinoflagellates: Morphology Does Not Recapitulate Phylogeny. Molecular Phylogenetics and Evolution 10:436-448

Wood-Charlson EM, Hollingsworth LL, Krupp DA, Weis VM (2006) Lectin/glycan interactions play a role in recognition in a coral/dinoflagellate symbiosis. Cellular Microbiology 8:1985-1993

CHARACTERIZATION OF A NOVEL EF-HAND HOMOLOGUE, CNIDEF, IN THE SEA ANEMONE ANTHOPLEURA ELEGANTISSIMA

Laura L. Hauck*, Wendy S. Phillips, Virginia M. Weis

Comparative Biochemistry and Physiology, Part B: Biochemistry and Molecular Biology Editorial Office University of British Columbia #1153 - 2111 Lower Mall Vancouver, B.C. V6T 1Z4 Canada Volume 146, Issue 4 , April 2007, Pages 551-559 32

ABSTRACT

The superfamily of EF-hand proteins is comprised of a large and diverse group of proteins that contain one or more characteristic EF-hand calcium-binding domains. This study describes and characterizes a novel EF-hand cDNA, CnidEF, from the sea anemone

Anthopleura elegantissima (Phylum Cnidaria, Class Anthozoa). CnidEF was found to contain two EF-hand motifs near the C-terminus of the deduced amino acid sequence and two regions near the N-terminus that could represent degenerate EF-hand motifs. CnidEF homologues were also identified from two other sea anemone species. A combination of bioinformatic and molecular phylogenetic analyses were used to compare CnidEF to EF- hand proteins in other organisms. The closest homologues identified from these analyses were a luciferin binding protein (LBP) involved in the bioluminescence of the anthozoan

Renilla reniformis, and a sarcoplasmic calcium-binding protein (SARC) involved in fluorescence of the annelid worm Nereis diversicolor. Predicted structure and folding analysis revealed a close association with bioluminescent aequorin (AEQ) proteins from the hydrozoan cnidarian Aequorea aequorea. Neighbor-joining analyses grouped CnidEF within the SARC lineage along with AEQ and other cnidarian bioluminescent proteins rather than in the lineage containing calmodulin (CAM) and troponin-C (TNC).

Key Words: Cnidarian, EF-hand, Anthopleura elegantissima, Calcium-binding protein, molecular evolution

INTRODUCTION

Calcium is used to mediate a large variety of biological functions in animals, including bioluminescence, muscle contraction, neurotransmitter release, cell growth and development, and signal transduction. The EF-hand motif is often present in calcium- binding proteins. Familiar examples of these proteins include calmodulin (CAM), troponin-C (TNC), sarcoplasmic calcium-binding protein (SARC), and aequorin (AEQ), which functions in bioluminescence in hydrozoan cnidarians. The EF-hand domain consists of a helix-loop-helix structure formed by a highly conserved 12 residue calcium- binding loop, flanked on both sides by α-helices (Nelson and Chazin, 1998). This loop binds calcium with the coordination of seven ligands (Fig. 1). Five are from side-chain carboxylate oxygens donated by residues 1, 3, 5, and 12. One is a backbone carbonyl oxygen from residue 7. And finally an indirect association with residue 9, which is mediated by the seventh ligand of a water-molecule hydrogen bound to its side chain and also often associated with residue 3 (Malmendal et al., 1998; Nelson and Chazin, 1998).

A variety of EF-hand subfamilies show conservation of the first position D (D1) which provides a ligand binding group, a G6 allowing for a 90° turn in the loop, and an E12 which provides two ligand binding groups (Jamieson et al., 1980; Malmendal et al., 1998; Yuasa et al., 2001).

There are at least 45 distinct subfamilies of EF-hand proteins which contain up to eight EF-hand domains that usually occur in pairs (Nakayama and Kretsinger, 1994;

Kawasaki et al., 1998). The function of only 13 of these subgroups is known. For the well-studied EF-hand proteins, in most cases, adjacent EF-hand domains cross-associate to form a calcium-binding pocket. The most significant differences between EF-hand 34

L7 G6

S9 N5 H2 O

Ca2 D3 +

E12

Fig. 1. Schematic representation of an EF-hand calcium-binding loop domain depicting the positions of the seven ligands that contribute to coordinated calcium binding.

35 proteins occur in the regions outside of the EF-hand domains. These can be catalytic, such as an oxygenase region encoded in AEQ, or structural, such as in CAM which transduces intracellular calcium signals through a conformational change (Nakayama and

Kretsinger, 1994). The conformational change in CAM causes activation of the enzymatic or structural portion of the target protein. Given the variety and importance of the many calcium-related biological functions, it is not surprising that this family of proteins has been well studied, including its molecular evolution and phylogenetics

(Nakayama and Kretsinger, 1994).

Several EF-hand proteins have been described in cnidarians, and are reviewed by Tsuji et al. (1995). These include AEQ, obelin (OBL), mitrocomins and cyclin, all isolated from different hydrozoans, and all proteins that function in bioluminescence.

Luciferin-binding protein (LBP), another bioluminescence protein, as well as a CAM have also been described in the anthozoan Renilla reniformis.

In this study, we describe a novel EF-hand protein, CnidEF, from another anthozoan, the North American Pacific coast temperate anemone Anthopleura elegantissima. CnidEF was first identified from A. elegantissima during screening of a subtracted library that was generated to characterize anemone genes expressed specifically as a function of its symbiosis with the dinoflagellate alga Symbiodinium muscatinei (Muscatine, 1971; LaJeunesse and Trench, 2000). Symbiosis between A. elegantissima and S. muscatinei is facultative; in high light environments anemones harbor symbionts in their tissues but in low light environments, such as caves and rock crevices, anemones are symbiont-free (Weis and Levine, 1996). This study describes comprehensive expression studies that revealed no correlation of CnidEF levels to 36 symbiotic state. In addition, we have identified CnidEF homologues from two other anemone species and performed structural and phylogenetic analyses of CnidEF, both of which place CnidEF within the SARC lineage as a novel addition to the EF-hand family of calcium-binding proteins.

METHODS

Isolation of CnidEF from Anthopleura elegantissima

CnidEF was originally isolated from a subtracted cDNA library made from

Anthopleura elegantissima RNA and designed to identify sequences enhanced in the symbiotic state. See Appendix A for details of the subtracted library.

RNA extraction and cDNA synthesis

Total RNA was extracted from animals as described in Weis and Reynolds (1999).

RNA was reverse transcribed using 0.5 μg oligo (dT)12-18 and the Superscript

Preamplification System (Life Technologies) to synthesize cDNA.

Northern hybridizations

To determine the relative level of CnidEF expression in field collected samples,

Northern hybridizations were conducted. Total RNA (6.75 µg) from 56 animals was resolved on a 1% formaldehyde denaturing gel in 1X MOPS buffer (0.1M MOPS, 40mM sodium acetate, 5 mM EDTA). RNA was then transferred to a nylon membrane and hybridized overnight at 68˚C in DIG Easy Hyb (Roche) containing 100μg/ml salmon sperm DNA and a 307 nucleotide digoxigenin-labeled RNA probe transcribed from a

CnidEF clone with specific primers (see Fig. 2 for primer locations). The membrane was 37

Fig. 2: The nucleotide, predicted amino acid sequence and predicted secondary structure {McGuffin, 2000 #254;McGuffin, 2003 #255} of Anthopleura elegantissima CnidEF (Genbank Accession no. ABD16201). Divergent EF-hand regions (Position I & Position II) and true EF-hand regions (Position III & Position IV) are bold and underlined in the amino acid sequence. Conserved EF-hand residues are in red with numerical annotation, and unique CnidEF conserved residues are in blue with numerical annotation. The numerous cysteine residues are green. Location of predicted secondary structural elements of helix, coil and strand are depicted below the amino acid sequence. Primer locations are as follows: specific forward and reverse primers for Northern hybridization probe construction are shaded gray, degenerate forward primer CnidEFDF1, shaded magenta, used with an oligo d(T) primer 1-rev (see text) for amplification of a CnidEF fragment from A. artemisia, degenerate forward primer CnidEFDF2, shaded blue, used together with degenerate reverse primer CnidEFDR1, shaded yellow, for amplification of a CnidEF fragment from Aiptasia pallida.

Fig. 2. 39 washed twice at room temperature with 2X SSC, 0.1% SDS. The hybridized RNA was then immunodetected using anti-digoxigenin antibody conjugated to alkaline phosphatase

(Roche). To quantify the relative expression levels, a pixilation analysis of the blot film was conducted using the ImageQuaNT phosphoimager (Molecular Dynamics, Inc.) according to manufacturer’s instructions. Optical density values were subjected to a 2- way ANOVA to test for differences in CnidEF expression between months and among groups (symbiotic versus aposymbiotic). They were also subjected to a post hoc Tukey

HSD multiple comparison test to identify the difference in expression by month. All statistical analyses were performed using SPSS V. 9.0.0 (1989).

Motif Recognition

Motif searches of homologues from the closest EF-hand families, and all

CnidEF sequences, were conducted at the ExPASy Website hosted by The Swiss

Institute of Bioinformatics (Bucher and Bairoch, 1994; Hofmann et al., 1999). Many

EF-hand proteins, including those used in the phylogenetic analysis described below, contain more than two EF-hands. Motif searches were conducted on all sequence groups of the final alignment to determine the number and location of EF-hands. This information was used to verify the alignment parameters, and to search for evidence of evolutionarily lost EF-hands within the CnidEF sequence. General EF-hand conservation patterns, such as D1, G6, and E12 (Jamieson et al., 1980; Malmendal et al.,

1998; Yuasa et al., 2001) were used to identify the possible locations of degenerate EF- hands.

Identification of CnidEF homologues from other anemone species

CnidEF homologues were identified from other anemone species using degenerate primers and reverse transcriptase PCR. EF-hand domains were the targets for degenerate primer design (see Fig. 2 for primer locations), and a modified oligo-dT primer 1-rev (5’-

CTCTAGAACTAGTCT18-3’) was used for reverse priming off of the poly-A tail (Weis and Reynolds, 1999). A fragment of a CnidEF homologue from A. artemisia was amplified with degenerate forward primer CnidEFDF1 and 1-rev. CnidEF amplification from A. pallida was performed in stages. The first fragment was amplified from a degenerate forward primer CnidEFDF2, and a degenerate reverse primer CnidEFDR1. A specific forward primer (5’-CTGACTACGACAAGAACAAG-3’) was made from this sequence and used with 1-rev to amplify the 3’ end of the cDNA. The PCR Reagent

System (Invitrogen) was used for all PCR reactions.

Single band PCR products were TA cloned into pGEM-T vectors (Promega).

Following amplification in DH5α Escherichia coli cells (Invitrogen), the plasmid DNA was sequenced with a Terminator v3.1 cycle sequencing kit (BigDye®) using a 3100

Genetic Analyzer (ABI Prism®), 3100 data collection software v.1.1 and DNA sequencing analysis software v.3.7 (ABI Prism®). Sequences were aligned in ClustalX with the original A. elegantissima CnidEF nucleotide sequence to determine if the isolated sequence was a CnidEF homologue (Thompson et al, 1997).

Structural analyses of sequences

The deduced amino acid sequence of CnidEF was analyzed by the Protein

Structure Prediction Server (PSIPRED) to predict the secondary structure (McGuffin et al., 2000). The predicted structure was then compared with known crystal structures 41 through a fold recognition analysis using the (m)GenTHREADER server (McGuffin and

Jones, 2003). R. reniformis LBP was also threaded to this database because there is no crystallized structure of LBP available for direct comparison with CnidEF. The next closest homologue, SARC from N. diversicolor, is in the crystallized structure database thus allowing for a structural comparison of all three homologues.

Phylogenetic analyses of sequences

Deduced amino acid sequences were compared with known protein sequences using BlastP and PsiBlast network databases (Altschul et al., 1990; 1997) at the National

Center for Biotechnology Information (NCBI). Additional EF-hand sequences from other subfamilies that did not appear in the BlastP and PsiBlast searches were also identified for use in the phylogenetic analysis to explore the molecular evolution of CnidEF. These included parvalbumin (PARV), oncomodulin, S100, calbindin, secretegogin, calsequestrin, calregulin, calcyclin, metastacin, and calreticulin.

The EF-hand subfamily sequences were included in alignments conducted in

ClustalX. Sequence lengths were not adjusted, nor were they masked during the alignment. Neighbor-Joining (NJ) analyses were conducted from these alignments using

PAUP software (Swofford, 2000), to generate a tree with bootstrap values of 1000.

According to Nakayama and Kretsinger (1994), EF-hand proteins are thought to have evolved from a “UR” precursor, after which the SARC and CAM/TNC lineages diverged from one another. Due to grouping of CnidEF within the SARC lineage, CAM and TNC sequences were retained in the final analysis to root the tree.

RESULTS

Northern Hybridization

A Northern blot analysis was conducted to examine expression patterns of the

CnidEF gene in anemones collected from the field at various times throughout the year.

The results show a highly variable level of expression, with aposymbiotic and symbiotic samples collected in close proximity to one another having almost identical expression levels (Fig. 3). The ANOVA showed no difference in expression between symbiotic and aposymbiotic animals. According to the Tukey HSD, the month of May had statistically significant elevations in gene expression for both groups (p = 0.05).

A. elegantissima CnidEF Sequence Description

The CnidEF cDNA (Genbank Accession no. ABD16201) is 635 bp in length, with a 441 bp open reading frame (ORF) corresponding to 147 amino acids and an approximate molecular weight of 16.6 kKDa (Fig. 2). Motif searches of the deduced amino acid sequence of CnidEF revealed the presence of EF-hand calcium-binding loop motifs. Prosite identified two such domains near the C-terminus. In an alignment of multiple EF-hand proteins (Fig. 4) there were four possible EF-hand locations, with

CnidEF having only positions III and IV.

It is possible that a CnidEF progenitor had additional EF-hands that have since diverged beyond recognition. Analysis of the CnidEF sequence near the N-terminus

(Fig. 2), where the position I EF-hand is present in other sequences of the alignment, shows G4 & G6 of the binding loop may have been maintained. These two residues are also found in position I EF-hand of CAM. These are the only possible retained residues

0.30 Symbiotic

Aposymbiotic

0.25

(4)

(3) 0.20

0.15 (7) (6)

0.10 (3) (2)

(3) (2)

Optical Density (9)

0.05 (1) (1)

0 January March April May July August Sample Collection Month

Fig. 3. Northern blot analysis comparing CnidEF expression between symbiotic and aposymbiotic Anthopleura elegantissima sampled at various times throughout the year. Number of individuals sampled is in parentheses above the column, error bars represent standard deviation. There was a statistically significant (p > 0.05) elevation in expression according to the Tukey HSD analysis for the month of May.

I II III IV

CAM NH3+ EF hand EF-hand EF-hand EF-hand COO

SARC NH3+ EF-hand EF-hand EF-hand COO

NH3+ EF-hand EF-hand EF-hand COO AEQ

NH3+ EF hand EF-hand EF-hand COO LBP

NH3+ EF-hand EF-hand COO PARV

NH3+ EF-hand EF-hand COO

CnidE

Fig. 4. Schematic diagram depicting location and number of EF-hand domains in Anthopleura elegantissima CnidEF and other EF- hand protein subfamilies. The grey bar indicates the amino acid strand of the entire protein, EF-hands are represented by black ovals, gaps as determined in a Clustal-X alignment, are shown as breaks in the grey bars. The possible degenerate EF-hand locations in CnidEF are indicated by dotted ovals. The presence of all EF-hands was verified in Scan Prosite. 45 and they do not provide convincing evidence for the existence of an ancestral EF-hand at this location.

The EF-hand loop region in position II of CnidEF shifted by several residues among the different alignments, most likely due to high sequence divergence in this region, and a 5 residue insertion-deletion (indel) mutation present in the AEQ and OBL sequences. According to one alignment, CnidEF contains a position II DA_G near the beginning of this EF-hand loop region that may relate to the D1, A2, G4 pattern present in CAM, and also contains P11E12, which is shared with AEQ, OBL, and CAM. In addition, it shares a position II S5 with most of the PARV sequences, and with TNC of

Danio rerio. These six conserved residues provide evidence that there was once a Ca2+ binding EF-hand loop in position II.

Comparison of the true EF-hands in positions III & IV of CnidEF to other EF- hand sequences in the alignment revealed substantial conservation in the calcium- binding loop. Position III shares D1, K2, D3, G4, I8, S/T9, D11 & E12 with most sequences, and position IV shares D1, G4, D5, I/L8, D11 & E12 with most subfamilies and

K2 & N3 only with TNC. CnidEF also has an N6, in place of the more widely conserved

G6, which appears to be an uncommon EF-hand feature that in this alignment is shared only with N6 of the EF-hand loop in position III of SARC from the annelid Nereis diversicolor. CnidEF has an unusually high number of cysteine residues with nine cysteines total, seven of which are concentrated in a region forty amino acids in length

(Fig. 2).

Predicted Secondary Structure and mGen-THREADER Analysis

The secondary structure of A. elegantissima CnidEF was predicted by the

PSIPRED server (McGuffin et al., 2000) and is shown in Fig. 2. Despite the divergence of all but two residues in the position I EF-hand loop region of CnidEF, the predicted secondary structure retained the EF-hand pattern (α-helix, coil loop, α-helix), although the second helix begins midway through the area where the calcium-binding loop should have been. The position II divergent EF-hand region, which showed the most potential for having an ancestral EF-hand origin, contained no structural similarity to true EF-hands.

The true EF-hands (III & IV) showed the expected EF-hand structure: α-helix, coil loop,

α-helix with a small β-strand leading into the second α-helix. For comparative purposes

Renilla reniformis LBP and AEQ, both cnidarian EF-hand sequences, were also submitted for analysis by PSIPRED. The predicted structure among the three representatives was similar, to include a common small β-strand leading into the second helix of the position

IV EF-hands (data not shown).

A. elegantissima CnidEF and R. reniformis LBP were threaded to a database of crystallized EF-hand homologues at the PSIPRED site to allow for structural comparison between the two anthozoan EF-hand sequences (Table 1). The results show a close structural relationship between these two homologues. The four most significant hits for

CnidEF were all also high hits for LBP and the best hit for both sequences was AEQ, another cnidarian homologue. In addition, both sequences threaded to a SARC homologue from N. diversicolor, a sequence of significance in phylogenetic analyses (see ahead).

Table 1. The most significant hits from the (m)GenTHREADER analysis for CnidEF from Anthopleura elegantissima and LBP from Renilla reniformis. Asterisks denote hits common to both lists.

Protein Organism Expect value Confidence Protein function

Hits for *AEQ Aequorea aequorea 0.010 Medium Bioluminescence Anthopleura elegantissima CnidEF *Myosin regulatory domain Aequipecten irradians 0.011 Medium Skeletal muscle contraction

*SARC Nereis diversicolor 0.025 Medium Fluorescence

*Calcineurin Homo sapiens 0.035 Medium CAM-stimulated phosphatase

Hits for *AEQ Aequorea aequorea 0.001 High Bioluminescence Renilla Reniformis LBP *SARC Nereis diversicolor 0.002 High Fluorescence

Branchiostoma SARC 0.002 High Possibly muscle contraction lanceolatum

Recoverin Bos Taurus 0.005 High Control of rhodopsin kinase activity

*Calcineurin Homo sapiens 0.008 High CAM-stimulated phosphatase Calcium-binding protein Arabidopsis thaliana 0.009 High Unknown *Myosin regulatory domain Aequipecten irradians 0.010 Medium Skeletal muscle contraction Apoptosis-linked protein (alg-2) Mus musculus 0.010 Medium Apoptosis signaling EhCaBP Entamoeba histolytica 0.013 Medium Signal transduction in pathogenesis Asterisks denote hits common to both list 48

Identification of CnidEF homologues from other anemone species

RT-PCR was used to identify CnidEF homologues from other anemones. A 476 bp fragment of a CnidEF was isolated from the closely related sympatric nonsymbiotic anemone Anthopleura artemisia (Genbank Accession no. ABD16203). This sequence displayed a 91% sequence identity to A. elegantissima CnidEF. In addition, a 478 bp fragment of a CnidEF was identified from the more distantly related symbiotic tropical anemone Aiptasia pallida (Genbank Accession no. ABD16202). This sequence was just 44% identical to the A. elegantissima CnidEF, considerably more divergent than the

A. artemisia sequence. For the EF-hands in positions III and IV, in the two Anthopleura species, the sixth residue is an N instead of the highly conserved G present in most other organisms. In A. pallida it remains a G in the EF-hand of position III, but is an R in position IV. All three CnidEF sequences contain a unique C10 in the fourth EF-hand loop.

Phylogenetic Analyses of Sequences

The majority of BlastP returned hits to A. elegantissima CnidEF were CAMs from a variety of different organisms, whereas PsiBlast and literature searches identified a variety of homologues from other EF-hand subfamilies including LBP, AEQ, OBL,

SARC and TNC. In initial analyses, using all identified EF-hand sequences (listed in methods), the only subfamilies with which CnidEF associated were LBP, AEQ, OBL and SARC (data not shown). Therefore, the final alignment used for phylogenetic tree generation (Fig. 5) used only these sequences (see Table 2 for sequence Accession IDs) and CAM and TNC. The CAM and TNC sequences grouped outside of the SARC lineage with strong bootstrap support and were used to root the tree. The distance 49

Fig. 5. Phylogenetic relationships of EF-hand proteins including CnidEF from Anthopleura elegantissima inferred by a Neighbor-Joining analysis. Percent of 1000 bootstrap replicates supporting the topology is given at each node. The tree is rooted with the CAM/TNC group. Cnidarian Sequences are in bold.

Table 2. GenBank accession IDs for sequences used in the phylogenetic analysis.

Organism Gene Name Accession ID # Anthopleura elegantissima CnidEF ABD16201 Anthopleura artemisia CnidEF ABD16203 Aiptasia pallida CnidEF ABD16202 Renilla reniformis LucBP P05938 Aequorea victoria AEQ P02592 Aequorea victoria AEQ P07164 Aequorea macrodactyla AEQ AAK02061 Aequorea coerulescens AEQ AAO91813 Mitrocoma cellularia Mitrocomin P39047 Clytia gregaria Clytin CAA49754 Obelia geniculata Obelin AAL86372 Obelia longissima Obelin Q27709 Neanthes diversicolor SARC P04571 Drosophila melanogaster SARC AF014952.1 Penaeus sp. SARC P02636 Branchiostoma lanceolatum SARC P04569 Penaeus sp. SARC P02635 Danio rerio Parv AAH81523 Triakis semifasciata Parv P30563 Gallus gallus Parv P43305 Merlangius merlangus Parv 1A75B Amphiuma means Parv P02616 Boa constrictor Parv P02615 Xenopus laevis Parv AAA49925 Homo sapiens Oncomodulin NP_006179 Chara corallina CAM BAA96536 Physcomitrella patens CAM CAA62150 Renilla reniformis CAM P62184 Metridium senile CAM BAB61796 Halichondria okadai CAM BAB61797 Patinopecten sp. CAM P02595 Halocynthia roretzi CAM BAA19788 Branchiostoma lanceolatum CAM BAA19786 Fagus sylvatica CAM Q39752 Oryctolagus cuniculus CAM 1003191A Toxoplasma gondii CAM CAA69660 Trypanosoma cruzi strain CL Brener CAM XP_808089 Drosophila melanogaster TC P47947 Solenopsis invicta TC AAL57489 Caenorhabditis elegans TC BAB84566 Todarodes pacificus TC BAB40597 Perinereis vancaurica tetradentata TC BAB18898 Mus musculus TC AAH24390 Danio rerio TC AAH64284 Branchiostoma lanceolatum TC BAA13733 Halocynthia roretzi TC BAA13630

51 analysis divided the tree into two major clades with very strong support, one consisting of PARV homologues and the other containing SARCs, AEQs and OBLs. This clade was further subdivided with moderate support into AEQ/OBL and SARC/LBP/CnidEF lineages. Within this SARC/LBP/CnidEF lineage, the analysis provided strong support for a terminal CnidEF and two SARC clades. A lineage containing R. reniformis LBP and N. diversicolor SARC grouped with the CnidEF sequences with very weak support.

Further, there was very weak support for the deepest branching node, suggesting that this analysis cannot confidently resolve the relationships within the SARC/LBP/CnidEF lineage.

DISCUSSION

CnidEF is a novel addition to the large EF-hand family of proteins, possessing two EF-hands near the C-terminus, and two upstream regions that might be degenerate

EF-hands. The retention of key residues in the position II region of CnidEF indicates that this protein may have once contained an EF-hand in this position that has since been evolutionarily lost. Because EF-hands usually occur in pairs, and the predicted secondary structure in the position I region reflects the expected α-helix, coil loop, α- helix pattern, it is also possible that there was once a position I EF-hand that has since diverged beyond recognition.

As discussed earlier, all EF-hand proteins evolved from a common UR ancestor which then, through a series of gene duplications and fusions (or lack there of), formed several distinct evolutionary clades (Nakayama and Kretsinger, 1994). According to the phylogenetic analysis presented here (Fig. 5), the evolutionary origin of CnidEF, as 52 well as AEQ and LBP, appears to be within the SARC lineage. CAM and TNC, although close BLAST homologues to CnidEF, distinctly group outside the SARC lineage, as does PARV. This is an interesting phenomenon as AEQ and SARC have previously been considered separate sub-families, and have not been joined by other molecular analyses. Structural analysis through the PSIPRED server (Table 1) supports the placement of CnidEF with AEQ and SARC. Within the SARC lineage, anthozoan

LBP and CnidEF do not group with the bioluminescent hydrozoan EF-hand proteins, such as AEQ and OBL, but rather with the SARCs from other organisms. There was a lack of association with CAM proteins isolated from the anthozoans Metridium senile and R. reniformis (Fig. 5) supporting the conclusion that CnidEF is a novel EF-hand protein that is not in the CAM lineage. The placement of CnidEF by sequence and structural analysis with LBP from the anthozoan R. reniformis, SARC from the annelid

N. diversicolor, and with AEQ and OBL from hydrozoans is intriguing because all of these proteins function in the production or modulation of light. Upon binding three calcium ions, the photoprotein AEQ undergoes a conformational change that converts it into an oxygenase, which in turn catalyzes the oxidative decarboxylation of tightly bound luciferin. It then uses green fluorescent protein as a secondary emitter to produce green light (Lewis and Daunert, 2000). The bioluminescent function of AEQ is made possible by several specific residues: a C-terminal proline, three cysteines in positions

145, 152 and 180, a histidine at position 169, and several tryptophan residues in positions 12, 79, 86, 108, 129 and 173 (Lewis and Daunert, 2000). LBP function is much like that of AEQ, however unlike AEQ, LBP requires, in addition to Ca2+, the presence of dissolved oxygen and a luciferase (Charbonneau and Cormier, 1979). The 53 binding of Ca2+ to the LBP photoprotein initiates a conformational change that exposes the bound luciferin and oxygen to the luciferase, thus allowing substrate oxidation to occur and light to be emitted. The function of N. diversicolor SARC is fluorescence, and the fluorescent properties of this SARC are linked to the presence of three tryptophan residues in positions 4, 57 and 170 (Sillen et al., 2003). SARCs, in general, have four typical helix-loop-helix EF-hands, however, like AEQ, only sites I, III, IV have retained Ca2+ or Mg2+ binding capacity (Cook et al., 1993; Sillen et al., 2003).

Comparison of the N. diversicolor SARC to other invertebrate SARCs has shown a high variability among the proteins, with only 9 residues in common to all species

(Collins et al., 1988).

There is no evidence that A. elegantissima, A. artemisia or A. pallida, all of which express a form of CnidEF, are bioluminescent organisms. Comparison of

CnidEF sequences to the residues important for AEQ light emission also disputes any link of CnidEF function to bioluminescence. CnidEF lacks tryptophan residues, which are responsible for coelentrazine substrate binding and the formation of a hydrophobic pocket in AEQ. CnidEF does contain many cysteine residues, although not in the same locations as those in AEQ, and lacks the H169 responsible for oxygen binding. CnidEF does, however, have a proline very close to the C-terminus, which aligns with a proline from AEQ. All three anemones expressing CnidEF do fluoresce (Buchsbaum, 1968;

Rice, 1999; Mazel, 2006), however all three forms of CnidEF lack the tryptophan residues that impart the fluorescent properties of N. diversicolor SARC (Sillen et al.,

2003). In addition, the work presented in this study shows that CnidEF expression is not linked to the symbiotic state. Samples collected in close proximity to one another 54 had nearly identical expression (data not shown). This suggests that environmental factors played a role in CnidEF expression. The emergence of CnidEF as a symbiosis- linked gene in the subtracted library was likely an artifact of the collection process.

Therefore, the function of CnidEF remains unclear. It has been hypothesized that the actual function of bioluminescent proteins is not bioluminescence at all; rather that bioluminescence is a byproduct of a different biological function (Shimomura, 1985).

Perhaps, due to the lack of key residues necessary for light production or modulation,

CnidEF never developed the side effect of bioluminescence and only performs the original (and still unknown) biological function of this curious group of proteins.

ACKNOWLEDGEMENTS

We thank Steve Giovannoni for assistance with bioinformatic analysis, and

Andrew Karplus and Elisha Wood-Charlson for assistance with protein structure analysis.

We also thank members of the Weis Lab for comments on the manuscript. This work was supported by grants from the National Science Foundation (MCB0237230 &

IOB0542452) to V.M.W. and by a National Science Foundation Fellowship to L.L.H.

REFERENCES

Altschul, S.F., Gish, S.F., Miller, W., Myers, E.W., and Lipman, D.J. 1990. Basic local alignment search tools. J. Mol. Biol. 215:403-410.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.

Bucher, P., and Bairoch, A. 1994. A generalized profile syntax for biomolecular sequence motifs and its function in automatic sequence interpretation. In: Proceedings 2nd International Conference on Intelligent Systems for Molecular Biology. S. D., editor. AAAIPress, Menlo Park. 53-61.

Buchsbaum, V.M. 1968. Behavioral and physiological responses to light by the sea anemone Anthopleura elegantissima as related to its algal endosymbionts. In: Department of Biological Sciences. Stanford University, Stanford, CA. 123.

Charbonneau, H., and Cormier, M.J. 1979. Ca2+-Induced bioluminescence in Renilla reniformis. J. Biol. Chem. 254:769-780.

Collins, J.H., Cox, J.A., and Theibert, J.L. 1988. Amino acid sequence of a sarcoplasmic calcium-binding protein from the sandworm Nereis diversicolor. J. Biol. Chem. 263:15378-15385.

Cook, W.J., Jeffrey, L.C., Cox, J.A., and Vijay-Kumar, S. 1993. Structure of a sarcoplasmic calcium-binding protein from amphioxus refined at 2.4 A resolution. J. Mol. Biol. 229:461-71.

Hofmann, K., Bucher, P., Flaquet, L., and Bairoch, A. 1999. The PROSITE database, its status in 1999. Nucleic Acids Res. 27:215-219.

Jamieson, G.A., Jr., Bronson, D.D., Schachat, F.H., and Vanaman, T.C. 1980. Structure and function relationships among calmodulins and troponin C-like proteins from divergent eukaryotic organisms. Ann N Y Acad Sci. 356:1-13.

Kawasaki, H., Nakayama, S., and Kretsinger, R.H. 1998. Classification and evolution of EF-hand proteins. Biometals. 11:227-295.

LaJeunesse, T., C., and Trench, R.K. 2000. Biogeography of two species of Symbiodinium (Freudenthal) inhabiting the intertidal sea anemone Anthopleura elegantissima (Brandt). Biol. Bull. 199:126-130.

Lewis, J.C., and Daunert, S. 2000. Photoproteins as luminescent labels in binding assays. Fresenius' J. Anal. Chem. 366:760-8. 56

Malmendal, A., Carlstrom, G., Hambraeus, C., Drakenberg, T., Forsen, S., and Akke, M. 1998. Sequence and context dependence of EF-hand loop dynamics. An 15N relaxation study of a calcium-binding site mutant of calbindin D9k. Biochemistry. 37:2586-95.

Mazel, C. 2006. NightSea Website: Posting of photos by Charles Mazel and Jack Sullins depicting Anthopleura artemisia fluorescence. http://nightsea.com/home.htm.

McGuffin, L., Bryson, K., and Jones, D. 2000. The PSIPRED protein structure prediction server. Bioinformatics. 16:404-405.

McGuffin, L.J., and Jones, D.T. 2003. Improvement of the GenTHREADER method for genomic fold recognition for genomic sequences. Bioinformatics. 19:874-881.

Muscatine, L. 1971. Experiments on green algae coexistent with zooxanthellae in sea anemones. Pac. Sci. 25:13-21.

Nakayama, S., and Kretsinger, R.H. 1994. Evolution of the EF-hand family of proteins. Annu. Rev. Biophys. Biomol. Struct. 23:473-507.

Nelson, M.R., and Chazin, W.J. 1998. Chapter 2: calmodulin as a calcium sensor. Academic Press, New York. 17-64 pp.

Rice, J. 1999. Writhe and shine. Nat. Hist. 108:76 - 77.

Shimomura, O. 1985. Bioluminescence in the sea: photoprotein systems. Symp. Soc. Exp. Biol. 39:351-372.

Sillen, A., Verheyden, S., Delfosse, L., Braem, T., Robben, J., Volckaert, G., and Engelborghs, Y. 2003. Mechanism of Fluorescence and Conformational Changes of the Sarcoplasmic Calcium Binding Protein of the Sand Worm Nereis diversicolor upon Ca2+ or Mg2+ Binding. Biophys. J. 85:1882-1893.

Swofford, D.L. 2000. PAUP*: phylogenetic analysis using parsimony and other methods (software). Sinauer Associates, Sunderland, MA.

Tsuji, F.I., Ohmiya, Y., Fagan, T.F., Toh, H., and Inouye, S. 1995. Molecular evolution of the Ca2+-binding photoproteins of the hydrozoa. Photochem. Photobiol. 62:657-661.

Weis, V.M., and Levine, P.R. 1996. Differential protein profiles reflect the different lifestyles of symbiotic and aposymbiotic Anthopleura elegantissima, a sea anemone from temperate waters. J. Exp. Biol. 199:883-892. 57

Weis, V.M., and Reynolds, W.S. 1999. Carbonic anhydrase expression and synthesis in the sea anemone Anthopleura elegantissima are enhanced by the presence of dinoflagellate symbionts. Physiol. Biochem. Zool. 72:307-316.

Weis, V.M., Verde, E.A., and Reynolds, W.S. 2002. Characterization of a Short Form Peridinin-Chlorophyll-Protein (PCP) cDNA and Protein from the Symbiotic Dinoflagellate Symbiodinium muscatinei (Dinophyceae) from the Sea Anemone Anthopleura elegantissima (Cnidaria). Journal of Phycology. 38:157-163.

Yuasa, H.J., Suzuki, T., and Yazawa, M. 2001. Structural organization of lower marine nonvertebrate calmodulin genes. Gene. 279:205-12.

IDENTIFICATION OF BLEACHING-LINKED GENES FROM THE SCLERACTINIAN CORAL, MONTIPORA CAPITATA, USING HIGH-THROUGHPUT SCREENING OF A CDNA SUBTRACTED LIBRARY ON A DNA MICROARRAY PLATFORM

Laura L. Hauck & Virginia M. Weis

Prepared for submission to: BMC Genomics BioMed Central Ltd, Middlesex House, 34-42 Cleveland Street, London W1T 4LB, UK 59

ABSTRACT

Background: Cnidarians, such as anemones and corals, engage in an intracellular symbiosis with photosynthetic dinoflagellates (zooxanthellae). Corals with healthy symbiont populations form both the trophic and structural foundation of reef ecosystems and are responsible for nutrient cycling in these nutrient poor waters. The breakdown of this symbiosis is often referred to as bleaching, worldwide episodes of coral bleaching are extremely serious considering that many tropical ecosystems would disappear without healthy reefs. Despite its environmental importance, little is known about the molecular basis of the symbiosis. In this study we created a microarray platform from a cDNA subtracted library, made from experimentally bleached Montipora capitata to identify genes that are induced and repressed during bleaching.

Results: We detected a large number of host genes that displayed statistically different ratios of expression between the control and bleached groups of corals. The induced genes identified included oxidative stress responders, structural proteins, and multiple isoforms of beta-gamma crystallin homologs of unknown function. The identified repressed genes include a component of the organic matrix, ubiquitin, and a novel carbohydrate associated protein (CnidCAP) putatively involved in host/symbiont specificity and recognition.

Conclusions: Our data, particularly the emergence of CnidCAP, suggest that host/symbiont specificity in corals is homologous to the complement pathway active in innate immunity in animals. Our data also support the concept that calcification of the coral skeleton is repressed during stress that results in a loss of symbionts. In addition, we have isolated many novel, unidentified genes that may prove useful as markers of coral 60 stress, and have successfully created the first “stress-chip” for monitoring the health of the coral M. capitata. The combined use of a subtracted library and a DNA microarray platform is a very effective tool in gene expression analysis of corals.

INTRODUCTION

Corals are cnidarians that often engage in a mutualistic symbiosis with photosynthetic dinoflagellates (zooxanthellae). The algae pass energy in the form of photosynthetically fixed carbon to the host in exchange for nitrogen, phosphorous and inorganic carbon from the host (Lewis & Smith 1971, Muscatine & Porter 1977, Smith &

Douglas 1987, Wang & Douglas 1998, Weis & Reynolds 1999). Furthermore, by hosting the symbionts in vacuoles called symbiosomes within their own gastrodermal cell layer

(Smith & Douglas 1987, Muller-Parker & D'Elia 1997), the host coral also provides the dinoflagellate with a high light, and stable living environment and a refuge from herbivory. Corals with healthy symbiont populations form both the trophic and structural foundation of reef ecosystems and are responsible for nutrient cycling in these nutrient poor waters (Muscatine & Porter 1977).

Coral bleaching is defined as an event in which there is a loss of the symbiotic zooxanthellae, or a reduction in the chlorophyll pigment concentrations of the symbiont

(Sawyer & Muscatine 2001). It has also been shown that damage to the photosystems of the symbiont, particularly the D1 reaction center of photosystem II, is the first step in the coral bleaching process (Iglesias-Prieto 1997, Jones et al. 1998, Warner et al. 1999). In addition, damage to the symbiont’s photosystems as a result of elevated temperature and

UV radiation has been shown to result in oxidative stress due to the production of reactive oxygen species (ROS) such as superoxide radical (Lesser 1996, Franklin et al. 2004).

This would imply that the dinoflagellate is the ‘weak link’ in this symbiosis, and that bleaching is a host response to an impaired symbiont. Loss of the symbiosis as an adaptive strategy for the coral host has been explored and debated extensively

(Buddemeier & Fautin 1993, Baker 2001, Kinzie III et al. 2001, Downs et al. 2002).

What is not known about the breakdown of this crucial symbiosis is the extent to which differential gene expression is a factor, and to what extent bleaching is dictated by the host or the symbiont. This study was designed to explore those questions.

The use of molecular technology in the study of coral reefs, and the cnidarian symbiosis in general, is a trend that is just now beginning to fully develop into its potential. The quest for symbiosis-specific genes in cnidarians was originally pursued by the use of proteomic analyses, and focused on anemones due to their occurrence in nature in both the symbiotic and aposymbiotic (symbiont-free) state (Weis & Levine 1996).

More recently, however, molecular tools have emerged to include subtractive library analysis of the corals Fungia scutaria (deBoer et al. 2007) and Acropora tenuis (Yuyama 62 et al. 2005), EST analysis of the corals Acropora millepora (Kortschak et al. 2003) and

Acropora palmata (Schwarz et al. 2006) and the anemone Aiptasia pulchella (Kuo et al.

2004), development of a 32 feature dot-blot stress array from the coral Montrastraea faveolata (Edge et al. 2005), and the development of a 10,368 feature transcriptome DNA microarray of the anemone Anthopleura elegantissima (Rodriguez-Lanetty et al. 2006). In addition, the genome of the anemone Nematostella vectensis has been sequenced and is publicly accessible at StellaBase (http://evodevo.bu.edu/stellabase), making genomic information in cnidarians even more accessible. The use of DNA microarrays to examine stress responses of many organisms is well developed (Chen et al. 2003, Girardot et al.

2004), but this study is the first use of a DNA microarray to profile gene expression of a coral during coral bleaching. Our combined use of a subtracted library with a DNA microarray platform is not new, in fact these two techniques have been combined as early as 1998 in medical studies pertaining to humans (Welford et al. 1998, Yang et al. 1999) reviewed in (Dougherty & Geschwind 2002).

Our goal in this study was to profile the patterns of gene expression found in the host coral Montipora capitata during coral bleaching initiated by impairment of the photosystems of their symbiotic Symbiodinium dinoflagellates. To initiate the coral bleaching response the holobiont was exposed to the commercial herbicide Diuron, also known as DCMU (3-(3,4-Dichlorophenyl)-1,1-Dimethylurea), which acts by blocking electron flow at the quinone acceptors of photosystem II (Taiz & Zeiger 1991). This exposure serves as a proxy to the type of damage that occurs to photosystem II during heat and UV stress as described above, and allows us to specifically examine the host’s 63 response to a photosynthetically impaired symbiont without the interference of additional environmental stressors.

RESULTS AND DISCUSSION

DCMU induced bleaching

The DCMU exposure initiated an acute bleaching response. ANOVA analysis showed a significant change in zooxanthellae concentration for both treatment and time of

DCMU exposure, with significant differences between the control and experimental groups being seen at 24 hrs and 72 hrs (Fig. 1).

Screening for Dinoflagellate Contamination of Host Microarray Features

A hybridization of host-free symbiont genomic DNA to the array was performed to identify features coming from the symbiont genome. A total of 166 (7.2%) of the

2,304 features from the cDNA microarray were identified as dinoflagellate in origin, and disregarded in this study. Of these 166 features, 95 (57.2%) came from the non- subtracted control group (12.4% of that group’s 768 features). The remaining 42.8% of the dinoflagellate genes were split between the remaining two groups, bleaching- repressed and bleaching-induced, comprising only 4.6% of the 768 features in each of these groups. These data suggest that the subtraction procedure not only enriched for those genes with the greatest difference in expression, but it also assisted in removing a large portion of the contaminating dinoflagellate cDNA. Of the 166 features identified as dinoflagellate in origin, only 25 (4.6%) cross-listed with the significantly differential features: 20 from the bleaching-induced, three from the bleaching-repressed and only two from the non-subtracted control group. The genomic PCR analysis for 64

2.00 Control 1.80 DCMU

1.60 * * 1.40 1.20 * * 1.00 0.80

0.60

# Dinoflagellates/cm2 x10(6) 0.40

0.20

0.00 0 244872 Hours After Start of Treatment

Fig. 1. Bleaching response monitored by cell counts from cores taken during the DCMU-induced bleaching experiment. ANOVA analysis revealed a statistically significant (p=0.05) difference for both condition (DCMU-exposed v. control) and time. (*) Indicate those time-points where the paired t-test revealed a significant (p=0.05) difference between the control and DCMU-exposed groups. Error bars represent means ± Stdev (n=6).

65 contamination conducted for the A. elegantissiuma array (Rodriguez-Lanetty et al.

2006) revealed that the 12 unigenes with the greatest fold-changes were algal in origin

(13.2% of their significant results). This proportion of dinoflagellate contamination is comparable to the 12.4% from the non-subtracted control group in our study, and is further evidence that the subtraction procedure removed some of the symbiont contamination prior to hybridization and analysis.

Microarray analysis

A total of 537 (23%) of the 2,304 features from the microarray were identified as having significantly different ratios of expression between the control and bleaching samples after adjusting for the false discovery rate (FDR) at p<0.05. The FDR accounts for type I errors associated with multiple testing (Wu et al. 2003, Benjamini, 1995 #4).

The changes in expression for genes induced during bleaching were both more pronounced and more numerous than those repressed during bleaching (Fig. 2). Of the

537 differentially expressed features, only 118 (22%) came from the bleaching- repressed group and 47 (9%) came from the non-subtracted control group. The remaining 372 (69%) came from the bleaching-induced group. This suggests that the genes that are expressed in the non-stress condition which maintain primary metabolic functions are not likely to be greatly repressed during a stressful event, while there are many genes that must be mobilized to counter the effects of stress. This is consistent with whole genome expression profiling studies conducted in the budding yeast

Saccharomyces cerevisiae. Their findings indicate that only 10-14% of all genes are induced or repressed in response to a wide range of stressors (Gasch et al. 2000,

Causton et al. 2001). Chen et al (2003) found that the fission yeast 66

200 Down-regulated Up-regulated 180 11

160

140

120

100 5 80

Features of Number 60 3 5 40 1 20 0 5 2 2 5

30 25 20 15 10 10 15 20 25 30 1.5 1.5 1.25 1.25 Ratio of Gene Expression

Fig. 2. Distribution of the significant array features (p<0.05 after adjusting for the FDR) as a function of the ratio of gene expression. The ratio of gene expression was derived by averaging the medians of the signal ratio per feature from each array. Numbers above the columns indicate the number of features in each group identified as dinoflagellate in origin and removed from the study.

Schizosaccharomyces pombe exposed to a variety of stressors had far more core environmental stress response genes (CESR, those universally induced or repressed during exposure to multiple stressors) induced during stress (140) in contrast with

CESR genes repressed (11 using the same criteria). They also found the identified repressed genes to be somewhat arbitrary in function. These findings make the small group of genes that are greatly down-regulated (10 – 20 fold) during bleaching in this study of particular interest. In addition, the low number of sequences seen in the -1.25 to +2 fold changes is likely a direct result of the subtracted library used in the array. Of the 47 significant genes that came from the non-subtracted control group, only six showed changes in expression greater than five fold, and the greatest change was 8.3 fold. Over 50% of the non-subtracted significant genes did not exceed a 2.5 fold change in expression either way.

From the 537 significant features, 117 were selected for sequencing. These 117 sequences resolved into 54 unigenes, 44 of which were induced and 10 of which were suppressed during bleaching. The redundancy of the significant array features was therefore 44% and very similar to the 48% redundancy of the A. elegantissima microarray (2006). Nine of the ten of the down-regulated sequences and 18 of the 44 up-regulated sequences displayed significant homology with sequences found in

Genbank (Tables 1 and 2). The remaining 50% of unigenes displayed no significant homology in Blastx searches (Table 3). This high proportion of unknown sequences is similar to the 55% unknowns from an EST study of the anemone Aiptasia pulchella

(Kuo et al. 2004), 64% from an EST study of the coral Acropora millepora 68

Table 1. Known unigenes significantly down-regulated (p<0.05 after FDR adjustment) during coral bleaching. Identification based on the e-value of Blastx hits from Genbank. Ratios reflecting the fold change of gene expression for Q-RT-PCR and microarray analyses are shown. Arrows indicate the direction of expression as a function of coral bleaching. See Table 4 for CnidCAP isoform feature IDs when multiple features formed an isoform unigene.

Array Ratio of Blast ID Best e-value Feature ID Q-RT-PCR the Medians Ratio When averaged: ± StDev (# of seq)

Ubiquitin 8e-12 SubCont2M8 È 328.6 È 7.69

Galaxin 3e-45 SubCont1P23 È 15.00 È 2.44

Cnidarian carbohydrate-associated protein (CnidCAP) È 329.21 È 14.63 Isoforms: ± 3.07 (29) Includes all Averaged from Isoforms all Isoforms

Isoform 1 1e-08 È 15.37 ± 5.05 (5)

Isoform 2 1e-08 È 15.11 ± 3.90 (5)

Isoform 3 8e-08 È 12.86 ± 2.54 (5)

Isoform 4 2e-11 SubCont2F11 È 20.00

Isoform 5 0.005 È 12.11 ± 2.10 (9)

Isoform 6 0.0001 SubCont2C1 È 10.00

Isoform 7 3e-11 È 16.98 ± 2.87 (3)

Table 2. Known unigenes significantly up-regulated (p<0.05 after FDR adjustment) during coral bleaching. Identification is based on the e-value of Blastx hits from Genbank. Ratios reflecting the fold change of gene expression for Q-RT-PCR and microarray analyses are shown. Arrows indicate the direction of expression as a function of coral bleaching. See Table 4 for beta-gamma crystallin feature IDs when multiple features formed an isoform unigene.

Array Ratio of Blast ID Best e-value Feature ID Q-RT-PCR the Medians Ratio When averaged: ± StDev (# of seq) Collagen 4e-11 DCMU1D9 Ç 3.65 Ç 10.84

GP-2/THP family 9e-23 DCMU2M7 Ç 15.39 homolog

Glutaredoxin 3e-12 DCMU1F13 Ç 1.63 SubCont1K22 ± 0.24 (2) Ferritin 2e-35 DCMU2A4 Ç 1.52* Ç 17.85

Beta-Gamma Crystallin Isoforms: Ç 6.11 Ç 13.12

± 4.49 (22) Includes Isoforms Averaged from

1, 8 & 7 all Isoforms

Isoform 1** No significant DCMU2N2 Ç 19.98 hits Isoform 2 1e-07 Ç 12.39 ± 2.44 (2)

Isoform 3 8e-05 DCMU1E24 Ç 8.99

Isoform 4 3e-05 DCMU1E23 Ç 11.48

Isoform 5 4e-05 DCMU1P21 Ç 5.04

Isoform 6 0.0002 DCMU2L13 Ç 13.83

Isoform 7** 3e-09 DCMU2L20 Ç 16.53

Isoform 8** 5e-09 Ç 18.43 ± 2.04 (2)

Isoform 9 2e-09 DCMU1M2 Ç 13.14

Isoform 10** 9e-14 Ç 15.22 ± 1.45 (4) Isoform 11** 4e-13 Ç 17.52 ± 0.12 (2)

Isoform 12 8e-09 Ç 11.63 ± 1.36 (2)

Isoform 13** No significant Ç 15.01 hits ± 5.39 (7)

Isoform 14** No significant Ç 14.46 hits ±3.39 (2)

*Not Statistically Significant Q-RT-PCR result ** indicates presence of BGCrys domain

Table 3. Unknown unigenes significantly up or down-regulated during coral bleaching (p<0.05 after FDR adjustment). Ratios reflecting the fold change of gene expression for Q-RT-PCR and microarray analyses are shown, arrows indicate the direction of expression as a function of the bleaching event. Unknown status is based on a lack of significant Blast hits (p<1e-4) from Blastx searches of Genbank.

Unidentified Up-Regulated Genes Avg Ratio of the Feature ID Q-RT-PCR Medians Ratio ± StDev UnIDUpreg1 DCMU1M21 Ç 8.73 DCMU1L18 ± 0.81 UnIDUpreg2 DCMU1O17 DCMU1L7 Ç 16.13 DCMU1A19 ± 5.38 UnIDUpreg3 DCMU2J1 Ç 10.98 DCMU2F7 ± 0.65 DCMU2B5 Ç 42.87 Ç 5.90 DCMU2I18 Ç 20.15 DCMU2E9 Ç 12.99 DCMU2I7 Ç 21.97 DCMU2D14 Ç 13.14 DCMU1L5 Ç 7.55 DCMU1M17 Ç 12.05 DCMU2G14 Ç 14.23 DCMU2G13 Ç 14.12 DCMU2E18 Ç 14.94 DCMU2G20 Ç 9.94 DCMU2P19 Ç 11.19 DCMU2K9 Ç 13.74 DCMU1J11 Ç 11.77 DCMU1B17 Ç 10.52 DCMU2G21 Ç 18.29 DCMU2K10 Ç 11.85 DCMU1J8 Ç 2.80 DCMU2M5 Ç 8.90 DCMU2J22 Ç 4.92 DCMU2C4 Ç 2.47 DCMU2K1 Ç 2.34 Unidentified Down-Regulated Genes SubCont1H7 È 11.11

Table 4. Feature IDs for the sequences contributing to the CnidCAP and beta-gamma crystallin isoform unigenes formed from multiple sequences.

CnidCAP Isoforms: Feature IDs Beta-gamma Feature IDs Crystallin Isoforms:

Isoform 1 SubCont1E4 Isoform 2 DCMU2N5 SubCont1H9 DCMU2P5 SubCont1L23 SubCont2P11 Isoform 8 DCMU1H21 SubCont2K7 DCMU2P14

Isoform 2 SubCont2O8 Isoform 10 DCMU1F23 SubCont1P10 DCMU2J2 SubCont2B3 DCMU2H24 SubCont2H4 DCMU1G23 SubCont1G19

Isoform 3 SubCont1E6 Isoform 11 DCMU2L4 SubCont1J2 DCMU2F18 SubCont2J13 SubCont1L19 Isoform 12 DCMU2H6 SubCont1P8 DCMU2B24

Isoform 5 SubCont2C8 Isoform 13 DCMU1F19 SubCont2N9 DCMUIP14 SubCont2M24 DCMU2F24 SubCont2I12 DCMU2N2 SubCont2H8 DCMU2J10 SubCont2B11 DCMU1F3 SubCont1D4 DCMU1M9 SubCont1D14 SubCont1N20

Isoform 7 SubCont1C8 Isoform 14 DCMU1P11 SubCont2O22 DCMU1J20 SubCont2J3

(Kortschak et al. 2003), and 65% from the A. elegantissima microarray study

(Rodriguez-Lanetty et al. 2006).

Two large groups of isoforms emerged from the identified sequences in our significant results; one in the repressed group containing 7 isoforms (CnidCAPs), and one in the induced group containing 14 isoforms (beta-gamma crystalins). These two complex groups of sequences warranted bioinformatic analysis beyond the primary

Blast hits to appropriately identify them.

Genes Down-regulated as a Function of Coral Bleaching

CnidCAPs

The group of seven isoform unigenes had an average 14.63 fold drop in expression during bleaching. Q-PCR results strongly confirmed the down-regulation, showing a 329.21 fold change in expression (Table 1). Due to the presence of repeating units in the multiple isoforms it was impossible to generate a primer set that would amplify just one isoform. Therefore, a primer set was designed to amplify a product in all isoforms which may explain the pronounced change in expression revealed in the Q-

PCR. Analysis revealed that these isoforms are homologous to a variety of CUB domain proteins (Table 7) with E values ranging from 0.0001 to 2e-11 (Table 1). The

CUB domain is named after the three proteins from which it was first identified:

C1r/C1s complement pathway proteins, embryonic sea urchin protein UVS.2, and bone morphogenetic protein 1 – BMP1 (Bork 1991). The CUB domain is a 110 residue extracellular domain found in functionally diverse, largely developmentally regulated proteins (Bork & Beckmann 1993, Hofmann et al. 1999).

Canis familiaris TSG6pre 73 Oryctolagus cuniculus TSG6pre Homo sapiens CD44

Equus caballus TNFαP6

Rattus norvegicus TSG6 Gallus gallus TNFαP6

Bos taurus spermadhesin 60 Riftia pachyptila RP43 Takifugu rubripes Pcolce 99 Homo sapiens Pcolce 100 Rattus norvegicus Pcolce 100 100 Mus musculus PCPE-1 Apis mellifera Tolkin Homo sapiens Tolloid-like 2 57 88 Mus muscalus Bmp1 96 100 Homo sapiens Bmp1Iso1 100 100 Macaca mulatta Tolloid-like1 100 Homo sapiens Tolloid-like1

Drosophila melanogaster Tolloid 100 Drosophila melanogaster DVP

M. capitata CnidCAP Isoform 7

100 M. capitata CnidCAP Isoform 6

M. capitata CnidCAP Isoform 1 50 M. capitata CnidCAP Isoform 2 85 80 M. capitata CnidCAP Isoform 3 89 M. capitata CnidCAP Isoform 4 71 95 M. capitata CnidCAP Isoform 5 Eptatretus Burgeri MASP1 Gallus gallus MASP1 Homo sapiens P100precurs 100 100 100 Homo sapiens MASP1 53 Mus musculus MBLSP3 86 100 Rattus norvegicus MASP3 Homo sapiens MASP2var1

100 Mus musculus MBLSP2var1

99 Rattus norvegicus MASP2 93 Rattus norvegicus MASP2chainA

Fig. 3. Phylogenetic relationships of CUB domain proteins with the 7 isoforms of CUB containing CnidCAP sequences repressed in M. capitata during bleaching. The relationships are inferred by a Neighbor-Joining analysis. Percent of 1000 bootstrap replicates supporting the toplogy is given at each node. M. capitata sequences are in bold, spermadhesin sequence is indicated with an arrow and MASP sequences are grouped within a bracket. Genbank accession IDs are provided in Table 6. 74

To determine where the seven isoforms grouped among the diverse CUB domain proteins, an alignment was generated, and a Neighbor-Joining (NJ) analysis was performed (Fig. 3). All of the isoforms grouped with very strong bootstrap support in a clade with the mannose-binding lectin-associated group of serine proteases (MASP1 and MASP2). They then formed a separate clade within the MASP group with weak bootstrap support of 71. MASPs have multiple isoforms that form from splice-variants

(Endo et al. 2003). Alignments of the seven isoforms of the CUB domain homologs identified in M. capitata show the presence of shuffled units, evidence that a splicing is occurring to create the isoforms (data not shown).

MASPs are characterized by the presence of two CUB domains at the N- terminus, followed by two centrally located disulfide activation domains and the presence of a serine protease domain at the C-terminus. Domain scanning conducted at

Prosite indicates that the M. capitata CUB homologs lack both the central activation domains and the C-terminal serine protease. The reading frames from each isoform are incomplete, in that they lack the 5’ start codon, but they do include the 3’ stop codon and in many cases the poly-A region. Therefore, the absence of the C-terminal serine protease domain is likely real and not due to incomplete sequence. M. capitata CUB isoforms were further structurally analyzed at the (m)GenTHREADER server

(McGuffin & Jones 2003) to see if their predicted structure conformed with that expected of a MASP (Table 5).

The appearance of MASP-2 as the consistent best threading result, with a confidence rating of “certain” in all but isoform 5, strongly supports the MASP identity suggested by the NJ analysis. The 2nd best result, also with certain confidence, was the 75

Table 5. M. capitata CnidCAP (m)GenTHREADER results. Data provided include in order: Name, Source Organism, Protein Data Base (PDB) id, p-value and Confidence Rating in order.

M. capitata Top Three (m)GenTHREADER Results in order of Significance

CnidCAP Isoform Best 2nd 3rd Hydrolase, sugar binding Hydrolase, Cub1-egf Spermadhesin 1 protein cub-1-egf-cub2 interaction domain of region of MASP-2 complement protease C1s Rattus norvegicus Homo sapiens Bos taurus 1nt0 1nzi 1sfp p = 1e-08 p = 9e-08 p = 6e-06 Certain Certain Certain Hydrolase, sugar binding Hydrolase, Cub1-egf Spermadhesin 2 protein cub-1-egf-cub2 interaction domain of region of MASP-2 complement protease C1s Rattus norvegicus Homo sapiens Bos taurus 1nt0 1nzi 1sfp p = 3e-08 p = 7e-08 p = 6e-06 Certain Certain Certain Hydrolase, sugar binding Hydrolase, Cub1-egf Transferase, Fragment: 3 protein cub-1-egf-cub2 interaction domain of ligand-binding domain, region of MASP-2 complement protease C1s cd202b antigen Rattus norvegicus Homo sapiens Homo sapiens 1nt0 1nzi 2gy5 p = 3e-08 p = 5e-08 p = 8e-07 Certain Certain Certain Hydrolase, sugar binding Hydrolase, Cub1-egf Cell Adhesion, extracellular 4 protein cub-1-egf-cub2 interaction domain of segment of integrin region of MASP-2 complement protease C1s alphavbeta3 Rattus norvegicus Homo sapiens Homo sapiens 1nt0 1nzi 1jv2 p = 1e-08 p = 6e-08 p = 2e-07 Certain Certain Certain Hydrolase, sugar binding Hydrolase, mouse mRNA Protein binding, coactosin- 5 protein cub-1-egf-cub2 capping enzyme like protein (cofilin family) region of MASP-2 Rattus norvegicus Mus musculus Mus musculus 1nt0 1i9s 1udm p = 0.118 p = 0.544 p = 0.574 Guess Guess Guess Hydrolase, sugar binding Hydrolase, Cub1-egf Spermadhesin 6 protein cub-1-egf-cub2 interaction domain of region of MASP-2 complement protease C1s Rattus norvegicus Homo sapiens Bos taurus 1nt0 1nzi 1sfp p = 1e-06 p = 8e-06 p = 4e-05 Certain Certain Certain Hydrolase, sugar binding Hydrolase, Cub1-egf Cell Adhesion, extracellular 7 protein cub-1-egf-cub2 interaction domain of segment of integrin region of MASP-2 complement protease C1s alphavbeta3 Rattus norvegicus Homo sapiens Homo sapiens 1nt0 1nzi 1jv2 p = 3e-08 p = 1e-07 p = 2e-07 Certain Certain Certain 76 hydrolase complement protease C1s. The 3rd best threading results were somewhat less consistent, but spermadhesin was common to three of the results and as such warranted further investigation.

MASP proteins are members of the lectin-associated complement pathway of immunity. Lectins, such as mannan-binding protein (MBL), adhere to carbohydrate moieties on the surfaces of invading microbes. MASPs then bind to MBL, thereby becoming activated. Once activated, the C-terminal serine protease domain activates a classic pathway of the complement system through proteolytic cleavage of C2, C3 or

C4, which in turn triggers the C-cascade and targets the complex for phagocytosis

(Matsushita & Fujita 1992, Ji et al. 1997, Endo et al. 2003) reviewed in (Fujita et al.

2004). The lectin-MASP complex bypasses the first component of the classical complement pathway, C1. Lectin and MASP combined is structurally and functionally equivalent to C1, which was also the second best threading result in this study. Indeed, the lectin-protease complex has been considered the evolutionary origin of the more highly evolved C1 containing classical complement pathway (Fujita et al. 2004).

This makes the complement protease C1s, as the second best threading result, of particular interest. Because the MASP/MBL complex performs the same function as

C1, and structure denotes function, it is intuitive that these threading results would coincide with one another, despite the evolutionary divergence between the ancient

MASPs and the modern complement components. The MASP mediated lectin- complement pathway has been revealed in other invertebrates, such as the cephalochordate Amphioxus (Endo et al. 2003) and the ascidian urochordate 77

Halocynthia roretzi (Ji et al. 1997), but this would be the first isolation of a MASP-like protein in a ‘basal’ invertebrate.

Spermadhesin is a lectin involved in sperm-egg binding of Bos taurus (Romero et al. 1997). The high placement of spermadhesin as the third best result for three of the isoforms suggests that the M. capitata CUB isoforms possess carbohydrate-binding properties, which would eliminate the need for a lectin intermediate. Spermadhesin was included in the NJ analysis however, and separated from all of the MASP sequences and the CUB-isoforms from M. capitata, with strong bootstrap support of 100 (Fig. 3).

This disputes their direct relationship to the isoforms identified in this study. All three of the possible identities: MASP, C1 or spermadhesin, are consistent with one another in function – that is they are all binding proteins associated with carbohydrate residues.

While MASP seems to be the best possible identity for our unknown CUB containing genes, their lack of a serine protease domain disputes their placement in this family of serine proteases. Because of their putative association with carbohydrates, we have named the M. capitata CUB isoforms Cnidarian Carbohydrate-Associated Proteins

(CnidCAPs).

Lectin/glycan interactions play a role in symbiont recognition and specificity during the onset of symbiosis in the scleractinian coral Fungia scutaria (Wood-

Charlson et al. 2006), and the sea anemone Aiptasia pulchella (Lin et al. 2000); and a host lectin has been sequenced from the octocoral Sinularia lochmodes, which was shown through immunohistochemical studies to bind to the surface of the symbiotic dinoflagellates (Jimbo et al. 2000). What recognition events occur subsequent to the lectin/glycan interaction remains undescribed. In these cases, however, it is clear that 78 the lectin/glycan interaction is beneficial to the mutualistic symbiosis. If CnidCAPs play a role in host/symbiont specificity, their down-regulation during bleaching could be indicating a collapse of the recognition with stress. This is the first glimpse into the downstream pathways that moderate the immune response of the host resulting in the persistence of the mutualistic symbiont. This suggests that the pathways activated during pathogenic and mutualistic symbioses share homology.

Ubiquitin

Another gene repressed as a function of bleaching was ubiquitin (Table 1). It displayed a 7.69 fold drop in expression during bleaching, which was verified by a

328.6 fold drop in expression by Q-PCR. This sequence contained a full ORF and showed a single ubiquitin domain according to Prosite. In contrast, many ubiquitins have repeating domains, and all are highly conserved (Catic & Ploehg 2005). The dramatic Q-PCR results could be the result of priming off of multiple conserved ubiquitin and polyubiquitin proteins, and suggests a pronounced down-regulation of multiple ubiquitins in this experiment.

Ubiquitins are multifunctional proteins, but perhaps their best understood role is in the mediation of a proteolytic pathway (Wilkinson 2000). Their involvement in the selective turnover of proteins begins with the enzymatically assisted posttranslational modification of a target protein resulting in the attachment of ubiquitin residues in a process is called ubiquitination. After ubiquitination, the protein is typically targeted for degradation by one or more proteosomes (Wilkinson 2000). Ubiquitins have also been shown to have other cellular roles, such as ribosome biogenesis, maintenance of chromatin structure, regulation of gene expression, and in stress response with heat- 79 shock proteins (Finley 1985, Monia et al. 1990, Nemer et al. 1991, Hofmann & Somero

1996, Hofmann et al. 1999).

The observed dramatic down-regulation of ubiquitin is unexpected. Most studies examining stress mediated gene expression show a marked up-regulation of ubiquitin in response to environmental stress (Chen et al. 2003). There is even evidence of heat shock promoter elements in genes encoding for polyubiquitin (see reviews above). However, ubiquitin ligase was similarly repressed in a study that used paraquat to initiate oxidative stress in Drosophila melanogaster (Girardot et al. 2004). Our combined results indicate that the role of ubiquitin in stress, particularly oxidative stress, is not yet fully understood.

Genes Possibly Involved in Biomineralization of the Coral Skeleton

Galaxin & GP2/THP homologs

Many studies have shown that there is a link between the symbiotic status of hermatypic (reef-building) corals and their enhanced ability to build a calcified exoskeleton, although there is still much in the process that is not understood including exactly how the symbiosis enhances the biomineralization process (Gattuso et al. 1999).

Our study has revealed the molecular regulation of two genes that could be involved in the process. The first was identified as galaxin (Table 1). Galaxin was originally isolated from the hermatypic coral Galaxea fascicularis as a component of the organic matrix, which is involved in the coral biomineralization process (Fukuda et al. 2003,

Watanabe et al. 2003). The array and Q-PCR results show a 1.65 fold and 15 fold drop respectively in galaxin during bleaching. The drop in production of galaxin, as a component of the organic matrix, would indicate a reduction in skeletal growth. 80

The other protein that may be involved in a reduction of skeletal growth is homologous to the Zymogen granule membrane protein 2 (GP-2)/ Uromodulin (or

Tamm-Horsfall protein, THP) family of glycosylphosphatidylinositol (GPI) anchored proteins. GP-2 and THP proteins are found attached to the apical outer surface of the plasma membrane of cells of the pancreas and kidney respectively (Fukuoka et al. 1992,

Fukuoka 2000). Our GP-2/THP homolog had a 15.39 fold increase in expression during coral bleaching (Table 2). The GP-2/THP family members have been shown to be involved in membrane trafficking of excreted proteins after exocytosis (Scheele et al.

1994).

While the specific function of this GP2/THP homolog in corals is unknown, it is interesting to note that THP is involved in suppressing the formation of calcium oxalate crystal growth in urine. The process by which it suppresses the growth of the crystals may be through moderation of aggregation (Worcester 1994) or through membrane trafficking (Bernascone et al. 2006). Whatever the process, it is interesting to see a homologous protein up-regulated in bleaching where a reduction in biomineralization is expected. These combined results, a suppression of galaxin and an induction of GP-

2/THP, would be consistent with a reduction in exoskeleton formation during a loss of symbiosis or stress.

Genes Up-regulated as a Function of Coral Bleaching

Beta-Gamma Crystallins

The group of 14 isoform unigenes, resolved from 28 individual features had an average

13.12 fold increase in expression during bleaching. This was verified by a 6.11 fold increase in expression by Q-PCR using primers designed to anneal to three of the 14 81 isoforms. Eleven of the 14 isoforms showed homology to a variety of crystallins (listed in Table 7) and particularly to beta-gamma crystallins; while three of the isoforms had no significant homologs (Table 2). Only half of the isoforms contain the beta-gamma crystallin (BGCrys) domain according to Prosite (Hofmann et al. 1999), and all three of the isoforms that did not show homology during Blastx searches contained the BGCrys domain (Table 2). To look at the effect of the BGCrys domain on the phylogenetic relationships among the 14 isoforms, and within the crystallins, an alignment was generated and a NJ analysis was performed (Fig. 4). The isoforms containing the

BGCrys domain grouped together, and grouped with all of the other crystallin sequences (except the beta-gamma crystallin from the sponge Geodia cydonium) with strong bootstrap support (100). They separated into their own clade within the crystallins with very little support (64). Those isoforms that lacked the BGCrys domain formed their own group and polytomy outside all of the crystallin sequences. Although they did not belong to the crystallin group in the NJ analysis, the Blastx p-values for most of the non-domain containing isoforms ranged from 8e-05 to 8e-09, with the G. cydonium beta-gamma crystallin as their best match (Table 2). Isoform 6 lacked both a domain and significant homology, but its best homolog was the G. cydonium beta- gamma crystallin with a p-value of 0.0002 – which is just beyond the significance threshold of 0.0001.

Crystallins are proteins whose unique biochemical composition allows them to function as structural proteins of the vertebrate eye lens. They are further classified into three types by genetics, expression patterns and disease participation. Those groups are the alpha, beta and gamma crystallins; with the beta and gamma crystallins recognized 82

M. capitata BGCrys Isoform3

M. capitata BGCrys Isoform5

M. capitata BGCrys Isoform4

M. capitata BGCrys Isoform6 Missing Beta-gamma Crystallin Domain

M. capitata BGCrys Isoform2

64 M. capitata BGCrys Isoform9 97 M. capitata BGCrys Isoform12

Geodia cydonium BGCrys

M. capitata BGCrys Isoform14

M. capitata BGCrys Isoform13 100

100 M. capitata BGCrys Isoform1 81 M. capitata BGCrys Isoform8 Containing Beta-gamma Crystallin Domain

M. capitata BGCrys Isoform7 53

64 M. capitata BGCrys Isoform10 100 M. capitata BGCrys Isoform11

Ciona intestinalis BGCrysChainA

Iguana iguana GammaNCrys

97 Danio rerio GammaMXCrys

92 Chiloscyllium colax BetaCrysS2 50 66 Cynops pyrrhogaster GammaCrys

96 Xenopus laevis GammaCrysII

99 100 Xenopus laevis GammaCrys 100 Xenopus laevis GammaCrys6

Danio rerio gammaM5Crys 99 Danio rerio GammaCrysM2d2 10

Fig. 4. Phylogenetic relationships of crystallin proteins with the 14 isoforms of beta- gamma crystallin (BGCrys) induced in M. capitata during bleaching. The relationships are inferred by a Neighbor-Joining analysis. Percent of 1000 bootstrap replicates supporting the toplogy is given at each node. M. capitata sequences are in bold. Genbank accession IDs are provided in Table 2.

83 as members of a related beta-gamma superfamily (Graw 1997). Each group, in addition to being structural components of the lens, has members that perform other cellular functions. For example, the alpha crystallins have been shown to be molecular chaparones, autokinases, gene activators and heat shock proteins (Graw 1997). Several non-lens forms of beta-gamma crystallins have also been identified, including two involved in stress response. Spherulin 3a (Physarum polycephalum) and Protein S

(Myxococcus xanthus) are induced during stress and are involved with encystment and sporulation respectively. Absent in melanoma 1 (AIM1, Homo sapiens) is associated with chromosome-6 mediated tumor suppression, and its role here has led researches to believe that the beta-gamma superfamily may be involved in management of cell morphology and shape (Ray et al. 1997). In addition, beta-gamma crystallins have been identified in two other non-lens forming invertebrates: the sponge Geodia cydonium

(Krasko et al. 1997, Maro et al. 2002) and the urochordate Ciona intestinalis (Shimeld et al. 2005). All of the identified non-lens forms of the beta-gamma crystallins were included in the phylogenetic analysis, but they did not form informative groups with the

M. capitata sequences and many were removed from the final phylogenetic analysis for clarity. The function of the M. capitata beta-gamma crystallin isoforms in response to oxidative stress during coral bleaching remains unknown, but there is a precedent in other systems for multiple functions, both structural and otherwise. Therefore, considering the high level of variation among the 14 isoforms, members of this group may perform a number of functions.

Collagen

A collagen homolog was also induced during coral bleaching. The ratios reflect a 10.84 fold increase in collagen expression that was verified by a 3.65 fold increase with Q-PCR (Table 2). A collagen-specific molecular chaperone, Hsp47, was found to be exclusively expressed in cells producing collagen (Nagata 1996) and Hsp47 was up- regulated during temperature shock of the gorgonian L. virgulata (Kingsley et al. 2003) providing further evidence for an increase in collagen during cnidarian stress. Collagen has been isolated in many cnidarians, and is a major component of the extracelluar gelatinous mesoglea that is located between the endodermal and ectodermal layers

(Schmid et al. 1991, Titlyanov & Titlyanova 2002, Mullen et al. 2004). Collagen is also linked to the biomineralization of the axial skeletal rod in the sea pen Veretillum cynomorium, and as a component in the organic matrix of spicules from the gorgonian

Leptogrogia virgulata (Kingsley & Dupree 1993). An organic matrix is involved in biomineralization of scleractinian corals as discussed above (Fukuda et al. 2003,

Watanabe et al. 2003, Puverel et al. 2005) but to our knowledge, collagen has not yet been determined to play a role in coral biomineralization or to be a component in the organic matrix of scleractinans. As a mesogleal component in hydrozoans, collagen forms a dense plexus of fibrils which are involved in endodermal cell adhesion (Weber

& Schmid 1985, Schmid et al. 1991). As temperature-induced bleaching can occur by detachment of the endodermal cell layer (Gates et al. 1992), oxidative stress may elicit the same cellular adhesion dysfunction. If collagen is lost as a result of endodermal cell detachment during bleaching, its expression might be upregulated to replace lost material. 85

Glutaredoxin

A glutaredoxin homolog showed a 3.47 fold increase in expression during coral bleaching (Table 2). Glutaredoxin has multiple cellular functions including regulation of redox-activated signal transduction through glutathionylation (Barrett et al. 1999,

Ghezzi 2005) and protection during oxidative stress (Starke et al. 2003). To alleviate oxidative stress from superoxide radicals, glutaredoxin uses glutathione as an intermediate to capture oxygen radicals forming a glutathione radical. In a series of steps, one of which is catalyzed by glutaredoxin, the original superoxide radical is converted into hydrogen peroxide (a less toxic form of oxygen) which would be further detoxified by downstream enzymes (Starke et al. 2003). Considering the induction of glutaredoxin in this study, where oxidative stress has been intentionally generated, its most likely function is as an oxygen radical scavenger.

Ferritin

A ferritin homolog, the final bleaching induced gene, is also an oxidative stress responder. Ferritin showed a 17.85 fold increase in expression during coral bleaching

(Table 2). The up-regulation of ferritin was not supported by Q-PCR, which revealed a much lower ratio of 1.52 that was not statistically significant. Ferritin, as an iron sequestering protein, serves a double function – it protects against the toxicity of free iron, which can catalyze the formation of reactive oxygen species, and it is induced by oxidative stressors and shown to confer resistance to subsequent oxidative insults (Cairo et al. 1995, Dunkov & Georgieva 2006). Ferritin uses oxygen to concentrate iron for the biosynthesis of hemoglobin, ferredoxins, nitrogenase and ribonucleotide reductase, and mini-ferritins (Dps proteins) have been shown to trap oxidants that damage DNA 86

(Liu & Theil 2005). Ferritin has also been implicated as having a role in the insect innate immune response, (reviewed in Dunkov and Georgieva, 2006) with differential regulation observed for two different ferritin subunits in different cell types as a result of multiple challenges to the immune system of flies and mosquitoes.

Therefore there are two possible roles for ferritin in the bleaching response 1) in response to the oxidative stress initiated by the un-linking of photosystem II of the dinoflagellate symbionts and 2) in an innate immune response designed to eliminate the defective symbionts from the host. Whatever its function, ferritin was also revealed as a stress response protein in the coral Montastrea faveolata (Edge et al. 2005), indicating that this protein is consistently induced in response to stress.

CONCLUSION

The gene expression profile of the symbiotic coral, M. capitata, during the loss of the symbiotic dinoflagellate, Symbiodinium, showed numerous genes that are induced and repressed as a function of bleaching. Those genes that were identifiable in this study tended to be genes with specialized functions. For example, two oxidative stress response genes, glutaredoxin and ferritin, were induced during bleaching caused by photoinhibition of the symbiont – which would lead to ROS production. Another example is the induction of a GP-2/THP homolog in conjunction with the repression of galaxin; which collectively correlate to an expected reduction in skeletal growth during stress resulting in a loss of the symbiosis.

Two large isoform groups emerged in the study: 14 induced beta-gamma crystallin isoforms of unknown function, and 7 repressed isoforms of a novel carbohydrate- 87 associated protein we called CnidCAP. The isoform groups show evidence of a splicing mechanism in place to provide M. capitata with genetic variability within these two groups. The emergence of the CnidCAP group is of particular interest in the study of the cnidarian/dinoflagellate symbiosis. CnidCAP is homologous to MASP, a component of the lectin-mediated activation of the classic complement pathway of innate immunity.

The repression of CnidCAP during coral bleaching suggests that it has a role in maintaining the symbiosis, and could indicate that this mutualism had a pathogenic origin and is still modulated by components of innate immunity. Evidence of a lectin-mediated interaction between the host and the symbiont has already been shown (Jimbo et al. 2000,

Lin et al. 2000, Wood-Charlson et al. 2006) and this study lends further support for this finding.

Our study shows that the combination of a subtracted library with a DNA microarray platform is a very effective way to profile gene expression in the non-model cnidarian symbiosis. We found 23% of our array features were significant after statistical analysis (adjusting for the FDR, p<0.05) which is in stark contrast to the 1.82% significant features revealed in the A. elegantissima transcriptome analysis (Rodriguez-Lanetty et al.

2006). In addition, our method for screening for dinoflagellate contamination of our host array, by hybridizing to the array a genomic DNA prep made from host-free symbionts, was both quick and efficient. Future sequencing and analysis of the remaining 420 significant features from this study will surely reveal more about this complex and environmentally important symbiosis. We have already deployed this array in a field application, and are currently analyzing results from hybridization of bleaching and 88 healthy samples collected in Kauaii, HI. We will be comparing the experimental and field results in our next paper.

METHODS

Collection and maintenance of experimental organisms

Healthy samples of Montipora capitata colonies of the plate morphology were collected at various depths, ranging from 1-4 M, around Coconut Island in Kaneohe Bay,

Oahu, Hawaii during July, 2002. Once collected, the plates were trimmed with bone shears to a relatively uniform size with a surface area of ~ 15 cm2. The trimmed plates were left to acclimate in flowing seawater tables at ambient temperature 27-27.5 ˚C under a cover that screened 96% of ambient light for 10 days. No bleaching was observed under these recovery conditions. Two days prior to the start of the bleaching experiment, the screen was reduced to an 80 % cover, and the samples were randomly distributed into groups of 6 in two 8-liter static tanks aerated with forced air and set up in the flowing seawater table to maintain ambient temperature. One of these tanks was the control and the other tank was the experimental.

DCMU-induced bleaching

Coral bleaching was induced with exposure of the intact symbiosis to the commercial herbicide Diuron, also known as DCMU: 3-(3,4-Dichlorophenyl)-1,1-

Dimethylurea which acts by blocking electron flow at the quinone acceptors of photosystem II. Blocking takes place via competitive binding at the site normally occupied by the oxidized electron acceptor plastoquinone known as QB resulting in the inhibition of photosynthate production and the generation of singlet oxygen (Taiz & 89

Zeiger 1991). DCMU exposure, ranging from 10 μM– 500 μM, to render symbiotic cnidarians aposymbiotic has a long experimental history (Vandermeulen et al. 1972, Pardy

1976, Hofmann & Kremer 1981, Steele & Smith 1981, Nii & Muscatine 1997). By specifically inhibiting photosystem II, DCMU is an effective proxy for the effects of heat stress and UV on corals, and bleaching induction occurs without initiating significant external stress on the host (Lesser 1996, Franklin et al. 2004, Jones 2004). In this way we effectively isolate the host’s response to a photosynthetically impaired symbiont in an otherwise non-stressful environment. To determine the appropriate dose for an acute bleaching response a trial experiment of DCMU-induced bleaching was conducted at two different DCMU concentrations: 10μM and 100μM. By t=48 hrs the 100μM-exposed samples showed visible bleaching. The trial was terminated on day 4 where only the

100μM-exposed samples showed signs of bleaching and the 10μM-exposed samples looked exactly like the control samples. An acute response, such as that observed in the

100μM-exposed samples, was desired because such an immediate response is likely to induce or repress the largest number of bleaching and symbiosis-linked genes for one time point, and the subtracted library was to be constructed from a single time-point. The

100μM concentration was therefore chosen for the experiment.

The experimental tank was dosed with 100 μM of DCMU dissolved in 7 ml of ethanol (equivalent to 1 % of the total tank volume) and the control tank was dosed with an equal volume of ethanol. Tissue samples for RNA extraction were taken every 24 hrs and flash-frozen in liquid nitrogen. Using a cork borer, 6 mm cores were also taken every

24 hrs to monitor the bleaching response. All samples were shipped to Oregon State 90

University on dry ice, and stored at -80°C. Algae were removed from the core samples by a waterpik in a fixed amount of filtered sea water (FSW), counted on an improved

Neubauer haemocytometer, and indexed to surface area. The values were subjected to 2- way ANOVA general linear model univariate analysis to test for differences over time in zooxanthellae density as a result of treatment with DCMU using SPSS V. 9.0.0 (1989).

Paired-t tests were also conducted to identify those individual time-points where there was a statistically significant difference between the control and experimental samples using

Minitab V. 12.22 (1998).

Total RNA extraction

3 min while the remaining samples were processed. After re-vortexing, the Trizol was then transferred to a 15 ml tube and centrifuged at 4,300 g at 4° C for 5 min to remove algal contaminants in an attempt to isolate host-only RNA. The supernatant was transferred to another 15 ml tube and the process was repeated. The supernatant was then transferred to two 1.5 ml RNase-free microfuge tubes (1 ml per tube), to which 200

μl of chloroform was added. Vigorous mixing and a 3-minute delay on ice followed this addition. The tubes were then centrifuged at 12,000 g for 15 min. The clear supernatant was removed to a fresh 2 ml RNase-free microfuge tube, and the remaining volume filled with ice-cold 100% isopropanol. This was left to precipitate overnight at

-20° C, and then spun at 12,000 g for 15 min. The isopropanol was then decanted off 91 the pellet and replaced with 1,200 μl of an ice cold 75% ethanol wash, mixed well and centrifuged at 7,500 g at 4° C. The 75% e thanol was then poured off, and the pellet left to air dry before being resuspended in 20 – 50 μl DMPC treated water. RNA quality was determined by visualization on a denaturing RNA formaldehyde gel, and quantity was determined on a NanoDrop ND-1000 UV-Vis Spectrophotometer. Only samples showing RNA with good ribosomal bands and large sized mRNA smears were used in subsequent experiments.

Construction of cDNA subtracted library

The subtracted library was constructed using the Clontech PCR-Select cDNA

Subtraction Kit. The time-point of t=72 hrs was selected for construction of the subtracted library, and total RNA from all six samples was pooled. To ensure that only messenger RNA was used in the construction of the library, a poly-A extraction of the total RNA sample was performed using the MicroPoly(A) PuristTM mRNA Purification

Kit from Ambion according to the manufacturer’s directions. This significantly reduced the amount of starting material, so the poly-A RNA was pre-amplified using the BD

SMART PCR cDNA synthesis kit, as described in the Clontech PCR-Select cDNA

Subtraction Kit User Manual, prior to conducting the subtraction as described by the manufacturer. After the subtraction, two groups were generated: 1) enriched for genes induced during coral bleaching and 2) enriched for genes repressed during coral bleaching.

Construction of cDNA arrays

The subtracted cDNA library was TA cloned into pGEM-T plasmids from Promega, transformed into MAX Efficiency® DH5™ Competent Cells (Invitrogen) and plated 92 onto LB-agar plates. There were two batches of transformants created from the subtracted library: bleaching induced and bleaching repressed; and a third group of transformants was created by TA cloning non-subtracted control cDNA derived from the control samples of the experiment. Individual colonies were picked and grown in

LB overnight in 384 well plates, with two 384 well plates (768) picked for each group.

The cDNA inserts were PCR amplifed using M13 forward and reverse vector primers.

The size of cDNA inserts varied between 0.4 and 2.5 Kb. A total of 2,304 PCR amplified cDNAs buffered in 3× SSC and 1.5 M betaine were spotted on UltraGAPS™ coated slides (Corning) with duplication, for a total of 4,608 features. Alien features were also spotted onto the array as internal controls for normalization of the array after hybridization. Two batches of arrays were printed, using aliens manufactured by

Invitrogen and Lucida respectively. All arrays were printed at the Center for Genome

Research and Biocomputing, OSU, using a Microgrid II machine by BioRobotics. After printing, the arrays were dried for 24 hrs in vacuum desiccators, and UV cross linked at

300 mJ. The slides were stored in desiccators until the hybridization process.

Hybridization of arrays

For probe construction, cDNA was synthesized from total RNA extracted from paired t=72 hrs control and bleached samples using Superscript II Reverse Transcripase

(Invitrogen) and the Genisphere 3DNA-900 microarray kit according to the manufacturers' instructions. For each of the six pairs, the same quantity of RNA was used as a template. The range by pair was anywhere from 0.5 μg to 2.5 μg per pair; and

1 μl of alien RNA was added to each cDNA synthesis reaction. After synthesis, the paired cDNA samples were combined and concentrated prior to hybridization using a 93

Microcon YM-30 column. Slides for hybridization were chosen randomly from the batch of high quality printed arrays. Before experimental hybridization, the slides were pre-hybridized for one hour at 50˚C with 5 μg sheared salmon sperm DNA to reduce background. Following post pre-hybridization washes, the slide was spun dry and pre- warmed before the experimental cDNA was added and left to hybridize overnight at

50˚C. Following post-hybridization washes, Cy3 and Cy5 capture reagents were hybridized to the array for 3 hrs at 50°C. All hybridizations took place in a formamide based hybridization buffer under LifterSlips in a sealed humidified chamber. Following post reagent-hybridization washes, slides were scanned using a GenePix ® 4200 scanner (Axon Instruments) and image acquisition and quality control was performed using the software GenePix ® Pro 5.

Experimental design and statistical analysis of microarray data

All statistical analyses were conducted using Acuity v. 4.0.0.57 software in conjunction with the GenePix ® 4200 scanner and the GenePix ® Pro 5 software package used for scanning and data acquisition as described above. We applied a multiple dye-swap experimental design for the two conditions, healthy control coral and experimentally bleached coral, compared in our experiment (Wu et al. 2003). Six biological replicates per condition were used as recommended for this type of two- comparison experimental design (Wu et al. 2003) for a total of 12 microarrays. The assumption from cDNA microarray data is that most genes are not differentially expressed among treatments, and therefore most points in the RI plots should fall along a horizontal line centered on zero. This array, however, being constructed from subtracted library, did not display this distribution. The arrays were therefore 94 normalized solely on the internal control (alien) spots, setting the ratio of medians

(635/532) of the control spots to 1 using the Acuity normalization wizard. The dye- swap array data were also transformed to allow for multi-array comparisons with common signal designations. To detect differentially expressed genes between the two conditions, a one sample t-test was conducted on the log ratio (635/532) intensity values

(as calculated by the Acuity software), and the p-values were adjusted using the

Benjamini-Hochberg method to control the false discovery rate (FDR) and correct for the Type I errors associated with multiple testing (Wu et al. 2003, Benjamini, 1995).

Only those genes with an adjusted p-value < 0.05 were considered for subsequent sequencing and analysis.

Screening for Dinoflagellate Contamination of Host Microarray Features

Due to the close association of this intracellular symbiosis, dinoflagellate contamination in the host RNA preparations used to create the subtracted library and the subsequent array is unavoidable despite efforts to remove the symbionts during the

RNA extraction procedure. The usual method used to screen for symbiont contamination of host cDNA is to conduct a genomic PCR analysis, using genomic

DNA from the symbiont as a template and custom primers designed from suspicious sequences (Weis & Reynolds 1999, Yuyama et al. 2005, Rodriguez-Lanetty et al.

2006). This method can be quite labor intensive, considering the hundreds of results that can arise from an experiment using a microarray platform. The method we chose to use in this experiment is hybridization of host-free symbiont genomic DNA to the array itself. This is a much more efficient method that provides identification of all contaminating spots without the need of custom primers or PCR analysis. 95

First, freshly isolated zooxanthellae (FIZ) were removed from M. capitata by a water pick and filtered sea water (FSW). The FIZ were then incubated in FSW at ambient temperature for 36 hrs. During this incubation period any residual host cell material contaminating the FIZ extraction degraded (Reynolds et al. 2000). After 36 hrs the FIZ were washed to remove the degraded host material, pelleted and frozen. A genomic DNA preparation was then conducted with the DNeasy Plant Mini Kit

(Qiagen) according to the manufacturer’s instructions; disrupting the cell membrane mechanically by grinding the sample with a pestle while suspending the sample tube in liquid nitrogen. The resulting host-free genomic Symbiodinium DNA was prepared for hybridization to the microarray using the Array 900 DNA kit (Genisphere) according to the manufacturer’s instructions. The hybridization, scanning and data acquisition was conducted as described above for the cDNA hybridizations. Any spots that gave a signal to noise ratio (SNR) > 3 were identified as likely dinoflagellate genes and discarded from the study.

Sequencing and gene identity

Differentially expressed cDNA inserts were sequenced with M13F vector primers using the ABI BigDye Terminator Cycle Sequencing Ready Reaction Kit v3.1 and the

ABI3730 DNA Analyzer at the Nevada Genomics Center. Most sequences directionally ligated into the vector with the poly-A tail at the 3’ end. Those sequences that ligated with the poly-A region at the 5’ end had poor quality and were re-sequenced with M13R. Vector sequence was identified and removed from each sequence prior to additional analysis. Blastx searches of NCBI were then performed on each sequence, and those with expect values (E values) less than 1e-4 were considered significant 96

(Altschul et al. 1990, 1997). Those sequences with the same or similar results were then aligned with one another to resolve whether or not there were multiple features containing a common cDNA message. Those alignments were then used to create single copy unigenes. Those genes without significant Blast hits were then converted into their reverse complement and both the forward and reverse-complement sequences were aligned with one another to identify any possible duplication in the non-identified sequences. All duplicate unidentified sequences were also resolved into single copy consensus sequences.

Validation by quantitative real time PCR

Specific primers amplifying 100-200 bp PCR products were designed for some of the significant genes and house keeping genes (Table 6). Specific amplification of appropriately sized bands was verified on a DNA gel. cDNAs from each of four control and experimental samples were synthesized from 1ug of total RNA using Superscript II

Reverse Transcripase (Invitrogen). One µl of cDNA was used in triplicate 20 µl quantitative real time PCR (Q-PCR) reactions with 5 μM F and R primers and iQ SYBR

Green Supermix (BioRad) in a three-step program for a total of 40 cycles. For some of the genes, dilutions of the cDNA (either 1:10 or 1:20) were necessary to stay within the range of sensitivity for this method. All samples (control and experimental) were tested at the same concentration of cDNA for each gene. The comparative delta CT method correcting for the actual PCR efficiency was used to determine relative quantities of mRNA transcripts from each sample, and determined using Lin-RegPCR (Ramakers et al. 2003). To identify house-keeping gene controls for Q-PCR normalization, 5 genes that showed neutral expression (ratio=1) during the array hybridizations were selected. 97

Table 6. Forward and Reverse primers used to amplify selected genes for Q-PCR assays. Housekeeping genes are indicated with (*).

Gene Product Primer Sequence Size Beta-gamma crystallin 130 bp F = CTATTGCAGAGCGTCCGTAA Designed to anneal to a conserved R = GGCTCAATATAGCAGCATCG region found only in Isoforms1, 8 & 7

CnidCAP 154 bp F = TTTTGTGGGGTGCATACTGA Designed to anneal to a conserved region present in all of R = TCCTCTTCTTTCGGTCAACAG the 7 isoforms identified in this library

Polyubiquitin 175 bp F = AGGCAGTAAAAGCCTTCGTG R = TGGTTGCCTCTAACATGTCC

Lymphocyte Antigen 6 Complex 180 bp F = CTGGGTATGCCCTCAAGTGT R = TGAAGCGAAACAGCTTCTCA

Ferritin F = GCCTGAGAAAGACGAATGGG R = TAGACTCCACCTGCTCGTCA

Collagen 157 bp F = AGGCGTTTGTGGTTCACTTC R = GGCTTGCTAGCGAATGGTAT

Ribosomal Protein S3 (RPS3)* 156 bp F = TGCAGATGGCGTATTCAAAG R = CTCCCCTTTTCTCCCAGAAC

Retinitis Pigmentosa GTPase Regulator (RPGR) * 151 bp F = TGCTTCCACTTCTTCCTGGT R = CGAAGCTGATGAACAGAACG

Phosphatidyl-Serine Decarboxylase (PSDC)* 148 bp F = TCTTTTTGCAACACGAGCAT R = ACTTTGGGTTTTTGCACCTG

These putative housekeeping genes were sequenced, identified and then tested for their expression stability using geNorm (Paepe & Speleman 2002). The two most stable genes were used to calculate the normalization factor for each of the cDNA samples.

Of the 5 potential house keeping genes, 1 cDNA was of poor quality and discarded and another had no significant Blast results. The remaining 3 genes were Ribosomal Protein

S3 (RPS3), Retinitis Pigmentosa GTPase (RPGR) and Phosphatidyl-Serine

Decarboxylase (PSDC). The two identified by GeNorm as the most stable were RPS3 and RPGR. Statistical analysis was conducted on the normalized data using a paired t- test and MiniTab software V. 12.22 (1989).

Phylogenetic analyses of CnidCAP and Beta-gamma Crystallin sequences

Using the BLAST results, multiple sequences were downloaded from Genbank and included in alignments conducted in ClustalX for both the CUB domain homologs

(later named CnidCAP, see discussion) and the beta-gamma crystallin homologs (Table

7). Neighbor Joining (NJ) analyses were conducted from these alignments using PAUP software (Swofford 2000), to generate trees with bootstrap values of 1000.

Motif Recognition

Motif searches on many of the identified proteins were conducted in

Prosite at the ExPASy Website hosted by The Swiss Institute of Bioinformatics (Bucher

& Bairoch 1994, Hofmann et al. 1999) to look for the presence of conserved domains. In particular, the multiple M. capitata isoforms that had BLAST hits to beta-gamma crystallins were scanned to determine which of the isoforms retained the actual beta and gamma crystallin ‘Greek key’ motif (Prosite documentation PDOC00197), and motif searches were also performed on the multiple isoforms of M. capitata MASP proteins to 99

Table 7. Genbank accession identification numbers of sequences used in alignments.

Organism Sequence Description Accession ID

CUB Domain Sequences

Bos taurus Crystal Structure Of Acidic Seminal Fluid Protein 1SFP_GI:3318757 (Asfp) At 1.9 A Resolution: A Bovine Polypeptide From The Spermadhesin Family Riftia pachyptila Exoskeleton protein RP43 precursor Q9NH13 Mus musculus Bone Morphogenetic Protein 1 (Bmp1) BC063079.1 Homo sapiens Bone Morphogenetic Protein 1 isoform 2 (Bmp1Iso1) NM_006128.1 Homo sapiens adhesion receptor CD44 M31165.1 Rattus norvegicus Tumor Necrosis Factor (TNF) -stimulated gene 6 XM_001065494.1 protein (TSG-6) Canis familiaris TNF-stimulated gene 6 protein precursor (TSG-6 pre) XM_533354.2 Oryctolagus cuniculus TNF-inducible protein 6 precursor (TSG-6 pre) P98065 Gallus gallus TNF alpha-induced protein 6 (TNFαP6) NM_001037837.2 Equus caballus TNF alpha-induced protein 6 (TNFαP6) AY919871.1 Drosophila melanogaster Tolloid NM_079763.2 Macaca mulatto Tolloid-like 1 XM_001101883.1 Homo sapiens Tolloid-like 1 NM_012464.3 Homo sapiens Tolloid-like 2 NM_012465.2 Apis mellifera Similar to Tolkin CG6863-PA XP_393866 Rattus norvegicus Procollagen C-proteinase enhancer protein (Pcolce) AAH86572 Mus musculus Procollagen C-endopeptidase enhancer 1 precursor Q61398 (Procollagen COOH-terminal proteinase enhancer 1) (PCPE-1) Takifugu rubripes Procollagen C-proteinase enhancer protein (Pcolce) AF016494.1 Homo sapiens procollagen C-endopeptidase enhancer (Pcolce) CH236956.1 Drosophila melanogaster dorsal-ventral patterning protein (DVP) AAA28491 Gallus gallus Mannan-binding lectin serine protease 1 (C4/C2 NM_213586 activating component of Ra-reactive factor) (MASP1) Homo sapiens MASP1 protein BC039724.1 Homo sapiens Mannan-binding lectin serine peptidase 2 transcript NM_006610.2 variant 1 (MASP2_Var1) Homo sapiens precursor of P100 serine protease of Ra-reactive BAA04477 factor ( forms RaRF complex with mannose-binding protein) Mus musculus Mannan-binding lectin serine peptidase 2 transcript NM_001003893.2 variant 1 (MASP2_Var1) Mus musculus MBL-associated serine protease-3 (MASP3) AB049755.1 Rattus norvegicus mannan-binding lectin serine protease 2 (MASP2) NM_172043.1 Rattus norvegicus MASP-3 protein AJ487622.1 Rattus norvegicus Chain A, Crystal Structure Of The Cub1-Egf-Cub2 GI:31615702 Region Of Masp2 (MASP2chainA) Eptatretus burger Mannose-binding lectin-associated serine protease 1 AB206124.1 (MASP1)

100

Table 7. Genbank accession identification numbers of sequences used in alignments. (continued)

Crystallin Sequences

Geodia cydonium Beta-gamma-crystallin (BGCrys) Y08771.1 Ciona intestinalis Beta Gamma Crystallin, chain A (BGCrysChainA) 2BV2_A Iguana iguana GammaN-crystallin (GammaNCrys) AF445457.1 Chiloscyllium colax Beta crystallin S-2 (BetaCrysS2) P48647 Cynops pyrrhogaster Gamma crystalline (GammaCrys) AB238683.1 Xenopus laevis Gamma-crystallin 6 (GammaCrys6) AF071563.1 Xenopus laevis Gamma-crystallin (GammaCrys) M99581.1 Xenopus laevis Gamma crystallin II (GammaCrysII) Q91724 Danio rerio GammaM5-crystallin (GammaM5Crys) NM_001007058.1 Danio rerio Gamma M2d2 crystallin (GammaM2d2Crys) NM_001044866.1 Danio rerio Gamma MX crystallin (GammaMXCrys) NM_001013262.1

101 look for functional domains that are present in MASP proteins from other organisms.

Structural analysis of CnidCAP sequences

Due to the missing domains in the MASP group of isoforms, the predicted structure of each isoform was compared with known crystal structures through a fold recognition analysis using the (m)GenTHREADER server (McGuffin & Jones 2003) in an attempt to verify the identity of this large group as MASP proteins.

AUTHORS' CONTRIBUTIONS

LLH conceived the experimental design, carried out all of the molecular genetic study, performed the statistical analysis, performed the sequence alignments and gene database Blasts, and drafted the manuscript. VMW conceived the study, and participated in the design and coordination of the study. All the authors read and approved the final manuscript.

ACKNOWLEDGEMENTS

We would like to thank Caprice Rosato at the Center for Genome Research and

Biocomputing at Oregon State University for her invaluable help printing the cDNA microarrays, and for continued technical support. We are also grateful for the lab space at the Hawaii Institute of Marine Science, University of Hawaii, where the bleaching experiments were performed during the Pauley Summer Program 2002 Molecular Biology of Corals course. We also thank members of the Weis Lab for comments on the 102 manuscript, and would like to thank Mauricio Rodriguez-Lanetty for statistics advice,

Wendy Phillips, Sophie Richier and Simon Dunn for assistance with quantitative PCR, and Marissa Matzler for hours of dinoflagellate cell counts. This work was supported by grants from the National Science Foundation (MCB0237230 & IOB0542452) to V.M.W. and by a National Science Foundation Fellowship to L.L.H.

103

REFERENCES

Altschul SF, Gish SF, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tools. J. Mol. Biol. 215:403-410

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402

Baker AC (2001) Reef Corals Bleach to Survive Change. Nature 411:765-766

Barrett WC, DeGnore JP, Konig S, Fales HM, Keng YF, Zhang ZY, B YM, Chock PB (1999) Regulation of PTP1B via glutathionylation of the active site cysteine 215. Biochemistry 38:6699-6705

Bernascone I, Vavassori S, Di Pentima A, Santamborogio S, Lamorte G, Amoroso A, Scolari F, Ghiggeri GM, Casari G, Polishchuk R, Rampoldi L (2006) Defective intracellular trafficking of uromodulin mutant isoforms. Traffic 7:1567-1579

Bork P (1991) Complement components C1r/C1s, bone morphogenetic protein 1 and Xenopus laevis developmentally regulated protein UVS.2 share common repeats. FEBS Letters 282:9-12

Bork P, Beckmann G (1993) The CUB domain. A widespread module in developmentally regulated proteins. J Mol Biol 231:539 - 545

Bucher P, Bairoch A (1994) A generalized profile syntax for biomolecular sequence motifs and its function in automatic sequence interpretation. In: D. S (ed) Proceedings 2nd International Conference on Intelligent Systems for Molecular Biology. AAAIPress, Menlo Park, p 53-61

Buddemeier RW, Fautin DG (1993) Coral Bleaching as an Adaptive Mechanism. BioScience 43:320-326

Cairo G, Tacchini L, Pogliaghi G, Anzon E, Tomasi A, Bernelli-Zazzera A (1995) Induction of ferritin synthesis by oxidative stress. The Journal of Biological Chemistry 270:700-703

Catic A, Ploehg HL (2005) Ubiquitin - conserved protein or selfish gene. TRENDS in Biochemical Sciences 30:600 - 604

Causton HC, Ren B, Koh SS, Harbison CT, Kanin E, Jennings EG, Lee TI, True HL, Lander ES, Young RA (2001) Remodeling of yeast genome expression in response to envvironmental changes. Mol Biol Cell 12:323-337 104

Chen D, Toone WM, Mata H, Lyne R, Burns G, Kivinen K, Brazma A, Jones N, Bahler J (2003) Global transcription responses of fission yeast to environmental stress. Molecular Biology of the Cell 14:214-229 deBoer ML, Krupp DA, Weis VM (2007) Proteomic and transcriptional analyses of coral larvae newly engaged in symbiosis with dinoflagellates. Comparative Biochemistry and Physiology Part D doi:10.1016/j.cbd.2006.11.003

Dougherty JD, Geschwind DH (2002) Subtraction-coupled custom microarray analysis for gene discovery and gene expression studies in the CNS. Chem Senses 27:293-298

Douglas AE (2003) Coral Bleaching - How and Why? Marine Pollution Bulletin 46:385-392

Downs CA, Fauth JE, Halas JC, Dustan P, Bemiss J, Woodley CM (2002) Oxidative stress and seasonal coral bleaching. Free Radical Biology & Medicine 33:533- 543

Dunkov B, Georgieva T (2006) Insect iron binding proteins: Insights from the genomes. Insect biochemistry and Molecular Biology 36:300 - 309

Edge AE, Morgan MB, Gleason DF, Snell TW (2005) Development of a coral cDNA array to examine gene expression profiles in Montastraea faveolata exposed to environmental stress. Marine Pollution Bulletin 51:507 - 523

Endo Y, Nonaka M, Saiga H, Kakinuma Y, Matsushita A, Takahashi M, Matsushita M, Fujita T (2003) Origin of mannose-binding lectin-associated serine protease (MASP)-1 and MASP-3 involved in the lectin complement pathway traced back to the invertebrate, Amphioxus. The Journal of Immunology 170:4701-4707

Finley D (1985) The ubiquitin system: functions and mechanisms. Trends in Biochemical Sciences:343-347

Franklin DJ, Hoegh-Guldberg O, Jones RJ, Berges JA (2004) Cell death and degeneration in the symbiotic dinoflagellates of the coral Stylophora pistillata during bleaching. Marine Ecology Progress Series 272:117-130

Fujita T, Matsushita M, Endo Y (2004) The lectin-compliment pathway - its role in innate immunity and evolution. Immunological Reviews 198:185 - 202

Fukuda I, Ooki S, Fujita T, Murayama E, Nagasawa H, Isa Y, Watanabe T (2003) Molecular cloning of a cDNA encoding a soluble protein in the coral exoskeleton. Biochemical and Biophysical Research Communications 304:11- 17 105

Fukuoka S-I (2000) Molecular cloning and sequences of cDNAs encoding a (large) and b (small) isoforms of human pancreatic zymogen granule membrane-associated protein GP2. Biochemica et Biophysica Acta 1491:376-380

Fukuoka S-I, Freedman SD, Yu H, Sukhatme VP, Scheele GA (1992) GP-2/THP gene family encodes self-binding glycosylphosphatidylinositol-anchored proteins in apical secretory compartments of pancreas and kidney. Proceeding of the National Academy of Science 89:1189-1193

Gasch AP, Spellman PT, Kao CM, Carmel-Harel O, Eisen MB, Storz G, Botstein D, Brown PO (2000) Genomic expression programs in the response of yeast cells to environmental changes. Mol Biol Cell 11:4241-4257

Gates RD, Baghdasarian G, Muscatine L (1992) Temperature stress causes host cell detachment in symbiotic cnidarians: implications for coral bleaching. Biol Bull 182:324-332

Gattuso J-P, Allemand D, Frankignoulle M (1999) Photosynthesis and calcification at cellular, organismal and community levels in coral reefs: a review on interactions and control by carbonate chemistry. American Zoologist 39:160- 183

Ghezzi P (2005) Regulationof protein function by glutathionylation. Free Radical Research 39:573-580

Girardot F, Monnier V, Tricoire H (2004) Genome wide analysis of common and specific stress responses in adult Drosophila melanogaster. BMC Genomics 5:74

Glynn PW (1993) Coral Reef Bleaching: Ecological Perspectives. Coral Reefs 12:1-17

Graw H (1997) The Crystallins: genes, proteins and diseases. Biol Chem 378:1331- 1348

Hofmann DK, Kremer BP (1981) Carbon metabolism and strobiliation in Cassiopea andromedea (cnidaria: scyphozoa)" significance of endosymbiotic dinoflagellates. Marine Biology 65:25-33

Hofmann GE, Somero GN (1996) Interspecific variation in the thermal denaturation of proteins in the congeneric mussels Mytilus trossulus and M. galloprovincialis: evidence from the heat-shock response and protein ubiquination. Marine Biology 126:65-75

Hofmann K, Bucher P, Flaquet L, Bairoch A (1999) The PROSITE database, its status in 1999. Nucleic Acids Res. 27:215-219 106

Iglesias-Prieto R (1997) Temperature-Dependent Inactivation of Photosystem II in Symbiotic Dinoflagellates Proceedings of the 8th International Coral Reef Symposium, Panama City, p 1313-1318

Ji X, Azumi K, Sasaki M, Nonaka M (1997) Ancient origin of the complement lectin pathway revealed by molecular cloning of mannan binding protein-associated swerin protease from a urochordate, the Japanese ascidian Halocynthia roretzi. Proceeding of the National Academy of Science 94:6340-6345

Jones RJ (2004) Testing the 'photoinhibition' model of coral bleaching using chemical inhibitors. Marine Ecology Progress Series 284:133-145

Kingsley RJ, Afif E, Cox BC, Kothari s, Kriechbaum K, Kuchinsky K, Neill AT, Puri AF, Kish V (2003) Expression of heat shock and cold shock proteins in the gorgonian Leptogrogia virgulata. Journal of Experimental Zoology 296:98-107

Kingsley RJ, Dupree JL (1993) Seasonal localization of a collagenous protein in the organic matrix of spicules from the gorgonian Leptogorgia virgulata (Cnidaria: Gorgonacea). Cell & Tissue Research 273:309-316

Kinzie III RA, Takayama M, Santos SR, Coffroth MA (2001) The Adaptive Bleaching Hypothesis: Experimental Tests of Critical Assumptions. Biological Bulletin 200:51-18

Kortschak RD, Samuel G, Saint R, Miller DJ (2003) EST analysis of the cnidarian Acropora millepora reveals extensive gene loss and rapid sequence divergence in the model invertebrates. Current Biology 13:2190-2195

Krasko A, Muller IM, Muller WE (1997) Evolutionary relationships of the metazoan beta gamma crystallins including that from the marine sponge Geodia cydonium. Proceedings: Biological Sciences 264:1077-1084

Kuo J, Chen M-C, Lin C-H, Fang L-S (2004) Comparative gene expression in the symbiotic and aposymbiotic Aiptasia pulchella by expressed sequence tag analysis. Biochemical and Biophysical Research Communications 318:176-186 107

Lesser MP (1996) Elevated temperatures and ultraviolet radiation cause oxidative stress and inhibit photosynthesis in symbiotic dinoflagellates. Limnology and oceanography 41:271-283

Liu X, Theil EC (2005) Ferritins: dynamic management of biological iron and oxygen chemistry. Acc Chem Res 38:167-175

Maro AD, Pizzo E, Cubellis MV, D'Alessio G (2002) An intron-less BG-crystallin-type gene from the sponge Geodia cydonium. Gene 299:79-82

Matsushita M, Fujita T (1992) Activation of the classical complement pathway by mannose-binding protein in assocation with a novel C1s-like serine protease. J. Exp. Med. 176:1497-1502

McGuffin LJ, Jones DT (2003) Improvement of the GenTHREADER method for genomic fold recognition for genomic sequences. Bioinformatics 19:874-881

Monia BP, Ecker DJ, Crooke ST (1990) New perspectives on the structure and function of ubiquitin. Bio/Technology 8:209-215

Mullen KM, Peters EC, Harvell D (2004) 22. Coral Resistance to Disease. In: Rosenberg E (ed) Coral Health and Disease. Springer Verlag, p 377-399

Muller-Parker G, D'Elia CF (1997) Chapter 5 "Interactions Between Corals and Their Symbiotic Algae" in Life and Death of Corals Reefs, Vol. Chapman and Hall, New York, New York

Muscatine L, Porter JW (1977) Reef Corals: Mutualistic Symbioses Adapted to Nutrient-Poor Environments. BioScience 27:454-460

Nagata K (1996) Hsp47: a collagen-specific molecular chaperone. Trends Biol Sci 21:23-26

Nemer M, Rondinelli E, Infante D, Infante AA (1991) Polyubiquitin RNA characteristics and conditional induction in sea urchin embryos. Developmental Biology 145:255-265 108

Nii CM, Muscatine L (1997) Oxidative stress in the symbiotic sea anemone Aiptasia pulchella (Carlgren, 1943): contribution of the animal to superoxide anion production at elevated temperature. Biol Bull 192:444-456

Paepe A, Speleman F (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3:1-11

Pardy RL (1976) The Production of Aposymbiotic Hydra by the Photodestruction of Green Hydra Zoochlorellae. Biological Bulletin 151:225-235

Puverel S, Tambutte E, Zoccola D, Domart-Coulon I, Bouchot a, Lotto S, Allemand D, Tambutte S (2005) Antibodies against the organic matrix in scleractinians: a new tool to study coral biomineralization. Coral Reefs 24:149-156

Ramakers C, Ruijter JM, Deprez RH, Moorman AF (2003) Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neuroscience Letters 339:62-66

Ray ME, Wistow G, A SY, Meltzer PS, Trent JM (1997) AIM1, a novel non-lens member of the BG-crystallin superfamily, is associated with the control of tumorigenicity in human malignant melanoma. Proceeding of the National Academy of Science 94:3229-3234

Rodriguez-Lanetty M, Phillips WS, Weis VM (2006) Transcriptome analysis of a cnidarian-dinoflagellate mutualism reveals complex modulation of host gene expression. BMC Genomics 7

Romero A, Romao MJ, Varela PF, Killn I, Dias JM, Carvalho AL, Topfer-Petersen E, Calvete JJ (1997) The crystal structures of two spermadhesins reveal the CUB domain fold. Nat Struct Biol 10:783-788

Sawyer SJ, Muscatine L (2001) Cellular Mechanisms Underlying Temperature-Induced Bleaching in the Tropical Sea Anemone Aiptasia pulchella. The Journal of Experimental Biology 204:3443-3456

Scheele GA, Fukuoka S, Freedman SD (1994) Role of the GP2/THP family of GPI- anchored proteins in membrane trafficking during regulated exocrine secretion. Pancreas 2:139-149 109

Schmid V, Bally A, Beck K, Haller M, Schlage WK, Weber C (1991) The extracellular matrix (mesoglea) of hydrozoan jelly fish and its ability to support cell adhesion and spreading. Hydrobiologia 216/217:3-10

Schwarz JA, Brokstein P, Namohar C, Coffroth MA, Szmant A, Medina M (2006) Coral reef genomics: developing tools for functional genomics of coral symbiosis. 10th International Coral Reef Symposium, accepted

Shimeld SM, Purkiss AG, Dirks RPH, Bateman OA, Slingsby C, Lubsen NH (2005) Urochordate BG-crystallin and the evolutionary origin of the vertebrate eye lens. Current Biology 15:1684-1689

Smith DC, Douglas AE (1987) The Biology of Symbiosis: Chapter 3, Vol. Edward Arnold Publishers, London

Starke DW, Chock PB, Mieyal JJ (2003) Glutathione-thiyl radical scavenging and transferase properties of human glutaredoxin (thioltransferase). The Journal of Biological Chemistry 278:14607-14613

Steele RD, Smith DC (1981) Factors Affecting the Reduction of the Algal Symbiont Population in Green Hydra. Journal of Zoology 193:201-214

Swofford DL (2000) PAUP*: phylogenetic analysis using parsimony and other methods (software), Vol. Sinauer Associates, Sunderland, MA

Taiz L, Zeiger E (1991) Plant Physiology, Vol. The Benjamin/Cummings Publishing Company, Inc., Redwood City, California

Titlyanov EA, Titlyanova TV (2002) Reef-building corals - symbiotic autotorphic organisms: 1. General structure, feeding pattern , and light-dependent distribution in the shelf. Hydrobiology 28:S1-S15

Vandermeulen JH, Davis ND, Muscatine L (1972) The effect of inhibitors of photosynthesis on zooxanthellae in corals and other marine invertebrates. Marine Biology 385:1432-1793 110

Walther G-R, Post E, Convey P, Menzel A, Parmesan C, Beebee TJC, Fromentin J-M, Hoegh-Guldberg O, Bairlein F (2002) Ecological responses to recent climate change. Nature 416:389-395

Wang J-T, Douglas AE (1998) Nitrogen Recycling or Nitrogen Conservation in an Alga-Invertebrate Symbiosis. The Journal of Experimental Biology 201:2445- 2453

Watanabe T, Fukuda I, China K, Isa Y (2003) Molecular analyses of protein components of the organic matrix in in the exoskeleton of two scleractinian coral species. Comparative Biochemistry and Physiology Part B 136:767-774

Weber C, Schmid V (1985) The fibrous system in the extracellular matrix of Hydromedusae. Tissue Cell 17:811-822

Weis VM, Levine PR (1996) Differential protein profiles reflect the different lifestyles of symbiotic and aposymbiotic Anthopleura elegantissima, a sea anemone from temperate waters. J. Exp. Biol. 199:883-892

Welford SM, Gregg J, Chen E, Garrison D, Sorensen PH, Denny CT, Nelson SF (1998) Detection of differentially expressed genes in primary tumor tissues using representational differences analysis coupled to microarray hybridization. Nucleic Acids Research 26:3059-3065

Wilkinson KD (2000) Ubiquitination and deubiquitination: Targeting of proteins for degradation by the proteasome. Cell & Developmental Biology 11:141 - 148

Wood-Charlson EM, Hollingsworth LL, Krupp DA, Weis VM (2006) Lectin/glycan interactions play a role in recognition in a coral/dinoflagellate symbiosis. Cellular Microbiology 8:1985-1993

Worcester EM (1994) Urinary calcium oxalate crystal growth inhibitors. J Am Soc Nephrol 5:S46-S53

Wu H, Kerr MK, X C, A CG (eds) (2003) MAANOVA: A software package for the analysis of spotted cDNA microarray experiments, Vol 111

Yang GP, Ross DT, Kuang WW, Brown PO, Weigel RJ (1999) Combining SSH and cDNA microarrays for rapid identification of differentially expressed genes. Nucleic Acids Research 27:1517-1523

Yuyama I, Hayakawa H, Endo H, Iwao K, Takeyama H, Maruyama T, Watanabe T (2005) Identification of a symbiotically expressed coral mRNAs using a model infection system. Biochemical and Biophysical Research Communications 336:793-798

112

TRANSCRIPTOME ANALYSIS OF THE CORAL MONTIPORA CAPITATA DURING CORAL BLEACHING IN PILAA BAY, KAUAI, HI

Laura L. Hauck, Steve J. Dollar, Virginia M. Weis

Prepared for submission to: Coral Reefs Editorial Office West Briscoe, Baldersdale, Barnard Castle, Co Durham, DL12 9UP. UK. 113

ABSTRACT

Corals-dinoflagellate symbioses form both the trophic and structural foundation of reef ecosystems and are responsible for nutrient cycling in these nutrient poor waters. The breakdown of this symbiosis results in coral bleaching. Worldwide episodes of coral bleaching are extremely disconcerting considering that many tropical ecosystems will disappear without healthy reefs. Despite their environmental importance, little is known about the molecular basis of the symbiosis, healthy or otherwise. Chapter 2 describes the development of a 2,304 feature custom Montipora capitata DNA stress microarray. This

DNA microarray was made from cDNA that came from a subtracted library of experimentally bleached M. capitata samples. In this study, we deploy this array in the field to profile the gene expression pattern of bleached samples collected in Pilaa Bay,

Kauai, HI. We detected 81 genes that displayed statistically different ratios of expression between the healthy and bleached groups of field collected corals. Seven of these 81 genes matched those identified in chapter 2 as a function of DCMU-induced bleaching.

The identified genes induced in this field study included some involved in immunity, such as a halide peroxidase and a c-type lysozyme, as well as genes of varying function including glutaredoxin, galaxin, and ribosomal protein S21. The identified repressed genes from this study included egr-1, a transcriptional regulator, and hedgehog, a signaling protein which functions in embryological development. In addition, we isolated many novel, unidentified genes that may prove to be useful as markers of coral stress or may be identified later as mediators of the symbiosis.

114

INTRODUCTION

Cnidarians, such as the coral Montipora capitata, host photosynthetic dinoflagellates (zooxanthellae) in vacuoles called symbiosomes within their own gastrodermal cell layer (Muller-Parker and D'Elia 1997, Smith and Douglas 1987). This relationship is a mutually beneficial symbiosis that involves the transfer of nutrients and compounds between the partners (Lewis and Smith 1971, Muscatine and Porter 1977,

Smith and Douglas 1987, Wang and Douglas 1998, Weis and Reynolds 1999). The benefits of this partnership have allowed the corals to form both the trophic and structural foundation of reef ecosystems; and make them responsible for nutrient cycling in these nutrient poor waters (Muscatine and Porter 1977). The breakdown of this symbiosis is often referred to as bleaching.

Coral bleaching is defined as an event in which there is a loss of the symbiotic zooxanthellae, or a reduction in the chlorophyll pigment concentrations of the symbiont

(Douglas 2003, Glynn 1993) causing the host tissue to appear white. Worldwide episodes of coral bleaching are extremely disconcerting considering that many coral species die without their algal symbionts and many tropical ecosystems would disappear without healthy reefs (Wilkinson 1999). The decline of vast reef ecosystems could have deleterious effects on a global scale. Reef-wide bleaching events are now known to be caused primarily by elevated sea surface temperatures, such as those cause by global warming (Walther et al. 2002), and also by elevated UV radiation (Shick and Lesser 1991,

Shick et al. 1991). Many studies have shown that exposure of some corals to even slightly elevated temperatures can initiate a bleaching response (Sawyer and Muscatine 2001). It has also been shown that damage to the photosystems of the symbiont, particularly the D1 115 reaction center of photosystem II, is the first step in the coral bleaching process (Iglesias-

Prieto 1997, Jones et al. 1998, Warner et al. 1999). This might suggest that the dinoflagellate is the ‘weak link’ in this symbiosis, and that bleaching is a host response to an impaired symbiont. Loss of the symbiosis as an adaptive strategy for the coral host has been explored and debated extensively (Baker 2001, Buddemeier and Fautin 1993, Downs et al. 2002, Kinzie III et al. 2001).

The use of molecular biological approaches in the study of corals, and cnidarian- dinoflagellate symbiosis in general, is a trend that is just now beginning to fully develop into its potential. The search for symbiosis-specific genes in cnidarians was originally pursued by the use of proteomic analyses, and focused on anemones, due to their occurrence in nature in both the symbiotic and aposymbiotic (symbiont-free) state (Weis and Levine 1996). More recently, however, molecular tools have emerged to include subtractive library analysis of the corals Fungia scutaria (deBoer et al. 2007) and

Acropora tenuis (Yuyama et al. 2005), EST analysis of the corals Acropora millepora

(Kortschak et al. 2003) and Acropora palmata (Schwarz et al. 2006) and the anemone

Aiptasia pulchella (Kuo et al. 2004), development of a 32 feature dot-blot stress array from the coral Montrastraea faveolata (Edge et al. 2005), and the development of a

10,368 feature transcriptome DNA microarray of the anemone Anthopleura elegantissima

(Rodriguez-Lanetty et al. 2006). In addition, the genome of the anemone Nematostella vectensis has been sequenced and is publicly available at StellaBase

(http://evodevo.bu.edu/stellabase), making genomic information in cnidarians even more accessible. The use of DNA microarrays to examine stress responses of many organisms is well developed (Chen et al. 2003, Girardot et al. 2004), but this study would be the first 116 use of a DNA microarray to profile gene expression of a coral during coral bleaching in the field.

The development of our custom DNA array was discussed in Chapter 2. In summary, we created a 2,304 feature microarray platform from a cDNA subtracted library, made from experimentally bleached Montipora capitata to identify genes that are induced and repressed during bleaching. To initiate the coral bleaching response the holobiont was exposed to the commercial herbicide Diuron, also known as DCMU (3-

(3,4-Dichlorophenyl)-1,1-Dimethylurea) which acts by blocking electron flow at the quinone acceptors of photosystem II (Taiz and Zeiger 1991). This exposure serves as a proxy to the type of damage that occurs to photosystem II during heat and UV stress as described above, and allows us to specifically examine the host’s response to a photosynthetically impaired symbiont without the interference of additional environmental stressors. We detected 537 host genes that displayed statistically different ratios of expression between the control and bleached groups of experimental corals. The identified genes induced by DCMU exposure included oxidative stress responders, structural proteins, and multiple isoforms of beta-gamma crystallin homologs of unknown function. The identified genes repressed during DCMU exposure include a component of the organic matrix, ubiquitin, and a novel carbohydrate associated protein (Cnid-CAP) putatively involved in host/symbiont specificity and recognition. The data from this first microarray study, particularly the emergence of Cnid-CAP, suggest that host/symbiont specificity in corals is homologous to the complement pathway active in innate immunity in animals. 117

The goal of the current study is to profile the gene expression of M. capitata colonies bleaching in the field through hybridization of healthy and bleached field- sample-derived cDNA to our custom DNA microarray. We are interested in determining if the gene expression patterns elicited by experimental bleaching (observed in Chapter 2) are similar to those in a field bleaching event, and ultimately to identify those significant genes that are common to both bleaching events. We chose Pilaa Bay; which is located on the North shore of Kauai, Hawaii, as our field site. Observations of M. capitata colonies persisting with greatly reduced symbiont populations were made in 2002 (Dollar, pers comm). Observations of this phenomenon continued for the next two years, during which time there was no decrease in colony size observed, and no colony mortality (noted by algal overgrowth). A heat differential between the non-bleached and bleached sides of this bay, possibly due to the underwater topography of the site, has been observed. The warmer half of the bay is where the bleaching colonies are found. We chose to sample the corals at this field site because of their persistent state of naturally occurring reduced symbiosis, and because we hypothesized that the elevated water temperatures were likely to blame for the bleaching response. These parameters make this field data set ideal for comparison with the DCMU-induced experimental bleaching profile determined in

Chapter 2.

METHODS

Construction of cDNA arrays

The complete description of array construction can be found in Chapter 2. In summary, the array was printed from portions of a subtracted library built from RNA extracted 118 from coral samples in an experimentally-induced bleaching experiment. To initiate the coral bleaching response in the initial study, the holobiont was exposed to the commercial herbicide Diuron, also known as DCMU (3-(3,4-Dichlorophenyl)-1,1-

Dimethylurea) which acts by blocking electron flow at the quinone acceptors of photosystem II. Blocking takes place via competitive binding at the site normally occupied by the oxidized electron acceptor plastoquinone known as QB resulting in the inhibition of photosynthate production and the generation of singlet oxygen (Taiz and

Zeiger 1991). By specifically inhibiting photosystem II, DCMU is a proxy for the effects of UV and heat stress-induced coral bleaching, without initiating additional environmental stress on the host. In this way we effectively isolate the host’s response to a photosynthetically impaired symbiont. Two 384-well plates were grown and PCR amplified from each of 3 groups of transformants: subtracted control (repressed), subtracted DCMU exposed (induced) and a third group created by TA cloning non- subtracted cDNA derived from the control samples of the experiment. The size of cDNA inserts varied between 0.4 and 2.5 Kb. A total of 2,304 PCR amplified cDNAs buffered in 3× SSC and 1.5 M betaine were spotted on UltraGAPS™ coated slides

(Corning) with duplication, for a total of 4,608 features. Alien features were also spotted onto the array as internal controls for normalization of the array after hybridization. All arrays were printed at the Center for Gene Research and

Biotechnology, OSU, using a Microgrid II machine by BioRobotics. After printing, the arrays were dried for 24 hrs in vacuum desiccators, and UV cross linked at 300 mJ.

Slides were stored in desiccators until the hybridization process.

119

Collection of field samples

Bleached and healthy samples of Montipora capitata colonies, of the plate morphology, were collected at various depths, ranging from one to five meters in Pilaa

Bay, on the north shore of Kauai, Hawaii during July, 2004. Once collected, the tissue samples were flash frozen in isopropanol on dry ice, shipped to Oregon State University on dry ice, and stored at -80°C pending RNA extraction.

Total RNA extraction

Immediately upon removal from -80°C, small pieces of the skeleton were chipped off and placed in a 50 ml conical tube containing 2 – 3 ml Trizol. The tube was then vigorously vortexed for 1-3 min, and left at room temperature for at least 3 min while the remaining samples were processed. After re-vortexing, the Trizol was then transferred to a 15 ml tube and centrifuged at 4,300 g at 4° C for 5 min to remove algal contaminants in an attempt to isolate host-only RNA. The supernatant was transferred to another 15 ml tube and the process was repeated. The supernatant was then transferred to two 1.5 ml RNase-free microfuge tubes (1 ml per tube), to which 200 μl of chloroform was added. Vigorous mixing and a 3-minute delay on ice followed this addition. The tubes were then centrifuged at 12,000 g for 15 min. The clear supernatant was removed to a fresh 2 ml RNase-free microfuge tube, and the remaining volume filled with ice-cold 100% isopropanol. This was left to precipitate overnight at

-20° C, and then spun at 12,000 g for 15 min. The isopropanol was then decanted off the pellet and replaced with 1,200 μl of an ice cold 75% ethanol wash, mixed well and centrifuged at 7,500 g at 4° C. The 75% ethanol was then poured off, and the pellet left 120 to air dry before being resuspended in 20 – 50 μl DMPC treated water. RNA quality was determined by visualization on a denaturing RNA formaldehyde gel, and quantity was determined on a NanoDrop ND-1000 UV-Vis Spectrophotometer. Only samples showing RNA with good ribosomal bands and large sized mRNA smears were used in subsequent experiments.

Hybridization of arrays

For probe construction, cDNA was synthesized from total RNA extracted from paired bleached and healthy samples using Superscript II Reverse Transcripase

(Invitrogen) and the Genisphere 3DNA-900 microarray kit according to the manufacturers' instructions. For each of the four pairs, the same quantity of RNA was used as a template. The range by pair was anywhere from 0.5 μg to 2.5μg per pair; and

1 μl of alien RNA was added to each cDNA synthesis reaction. After synthesis, the paired cDNA samples were combined and concentrated prior to hybridization using a

Microcon YM-30 column. Slides for hybridization were chosen randomly from the batch of high quality printed arrays. Before experimental hybridization, the slides were pre-hybridized for 1 hr at 50˚C with 5 μg sheared salmon sperm DNA to reduce background. Following post pre-hybridization washes, the slide was spun dry and pre- warmed before the experimental cDNA was added and left to hybridize overnight at

50˚C. Following post-hybridization washes, Cy3 and Cy5 capture reagents were hybridized to the array for 3 hrs at 50°C. All hybridizations took place in a formamide- based hybridization buffer under LifterSlips in a sealed humidified chamber. Following post reagent-hybridization washes, slides were scanned using a GenePix ® 4200 121 scanner (Axon Instruments) and image acquisition and quality control was performed using the software GenePix ® Pro 5.

Experimental design and statistical analysis of microarray data

All statistical analyses were conducted using Acuity v. 4.0.0.57 software, which is designed to be used in conjunction with the GenePix ® 4200 scanner and the GenePix

® Pro 5 software package used for scanning and data acquisition as described above.

We applied a multiple dye-swap experimental design for the two conditions, healthy coral and bleached coral (Wu et al. 2003). Four biological replicates per condition were used, for a total of 8 microarrays. The assumption for cDNA microarray data is that most genes are not differentially expressed among treatments, and therefore most points in the RI plots should fall along a horizontal line centered on zero (Yang et al. 2002).

The arrays were therefore normalized globally, and the effects of the normalization were tested using the internal control (alien) spots, which is a recommended normalization analysis (Yang et al. 2002). The dye-swap array data was also transformed to allow for multi-array comparisons with common signal designations. To detect differentially expressed genes between the two conditions, a one sample t-test was conducted on the log ratio (635/532) intensity values (as calculated by the Acuity software), and the p-values were adjusted using the Benjamini-Hochberg method to control the false discovery rate (FDR) and correct for the Type I errors associated with multiple testing (Benjamini and Hochberg 1995, Wu et al. 2003). Only those genes with an adjusted p-value < 0.05 were considered for subsequent sequencing and analysis.

122

Screening for Dinoflagellate Contamination of Host Microarray Features

Identification of features that were likely dinoflagellate in origin was conducted as described in Chapter 2. In summary, host-free genomic DNA from the symbiotic dinoflagellates was hybridized to the array using the Array 900 DNA kit (Genisphere) according to the manufacturer’s instructions. Any spots that gave a signal to noise ratio

(SNR) > 3 were flagged as potentially dinoflagellate in origin and discarded from the study.

Sequencing and gene identity

Differentially expressed cDNA inserts were sequenced with M13F vector primers using the ABI BigDye Terminator Cycle Sequencing Ready Reaction Kit v3.1 and the

ABI3730 DNA Analyzer at the Nevada Genomics Center. Most sequences directionally ligated into the vector with the poly-A tail at the 3’ end. Those sequences that ligated with the poly-A region at the 5’ end had poor quality and were re-sequenced with M13R. Vector sequence was identified and removed from each sequence prior to additional analysis. Blastx searches for homologs at NCBI and rpsBlast searches for conserved domains were then performed on each sequence (Altschul et al. 1990, 1997).

Those sequences with the same or similar results were aligned with one another to resolve whether or not there were multiple features containing a common cDNA message. Those alignments were then used to create single copy unigenes. Those genes without significant Blast hits were then converted into their reverse complement and both the forward and reverse-complement sequences were aligned with one another to identify any possible duplication in the non-identified sequences. All duplicate unidentified sequences were also resolved into single copy unigenes. 123

Phylogenetic analyses of Beta-Gamma Crystallin sequences

In Chapter 2, a group of 14 beta-gamma crystallin isoforms were identified. These

Beta-gamma crystallin isoforms showed an average 13.12 fold increase in expression during DCMU-induced bleaching, which was verified by a 6.11 fold increase in expression by Q-PCR. Only half of these isoforms contain the beta-gamma crystallin

(BGCrys) domain according to Prosite (Hofmann et al. 1999). The appearance of an additional beta-gamma crystallin in the significantly differential genes identified in the field required additional bioinformatic analysis. The new beta-gamma crystallin isoform, all beta-gamma crystallin isoforms identified in Chapter 2, and Blast results from those sequences (Table 1) were included in an alignment conducted in ClustalX. Neighbor

Joining (NJ) analyses were conducted from these alignments using PAUP software

(Swofford 2000), to generate trees with bootstrap values of 1000.

RESULTS

A total of 81 (3.5%) of the 2,304 features from the microarray were identified as having significantly different ratios of expression between the control and bleaching samples after adjusting for the FDR at p<0.05. Seven features were significantly differential in both this study and the experimental study (Chapter 2). Five of the seven had similar patterns of expression between the experiment and the field, and two had contrasting patterns of expression (Table 2). One of the repressed genes which was significant only in the field, was identified as an isoform of beta-gamma crystallin. A large number of beta-gamma crystallin isoforms were found to be induced during bleaching in Chapter 2 placed it in a group of isoforms induced in the experimental 124

Table 1. Genbank accession identification numbers of crystallin sequences used in the alignment.

Organism Sequence Description Accession ID

125 study. The newly identified isoform was therefore added to the shared field and experimental group as a contrasting result.

The changes in expression of genes repressed during bleaching were both more pronounced and more numerous (Fig.1). Of the 81 differentially expressed features, only four (4.9%) came from the bleaching repressed group, and 12 (14.8%) came from the non-subtracted control group. The remaining 65 (80.2%) came from the bleaching induced group. None of the significantly differential genes, induced or repressed, reflected a fold change greater than five. Four (4.9%) of the 81 significantly differential features also hybridized to symbiont genomic DNA (see Chapter 2), making them likely dinoflagellate genes. These were removed from the analysis. All four of those features came from the bleaching-induced group printed on the array.

Thirty-six of the 81 significant features were selected for sequencing. These resolved into 23 unigenes, ten of which were induced and 13 of which were repressed during bleaching. The redundancy of the significant array features was therefore 36%.

Five of the ten induced genes and three of the 13 repressed genes (35% of the 23 unigenes) displayed significant Blast hits (Tables 2 – 4). The remaining five induced and ten repressed genes (65% of the 23 unigenes) are unidentifiable (Tables 2-4).

DISCUSSION

The percentage of significantly differential features that were determined to be dinoflagellate in origin in the experimental study, 4.6% (Chapter 2), is very comparable to the 4.9% found in this field study. The 36% redundancy rate for this study is lower than the 44% from the experimental study (Chapter 2) and the 48% redundancy found 126 35 Down-regulated Up-regulated

1 30

25 2

Number of Features 10

5 1

5 4 3 2 2 3 4 5 1.5 1.5 1.25 1.25 Ratio of Gene Expression

Fig. 1. Distribution of the significant array features (p<0.05 after adjusting for the FDR) as a function of the ratio of gene expression. The ratio of gene expression was derived by averaging the medians of the signal ratio per feature from each array. The numbers above the columns indicate how many features in each group were identified as dinoflagellate in origin and removed from the study.

127

Table 2. Significant unigenes (p<0.05 after FDR adjustment) shared by both the field collected bleached corals, and the experimentally bleached corals (Chapter 2). Identification is based on the e-value of Blastx hits from Genbank. Arrows indicate the direction of expression as a function of coral bleaching.

Field Experimental Blast ID Best Blastx Feature ID Array Ratio of Array Ratio of e-value the Medians the Medians When averaged: When averaged: ± StDev ± StDev (# of seq) (# of seq)

Glutaredoxin 3e-12 DCMU1F13 Ç 1.63 (2) Ç 3.47 SubCont1K22 ± 0.21 ± 0.24 (2)

Unidentified DCMU2J22 Ç 3.11 Ç 4.92

Unidentified DCMU2K1 Ç 1.89 Ç 2.34 Similar Similar Expression Unidentified DCMU1J8 Ç 1.70 Ç 2.80

Unidentifed DCMU2C4 Ç 2.88 Ç 2.47

Galaxin 3e-45 SubCont1P23 Ç 1.32 È 2.44

Beta-Gamma No significant DCMU2G17 È 4.00 Ç 13.12 Crystallin hits, ID from ± 4.49 (22) Isoform15 alignment (all isoforms) Expression

Contrasting Unidentified DCMU2M5 È 1.60 Ç 8.90

128

Table 3. Known significant unigenes (p<0.05 after FDR adjustment) induced and repressed during coral bleaching in the field. Identification based on the e-value of Blastx hits from Genbank. Ratios showing the fold change of gene expression are shown. Arrows indicate the direction of expression as a function of coral bleaching.

Best Blastx Array Ratio of Blast ID Match e-value Feature ID the Medians

Halide Peroxidase (HPO) 6e-19 DCMU2K21 Ç 3.40

C-type Lysozyme 5e-17 SubCont2G11 Ç 2.56

Induced Induced RPS21: 3e-27 NSC1C8 Ç 1.47 Ribosomal Protein S21

Egr1: Zinc Finger 3e-47 SubCont2A10 È 1.29

Transcriptional Regulator

Hedgehog 2e-16 NSC2E22 È 1.67 Repressed

129

Table 4. Unknown unigenes significantly induced or repressed (p<0.05 after FDR adjustment) in the field during coral bleaching. Ratios showing the fold change of gene expression are shown; arrows indicate the direction of expression as a function of coral bleaching. Unknown status is based on a lack of significant Blast hits (p<1e-4) from Blastx searches of Genbank.

Avg Ratio of Feature ID the Medians When averaged: ± StDev (# of seq)

NSC2P17 Ç1.39

Induced

NSC1O13 Ç 4.61

DCMU2M22 Ç 4.30

DCMU2O20 Ç 3.41

NSC2A20 Ç 2.30

Group of Unidentified Field Isoforms

UnIDRepFld1 DCMU1F6 È 3.65 ± 1.29 (4) DCMU2H17 DCUM1I10 DCMU1O5

UnIDRepFld2 NSC1F3 È 3.58 DCMU1L4 ± 0.55 (4)

Repressed DCMU1B10 DCMU2J13

UnIDRepFld3 DCMU2P7 È 4.00 DCMU1A13 ± 0.23 (7) DCMU1A3 NSC1E3 DCMU2F17 DCMU1D13 DCMU1E2

UnIDRepFld4 DCMU2N14 È4.01

130 in the A. elegantissima array (Rodriguez-Lanetty et al. 2006). The reduction in redundancy is likely due to changes in selection procedures for sequencing. Significant sequences were grouped by similarity in fold-change, and limited numbers of sequences from each group were selected for sequencing. This decision was based on the experimental study results which indicated that a large number of the sequences within any fold-change group were likely to be duplicates of one another. The field unidentified rate of 65% is high when compared to the 50% of the experimental study

(Chapter 2), 64% in the coral Acropora millepora EST study (Kortschak et al. 2003) and 65% in the A. elegantissima microarray (Rodriguez-Lanetty et al. 2006). This may be due to the low number of sequences analyzed, and to the large group of isoforms in the unidentified group.

The changes in expression of genes induced during bleaching in the experimental analysis (Chapter 2) were both more pronounced and more numerous, which is in contrast to our current findings. The fold changes in this study never exceeded a five fold change in either direction, which is much lower than the fold changes found in the experimental results (Chapter 2), which ranged up a 30 fold induction and a 20 fold repression. This more subtle change in expression in the field is not surprising given that the experimental stress elicited was acute and severe compared to the field stress, which was likely chronic and of lower intensity. In addition, the

DCMU-induced coral bleaching had just occurred whereas the reduced symbiosis sampled in the field appears to have been persisting for at least 2 years. The results from this study are also more in keeping with the subtle changes in expression observed in the anemone A. elegantissima transcriptome array (Rodriguez-Lanetty et al. 2006). 131

The symbiosis that A. elegantissima participates in is facultative rather than obligate, and anemones can occur in the aposymbiotic state in low light environments with no stress exposure.

Genes differentially expressed in both field collected bleached corals and experimentally-induced bleached corals

Glutaredoxin

All five genes sharing common expression patterns between the field-collected samples and the experimental samples (Chapter 2) were induced during bleaching, and only one showed significant homology to a known gene. This was glutaredoxin, which showed a 1.63 and 3.47 fold increase in expression in field-collected corals (Table 2) and experimentally-induced bleaching corals (Chapter 2) respectively. Glutaredoxin has multiple cellular functions including regulation of redox-activated signal transduction through glutathionylation (Barrett et al. 1999, Ghezzi 2005) and cellular protection during oxidative stress (Starke et al. 2003). Considering its experimental induction, where oxidative stress was intentionally generated by decoupling the dinoflagellate photosystems through DCMU exposure, its most likely function is to protect against oxidative stress by acting as an oxygen radical scavenger. This suggests that the bleached colonies from the field were experiencing oxidative stress when they were sampled.

Galaxin

Two of the three genes that displayed contrasting expression patterns in field- bleached and the experimentally-bleached (Chapter 2) animals have been identified.

The first is galaxin, which showed a 1.32 fold induction and 2.44 fold reduction in field- 132 collected corals (Table 2) and experimentally-induced bleaching corals (Chapter 2) respectively. Galaxin was originally isolated from the hermatypic (reef-building) coral

Galaxea fascicularis as a component of the organic matrix, which is involved in the coral biomineralization process (Fukuda et al. 2003, Watanabe et al. 2003). As discussed in Chapter 2, it has long been understood that there is a link between the symbiotic status of hermatypic corals and their enhanced ability to build a calcified exoskeleton and it is generally accepted that the symbiosis plays a role in increasing the calcification rates of hermatypic corals (Gattuso et al. 1999). The experimental study

(Chapter 2) also revealed the induction of a second gene, homologous to the Zymogen granule membrane protein 2 (GP-2)/Uromodulin (or Tamm-Horsfall protein, THP) family of glycosylphosphatidylinositol (GPI) anchored proteins, that we hypothesized could play a role in the inhibition of calcium crystal formation. This gene did exhibit a significant difference in expression in the field. Taken together these expression profiles would suggest that the bleached field samples are growing their skeletons at faster rates than the non-bleached colonies in the field, and emphasizes that there is much left to be understood in the biomineralization process and recovery after bleaching.

Beta-Gamma Crystallins

In the experimental study (Chapter 2) 14 isoforms of beta-gamma crystallins were identified that were induced as a function of coral bleaching, with an average fold change of 13.12. Only half of these isoforms contained the beta-gamma crystallin

(BGCrys) domain according to Prosite (Hofmann et al. 1999). In this study one of the repressed features, DCMU2G17, which showed a four fold decrease in expression, also 133 showed a possible BGCrys domain in a rpsBlast search at NCBI (p=0.53). While the high p-value made the identity of this domain questionable, the identification of multiple isoforms of Beta-gamma crystallin in the previous study made this a possible identity worth further investigation. This sequence was added to an alignment containing the 14 M. capitata isoforms and various crystallin sequences downloaded from NCBI (Table 1). The new alignment was followed by a Neighbor Joining analysis

(Fig. 2). This sequence grouped within the domain containing M. capitata Beta-gamma crystallin isoforms, confirming its identity as the fifteenth isoform of Beta-gamma crystallin identified in M. capitata.

As discussed in Chapter 2, several non-lens forms of beta-gamma crystallins have also been identified, including two involved in stress response. Spherulin 3a

(Physarum polycephalum) and Protein S (Myxococcus xanthus) are induced during stress and are involved with encystment and sporulation respectively. Absent in melanoma (AIM1, Homo sapiens) is associated with chromosome-6 mediated tumor suppression, and its role here has led researchers to believe that the beta-gamma superfamily may be involved in management of cell morphology and shape (Ray et al.

1997). In addition, beta-gamma crystallins have been identified in two other non-lens forming invertebrates: the sponge Geodia cydonium (Krasko et al. 1997, Maro et al.

2002) and the urochordate Ciona intestinalis (Shimeld et al. 2005). The function of the

M. capitata beta-gamma crystallin isoforms during coral bleaching remains unknown.

Due to the high level of variation among the 15 isoforms, it is likely that this group may actually perform a number of functions. 134

M. capitata BGCrys Isoform3

M. capitata BGCrys Isoform4

M. capitata BGCrys Isoform5

M. capitata BGCrys Isoform6 Isoforms of Beta-gamma Crystallin Missing BGCrys Domain 64 M. capitata BGCrys Isoform2

96 M. capitata BGCrys Isoform9 96 62 M. capitata BGCrys Isoform12

M. capitata BGCrys Isoform14

M. capitata BGCrys Isoform8

84 100 M. capitata BGCrys Isoform7

M. capitata BGCrys Isoform13 82 Isoforms of Beta-gamma Crystallin 68 M. capitata BGCrys Isoform15Fld Containing BGCrys Domain 72 M. capitata BGCrys Isoform1

100 M. capitata BGCrys Isoform10 100 M. capitata BGCrys Isoform11

Geodia cydonium BGCrys

Iguana iguana GammaNCrys 72 99 Ciona intestinalis BGCrys

Danio rerio gammaMXCrys

98 95 Chiloscyllium colax BetaCrysS2

89 Cynops pyrrhogaster GammaCrys

89 Xenopus laevis GammaCrysII

99 100 Xenopus laevis GammaCrys 100 Xenopus laevis GammaCrys6

Danio rerio gammaM5Crys 98 Danio rerio GammaCrysM2d2 100

Fig. 2. Phylogenetic relationship of repressed isoform 15 beta-gamma crystallin (BGCrys) identified in the field study with the 14 isoforms of BGCrys induced in M. capitata during experimental bleaching and other crystallins. The relationships are inferred by a Neighbor-Joining analysis. Percent of 1000 bootstrap replicates supporting the toplogy is given at each node. M. capitata sequences are in bold, the arrow indicates the new field isoform, and presence or absence of the BGCrys domain is indicated by labeled brackets. Genbank accession IDs are provided in Table 2. 135

Genes Induced as a Function of Coral Bleaching in the Field

Halide Peroxidase (HPO)

The balance between mutualistic symbiosis and parasitic invasion can be very delicate. The first obstacle that a potential symbiont or pathogen must overcome is the innate immune defenses of the host. In Chapter 2 we identified a potential member of the innate immunity complement pathway, cnidarian carbohydrate associated protein

(CnidCAP), and discussed the implications of a homolog to an innate immunity pathway being involved in the modulation of a mutualistic symbiotic relationship. The field study has revealed two more genes upregulated during coral bleaching that are well described in host innate immune response to microbial invasions. The first is

HPO, a homolog to myeloperoxidase. HPO had ratios showing a 3.4 fold increase in expression during coral bleaching (Table3). Myeloperoxidase is highly expressed in neutrophils, and has a major role in microbicidal action. It catalyzes an oxidative reaction with idodide (I-), bromide (Br-), thiocyanate (SCN-) or Chloride (Cl-) in the presence of hydrogen peroxide to generate the respective hypo halide that is toxic to microbes (Fang 2004, Ihalin et al. 2006, Suzuki et al. 2004). In addition, this reaction consumes potentially toxic hydrogen peroxide, thus protecting against oxidative stress as well. HPO has also been implicated in another symbiosis as a symbiont population control method. Elevated peroxidase activity, and increased mRNA transcript levels for a myeloperoxide related gene (later called halide peroxidase or HPO), were found in the light organ of the sepiolid squid Euprymna scolopes where its population of symbiotic light-producing bacteria, Vibrio fischeri, is housed (Tomarev et al. 1993, Weis et al.

1996). Additional studies of HPO in the Euprymna-Vibrio symbiosis showed elevated 136 levels of HPO elsewhere in the squid where pathogenic bacterial infections were occurring, further suggesting that the role of this enzyme is in population control of bacteria - both cooperative and pathogenic (McFall-Ngai 2000).

Glutaredoxin, which was up-regulated in both the field collected bleached corals and in the DCMU-induced bleached corals (Chapter 2), has been shown to play a role in a pathway that creates hydrogen peroxide during superoxide anion scavenging (Starke et al. 2003). As discussed above, this enzyme’s most likely function in M. capitata is to protect against oxidative stress by acting as an oxygen radical scavenger. This could be one of the sources of hydrogen peroxide needed for HPO activity. The HPO could perform two roles in the breakdown of the M. capitata symbiosis. It may protect against the oxidative stress from the hydrogen peroxide generated at the end of the multiple enzyme pathway during gultaredoxin scavenging of the more toxic superoxide radicals, while at the same time generating the microbicidal hypo halides that may control the dinoflagellate population that generated the superoxide to begin with. These ideas remain to be tested.

C-type Lysozyme

Another induced gene, displaying a 2.56 fold increase (Table 3) in expression in the field during bleaching, was identified as a c-type lysozyme which is another gene involved in the innate immune response. C-type lysozymes are ancient enzymes that serve a bacteriolytic function via cell lysis through the hydrolytic cleaveage of a glycosidic linkage in the peptidoglycan layer of cell walls in gram negative bacteria (Li et al. 2005, Qasba and Kumar 1997). While this function might not directly affect the dinoflagellate symbionts, the combined expression of HPO and c-type lysozyme could 137 be part of a non-specific innate immune response initiated by a failing host-symbiont interaction. Alternatively, the expression of these two genes may provide evidence that our array has detected an active bacterial infection in the field samples.

Genes Repressed as a Function of Coral Bleaching in the Field

Early Growth Response 1 (egr-1)

Two of the genes repressed only in the field during coral bleaching were identified. The first is a zinc finger transcriptional regulator known as early growth response 1 (egr-1). Egr-1, which showed a 1.29 fold decrease in expression (Table 3), functions as part of the immediate-early response in the first wave of gene expression induced in a neuron by stimulation from a variety of natural experiences, sensory stimuli and production of behaviors (Burmeister and Fernald 2005). Egr-1 is also a member of the signaling pathway induced by a variety of stressors to including heat shock, sodium arsenite, ultraviolet radiation and anisomycin (Lim et al. 1998), making its repression during coral bleaching surprising. It has also been shown to mediate transcription of the membrane type 1 matrix metalloproteinase in endothelim undergoing angiogenesis (Haas et al. 1999), which could indicate a role in tissue restructuring, and egr-1 has also been found to be involved in both the induction (Thiel and Cibelli 2002) and inhibition of apoptosis (Hallahan et al. 1995, Huang et al. 1998).

Differential expression of sphinogosine-1-phosphate phosphatase (SPPase) in the A. elegantissima transcriptome array (Rodriguez-Lanetty et al. 2006) suggests that the suppression of sphingolipid-induced apoptosis is important in maintaining the symbiotic state. If indeed host egr-1 is involved in the repression of apoptosis, a down-regulation of this gene during coral bleaching is understandable because apoptosis is known to be 138 involved in the bleaching process (Dunn et al. 2002 (a), Dunn et al. 2002 (b), Franklin et al. 2004).

Hedgehog

The other identified gene, repressed 1.67 fold in the field during coral bleaching

(Table 3), is hedgehog. Hedgehog genes occur as a family of intercellular signaling proteins that are mediators of many processes including growth, patterning and morphogenesis in embryonic development (Ingham and McMahon 2001). Its decrease in expression may show growth patterns in the bleached colony.

CONCLUSION

The cDNA array used in this study was built from M. capitata corals bleached through exposure to DCMU, which served as a proxy to the types of stress experienced by corals experiencing elevated temperature and UV stress; making it is a stress array with

2,304 features and the first microarray used to profile gene expression patterns during experimental and field coral bleaching. Both the field and experimental hybridizations to this microarray revealed a large number of genes potentially involved in coral bleaching or stress management. These genes may be important stress-markers that should be considered for inclusion in the development of future stress microarrays to monitor the health of other coral species. As concluded by Van Oppen and Gates (2006), “The characterization of stress responses at the molecular level may lead to the development of diagnostic assays for the early detection of stress responses in corals and the rapid identification of the exact stressor(s) responsible for degradation of certain coral-reef ecosystems.” This study is only one of the many studies which will be needed to 139 successfully develop a comprehensive diagnostic assay to monitor the health of coral reefs.

ACKNOWLEDGMENTS

We would like to thank Caprice Rosato at the Center for Genome Research and

Biocomputing at Oregon State University for her invaluable help printing the cDNA microarrays, and for continued technical support. We also thank members of the Weis

Lab for comments on the manuscript, in particular Mauricio Rodriguez-Lanetty for statistics advice. This work was supported by grants from the National Science

Foundation (MCB0237230 & IOB0542452) to V.M.W. and by a National Science

Foundation Fellowship to L.L.H.

140

REFERENCES

Altschul, S. F., S. F. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tools. J. Mol. Biol. 215: 403-410.

Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389-3402.

Baker, A. C. 2001. Reef Corals Bleach to Survive Change. Nature 411: 765-766.

Barrett, W. C., J. P. DeGnore, S. Konig, H. M. Fales, Y. F. Keng, Z. Y. Zhang, Y. M. B, and P. B. Chock. 1999. Regulation of PTP1B via glutathionylation of the active site cysteine 215. Biochemistry 38: 6699-6705.

Benjamini, Y., and Y. Hochberg. 1995. The FDR method of Benjamini & Hochberg. Journal of the Royal Statistical Society B 57: 289-300.

Buddemeier, R. W., and D. G. Fautin. 1993. Coral Bleaching as an Adaptive Mechanism. BioScience 43: 320-326.

Burmeister, S. S., and R. D. Fernald. 2005. Evolutionary conservation of the egr-1 immediate-early gene response in a teleost. The Journal of Comparative Neurology 481: 220-232.

Chen, D., W. M. Toone, H. Mata, R. Lyne, G. Burns, K. Kivinen, A. Brazma, N. Jones, and J. Bahler. 2003. Global transcription responses of fission yeast to environmental stress. Molecular Biology of the Cell 14: 214-229. deBoer, M. L., D. A. Krupp, and V. M. Weis. 2007. Proteomic and transcriptional analyses of coral larvae newly engaged in symbiosis with dinoflagellates. Comparative Biochemistry and Physiology Part D doi:10.1016/j.cbd.2006.11.003.

Douglas, A. E. 2003. Coral Bleaching - How and Why? Marine Pollution Bulletin 46: 385-392.

Downs, C. A., J. E. Fauth, J. C. Halas, P. Dustan, J. Bemiss, and C. M. Woodley. 2002. Oxidative stress and seasonal coral bleaching. Free Radical Biology & Medicine 33: 533-543.

Dunn, S. R., J. C. Bythell, M. D. A. Le Tissier, W. J. Burnett, and J. C. Thomason. 2002 (a). Programmed Cell Death and Cell Necrosis Activity During Hyperthermic Stress-Induced Bleaching of the Symbiotic Sea Anemone Aiptasia sp. Journal of Experimental Marine Biology and Ecology 272: 29-53. 141

Dunn, S. R., J. C. Thomason, M. D. A. Le Tissier, and J. C. Bythell. 2002 (b). Detection of Cell Death Activity During Bleaching of the Symbiotic Sea Anemone Aiptasia sp. in K. Moosa, ed. Proceedings of the 9th International Coral Reef Symposium, Bali.

Edge, A. E., M. B. Morgan, D. F. Gleason, and T. W. Snell. 2005. Development of a coral cDNA array to examine gene expression profiles in Montastraea faveolata exposed to environmental stress. Marine Pollution Bulletin 51: 507 - 523.

Fang, F. C. 2004. Antimicrobial reactive oxygen and nitrogen species: concepts and controversies. Nature Reviews: Microbiology 2: 820-832.

Franklin, D. J., O. Hoegh-Guldberg, R. J. Jones, and J. A. Berges. 2004. Cell death and degeneration in the symbiotic dinoflagellates of the coral Stylophora pistillata during bleaching. Marine Ecology Progress Series 272: 117-130.

Fukuda, I., S. Ooki, T. Fujita, E. Murayama, H. Nagasawa, Y. Isa, and T. Watanabe. 2003. Molecular cloning of a cDNA encoding a soluble protein in the coral exoskeleton. Biochemical and Biophysical Research Communications 304: 11- 17.

Gattuso, J.-P., D. Allemand, and M. Frankignoulle. 1999. Photosynthesis and calcification at cellular, organismal and community levels in coral reefs: a review on interactions and control by carbonate chemistry. American Zoologist 39: 160-183.

Ghezzi, P. 2005. Regulationof protein function by glutathionylation. Free Radical Research 39: 573-580.

Girardot, F., V. Monnier, and H. Tricoire. 2004. Genome wide analysis of common and specific stress responses in adult Drosophila melanogaster. BMC Genomics 5:74.

Glynn, P. W. 1993. Coral Reef Bleaching: Ecological Perspectives. Coral Reefs 12: 1- 17.

Haas, T. L., D. Stitelman, S. J. Davis, S. S. Apte, and J. A. Madri. 1999. Egr-1 mediates extracellular matrix-driven transcription of membrane type 1 matrix metalloproteinase in endothelium. The Journal of Biological Chemistry 274: 22679-22685.

Hallahan, D. E., e. Dunphy, S. Virudachalam, V. P. Sukhatme, D. W. Kufe, and R. R. Weichselbaum. 1995. C-jun and egr-1 participation in DNA Synthesis and cell survival in response to ionizing radiation exposure. The Journal of Biological Chemistry 270: 30303-30309. 142

Hofmann, K., P. Bucher, L. Flaquet, and A. Bairoch. 1999. The PROSITE database, its status in 1999. Nucleic Acids Res. 27: 215-219.

Huang, R.-P., Y. Fan, I. deBelle, Z. Ni, W. Matheny, and E. D. Adamson. 1998. Egr-1 inhibits apoptosis during the UV response: correlation of cell survival with Egr- 1 phosphorylation. Cell Death and differentiation 5: 96-106.

Iglesias-Prieto, R. 1997. Temperature-Dependent Inactivation of Photosystem II in Symbiotic Dinoflagellates. Pages 1313-1318. Proceedings of the 8th International Coral Reef Symposium, Panama City.

Ihalin, R., V. Loimaranta, and J. Tenovuo. 2006. Origin, structure and biological activities of peroxidases in human saliva. Archives of Biochemistry and Biophysics 445: 261-268.

Ingham, P. W., and A. P. McMahon. 2001. Hedgehog signaling in animal development: paradigms and principles. Genes Dev 15: 3059-3087.

Jones, R. J., O. Hoegh-Guldberg, A. W. D. Larkum, and U. Schreiber. 1998. Temperature-Induced Bleaching of Corals Begins With Impairment of the CO2 Fixation Mechanism in Zooxanthellae. Plant, Cell and Environment 21: 1219- 1230.

Kinzie III, R. A., M. Takayama, S. R. Santos, and M. A. Coffroth. 2001. The Adaptive Bleaching Hypothesis: Experimental Tests of Critical Assumptions. Biological Bulletin 200: 51-18.

Kortschak, R. D., G. Samuel, R. Saint, and D. J. Miller. 2003. EST analysis of the cnidarian Acropora millepora reveals extensive gene loss and rapid sequence divergence in the model invertebrates. Current Biology 13: 2190-2195.

Krasko, A., I. M. Muller, and W. E. Muller. 1997. Evolutionary relationships of the metazoan beta gamma crystallins including that from the marine sponge Geodia cydonium. Proceedings: Biological Sciences 264: 1077-1084.

Kuo, J., M.-C. Chen, C.-H. Lin, and L.-S. Fang. 2004. Comparative gene expression in the symbiotic and aposymbiotic Aiptasia pulchella by expressed sequence tag analysis. Biochemical and Biophysical Research Communications 318: 176-186.

Lewis, D. H., and D. C. Smith. 1971. The Autotrophic Nutrition of Symbiotic Marine Coelenterates with Special Reference to Hermatypic Corals. I. Movement of Photosynthetic Products Between the Symbionts. Proceedings of the Royal Society of London. Series B, Biological Sciences. 178: 111-129. 143

Li, B., E. Calvo, O. Marinotti, A. A. James, and S. M. Paskewitz. 2005. Characterization of the c-type lysozyme gene family in Anopheles gambiae. Gene 360: 131-139.

Lim, C. P., N. Jain, and X. Cao. 1998. Stress-induced immediate-early gene, egr-1, involves activation of p38/JNK1. Oncogene 16: 2915-2926.

Maro, A. D., E. Pizzo, M. V. Cubellis, and G. D'Alessio. 2002. An intron-less BG- crystallin-type gene from the sponge Geodia cydonium. Gene 299: 79-82.

McFall-Ngai, M. J. 2000. Negotioations between animals and bacteria: the 'diplomacy' of the squid-vibrio symbiosis. Comparative Biochemistry and Physiology Part A 126: 471-480.

Muller-Parker, G., and C. F. D'Elia. 1997. Chapter 5 "Interactions Between Corals and Their Symbiotic Algae" in Life and Death of Corals Reefs. Chapman and Hall, New York, New York.

Muscatine, L., and J. W. Porter. 1977. Reef Corals: Mutualistic Symbioses Adapted to Nutrient-Poor Environments. BioScience 27: 454-460.

Orive, M. E. 1995. Senescence in organisms with clonal reproduction and complex life histories. The American Naturalist 145: 90-108.

Qasba, P. K., and S. Kumar. 1997. Molecular divergence of lysozymes and alpha- lactalbumin. Crit. Rev. Biochem. Mol. Biol. 32: 255-306.

Ray, M. E., G. Wistow, S. Y. A, P. S. Meltzer, and J. M. Trent. 1997. AIM1, a novel non-lens member of the BG-crystallin superfamily, is associated with the control of tumorigenicity in human malignant melanoma. Proceeding of the National Academy of Science 94: 3229-3234.

Rodriguez-Lanetty, M., W. S. Phillips, and V. M. Weis. 2006. Transcriptome analysis of a cnidarian-dinoflagellate mutualism reveals complex modulation of host gene expression. BMC Genomics 7.

Sawyer, S. J., and L. Muscatine. 2001. Cellular Mechanisms Underlying Temperature- Induced Bleaching in the Tropical Sea Anemone Aiptasia pulchella. The Journal of Experimental Biology 204: 3443-3456.

Schwarz, J. A., P. Brokstein, C. Namohar, M. A. Coffroth, A. Szmant, and M. Medina. 2006. Coral reef genomics: developing tools for functional genomics of coral symbiosis. 10th International Coral Reef Symposium, accepted.

Sebens, K. P. 1987. The ecology of indeterminate growth in animals. Annual Review of Ecology and Systematics 18: 371-407. 144

Shick, J. M., and M. P. Lesser. 1991. An Overview of Photooxidative Stress and Defenses Against It In Coral Reef Symbioses. Pages 1-15. Workshop on Coral Bleaching, Coral Reef Ecosystems and Global Climate Change: June 1991.

Shick, J. M., M. P. Lesser, and W. R. Stochaj. 1991. Ultraviolet Radiation and Photooxidative Stress in Zooxanthellate Anthozoa: the Sea Anemone Phyllodiscus semoni and the Octocoral Clavularia sp. Symbiosis 10: 145-173.

Shimeld, S. M., A. G. Purkiss, R. P. H. Dirks, O. A. Bateman, C. Slingsby, and N. H. Lubsen. 2005. Urochordate BG-crystallin and the evolutionary origin of the vertebrate eye lens. Current Biology 15: 1684-1689.

Smith, D. C., and A. E. Douglas. 1987. The Biology of Symbiosis: Chapter 3. Edward Arnold Publishers, London.

Starke, D. W., P. B. Chock, and J. J. Mieyal. 2003. Glutathione-thiyl radical scavenging and transferase properties of human glutaredoxin (thioltransferase). The Journal of Biological Chemistry 278: 14607-14613.

Suzuki, K., E. Muso, and W. M. Mauseef. 2004. Contribution of peroxidases in host- defense, diseases and cellular functions. Jpn. J. Infect. Dis. 57: S1-S2.

Swofford, D. L. 2000. PAUP*: phylogenetic analysis using parsimony and other methods (software). Sinauer Associates, Sunderland, MA.

Taiz, L., and E. Zeiger. 1991. Plant Physiology. The Benjamin/Cummings Publishing Company, Inc., Redwood City, California.

Thiel, G., and G. Cibelli. 2002. Regulation of life and death by the zinc finger transcription factor Egr-1. Journal of Cellular Physiology 193: 287-292.

Tomarev, S. I., R. D. Zinovieva, V. M. Weis, A. B. Chepelinsky, J. Piatigorsky, and M. J. McFall-Ngai. 1993. Abundant mRNAs in the squid light organ encode proteins with a high similarity to mammalian peroxidases. Gene 132: 219-226.

Walther, G.-R., E. Post, P. Convey, A. Menzel, C. Parmesan, T. J. C. Beebee, J.-M. Fromentin, O. Hoegh-Guldberg, and F. Bairlein. 2002. Ecological responses to recent climate change. Nature 416: 389-395.

Wang, J.-T., and A. E. Douglas. 1998. Nitrogen Recycling or Nitrogen Conservation in an Alga-Invertebrate Symbiosis. The Journal of Experimental Biology 201: 2445-2453.

Warner, M. E., W. K. Fitt, and G. W. Schmidt. 1999. Damage to Photosystem II in Symbiotic Dinoflagellates: A Determinant of Coral Bleaching. Proceedings of the National Academy of Science of the United States of America 96: 8007-8012. 145

Watanabe, T., I. Fukuda, K. China, and Y. Isa. 2003. Molecular analyses of protein components of the organic matrix in in the exoskeleton of two scleractinian coral species. Comparative Biochemistry and Physiology Part B 136: 767-774.

Weis, V. M., and P. R. Levine. 1996. Differential protein profiles reflect the different lifestyles of symbiotic and aposymbiotic Anthopleura elegantissima, a sea anemone from temperate waters. J. Exp. Biol. 199: 883-892.

Weis, V. M., and W. S. Reynolds. 1999. Carbonic anhydrase expression and synthesis in the sea anemone Anthopleura elegantissima are enhanced by the presence of dinoflagellate symbionts. Physiol. Biochem. Zool. 72: 307-316.

Weis, V. M., A. L. Small, and M. J. McFall-Ngai. 1996. A peroxidase related to the mammalian antimicrobial protein myeloperoxidase in the Euprymna-Vibrio mutualism. Proc Natl Acad Sci U S A 93: 13683-13688.

Wilkinson, C. R. 1999. Global and local threats to coral reef functioning and existence: review and predictions. Marine and Freshwater Research 50: 867-878.

Wu, H., M. K. Kerr, C. X, and C. G. A, eds. 2003. MAANOVA: A software package for the analysis of spotted cDNA microarray experiments.

Yang, Y. H., S. Dudoit, P. Luu, D. M. Lin, V. Peng, J. Ngai, and T. P. Speed. 2002. Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Research 30: e15.

Yuyama, I., H. Hayakawa, H. Endo, K. Iwao, H. Takeyama, T. Maruyama, and T. Watanabe. 2005. Identification of a symbiotically expressed coral mRNAs using a model infection system. Biochemical and Biophysical Research Communications 336: 793-798.

146

CHAPTER 4:

GENERAL CONCLUSIONS

147

GENERAL CONCLUSIONS

The work presented in this dissertation examines the symbiosis formed between cnidarians and dinoflagellates from two molecular perspectives. The first approach is to analyze a gene, CnidEF, identified in the anemone Anthopleura elegantissima as a putatively symbiosis-linked gene (chapter 1). The second approach was to profile the gene expression of the coral Montipora capitata during coral bleaching, the breakdown of this mutualistic symbiosis, by hybridization screening of a subtractive library using a custom cDNA microarray platform (chapters 2 and 3). This second approach (chapters

2 and 3) represent the first use of a microarray to profile host gene expression during a coral bleaching event, and as such is a major accomplishment in the field of coral reef research. The baseline information provided by this analysis can now be used as a jumping point for more detailed physiological research on the identified genes of interest.

The identification of symbiosis-linked genes has traditionally been pursued by the use of proteomic analyses, and focused on anemones due to their occurrence in nature in both the symbiotic and aposymbiotic (symbiont-free) state (Weis and Levine

1996). Recently, however, other members of the Weis lab have also examined this symbiosis from a molecular perspective through subtractive library analysis of the coral

Fungia scutaria (deBoer et al. 2007), and also through the development of a 10,368 feature transcriptome DNA microarray of the anemone Anthopleura elegantissima

(Rodriguez-Lanetty et al. 2006). The CnidEF study is the result of a subtractive library analysis (conducted by Wendy Phillips) intended to identify symbiosis-linked genes in the anemone A. elegantissima (Hauck et al. 2007). CnidEF, the putative symbiosis- 148 linked gene isolated from A. elegantissima, is a novel addition to the large EF-hand family of proteins possessing two EF-hands near the C-terminus, and two upstream regions that might be degenerate EF-hands. The closest homologues identified from these analyses were a luciferin binding protein (LBP) involved in the bioluminescence of the anthozoan Renilla reniformis, and a sarcoplasmic calcium-binding protein

(SARC) involved in fluorescence of the annelid worm Nereis diversicolor. CnidEF was also isolated from Anthopleura artemisia and Aiptasia pallida. The work presented in this study shows that CnidEF expression is not linked to the symbiotic state. Symbiotic and aposymbiotic samples collected in close proximity to one another in the field had nearly identical expression. This suggests that environmental factors played a role in

CnidEF expression. The emergence of CnidEF as a symbiosis-linked gene in the subtracted library was likely an artifact of the collection process. Therefore, the function of CnidEF remains unclear.

To profile the gene expression of M. capitata during coral bleaching we created a 2,304 feature microarray platform from a cDNA subtracted library, made from experimentally bleached Montipora capitata. To initiate the coral bleaching response the holobiont was exposed to the commercial herbicide DCMU, which served as a proxy to the type of damage that occurs to photosystem II during heat and UV stress

(see chapter 2 for details). This experimental design allowed us to specifically examine the host’s response to a photosynthetically impaired symbiont without the interference of additional environmental stressors. By analyzing which genes are induced and repressed when the relationship goes wrong, we were able to learn more about the molecular basis of this symbiosis, the coral’s reaction to stress and also about 149 host/symbiont recognition pathway. We created two expression profiles: 1) with experimentally-induced bleaching of M. capitata and 2) with bleaching corals collected in the field during a natural bleaching event.

When hybridizing experimentally-derived cDNA to the array, 537 (23%) of the array features, displayed statistically different ratios of expression (adjusting for the FDR, p<0.05) between the control and bleached groups of experimental corals. This shows that the combination of a subtracted library with a DNA microarray platform is a very effective way to profile gene expression in the non-model cnidarian symbiosis. Our 23% significant features is in stark contrast to the 1.82% significant features revealed in the A. elegantissima transcriptome analysis (Rodriguez-Lanetty et al. 2006). In addition, our method for screening for dinoflagellate contamination of our host array, by hybridizing to the array a genomic DNA prep made from host-free symbionts, was both quick and efficient. The standard method, using gene specific primers and PCR to check each individual gene, is far more labor intensive.

The identified genes induced by DCMU exposure included two oxidative stress response genes, glutaredoxin and ferritin, the structural protein collagen, and multiple isoforms of beta-gamma crystallin homologs of unknown function. The identified genes repressed during DCMU exposure include galaxin, which is a component of the organic matrix, ubiquitin, and a novel cnidarian carbohydrate-associated protein (CnidCAP) putatively involved in host/symbiont specificity and recognition. In addition, the induction of a GP-2/THP homolog, in conjunction with the repression of galaxin, collectively correlated with an expected reduction in skeletal growth during stress resulting in a loss of the symbiosis. The emergence of the CnidCAP group of isoforms is 150 of particular interest in the study of the cnidarian/dinoflagellate symbiosis because it is homologous to a mannose associated serine protease (MASP). MASP is a component of the lectin-mediated activation of the classic complement pathway of innate immunity.

The repression of CnidCAP during coral bleaching suggests that it has a role in maintaining the symbiosis. Evidence of a lectin-mediated interaction between the host and the symbiont has already been shown (Jimbo et al. 2000, Lin et al. 2000, Wood-

Charlson et al. 2006) and this study lends further support for this finding.

When hybridizing field-derived cDNA to the array a total of 81 (3.5%) of the array features were identified as having significantly different ratios of expression between the control and bleaching samples (adjusting for the FDR at p<0.05). Comparison of our experimental and field microarray analyses revealed five core genes that were consistently induced during experimental and field coral bleaching. Of these five, only one, glutaredoxin, was identified. This gene is likely involved in scavenging oxygen radicals produced by photosynthetically impaired dinoflagellates. There were three genes that showed contrasting expression patterns between experimental and field bleaching, which would indicate that their cellular roles within the experimental and field corals is likely to be independent of the actual coral bleaching event.

The identified genes induced in the field study included some involved in immunity, such as a halide peroxidase and a c-type lysozyme, as well as genes of varying function including galaxin, and ribosomal protein S21. The significant induction of halide peroxidase and a c-type lysozyme in the field bleaching samples is indicative of a generalized immune response, which may be in reaction to the photosynthetically- impaired dinoflagellates and the resultant failing symbiosis. Alternatively, the array 151 analysis may have detected an active microbial infection in the field samples. The identified repressed genes from this study included egr-1, a transcriptional regulator, and hedgehog, a signaling protein which functions in embryological development.

The data from the two microarray studies, particularly the emergence of

CnidCAPs in the experimental study, suggest that host/symbiont specificity in corals is homologous to the complement pathway active in innate immunity in animals. This could indicate that this mutualism had a pathogenic origin and is still modulated by components of innate immunity. The induction of a halide peroxidase and c-type lysozyme during bleaching in the field study is further evidence that innate immunity may play a role in the control of symbiont populations. Indeed, halide peroxidase has been shown to control the population of the bacterial symbiont Vibrio fischeri in the sepiolid squid Euprymna scolopes (McFall-Ngai 2000, Tomarev et al. 1993, Weis et al. 1996). In addition, we isolated many novel, unidentified genes that may prove to be useful as markers of coral stress, or may be identified later as mediators of the symbiosis. Future sequencing and analysis of the remaining significant features, 420 from the experimental hybridizations and 45 from the field hybridizations, will surely reveal more about this complex and environmentally important symbiosis.

152

BIBLIOGRAPHY

Baillie BK, Belda-Baillie CA, Maruyama T (2000) Conspecificity and Indo-Pacific Distribution of Symbiodinium Genotypes (Dinophyceae) from Giant Clams. Journal of Phycology 36:1153-1161

Baker AC (2001) Reef Corals Bleach to Survive Change. Nature 411:765-766

Belda-Baillie CA, Baillie BK, Maruyama T (2002) Specificity of a Model Cnidarian- Dinoflagellate Symbiosis. Biological Bulletin 202:74-85

Birch PRJ, Kamoun S (2000) Studying Interaction Transcriptomes: Coordinated Analyses of Gene Expression During Plant-Microorganism Interactions. Trends in Plant Science 5:77-82

Brown BE (1997) Coral Bleaching: Causes and Consequences. Coral Reefs 16:S129- S138

Buddemeier RW, Fautin DG (1993) Coral Bleaching as an Adaptive Mechanism. BioScience 43:320-326

Cox F (2002) Montipora capitata spawning and bleaching information, direct observation. In: Hauck LL (ed) deBoer ML, Krupp DA, Weis VM (2007) Proteomic and transcriptional analyses of coral larvae newly engaged in symbiosis with dinoflagellates. Comparative Biochemistry and Physiology Part D doi:10.1016/j.cbd.2006.11.003

Douglas AE (2003) Coral Bleaching - How and Why? Marine Pollution Bulletin 46:385-392 153